Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri
2015-12-01
Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.
Sugita, Chieko; Ogata, Koretsugu; Shikata, Masamitsu; Jikuya, Hiroyuki; Takano, Jun; Furumichi, Miho; Kanehisa, Minoru; Omata, Tatsuo; Sugiura, Masahiro; Sugita, Mamoru
2007-01-01
The entire genome of the unicellular cyanobacterium Synechococcus elongatus PCC 6301 (formerly Anacystis nidulans Berkeley strain 6301) was sequenced. The genome consisted of a circular chromosome 2,696,255 bp long. A total of 2,525 potential protein-coding genes, two sets of rRNA genes, 45 tRNA genes representing 42 tRNA species, and several genes for small stable RNAs were assigned to the chromosome by similarity searches and computer predictions. The translated products of 56% of the potential protein-coding genes showed sequence similarities to experimentally identified and predicted proteins of known function, and the products of 35% of the genes showed sequence similarities to the translated products of hypothetical genes. The remaining 9% of genes lacked significant similarities to genes for predicted proteins in the public DNA databases. Some 139 genes coding for photosynthesis-related components were identified. Thirty-seven genes for two-component signal transduction systems were also identified. This is the smallest number of such genes identified in cyanobacteria, except for marine cyanobacteria, suggesting that only simple signal transduction systems are found in this strain. The gene arrangement and nucleotide sequence of Synechococcus elongatus PCC 6301 were nearly identical to those of a closely related strain Synechococcus elongatus PCC 7942, except for the presence of a 188.6 kb inversion. The sequences as well as the gene information shown in this paper are available in the Web database, CYORF (http://www.cyano.genome.jp/).
Exome Sequence Analysis of 14 Families With High Myopia.
Kloss, Bethany A; Tompson, Stuart W; Whisenhunt, Kristina N; Quow, Krystina L; Huang, Samuel J; Pavelec, Derek M; Rosenberg, Thomas; Young, Terri L
2017-04-01
To identify causal gene mutations in 14 families with autosomal dominant (AD) high myopia using exome sequencing. Select individuals from 14 large Caucasian families with high myopia were exome sequenced. Gene variants were filtered to identify potential pathogenic changes. Sanger sequencing was used to confirm variants in original DNA, and to test for disease cosegregation in additional family members. Candidate genes and chromosomal loci previously associated with myopic refractive error and its endophenotypes were comprehensively screened. In 14 high myopia families, we identified 73 rare and 31 novel gene variants as candidates for pathogenicity. In seven of these families, two of the novel and eight of the rare variants were within known myopia loci. A total of 104 heterozygous nonsynonymous rare variants in 104 genes were identified in 10 out of 14 probands. Each variant cosegregated with affection status. No rare variants were identified in genes known to cause myopia or in genes closest to published genome-wide association study association signals for refractive error or its endophenotypes. Whole exome sequencing was performed to determine gene variants implicated in the pathogenesis of AD high myopia. This study provides new genes for consideration in the pathogenesis of high myopia, and may aid in the development of genetic profiling of those at greatest risk for attendant ocular morbidities of this disorder.
Gene and translation initiation site prediction in metagenomic sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John
2012-01-01
Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translationmore » initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.« less
Novel primers for complete mitochondrial cytochrome b genesequencing in mammals
Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie
2011-01-01
Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.
Sequence Composition and Gene Content of the Short Arm of Rye (Secale cereale) Chromosome 1
Fluch, Silvia; Kopecky, Dieter; Burg, Kornel; Šimková, Hana; Taudien, Stefan; Petzold, Andreas; Kubaláková, Marie; Platzer, Matthias; Berenyi, Maria; Krainer, Siegfried; Doležel, Jaroslav; Lelley, Tamas
2012-01-01
Background The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale) with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. Methodology/Principal Findings Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3%) being the most abundant. More than four thousand simple sequence repeat (SSR) sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. Conclusions The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye. PMID:22328922
Tomazetto, Geizecler; Wibberg, Daniel; Schlüter, Andreas; Oliveira, Valéria M
2015-01-01
A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
DOE Office of Scientific and Technical Information (OSTI.GOV)
Onda, M.; Kudo, S.; Fukuda, M.
Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less
Exome Sequencing in Suspected Monogenic Dyslipidemias
Stitziel, Nathan O.; Peloso, Gina M.; Abifadel, Marianne; Cefalu, Angelo B.; Fouchier, Sigrid; Motazacker, M. Mahdi; Tada, Hayato; Larach, Daniel B.; Awan, Zuhier; Haller, Jorge F.; Pullinger, Clive R.; Varret, Mathilde; Rabès, Jean-Pierre; Noto, Davide; Tarugi, Patrizia; Kawashiri, Masa-aki; Nohara, Atsushi; Yamagishi, Masakazu; Risman, Marjorie; Deo, Rahul; Ruel, Isabelle; Shendure, Jay; Nickerson, Deborah A.; Wilson, James G.; Rich, Stephen S.; Gupta, Namrata; Farlow, Deborah N.; Neale, Benjamin M.; Daly, Mark J.; Kane, John P.; Freeman, Mason W.; Genest, Jacques; Rader, Daniel J.; Mabuchi, Hiroshi; Kastelein, John J.P.; Hovingh, G. Kees; Averna, Maurizio R.; Gabriel, Stacey; Boileau, Catherine; Kathiresan, Sekar
2015-01-01
Background Exome sequencing is a promising tool for gene mapping in Mendelian disorders. We utilized this technique in an attempt to identify novel genes underlying monogenic dyslipidemias. Methods and Results We performed exome sequencing on 213 selected family members from 41 kindreds with suspected Mendelian inheritance of extreme levels of low-density lipoprotein (LDL) cholesterol (after candidate gene sequencing excluded known genetic causes for high LDL cholesterol families) or high-density lipoprotein (HDL) cholesterol. We used standard analytic approaches to identify candidate variants and also assigned a polygenic score to each individual in order to account for their burden of common genetic variants known to influence lipid levels. In nine families, we identified likely pathogenic variants in known lipid genes (ABCA1, APOB, APOE, LDLR, LIPA, and PCSK9); however, we were unable to identify obvious genetic etiologies in the remaining 32 families despite follow-up analyses. We identified three factors that limited novel gene discovery: (1) imperfect sequencing coverage across the exome hid potentially causal variants; (2) large numbers of shared rare alleles within families obfuscated causal variant identification; and (3) individuals from 15% of families carried a significant burden of common lipid-related alleles, suggesting complex inheritance can masquerade as monogenic disease. Conclusions We identified the genetic basis of disease in nine of 41 families; however, none of these represented novel gene discoveries. Our results highlight the promise and limitations of exome sequencing as a discovery technique in suspected monogenic dyslipidemias. Considering the confounders identified may inform the design of future exome sequencing studies. PMID:25632026
Mining biological databases for candidate disease genes
NASA Astrophysics Data System (ADS)
Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.
2001-07-01
The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).
Church, Sheri A; Livingstone, Kevin; Lai, Zhao; Kozik, Alexander; Knapp, Steven J; Michelmore, Richard W; Rieseberg, Loren H
2007-02-01
Using likelihood-based variable selection models, we determined if positive selection was acting on 523 EST sequence pairs from two lineages of sunflower and lettuce. Variable rate models are generally not used for comparisons of sequence pairs due to the limited information and the inaccuracy of estimates of specific substitution rates. However, previous studies have shown that the likelihood ratio test (LRT) is reliable for detecting positive selection, even with low numbers of sequences. These analyses identified 56 genes that show a signature of selection, of which 75% were not identified by simpler models that average selection across codons. Subsequent mapping studies in sunflower show four of five of the positively selected genes identified by these methods mapped to domestication QTLs. We discuss the validity and limitations of using variable rate models for comparisons of sequence pairs, as well as the limitations of using ESTs for identification of positively selected genes.
Jupe, Florian; Witek, Kamil; Verweij, Walter; Śliwka, Jadwiga; Pritchard, Leighton; Etherington, Graham J; Maclean, Dan; Cock, Peter J; Leggett, Richard M; Bryan, Glenn J; Cardle, Linda; Hein, Ingo; Jones, Jonathan DG
2013-01-01
Summary RenSeq is a NB-LRR (nucleotide binding-site leucine-rich repeat) gene-targeted, Resistance gene enrichment and sequencing method that enables discovery and annotation of pathogen resistance gene family members in plant genome sequences. We successfully applied RenSeq to the sequenced potato Solanum tuberosum clone DM, and increased the number of identified NB-LRRs from 438 to 755. The majority of these identified R gene loci reside in poorly or previously unannotated regions of the genome. Sequence and positional details on the 12 chromosomes have been established for 704 NB-LRRs and can be accessed through a genome browser that we provide. We compared these NB-LRR genes and the corresponding oligonucleotide baits with the highest sequence similarity and demonstrated that ∼80% sequence identity is sufficient for enrichment. Analysis of the sequenced tomato S. lycopersicum ‘Heinz 1706’ extended the NB-LRR complement to 394 loci. We further describe a methodology that applies RenSeq to rapidly identify molecular markers that co-segregate with a pathogen resistance trait of interest. In two independent segregating populations involving the wild Solanum species S. berthaultii (Rpi-ber2) and S. ruiz-ceballosii (Rpi-rzc1), we were able to apply RenSeq successfully to identify markers that co-segregate with resistance towards the late blight pathogen Phytophthora infestans. These SNP identification workflows were designed as easy-to-adapt Galaxy pipelines. PMID:23937694
Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing.
Jäger, Marten; Ott, Claus-Eric; Grünhagen, Johannes; Hecht, Jochen; Schell, Hanna; Mundlos, Stefan; Duda, Georg N; Robinson, Peter N; Lienau, Jasmin
2011-03-24
The sheep is an important model organism for many types of medically relevant research, but molecular genetic experiments in the sheep have been limited by the lack of knowledge about ovine gene sequences. Prior to our study, mRNA sequences for only 1,556 partial or complete ovine genes were publicly available. Therefore, we developed a composite de novo transcriptome assembly method for next-generation sequence data to combine known ovine mRNA and EST sequences, mRNA sequences from mouse and cow, and sequences assembled de novo from short read RNA-Seq data into a composite reference transcriptome, and identified transcripts from over 12 thousand previously undescribed ovine genes. Gene expression analysis based on these data revealed substantially different expression profiles in standard versus delayed bone healing in an ovine tibial osteotomy model. Hundreds of transcripts were differentially expressed between standard and delayed healing and between the time points of the standard and delayed healing groups. We used the sheep sequences to design quantitative RT-PCR assays with which we validated the differential expression of 26 genes that had been identified by RNA-seq analysis. A number of clusters of characteristic expression profiles could be identified, some of which showed striking differences between the standard and delayed healing groups. Gene Ontology (GO) analysis showed that the differentially expressed genes were enriched in terms including extracellular matrix, cartilage development, contractile fiber, and chemokine activity. Our results provide a first atlas of gene expression profiles and differentially expressed genes in standard and delayed bone healing in a large-animal model and provide a number of clues as to the shifts in gene expression that underlie delayed bone healing. In the course of our study, we identified transcripts of 13,987 ovine genes, including 12,431 genes for which no sequence information was previously available. This information will provide a basis for future molecular research involving the sheep as a model organism.
Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing
2011-01-01
Background The sheep is an important model organism for many types of medically relevant research, but molecular genetic experiments in the sheep have been limited by the lack of knowledge about ovine gene sequences. Results Prior to our study, mRNA sequences for only 1,556 partial or complete ovine genes were publicly available. Therefore, we developed a composite de novo transcriptome assembly method for next-generation sequence data to combine known ovine mRNA and EST sequences, mRNA sequences from mouse and cow, and sequences assembled de novo from short read RNA-Seq data into a composite reference transcriptome, and identified transcripts from over 12 thousand previously undescribed ovine genes. Gene expression analysis based on these data revealed substantially different expression profiles in standard versus delayed bone healing in an ovine tibial osteotomy model. Hundreds of transcripts were differentially expressed between standard and delayed healing and between the time points of the standard and delayed healing groups. We used the sheep sequences to design quantitative RT-PCR assays with which we validated the differential expression of 26 genes that had been identified by RNA-seq analysis. A number of clusters of characteristic expression profiles could be identified, some of which showed striking differences between the standard and delayed healing groups. Gene Ontology (GO) analysis showed that the differentially expressed genes were enriched in terms including extracellular matrix, cartilage development, contractile fiber, and chemokine activity. Conclusions Our results provide a first atlas of gene expression profiles and differentially expressed genes in standard and delayed bone healing in a large-animal model and provide a number of clues as to the shifts in gene expression that underlie delayed bone healing. In the course of our study, we identified transcripts of 13,987 ovine genes, including 12,431 genes for which no sequence information was previously available. This information will provide a basis for future molecular research involving the sheep as a model organism. PMID:21435219
Zhang, Senhao; Shi, Yinghua; Cheng, Ningning; Du, Hongqi; Fan, Wenna; Wang, Chengzhang
2015-01-01
Alfalfa (Medicago sativa L.) is one of the most widely cultivated perennial forage legumes worldwide. Fall dormancy is an adaptive character related to the biomass production and winter survival in alfalfa. The physiological, biochemical and molecular mechanisms causing fall dormancy and the related genes have not been well studied. In this study, we sequenced two standard varieties of alfalfa (dormant and non-dormant) at two time points and generated approximately 160 million high quality paired-end sequence reads using sequencing by synthesis (SBS) technology. The de novo transcriptome assembly generated a set of 192,875 transcripts with an average length of 856 bp representing about 165.1 Mb of the alfalfa leaf transcriptome. After assembly, 111,062 (57.6%) transcripts were annotated against the NCBI non-redundant database. A total of 30,165 (15.6%) transcripts were mapped to 323 Kyoto Encyclopedia of Genes and Genomes pathways. We also identified 41,973 simple sequence repeats, which can be used to generate markers for alfalfa, and 1,541 transcription factors were identified across 1,350 transcripts. Gene expression between dormant and non-dormant alfalfa at different time points were performed, and we identified several differentially expressed genes potentially related to fall dormancy. The Gene Ontology and pathways information were also identified. We sequenced and assembled the leaf transcriptome of alfalfa related to fall dormancy, and also identified some genes of interest involved in the fall dormancy mechanism. Thus, our research focused on studying fall dormancy in alfalfa through transcriptome sequencing. The sequencing and gene expression data generated in this study may be used further to elucidate the complete mechanisms governing fall dormancy in alfalfa.
Cheng, Ningning; Du, Hongqi; Fan, Wenna; Wang, Chengzhang
2015-01-01
Alfalfa (Medicago sativa L.) is one of the most widely cultivated perennial forage legumes worldwide. Fall dormancy is an adaptive character related to the biomass production and winter survival in alfalfa. The physiological, biochemical and molecular mechanisms causing fall dormancy and the related genes have not been well studied. In this study, we sequenced two standard varieties of alfalfa (dormant and non-dormant) at two time points and generated approximately 160 million high quality paired-end sequence reads using sequencing by synthesis (SBS) technology. The de novo transcriptome assembly generated a set of 192,875 transcripts with an average length of 856 bp representing about 165.1 Mb of the alfalfa leaf transcriptome. After assembly, 111,062 (57.6%) transcripts were annotated against the NCBI non-redundant database. A total of 30,165 (15.6%) transcripts were mapped to 323 Kyoto Encyclopedia of Genes and Genomes pathways. We also identified 41,973 simple sequence repeats, which can be used to generate markers for alfalfa, and 1,541 transcription factors were identified across 1,350 transcripts. Gene expression between dormant and non-dormant alfalfa at different time points were performed, and we identified several differentially expressed genes potentially related to fall dormancy. The Gene Ontology and pathways information were also identified. We sequenced and assembled the leaf transcriptome of alfalfa related to fall dormancy, and also identified some genes of interest involved in the fall dormancy mechanism. Thus, our research focused on studying fall dormancy in alfalfa through transcriptome sequencing. The sequencing and gene expression data generated in this study may be used further to elucidate the complete mechanisms governing fall dormancy in alfalfa. PMID:25799491
Messmer, Bradley T; Raphael, Benjamin J; Aerni, Sarah J; Widhopf, George F; Rassenti, Laura Z; Gribben, John G; Kay, Neil E; Kipps, Thomas J
2009-01-01
The leukemia cells of unrelated patients with chronic lymphocytic leukemia (CLL) display a restricted repertoire of immunoglobulin (Ig) gene rearrangements with preferential usage of certain Ig gene segments. We developed a computational method to rigorously quantify biases in Ig sequence similarity in large patient databases and to identify groups of patients with unusual levels of sequence similarity. We applied our method to sequences from 1577 CLL patients through the CLL Research Consortium (CRC), and identified 67 similarity groups into which roughly 20% of all patients could be assigned. Immunoglobulin light chain class was highly correlated within all groups and light chain gene usage was similar within sets. Surprisingly, over 40% of the identified groups were composed of somatically mutated genes. This study significantly expands the evidence that antigen selection shapes the Ig repertoire in CLL. PMID:18640719
Messmer, Bradley T; Raphael, Benjamin J; Aerni, Sarah J; Widhopf, George F; Rassenti, Laura Z; Gribben, John G; Kay, Neil E; Kipps, Thomas J
2009-03-01
The leukemia cells of unrelated patients with chronic lymphocytic leukemia (CLL) display a restricted repertoire of immunoglobulin (Ig) gene rearrangements with preferential usage of certain Ig gene segments. We developed a computational method to rigorously quantify biases in Ig sequence similarity in large patient databases and to identify groups of patients with unusual levels of sequence similarity. We applied our method to sequences from 1577 CLL patients through the CLL Research Consortium (CRC), and identified 67 similarity groups into which roughly 20% of all patients could be assigned. Immunoglobulin light chain class was highly correlated within all groups and light chain gene usage was similar within sets. Surprisingly, over 40% of the identified groups were composed of somatically mutated genes. This study significantly expands the evidence that antigen selection shapes the Ig repertoire in CLL.
Ye, Weixing; Zhu, Lei; Liu, Yingying; Crickmore, Neil; Peng, Donghai; Ruan, Lifang; Sun, Ming
2012-07-01
We have designed a high-throughput system for the identification of novel crystal protein genes (cry) from Bacillus thuringiensis strains. The system was developed with two goals: (i) to acquire the mixed plasmid-enriched genomic sequence of B. thuringiensis using next-generation sequencing biotechnology, and (ii) to identify cry genes with a computational pipeline (using BtToxin_scanner). In our pipeline method, we employed three different kinds of well-developed prediction methods, BLAST, hidden Markov model (HMM), and support vector machine (SVM), to predict the presence of Cry toxin genes. The pipeline proved to be fast (average speed, 1.02 Mb/min for proteins and open reading frames [ORFs] and 1.80 Mb/min for nucleotide sequences), sensitive (it detected 40% more protein toxin genes than a keyword extraction method using genomic sequences downloaded from GenBank), and highly specific. Twenty-one strains from our laboratory's collection were selected based on their plasmid pattern and/or crystal morphology. The plasmid-enriched genomic DNA was extracted from these strains and mixed for Illumina sequencing. The sequencing data were de novo assembled, and a total of 113 candidate cry sequences were identified using the computational pipeline. Twenty-seven candidate sequences were selected on the basis of their low level of sequence identity to known cry genes, and eight full-length genes were obtained with PCR. Finally, three new cry-type genes (primary ranks) and five cry holotypes, which were designated cry8Ac1, cry7Ha1, cry21Ca1, cry32Fa1, and cry21Da1 by the B. thuringiensis Toxin Nomenclature Committee, were identified. The system described here is both efficient and cost-effective and can greatly accelerate the discovery of novel cry genes.
Hsu, Ju-Chun; Chien, Ting-Ying; Hu, Chia-Cheng; Chen, Mei-Ju May; Wu, Wen-Jer; Feng, Hai-Tung; Haymer, David S; Chen, Chien-Yu
2012-01-01
Insecticide resistance has recently become a critical concern for control of many insect pest species. Genome sequencing and global quantization of gene expression through analysis of the transcriptome can provide useful information relevant to this challenging problem. The oriental fruit fly, Bactrocera dorsalis, is one of the world's most destructive agricultural pests, and recently it has been used as a target for studies of genetic mechanisms related to insecticide resistance. However, prior to this study, the molecular data available for this species was largely limited to genes identified through homology. To provide a broader pool of gene sequences of potential interest with regard to insecticide resistance, this study uses whole transcriptome analysis developed through de novo assembly of short reads generated by next-generation sequencing (NGS). The transcriptome of B. dorsalis was initially constructed using Illumina's Solexa sequencing technology. Qualified reads were assembled into contigs and potential splicing variants (isotigs). A total of 29,067 isotigs have putative homologues in the non-redundant (nr) protein database from NCBI, and 11,073 of these correspond to distinct D. melanogaster proteins in the RefSeq database. Approximately 5,546 isotigs contain coding sequences that are at least 80% complete and appear to represent B. dorsalis genes. We observed a strong correlation between the completeness of the assembled sequences and the expression intensity of the transcripts. The assembled sequences were also used to identify large numbers of genes potentially belonging to families related to insecticide resistance. A total of 90 P450-, 42 GST-and 37 COE-related genes, representing three major enzyme families involved in insecticide metabolism and resistance, were identified. In addition, 36 isotigs were discovered to contain target site sequences related to four classes of resistance genes. Identified sequence motifs were also analyzed to characterize putative polypeptide translational products and associate them with specific genes and protein functions.
USDA-ARS?s Scientific Manuscript database
Background: Access to sheep genome sequences significantly improves the chances of identifying genes that may influence the health, welfare, and productivity of these animals. Methods: A public, searchable DNA sequence resource for U.S. sheep was created with whole genome sequence (WGS) of 96 rams. ...
Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander
2010-04-01
Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.
Li, Li; Brunk, Brian P.; Kissinger, Jessica C.; Pape, Deana; Tang, Keliang; Cole, Robert H.; Martin, John; Wylie, Todd; Dante, Mike; Fogarty, Steven J.; Howe, Daniel K.; Liberator, Paul; Diaz, Carmen; Anderson, Jennifer; White, Michael; Jerome, Maria E.; Johnson, Emily A.; Radke, Jay A.; Stoeckert, Christian J.; Waterston, Robert H.; Clifton, Sandra W.; Roos, David S.; Sibley, L. David
2003-01-01
Large-scale EST sequencing projects for several important parasites within the phylum Apicomplexa were undertaken for the purpose of gene discovery. Included were several parasites of medical importance (Plasmodium falciparum, Toxoplasma gondii) and others of veterinary importance (Eimeria tenella, Sarcocystis neurona, and Neospora caninum). A total of 55,192 ESTs, deposited into dbEST/GenBank, were included in the analyses. The resulting sequences have been clustered into nonredundant gene assemblies and deposited into a relational database that supports a variety of sequence and text searches. This database has been used to compare the gene assemblies using BLAST similarity comparisons to the public protein databases to identify putative genes. Of these new entries, ∼15%–20% represent putative homologs with a conservative cutoff of p < 10−9, thus identifying many conserved genes that are likely to share common functions with other well-studied organisms. Gene assemblies were also used to identify strain polymorphisms, examine stage-specific expression, and identify gene families. An interesting class of genes that are confined to members of this phylum and not shared by plants, animals, or fungi, was identified. These genes likely mediate the novel biological features of members of the Apicomplexa and hence offer great potential for biological investigation and as possible therapeutic targets. [The sequence data from this study have been submitted to dbEST division of GenBank under accession nos.: Toxoplasma gondii: –, –, –, –, – , –, –, –, –. Plasmodium falciparum: –, –, –, –. Sarcocystis neurona: , , , , , , , , , , , , , –, –, –, –, –. Eimeria tenella: –, –, –, –, –, –, –, –, – , –, –, –, –, –, –, –, –, –, –, –. Neospora caninum: –, –, , – , –, –.] PMID:12618375
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fields, C.A.
1994-09-01
This Report concludes the DOE Human Genome Program project, ``Identification of Genes in Anonymous DNA Sequence.`` The central goals of this project have been (1) understanding the problem of identifying genes in anonymous sequences, and (2) development of tools, primarily the automated identification system gm, for identifying genes. The activities supported under the previous award are summarized here to provide a single complete report on the activities supported as part of the project from its inception to its completion.
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Digital transcriptome analysis of putative sex-determination genes in papaya (Carica papaya).
Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo
2012-01-01
Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Y(h)) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Y(h) chromosome, implying a loss of many genes on the Y(h) chromosome. Nevertheless, candidate Y(h) chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya.
Digital Transcriptome Analysis of Putative Sex-Determination Genes in Papaya (Carica papaya)
Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo
2012-01-01
Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Yh) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Yh chromosome, implying a loss of many genes on the Yh chromosome. Nevertheless, candidate Yh chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya. PMID:22815863
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
NASA Astrophysics Data System (ADS)
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Feline hypersomatotropism and acromegaly tumorigenesis: a potential role for the AIP gene.
Scudder, C J; Niessen, S J; Catchpole, B; Fowkes, R C; Church, D B; Forcada, Y
2017-04-01
Acromegaly in humans is usually sporadic, however up to 20% of familial isolated pituitary adenomas are caused by germline sequence variants of the aryl-hydrocarbon-receptor interacting protein (AIP) gene. Feline acromegaly has similarities to human acromegalic families with AIP mutations. The aim of this study was to sequence the feline AIP gene, identify sequence variants and compare the AIP gene sequence between feline acromegalic and control cats, and in acromegalic siblings. The feline AIP gene was amplified through PCR using whole blood genomic DNA from 10 acromegalic and 10 control cats, and 3 sibling pairs affected by acromegaly. PCR products were sequenced and compared with the published predicted feline AIP gene. A single nonsynonymous SNP was identified in exon 1 (AIP:c.9T > G) of two acromegalic cats and none of the control cats, as well as both members of one sibling pair. The region of this SNP is considered essential for the interaction of the AIP protein with its receptor. This sequence variant has not previously been reported in humans. Two additional synonymous sequence variants were identified (AIP:c.481C > T and AIP:c.826C > T). This is the first molecular study to investigate a potential genetic cause of feline acromegaly and identified a nonsynonymous AIP single nucleotide polymorphism in 20% of the acromegalic cat population evaluated, as well as in one of the sibling pairs evaluated. Copyright © 2016 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Background: Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results: We describe the sequencing and assembly of...
Howard, Thomas P; Hayward, Andrew P; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A; Tohme, Joe; Kausch, Albert P; Mottinger, John P; Dellaporta, Stephen L
2014-01-01
Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform.
Howard, Thomas P.; Hayward, Andrew P.; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A.; Tohme, Joe; Kausch, Albert P.; Mottinger, John P.; Dellaporta, Stephen L.
2014-01-01
Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform. PMID:24498020
Zhang, Yuan Yuan; Li, Yan Bing; Huang, Ming Xiang; Zhao, Xiu Qin; Zhang, Li Shui; Liu, Wen En; Wan, Kang Lin
2013-11-01
To identify the novel species 'Mycobacterium fukienense' sp. nov of Mycobacterium chelonae/abscessus complex from tuberculosis patients in Fujian Province, China. Five of 27 clinical Mycobacterium isolates (Cls) were previously identified as M. chelonae/abscessus complex by sequencing the hsp65, rpoB, 16S-23S rRNA internal transcribed spacer region (its), recA and sodA house-keeping genes commonly used to describe the molecular characteristics of Mycobacterium. Clinical Mycobacterium isolates were classified according to the gene sequence using a clustering analysis program. Sequence similarity within clusters and diversity between clusters were analyzed. The 5 isolates were identified with distinct sequences exhibiting 99.8% homology in the hsp65 gene. However, a complete lack of homology was observed among the sequences of the rpoB, 16S-23S rRNA internal transcribed spacer region (its), sodA, and recA genes as compared with the M. abscessus. Furthermore, no match for rpoB, sodA, and recA genes was identified among the published sequences. The novel species, Mycobacterium fukienense, is identified from tuberculosis patients in Fujian Province, China, which does not belong to any existing subspecies of M. chelonea/abscessus complex. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Piao, Hailan; Froula, Jeff; Du, Changbin; Kim, Tae-Wan; Hawley, Erik R; Bauer, Stefan; Wang, Zhong; Ivanova, Nathalia; Clark, Douglas S; Klenk, Hans-Peter; Hess, Matthias
2014-08-01
Although recent nucleotide sequencing technologies have significantly enhanced our understanding of microbial genomes, the function of ∼35% of genes identified in a genome currently remains unknown. To improve the understanding of microbial genomes and consequently of microbial processes it will be crucial to assign a function to this "genomic dark matter." Due to the urgent need for additional carbohydrate-active enzymes for improved production of transportation fuels from lignocellulosic biomass, we screened the genomes of more than 5,500 microorganisms for hypothetical proteins that are located in the proximity of already known cellulases. We identified, synthesized and expressed a total of 17 putative cellulase genes with insufficient sequence similarity to currently known cellulases to be identified as such using traditional sequence annotation techniques that rely on significant sequence similarity. The recombinant proteins of the newly identified putative cellulases were subjected to enzymatic activity assays to verify their hydrolytic activity towards cellulose and lignocellulosic biomass. Eleven (65%) of the tested enzymes had significant activity towards at least one of the substrates. This high success rate highlights that a gene context-based approach can be used to assign function to genes that are otherwise categorized as "genomic dark matter" and to identify biomass-degrading enzymes that have little sequence similarity to already known cellulases. The ability to assign function to genes that have no related sequence representatives with functional annotation will be important to enhance our understanding of microbial processes and to identify microbial proteins for a wide range of applications. © 2014 Wiley Periodicals, Inc.
Mouse mammary tumor virus-like gene sequences are present in lung patient specimens
2011-01-01
Background Previous studies have reported on the presence of Murine Mammary Tumor Virus (MMTV)-like gene sequences in human cancer tissue specimens. Here, we search for MMTV-like gene sequences in lung diseases including carcinomas specimens from a Mexican population. This study was based on our previous study reporting that the INER51 lung cancer cell line, from a pleural effusion of a Mexican patient, contains MMTV-like env gene sequences. Results The MMTV-like env gene sequences have been detected in three out of 18 specimens studied, by PCR using a specific set of MMTV-like primers. The three identified MMTV-like gene sequences, which were assigned as INER6, HZ101, and HZ14, were 99%, 98%, and 97% homologous, respectively, as compared to GenBank sequence accession number AY161347. The INER6 and HZ-101 samples were isolated from lung cancer specimens, and the HZ-14 was isolated from an acute inflammatory lung infiltrate sample. Two of the env sequences exhibited disruption of the reading frame due to mutations. Conclusion In summary, we identified the presence of MMTV-like gene sequences in 2 out of 11 (18%) of the lung carcinomas and 1 out of 7 (14%) of acute inflamatory lung infiltrate specimens studied of a Mexican Population. PMID:21943279
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
Murthy, S C; Bhat, G P; Thimmappaya, B
1985-01-01
A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577
Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J
2005-01-01
Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134
Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred
2014-11-20
Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.
Finding functional features in Saccharomyces genomes by phylogenetic footprinting.
Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark
2003-07-04
The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.
Jang, Mi Ae; Lee, Chang Woo; Kim, Jin Kyung; Ki, Chang Seok
2015-11-01
Cornelia de Lange syndrome (CdLS) is a clinically and genetically heterogeneous congenital anomaly. Mutations in the NIPBL gene account for a half of the affected individuals. We describe a family with CdLS carrying a novel pathogenic variant of the SMC1A gene identified by exome sequencing. The proband was a 3-yr-old boy presenting with a developmental delay. He had distinctive facial features without major structural anomalies and tested negative for the NIPBL gene. His younger sister, mother, and maternal grandmother presented with mild mental retardation. By exome sequencing of the proband, a novel SMC1A variant, c.3178G>A, was identified, which was expected to cause an amino acid substitution (p.Glu1060Lys) in the highly conserved coiled-coil domain of the SMC1A protein. Sanger sequencing confirmed that the three female relatives with mental retardation also carry this variant. Our results reveal that SMC1A gene defects are associated with milder phenotypes of CdLS. Furthermore, we showed that exome sequencing could be a useful tool to identify pathogenic variants in patients with CdLS.
Capturing novel mouse genes encoding chromosomal and other nuclear proteins.
Tate, P; Lee, M; Tweedie, S; Skarnes, W C; Bickmore, W A
1998-09-01
The burgeoning wealth of gene sequences contrasts with our ignorance of gene function. One route to assigning function is by determining the sub-cellular location of proteins. We describe the identification of mouse genes encoding proteins that are confined to nuclear compartments by splicing endogeneous gene sequences to a promoterless betageo reporter, using a gene trap approach. Mouse ES (embryonic stem) cell lines were identified that express betageo fusions located within sub-nuclear compartments, including chromosomes, the nucleolus and foci containing splicing factors. The sequences of 11 trapped genes were ascertained, and characterisation of endogenous protein distribution in two cases confirmed the validity of the approach. Three novel proteins concentrated within distinct chromosomal domains were identified, one of which appears to be a serine/threonine kinase. The sequence of a gene whose product co-localises with splicesome components suggests that this protein may be an E3 ubiquitin-protein ligase. The majority of the other genes isolated represent novel genes. This approach is shown to be a powerful tool for identifying genes encoding novel proteins with specific sub-nuclear localisations and exposes our ignorance of the protein composition of the nucleus. Motifs in two of the isolated genes suggest new links between cellular regulatory mechanisms (ubiquitination and phosphorylation) and mRNA splicing and chromosome structure/function.
Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F
2007-03-01
In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.
Adamczuk, Marcin; Dziewit, Lukasz
2017-01-01
The draft genome of multidrug-resistant Aeromonas sp. ARM81 isolated from a wastewater treatment plant in Warsaw (Poland) was obtained. Sequence analysis revealed multiple genes conferring resistance to aminoglycosides, β-lactams or tetracycline. Three different β-lactamase genes were identified, including an extended-spectrum β-lactamase gene bla PER-1 . The antibiotic susceptibility was experimentally tested. Genome sequencing also allowed us to investigate the plasmidome and transposable mobilome of ARM81. Four plasmids, of which two carry phenotypic modules (i.e., genes encoding a zinc transporter ZitB and a putative glucosyltransferase), and 28 putative transposase genes were identified. The mobility of three insertion sequences (isoforms of previously identified elements ISAs12, ISKpn9 and ISAs26) was confirmed using trap plasmids.
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kim, Bongju; Kim, Kyunghee; Yang, Tae-Jin; Kim, Sunggil
2016-11-01
Cytoplasmic male-sterility (CMS) conferred by the CMS-S cytoplasm has been most commonly used for onion (Allium cepa L.) F 1 hybrid seed production. We first report the complete mitochondrial genome sequence containing CMS-S cytoplasm in this study. Initially, seven contigs were de novo assembled from 150-bp paired-end raw reads produced from the total genomic DNA using the Illumina NextSeq500 platform. These contigs were connected into a single circular genome consisting of 316,363 bp (GenBank accession: KU318712) by PCR amplification. Although all 24 core protein-coding genes were present, no ribosomal protein-coding genes, except rps12, were identified in the onion mitochondrial genome. Unusual trans-splicing of the cox2 gene was verified, and the cox1 gene was identified as part of the chimeric orf725 gene, which is a candidate gene responsible for inducing CMS. In addition to orf725, two small chimeric genes were identified, but no transcripts were detected for these two open reading frames. Thirteen chloroplast-derived sequences, with sizes of 126-13,986 bp, were identified in the intergenic regions. Almost 10 % of the onion mitochondrial genome was composed of repeat sequences. The vast majority of repeats were short repeats of <100 base pairs. Interestingly, the gene encoding ccmF N was split into two genes. The ccmF N gene split is first identified outside the Brassicaceae family. The breakpoint in the onion ccmF N gene was different from that of other Brassicaceae species. This split of the ccmF N gene was also present in 30 other Allium species. The complete onion mitochondrial genome sequence reported in this study would be fundamental information for elucidation of onion CMS evolution.
Kim, Moon Jung; Bae, Il Kwon; Jeong, Seok Hoon; Kim, So Hyun; Song, Jae Hoon; Choi, Jae Young; Yoon, Sang Sun; Thamlikitkul, Visanu; Hsueh, Po-Ren; Yasin, Rohani Md; Lalitha, M K; Lee, Kyungwon
2013-12-01
To investigate the epidemiological traits of metallo-β-lactamase (MBL)-producing Pseudomonas aeruginosa (MPPA) clinical isolates collected by the Asian Network for Surveillance of Resistant Pathogens (ANSORP). A total of 16 MPPA clinical isolates were collected from six Asian countries in 2000 to 2009 by ANSORP. The MBL gene was detected by PCR amplification. The genetic organization of the class 1 integron carrying the MBL gene cassette was investigated by PCR mapping and sequencing. Southern blotting, repetitive sequence-based PCR and multilocus sequence typing (MLST) experiments were performed to characterize the isolates. PCR and sequencing experiments detected the blaVIM-2 (n = 12), blaVIM-3 (n = 1), blaIMP-6 (n = 2) and blaIMP-26 (n = 1) genes. The MBL genes were located on the chromosome in all isolates except one. Furthermore, all the MBL genes were located in a class 1 integron. All the MPPA isolates from Malaysia, Thailand, Sri Lanka and Korea were identified as sequence type (ST) 235 by MLST. Three VIM-2-producing isolates from India were identified as ST773, and one isolate harbouring VIM-3 from Taiwan was identified as ST298. P. aeruginosa ST235 might play a role in dissemination of MBL genes in Asian countries.
Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N
2013-06-03
Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.
2013-01-01
Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509
2014-01-01
Background Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. Methods We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Results Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients’ clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Conclusions Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology. PMID:24885126
Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan
2014-05-15
Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.
A wing expressed sequence tag resource for Bicyclus anynana butterflies, an evo-devo model
Beldade, Patrícia; Rudd, Stephen; Gruber, Jonathan D; Long, Anthony D
2006-01-01
Background Butterfly wing color patterns are a key model for integrating evolutionary developmental biology and the study of adaptive morphological evolution. Yet, despite the biological, economical and educational value of butterflies they are still relatively under-represented in terms of available genomic resources. Here, we describe an Expression Sequence Tag (EST) project for Bicyclus anynana that has identified the largest available collection to date of expressed genes for any butterfly. Results By targeting cDNAs from developing wings at the stages when pattern is specified, we biased gene discovery towards genes potentially involved in pattern formation. Assembly of 9,903 ESTs from a subtracted library allowed us to identify 4,251 genes of which 2,461 were annotated based on BLAST analyses against relevant gene collections. Gene prediction software identified 2,202 peptides, of which 215 longer than 100 amino acids had no homology to any known proteins and, thus, potentially represent novel or highly diverged butterfly genes. We combined gene and Single Nucleotide Polymorphism (SNP) identification by constructing cDNA libraries from pools of outbred individuals, and by sequencing clones from the 3' end to maximize alignment depth. Alignments of multi-member contigs allowed us to identify over 14,000 putative SNPs, with 316 genes having at least one high confidence double-hit SNP. We furthermore identified 320 microsatellites in transcribed genes that can potentially be used as genetic markers. Conclusion Our project was designed to combine gene and sequence polymorphism discovery and has generated the largest gene collection available for any butterfly and many potential markers in expressed genes. These resources will be invaluable for exploring the potential of B. anynana in particular, and butterflies in general, as models in ecological, evolutionary, and developmental genetics. PMID:16737530
Experience of targeted Usher exome sequencing as a clinical test
Besnard, Thomas; García-García, Gema; Baux, David; Vaché, Christel; Faugère, Valérie; Larrieu, Lise; Léonard, Susana; Millan, Jose M; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise
2014-01-01
We show that massively parallel targeted sequencing of 19 genes provides a new and reliable strategy for molecular diagnosis of Usher syndrome (USH) and nonsyndromic deafness, particularly appropriate for these disorders characterized by a high clinical and genetic heterogeneity and a complex structure of several of the genes involved. A series of 71 patients including Usher patients previously screened by Sanger sequencing plus newly referred patients was studied. Ninety-eight percent of the variants previously identified by Sanger sequencing were found by next-generation sequencing (NGS). NGS proved to be efficient as it offers analysis of all relevant genes which is laborious to reach with Sanger sequencing. Among the 13 newly referred Usher patients, both mutations in the same gene were identified in 77% of cases (10 patients) and one candidate pathogenic variant in two additional patients. This work can be considered as pilot for implementing NGS for genetically heterogeneous diseases in clinical service. PMID:24498627
DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.
Choudhary, M; Kaplan, S
2000-02-15
This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.
Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R
2005-09-01
We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.
Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O
2000-12-15
Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.
Targeted Analysis of Whole Genome Sequence Data to Diagnose Genetic Cardiomyopathy
Golbus, Jessica R.; Puckelwartz, Megan J.; Dellefave-Castillo, Lisa; ...
2014-09-01
Background—Cardiomyopathy is highly heritable but genetically diverse. At present, genetic testing for cardiomyopathy uses targeted sequencing to simultaneously assess the coding regions of more than 50 genes. New genes are routinely added to panels to improve the diagnostic yield. With the anticipated $1000 genome, it is expected that genetic testing will shift towards comprehensive genome sequencing accompanied by targeted gene analysis. Therefore, we assessed the reliability of whole genome sequencing and targeted analysis to identify cardiomyopathy variants in 11 subjects with cardiomyopathy. Methods and Results—Whole genome sequencing with an average of 37× coverage was combined with targeted analysis focused onmore » 204 genes linked to cardiomyopathy. Genetic variants were scored using multiple prediction algorithms combined with frequency data from public databases. This pipeline yielded 1-14 potentially pathogenic variants per individual. Variants were further analyzed using clinical criteria and/or segregation analysis. Three of three previously identified primary mutations were detected by this analysis. In six subjects for whom the primary mutation was previously unknown, we identified mutations that segregated with disease, had clinical correlates, and/or had additional pathological correlation to provide evidence for causality. For two subjects with previously known primary mutations, we identified additional variants that may act as modifiers of disease severity. In total, we identified the likely pathological mutation in 9 of 11 (82%) subjects. We conclude that these pilot data demonstrate that ~30-40× coverage whole genome sequencing combined with targeted analysis is feasible and sensitive to identify rare variants in cardiomyopathy-associated genes.« less
2012-01-01
Background As a human replacement, the crab-eating macaque (Macaca fascicularis) is an invaluable non-human primate model for biomedical research, but the lack of genetic information on this primate has represented a significant obstacle for its broader use. Results Here, we sequenced the transcriptome of 16 tissues originated from two individuals of crab-eating macaque (male and female), and identified genes to resolve the main obstacles for understanding the biological response of the crab-eating macaque. From 4 million reads with 1.4 billion base sequences, 31,786 isotigs containing genes similar to those of humans, 12,672 novel isotigs, and 348,160 singletons were identified using the GS FLX sequencing method. Approximately 86% of human genes were represented among the genes sequenced in this study. Additionally, 175 tissue-specific transcripts were identified, 81 of which were experimentally validated. In total, 4,314 alternative splicing (AS) events were identified and analyzed. Intriguingly, 10.4% of AS events were associated with transposable element (TE) insertions. Finally, investigation of TE exonization events and evolutionary analysis were conducted, revealing interesting phenomena of human-specific amplified trends in TE exonization events. Conclusions This report represents the first large-scale transcriptome sequencing and genetic analyses of M. fascicularis and could contribute to its utility for biomedical research and basic biology. PMID:22554259
Nguyen, Thong T; Suryamohan, Kushal; Kuriakose, Boney; Janakiraman, Vasantharajan; Reichelt, Mike; Chaudhuri, Subhra; Guillory, Joseph; Divakaran, Neethu; Rabins, P E; Goel, Ridhi; Deka, Bhabesh; Sarkar, Suman; Ekka, Preety; Tsai, Yu-Chih; Vargas, Derek; Santhosh, Sam; Mohan, Sangeetha; Chin, Chen-Shan; Korlach, Jonas; Thomas, George; Babu, Azariah; Seshagiri, Somasekar
2018-06-12
We sequenced the Hyposidra talaca NPV (HytaNPV) double stranded circular DNA genome using PacBio single molecule sequencing technology. We found that the HytaNPV genome is 139,089 bp long with a GC content of 39.6%. It encodes 141 open reading frames (ORFs) including the 37 baculovirus core genes, 25 genes conserved among lepidopteran baculoviruses, 72 genes known in baculovirus, and 7 genes unique to the HytaNPV genome. It is a group II alphabaculovirus that codes for the F protein and lacks the gp64 gene found in group I alphabaculovirus viruses. Using RNA-seq, we confirmed the expression of the ORFs identified in the HytaNPV genome. Phylogenetic analysis showed HytaNPV to be closest to BusuNPV, SujuNPV and EcobNPV that infect other tea pests, Buzura suppressaria, Sucra jujuba, and Ectropis oblique, respectively. We identified repeat elements and a conserved non-coding baculovirus element in the genome. Analysis of the putative promoter sequences identified motif consistent with the temporal expression of the genes observed in the RNA-seq data.
Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia
2015-10-01
Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).
Aslam, Luqman; Beal, Kathryn; Ann Blomberg, Le; Bouffard, Pascal; Burt, David W.; Crasta, Oswald; Crooijmans, Richard P. M. A.; Cooper, Kristal; Coulombe, Roger A.; De, Supriyo; Delany, Mary E.; Dodgson, Jerry B.; Dong, Jennifer J.; Evans, Clive; Frederickson, Karin M.; Flicek, Paul; Florea, Liliana; Folkerts, Otto; Groenen, Martien A. M.; Harkins, Tim T.; Herrero, Javier; Hoffmann, Steve; Megens, Hendrik-Jan; Jiang, Andrew; de Jong, Pieter; Kaiser, Pete; Kim, Heebal; Kim, Kyu-Won; Kim, Sungwon; Langenberger, David; Lee, Mi-Kyung; Lee, Taeheon; Mane, Shrinivasrao; Marcais, Guillaume; Marz, Manja; McElroy, Audrey P.; Modise, Thero; Nefedov, Mikhail; Notredame, Cédric; Paton, Ian R.; Payne, William S.; Pertea, Geo; Prickett, Dennis; Puiu, Daniela; Qioa, Dan; Raineri, Emanuele; Ruffier, Magali; Salzberg, Steven L.; Schatz, Michael C.; Scheuring, Chantel; Schmidt, Carl J.; Schroeder, Steven; Searle, Stephen M. J.; Smith, Edward J.; Smith, Jacqueline; Sonstegard, Tad S.; Stadler, Peter F.; Tafer, Hakim; Tu, Zhijian (Jake); Van Tassell, Curtis P.; Vilella, Albert J.; Williams, Kelly P.; Yorke, James A.; Zhang, Liqing; Zhang, Hong-Bin; Zhang, Xiaojun; Zhang, Yang; Reed, Kent M.
2010-01-01
A synergistic combination of two next-generation sequencing platforms with a detailed comparative BAC physical contig map provided a cost-effective assembly of the genome sequence of the domestic turkey (Meleagris gallopavo). Heterozygosity of the sequenced source genome allowed discovery of more than 600,000 high quality single nucleotide variants. Despite this heterozygosity, the current genome assembly (∼1.1 Gb) includes 917 Mb of sequence assigned to specific turkey chromosomes. Annotation identified nearly 16,000 genes, with 15,093 recognized as protein coding and 611 as non-coding RNA genes. Comparative analysis of the turkey, chicken, and zebra finch genomes, and comparing avian to mammalian species, supports the characteristic stability of avian genomes and identifies genes unique to the avian lineage. Clear differences are seen in number and variety of genes of the avian immune system where expansions and novel genes are less frequent than examples of gene loss. The turkey genome sequence provides resources to further understand the evolution of vertebrate genomes and genetic variation underlying economically important quantitative traits in poultry. This integrated approach may be a model for providing both gene and chromosome level assemblies of other species with agricultural, ecological, and evolutionary interest. PMID:20838655
Ross, Cody T.; Roodgar, Morteza; Smith, David Glenn
2015-01-01
We use the Reciprocal Smallest Distance (RSD) algorithm to identify amino acid sequence orthologs in the Chinese and Indian rhesus macaque draft sequences and estimate the evolutionary distance between such orthologs. We then use GOanna to map gene function annotations and human gene identifiers to the rhesus macaque amino acid sequences. We conclude methodologically by cross-tabulating a list of amino acid orthologs with large divergence scores with a list of genes known to be involved in SIV or HIV pathogenesis. We find that many of the amino acid sequences with large evolutionary divergence scores, as calculated by the RSD algorithm, have been shown to be related to HIV pathogenesis in previous laboratory studies. Four of the strongest candidate genes for SIVmac resistance in Chinese rhesus macaques identified in this study are CDK9, CXCL12, TRIM21, and TRIM32. Additionally, ANKRD30A, CTSZ, GORASP2, GTF2H1, IL13RA1, MUC16, NMDAR1, Notch1, NT5M, PDCD5, RAD50, and TM9SF2 were identified as possible candidates, among others. We failed to find many laboratory experiments contrasting the effects of Indian and Chinese orthologs at these sites on SIVmac pathogenesis, but future comparative studies might hold fertile ground for research into the biological mechanisms underlying innate resistance to SIVmac in Chinese rhesus macaques. PMID:25884674
Wei, Xiaoming; Sun, Yan; Xie, Jiansheng; Shi, Quan; Qu, Ning; Yang, Guanghui; Cai, Jun; Yang, Yi; Liang, Yu; Wang, Wei; Yi, Xin
2012-11-20
Targeted enrichment and next-generation sequencing (NGS) have been employed for detection of genetic diseases. The purpose of this study was to validate the accuracy and sensitivity of our method for comprehensive mutation detection of hereditary hearing loss, and identify inherited mutations involved in human deafness accurately and economically. To make genetic diagnosis of hereditary hearing loss simple and timesaving, we designed a 0.60 MB array-based chip containing 69 nuclear genes and mitochondrial genome responsible for human deafness and conducted NGS toward ten patients with five known mutations and a Chinese family with hearing loss (never genetically investigated). Ten patients with five known mutations were sequenced using next-generation sequencing to validate the sensitivity of the method. We identified four known mutations in two nuclear deafness causing genes (GJB2 and SLC26A4), one in mitochondrial DNA. We then performed this method to analyze the variants in a Chinese family with hearing loss and identified compound heterozygosity for two novel mutations in gene MYO7A. The compound heterozygosity identified in gene MYO7A causes Usher Syndrome 1B with severe phenotypes. The results support that the combination of enrichment of targeted genes and next-generation sequencing is a valuable molecular diagnostic tool for hereditary deafness and suitable for clinical application. Copyright © 2012 Elsevier B.V. All rights reserved.
Taylor, Brandie D; Zheng, Xiaojing; Darville, Toni; Zhong, Wujuan; Konganti, Kranti; Abiodun-Ojo, Olayinka; Ness, Roberta B; O'Connell, Catherine M; Haggerty, Catherine L
2017-01-01
Ideal management of sexually transmitted infections (STI) may require risk markers for pathology or vaccine development. Previously, we identified common genetic variants associated with chlamydial pelvic inflammatory disease (PID) and reduced fecundity. As this explains only a proportion of the long-term morbidity risk, we used whole-exome sequencing to identify biological pathways that may be associated with STI-related infertility. We obtained stored DNA from 43 non-Hispanic black women with PID from the PID Evaluation and Clinical Health Study. Infertility was assessed at a mean of 84 months. Principal component analysis revealed no population stratification. Potential covariates did not significantly differ between groups. Sequencing kernel association test was used to examine associations between aggregates of variants on a single gene and infertility. The results from the sequencing kernel association test were used to choose "focus genes" (P < 0.01; n = 150) for subsequent Ingenuity Pathway Analysis to identify "gene sets" that are enriched in biologically relevant pathways. Pathway analysis revealed that focus genes were enriched in canonical pathways including, IL-1 signaling, P2Y purinergic receptor signaling, and bone morphogenic protein signaling. Focus genes were enriched in pathways that impact innate and adaptive immunity, protein kinase A activity, cellular growth, and DNA repair. These may alter host resistance or immunopathology after infection. Targeted sequencing of biological pathways identified in this study may provide insight into STI-related infertility.
Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo
2003-01-01
To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979
Ming, De-Song; Chen, Qing-Qing; Chen, Xiao-Tin
2018-05-14
To clarify the resistance mechanisms of Pannonibacter phragmitetus 31801, isolated from the blood of a liver abscess patient, at the genomic level, we performed whole genomic sequencing using a PacBio RS II single-molecule real-time long-read sequencer. Bioinformatic analysis of the resulting sequence was then carried out to identify any possible resistance genes. Analyses included Basic Local Alignment Search Tool searches against the Antibiotic Resistance Genes Database, ResFinder analysis of the genome sequence, and Resistance Gene Identifier analysis within the Comprehensive Antibiotic Resistance Database. Prophages, clustered regularly interspaced short palindromic repeats (CRISPR), and other putative virulence factors were also identified using PHAST, CRISPRfinder, and the Virulence Factors Database, respectively. The circular chromosome and single plasmid of P. phragmitetus 31801 contained multiple antibiotic resistance genes, including those coding for three different types of β-lactamase [NPS β-lactamase (EC 3.5.2.6), β-lactamase class C, and a metal-dependent hydrolase of β-lactamase superfamily I]. In addition, genes coding for subunits of several multidrug-resistance efflux pumps were identified, including those targeting macrolides (adeJ, cmeB), tetracycline (acrB, adeAB), fluoroquinolones (acrF, ceoB), and aminoglycosides (acrD, amrB, ceoB, mexY, smeB). However, apart from the tripartite macrolide efflux pump macAB-tolC, the genome did not appear to contain the complete complement of subunit genes required for production of most of the major multidrug-resistance efflux pumps.
Li, Jingtao; Sun, Xinhua; Yu, Gang; Jia, Chengguo; Liu, Jinliang; Pan, Hongyu
2014-01-01
Little information is available on gene expression profiling of halophyte A. canescens. To elucidate the molecular mechanism for stress tolerance in A. canescens, a full-length complementary DNA library was generated from A. canescens exposed to 400 mM NaCl, and provided 343 high-quality ESTs. In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to Arabidopsis MIPS functional category and GO classifications, we identified 193 unigenes of the 311 annotations EST, representing 72 non-redundant unigenes sharing similarities with genes related to the defense response. The sets of ESTs obtained provide a rich genetic resource and 17 up-regulated genes related to salt stress resistance were identified by qRT-PCR. Six of these genes may contribute crucially to earlier and later stage salt stress resistance. Additionally, among the 343 unigenes sequences, 22 simple sequence repeats (SSRs) were also identified contributing to the study of A. canescens resources. PMID:24960361
Flynn, A N; Lyndon, C A; Church, D L
2013-08-01
A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.
Terrados, Gloria; Finkernagel, Florian; Stielow, Bastian; Sadic, Dennis; Neubert, Juliane; Herdt, Olga; Krause, Michael; Scharfe, Maren; Jarek, Michael; Suske, Guntram
2012-01-01
The transcription factor Sp2 is essential for early mouse development and for proliferation of mouse embryonic fibroblasts in culture. Yet its mechanisms of action and its target genes are largely unknown. In this study, we have combined RNA interference, in vitro DNA binding, chromatin immunoprecipitation sequencing and global gene-expression profiling to investigate the role of Sp2 for cellular functions, to define target sites and to identify genes regulated by Sp2. We show that Sp2 is important for cellular proliferation that it binds to GC-boxes and occupies proximal promoters of genes essential for vital cellular processes including gene expression, replication, metabolism and signalling. Moreover, we identified important key target genes and cellular pathways that are directly regulated by Sp2. Most significantly, Sp2 binds and activates numerous sequence-specific transcription factor and co-activator genes, and represses the whole battery of cholesterol synthesis genes. Our results establish Sp2 as a sequence-specific regulator of vitally important genes. PMID:22684502
DOE Office of Scientific and Technical Information (OSTI.GOV)
Golbus, Jessica R.; Puckelwartz, Megan J.; Dellefave-Castillo, Lisa
Background—Cardiomyopathy is highly heritable but genetically diverse. At present, genetic testing for cardiomyopathy uses targeted sequencing to simultaneously assess the coding regions of more than 50 genes. New genes are routinely added to panels to improve the diagnostic yield. With the anticipated $1000 genome, it is expected that genetic testing will shift towards comprehensive genome sequencing accompanied by targeted gene analysis. Therefore, we assessed the reliability of whole genome sequencing and targeted analysis to identify cardiomyopathy variants in 11 subjects with cardiomyopathy. Methods and Results—Whole genome sequencing with an average of 37× coverage was combined with targeted analysis focused onmore » 204 genes linked to cardiomyopathy. Genetic variants were scored using multiple prediction algorithms combined with frequency data from public databases. This pipeline yielded 1-14 potentially pathogenic variants per individual. Variants were further analyzed using clinical criteria and/or segregation analysis. Three of three previously identified primary mutations were detected by this analysis. In six subjects for whom the primary mutation was previously unknown, we identified mutations that segregated with disease, had clinical correlates, and/or had additional pathological correlation to provide evidence for causality. For two subjects with previously known primary mutations, we identified additional variants that may act as modifiers of disease severity. In total, we identified the likely pathological mutation in 9 of 11 (82%) subjects. We conclude that these pilot data demonstrate that ~30-40× coverage whole genome sequencing combined with targeted analysis is feasible and sensitive to identify rare variants in cardiomyopathy-associated genes.« less
Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...
2015-05-12
Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.
Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less
Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui
2015-01-01
Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410
Winters, Jennifer L; Davila, Jaime I; McDonald, Amber M; Nair, Asha A; Fadra, Numrah; Wehrs, Rebecca N; Thomas, Brittany C; Balcom, Jessica R; Jin, Long; Wu, Xianglin; Voss, Jesse S; Klee, Eric W; Oliver, Gavin R; Graham, Rondell P; Neff, Jadee L; Rumilla, Kandelaria M; Aypar, Umut; Kipp, Benjamin R; Jenkins, Robert B; Jen, Jin; Halling, Kevin C
2018-06-13
We assessed the performance characteristics of an RNA sequencing (RNA-Seq) assay designed to detect gene fusions in 571 genes to help manage patients with cancer. Polyadenylated RNA was converted to cDNA, which was then used to prepare next-generation sequencing libraries that were sequenced on an Illumina HiSeq 2500 instrument and analyzed with an in-house developed bioinformatic pipeline. The assay identified 38 of 41 gene fusions detected by another method, such as fluorescence in situ hybridization or RT-PCR, for a sensitivity of 93%. No false-positive gene fusions were identified in 15 normal tissue specimens and 10 tumor specimens that were negative for fusions by RNA sequencing or Mate Pair NGS (100% specificity). The assay also identified 22 fusions in 17 tumor specimens that had not been detected by other methods. Eighteen of the 22 fusions had not previously been described. Good intra-assay and interassay reproducibility was observed with complete concordance for the presence or absence of gene fusions in replicates. The analytical sensitivity of the assay was tested by diluting RNA isolated from gene fusion-positive cases with fusion-negative RNA. Gene fusions were generally detectable down to 12.5% dilutions for most fusions and as little as 3% for some fusions. This assay can help identify fusions in patients with cancer; these patients may in turn benefit from both US Food and Drug Administration-approved and investigational targeted therapies. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags
de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.
2000-01-01
Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084
Hecht, Jochen; Kuhl, Heiner; Haas, Stefan A; Bauer, Sebastian; Poustka, Albert J; Lienau, Jasmin; Schell, Hanna; Stiege, Asita C; Seitz, Volkhard; Reinhardt, Richard; Duda, Georg N; Mundlos, Stefan; Robinson, Peter N
2006-07-05
The sheep is an important model animal for testing novel fracture treatments and other medical applications. Despite these medical uses and the well known economic and cultural importance of the sheep, relatively little research has been performed into sheep genetics, and DNA sequences are available for only a small number of sheep genes. In this work we have sequenced over 47 thousand expressed sequence tags (ESTs) from libraries developed from healing bone in a sheep model of fracture healing. These ESTs were clustered with the previously available 10 thousand sheep ESTs to a total of 19087 contigs with an average length of 603 nucleotides. We used the newly identified sequences to develop RT-PCR assays for 78 sheep genes and measured differential expression during the course of fracture healing between days 7 and 42 postfracture. All genes showed significant shifts at one or more time points. 23 of the genes were differentially expressed between postfracture days 7 and 10, which could reflect an important role for these genes for the initiation of osteogenesis. The sequences we have identified in this work are a valuable resource for future studies on musculoskeletal healing and regeneration using sheep and represent an important head-start for genomic sequencing projects for Ovis aries, with partial or complete sequences being made available for over 5,800 previously unsequenced sheep genes.
Transcriptome sequencing and de novo analysis of the copepod Calanus sinicus using 454 GS FLX.
Ning, Juan; Wang, Minxiao; Li, Chaolun; Sun, Song
2013-01-01
Despite their species abundance and primary economic importance, genomic information about copepods is still limited. In particular, genomic resources are lacking for the copepod Calanus sinicus, which is a dominant species in the coastal waters of East Asia. In this study, we performed de novo transcriptome sequencing to produce a large number of expressed sequence tags for the copepod C. sinicus. Copepodid larvae and adults were used as the basic material for transcriptome sequencing. Using 454 pyrosequencing, a total of 1,470,799 reads were obtained, which were assembled into 56,809 high quality expressed sequence tags. Based on their sequence similarity to known proteins, about 14,000 different genes were identified, including members of all major conserved signaling pathways. Transcripts that were putatively involved with growth, lipid metabolism, molting, and diapause were also identified among these genes. Differentially expressed genes related to several processes were found in C. sinicus copepodid larvae and adults. We detected 284,154 single nucleotide polymorphisms (SNPs) that provide a resource for gene function studies. Our data provide the most comprehensive transcriptome resource available for C. sinicus. This resource allowed us to identify genes associated with primary physiological processes and SNPs in coding regions, which facilitated the quantitative analysis of differential gene expression. These data should provide foundation for future genetic and genomic studies of this and related species.
rpoB Gene Sequencing for Identification of Corynebacterium Species
Khamis, Atieh; Raoult, Didier; La Scola, Bernard
2004-01-01
The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970
Tian, Xin-Jie; Long, Yan; Wang, Jiao; Zhang, Jing-Wen; Wang, Yan-Yan; Li, Wei-Min; Peng, Yu-Fa; Yuan, Qian-Hua; Pei, Xin-Wu
2015-01-01
The perennial O. rufipogon (common wild rice), which is considered to be the ancestor of Asian cultivated rice species, contains many useful genetic resources, including drought resistance genes. However, few studies have identified the drought resistance and tissue-specific genes in common wild rice. In this study, transcriptome sequencing libraries were constructed, including drought-treated roots (DR) and control leaves (CL) and roots (CR). Using Illumina sequencing technology, we generated 16.75 million bases of high-quality sequence data for common wild rice and conducted de novo assembly and annotation of genes without prior genome information. These reads were assembled into 119,332 unigenes with an average length of 715 bp. A total of 88,813 distinct sequences (74.42% of unigenes) significantly matched known genes in the NCBI NT database. Differentially expressed gene (DEG) analysis showed that 3617 genes were up-regulated and 4171 genes were down-regulated in the CR library compared with the CL library. Among the DEGs, 535 genes were expressed in roots but not in shoots. A similar comparison between the DR and CR libraries showed that 1393 genes were up-regulated and 315 genes were down-regulated in the DR library compared with the CR library. Finally, 37 genes that were specifically expressed in roots were screened after comparing the DEGs identified in the above-described analyses. This study provides a transcriptome sequence resource for common wild rice plants and establishes a digital gene expression profile of wild rice plants under drought conditions using the assembled transcriptome data as a reference. Several tissue-specific and drought-stress-related candidate genes were identified, representing a fully characterized transcriptome and providing a valuable resource for genetic and genomic studies in plants.
Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.
Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier
2014-01-01
Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.
2014-01-01
Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182
ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism
Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry
2012-01-01
Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617
Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael
2013-01-01
Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343
Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok
2016-04-01
Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.
Exploiting proteomic data for genome annotation and gene model validation in Aspergillus niger.
Wright, James C; Sugden, Deana; Francis-McIntyre, Sue; Riba-Garcia, Isabel; Gaskell, Simon J; Grigoriev, Igor V; Baker, Scott E; Beynon, Robert J; Hubbard, Simon J
2009-02-04
Proteomic data is a potentially rich, but arguably unexploited, data source for genome annotation. Peptide identifications from tandem mass spectrometry provide prima facie evidence for gene predictions and can discriminate over a set of candidate gene models. Here we apply this to the recently sequenced Aspergillus niger fungal genome from the Joint Genome Institutes (JGI) and another predicted protein set from another A.niger sequence. Tandem mass spectra (MS/MS) were acquired from 1d gel electrophoresis bands and searched against all available gene models using Average Peptide Scoring (APS) and reverse database searching to produce confident identifications at an acceptable false discovery rate (FDR). 405 identified peptide sequences were mapped to 214 different A.niger genomic loci to which 4093 predicted gene models clustered, 2872 of which contained the mapped peptides. Interestingly, 13 (6%) of these loci either had no preferred predicted gene model or the genome annotators' chosen "best" model for that genomic locus was not found to be the most parsimonious match to the identified peptides. The peptides identified also boosted confidence in predicted gene structures spanning 54 introns from different gene models. This work highlights the potential of integrating experimental proteomics data into genomic annotation pipelines much as expressed sequence tag (EST) data has been. A comparison of the published genome from another strain of A.niger sequenced by DSM showed that a number of the gene models or proteins with proteomics evidence did not occur in both genomes, further highlighting the utility of the method.
Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry
2007-01-01
Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146
Using whole-exome sequencing to identify variants inherited from mosaic parents
Rios, Jonathan J; Delgado, Mauricio R
2015-01-01
Whole-exome sequencing (WES) has allowed the discovery of genes and variants causing rare human disease. This is often achieved by comparing nonsynonymous variants between unrelated patients, and particularly for sporadic or recessive disease, often identifies a single or few candidate genes for further consideration. However, despite the potential for this approach to elucidate the genetic cause of rare human disease, a majority of patients fail to realize a genetic diagnosis using standard exome analysis methods. Although genetic heterogeneity contributes to the difficulty of exome sequence analysis between patients, it remains plausible that rare human disease is not caused by de novo or recessive variants. Multiple human disorders have been described for which the variant was inherited from a phenotypically normal mosaic parent. Here we highlight the potential for exome sequencing to identify a reasonable number of candidate genes when dominant disease variants are inherited from a mosaic parent. We show the power of WES to identify a limited number of candidate genes using this disease model and how sequence coverage affects identification of mosaic variants by WES. We propose this analysis as an alternative to discover genetic causes of rare human disorders for which typical WES approaches fail to identify likely pathogenic variants. PMID:24986828
Petti, C. A.; Polage, C. R.; Schreckenberger, P.
2005-01-01
Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109
Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santini, Simona; Boore, Jeffrey L.; Meyer, Axel
2003-12-31
Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less
Fahlgren, Noah; Howell, Miya D.; Kasschau, Kristin D.; Chapman, Elisabeth J.; Sullivan, Christopher M.; Cumbie, Jason S.; Givan, Scott A.; Law, Theresa F.; Grant, Sarah R.; Dangl, Jeffery L.; Carrington, James C.
2007-01-01
In plants, microRNAs (miRNAs) comprise one of two classes of small RNAs that function primarily as negative regulators at the posttranscriptional level. Several MIRNA genes in the plant kingdom are ancient, with conservation extending between angiosperms and the mosses, whereas many others are more recently evolved. Here, we use deep sequencing and computational methods to identify, profile and analyze non-conserved MIRNA genes in Arabidopsis thaliana. 48 non-conserved MIRNA families, nearly all of which were represented by single genes, were identified. Sequence similarity analyses of miRNA precursor foldback arms revealed evidence for recent evolutionary origin of 16 MIRNA loci through inverted duplication events from protein-coding gene sequences. Interestingly, these recently evolved MIRNA genes have taken distinct paths. Whereas some non-conserved miRNAs interact with and regulate target transcripts from gene families that donated parental sequences, others have drifted to the point of non-interaction with parental gene family transcripts. Some young MIRNA loci clearly originated from one gene family but form miRNAs that target transcripts in another family. We suggest that MIRNA genes are undergoing relatively frequent birth and death, with only a subset being stabilized by integration into regulatory networks. PMID:17299599
Gene expression profiling of flax (Linum usitatissimum L.) under edaphic stress.
Dmitriev, Alexey A; Kudryavtseva, Anna V; Krasnov, George S; Koroban, Nadezhda V; Speranskaya, Anna S; Krinitsina, Anastasia A; Belenikin, Maxim S; Snezhkina, Anastasiya V; Sadritdinova, Asiya F; Kishlyan, Natalya V; Rozhmina, Tatiana A; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Melnikova, Nataliya V
2016-11-16
Cultivated flax (Linum usitatissimum L.) is widely used for production of textile, food, chemical and pharmaceutical products. However, various stresses decrease flax production. Search for genes, which are involved in stress response, is necessary for breeding of adaptive cultivars. Imbalanced concentration of nutrient elements in soil decrease flax yields and also results in heritable changes in some flax lines. The appearance of Linum Insertion Sequence 1 (LIS-1) is the most studied modification. However, LIS-1 function is still unclear. High-throughput sequencing of transcriptome of flax plants grown under normal (N), phosphate deficient (P), and nutrient excess (NPK) conditions was carried out using Illumina platform. The assembly of transcriptome was performed, and a total of 34924, 33797, and 33698 unique transcripts for N, P, and NPK sequencing libraries were identified, respectively. We have not revealed any LIS-1 derived mRNA in our sequencing data. The analysis of high-throughput sequencing data allowed us to identify genes with potentially differential expression under imbalanced nutrition. For further investigation with qPCR, 15 genes were chosen and their expression levels were evaluated in the extended sampling of 31 flax plants. Significant expression alterations were revealed for genes encoding WRKY and JAZ protein families under P and NPK conditions. Moreover, the alterations of WRKY family genes differed depending on LIS-1 presence in flax plant genome. Besides, we revealed slight and LIS-1 independent mRNA level changes of KRP2 and ING1 genes, which are adjacent to LIS-1, under nutrition stress. Differentially expressed genes were identified in flax plants, which were grown under phosphate deficiency and excess nutrition, on the basis of high-throughput sequencing and qPCR data. We showed that WRKY and JAS gene families participate in flax response to imbalanced nutrient content in soil. Besides, we have not identified any mRNA, which could be derived from LIS-1, in our transcriptome sequencing data. Expression of LIS-1 flanking genes, ING1 and KRP2, was suggested not to be nutrient stress-induced. Obtained results provide new insights into edaphic stress response in flax and the role of LIS-1 in these process.
Flynn, A. N.; Lyndon, C. A.
2013-01-01
A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532
Gerrard, Gareth; Valgañón, Mikel; Foong, Hui En; Kasperaviciute, Dalia; Iskander, Deena; Game, Laurence; Müller, Michael; Aitman, Timothy J; Roberts, Irene; de la Fuente, Josu; Foroni, Letizia; Karadimitris, Anastasios
2013-08-01
Diamond-Blackfan anaemia (DBA) is caused by inactivating mutations in ribosomal protein (RP) genes, with mutations in 13 of the 80 RP genes accounting for 50-60% of cases. The remaining 40-50% cases may harbour mutations in one of the remaining RP genes, but the very low frequencies render conventional genetic screening as challenging. We, therefore, applied custom enrichment technology combined with high-throughput sequencing to screen all 80 RP genes. Using this approach, we identified and validated inactivating mutations in 15/17 (88%) DBA patients. Target enrichment combined with high-throughput sequencing is a robust and improved methodology for the genetic diagnosis of DBA. © 2013 John Wiley & Sons Ltd.
Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil
2009-10-23
We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.
Byers, Helen; Wallis, Yvonne; van Veen, Elke M; Lalloo, Fiona; Reay, Kim; Smith, Philip; Wallace, Andrew J; Bowers, Naomi; Newman, William G; Evans, D Gareth
2016-11-01
The sensitivity of testing BRCA1 and BRCA2 remains unresolved as the frequency of deep intronic splicing variants has not been defined in high-risk familial breast/ovarian cancer families. This variant category is reported at significant frequency in other tumour predisposition genes, including NF1 and MSH2. We carried out comprehensive whole gene RNA analysis on 45 high-risk breast/ovary and male breast cancer families with no identified pathogenic variant on exonic sequencing and copy number analysis of BRCA1/2. In addition, we undertook variant screening of a 10-gene high/moderate risk breast/ovarian cancer panel by next-generation sequencing. DNA testing identified the causative variant in 50/56 (89%) breast/ovarian/male breast cancer families with Manchester scores of ≥50 with two variants being confirmed to affect splicing on RNA analysis. RNA sequencing of BRCA1/BRCA2 on 45 individuals from high-risk families identified no deep intronic variants and did not suggest loss of RNA expression as a cause of lost sensitivity. Panel testing in 42 samples identified a known RAD51D variant, a high-risk ATM variant in another breast ovary family and a truncating CHEK2 mutation. Current exonic sequencing and copy number analysis variant detection methods of BRCA1/2 have high sensitivity in high-risk breast/ovarian cancer families. Sequence analysis of RNA does not identify any variants undetected by current analysis of BRCA1/2. However, RNA analysis clarified the pathogenicity of variants of unknown significance detected by current methods. The low diagnostic uplift achieved through sequence analysis of the other known breast/ovarian cancer susceptibility genes indicates that further high-risk genes remain to be identified.
Lim, Eileen C P; Brett, Maggie; Lai, Angeline H M; Lee, Siew-Peng; Tan, Ee-Shien; Jamuar, Saumya S; Ng, Ivy S L; Tan, Ene-Choo
2015-12-14
Next-generation sequencing (NGS) has revolutionized genetic research and offers enormous potential for clinical application. Sequencing the exome has the advantage of casting the net wide for all known coding regions while targeted gene panel sequencing provides enhanced sequencing depths and can be designed to avoid incidental findings in adult-onset conditions. A HaloPlex panel consisting of 180 genes within commonly altered chromosomal regions is available for use on both the Ion Personal Genome Machine (PGM) and MiSeq platforms to screen for causative mutations in these genes. We used this Haloplex ICCG panel for targeted sequencing of 15 patients with clinical presentations indicative of an abnormality in one of the 180 genes. Sequencing runs were done using the Ion 318 Chips on the Ion Torrent PGM. Variants were filtered for known polymorphisms and analysis was done to identify possible disease-causing variants before validation by Sanger sequencing. When possible, segregation of variants with phenotype in family members was performed to ascertain the pathogenicity of the variant. More than 97% of the target bases were covered at >20×. There was an average of 9.6 novel variants per patient. Pathogenic mutations were identified in five genes for six patients, with two novel variants. There were another five likely pathogenic variants, some of which were unreported novel variants. In a cohort of 15 patients, we were able to identify a likely genetic etiology in six patients (40%). Another five patients had candidate variants for which further evaluation and segregation analysis are ongoing. Our results indicate that the HaloPlex ICCG panel is useful as a rapid, high-throughput and cost-effective screening tool for 170 of the 180 genes. There is low coverage for some regions in several genes which might have to be supplemented by Sanger sequencing. However, comparing the cost, ease of analysis, and shorter turnaround time, it is a good alternative to exome sequencing for patients whose features are suggestive of a genetic etiology involving one of the genes in the panel.
Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang
2005-02-01
To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.
Zhang, Tingting; Hu, Shuhao; Yan, Caixia; Li, Chunjuan; Zhao, Xiaobo; Wan, Shubo; Shan, Shihua
2017-02-01
In the present investigation, a total of 60 conserved peanut (Arachis hypogaea L.) microRNA (miRNA) sequences, belonging to 16 families, were identified using bioinformatics methods. There were 392 target gene sequences, identified from 58 miRNAs with Target-align software and BLASTx analyses. Gene Ontology (GO) functional analysis suggested that these target genes were involved in mediating peanut growth and development, signal transduction and stress resistance. There were 55 miRNA sequences, verified employing a poly (A) tailing test, with a success rate of up to 91.67%. Twenty peanut target gene sequences were randomly selected, and the 5' rapid amplification of the cDNA ends (5'-RACE) method were used to validate the cleavage sites of these target genes. Of these, 14 (70%) peanut miRNA targets were verified by means of gel electrophoresis, cloning and sequencing. Furthermore, functional analysis and homologous sequence retrieval were conducted for target gene sequences, and 26 target genes were chosen as the objects for stress resistance experimental study. Real-time fluorescence quantitative PCR (qRT-PCR) technology was applied to measure the expression level of resistance-associated miRNAs and their target genes in peanut exposed to Aspergillus flavus (A. flavus) infection and drought stress, respectively. In consequence, 5 groups of miRNAs & targets were found accorded with the mode of miRNA negatively controlling the expression of target genes. This study, preliminarily determined the biological functions of some resistance-associated miRNAs and their target genes in peanut. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs.
Powell, Bradford C; Hutchison, Clyde A
2006-01-19
Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs) of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs). We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not) are attractive targets when seeking errors of gene prediction. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency). We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.
Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs
Powell, Bradford C; Hutchison, Clyde A
2006-01-01
Background Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs) of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs). We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. Results "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not) are attractive targets when seeking errors of gene predicion. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency). We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Conclusion Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes. PMID:16423288
DRS is far less divergent than streptococcal inhibitor of complement of group A streptococcus.
Sagar, Vivek; Kumar, Rajesh; Ganguly, Nirmal K; Menon, Thangam; Chakraborti, Anuradha
2007-04-01
When 100 group A streptococcus isolates were screened, drs, a variant of sic, was identified in emm12 and emm55 isolates. Molecular characterization showed that the drs gene sequence is highly conserved, unlike the sic gene sequence. However, the variation in gene size observed was due to the presence of extra internal repeat sequences.
DRS Is Far Less Divergent than Streptococcal Inhibitor of Complement of Group A Streptococcus▿
Sagar, Vivek; Kumar, Rajesh; Ganguly, Nirmal K.; Menon, Thangam; Chakraborti, Anuradha
2007-01-01
When 100 group A streptococcus isolates were screened, drs, a variant of sic, was identified in emm12 and emm55 isolates. Molecular characterization showed that the drs gene sequence is highly conserved, unlike the sic gene sequence. However, the variation in gene size observed was due to the presence of extra internal repeat sequences. PMID:17237170
Huang, Lin; Li, Guiyang; Mo, Zhaolan; Xiao, Peng; Li, Jie; Huang, Jie
2015-01-01
Background Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Asia and has suffered from disease outbreaks caused by various pathogens, which requires more information for immune relevant genes on genome background. However, genomic and transcriptomic data for Japanese flounder remain scarce, which limits studies on the immune system of this species. In this study, we characterized the Japanese flounder spleen transcriptome using an Illumina paired-end sequencing platform to identify putative genes involved in immunity. Methodology/Principal Findings A cDNA library from the spleen of P. olivaceus was constructed and randomly sequenced using an Illumina technique. The removal of low quality reads generated 12,196,968 trimmed reads, which assembled into 96,627 unigenes. A total of 21,391 unigenes (22.14%) were annotated in the NCBI Nr database, and only 1.1% of the BLASTx top-hits matched P. olivaceus protein sequences. Approximately 12,503 (58.45%) unigenes were categorized into three Gene Ontology groups, 19,547 (91.38%) were classified into 26 Cluster of Orthologous Groups, and 10,649 (49.78%) were assigned to six Kyoto Encyclopedia of Genes and Genomes pathways. Furthermore, 40,928 putative simple sequence repeats and 47, 362 putative single nucleotide polymorphisms were identified. Importantly, we identified 1,563 putative immune-associated unigenes that mapped to 15 immune signaling pathways. Conclusions/Significance The P. olivaceus transciptome data provides a rich source to discover and identify new genes, and the immune-relevant sequences identified here will facilitate our understanding of the mechanisms involved in the immune response. Furthermore, the plentiful potential SSRs and SNPs found in this study are important resources with respect to future development of a linkage map or marker assisted breeding programs for the flounder. PMID:25723398
Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism
Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang
2013-01-01
Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972
Reinprecht, Yarmilla; Yadegari, Zeinab; Perry, Gregory E.; Siddiqua, Mahbuba; Wright, Lori C.; McClean, Phillip E.; Pauls, K. Peter
2013-01-01
Legumes contain a variety of phytochemicals derived from the phenylpropanoid pathway that have important effects on human health as well as seed coat color, plant disease resistance and nodulation. However, the information about the genes involved in this important pathway is fragmentary in common bean (Phaseolus vulgaris L.). The objectives of this research were to isolate genes that function in and control the phenylpropanoid pathway in common bean, determine their genomic locations in silico in common bean and soybean, and analyze sequences of the 4CL gene family in two common bean genotypes. Sequences of phenylpropanoid pathway genes available for common bean or other plant species were aligned, and the conserved regions were used to design sequence-specific primers. The PCR products were cloned and sequenced and the gene sequences along with common bean gene-based (g) markers were BLASTed against the Glycine max v.1.0 genome and the P. vulgaris v.1.0 (Andean) early release genome. In addition, gene sequences were BLASTed against the OAC Rex (Mesoamerican) genome sequence assembly. In total, fragments of 46 structural and regulatory phenylpropanoid pathway genes were characterized in this way and placed in silico on common bean and soybean sequence maps. The maps contain over 250 common bean g and SSR (simple sequence repeat) markers and identify the positions of more than 60 additional phenylpropanoid pathway gene sequences, plus the putative locations of seed coat color genes. The majority of cloned phenylpropanoid pathway gene sequences were mapped to one location in the common bean genome but had two positions in soybean. The comparison of the genomic maps confirmed previous studies, which show that common bean and soybean share genomic regions, including those containing phenylpropanoid pathway gene sequences, with conserved synteny. Indels identified in the comparison of Andean and Mesoamerican common bean 4CL gene sequences might be used to develop inter-pool phenylpropanoid pathway gene-based markers. We anticipate that the information obtained by this study will simplify and accelerate selections of common bean with specific phenylpropanoid pathway alleles to increase the contents of beneficial phenylpropanoids in common bean and other legumes. PMID:24046770
Hafler, Brian P
2017-03-01
Inherited retinal dystrophies are a significant cause of vision loss and are characterized by the loss of photoreceptors and the retinal pigment epithelium (RPE). Mutations in approximately 250 genes cause inherited retinal degenerations with a high degree of genetic heterogeneity. New techniques in next-generation sequencing are allowing the comprehensive analysis of all retinal disease genes thus changing the approach to the molecular diagnosis of inherited retinal dystrophies. This review serves to analyze clinical progress in genetic diagnostic testing and implications for retinal gene therapy. A literature search of PubMed and OMIM was conducted to relevant articles in inherited retinal dystrophies. Next-generation genetic sequencing allows the simultaneous analysis of all the approximately 250 genes that cause inherited retinal dystrophies. Reported diagnostic rates range are high and range from 51% to 57%. These new sequencing tools are highly accurate with sensitivities of 97.9% and specificities of 100%. Retinal gene therapy clinical trials are underway for multiple genes including RPE65, ABCA4, CHM, RS1, MYO7A, CNGA3, CNGB3, ND4, and MERTK for which a molecular diagnosis may be beneficial for patients. Comprehensive next-generation genetic sequencing of all retinal dystrophy genes is changing the paradigm for how retinal specialists perform genetic testing for inherited retinal degenerations. Not only are high diagnostic yields obtained, but mutations in genes with novel clinical phenotypes are also identified. In the era of retinal gene therapy clinical trials, identifying specific genetic defects will increasingly be of use to identify patients who may enroll in clinical studies and benefit from novel therapies.
Myelin protein zero gene sequencing diagnoses Charcot-Marie-Tooth Type 1B disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Su, Y.; Zhang, H.; Madrid, R.
1994-09-01
Charcot-Marie-Tooth disease (CMT), the most common genetic neuropathy, affects about 1 in 2600 people in Norway and is found worldwide. CMT Type 1 (CMT1) has slow nerve conduction with demyelinated Schwann cells. Autosomal dominant CMT Type 1B (CMT1B) results from mutations in the myelin protein zero gene which directs the synthesis of more than half of all Schwann cell protein. This gene was mapped to the chromosome 1q22-1q23.1 borderline by fluorescence in situ hybridization. The first 7 of 7 reported CMT1B mutations are unique. Thus the most effective means to identify CMT1B mutations in at-risk family members and fetuses ismore » to sequence the entire coding sequence in dominant or sporadic CMT patients without the CMT1A duplication. Of the 19 primers used in 16 pars to uniquely amplify the entire MPZ coding sequence, 6 primer pairs were used to amplify and sequence the 6 exons. The DyeDeoxy Terminator cycle sequencing method used with four different color fluorescent lables was superior to manual sequencing because it sequences more bases unambiguously from extracted genomic DNA samples within 24 hours. This protocol was used to test 28 CMT and Dejerine-Sottas patients without CMT1A gene duplication. Sequencing MPZ gene-specific amplified fragments identified 9 polymorphic sites within the 6 exons that encode the 248 amino acid MPZ protein. The large number of major CMT1B mutations identified by single strand sequencing are being verified by reverse strand sequencing and when possible, by restriction enzyme analysis. This protocol can be used to distringuish CMT1B patients from othre CMT phenotypes and to determine the CMT1B status of relatives both presymptomatically and prenatally.« less
Bruse, Shannon; Moreau, Michael; Bromberg, Yana; Jang, Jun-Ho; Wang, Nan; Ha, Hongseok; Picchi, Maria; Lin, Yong; Langley, Raymond J; Qualls, Clifford; Klensney-Tait, Julia; Zabner, Joseph; Leng, Shuguang; Mao, Jenny; Belinsky, Steven A; Xing, Jinchuan; Nyunoya, Toru
2016-01-07
Chronic obstructive pulmonary disease (COPD) is characterized by an irreversible airflow limitation in response to inhalation of noxious stimuli, such as cigarette smoke. However, only 15-20 % smokers manifest COPD, suggesting a role for genetic predisposition. Although genome-wide association studies have identified common genetic variants that are associated with susceptibility to COPD, effect sizes of the identified variants are modest, as is the total heritability accounted for by these variants. In this study, an extreme phenotype exome sequencing study was combined with in vitro modeling to identify COPD candidate genes. We performed whole exome sequencing of 62 highly susceptible smokers and 30 exceptionally resistant smokers to identify rare variants that may contribute to disease risk or resistance to COPD. This was a cross-sectional case-control study without therapeutic intervention or longitudinal follow-up information. We identified candidate genes based on rare variant analyses and evaluated exonic variants to pinpoint individual genes whose function was computationally established to be significantly different between susceptible and resistant smokers. Top scoring candidate genes from these analyses were further filtered by requiring that each gene be expressed in human bronchial epithelial cells (HBECs). A total of 81 candidate genes were thus selected for in vitro functional testing in cigarette smoke extract (CSE)-exposed HBECs. Using small interfering RNA (siRNA)-mediated gene silencing experiments, we showed that silencing of several candidate genes augmented CSE-induced cytotoxicity in vitro. Our integrative analysis through both genetic and functional approaches identified two candidate genes (TACC2 and MYO1E) that augment cigarette smoke (CS)-induced cytotoxicity and, potentially, COPD susceptibility.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.
2003-06-01
OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less
Comparative and evolutionary studies of vertebrate ALDH1A-like genes and proteins.
Holmes, Roger S
2015-06-05
Vertebrate ALDH1A-like genes encode cytosolic enzymes capable of metabolizing all-trans-retinaldehyde to retinoic acid which is a molecular 'signal' guiding vertebrate development and adipogenesis. Bioinformatic analyses of vertebrate and invertebrate genomes were undertaken using known ALDH1A1, ALDH1A2 and ALDH1A3 amino acid sequences. Comparative analyses of the corresponding human genes provided evidence for distinct modes of gene regulation and expression with putative transcription factor binding sites (TFBS), CpG islands and micro-RNA binding sites identified for the human genes. ALDH1A-like sequences were identified for all mammalian, bird, lizard and frog genomes examined, whereas fish genomes displayed a more restricted distribution pattern for ALDH1A1 and ALDH1A3 genes. The ALDH1A1 gene was absent in many bony fish genomes examined, with the ALDH1A3 gene also absent in the medaka and tilapia genomes. Multiple ALDH1A1-like genes were identified in mouse, rat and marsupial genomes. Vertebrate ALDH1A1, ALDH1A2 and ALDH1A3 subunit sequences were highly conserved throughout vertebrate evolution. Comparative amino acid substitution rates showed that mammalian ALDH1A2 sequences were more highly conserved than for the ALDH1A1 and ALDH1A3 sequences. Phylogenetic studies supported an hypothesis for ALDH1A2 as a likely primordial gene originating in invertebrate genomes and undergoing sequential gene duplication to generate two additional genes, ALDH1A1 and ALDH1A3, in most vertebrate genomes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity
Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H.; Allen, Andrew S.; Goldstein, David B.
2015-01-01
Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene’s proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene’s regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen’s Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, ncCADD and ncGWAVA, and find both scores are significantly predictive of human dosage sensitive genes and appear to carry information beyond conservation, as assessed by ncGERP. These results highlight that the intolerance of noncoding sequence stretches in the human genome can provide a critical complementary tool to other genome annotation approaches to help identify the parts of the human genome increasingly likely to harbor mutations that influence risk of disease. PMID:26332131
Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes
2016-03-01
Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling
2012-10-01
To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.
Winterhoff, Boris J; Maile, Makayla; Mitra, Amit Kumar; Sebe, Attila; Bazzaro, Martina; Geller, Melissa A; Abrahante, Juan E; Klein, Molly; Hellweg, Raffaele; Mullany, Sally A; Beckman, Kenneth; Daniel, Jerry; Starr, Timothy K
2017-03-01
The purpose of this study was to determine the level of heterogeneity in high grade serous ovarian cancer (HGSOC) by analyzing RNA expression in single epithelial and cancer associated stromal cells. In addition, we explored the possibility of identifying subgroups based on pathway activation and pre-defined signatures from cancer stem cells and chemo-resistant cells. A fresh, HGSOC tumor specimen derived from ovary was enzymatically digested and depleted of immune infiltrating cells. RNA sequencing was performed on 92 single cells and 66 of these single cell datasets passed quality control checks. Sequences were analyzed using multiple bioinformatics tools, including clustering, principle components analysis, and geneset enrichment analysis to identify subgroups and activated pathways. Immunohistochemistry for ovarian cancer, stem cell and stromal markers was performed on adjacent tumor sections. Analysis of the gene expression patterns identified two major subsets of cells characterized by epithelial and stromal gene expression patterns. The epithelial group was characterized by proliferative genes including genes associated with oxidative phosphorylation and MYC activity, while the stromal group was characterized by increased expression of extracellular matrix (ECM) genes and genes associated with epithelial-to-mesenchymal transition (EMT). Neither group expressed a signature correlating with published chemo-resistant gene signatures, but many cells, predominantly in the stromal subgroup, expressed markers associated with cancer stem cells. Single cell sequencing provides a means of identifying subpopulations of cancer cells within a single patient. Single cell sequence analysis may prove to be critical for understanding the etiology, progression and drug resistance in ovarian cancer. Copyright © 2017 Elsevier Inc. All rights reserved.
Genomics approach to the environmental community of microorganisms
NASA Astrophysics Data System (ADS)
Kawarabayasi, Y.; Maruyama, A.
2004-12-01
It was indicated by microscopic observation or comparison of 16S rDNA sequence that many extremophiles were surviving in many hydrothermal environments. But it is generally said that over 99% of total microbes are now uncultivable. Thus, we planned to identify uncultivable microbes through direct sequencing of environmental DNA. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected from low-temperature hydrothermal water at RM24 in the Southern East Pacific Rise (S-EPR). It was shown that the sequences of some number of clones indicated the similar feature to the intron in eukaryote or tandem repetitive sequence identified in some human familiar diseases. The results indicated that many microorganisms with eukaryotic feature were dominant in low temperature water of S-EPR. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. The ORFs were easily identified all clones determined entire sequence. Thus it can be said that hot springs is good resources for searching novel genes. At last, the mixed microbes isolated from Suiyo seamount were used for construction of shotgun library. The clones in this library contained the ORFs. From some clones in hot spring and Suiyo sample, aminoacyl-tRNA synthatase, which is generally present in all organisms, was isolated by similarity. The phylogenetic analysis of aminoacyl-tRNA synthetase identified indicated that novel and unidentified microorganisms should be present in hot spring or Suiyo seamount. The novel genes identified from Suiyo seamount were also utilized for expression in E. coli. Some gene products were successfully obtained from the E. coli cells as soluble proteins. Some protein indicated the thermostability up to 70_E#8249;C, meaning that the original host cell of this gene should be stable up to the same temperature. Our work indicates that environmental genomics, including the direct cloning, sequencing of environmental DNA and expression of gene identified, is powerful approach to collect novel uncultivable microbes or novel active genes.
The Essential Genome of Escherichia coli K-12
2018-01-01
ABSTRACT Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. PMID:29463657
Antosik, Karolina; Gnyś, Piotr; Jarosz-Chobot, Przemysława; Myśliwiec, Małgorzata; Szadkowska, Agnieszka; Małecki, Maciej; Młynarski, Wojciech; Borowiec, Maciej
2017-01-01
Monogenic diabetes is a rare disease caused by single gene mutations. Maturity onset diabetes of the young (MODY) is one of the major forms of monogenic diabetes recognised in the paediatric population. To date, 13 genes have been related to MODY development. The aim of the study was to analyse the sequence of the BCL2-associated agonist of cell death (BAD) gene in patients with clinical suspicion of GCK-MODY, but who were negative for glucokinase (GCK) gene mutations. A group of 122 diabetic patients were recruited from the "Polish Registry for Paediatric and Adolescent Diabetes - nationwide genetic screening for monogenic diabetes" project. The molecular testing was performed by Sanger sequencing. A total of 10 sequence variants of the BAD gene were identified in 122 analysed diabetic patients. Among the analysed patients suspected of MODY, one possible pathogenic variant was identified in one patient; however, further confirmation is required for a certain identification.
Zhang, Quan; Zhu, Feng; Liu, Long; Zheng, Chuan Wei; Wang, De He; Hou, Zhuo Cheng; Ning, Zhong Hua
2015-01-01
Eggshell damages lead to economic losses in the egg production industry and are a threat to human health. We examined 49-wk-old Rhode Island White hens (Gallus gallus) that laid eggs having shells with significantly different strengths and thicknesses. We used HiSeq 2000 (Illumina) sequencing to characterize the chicken transcriptome and whole genome to identify the key genes and genetic mutations associated with eggshell calcification. We identified a total of 14,234 genes expressed in the chicken uterus, representing 89% of all annotated chicken genes. A total of 889 differentially expressed genes were identified by comparing low eggshell strength (LES) and normal eggshell strength (NES) genomes. The DEGs are enriched in calcification-related processes, including calcium ion transport and calcium signaling pathways as revealed by gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis. Some important matrix proteins, such as OC-116, LTF and SPP1, were also expressed differentially between two groups. A total of 3,671,919 single-nucleotide polymorphisms (SNPs) and 508,035 Indels were detected in protein coding genes by whole-genome re-sequencing, including 1775 non-synonymous variations and 19 frame-shift Indels in DEGs. SNPs and Indels found in this study could be further investigated for eggshell traits. This is the first report to integrate the transcriptome and genome re-sequencing to target the genetic variations which decreased the eggshell qualities. These findings further advance our understanding of eggshell calcification in the chicken uterus.
Liu, X Q; Xu, H; Huang, C
1993-10-01
Light-independent chlorophyll synthesis occurs in some algae, lower plants, and gymnosperms, but not in angiosperms. We have identified a new chloroplast gene, chlB, that is required for the light-independent accumulation of chlorophyll in the green alga Chlamydomonas reinhardtii. The chlB gene was cloned, sequenced, and then disrupted by performing particle gun-mediated chloroplast transformation. The resulting homoplasmic mutant was unable to accumulate chlorophyll in the dark and thus exhibited a 'yellow-in-the-dark' phenotype. The chlB gene encodes a polypeptide of 688 amino acid residues, and is distinct from two previously characterized chloroplast genes (chlN and chlL) also required for light-independent chlorophyll accumulation in C. reinhardtii. Three unidentified open reading frames in chloroplast genomes of liverwort, black pine, and Chlamydomonas moewusii were also identified as chlB genes, based on their striking sequence similarities to the C. reinhardtii chlB gene. A chlB-like gene is absent in chloroplast genomes of tobacco and rice, consistent with the lack of light-independent chlorophyll synthesis in these plants. Polypeptides encoded by the chloroplast chlB genes also show significant sequence similarities with the bchB gene product of Rhodobacter capsulatus. Comparisons among the chloroplast chlB and the bacterial bchB gene products revealed five highly conserved sequence areas that are interspersed by four stretches of highly variable and probably insertional sequences.
Johnson, Matthew G.; Gardner, Elliot M.; Liu, Yang; Medina, Rafael; Goffinet, Bernard; Shaw, A. Jonathan; Zerega, Nyree J. C.; Wickett, Norman J.
2016-01-01
Premise of the study: Using sequence data generated via target enrichment for phylogenetics requires reassembly of high-throughput sequence reads into loci, presenting a number of bioinformatics challenges. We developed HybPiper as a user-friendly platform for assembly of gene regions, extraction of exon and intron sequences, and identification of paralogous gene copies. We test HybPiper using baits designed to target 333 phylogenetic markers and 125 genes of functional significance in Artocarpus (Moraceae). Methods and Results: HybPiper implements parallel execution of sequence assembly in three phases: read mapping, contig assembly, and target sequence extraction. The pipeline was able to recover nearly complete gene sequences for all genes in 22 species of Artocarpus. HybPiper also recovered more than 500 bp of nontargeted intron sequence in over half of the phylogenetic markers and identified paralogous gene copies in Artocarpus. Conclusions: HybPiper was designed for Linux and Mac OS X and is freely available at https://github.com/mossmatters/HybPiper. PMID:27437175
Diehn, Till A.; Pommerrenig, Benjamin; Bernhardt, Nadine; Hartmann, Anja; Bienert, Gerd P.
2015-01-01
Aquaporins (AQPs) are essential channel proteins that regulate plant water homeostasis and the uptake and distribution of uncharged solutes such as metalloids, urea, ammonia, and carbon dioxide. Despite their importance as crop plants, little is known about AQP gene and protein function in cabbage (Brassica oleracea) and other Brassica species. The recent releases of the genome sequences of B. oleracea and Brassica rapa allow comparative genomic studies in these species to investigate the evolution and features of Brassica genes and proteins. In this study, we identified all AQP genes in B. oleracea by a genome-wide survey. In total, 67 genes of four plant AQP subfamilies were identified. Their full-length gene sequences and locations on chromosomes and scaffolds were manually curated. The identification of six additional full-length AQP sequences in the B. rapa genome added to the recently published AQP protein family of this species. A phylogenetic analysis of AQPs of Arabidopsis thaliana, B. oleracea, B. rapa allowed us to follow AQP evolution in closely related species and to systematically classify and (re-) name these isoforms. Thirty-three groups of AQP-orthologous genes were identified between B. oleracea and Arabidopsis and their expression was analyzed in different organs. The two selectivity filters, gene structure and coding sequences were highly conserved within each AQP subfamily while sequence variations in some introns and untranslated regions were frequent. These data suggest a similar substrate selectivity and function of Brassica AQPs compared to Arabidopsis orthologs. The comparative analyses of all AQP subfamilies in three Brassicaceae species give initial insights into AQP evolution in these taxa. Based on the genome-wide AQP identification in B. oleracea and the sequence analysis and reprocessing of Brassica AQP information, our dataset provides a sequence resource for further investigations of the physiological and molecular functions of Brassica crop AQPs. PMID:25904922
Xu, Yuantao; Wu, Guizhi; Hao, Baohai; Chen, Lingling; Deng, Xiuxin; Xu, Qiang
2015-11-23
With the availability of rapidly increasing number of genome and transcriptome sequences, lineage-specific genes (LSGs) can be identified and characterized. Like other conserved functional genes, LSGs play important roles in biological evolution and functions. Two set of citrus LSGs, 296 citrus-specific genes (CSGs) and 1039 orphan genes specific to sweet orange, were identified by comparative analysis between the sweet orange genome sequences and 41 genomes and 273 transcriptomes. With the two sets of genes, gene structure and gene expression pattern were investigated. On average, both the CSGs and orphan genes have fewer exons, shorter gene length and higher GC content when compared with those evolutionarily conserved genes (ECs). Expression profiling indicated that most of the LSGs expressed in various tissues of sweet orange and some of them exhibited distinct temporal and spatial expression patterns. Particularly, the orphan genes were preferentially expressed in callus, which is an important pluripotent tissue of citrus. Besides, part of the CSGs and orphan genes expressed responsive to abiotic stress, indicating their potential functions during interaction with environment. This study identified and characterized two sets of LSGs in citrus, dissected their sequence features and expression patterns, and provided valuable clues for future functional analysis of the LSGs in sweet orange.
Warburton, Marilyn L; Williams, William Paul; Hawkins, Leigh; Bridges, Susan; Gresham, Cathy; Harper, Jonathan; Ozkan, Seval; Mylroie, J Erik; Shan, Xueyan
2011-07-01
A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL) mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel) and SNP genotyping in the population(s) for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.
Personalized genomic analyses for cancer mutation discovery and interpretation
Jones, Siân; Anagnostou, Valsamo; Lytle, Karli; Parpart-Li, Sonya; Nesselbush, Monica; Riley, David R.; Shukla, Manish; Chesnick, Bryan; Kadan, Maura; Papp, Eniko; Galens, Kevin G.; Murphy, Derek; Zhang, Theresa; Kann, Lisa; Sausen, Mark; Angiuoli, Samuel V.; Diaz, Luis A.; Velculescu, Victor E.
2015-01-01
Massively parallel sequencing approaches are beginning to be used clinically to characterize individual patient tumors and to select therapies based on the identified mutations. A major question in these analyses is the extent to which these methods identify clinically actionable alterations and whether the examination of the tumor tissue alone is sufficient or whether matched normal DNA should also be analyzed to accurately identify tumor-specific (somatic) alterations. To address these issues, we comprehensively evaluated 815 tumor-normal paired samples from patients of 15 tumor types. We identified genomic alterations using next-generation sequencing of whole exomes or 111 targeted genes that were validated with sensitivities >95% and >99%, respectively, and specificities >99.99%. These analyses revealed an average of 140 and 4.3 somatic mutations per exome and targeted analysis, respectively. More than 75% of cases had somatic alterations in genes associated with known therapies or current clinical trials. Analyses of matched normal DNA identified germline alterations in cancer-predisposing genes in 3% of patients with apparently sporadic cancers. In contrast, a tumor-only sequencing approach could not definitively identify germline changes in cancer-predisposing genes and led to additional false-positive findings comprising 31% and 65% of alterations identified in targeted and exome analyses, respectively, including in potentially actionable genes. These data suggest that matched tumor-normal sequencing analyses are essential for precise identification and interpretation of somatic and germline alterations and have important implications for the diagnostic and therapeutic management of cancer patients. PMID:25877891
Goettel, Wolfgang; Xia, Eric; Upchurch, Robert; Wang, Ming-Li; Chen, Pengyin; An, Yong-Qiang Charles
2014-04-23
Variation in seed oil composition and content among soybean varieties is largely attributed to differences in transcript sequences and/or transcript accumulation of oil production related genes in seeds. Discovery and analysis of sequence and expression variations in these genes will accelerate soybean oil quality improvement. In an effort to identify these variations, we sequenced the transcriptomes of soybean seeds from nine lines varying in oil composition and/or total oil content. Our results showed that 69,338 distinct transcripts from 32,885 annotated genes were expressed in seeds. A total of 8,037 transcript expression polymorphisms and 50,485 transcript sequence polymorphisms (48,792 SNPs and 1,693 small Indels) were identified among the lines. Effects of the transcript polymorphisms on their encoded protein sequences and functions were predicted. The studies also provided independent evidence that the lack of FAD2-1A gene activity and a non-synonymous SNP in the coding sequence of FAB2C caused elevated oleic acid and stearic acid levels in soybean lines M23 and FAM94-41, respectively. As a proof-of-concept, we developed an integrated RNA-seq and bioinformatics approach to identify and functionally annotate transcript polymorphisms, and demonstrated its high effectiveness for discovery of genetic and transcript variations that result in altered oil quality traits. The collection of transcript polymorphisms coupled with their predicted functional effects will be a valuable asset for further discovery of genes, gene variants, and functional markers to improve soybean oil quality.
Exploiting proteomic data for genome annotation and gene model validation in Aspergillus niger
Wright, James C; Sugden, Deana; Francis-McIntyre, Sue; Riba-Garcia, Isabel; Gaskell, Simon J; Grigoriev, Igor V; Baker, Scott E; Beynon, Robert J; Hubbard, Simon J
2009-01-01
Background Proteomic data is a potentially rich, but arguably unexploited, data source for genome annotation. Peptide identifications from tandem mass spectrometry provide prima facie evidence for gene predictions and can discriminate over a set of candidate gene models. Here we apply this to the recently sequenced Aspergillus niger fungal genome from the Joint Genome Institutes (JGI) and another predicted protein set from another A.niger sequence. Tandem mass spectra (MS/MS) were acquired from 1d gel electrophoresis bands and searched against all available gene models using Average Peptide Scoring (APS) and reverse database searching to produce confident identifications at an acceptable false discovery rate (FDR). Results 405 identified peptide sequences were mapped to 214 different A.niger genomic loci to which 4093 predicted gene models clustered, 2872 of which contained the mapped peptides. Interestingly, 13 (6%) of these loci either had no preferred predicted gene model or the genome annotators' chosen "best" model for that genomic locus was not found to be the most parsimonious match to the identified peptides. The peptides identified also boosted confidence in predicted gene structures spanning 54 introns from different gene models. Conclusion This work highlights the potential of integrating experimental proteomics data into genomic annotation pipelines much as expressed sequence tag (EST) data has been. A comparison of the published genome from another strain of A.niger sequenced by DSM showed that a number of the gene models or proteins with proteomics evidence did not occur in both genomes, further highlighting the utility of the method. PMID:19193216
Hayes, C; Rump, A; Cadman, M R; Harrison, M; Evans, E P; Lyon, M F; Morriss-Kay, G M; Rosenthal, A; Brown, S D
2001-12-01
The mouse doublefoot (Dbf) mutant exhibits preaxial polydactyly in association with craniofacial defects. This mutation has previously been mapped to mouse chromosome 1. We have used a positional cloning strategy, coupled with a comparative sequencing approach using available human draft sequence, to identify putative candidates for the Dbf gene in the mouse and in homologous human region. We have constructed a high-resolution genetic map of the region, localizing the mutation to a 0.4-cM (+/-0.0061) interval on mouse chromosome 1. Furthermore, we have constructed contiguous BAC/PAC clone maps across the mouse and human Dbf region. Using existing markers and additional sequence tagged sites, which we have generated, we have anchored the physical map to the genetic map. Through the comparative sequencing of these clones we have identified 35 genes within this interval, indicating that the region is gene-rich. From this we have identified several genes that are known to be differentially expressed in the developing mid-gestation mouse embryo, some in the developing embryonic limb buds. These genes include those encoding known developmental signaling molecules such as WNT proteins and IHH, and we provide evidence that these genes are candidates for the Dbf mutation.
Evolutionary trajectory of Pack-MULEs is determined by their epigenetic status
USDA-ARS?s Scientific Manuscript database
Acquisition and rearrangement of host genes by transposable elements is one mechanism to increase gene diversity. The rice genome is replete in such sequences and while ~3,000 Pack- Mutator-like transposable elements containing gene sequences (Pack-MULEs) have been identified, their function remains...
Whole-exome sequencing identifies USH2A mutations in a pseudo-dominant Usher syndrome family.
Zheng, Sui-Lian; Zhang, Hong-Liang; Lin, Zhen-Lang; Kang, Qian-Yan
2015-10-01
Usher syndrome (USH) is an autosomal recessive (AR) multi-sensory degenerative disorder leading to deaf-blindness. USH is clinically subdivided into three subclasses, and 10 genes have been identified thus far. Clinical and genetic heterogeneities in USH make a precise diagnosis difficult. A dominant‑like USH family in successive generations was identified, and the present study aimed to determine the genetic predisposition of this family. Whole‑exome sequencing was performed in two affected patients and an unaffected relative. Systematic data were analyzed by bioinformatic analysis to remove the candidate mutations via step‑wise filtering. Direct Sanger sequencing and co‑segregation analysis were performed in the pedigree. One novel and two known mutations in the USH2A gene were identified, and were further confirmed by direct sequencing and co‑segregation analysis. The affected mother carried compound mutations in the USH2A gene, while the unaffected father carried a heterozygous mutation. The present study demonstrates that whole‑exome sequencing is a robust approach for the molecular diagnosis of disorders with high levels of genetic heterogeneity.
In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library
Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul
2005-01-01
The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642
Gene Unprediction with Spurio: A tool to identify spurious protein sequences.
Höps, Wolfram; Jeffryes, Matt; Bateman, Alex
2018-01-01
We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation. Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases. We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes. Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Fonseca, Dora Janeth; Patiño, Liliana Catherine; Suárez, Yohjana Carolina; de Jesús Rodríguez, Asid; Mateus, Heidi Eliana; Jiménez, Karen Marcela; Ortega-Recalde, Oscar; Díaz-Yamal, Ivonne; Laissue, Paul
2015-07-01
To identify new molecular actors involved in nonsyndromic premature ovarian failure (POF) etiology. This is a retrospective case-control cohort study. University research group and IVF medical center. Twelve women affected by nonsyndromic POF. The control group included 176 women whose menopause had occurred after age 50 and had no antecedents regarding gynecological disease. A further 345 women from the same ethnic origin (general population group) were also recruited to assess allele frequency for potentially deleterious sequence variants. Next generation sequencing (NGS), Sanger sequencing, and bioinformatics analysis. The complete coding regions of 70 candidate genes were massively sequenced, via NGS, in POF patients. Bioinformatics and genetics were used to confirm NGS results and to identify potential sequence variants related to the disease pathogenesis. We have identified mutations in two novel genes, ADAMTS19 and BMPR2, that are potentially related to POF origin. LHCGR mutations, which might have contributed to the phenotype, were also detected. We thus recommend NGS as a powerful tool for identifying new molecular actors in POF and for future diagnostic/prognostic purposes. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
2013-01-01
Background The narrow-leafed lupin, Lupinus angustifolius L., is a grain legume species with a relatively compact genome. The species has 2n = 40 chromosomes and its genome size is 960 Mbp/1C. During the last decade, L. angustifolius genomic studies have achieved several milestones, such as molecular-marker development, linkage maps, and bacterial artificial chromosome (BAC) libraries. Here, these resources were integratively used to identify and sequence two gene-rich regions (GRRs) of the genome. Results The genome was screened with a probe representing the sequence of a microsatellite fragment length polymorphism (MFLP) marker linked to Phomopsis stem blight resistance. BAC clones selected by hybridization were subjected to restriction fingerprinting and contig assembly, and 232 BAC-ends were sequenced and annotated. BAC fluorescence in situ hybridization (BAC-FISH) identified eight single-locus clones. Based on physical mapping, cytogenetic localization, and BAC-end annotation, five clones were chosen for sequencing. Within the sequences of clones that hybridized in FISH to a single-locus, two large GRRs were identified. The GRRs showed strong and conserved synteny to Glycine max duplicated genome regions, illustrated by both identical gene order and parallel orientation. In contrast, in the clones with dispersed FISH signals, more than one-third of sequences were transposable elements. Sequenced, single-locus clones were used to develop 12 genetic markers, increasing the number of L. angustifolius chromosomes linked to appropriate linkage groups by five pairs. Conclusions In general, probes originating from MFLP sequences can assist genome screening and gene discovery. However, such probes are not useful for positional cloning, because they tend to hybridize to numerous loci. GRRs identified in L. angustifolius contained a low number of interspersed repeats and had a high level of synteny to the genome of the model legume G. max. Our results showed that not only was the gene nucleotide sequence conserved between soybean and lupin GRRs, but the order and orientation of particular genes in syntenic blocks was homologous, as well. These findings will be valuable to the forthcoming sequencing of the lupin genome. PMID:23379841
Friedenberg, Steven G; Chdid, Lhoucine; Keene, Bruce; Sherry, Barbara; Motsinger-Reif, Alison; Meurs, Kathryn M
2016-07-01
OBJECTIVE To identify cardiac tissue genes and gene pathways differentially expressed between dogs with and without dilated cardiomyopathy (DCM). ANIMALS 8 dogs with and 5 dogs without DCM. PROCEDURES Following euthanasia, samples of left ventricular myocardium were collected from each dog. Total RNA was extracted from tissue samples, and RNA sequencing was performed on each sample. Samples from dogs with and without DCM were grouped to identify genes that were differentially regulated between the 2 populations. Overrepresentation analysis was performed on upregulated and downregulated gene sets to identify altered molecular pathways in dogs with DCM. RESULTS Genes involved in cellular energy metabolism, especially metabolism of carbohydrates and fats, were significantly downregulated in dogs with DCM. Expression of cardiac structural proteins was also altered in affected dogs. CONCLUSIONS AND CLINICAL RELEVANCE Results suggested that RNA sequencing may provide important insights into the pathogenesis of DCM in dogs and highlight pathways that should be explored to identify causative mutations and develop novel therapeutic interventions.
Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys
Berry, David; Gutierrez, Tony
2017-01-01
Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035
Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.
Berry, David; Gutierrez, Tony
2017-01-01
Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.
Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene
USDA-ARS?s Scientific Manuscript database
This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...
O'Rourke, Jamie A; Fu, Fengli; Bucciarelli, Bruna; Yang, S Sam; Samac, Deborah A; Lamb, JoAnn F S; Monteros, Maria J; Graham, Michelle A; Gronwald, John W; Krom, Nick; Li, Jun; Dai, Xinbin; Zhao, Patrick X; Vance, Carroll P
2015-07-07
Alfalfa (Medicago sativa L.) is the primary forage legume crop species in the United States and plays essential economic and ecological roles in agricultural systems across the country. Modern alfalfa is the result of hybridization between tetraploid M. sativa ssp. sativa and M. sativa ssp. falcata. Due to its large and complex genome, there are few genomic resources available for alfalfa improvement. A de novo transcriptome assembly from two alfalfa subspecies, M. sativa ssp. sativa (B47) and M. sativa ssp. falcata (F56) was developed using Illumina RNA-seq technology. Transcripts from roots, nitrogen-fixing root nodules, leaves, flowers, elongating stem internodes, and post-elongation stem internodes were assembled into the Medicago sativa Gene Index 1.2 (MSGI 1.2) representing 112,626 unique transcript sequences. Nodule-specific and transcripts involved in cell wall biosynthesis were identified. Statistical analyses identified 20,447 transcripts differentially expressed between the two subspecies. Pair-wise comparisons of each tissue combination identified 58,932 sequences differentially expressed in B47 and 69,143 sequences differentially expressed in F56. Comparing transcript abundance in floral tissues of B47 and F56 identified expression differences in sequences involved in anthocyanin and carotenoid synthesis, which determine flower pigmentation. Single nucleotide polymorphisms (SNPs) unique to each M. sativa subspecies (110,241) were identified. The Medicago sativa Gene Index 1.2 increases the expressed sequence data available for alfalfa by ninefold and can be expanded as additional experiments are performed. The MSGI 1.2 transcriptome sequences, annotations, expression profiles, and SNPs were assembled into the Alfalfa Gene Index and Expression Database (AGED) at http://plantgrn.noble.org/AGED/ , a publicly available genomic resource for alfalfa improvement and legume research.
Gene discovery using next-generation pyrosequencing to develop ESTs for Phalaenopsis orchids
2011-01-01
Background Orchids are one of the most diversified angiosperms, but few genomic resources are available for these non-model plants. In addition to the ecological significance, Phalaenopsis has been considered as an economically important floriculture industry worldwide. We aimed to use massively parallel 454 pyrosequencing for a global characterization of the Phalaenopsis transcriptome. Results To maximize sequence diversity, we pooled RNA from 10 samples of different tissues, various developmental stages, and biotic- or abiotic-stressed plants. We obtained 206,960 expressed sequence tags (ESTs) with an average read length of 228 bp. These reads were assembled into 8,233 contigs and 34,630 singletons. The unigenes were searched against the NCBI non-redundant (NR) protein database. Based on sequence similarity with known proteins, these analyses identified 22,234 different genes (E-value cutoff, e-7). Assembled sequences were annotated with Gene Ontology, Gene Family and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. Among these annotations, over 780 unigenes encoding putative transcription factors were identified. Conclusion Pyrosequencing was effective in identifying a large set of unigenes from Phalaenopsis. The informative EST dataset we developed constitutes a much-needed resource for discovery of genes involved in various biological processes in Phalaenopsis and other orchid species. These transcribed sequences will narrow the gap between study of model organisms with many genomic resources and species that are important for ecological and evolutionary studies. PMID:21749684
Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici
McDonald, Megan C.; McGinness, Lachlan; Hane, James K.; Williams, Angela H.; Milgate, Andrew; Solomon, Peter S.
2016-01-01
Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene. PMID:26837952
Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P
2007-08-01
To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.
2011-01-01
Background Alfalfa, [Medicago sativa (L.) sativa], a widely-grown perennial forage has potential for development as a cellulosic ethanol feedstock. However, the genomics of alfalfa, a non-model species, is still in its infancy. The recent advent of RNA-Seq, a massively parallel sequencing method for transcriptome analysis, provides an opportunity to expand the identification of alfalfa genes and polymorphisms, and conduct in-depth transcript profiling. Results Cell walls in stems of alfalfa genotype 708 have higher cellulose and lower lignin concentrations compared to cell walls in stems of genotype 773. Using the Illumina GA-II platform, a total of 198,861,304 expression sequence tags (ESTs, 76 bp in length) were generated from cDNA libraries derived from elongating stem (ES) and post-elongation stem (PES) internodes of 708 and 773. In addition, 341,984 ESTs were generated from ES and PES internodes of genotype 773 using the GS FLX Titanium platform. The first alfalfa (Medicago sativa) gene index (MSGI 1.0) was assembled using the Sanger ESTs available from GenBank, the GS FLX Titanium EST sequences, and the de novo assembled Illumina sequences. MSGI 1.0 contains 124,025 unique sequences including 22,729 tentative consensus sequences (TCs), 22,315 singletons and 78,981 pseudo-singletons. We identified a total of 1,294 simple sequence repeats (SSR) among the sequences in MSGI 1.0. In addition, a total of 10,826 single nucleotide polymorphisms (SNPs) were predicted between the two genotypes. Out of 55 SNPs randomly selected for experimental validation, 47 (85%) were polymorphic between the two genotypes. We also identified numerous allelic variations within each genotype. Digital gene expression analysis identified numerous candidate genes that may play a role in stem development as well as candidate genes that may contribute to the differences in cell wall composition in stems of the two genotypes. Conclusions Our results demonstrate that RNA-Seq can be successfully used for gene identification, polymorphism detection and transcript profiling in alfalfa, a non-model, allogamous, autotetraploid species. The alfalfa gene index assembled in this study, and the SNPs, SSRs and candidate genes identified can be used to improve alfalfa as a forage crop and cellulosic feedstock. PMID:21504589
Kim, Daniel Seung; Burt, Amber A; Ranchalis, Jane E; Wilmot, Beth; Smith, Joshua D; Patterson, Karynne E; Coe, Bradley P; Li, Yatong K; Bamshad, Michael J; Nikolas, Molly; Eichler, Evan E; Swanson, James M; Nigg, Joel T; Nickerson, Deborah A; Jarvik, Gail P
2017-06-01
Attention-Deficit Hyperactivity Disorder (ADHD) has high heritability; however, studies of common variation account for <5% of ADHD variance. Using data from affected participants without a family history of ADHD, we sought to identify de novo variants that could account for sporadic ADHD. Considering a total of 128 families, two analyses were conducted in parallel: first, in 11 unaffected parent/affected proband trios (or quads with the addition of an unaffected sibling) we completed exome sequencing. Six de novo missense variants at highly conserved bases were identified and validated from four of the 11 families: the brain-expressed genes TBC1D9, DAGLA, QARS, CSMD2, TRPM2, and WDR83. Separately, in 117 unrelated probands with sporadic ADHD, we sequenced a panel of 26 genes implicated in intellectual disability (ID) and autism spectrum disorder (ASD) to evaluate whether variation in ASD/ID-associated genes were also present in participants with ADHD. Only one putative deleterious variant (Gln600STOP) in CHD1L was identified; this was found in a single proband. Notably, no other nonsense, splice, frameshift, or highly conserved missense variants in the 26 gene panel were identified and validated. These data suggest that de novo variant analysis in families with independently adjudicated sporadic ADHD diagnosis can identify novel genes implicated in ADHD pathogenesis. Moreover, that only one of the 128 cases (0.8%, 11 exome, and 117 MIP sequenced participants) had putative deleterious variants within our data in 26 genes related to ID and ASD suggests significant independence in the genetic pathogenesis of ADHD as compared to ASD and ID phenotypes. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon
2013-01-01
Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044
Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Kadoo, Narendra Y; Gupta, Vidya S
2012-05-08
The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that seven UGTs were flax diverged. Flax has a large number of UGT genes including few flax diverged ones. Phylogenetic analysis and expression profiles of these genes identified tissue and condition specific repertoire of UGT genes from this crop. This study would facilitate precise selection of candidate genes and their further characterization of substrate specificities and in planta functions.
2012-01-01
Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that seven UGTs were flax diverged. Conclusions Flax has a large number of UGT genes including few flax diverged ones. Phylogenetic analysis and expression profiles of these genes identified tissue and condition specific repertoire of UGT genes from this crop. This study would facilitate precise selection of candidate genes and their further characterization of substrate specificities and in planta functions. PMID:22568875
Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors
Bii, Victor M.; Trobridge, Grant D.
2016-01-01
Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127
HAFLER, BRIAN P.
2017-01-01
Purpose Inherited retinal dystrophies are a significant cause of vision loss and are characterized by the loss of photoreceptors and the retinal pigment epithelium (RPE). Mutations in approximately 250 genes cause inherited retinal degenerations with a high degree of genetic heterogeneity. New techniques in next-generation sequencing are allowing the comprehensive analysis of all retinal disease genes thus changing the approach to the molecular diagnosis of inherited retinal dystrophies. This review serves to analyze clinical progress in genetic diagnostic testing and implications for retinal gene therapy. Methods A literature search of PubMed and OMIM was conducted to relevant articles in inherited retinal dystrophies. Results Next-generation genetic sequencing allows the simultaneous analysis of all the approximately 250 genes that cause inherited retinal dystrophies. Reported diagnostic rates range are high and range from 51% to 57%. These new sequencing tools are highly accurate with sensitivities of 97.9% and specificities of 100%. Retinal gene therapy clinical trials are underway for multiple genes including RPE65, ABCA4, CHM, RS1, MYO7A, CNGA3, CNGB3, ND4, and MERTK for which a molecular diagnosis may be beneficial for patients. Conclusion Comprehensive next-generation genetic sequencing of all retinal dystrophy genes is changing the paradigm for how retinal specialists perform genetic testing for inherited retinal degenerations. Not only are high diagnostic yields obtained, but mutations in genes with novel clinical phenotypes are also identified. In the era of retinal gene therapy clinical trials, identifying specific genetic defects will increasingly be of use to identify patients who may enroll in clinical studies and benefit from novel therapies. PMID:27753762
2011-01-01
Background Parasitoid insects manipulate their hosts' physiology by injecting various factors into their host upon parasitization. Transcriptomic approaches provide a powerful approach to study insect host-parasitoid interactions at the molecular level. In order to investigate the effects of parasitization by an ichneumonid wasp (Diadegma semiclausum) on the host (Plutella xylostella), the larval transcriptome profile was analyzed using a short-read deep sequencing method (Illumina). Symbiotic polydnaviruses (PDVs) associated with ichneumonid parasitoids, known as ichnoviruses, play significant roles in host immune suppression and developmental regulation. In the current study, D. semiclausum ichnovirus (DsIV) genes expressed in P. xylostella were identified and their sequences compared with other reported PDVs. Five of these genes encode proteins of unknown identity, that have not previously been reported. Results De novo assembly of cDNA sequence data generated 172,660 contigs between 100 and 10000 bp in length; with 35% of > 200 bp in length. Parasitization had significant impacts on expression levels of 928 identified insect host transcripts. Gene ontology data illustrated that the majority of the differentially expressed genes are involved in binding, catalytic activity, and metabolic and cellular processes. In addition, the results show that transcription levels of antimicrobial peptides, such as gloverin, cecropin E and lysozyme, were up-regulated after parasitism. Expression of ichnovirus genes were detected in parasitized larvae with 19 unique sequences identified from five PDV gene families including vankyrin, viral innexin, repeat elements, a cysteine-rich motif, and polar residue rich protein. Vankyrin 1 and repeat element 1 genes showed the highest transcription levels among the DsIV genes. Conclusion This study provides detailed information on differential expression of P. xylostella larval genes following parasitization, DsIV genes expressed in the host and also improves our current understanding of this host-parasitoid interaction. PMID:21906285
van der Ley, P
1988-11-01
Gonococci express a family of related outer membrane proteins designated protein II (P.II). These surface proteins are subject to both phase variation and antigenic variation. The P.II gene repertoire of Neisseria gonorrhoeae strain JS3 was found to consist of at least ten genes, eight of which were cloned. Sequence analysis and DNA hybridization studies revealed that one particular P.II-encoding sequence is present in three distinct, but almost identical, copies in the JS3 genome. These genes encode the P.II protein that was previously identified as P.IIc. Comparison of their sequences shows that the multiple copies of this P.IIc-encoding gene might have been generated by both gene conversion and gene duplication.
Internal control regions for transcription of eukaryotic tRNA genes.
Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D
1981-01-01
We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Common Viral Integration Sites Identified in Avian Leukosis Virus-Induced B-Cell Lymphomas
Justice, James F.; Morgan, Robin W.
2015-01-01
ABSTRACT Avian leukosis virus (ALV) induces B-cell lymphoma and other neoplasms in chickens by integrating within or near cancer genes and perturbing their expression. Four genes—MYC, MYB, Mir-155, and TERT—have previously been identified as common integration sites in these virus-induced lymphomas and are thought to play a causal role in tumorigenesis. In this study, we employ high-throughput sequencing to identify additional genes driving tumorigenesis in ALV-induced B-cell lymphomas. In addition to the four genes implicated previously, we identify other genes as common integration sites, including TNFRSF1A, MEF2C, CTDSPL, TAB2, RUNX1, MLL5, CXorf57, and BACH2. We also analyze the genome-wide ALV integration landscape in vivo and find increased frequency of ALV integration near transcriptional start sites and within transcripts. Previous work has shown ALV prefers a weak consensus sequence for integration in cultured human cells. We confirm this consensus sequence for ALV integration in vivo in the chicken genome. PMID:26670384
Molecular defects identified by whole exome sequencing in a child with Fanconi anemia.
Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua
2013-11-10
Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.
Tanase, Koji; Nishitani, Chikako; Hirakawa, Hideki; Isobe, Sachiko; Tabata, Satoshi; Ohmiya, Akemi; Onozaki, Takashi
2012-07-02
Carnation (Dianthus caryophyllus L.), in the family Caryophyllaceae, can be found in a wide range of colors and is a model system for studies of flower senescence. In addition, it is one of the most important flowers in the global floriculture industry. However, few genomics resources, such as sequences and markers are available for carnation or other members of the Caryophyllaceae. To increase our understanding of the genetic control of important characters in carnation, we generated an expressed sequence tag (EST) database for a carnation cultivar important in horticulture by high-throughput sequencing using 454 pyrosequencing technology. We constructed a normalized cDNA library and a 3'-UTR library of carnation, obtaining a total of 1,162,126 high-quality reads. These reads were assembled into 300,740 unigenes consisting of 37,844 contigs and 262,896 singlets. The contigs were searched against an Arabidopsis sequence database, and 61.8% (23,380) of them had at least one BLASTX hit. These contigs were also annotated with Gene Ontology (GO) and were found to cover a broad range of GO categories. Furthermore, we identified 17,362 potential simple sequence repeats (SSRs) in 14,291 of the unigenes. We focused on gene discovery in the areas of flower color and ethylene biosynthesis. Transcripts were identified for almost every gene involved in flower chlorophyll and carotenoid metabolism and in anthocyanin biosynthesis. Transcripts were also identified for every step in the ethylene biosynthesis pathway. We present the first large-scale sequence data set for carnation, generated using next-generation sequencing technology. The large EST database generated from these sequences is an informative resource for identifying genes involved in various biological processes in carnation and provides an EST resource for understanding the genetic diversity of this plant.
2012-01-01
Background Carnation (Dianthus caryophyllus L.), in the family Caryophyllaceae, can be found in a wide range of colors and is a model system for studies of flower senescence. In addition, it is one of the most important flowers in the global floriculture industry. However, few genomics resources, such as sequences and markers are available for carnation or other members of the Caryophyllaceae. To increase our understanding of the genetic control of important characters in carnation, we generated an expressed sequence tag (EST) database for a carnation cultivar important in horticulture by high-throughput sequencing using 454 pyrosequencing technology. Results We constructed a normalized cDNA library and a 3’-UTR library of carnation, obtaining a total of 1,162,126 high-quality reads. These reads were assembled into 300,740 unigenes consisting of 37,844 contigs and 262,896 singlets. The contigs were searched against an Arabidopsis sequence database, and 61.8% (23,380) of them had at least one BLASTX hit. These contigs were also annotated with Gene Ontology (GO) and were found to cover a broad range of GO categories. Furthermore, we identified 17,362 potential simple sequence repeats (SSRs) in 14,291 of the unigenes. We focused on gene discovery in the areas of flower color and ethylene biosynthesis. Transcripts were identified for almost every gene involved in flower chlorophyll and carotenoid metabolism and in anthocyanin biosynthesis. Transcripts were also identified for every step in the ethylene biosynthesis pathway. Conclusions We present the first large-scale sequence data set for carnation, generated using next-generation sequencing technology. The large EST database generated from these sequences is an informative resource for identifying genes involved in various biological processes in carnation and provides an EST resource for understanding the genetic diversity of this plant. PMID:22747974
Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J
2005-01-01
Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-01-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404
Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y
2004-05-01
Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.
The GENCODE exome: sequencing the complete human exome
Coffey, Alison J; Kokocinski, Felix; Calafato, Maria S; Scott, Carol E; Palta, Priit; Drury, Eleanor; Joyce, Christopher J; LeProust, Emily M; Harrow, Jen; Hunt, Sarah; Lehesjoki, Anna-Elina; Turner, Daniel J; Hubbard, Tim J; Palotie, Aarno
2011-01-01
Sequencing the coding regions, the exome, of the human genome is one of the major current strategies to identify low frequency and rare variants associated with human disease traits. So far, the most widely used commercial exome capture reagents have mainly targeted the consensus coding sequence (CCDS) database. We report the design of an extended set of targets for capturing the complete human exome, based on annotation from the GENCODE consortium. The extended set covers an additional 5594 genes and 10.3 Mb compared with the current CCDS-based sets. The additional regions include potential disease genes previously inaccessible to exome resequencing studies, such as 43 genes linked to ion channel activity and 70 genes linked to protein kinase activity. In total, the new GENCODE exome set developed here covers 47.9 Mb and performed well in sequence capture experiments. In the sample set used in this study, we identified over 5000 SNP variants more in the GENCODE exome target (24%) than in the CCDS-based exome sequencing. PMID:21364695
Zhang, Shanshan; Li, Jie; Li, Shujin; Yang, Yeming; Yang, Mu; Yang, Zhenglin; Zhu, Xianjun; Zhang, Lin
2018-04-25
Retinitis pigmentosa (RP) is a genetically heterogeneous disease with over 70 causative genes identified to date. However, approximately 40% of RP cases remain genetically unsolved, suggesting that many novel disease-causing mutations are yet to be identified. The purpose of this study is to identify the causative mutations of a Chinese RP family. Targeted next-generation sequencing (NGS) for a total of 163 genes which involved in inherited retinal disorders were used to screen the possible causative mutations. Sanger sequencing was used to verify the mutations. As results, we identified two heterozygous mutations: a splicing site mutation c.1407 + 1G>C and a nonsense mutation c. 1957C>T (p.R653X) in phosphodiesterase 6A (PDE6A) gene in the RP patient. These two mutations are inherited from his father and mother, respectively. Furthermore, these mutations are unique in our in-house database and are rare in human genome databases, implicating that these two mutations are pathological. By using targeted NGS method, we identified a compound heterozygous mutation in PDE6A gene that is associated with RP in a Chinese family.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
NASA Astrophysics Data System (ADS)
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Kornthong, Napamanee; Cummins, Scott F; Chotwiwatthanakun, Charoonroj; Khornchatri, Kanjana; Engsusophon, Attakorn; Hanna, Peter J; Sobhon, Prasert
2014-01-01
The central nervous system (CNS) is often intimately involved in reproduction control and is therefore a target organ for transcriptomic investigations to identify reproduction-associated genes. In this study, 454 transcriptome sequencing was performed on pooled brain and ventral nerve cord of the female mud crab (Scylla olivacea) following serotonin injection (5 µg/g BW). A total of 197,468 sequence reads was obtained with an average length of 828 bp. Approximately 38.7% of 2,183 isotigs matched with significant similarity (E value < 1e-4) to sequences within the Genbank non-redundant (nr) database, with most significant matches being to crustacean and insect sequences. Approximately 32 putative neuropeptide genes were identified from nonmatching blast sequences. In addition, we identified full-length transcripts for crustacean reproductive-related genes, namely farnesoic acid o-methyltransferase (FAMeT), estrogen sulfotransferase (ESULT) and prostaglandin F synthase (PGFS). Following serotonin injection, which would normally initiate reproductive processes, we found up-regulation of FAMeT, ESULT and PGFS expression in the female CNS and ovary. Our data here provides an invaluable new resource for understanding the molecular role of the CNS on reproduction in S. olivacea.
Haarmann, Thomas; Machado, Caroline; Lübbe, Yvonne; Correia, Telmo; Schardl, Christopher L; Panaccione, Daniel G; Tudzynski, Paul
2005-06-01
The genomic region of Claviceps purpurea strain P1 containing the ergot alkaloid gene cluster [Tudzynski, P., Hölter, K., Correia, T., Arntz, C., Grammel, N., Keller, U., 1999. Evidence for an ergot alkaloid gene cluster in Claviceps purpurea. Mol. Gen. Genet. 261, 133-141] was explored by chromosome walking, and additional genes probably involved in the ergot alkaloid biosynthesis have been identified. The putative cluster sequence (extending over 68.5kb) contains 4 different nonribosomal peptide synthetase (NRPS) genes and several putative oxidases. Northern analysis showed that most of the genes were co-regulated (repressed by high phosphate), and identified probable flanking genes by lack of co-regulation. Comparison of the cluster sequences of strain P1, an ergotamine producer, with that of strain ECC93, an ergocristine producer, showed high conservation of most of the cluster genes, but significant variation in the NRPS modules, strongly suggesting that evolution of these chemical races of C. purpurea is determined by evolution of NRPS module specificity.
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-01-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Nearing saturation of cancer driver gene discovery.
Hsiehchen, David; Hsieh, Antony
2018-06-15
Extensive sequencing efforts of cancer genomes such as The Cancer Genome Atlas (TCGA) have been undertaken to uncover bona fide cancer driver genes which has enhanced our understanding of cancer and revealed therapeutic targets. However, the number of driver gene mutations is bounded, indicating that there must be a point when further sequencing efforts will be excessive. We found that there was a significant positive correlation between sample size and identified driver gene mutations across 33 cancers sequenced by the TCGA, which is expected if additional sequencing is still leading to the identification of more driver genes. However, the rate of new cancer driver genes being discovered with larger samples is declining rapidly. Our analysis provides a general guide for determining which cancer types would likely benefit from additional sequencing efforts, particularly those with relatively high rates of cancer driver gene discovery. Our results argue that past strategies of indiscriminately sequencing as many specimens as possible for all cancer types is becoming inefficient. In addition, without significant investments into applying our knowledge of cancer genomes, we risk sequencing more cancer genomes for the sake of sequencing rather than meaningful patient benefit.
Liu, Long; Zheng, Chuan Wei; Wang, De He; Hou, Zhuo Cheng; Ning, Zhong Hua
2015-01-01
Eggshell damages lead to economic losses in the egg production industry and are a threat to human health. We examined 49-wk-old Rhode Island White hens (Gallus gallus) that laid eggs having shells with significantly different strengths and thicknesses. We used HiSeq 2000 (Illumina) sequencing to characterize the chicken transcriptome and whole genome to identify the key genes and genetic mutations associated with eggshell calcification. We identified a total of 14,234 genes expressed in the chicken uterus, representing 89% of all annotated chicken genes. A total of 889 differentially expressed genes were identified by comparing low eggshell strength (LES) and normal eggshell strength (NES) genomes. The DEGs are enriched in calcification-related processes, including calcium ion transport and calcium signaling pathways as reveled by gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis. Some important matrix proteins, such as OC-116, LTF and SPP1, were also expressed differentially between two groups. A total of 3,671,919 single-nucleotide polymorphisms (SNPs) and 508,035 Indels were detected in protein coding genes by whole-genome re-sequencing, including 1775 non-synonymous variations and 19 frame-shift Indels in DEGs. SNPs and Indels found in this study could be further investigated for eggshell traits. This is the first report to integrate the transcriptome and genome re-sequencing to target the genetic variations which decreased the eggshell qualities. These findings further advance our understanding of eggshell calcification in the chicken uterus. PMID:25974068
The complete plastid genome sequence of Eustrephus latifolius (Asparagaceae: Lomandroideae).
Kim, Hyoung Tae; Kim, Jung Sung; Kim, Joo-Hwan
2016-01-01
The complete chloroplast (cp) genome sequence of Eustrephus latifolius was firstly determined in subfamily Lomandriodeae of family Asparagaceae. It was 159,736 bp and contained a large single copy region (82,403 bp) and a small single copy region (13,607 bp) which were separated by two inverted repeat regions (31,863 bp). In total, 132 genes were identified and they were consisted of 83 coding genes, 8 rRNA genes, 38 tRNA genes, 3 pseudogenes. rpl23 and clpP were pseudogenes due to sequence deletions. Among 23 genes containing introns, rps12 and ycf3 contained two introns and the rest had just one intron. The intact ycf68 was identified within an intron of trnI-GAU. The amino acid sequence was almost identical with Phoenix dactylifera in Aracales. Ycf1 of E. latifolius was completely located in IR. It was similar to cp genome structure of Lemna minor, Spirodela polyrhiza, Wolffiella lingulata, Wolffia australiana in Alismatales.
Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways.
Cirulli, Elizabeth T; Lasseigne, Brittany N; Petrovski, Slavé; Sapp, Peter C; Dion, Patrick A; Leblond, Claire S; Couthouis, Julien; Lu, Yi-Fan; Wang, Quanli; Krueger, Brian J; Ren, Zhong; Keebler, Jonathan; Han, Yujun; Levy, Shawn E; Boone, Braden E; Wimbish, Jack R; Waite, Lindsay L; Jones, Angela L; Carulli, John P; Day-Williams, Aaron G; Staropoli, John F; Xin, Winnie W; Chesi, Alessandra; Raphael, Alya R; McKenna-Yasek, Diane; Cady, Janet; Vianney de Jong, J M B; Kenna, Kevin P; Smith, Bradley N; Topp, Simon; Miller, Jack; Gkazi, Athina; Al-Chalabi, Ammar; van den Berg, Leonard H; Veldink, Jan; Silani, Vincenzo; Ticozzi, Nicola; Shaw, Christopher E; Baloh, Robert H; Appel, Stanley; Simpson, Ericka; Lagier-Tourenne, Clotilde; Pulst, Stefan M; Gibson, Summer; Trojanowski, John Q; Elman, Lauren; McCluskey, Leo; Grossman, Murray; Shneider, Neil A; Chung, Wendy K; Ravits, John M; Glass, Jonathan D; Sims, Katherine B; Van Deerlin, Vivianna M; Maniatis, Tom; Hayes, Sebastian D; Ordureau, Alban; Swarup, Sharan; Landers, John; Baas, Frank; Allen, Andrew S; Bedlack, Richard S; Harper, J Wade; Gitler, Aaron D; Rouleau, Guy A; Brown, Robert; Harms, Matthew B; Cooper, Gregory M; Harris, Tim; Myers, Richard M; Goldstein, David B
2015-03-27
Amyotrophic lateral sclerosis (ALS) is a devastating neurological disease with no effective treatment. We report the results of a moderate-scale sequencing study aimed at increasing the number of genes known to contribute to predisposition for ALS. We performed whole-exome sequencing of 2869 ALS patients and 6405 controls. Several known ALS genes were found to be associated, and TBK1 (the gene encoding TANK-binding kinase 1) was identified as an ALS gene. TBK1 is known to bind to and phosphorylate a number of proteins involved in innate immunity and autophagy, including optineurin (OPTN) and p62 (SQSTM1/sequestosome), both of which have also been implicated in ALS. These observations reveal a key role of the autophagic pathway in ALS and suggest specific targets for therapeutic intervention. Copyright © 2015, American Association for the Advancement of Science.
Analysis of MHC class I genes across horse MHC haplotypes
Tallmadge, Rebecca L.; Campbell, Julie A.; Miller, Donald C.; Antczak, Douglas F.
2010-01-01
The genomic sequences of 15 horse Major Histocompatibility Complex (MHC) class I genes and a collection of MHC class I homozygous horses of five different haplotypes were used to investigate the genomic structure and polymorphism of the equine MHC. A combination of conserved and locus-specific primers was used to amplify horse MHC class I genes with classical and non-classical characteristics. Multiple clones from each haplotype identified three to five classical sequences per homozygous animal, and two to three non-classical sequences. Phylogenetic analysis was applied to these sequences and groups were identified which appear to be allelic series, but some sequences were left ungrouped. Sequences determined from MHC class I heterozygous horses and previously described MHC class I sequences were then added, representing a total of ten horse MHC haplotypes. These results were consistent with those obtained from the MHC homozygous horses alone, and 30 classical sequences were assigned to four previously confirmed loci and three new provisional loci. The non-classical genes had few alleles and the classical genes had higher levels of allelic polymorphism. Alleles for two classical loci with the expected pattern of polymorphism were found in the majority of haplotypes tested, but alleles at two other commonly detected loci had more variation outside of the hypervariable region than within. Our data indicate that the equine Major Histocompatibility Complex is characterized by variation in the complement of class I genes expressed in different haplotypes in addition to the expected allelic polymorphism within loci. PMID:20099063
Yockteng, Roxana; Marthey, Sylvain; Chiapello, Hélène; Gendrault, Annie; Hood, Michael E; Rodolphe, François; Devier, Benjamin; Wincker, Patrick; Dossat, Carole; Giraud, Tatiana
2007-01-01
Background The basidiomycete fungus Microbotryum violaceum is responsible for the anther-smut disease in many plants of the Caryophyllaceae family and is a model in genetics and evolutionary biology. Infection is initiated by dikaryotic hyphae produced after the conjugation of two haploid sporidia of opposite mating type. This study describes M. violaceum ESTs corresponding to nuclear genes expressed during conjugation and early hyphal production. Results A normalized cDNA library generated 24,128 sequences, which were assembled into 7,765 unique genes; 25.2% of them displayed significant similarity to annotated proteins from other organisms, 74.3% a weak similarity to the same set of known proteins, and 0.5% were orphans. We identified putative pheromone receptors and genes that in other fungi are involved in the mating process. We also identified many sequences similar to genes known to be involved in pathogenicity in other fungi. The M. violaceum EST database, MICROBASE, is available on the Web and provides access to the sequences, assembled contigs, annotations and programs to compare similarities against MICROBASE. Conclusion This study provides a basis for cloning the mating type locus, for further investigation of pathogenicity genes in the anther smut fungi, and for comparative genomics. PMID:17692127
Martin, Natalia; Patel, Satyakam; Segre, Julia A.
2004-01-01
Mammalian epidermis provides a permeability barrier between an organism and its environment. Under homeostatic conditions, epidermal cells produce structural proteins, which are cross-linked in an orderly fashion to form a cornified envelope (CE). However, under genetic or environmental stress, specific genes are induced to rapidly build a temporary barrier. Small proline-rich (SPRR) proteins are the primary constituents of the CE. Under stress the entire family of 14 Sprr genes is upregulated. The Sprr genes are clustered within the larger epidermal differentiation complex on mouse chromosome 3, human chromosome 1q21. The clustering of the Sprr genes and their upregulation under stress suggest that these genes may be coordinately regulated. To identify enhancer elements that regulate this stress response activation of the Sprr locus, we utilized bioinformatic tools and classical biochemical dissection. Long-range comparative sequence analysis identified conserved noncoding sequences (CNSs). Clusters of epidermal-specific DNaseI-hypersensitive sites (HSs) mapped to specific CNSs. Increased prevalence of these HSs in barrier-deficient epidermis provides in vivo evidence of the regulation of the Sprr locus by these conserved sequences. Individual components of these HSs were cloned, and one was shown to have strong enhancer activity specific to conditions when the Sprr genes are coordinately upregulated. PMID:15574822
Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi
2004-02-01
To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.
Analyses of Hypomethylated Oil Palm Gene Space
Jayanthi, Nagappan; Mohd-Amin, Ab Halim; Azizi, Norazah; Chan, Kuang-Lim; Maqbool, Nauman J.; Maclean, Paul; Brauning, Rudi; McCulloch, Alan; Moraga, Roger; Ong-Abdullah, Meilina; Singh, Rajinder
2014-01-01
Demand for palm oil has been increasing by an average of ∼8% the past decade and currently accounts for about 59% of the world's vegetable oil market. This drives the need to increase palm oil production. Nevertheless, due to the increasing need for sustainable production, it is imperative to increase productivity rather than the area cultivated. Studies on the oil palm genome are essential to help identify genes or markers that are associated with important processes or traits, such as flowering, yield and disease resistance. To achieve this, 294,115 and 150,744 sequences from the hypomethylated or gene-rich regions of Elaeis guineensis and E. oleifera genome were sequenced and assembled into contigs. An additional 16,427 shot-gun sequences and 176 bacterial artificial chromosomes (BAC) were also generated to check the quality of libraries constructed. Comparison of these sequences revealed that although the methylation-filtered libraries were sequenced at low coverage, they still tagged at least 66% of the RefSeq supported genes in the BAC and had a filtration power of at least 2.0. A total 33,752 microsatellites and 40,820 high-quality single nucleotide polymorphism (SNP) markers were identified. These represent the most comprehensive collection of microsatellites and SNPs to date and would be an important resource for genetic mapping and association studies. The gene models predicted from the assembled contigs were mined for genes of interest, and 242, 65 and 14 oil palm transcription factors, resistance genes and miRNAs were identified respectively. Examples of the transcriptional factors tagged include those associated with floral development and tissue culture, such as homeodomain proteins, MADS, Squamosa and Apetala2. The E. guineensis and E. oleifera hypomethylated sequences provide an important resource to understand the molecular mechanisms associated with important agronomic traits in oil palm. PMID:24497974
Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana.
Mayer, K; Schüller, C; Wambutt, R; Murphy, G; Volckaert, G; Pohl, T; Düsterhöft, A; Stiekema, W; Entian, K D; Terryn, N; Harris, B; Ansorge, W; Brandt, P; Grivell, L; Rieger, M; Weichselgartner, M; de Simone, V; Obermaier, B; Mache, R; Müller, M; Kreis, M; Delseny, M; Puigdomenech, P; Watson, M; Schmidtheini, T; Reichert, B; Portatelle, D; Perez-Alonso, M; Boutry, M; Bancroft, I; Vos, P; Hoheisel, J; Zimmermann, W; Wedler, H; Ridley, P; Langham, S A; McCullagh, B; Bilham, L; Robben, J; Van der Schueren, J; Grymonprez, B; Chuang, Y J; Vandenbussche, F; Braeken, M; Weltjens, I; Voet, M; Bastiaens, I; Aert, R; Defoor, E; Weitzenegger, T; Bothe, G; Ramsperger, U; Hilbert, H; Braun, M; Holzer, E; Brandt, A; Peters, S; van Staveren, M; Dirske, W; Mooijman, P; Klein Lankhorst, R; Rose, M; Hauf, J; Kötter, P; Berneiser, S; Hempel, S; Feldpausch, M; Lamberth, S; Van den Daele, H; De Keyser, A; Buysshaert, C; Gielen, J; Villarroel, R; De Clercq, R; Van Montagu, M; Rogers, J; Cronin, A; Quail, M; Bray-Allen, S; Clark, L; Doggett, J; Hall, S; Kay, M; Lennard, N; McLay, K; Mayes, R; Pettett, A; Rajandream, M A; Lyne, M; Benes, V; Rechmann, S; Borkova, D; Blöcker, H; Scharfe, M; Grimm, M; Löhnert, T H; Dose, S; de Haan, M; Maarse, A; Schäfer, M; Müller-Auer, S; Gabel, C; Fuchs, M; Fartmann, B; Granderath, K; Dauner, D; Herzl, A; Neumann, S; Argiriou, A; Vitale, D; Liguori, R; Piravandi, E; Massenet, O; Quigley, F; Clabauld, G; Mündlein, A; Felber, R; Schnabl, S; Hiller, R; Schmidt, W; Lecharny, A; Aubourg, S; Chefdor, F; Cooke, R; Berger, C; Montfort, A; Casacuberta, E; Gibbons, T; Weber, N; Vandenbol, M; Bargues, M; Terol, J; Torres, A; Perez-Perez, A; Purnelle, B; Bent, E; Johnson, S; Tacon, D; Jesse, T; Heijnen, L; Schwarz, S; Scholler, P; Heber, S; Francs, P; Bielke, C; Frishman, D; Haase, D; Lemcke, K; Mewes, H W; Stocker, S; Zaccaria, P; Bevan, M; Wilson, R K; de la Bastide, M; Habermann, K; Parnell, L; Dedhia, N; Gnoj, L; Schutz, K; Huang, E; Spiegel, L; Sehkon, M; Murray, J; Sheet, P; Cordes, M; Abu-Threideh, J; Stoneking, T; Kalicki, J; Graves, T; Harmon, G; Edwards, J; Latreille, P; Courtney, L; Cloud, J; Abbott, A; Scott, K; Johnson, D; Minx, P; Bentley, D; Fulton, B; Miller, N; Greco, T; Kemp, K; Kramer, J; Fulton, L; Mardis, E; Dante, M; Pepin, K; Hillier, L; Nelson, J; Spieth, J; Ryan, E; Andrews, S; Geisel, C; Layman, D; Du, H; Ali, J; Berghoff, A; Jones, K; Drone, K; Cotton, M; Joshu, C; Antonoiu, B; Zidanic, M; Strong, C; Sun, H; Lamar, B; Yordan, C; Ma, P; Zhong, J; Preston, R; Vil, D; Shekher, M; Matero, A; Shah, R; Swaby, I K; O'Shaughnessy, A; Rodriguez, M; Hoffmann, J; Till, S; Granat, S; Shohdy, N; Hasegawa, A; Hameed, A; Lodhi, M; Johnson, A; Chen, E; Marra, M; Martienssen, R; McCombie, W R
1999-12-16
The higher plant Arabidopsis thaliana (Arabidopsis) is an important model for identifying plant genes and determining their function. To assist biological investigations and to define chromosome structure, a coordinated effort to sequence the Arabidopsis genome was initiated in late 1996. Here we report one of the first milestones of this project, the sequence of chromosome 4. Analysis of 17.38 megabases of unique sequence, representing about 17% of the genome, reveals 3,744 protein coding genes, 81 transfer RNAs and numerous repeat elements. Heterochromatic regions surrounding the putative centromere, which has not yet been completely sequenced, are characterized by an increased frequency of a variety of repeats, new repeats, reduced recombination, lowered gene density and lowered gene expression. Roughly 60% of the predicted protein-coding genes have been functionally characterized on the basis of their homology to known genes. Many genes encode predicted proteins that are homologous to human and Caenorhabditis elegans proteins.
Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Kumar, Vinay; Kale, Sandip M; Sinha, Pallavi; Chitikineni, Annapurna; Pazhamala, Lekha T; Garg, Vanika; Sharma, Mamta; Sameer Kumar, Chanda Venkata; Parupalli, Swathi; Vechalapu, Suryanarayana; Patil, Suyash; Muniswamy, Sonnappa; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Dharmaraj, Pallavi Subbanna; Varshney, Rajeev K
2016-05-01
To map resistance genes for Fusarium wilt (FW) and sterility mosaic disease (SMD) in pigeonpea, sequencing-based bulked segregant analysis (Seq-BSA) was used. Resistant (R) and susceptible (S) bulks from the extreme recombinant inbred lines of ICPL 20096 × ICPL 332 were sequenced. Subsequently, SNP index was calculated between R- and S-bulks with the help of draft genome sequence and reference-guided assembly of ICPL 20096 (resistant parent). Seq-BSA has provided seven candidate SNPs for FW and SMD resistance in pigeonpea. In parallel, four additional genotypes were re-sequenced and their combined analysis with R- and S-bulks has provided a total of 8362 nonsynonymous (ns) SNPs. Of 8362 nsSNPs, 60 were found within the 2-Mb flanking regions of seven candidate SNPs identified through Seq-BSA. Haplotype analysis narrowed down to eight nsSNPs in seven genes. These eight nsSNPs were further validated by re-sequencing 11 genotypes that are resistant and susceptible to FW and SMD. This analysis revealed association of four candidate nsSNPs in four genes with FW resistance and four candidate nsSNPs in three genes with SMD resistance. Further, In silico protein analysis and expression profiling identified two most promising candidate genes namely C.cajan_01839 for SMD resistance and C.cajan_03203 for FW resistance. Identified candidate genomic regions/SNPs will be useful for genomics-assisted breeding in pigeonpea. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
2014-01-01
Background Variation in seed oil composition and content among soybean varieties is largely attributed to differences in transcript sequences and/or transcript accumulation of oil production related genes in seeds. Discovery and analysis of sequence and expression variations in these genes will accelerate soybean oil quality improvement. Results In an effort to identify these variations, we sequenced the transcriptomes of soybean seeds from nine lines varying in oil composition and/or total oil content. Our results showed that 69,338 distinct transcripts from 32,885 annotated genes were expressed in seeds. A total of 8,037 transcript expression polymorphisms and 50,485 transcript sequence polymorphisms (48,792 SNPs and 1,693 small Indels) were identified among the lines. Effects of the transcript polymorphisms on their encoded protein sequences and functions were predicted. The studies also provided independent evidence that the lack of FAD2-1A gene activity and a non-synonymous SNP in the coding sequence of FAB2C caused elevated oleic acid and stearic acid levels in soybean lines M23 and FAM94-41, respectively. Conclusions As a proof-of-concept, we developed an integrated RNA-seq and bioinformatics approach to identify and functionally annotate transcript polymorphisms, and demonstrated its high effectiveness for discovery of genetic and transcript variations that result in altered oil quality traits. The collection of transcript polymorphisms coupled with their predicted functional effects will be a valuable asset for further discovery of genes, gene variants, and functional markers to improve soybean oil quality. PMID:24755115
Cold Shock Exoribonuclease R (VacB) is Involved in Aeromonas hydrophila Pathogenesis
In this study, we cloned and sequenced a virulence-associated gene (vacB) from a clinical isolate SSU of Aeromonas hydrophila. We identified this gene based on our recently annotated genome sequence of the environmental isolate ATCC 7966T of A. hydrophila and the vacB gene of Shi...
Cold Shock Exoribonuclease R(VacB) is involved in Aeromonas hydrophila Virulence
In this study, we cloned and sequenced a virulence-associated gene (vacB) from a clinical isolate SSU of Aeromonas hydrophila. We identified this gene based on our recently annotated genome sequence of the environmental isolate ATCC 7966T of A. hydrophila and the vacB gene of Shi...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee, Poulabi; Bahlo, Melanie; Schwartz, Jody R.
2002-01-01
Genome wide disease association analysis using SNPs is being explored as a method for dissecting complex genetic traits and a vast number of SNPs have been generated for this purpose. As there are cost and throughput limitations of genotyping large numbers of SNPs and statistical issues regarding the large number of dependent tests on the same data set, to make association analysis practical it has been proposed that SNPs should be prioritized based on likely functional importance. The most easily identifiable functional SNPs are coding SNPs (cSNPs) and accordingly cSNPs have been screened in a number of studies. SNPs inmore » gene regulatory sequences embedded in noncoding DNA are another class of SNPs suggested for prioritization due to their predicted quantitative impact on gene expression. The main challenge in evaluating these SNPs, in contrast to cSNPs is a lack of robust algorithms and databases for recognizing regulatory sequences in noncoding DNA. Approaches that have been previously used to delineate noncoding sequences with gene regulatory activity include cross-species sequence comparisons and the search for sequences recognized by transcription factors. We combined these two methods to sift through mouse human genomic sequences to identify putative gene regulatory elements and subsequently localized SNPs within these sequences in a 1 Megabase (Mb) region of human chromosome 5q31, orthologous to mouse chromosome 11 containing the Interleukin cluster.« less
Weirather, Jason L.; Afshar, Pegah Tootoonchi; Clark, Tyson A.; Tseng, Elizabeth; Powers, Linda S.; Underwood, Jason G.; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai
2015-01-01
We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. PMID:26040699
Monier, Adam; Welsh, Rory M; Gentemann, Chelle; Weinstock, George; Sodergren, Erica; Armbrust, E Virginia; Eisen, Jonathan A; Worden, Alexandra Z
2012-01-01
Phosphate (PO(4)) is an important limiting nutrient in marine environments. Marine cyanobacteria scavenge PO(4) using the high-affinity periplasmic phosphate binding protein PstS. The pstS gene has recently been identified in genomes of cyanobacterial viruses as well. Here, we analyse genes encoding transporters in genomes from viruses that infect eukaryotic phytoplankton. We identified inorganic PO(4) transporter-encoding genes from the PHO4 superfamily in several virus genomes, along with other transporter-encoding genes. Homologues of the viral pho4 genes were also identified in genome sequences from the genera that these viruses infect. Genome sequences were available from host genera of all the phytoplankton viruses analysed except the host genus Bathycoccus. Pho4 was recovered from Bathycoccus by sequencing a targeted metagenome from an uncultured Atlantic Ocean population. Phylogenetic reconstruction showed that pho4 genes from pelagophytes, haptophytes and infecting viruses were more closely related to homologues in prasinophytes than to those in what, at the species level, are considered to be closer relatives (e.g. diatoms). We also identified PHO4 superfamily members in ocean metagenomes, including new metagenomes from the Pacific Ocean. The environmental sequences grouped with pelagophytes, haptophytes, prasinophytes and viruses as well as bacteria. The analyses suggest that multiple independent pho4 gene transfer events have occurred between marine viruses and both eukaryotic and bacterial hosts. Additionally, pho4 genes were identified in available genomes from viruses that infect marine eukaryotes but not those that infect terrestrial hosts. Commonalities in marine host-virus gene exchanges indicate that manipulation of host-PO(4) uptake is an important adaptation for viral proliferation in marine systems. Our findings suggest that PO(4) -availability may not serve as a simple bottom-up control of marine phytoplankton. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Genetic Mapping and Exome Sequencing Identify Variants Associated with Five Novel Diseases
Puffenberger, Erik G.; Jinks, Robert N.; Sougnez, Carrie; Cibulskis, Kristian; Willert, Rebecca A.; Achilly, Nathan P.; Cassidy, Ryan P.; Fiorentini, Christopher J.; Heiken, Kory F.; Lawrence, Johnny J.; Mahoney, Molly H.; Miller, Christopher J.; Nair, Devika T.; Politi, Kristin A.; Worcester, Kimberly N.; Setton, Roni A.; DiPiazza, Rosa; Sherman, Eric A.; Eastman, James T.; Francklyn, Christopher; Robey-Bond, Susan; Rider, Nicholas L.; Gabriel, Stacey; Morton, D. Holmes; Strauss, Kevin A.
2012-01-01
The Clinic for Special Children (CSC) has integrated biochemical and molecular methods into a rural pediatric practice serving Old Order Amish and Mennonite (Plain) children. Among the Plain people, we have used single nucleotide polymorphism (SNP) microarrays to genetically map recessive disorders to large autozygous haplotype blocks (mean = 4.4 Mb) that contain many genes (mean = 79). For some, uninformative mapping or large gene lists preclude disease-gene identification by Sanger sequencing. Seven such conditions were selected for exome sequencing at the Broad Institute; all had been previously mapped at the CSC using low density SNP microarrays coupled with autozygosity and linkage analyses. Using between 1 and 5 patient samples per disorder, we identified sequence variants in the known disease-causing genes SLC6A3 and FLVCR1, and present evidence to strongly support the pathogenicity of variants identified in TUBGCP6, BRAT1, SNIP1, CRADD, and HARS. Our results reveal the power of coupling new genotyping technologies to population-specific genetic knowledge and robust clinical data. PMID:22279524
Xochelli, Aliki; Agathangelidis, Andreas; Kavakiotis, Ioannis; Minga, Evangelia; Sutton, Lesley Ann; Baliakas, Panagiotis; Chouvarda, Ioanna; Giudicelli, Véronique; Vlahavas, Ioannis; Maglaveras, Nikos; Bonello, Lisa; Trentin, Livio; Tedeschi, Alessandra; Panagiotidis, Panagiotis; Geisler, Christian; Langerak, Anton W; Pospisilova, Sarka; Jelinek, Diane F; Oscier, David; Chiorazzi, Nicholas; Darzentas, Nikos; Davi, Fred; Ghia, Paolo; Rosenquist, Richard; Hadzidimitriou, Anastasia; Belessi, Chrysoula; Lefranc, Marie-Paule; Stamatopoulos, Kostas
2015-01-01
Νext generation sequencing studies in Homo sapiens have identified novel immunoglobulin heavy variable (IGHV) genes and alleles necessitating changes in the international ImMunoGeneTics information system (IMGT) GENE-DB and reference directories of IMGT/V-QUEST. In chronic lymphocytic leukaemia (CLL), the somatic hypermutation (SHM) status of the clonotypic rearranged IGHV gene is strongly associated with patient outcome. Correct determination of this parameter strictly depends on the comparison of the nucleotide sequence of the clonotypic rearranged IGHV gene with that of the closest germline counterpart. Consequently, changes in the reference directories could, in principle, affect the correct interpretation of the IGHV mutational status in CLL. To this end, we analyzed 8066 productive IG heavy chain (IGH) rearrangement sequences from our consortium both before and after the latest update of the IMGT/V-QUEST reference directory. Differences were identified in 405 cases (5 % of the cohort). In 291/405 sequences (71.9 %), changes concerned only the IGHV gene or allele name, whereas a change in the percent germline identity (%GI) was noted in 114/405 (28.1 %) sequences; in 50/114 (43.8 %) sequences, changes in the %GI led to a change in the mutational set. In conclusion, recent changes in the IMGT reference directories affected the interpretation of SHM in a sizeable number of IGH rearrangement sequences from CLL patients. This indicates that both physicians and researchers should consider a re-evaluation of IG sequence data, especially for those IGH rearrangement sequences that, up to date, have a GI close to 98 %, where caution is warranted.
Evaluation of microbial community in hydrothermal field by direct DNA sequencing
NASA Astrophysics Data System (ADS)
Kawarabayasi, Y.; Maruyama, A.
2002-12-01
Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.
Ekblom, Robert; Farrell, Lindsay L; Lank, David B; Burke, Terry
2012-01-01
By next generation transcriptome sequencing, it is possible to obtain data on both nucleotide sequence variation and gene expression. We have used this approach (RNA-Seq) to investigate the genetic basis for differences in plumage coloration and mating strategies in a non-model bird species, the ruff (Philomachus pugnax). Ruff males show enormous variation in the coloration of ornamental feathers, used for individual recognition. This polymorphism is linked to reproductive strategies, with dark males (Independents) defending territories on leks against other Independents, whereas white morphs (Satellites) co-occupy Independent's courts without agonistic interactions. Previous work found a strong genetic component for mating strategy, but the genes involved were not identified. We present feather transcriptome data of more than 6,000 de-novo sequenced ruff genes (although with limited coverage for many of them). None of the identified genes showed significant expression divergence between males, but many genetic markers showed nucleotide differentiation between different color morphs and mating strategies. These include several feather keratin genes, splicing factors, and the Xg blood-group gene. Many of the genes with significant genetic structure between mating strategies have not yet been annotated and their functions remain to be elucidated. We also conducted in-depth investigations of 28 pre-identified coloration candidate genes. Two of these (EDNRB and TYR) were specifically expressed in black- and rust-colored males, respectively. We have demonstrated the utility of next generation transcriptome sequencing for identifying and genotyping large number of genetic markers in a non-model species without previous genomic resources, and highlight the potential of this approach for addressing the genetic basis of ecologically important variation. PMID:23145334
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4−/− mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases. PMID:25644381
Doddapaneni, Harshavardhan; Yao, Jiqiang; Lin, Hong; Walker, M Andrew; Civerolo, Edwin L
2006-01-01
Background The Gram-negative, xylem-limited phytopathogenic bacterium Xylella fastidiosa is responsible for causing economically important diseases in grapevine, citrus and many other plant species. Despite its economic impact, relatively little is known about the genomic variations among strains isolated from different hosts and their influence on the population genetics of this pathogen. With the availability of genome sequence information for four strains, it is now possible to perform genome-wide analyses to identify and categorize such DNA variations and to understand their influence on strain functional divergence. Results There are 1,579 genes and 194 non-coding homologous sequences present in the genomes of all four strains, representing a 76. 2% conservation of the sequenced genome. About 60% of the X. fastidiosa unique sequences exist as tandem gene clusters of 6 or more genes. Multiple alignments identified 12,754 SNPs and 14,449 INDELs in the 1528 common genes and 20,779 SNPs and 10,075 INDELs in the 194 non-coding sequences. The average SNP frequency was 1.08 × 10-2 per base pair of DNA and the average INDEL frequency was 2.06 × 10-2 per base pair of DNA. On an average, 60.33% of the SNPs were synonymous type while 39.67% were non-synonymous type. The mutation frequency, primarily in the form of external INDELs was the main type of sequence variation. The relative similarity between the strains was discussed according to the INDEL and SNP differences. The number of genes unique to each strain were 60 (9a5c), 54 (Dixon), 83 (Ann1) and 9 (Temecula-1). A sub-set of the strain specific genes showed significant differences in terms of their codon usage and GC composition from the native genes suggesting their xenologous origin. Tandem repeat analysis of the genomic sequences of the four strains identified associations of repeat sequences with hypothetical and phage related functions. Conclusion INDELs and strain specific genes have been identified as the main source of variations among strains, with individual strains showing different rates of genome evolution. Based on these genome comparisons, it appears that the Pierce's disease strain Temecula-1 genome represents the ancestral genome of the X. fastidiosa. Results of this analysis are publicly available in the form of a web database. PMID:16948851
Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu
2016-04-11
Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.
Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.
Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia
2017-07-24
Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.
Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong
2008-12-31
CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts.
[Multiplexing mapping of human cDNAs]. Final report, September 1, 1991--February 28, 1994
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
Using PCR with automated product analysis, 329 human brain cDNA sequences have been assigned to individual human chromosomes. Primers were designed from single-pass cDNA sequences expressed sequence tags (ESTs). Primers were used in PCR reactions with DNA from somatic cell hybrid mapping panels as templates, often with multiplexing. Many ESTs mapped match sequence database records. To evaluate of these matches, the position of the primers relative to the matching region (In), the BLAST scores and the Poisson probability values of the EST/sequence record match were determined. In cases where the gene product was stringently identified by the sequence match hadmore » already been mapped, the gene locus determined by EST was consistent with the previous position which strongly supports the validity of assigning unknown genes to human chromosomes based on the EST sequence matches. In the present cases mapping the ESTs to a chromosome can also be considered to have mapped the known gene product: rolipram-sensitive cAMP phosphodiesterase, chromosome 1; protein phosphatase 2A{beta}, chromosome 4; alpha-catenin, chromosome 5; the ELE1 oncogene, chromosome 10q11.2 or q2.1-q23; MXII protein, chromosome l0q24-qter; ribosomal protein L18a homologue, chromosome 14; ribosomal protein L3, chromosome 17; and moesin, Xp11-cen. There were also ESTs mapped that were closely related to non-human sequence records. These matches therefore can be considered to identify human counterparts of known gene products, or members of known gene families. Examples of these include membrane proteins, translation-associated proteins, structural proteins, and enzymes. These data then demonstrate that single pass sequence information is sufficient to design PCR primers useful for assigning cDNA sequences to human chromosomes. When the EST sequence matches previous sequence database records, the chromosome assignments of the EST can be used to make preliminary assignments of the human gene to a chromosome.« less
[Polymorphic loci and polymorphism analysis of short tandem repeats within XNP gene].
Liu, Qi-Ji; Gong, Yao-Qin; Guo, Chen-Hong; Chen, Bing-Xi; Li, Jiang-Xia; Guo, Yi-Shou
2002-01-01
To select polymorphic short tandem repeat markers within X-linked nuclear protein (XNP) gene, genomic clones which contain XNP gene were recognized by homologous analysis with XNP cDNA. By comparing the cDNA with genomic DNA, non-exonic sequences were identified, and short tandem repeats were selected from non-exonic sequences by using BCM search Launcher. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five short tandem repeats were identified from XNP gene, two of which were polymorphic. Four and 11 alleles were observed in Chinese population for XNPSTR1 and XNPSTR4, respectively. Heterozygosities were 47% for XNPSTR1 and 70% for XNPSTR4. XNPSTR1 and XNPSTR4 localized within 3' end and intron 10, respectively. Two polymorphic short tandem repeats have been identified within XNP gene and will be useful for linkage analysis and gene diagnosis of XNP gene.
Stessman, Holly A. F.; Xiong, Bo; Coe, Bradley P.; Wang, Tianyun; Hoekzema, Kendra; Fenckova, Michaela; Kvarnung, Malin; Gerdts, Jennifer; Trinh, Sandy; Cosemans, Nele; Vives, Laura; Lin, Janice; Turner, Tychele N.; Santen, Gijs; Ruivenkamp, Claudia; Kriek, Marjolein; van Haeringen, Arie; Aten, Emmelien; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Haan, Eric; Shaw, Marie; Gecz, Jozef; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Schwartz, Charles; Kooy, R. Frank; Vandeweyer, Geert; Helsmoortel, Celine; Romano, Corrado; Alberti, Antonino; Vinci, Mirella; Avola, Emanuela; Giusto, Stefania; Courchesne, Eric; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Amaral, David; Scheffer, Ingrid E.; Delatycki, Martin B.; Lockhart, Paul J.; Hormozdiari, Fereydoun; Harich, Benjamin; Castells-Nobau, Anna; Xia, Kun; Peeters, Hilde; Nordenskjöld, Magnus; Schenck, Annette; Bernier, Raphael A.; Eichler, Evan E.
2017-01-01
Gene-disruptive mutations contribute to the biology of neurodevelopmental disorders (NDDs), but most pathogenic genes are not known. We sequenced 208 candidate genes from >11,730 patients and >2,867 controls. We report 91 genes with an excess of de novo mutations or private disruptive mutations in 5.7% of patients, including 38 novel NDD genes. Drosophila functional assays of a subset bolster their involvement in NDDs. We identify 25 genes that show a bias for autism versus intellectual disability and highlight a network associated with high-functioning autism (FSIQ>100). Clinical follow-up for NAA15, KMT5B, and ASH1L reveals novel syndromic and non-syndromic forms of disease. PMID:28191889
Sequencing artifacts in the type A influenza databases and attempts to correct them.
Suarez, David L; Chester, Nikki; Hatfield, Jason
2014-07-01
There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.
Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong
2018-03-01
A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.
Using the TIGR gene index databases for biological discovery.
Lee, Yuandan; Quackenbush, John
2003-11-01
The TIGR Gene Index web pages provide access to analyses of ESTs and gene sequences for nearly 60 species, as well as a number of resources derived from these. Each species-specific database is presented using a common format with a homepage. A variety of methods exist that allow users to search each species-specific database. Methods implemented currently include nucleotide or protein sequence queries using WU-BLAST, text-based searches using various sequence identifiers, searches by gene, tissue and library name, and searches using functional classes through Gene Ontology assignments. This protocol provides guidance for using the Gene Index Databases to extract information.
Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.
1999-01-01
Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930
Weerakkody, Ruwan A; Vandrovcova, Jana; Kanonidou, Christina; Mueller, Michael; Gampawar, Piyush; Ibrahim, Yousef; Norsworthy, Penny; Biggs, Jennifer; Abdullah, Abdulshakur; Ross, David; Black, Holly A; Ferguson, David; Cheshire, Nicholas J; Kazkaz, Hanadi; Grahame, Rodney; Ghali, Neeti; Vandersteen, Anthony; Pope, F Michael; Aitman, Timothy J
2016-11-01
Ehlers-Danlos syndrome (EDS) comprises a group of overlapping hereditary disorders of connective tissue with significant morbidity and mortality, including major vascular complications. We sought to identify the diagnostic utility of a next-generation sequencing (NGS) panel in a mixed EDS cohort. We developed and applied PCR-based NGS assays for targeted, unbiased sequencing of 12 collagen and aortopathy genes to a cohort of 177 unrelated EDS patients. Variants were scored blind to previous genetic testing and then compared with results of previous Sanger sequencing. Twenty-eight pathogenic variants in COL5A1/2, COL3A1, FBN1, and COL1A1 and four likely pathogenic variants in COL1A1, TGFBR1/2, and SMAD3 were identified by the NGS assays. These included all previously detected single-nucleotide and other short pathogenic variants in these genes, and seven newly detected pathogenic or likely pathogenic variants leading to clinically significant diagnostic revisions. Twenty-two variants of uncertain significance were identified, seven of which were in aortopathy genes and required clinical follow-up. Unbiased NGS-based sequencing made new molecular diagnoses outside the expected EDS genotype-phenotype relationship and identified previously undetected clinically actionable variants in aortopathy susceptibility genes. These data may be of value in guiding future clinical pathways for genetic diagnosis in EDS.Genet Med 18 11, 1119-1127.
Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping
2018-01-01
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.
Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.
1987-01-01
The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less
Gürtler, Nicolas; Röthlisberger, Benno; Ludin, Katja; Schlegel, Christoph; Lalwani, Anil K
2017-07-01
Identification of the causative mutation using next-generation sequencing in autosomal-dominant hereditary hearing impairment, as mutation analysis in hereditary hearing impairment by classic genetic methods, is hindered by the high heterogeneity of the disease. Two Swiss families with autosomal-dominant hereditary hearing impairment. Amplified DNA libraries for next-generation sequencing were constructed from extracted genomic DNA, derived from peripheral blood, and enriched by a custom-made sequence capture library. Validated, pooled libraries were sequenced on an Illumina MiSeq instrument, 300 cycles and paired-end sequencing. Technical data analysis was performed with SeqMonk, variant analysis with GeneTalk or VariantStudio. The detection of mutations in genes related to hearing loss by next-generation sequencing was subsequently confirmed using specific polymerase-chain-reaction and Sanger sequencing. Mutation detection in hearing-loss-related genes. The first family harbored the mutation c.5383+5delGTGA in the TECTA-gene. In the second family, a novel mutation c.2614-2625delCATGGCGCCGTG in the WFS1-gene and a second mutation TCOF1-c.1028G>A were identified. Next-generation sequencing successfully identified the causative mutation in families with autosomal-dominant hereditary hearing impairment. The results helped to clarify the pathogenic role of a known mutation and led to the detection of a novel one. NGS represents a feasible approach with great potential future in the diagnostics of hereditary hearing impairment, even in smaller labs.
Genome sequence of an aflatoxigenic pathogen of Argentinian peanut, Aspergillus arachidicola
USDA-ARS?s Scientific Manuscript database
In this study we sequenced the genome of the A. arachidicola Type strain (CBS 117610) and found its genome size to be 38.9 Mb, and its number of predicted genes to be 12,091, which are values comparable to those in other sequenced Aspergilli. Of its predicted genes, 691 were identified as unique to ...
Friedenberg, Steven G.; Chdid, Lhoucine; Keene, Bruce; Sherry, Barbara; Motsinger-Reif, Alison; Meurs, Kathryn M.
2017-01-01
OBJECTIVE To identify cardiac tissue genes and gene pathways differentially expressed between dogs with and without dilated cardiomyopathy (DCM). ANIMALS 8 dogs with and 5 dogs without DCM. PROCEDURES Following euthanasia, samples of left ventricular myocardium were collected from each dog. Total RNA was extracted from tissue samples, and RNA sequencing was performed on each sample. Samples from dogs with and without DCM were grouped to identify genes that were differentially regulated between the 2 populations. Overrepresentation analysis was performed on upregulated and downregulated gene sets to identify altered molecular pathways in dogs with DCM. RESULTS Genes involved in cellular energy metabolism, especially metabolism of carbohydrates and fats, were significantly downregulated in dogs with DCM. Expression of cardiac structural proteins was also altered in affected dogs. CONCLUSIONS AND CLINICAL RELEVANCE Results suggested that RNA sequencing may provide important insights into the pathogenesis of DCM in dogs and highlight pathways that should be explored to identify causative mutations and develop novel therapeutic interventions. PMID:27347821
Bharathi, Kosaraju; Sreenath, H L
2017-07-01
Coffea canephora is the commonly cultivated coffee species in the world along with Coffea arabica . Different pests and pathogens affect the production and quality of the coffee. Jasmonic acid (JA) is a plant hormone which plays an important role in plants growth, development, and defense mechanisms, particularly against insect pests. The key enzymes involved in the production of JA are lipoxygenase, allene oxide synthase, allene oxide cyclase, and 12-oxo-phytodienoic reductase. There is no report on the genes involved in JA pathway in coffee plants. We made an attempt to identify and analyze the genes coding for these enzymes in C. canephora . First, protein sequences of jasmonate pathway genes from model plant Arabidopsis thaliana were identified in the National Center for Biotechnology Information (NCBI) database. These protein sequences were used to search the web-based database Coffee Genome Hub to identify homologous protein sequences in C. canephora genome using Basic Local Alignment Search Tool (BLAST). Homologous protein sequences for key genes were identified in the C. canephora genome database. Protein sequences of the top matches were in turn used to search in NCBI database using BLAST tool to confirm the identity of the selected proteins and to identify closely related genes in species. The protein sequences from C. canephora database and the top matches in NCBI were aligned, and phylogenetic trees were constructed using MEGA6 software and identified the genetic distance of the respective genes. The study identified the four key genes of JA pathway in C. canephora , confirming the conserved nature of the pathway in coffee. The study expected to be useful to further explore the defense mechanisms of coffee plants. JA is a plant hormone that plays an important role in plant defense against insect pests. Genes coding for the 4 key enzymes involved in the production of JA viz., LOX, AOS, AOC, and OPR are identified in C. canephora (robusta coffee) by bioinformatic approaches confirming the conserved nature of the pathway in coffee. The findings are useful to understand the defense mechanisms of C. canephora and coffee breeding in the long run. JA is a plant hormone that plays an important role in plant defense against insect pests. Genes coding for the 4 key enzymes involved in the production of JA viz., LOX, AOS, AOC and OPR were identified and analyzed in C. canephora (robusta coffee) by in silico approach. The study has confirmed the conserved nature of JA pathway in coffee; the findings are useful to further explore the defense mechanisms of coffee plants. Abbreviations used: C. canephora : Coffea canephora ; C. arabica : Coffea arabica ; JA: Jasmonic acid; CGH: Coffee Genome Hub; NCBI: National Centre for Biotechnology Information; BLAST: Basic Local Alignment Search Tool; A. thaliana : Arabidopsis thaliana ; LOX: Lipoxygenase, AOS: Allene oxide synthase; AOC: Allene oxide cyclase; OPR: 12 oxo phytodienoic reductase.
2010-01-01
Background Expansins form a large multi-gene family found in wheat and other cereal genomes that are involved in the expansion of cell walls as a tissue grows. The expansin family can be divided up into two main groups, namely, alpha-expansin (EXPA) and beta-expansin proteins (EXPB), with the EXPB group being of particular interest as group 1-pollen allergens. Results In this study, three beta-expansin genes were identified and characterized from a newly sequenced region of the Triticum aestivum cv. Chinese Spring chromosome 3B physical map at the Sr2 locus (FPC contig ctg11). The analysis of a 357 kb sub-sequence of FPC contig ctg11 identified one beta-expansin genes to be TaEXPB11, originally identified as a cDNA from the wheat cv Wyuna. Through the analysis of intron sequences of the three wheat cv. Chinese Spring genes, we propose that two of these beta-expansin genes are duplications of the TaEXPB11 gene. Comparative sequence analysis with two other wheat cultivars (cv. Westonia and cv. Hope) and a Triticum aestivum var. spelta line validated the identification of the Chinese Spring variant of TaEXPB11. The expression in maternal and grain tissues was confirmed by examining EST databases and carrying out RT-PCR experiments. Detailed examination of the position of TaEXPB11 relative to the locus encoding Sr2 disease resistance ruled out the possibility of this gene directly contributing to the resistance phenotype. Conclusions Through 3-D structural protein comparisons with Zea mays EXPB1, we proposed that variations within the coding sequence of TaEXPB11 in wheats may produce a functional change within features such as domain 1 related to possible involvement in cell wall structure and domain 2 defining the pollen allergen domain and binding to IgE protein. The variation established in this gene suggests it is a clearly identifiable member of a gene family and reflects the dynamic features of the wheat genome as it adapted to a range of different environments and uses. Accession Numbers: ctg11 =FN564426 Survey sequences of TaEXPB11ws and TsEXPB11 are provided request. PMID:20507562
McInerney-Leo, A M; Harris, J E; Leo, P J; Marshall, M S; Gardiner, B; Kinning, E; Leong, H Y; McKenzie, F; Ong, W P; Vodopiutz, J; Wicking, C; Brown, M A; Zankl, A; Duncan, E L
2015-12-01
Short-rib thoracic dystrophies (SRTDs) are congenital disorders due to defects in primary cilium function. SRTDs are recessively inherited with mutations identified in 14 genes to date (comprising 398 exons). Conventional mutation detection (usually by iterative Sanger sequencing) is inefficient and expensive, and often not undertaken. Whole exome massive parallel sequencing has been used to identify new genes for SRTD (WDR34, WDR60 and IFT172); however, the clinical utility of whole exome sequencing (WES) has not been established. WES was performed in 11 individuals with SRTDs. Compound heterozygous or homozygous mutations were identified in six confirmed SRTD genes in 10 individuals (IFT172, DYNC2H1, TTC21B, WDR60, WDR34 and NEK1), giving overall sensitivity of 90.9%. WES data from 993 unaffected individuals sequenced using similar technology showed two individuals with rare (minor allele frequency <0.005) compound heterozygous variants of unknown significance in SRTD genes (specificity >99%). Costs for consumables, laboratory processing and bioinformatic analysis were
Exome Sequencing Fails to Identify the Genetic Cause of Aicardi Syndrome.
Lund, Caroline; Striano, Pasquale; Sorte, Hanne Sørmo; Parisi, Pasquale; Iacomino, Michele; Sheng, Ying; Vigeland, Magnus D; Øye, Anne-Marte; Møller, Rikke Steensbjerre; Selmer, Kaja K; Zara, Federico
2016-09-01
Aicardi syndrome (AS) is a well-characterized neurodevelopmental disorder with an unknown etiology. In this study, we performed whole-exome sequencing in 11 female patients with the diagnosis of AS, in order to identify the disease-causing gene. In particular, we focused on detecting variants in the X chromosome, including the analysis of variants with a low number of sequencing reads, in case of somatic mosaicism. For 2 of the patients, we also sequenced the exome of the parents to search for de novo mutations. We did not identify any genetic variants likely to be damaging. Only one single missense variant was identified by the de novo analyses of the 2 trios, and this was considered benign. The failure to identify a disease gene in this study may be due to technical limitations of our study design, including the possibility that the genetic aberration leading to AS is situated in a non-exonic region or that the mutation is somatic and not detectable by our approach. Alternatively, it is possible that AS is genetically heterogeneous and that 11 patients are not sufficient to reveal the causative genes. Future studies of AS should consider designs where also non-exonic regions are explored and apply a sequencing depth so that also low-grade somatic mosaicism can be detected.
Exome sequencing reveals novel genetic loci influencing obesity-related traits in Hispanic children
USDA-ARS?s Scientific Manuscript database
To perform whole exome sequencing in 928 Hispanic children and identify variants and genes associated with childhood obesity.Single-nucleotide variants (SNVs) were identified from Illumina whole exome sequencing data using integrated read mapping, variant calling, and an annotation pipeline (Mercury...
Ren, Xuefeng; Graham, Jessica C; Jing, Lichen; Mikheev, Andrei M; Gao, Yuan; Lew, Jenny Pan; Xie, Hong; Kim, Andrea S; Shang, Xiuling; Friedman, Cynthia; Vail, Graham; Fang, Ming Zhu; Bromberg, Yana; Zarbl, Helmut
2013-01-01
Rat strains differ dramatically in their susceptibility to mammary carcinogenesis. On the assumption that susceptibility genes are conserved across mammalian species and hence inform human carcinogenesis, numerous investigators have used genetic linkage studies in rats to identify genes responsible for differential susceptibility to carcinogenesis. Using a genetic backcross between the resistant Copenhagen (Cop) and susceptible Fischer 344 (F344) strains, we mapped a novel mammary carcinoma susceptibility (Mcs30) locus to the centromeric region on chromosome 12 (LOD score of ∼8.6 at the D12Rat59 marker). The Mcs30 locus comprises approximately 12 Mbp on the long arm of rat RNO12 whose synteny is conserved on human chromosome 13q12 to 13q13. After analyzing numerous genes comprising this locus, we identified Fry, the rat ortholog of the furry gene of Drosophila melanogaster, as a candidate Mcs gene. We cloned and determined the complete nucleotide sequence of the 13 kbp Fry mRNA. Sequence analysis indicated that the Fry gene was highly conserved across evolution, with 90% similarity of the predicted amino acid sequence among eutherian mammals. Comparison of the Fry sequence in the Cop and F344 strains identified two non-synonymous single nucleotide polymorphisms (SNPs), one of which creates a putative, de novo phosphorylation site. Further analysis showed that the expression of the Fry gene is reduced in a majority of rat mammary tumors. Our results also suggested that FRY activity was reduced in human breast carcinoma cell lines as a result of reduced levels or mutation. This study is the first to identify the Fry gene as a candidate Mcs gene. Our data suggest that the SNPs within the Fry gene contribute to the genetic susceptibility of the F344 rat strain to mammary carcinogenesis. These results provide the foundation for analyzing the role of the human FRY gene in cancer susceptibility and progression.
Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P
2018-03-01
Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.
Ding, Dong; Lou, Xiaoyan; Hua, Dasong; Yu, Wei; Li, Lisha; Wang, Jun; Gao, Feng; Zhao, Na; Ren, Guoping; Li, Lanjuan; Lin, Biaoyang
2012-01-01
Integration of the viral DNA into host chromosomes was found in most of the hepatitis B virus (HBV)–related hepatocellular carcinomas (HCCs). Here we devised a massive anchored parallel sequencing (MAPS) method using next-generation sequencing to isolate and sequence HBV integrants. Applying MAPS to 40 pairs of HBV–related HCC tissues (cancer and adjacent tissues), we identified 296 HBV integration events corresponding to 286 unique integration sites (UISs) with precise HBV–Human DNA junctions. HBV integration favored chromosome 17 and preferentially integrated into human transcript units. HBV targeted genes were enriched in GO terms: cAMP metabolic processes, T cell differentiation and activation, TGF beta receptor pathway, ncRNA catabolic process, and dsRNA fragmentation and cellular response to dsRNA. The HBV targeted genes include 7 genes (PTPRJ, CNTN6, IL12B, MYOM1, FNDC3B, LRFN2, FN1) containing IPR003961 (Fibronectin, type III domain), 7 genes (NRG3, MASP2, NELL1, LRP1B, ADAM21, NRXN1, FN1) containing IPR013032 (EGF-like region, conserved site), and three genes (PDE7A, PDE4B, PDE11A) containing IPR002073 (3′, 5′-cyclic-nucleotide phosphodiesterase). Enriched pathways include hsa04512 (ECM-receptor interaction), hsa04510 (Focal adhesion), and hsa04012 (ErbB signaling pathway). Fewer integration events were found in cancers compared to cancer-adjacent tissues, suggesting a clonal expansion model in HCC development. Finally, we identified 8 genes that were recurrent target genes by HBV integration including fibronectin 1 (FN1) and telomerase reverse transcriptase (TERT1), two known recurrent target genes, and additional novel target genes such as SMAD family member 5 (SMAD5), phosphatase and actin regulator 4 (PHACTR4), and RNA binding protein fox-1 homolog (C. elegans) 1 (RBFOX1). Integrating analysis with recently published whole-genome sequencing analysis, we identified 14 additional recurrent HBV target genes, greatly expanding the HBV recurrent target list. This global survey of HBV integration events, together with recently published whole-genome sequencing analyses, furthered our understanding of the HBV–related HCC. PMID:23236287
Rapid Hypothesis Testing with Candida albicans through Gene Disruption with Short Homology Regions
Wilson, R. Bryce; Davis, Dana; Mitchell, Aaron P.
1999-01-01
Disruption of newly identified genes in the pathogen Candida albicans is a vital step in determination of gene function. Several gene disruption methods described previously employ long regions of homology flanking a selectable marker. Here, we describe disruption of C. albicans genes with PCR products that have 50 to 60 bp of homology to a genomic sequence on each end of a selectable marker. We used the method to disrupt two known genes, ARG5 and ADE2, and two sequences newly identified through the Candida genome project, HRM101 and ENX3. HRM101 and ENX3 are homologous to genes in the conserved RIM101 (previously called RIM1) and PacC pathways of Saccharomyces cerevisiae and Aspergillus nidulans. We show that three independent hrm101/hrm101 mutants and two independent enx3/enx3 mutants are defective in filamentation on Spider medium. These observations argue that HRM101 and ENX3 sequences are indeed portions of genes and that the respective gene products have related functions. PMID:10074081
2012-01-01
Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742
Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation
Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu
2017-01-01
Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271
Gardiner, Laura-Jayne; Gawroński, Piotr; Olohan, Lisa; Schnurbusch, Thorsten; Hall, Neil; Hall, Anthony
2014-12-01
Mapping-by-sequencing analyses have largely required a complete reference sequence and employed whole genome re-sequencing. In species such as wheat, no finished genome reference sequence is available. Additionally, because of its large genome size (17 Gb), re-sequencing at sufficient depth of coverage is not practical. Here, we extend the utility of mapping by sequencing, developing a bespoke pipeline and algorithm to map an early-flowering locus in einkorn wheat (Triticum monococcum L.) that is closely related to the bread wheat genome A progenitor. We have developed a genomic enrichment approach using the gene-rich regions of hexaploid bread wheat to design a 110-Mbp NimbleGen SeqCap EZ in solution capture probe set, representing the majority of genes in wheat. Here, we use the capture probe set to enrich and sequence an F2 mapping population of the mutant. The mutant locus was identified in T. monococcum, which lacks a complete genome reference sequence, by mapping the enriched data set onto pseudo-chromosomes derived from the capture probe target sequence, with a long-range order of genes based on synteny of wheat with Brachypodium distachyon. Using this approach we are able to map the region and identify a set of deleted genes within the interval. © 2014 The Authors.The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.
Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pennacchio, L.A.
1994-05-06
We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.
Genome-wide identification of lineage-specific genes in Arabidopsis, Oryza and Populus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Xiaohan; Jawdy, Sara; Tschaplinski, Timothy J
2009-01-01
Protein sequences were compared among Arabidopsis, Oryza and Populus to identify differential gene (DG) sets that are in one but not the other two genomes. The DG sets were screened against a plant transcript database, the NR protein database and six newly-sequenced genomes (Carica, Glycine, Medicago, Sorghum, Vitis and Zea) to identify a set of species-specific genes (SS). Gene expression, protein motif and intron number were examined. 192, 641 and 109 SS genes were identified in Arabidopsis, Oryza and Populus, respectively. Some SS genes were preferentially expressed in flowers, roots, xylem and cambium or up-regulated by stress. Six conserved motifsmore » in Arabidopsis and Oryza SS proteins were found in other distant lineages. The SS gene sets were enriched with intronless genes. The results reflect functional and/or anatomical differences between monocots and eudicots or between herbaceous and woody plants. The Populus-specific genes are candidates for carbon sequestration and biofuel research.« less
Al-Bustan, Suzanne A; Al-Serri, Ahmad; Annice, Babitha G; Alnaqeeb, Majed A; Al-Kandari, Wafa Y; Dashti, Mohammed
2018-01-01
The role interethnic genetic differences play in plasma lipid level variation across populations is a global health concern. Several genes involved in lipid metabolism and transport are strong candidates for the genetic association with lipid level variation especially lipoprotein lipase (LPL). The objective of this study was to re-sequence the full LPL gene in Kuwaiti Arabs, analyse the sequence variation and identify variants that could attribute to variation in plasma lipid levels for further genetic association. Samples (n = 100) of an Arab ethnic group from Kuwait were analysed for sequence variation by Sanger sequencing across the 30 Kb LPL gene and its flanking sequences. A total of 293 variants including 252 single nucleotide polymorphisms (SNPs) and 39 insertions/deletions (InDels) were identified among which 47 variants (32 SNPs and 15 InDels) were novel to Kuwaiti Arabs. This study is the first to report sequence data and analysis of frequencies of variants at the LPL gene locus in an Arab ethnic group with a novel "rare" variant (LPL:g.18704C>A) significantly associated to HDL (B = -0.181; 95% CI (-0.357, -0.006); p = 0.043), TG (B = 0.134; 95% CI (0.004-0.263); p = 0.044) and VLDL (B = 0.131; 95% CI (-0.001-0.263); p = 0.043) levels. Sequence variation in Kuwaiti Arabs was compared to other populations and was found to be similar with regards to the number of SNPs, InDels and distribution of the number of variants across the LPL gene locus and minor allele frequency (MAF). Moreover, comparison of the identified variants and their MAF with other reports provided a list of 46 potential variants across the LPL gene to be considered for future genetic association studies. The findings warrant further investigation into the association of g.18704C>A with lipid levels in other ethnic groups and with clinical manifestations of dyslipidemia.
Al-Serri, Ahmad; Annice, Babitha G.; Alnaqeeb, Majed A.; Al-Kandari, Wafa Y.; Dashti, Mohammed
2018-01-01
The role interethnic genetic differences play in plasma lipid level variation across populations is a global health concern. Several genes involved in lipid metabolism and transport are strong candidates for the genetic association with lipid level variation especially lipoprotein lipase (LPL). The objective of this study was to re-sequence the full LPL gene in Kuwaiti Arabs, analyse the sequence variation and identify variants that could attribute to variation in plasma lipid levels for further genetic association. Samples (n = 100) of an Arab ethnic group from Kuwait were analysed for sequence variation by Sanger sequencing across the 30 Kb LPL gene and its flanking sequences. A total of 293 variants including 252 single nucleotide polymorphisms (SNPs) and 39 insertions/deletions (InDels) were identified among which 47 variants (32 SNPs and 15 InDels) were novel to Kuwaiti Arabs. This study is the first to report sequence data and analysis of frequencies of variants at the LPL gene locus in an Arab ethnic group with a novel “rare” variant (LPL:g.18704C>A) significantly associated to HDL (B = -0.181; 95% CI (-0.357, -0.006); p = 0.043), TG (B = 0.134; 95% CI (0.004–0.263); p = 0.044) and VLDL (B = 0.131; 95% CI (-0.001–0.263); p = 0.043) levels. Sequence variation in Kuwaiti Arabs was compared to other populations and was found to be similar with regards to the number of SNPs, InDels and distribution of the number of variants across the LPL gene locus and minor allele frequency (MAF). Moreover, comparison of the identified variants and their MAF with other reports provided a list of 46 potential variants across the LPL gene to be considered for future genetic association studies. The findings warrant further investigation into the association of g.18704C>A with lipid levels in other ethnic groups and with clinical manifestations of dyslipidemia. PMID:29438437
Deakin, Janine E; Edwards, Melanie J; Patel, Hardip; O'Meally, Denis; Lian, Jinmin; Stenhouse, Rachael; Ryan, Sam; Livernois, Alexandra M; Azad, Bhumika; Holleley, Clare E; Li, Qiye; Georges, Arthur
2016-06-10
Squamates (lizards and snakes) are a speciose lineage of reptiles displaying considerable karyotypic diversity, particularly among lizards. Understanding the evolution of this diversity requires comparison of genome organisation between species. Although the genomes of several squamate species have now been sequenced, only the green anole lizard has any sequence anchored to chromosomes. There is only limited gene mapping data available for five other squamates. This makes it difficult to reconstruct the events that have led to extant squamate karyotypic diversity. The purpose of this study was to anchor the recently sequenced central bearded dragon (Pogona vitticeps) genome to chromosomes to trace the evolution of squamate chromosomes. Assigning sequence to sex chromosomes was of particular interest for identifying candidate sex determining genes. By using two different approaches to map conserved blocks of genes, we were able to anchor approximately 42 % of the dragon genome sequence to chromosomes. We constructed detailed comparative maps between dragon, anole and chicken genomes, and where possible, made broader comparisons across Squamata using cytogenetic mapping information for five other species. We show that squamate macrochromosomes are relatively well conserved between species, supporting findings from previous molecular cytogenetic studies. Macrochromosome diversity between members of the Toxicofera clade has been generated by intrachromosomal, and a small number of interchromosomal, rearrangements. We reconstructed the ancestral squamate macrochromosomes by drawing upon comparative cytogenetic mapping data from seven squamate species and propose the events leading to the arrangements observed in representative species. In addition, we assigned over 8 Mbp of sequence containing 219 genes to the Z chromosome, providing a list of genes to begin testing as candidate sex determining genes. Anchoring of the dragon genome has provided substantial insight into the evolution of squamate genomes, enabling us to reconstruct ancestral macrochromosome arrangements at key positions in the squamate phylogeny, demonstrating that fusions between macrochromosomes or fusions of macrochromosomes and microchromosomes, have played an important role during the evolution of squamate genomes. Assigning sequence to the sex chromosomes has identified NR5A1 as a promising candidate sex determining gene in the dragon.
Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M
2014-06-01
It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.
Sun, Haiyue; Liu, Yushan; Gai, Yuzhuo; Geng, Jinman; Chen, Li; Liu, Hongdi; Kang, Limin; Tian, Youwen; Li, Yadong
2015-09-02
Cranberries (Vaccinium macrocarpon Ait.), renowned for their excellent health benefits, are an important berry crop. Here, we performed transcriptome sequencing of one cranberry cultivar, from fruits at two different developmental stages, on the Illumina HiSeq 2000 platform. Our main goals were to identify putative genes for major metabolic pathways of bioactive compounds and compare the expression patterns between white fruit (W) and red fruit (R) in cranberry. In this study, two cDNA libraries of W and R were constructed. Approximately 119 million raw sequencing reads were generated and assembled de novo, yielding 57,331 high quality unigenes with an average length of 739 bp. Using BLASTx, 38,460 unigenes were identified as putative homologs of annotated sequences in public protein databases, including NCBI NR, NT, Swiss-Prot, KEGG, COG and GO. Of these, 21,898 unigenes mapped to 128 KEGG pathways, with the metabolic pathways, secondary metabolites, glycerophospholipid metabolism, ether lipid metabolism, starch and sucrose metabolism, purine metabolism, and pyrimidine metabolism being well represented. Among them, many candidate genes were involved in flavonoid biosynthesis, transport and regulation. Furthermore, digital gene expression (DEG) analysis identified 3,257 unigenes that were differentially expressed between the two fruit developmental stages. In addition, 14,473 simple sequence repeats (SSRs) were detected. Our results present comprehensive gene expression information about the cranberry fruit transcriptome that could facilitate our understanding of the molecular mechanisms of fruit development in cranberries. Although it will be necessary to validate the functions carried out by these genes, these results could be used to improve the quality of breeding programs for the cranberry and related species.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B
1995-01-01
Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.
Guo, Yahong; Tsuruga, Ayako; Yamaguchi, Shigeharu; Oba, Koji; Iwai, Kasumi; Sekita, Setsuko; Mizukami, Hajime
2006-06-01
Chloroplast chlB gene encoding subunit B of light-independent protochlorophyllide reductase was amplified from herbarium and crude drug specimens of Ephedra sinica, E. intermedia, E. equisetina, and E. przewalskii. Sequence comparison of the chlB gene indicated that all the E. sinica specimens have the same sequence type (Type S) distinctive from other species, while there are two sequence types (Type E1 and Type E2) in E. equisetina. E. intermedia and E. prezewalskii revealed an identical sequence type (Type IP). E. sinica was also identified by digesting the chlB fragment with Bcl I. A novel method for DNA authentication of Ephedra Herb based on the sequences of the chloroplast chlB gene and internal transcribed spacer of nuclear rRNA genes was developed and successfully applied for identification of the crude drugs obtained in the Chinese market.
Yong, Delicia; Tee, Kok Keng; Yin, Wai-Fong; Chan, Kok-Gan
2016-01-01
To date, information on plasmid analysis in Pandoraea spp. is scarce. To address the gap of knowledge on this, the complete sequences of eight plasmids from Pandoraea spp. namely Pandoraea faecigallinarum DSM 23572T (pPF72-1, pPF72-2), Pandoraea oxalativorans DSM 23570T (pPO70-1, pPO70-2, pPO70-3, pPO70-4), Pandoraea vervacti NS15 (pPV15) and Pandoraea apista DSM 16535T (pPA35) were studied for the first time in this study. The information on plasmid sequences in Pandoraea spp. is useful as the sequences did not match any known plasmid sequence deposited in public databases. Replication genes were not identified in some plasmids, a situation that has led to the possibility of host interaction involvement. Some plasmids were also void of par genes and intriguingly, repA gene was also not discovered in these plasmids. This further leads to the hypothesis of host-plasmid interaction. Plasmid stabilization/stability protein-encoding genes were observed in some plasmids but were not established for participating in plasmid segregation. Toxin-antitoxin systems MazEF, VapBC, RelBE, YgiT-MqsR, HigBA, and ParDE were identified across the plasmids and their presence would improve plasmid maintenance. Conjugation genes were identified portraying the conjugation ability amongst Pandoraea plasmids. Additionally, we found a shared region amongst some of the plasmids that consists of conjugation genes. The identification of genes involved in replication, segregation, toxin-antitoxin systems and conjugation, would aid the design of drugs to prevent the survival or transmission of plasmids carrying pathogenic properties. Additionally, genes conferring virulence and antibiotic resistance were identified amongst the plasmids. The observed features in the plasmids shed light on the Pandoraea spp. as opportunistic pathogens. PMID:27790203
Zhou, Fusheng; Fu, Hongyang; Liu, Linghua; Cui, Yong; Zhang, Zhengzhong; Chang, Ruixue; Yue, Zhen; Yang, Sen; Zhang, Xuejun
2014-09-01
Progressive symmetric erythrokeratodermia (PSEK) is characterized by symmetric and growing erythematous hyperkeratotic patches over the body shortly after birth, particularly trunk and limbs, the buttocks, and the face, sometimes together with palmoplantar keratoderma (PPK). The GJB2, GJB3, GJB4, GJB6, ARS (Component B), and LOR gene mutation might contribute to PSEK manifestation. This study aimed to identify sequence alteration of these genes in a Chinese PSEK patient with pseudoainhum. Genomic DNA was purified from the patient's peripheral blood. Mutation analysis of target genes was performed by direct sequencing using ABI 3730 sequencer No exonic mutations was identified in the aforementioned genes. The result underlines the genetic heterogeneity of PSEK and other related erythrokeratodermas. © 2014 The International Society of Dermatology.
[Mutation analysis of beta myosin heavy chain gene in hypertrophic cardiomyopathy families].
Fan, Xin-ping; Yang, Zhong-wei; Feng, Xiu-li; Yang, Fu-hui; Xiao, Bai; Liang, Yan
2011-08-01
To detect the gene mutations of beta-myosin heavy chain gene (MYH7) in Chinese pedigrees with hypertrophic cardiomyopathy (HCM), and to analyze the correlation between the genotype and phenotype. Exons 3, 5, 7-9, 11-16 and 18-23 of the MYH7 gene were amplified with PCR in three Chinese pedigrees with HCM. The products were sequenced. Sequence alignment between the detected and the standard sequences was performed. A missense mutation of Thr441Met in exon 14 was identified in a pedigree, which was not detected in the controls. Several synonymous mutations of MYH7 gene were detected in the three pedigrees. The mutation of Thr441Met, located in the actin binding domain of the globular head, was first identified in Chinese. It probably caused HCM. HCM is a heterogeneous disease. Many factors are involved in the process of its occurrence and development.
Chassaing, Nicolas; Vigouroux, Adeline; Calvas, Patrick
2009-06-01
Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (SOX2, OTX2, RAX, and CHX10) have been implicated in isolated micro/anophthalmia, but causative mutations of these genes explain less than a quarter of these developmental defects. A specifically conserved SOX2/OTX2-mediated RAX expression regulatory sequence has recently been identified. We postulated that mutations in this sequence could lead to micro/anophthalmia, and thus we performed molecular screening of this regulatory element in patients suffering from micro/anophthalmia. Fifty-one patients suffering from nonsyndromic microphthalmia (n = 40) or anophthalmia (n = 11) were included in this study after negative molecular screening for SOX2, OTX2, RAX, and CHX10 mutations. Mutation screening of the RAX regulatory sequence was performed by direct sequencing for these patients. No mutations were identified in the highly conserved RAX regulatory sequence in any of the 51 patients. Mutations in the newly identified RAX regulatory sequence do not represent a frequent cause of nonsyndromic micro/anophthalmia.
Takeda, Haruna; Rust, Alistair G.; Ward, Jerrold M.; Yew, Christopher Chin Kuan; Jenkins, Nancy A.; Copeland, Neal G.
2016-01-01
Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4+/− mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC. PMID:27006499
Takeda, Haruna; Rust, Alistair G; Ward, Jerrold M; Yew, Christopher Chin Kuan; Jenkins, Nancy A; Copeland, Neal G
2016-04-05
Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4(+/-) mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC.
Regularized rare variant enrichment analysis for case-control exome sequencing data.
Larson, Nicholas B; Schaid, Daniel J
2014-02-01
Rare variants have recently garnered an immense amount of attention in genetic association analysis. However, unlike methods traditionally used for single marker analysis in GWAS, rare variant analysis often requires some method of aggregation, since single marker approaches are poorly powered for typical sequencing study sample sizes. Advancements in sequencing technologies have rendered next-generation sequencing platforms a realistic alternative to traditional genotyping arrays. Exome sequencing in particular not only provides base-level resolution of genetic coding regions, but also a natural paradigm for aggregation via genes and exons. Here, we propose the use of penalized regression in combination with variant aggregation measures to identify rare variant enrichment in exome sequencing data. In contrast to marginal gene-level testing, we simultaneously evaluate the effects of rare variants in multiple genes, focusing on gene-based least absolute shrinkage and selection operator (LASSO) and exon-based sparse group LASSO models. By using gene membership as a grouping variable, the sparse group LASSO can be used as a gene-centric analysis of rare variants while also providing a penalized approach toward identifying specific regions of interest. We apply extensive simulations to evaluate the performance of these approaches with respect to specificity and sensitivity, comparing these results to multiple competing marginal testing methods. Finally, we discuss our findings and outline future research. © 2013 WILEY PERIODICALS, INC.
Recombination in feline immunodeficiency virus from feral and companion domestic cats.
Hayward, Jessica J; Rodrigo, Allen G
2008-06-17
Recombination is a relatively common phenomenon in retroviruses. We investigated recombination in Feline Immunodeficiency Virus from naturally-infected New Zealand domestic cats (Felis catus) by sequencing regions of the gag, pol and env genes. The occurrence of intragenic recombination was highest in env, with evidence of recombination in 6.4% (n = 156) of all cats. A further recombinant was identified in each of the gag (n = 48) and pol (n = 91) genes. Comparisons of phylogenetic trees across genes identified cases of incongruence, indicating intergenic recombination. Three (7.7%, n = 39) of these incongruencies were found to be significantly different using the Shimodaira-Hasegawa test.Surprisingly, our phylogenies from the gag and pol genes showed that no New Zealand sequences group with reference subtype C sequences within intrasubtype pairwise distances. Indeed, we find one and two distinct unknown subtype groups in gag and pol, respectively. These observations cause us to speculate that these New Zealand FIV strains have undergone several recombination events between subtype A parent strains and undefined unknown subtype strains, similar to the evolutionary history hypothesised for HIV-1 "subtype E".Endpoint dilution sequencing was used to confirm the consensus sequences of the putative recombinants and unknown subtype groups, providing evidence for the authenticity of these sequences. Endpoint dilution sequencing also resulted in the identification of a dual infection event in the env gene. In addition, an intrahost recombination event between variants of the same subtype in the pol gene was established. This is the first known example of naturally-occurring recombination in a cat with infection of the parent strains. Evidence of intragenic recombination in the gag, pol and env regions, and complex intergenic recombination, of FIV from naturally-infected domestic cats in New Zealand was found. Strains of unknown subtype were identified in all three gene regions. These results have implications for the use of the current FIV vaccine in New Zealand.
Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John
2014-01-01
Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.
HomSI: a homozygous stretch identifier from next-generation sequencing data.
Görmez, Zeliha; Bakir-Gungor, Burcu; Sagiroglu, Mahmut Samil
2014-02-01
In consanguineous families, as a result of inheriting the same genomic segments through both parents, the individuals have stretches of their genomes that are homozygous. This situation leads to the prevalence of recessive diseases among the members of these families. Homozygosity mapping is based on this observation, and in consanguineous families, several recessive disease genes have been discovered with the help of this technique. The researchers typically use single nucleotide polymorphism arrays to determine the homozygous regions and then search for the disease gene by sequencing the genes within this candidate disease loci. Recently, the advent of next-generation sequencing enables the concurrent identification of homozygous regions and the detection of mutations relevant for diagnosis, using data from a single sequencing experiment. In this respect, we have developed a novel tool that identifies homozygous regions using deep sequence data. Using *.vcf (variant call format) files as an input file, our program identifies the majority of homozygous regions found by microarray single nucleotide polymorphism genotype data. HomSI software is freely available at www.igbam.bilgem.tubitak.gov.tr/softwares/HomSI, with an online manual.
Pham, Nikki T.; Wei, Tong; Schackwitz, Wendy S.; Lipzen, Anna M.; Duong, Phat Q.; Jones, Kyle C.; Ruan, Deling; Bauer, Diane; Peng, Yi; Schmutz, Jeremy
2017-01-01
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. PMID:28576844
2011-01-01
Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt), we have generated Expressed Sequence Tags (ESTs) by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores) and asexual (germinated urediniospores) stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum), 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs). Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt) and stripe rust, P. striiformis f. sp. tritici (Pst), and poplar leaf rust Melampsora species, and the corn smut fungus, Ustilago maydis (Um). While extensive homologies were found, many genes appeared novel and species-specific; over 40% of genes did not match any known sequence in existing databases. Focusing on spore stages, direct comparison to Um identified potential functional homologs, possibly allowing heterologous functional analysis in that model fungus. Many potentially secreted protein genes were identified by similarity searches against genes and proteins of Pgt and Melampsora spp., revealing apparent orthologs. Conclusions The current set of Pt unigenes contributes to gene discovery in this major cereal pathogen and will be invaluable for gene model verification in the genome sequence. PMID:21435244
Jo, Yeong Deuk; Ha, Yeaseong; Lee, Joung-Ho; Park, Minkyu; Bergsma, Alex C; Choi, Hong-Il; Goritschnig, Sandra; Kloosterman, Bjorn; van Dijk, Peter J; Choi, Doil; Kang, Byoung-Cheorl
2016-10-01
Using fine mapping techniques, the genomic region co-segregating with Restorer - of - fertility ( Rf ) in pepper was delimited to a region of 821 kb in length. A PPR gene in this region, CaPPR6 , was identified as a strong candidate for Rf based on expression pattern and characteristics of encoding sequence. Cytoplasmic-genic male sterility (CGMS) has been used for the efficient production of hybrid seeds in peppers (Capsicum annuum L.). Although the mitochondrial candidate genes that might be responsible for cytoplasmic male sterility (CMS) have been identified, the nuclear Restorer-of-fertility (Rf) gene has not been isolated. To identify the genomic region co-segregating with Rf in pepper, we performed fine mapping using an Rf-segregating population consisting of 1068 F2 individuals, based on BSA-AFLP and a comparative mapping approach. Through six cycles of chromosome walking, the co-segregating region harboring the Rf locus was delimited to be within 821 kb of sequence. Prediction of expressed genes in this region based on transcription analysis revealed four candidate genes. Among these, CaPPR6 encodes a pentatricopeptide repeat (PPR) protein with PPR motifs that are repeated 14 times. Characterization of the CaPPR6 protein sequence, based on alignment with other homologs, showed that CaPPR6 is a typical Rf-like (RFL) gene reported to have undergone diversifying selection during evolution. A marker developed from a sequence near CaPPR6 showed a higher prediction rate of the Rf phenotype than those of previously developed markers when applied to a panel of breeding lines of diverse origin. These results suggest that CaPPR6 is a strong candidate for the Rf gene in pepper.
Sun, Hokeun; Wang, Shuang
2014-08-15
Existing association methods for rare variants from sequencing data have focused on aggregating variants in a gene or a genetic region because of the fact that analysing individual rare variants is underpowered. However, these existing rare variant detection methods are not able to identify which rare variants in a gene or a genetic region of all variants are associated with the complex diseases or traits. Once phenotypic associations of a gene or a genetic region are identified, the natural next step in the association study with sequencing data is to locate the susceptible rare variants within the gene or the genetic region. In this article, we propose a power set-based statistical selection procedure that is able to identify the locations of the potentially susceptible rare variants within a disease-related gene or a genetic region. The selection performance of the proposed selection procedure was evaluated through simulation studies, where we demonstrated the feasibility and superior power over several comparable existing methods. In particular, the proposed method is able to handle the mixed effects when both risk and protective variants are present in a gene or a genetic region. The proposed selection procedure was also applied to the sequence data on the ANGPTL gene family from the Dallas Heart Study to identify potentially susceptible rare variants within the trait-related genes. An R package 'rvsel' can be downloaded from http://www.columbia.edu/∼sw2206/ and http://statsun.pusan.ac.kr. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.
Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad
2016-09-01
Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.
Santos, Regie Lyn P.; El-Shanti, Hatem; Sikandar, Shaheen; Lee, Kwanghyuk; Bhatti, Attya; Yan, Kai; Chahrour, Maria H.; McArthur, Nathan; Pham, Thanh L.; Mahasneh, Amjad Abdullah; Ahmad, Wasim
2010-01-01
To date, 37 genes have been identified for nonsyndromic hearing impairment (NSHI). Identifying the functional sequence variants within these genes and knowing their population-specific frequencies is of public health value, in particular for genetic screening for NSHI. To determine putatively functional sequence variants in the transmembrane inner ear (TMIE) gene in Pakistani and Jordanian families with autosomal recessive (AR) NSHI, four Jordanian and 168 Pakistani families with ARNSHI that is not due to GJB2 (CX26) were submitted to a genome scan. Two-point and multipoint parametric linkage analyses were performed, and families with logarithmic odds (LOD) scores of 1.0 or greater within the TMIE region underwent further DNA sequencing. The evolutionary conservation and location in predicted protein domains of amino acid residues where sequence variants occurred were studied to elucidate the possible effects of these sequence variants on function. Of seven families that were screened for TMIE, putatively functional sequence variants were found to segregate with hearing impairment in four families but were not seen in not less than 110 ethnically matched control chromosomes. The previously reported c.241C>T (p.R81C) variant was observed in two Pakistani families. Two novel variants, c.92A>G (p.E31G) and the splice site mutation c.212–2A>C, were identified in one Pakistani and one Jordanian family, respectively. The c.92A>G (p.E31G) variant occurred at a residue that is conserved in the mouse and is predicted to be extracellular. Conservation and potential functionality of previously published mutations were also examined. The prevalence of functional TMIE variants in Pakistani families is 1.7% [95% confidence interval (CI) 0.3–4.8]. Further studies on the spectrum, prevalence rates, and functional effect of sequence variants in the TMIE gene in other populations should demonstrate the true importance of this gene as a cause of hearing impairment. PMID:16389551
Bousfiha, Amale; Bakhchane, Amina; Charoute, Hicham; Detsouli, Mustapha; Rouba, Hassan; Charif, Majida; Lenaers, Guy; Barakat, Abdelhamid
2017-10-01
In the present work, we identified two novel compound heterozygote mutations in the GPR98 (G protein-coupled receptor 98) gene causing Usher syndrome. Whole-exome sequencing was performed to study the genetic causes of Usher syndrome in a Moroccan family with three affected siblings. We identify two novel compound heterozygote mutations (c.1054C > A, c.16544delT) in the GPR98 gene in the three affected siblings carrying post-linguale bilateral moderate hearing loss with normal vestibular functions and before installing visual disturbances. This is the first time that mutations in the GPR98 gene are described in the Moroccan deaf patients.
Chin, Ephrem L H; da Silva, Cristina; Hegde, Madhuri
2013-02-19
Detecting mutations in disease genes by full gene sequence analysis is common in clinical diagnostic laboratories. Sanger dideoxy terminator sequencing allows for rapid development and implementation of sequencing assays in the clinical laboratory, but it has limited throughput, and due to cost constraints, only allows analysis of one or at most a few genes in a patient. Next-generation sequencing (NGS), on the other hand, has evolved rapidly, although to date it has mainly been used for large-scale genome sequencing projects and is beginning to be used in the clinical diagnostic testing. One advantage of NGS is that many genes can be analyzed easily at the same time, allowing for mutation detection when there are many possible causative genes for a specific phenotype. In addition, regions of a gene typically not tested for mutations, like deep intronic and promoter mutations, can also be detected. Here we use 20 previously characterized Sanger-sequenced positive controls in disease-causing genes to demonstrate the utility of NGS in a clinical setting using standard PCR based amplification to assess the analytical sensitivity and specificity of the technology for detecting all previously characterized changes (mutations and benign SNPs). The positive controls chosen for validation range from simple substitution mutations to complex deletion and insertion mutations occurring in autosomal dominant and recessive disorders. The NGS data was 100% concordant with the Sanger sequencing data identifying all 119 previously identified changes in the 20 samples. We have demonstrated that NGS technology is ready to be deployed in clinical laboratories. However, NGS and associated technologies are evolving, and clinical laboratories will need to invest significantly in staff and infrastructure to build the necessary foundation for success.
Harvala, Heli; Wiman, Åsa; Wallensten, Anders; Zakikhany, Katherina; Englund, Hélène; Brytting, Maria
2016-02-15
It is increasingly difficult to differentiate measles viruses (MeVs) relating to certain outbreaks on the basis of the nucleoprotein (N) gene sequence only, as the diversity of circulating MeV strains has decreased. We studied genomic regions that could provide better molecular discrimination between epidemiologically linked and unlinked MeV variants identified in Sweden during 2013-2014. The hemagglutinin (H) gene and hypervariable region between the fusion and matrix genes (MF-HVR) from 53 MeV-positive samples were amplified and sequenced. Data on phylogenetic clustering of MeVs on the basis of N, H, and MF-HVR sequences were compared to epidemiological data. MeVs were genotyped: 27 were B3, and 26 were D8. One genotype B3 cluster based on the N gene sequence contained epidemiologically unrelated viruses from 4 outbreaks, whereas analysis of H and MF-HVR sequences separated them into phylogenetic clusters consistent with the epidemiological data. Similarly, the single cluster of viruses with a genotype D8 N gene could be divided into the 5 outbreak groups on the basis of the phylogeny of MF-HVR sequences. A detailed picture of MeV circulation with more-defined links between outbreaks was obtained by sequencing the H gene and MF-HVR. Further identification and better genetic characterization of MeVs internationally is essential in identifying sources and routes of MeV spread within and beyond Europe in the elimination end game. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Reddy, Ramesh; Fahiminiya, Somayyeh; El Zir, Elie; Mansour, Ahmad; Megarbane, Andre; Majewski, Jacek; Slim, Rima
2014-01-01
Background Usher syndrome (USH) is a genetically heterogeneous condition with ten disease-causing genes. The spectrum of genes and mutations causing USH in the Lebanese and Middle Eastern populations has not been described. Consequently, diagnostic approaches designed to screen for previously reported mutations were unlikely to identify the mutations in 11 unrelated families, eight of Lebanese and three of Middle Eastern origins. In addition, six of the ten USH genes consist of more than 20 exons, each, which made mutational analysis by Sanger sequencing of PCR-amplified exons from genomic DNA tedious and costly. The study was aimed at the identification of USH causing genes and mutations in 11 unrelated families with USH type I or II. Methods Whole exome sequencing followed by expanded familial validation by Sanger sequencing. Results We identified disease-causing mutations in all the analyzed patients in four USH genes, MYO7A, USH2A, GPR98 and CDH23. Eleven of the mutations were novel and protein truncating, including a complex rearrangement in GPR98. Conclusion Our data highlight the genetic diversity of Usher syndrome in the Lebanese population and the time and cost-effectiveness of whole exome sequencing approach for mutation analysis of genetically heterogeneous conditions caused by large genes. PMID:25211151
Reddy, Ramesh; Fahiminiya, Somayyeh; El Zir, Elie; Mansour, Ahmad; Megarbane, Andre; Majewski, Jacek; Slim, Rima
2014-01-01
Usher syndrome (USH) is a genetically heterogeneous condition with ten disease-causing genes. The spectrum of genes and mutations causing USH in the Lebanese and Middle Eastern populations has not been described. Consequently, diagnostic approaches designed to screen for previously reported mutations were unlikely to identify the mutations in 11 unrelated families, eight of Lebanese and three of Middle Eastern origins. In addition, six of the ten USH genes consist of more than 20 exons, each, which made mutational analysis by Sanger sequencing of PCR-amplified exons from genomic DNA tedious and costly. The study was aimed at the identification of USH causing genes and mutations in 11 unrelated families with USH type I or II. Whole exome sequencing followed by expanded familial validation by Sanger sequencing. We identified disease-causing mutations in all the analyzed patients in four USH genes, MYO7A, USH2A, GPR98 and CDH23. Eleven of the mutations were novel and protein truncating, including a complex rearrangement in GPR98. Our data highlight the genetic diversity of Usher syndrome in the Lebanese population and the time and cost-effectiveness of whole exome sequencing approach for mutation analysis of genetically heterogeneous conditions caused by large genes.
Long Term Follow up of the Delayed Effects of Acute Radiation Exposure in Primates
2017-10-01
66 of 94 We will then use shRNAs and/or CRISPR constructs targeting the gene of interest to knock down its expression in stem cells prior to...DLBCLs Mutational profiling identifies 150 driver genes Gene expression identifies sub- groups including cell of origin Unbiased CRISPR screen...Exome sequencing in 1,001 DLBCL patients comprehensively identifies 150 driver genes d Unbiased CRISPR screen in DLBCL cell lines identifies essential
Liu, Minrui; Lin, Pengwu; Qi, Xing'e; Ni, Yongqing
2016-04-14
The purpose of the study was to reveal geographic region-related Acidithiobacillus spp. distribution and allopatric speciation. Phylogenetic and diversity analysis was done to expand our knowledge on microbial phylogeography, diversity-maintaining mechanisms and molecular biogeography. We amplified 16S rRNA gene and RubisCO genes to construct corresponding phylogenetic trees based on the sequence homology and analyzed genetic diversity of Acidithiobacillus spp.. Thirty-five strains were isolated from three different regions in China (Yunnan, Hubei, Xinjiang). The whole isolates were classified into five groups. Four strains were identified as A. ferrivorans, six as A. ferridurans, YNTR4-15 Leptspirillum ferrooxidans and HBDY3-31 as Leptospirillum ferrodiazotrophum. The remaining strains were identified as A. ferrooxidans. Analysis of cbbL and cbbM genes sequences of representative 26 strains indicated that cbbL gene of 19 were two copies (cbbL1 and cbbL2) and 7 possessed only cbbL1. cbbM gene was single copy. In nucleotide-based trees, cbbL1 gene sequences of strains were separated into three sequence types, and the cbbL2 was similar to cbbL1 with three types. Codon bias of RubisCO genes was not obvious in Acidithiobacillus spp.. Strains isolated from three different regions in China indicated a great genetic diversity in Acidithiobacillus spp. and their 16S rRNA/RubisCO genes sequence was of significant difference. Phylogenetic tree based on 16S rRNA genes and RubisCO genes was different in Acidithiobacillus spp..
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gault, J.; Zonana, J.; Zeltinger, J.
A conserved mouse genomic clone was used to identify a homologous human genomic clone (the DXS732E locus), which was subsequently employed to isolate cDNAs from a human fetal brain library. Nine unique overlapping cDNAs were isolated, and sequences analysis of 3.9 kb identified a putative 1 kb ORF. GRAIL analysis of the sequence supported the hypothesis that the putative ORF was coding sequence, and Prosite analysis of the putative ORF identified potential glycosylation and phosphorylation sites. The 5{prime} end of the gene maps within a CpG island, and comparison of cDNA sequences indicate the gene is alternatively spliced at itsmore » 3{prime} end. Northern analysis and RT-PCR indicate that two different sized messages appear to be expressed with the gene expressed in human fetal kidney, intestine, brain, and muscle. The gene is expressed in 77 day human skin, a time when hair follicle formation occurs. Anhidrotic ectodermal dysplasia (EDA) results in the abnormal morphogenesis of hair, teeth and eccrine sweat glands. A positional cloning strategy towards cloning the EDA gene had been used, and deletion and X-autosome translocation patients have been useful in further delimiting the EDA region. The present gene at the DXS732E locus is partially deleted in one EDA patient who does not have other apparent abnormalities. No rearrangements of the gene have been detected in two female X-autosome translocation EDA patients, nor in four additional male patients with submicroscopic molecular deletions.« less
High-throughput identification of antigen-specific TCRs by TCR gene capture.
Linnemann, Carsten; Heemskerk, Bianca; Kvistborg, Pia; Kluin, Roelof J C; Bolotin, Dmitriy A; Chen, Xiaojing; Bresser, Kaspar; Nieuwland, Marja; Schotte, Remko; Michels, Samira; Gomez-Eerland, Raquel; Jahn, Lorenz; Hombrink, Pleun; Legrand, Nicolas; Shu, Chengyi Jenny; Mamedov, Ilgar Z; Velds, Arno; Blank, Christian U; Haanen, John B A G; Turchaninova, Maria A; Kerkhoven, Ron M; Spits, Hergen; Hadrup, Sine Reker; Heemskerk, Mirjam H M; Blankenstein, Thomas; Chudakov, Dmitriy M; Bendle, Gavin M; Schumacher, Ton N M
2013-11-01
The transfer of T cell receptor (TCR) genes into patient T cells is a promising approach for the treatment of both viral infections and cancer. Although efficient methods exist to identify antibodies for the treatment of these diseases, comparable strategies to identify TCRs have been lacking. We have developed a high-throughput DNA-based strategy to identify TCR sequences by the capture and sequencing of genomic DNA fragments encoding the TCR genes. We establish the value of this approach by assembling a large library of cancer germline tumor antigen-reactive TCRs. Furthermore, by exploiting the quantitative nature of TCR gene capture, we show the feasibility of identifying antigen-specific TCRs in oligoclonal T cell populations from either human material or TCR-humanized mice. Finally, we demonstrate the ability to identify tumor-reactive TCRs within intratumoral T cell subsets without knowledge of antigen specificities, which may be the first step toward the development of autologous TCR gene therapy to target patient-specific neoantigens in human cancer.
Molecular analysis of the anaerobic rumen fungus Orpinomyces - insights into an AT-rich genome.
Nicholson, Matthew J; Theodorou, Michael K; Brookman, Jayne L
2005-01-01
The anaerobic gut fungi occupy a unique niche in the intestinal tract of large herbivorous animals and are thought to act as primary colonizers of plant material during digestion. They are the only known obligately anaerobic fungi but molecular analysis of this group has been hampered by difficulties in their culture and manipulation, and by their extremely high A+T nucleotide content. This study begins to answer some of the fundamental questions about the structure and organization of the anaerobic gut fungal genome. Directed plasmid libraries using genomic DNA digested with highly or moderately rich AT-specific restriction enzymes (VspI and EcoRI) were prepared from a polycentric Orpinomyces isolate. Clones were sequenced from these libraries and the breadth of genomic inserts, both genic and intergenic, was characterized. Genes encoding numerous functions not previously characterized for these fungi were identified, including cytoskeletal, secretory pathway and transporter genes. A peptidase gene with no introns and having sequence similarity to a gene encoding a bacterial peptidase was also identified, extending the range of metabolic enzymes resulting from apparent trans-kingdom transfer from bacteria to fungi, as previously characterized largely for genes encoding plant-degrading enzymes. This paper presents the first thorough analysis of the genic, intergenic and rDNA regions of a variety of genomic segments from an anaerobic gut fungus and provides observations on rules governing intron boundaries, the codon biases observed with different types of genes, and the sequence of only the second anaerobic gut fungal promoter reported. Large numbers of retrotransposon sequences of different types were found and the authors speculate on the possible consequences of any such transposon activity in the genome. The coding sequences identified included several orphan gene sequences, including one with regions strongly suggestive of structural proteins such as collagens and lampirin. This gene was present as a single copy in Orpinomyces, was expressed during vegetative growth and was also detected in genomes from another gut fungal genus, Neocallimastix.
NASA Technical Reports Server (NTRS)
Lopez, J. C.; Ryan, S.; Blankenship, R. E.
1996-01-01
The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.
Li, Xi; Zhu, Yongze; Shen, Mengyuan; Du, Jing; Zhang, Lei; Wang, Dairong
2018-03-01
Enterobacter cloacae is one of the major pathogens responsible for a variety of human infections. Here we report the draft genome sequence of multidrug-resistant E. cloacae strain HBY isolated from a female patient in China. Whole genomic DNA of E. cloacae strain HBY was extracted and was sequenced using an Illumina HiSeq™ 2000 platform. The generated sequence reads were assembled using CLC Genomics Workbench. The draft genome was annotated using Rapid Annotations using Subsystems Technology (RAST), and the presence of antimicrobial resistance genes was identified. The 5799439-bp genome contains various antimicrobial resistance genes conferring resistance to aminoglycosides, β-lactams, fosfomycin, macrolides, sulphonamides and fluoroquinolones. Notably, the strain was identified to carry two main carbapenemase genes (bla KPC-2 and bla NDM-1 ). The genome sequence reported in this study will provide valuable information to understand antibiotic resistance mechanisms in this strain. It is important to monitor the spread strains of Enterobacter sp. encoding both of these carbapenemase genes. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.
He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin
2017-11-01
Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.
Takeda, Jun-ichi; Suzuki, Yutaka; Nakao, Mitsuteru; Barrero, Roberto A.; Koyanagi, Kanako O.; Jin, Lihua; Motono, Chie; Hata, Hiroko; Isogai, Takao; Nagai, Keiichi; Otsuki, Tetsuji; Kuryshev, Vladimir; Shionyu, Masafumi; Yura, Kei; Go, Mitiko; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Wiemann, Stefan; Nomura, Nobuo; Sugano, Sumio; Gojobori, Takashi; Imanishi, Tadashi
2006-01-01
We report the first genome-wide identification and characterization of alternative splicing in human gene transcripts based on analysis of the full-length cDNAs. Applying both manual and computational analyses for 56 419 completely sequenced and precisely annotated full-length cDNAs selected for the H-Invitational human transcriptome annotation meetings, we identified 6877 alternative splicing genes with 18 297 different alternative splicing variants. A total of 37 670 exons were involved in these alternative splicing events. The encoded protein sequences were affected in 6005 of the 6877 genes. Notably, alternative splicing affected protein motifs in 3015 genes, subcellular localizations in 2982 genes and transmembrane domains in 1348 genes. We also identified interesting patterns of alternative splicing, in which two distinct genes seemed to be bridged, nested or having overlapping protein coding sequences (CDSs) of different reading frames (multiple CDS). In these cases, completely unrelated proteins are encoded by a single locus. Genome-wide annotations of alternative splicing, relying on full-length cDNAs, should lay firm groundwork for exploring in detail the diversification of protein function, which is mediated by the fast expanding universe of alternative splicing variants. PMID:16914452
Parkin, Derek B; Archer, Linda L; Childress, April L; Wellehan, James F X
2009-07-01
Bearded dragons (Pogona vitticeps) are popular pets in the United States. Agamid Adenovirus 1 (AgAdV1) is an important infectious agent of bearded dragons. The only AgAdV1 sequences available to date are from a highly conserved region of the DNA polymerase gene. Degenerate primers were designed to amplify a variable region of the AgAdV1 hexon gene for sequencing. Genetic differences were identified within the hexon gene of 17 bearded dragons from 4 collections. Much less diversity was present in the polymerase gene. Bayesian analysis of the hexon nucleotide alignment identified two larger groups and two isolates that did not tightly cluster with these two groups. Multiple genotypes were identified within collections, and individual genotypes were seen in different collections. Three bearded dragons appeared to be infected by multiple strains. These findings show that this hexon region is useful for AgAdV1 genotyping, which can be used epidemiologically as well as in future investigations of AgAdV1 evolution and clinical implications of strain differences.
Cancer genes mutation profiling in calcifying epithelial odontogenic tumour.
de Sousa, Sílvia Ferreira; Diniz, Marina Gonçalves; França, Josiane Alves; Fontes Pereira, Thaís Dos Santos; Moreira, Rennan Garcias; Santos, Jean Nunes Dos; Gomez, Ricardo Santiago; Gomes, Carolina Cavalieri
2018-03-01
To identify calcifying epithelial odontogenic tumour (CEOT) mutations in oncogenes and tumour suppressor genes. A panel of 50 genes commonly mutated in cancer was sequenced in CEOT by next-generation sequencing. Sanger sequencing was used to cover the region of the frameshift deletion identified in one sample. Missense single nucleotide variants (SNVs) with minor allele frequency (MAF) <1% were detected in PTEN , MET and JAK3 . A frameshift deletion in CDKN2A occurred in association with a missense mutation in the same gene region, suggesting a second hit in the inactivation of this gene. APC, KDR, KIT, PIK3CA and TP53 missense SNVs were identified; however, these are common SNVs, showing MAF >1%. CEOT harbours mutations in the tumour suppressor PTEN and CDKN2A and in the oncogenes JAK3 and MET . As these mutations occurred in only one case each, they are probably not driver mutations for these tumours. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Development of phoH as a Novel Signature Gene for Assessing Marine Phage Diversity▿
Goldsmith, Dawn B.; Crosti, Giuseppe; Dwivedi, Bhakti; McDaniel, Lauren D.; Varsani, Arvind; Suttle, Curtis A.; Weinbauer, Markus G.; Sandaa, Ruth-Anne; Breitbart, Mya
2011-01-01
Phages play a key role in the marine environment by regulating the transfer of energy between trophic levels and influencing global carbon and nutrient cycles. The diversity of marine phage communities remains difficult to characterize because of the lack of a signature gene common to all phages. Recent studies have demonstrated the presence of host-derived auxiliary metabolic genes in phage genomes, such as those belonging to the Pho regulon, which regulates phosphate uptake and metabolism under low-phosphate conditions. Among the completely sequenced phage genomes in GenBank, this study identified Pho regulon genes in nearly 40% of the marine phage genomes, while only 4% of nonmarine phage genomes contained these genes. While several Pho regulon genes were identified, phoH was the most prevalent, appearing in 42 out of 602 completely sequenced phage genomes. Phylogenetic analysis demonstrated that phage phoH sequences formed a cluster distinct from those of their bacterial hosts. PCR primers designed to amplify a region of the phoH gene were used to determine the diversity of phage phoH sequences throughout a depth profile in the Sargasso Sea and at six locations worldwide. phoH was present at all sites examined, and a high diversity of phoH sequences was recovered. Most phoH sequences belonged to clusters without any cultured representatives. Each depth and geographic location had a distinct phoH composition, although most phoH clusters were recovered from multiple sites. Overall, phoH is an effective signature gene for examining phage diversity in the marine environment. PMID:21926220
Casella, Tiago; de Morais, Andressa Batista Zequini; de Paula Barcelos, Diego Diniz; Tolentino, Fernanda Modesto; Cerdeira, Louise Teixeira; Bueno, Maria Fernanda Campagnari; Francisco, Gabriela Rodrigues; de Andrade, Leonardo Neves; da Costa Darini, Ana Lucia; de Oliveira Garcia, Doroti; Lincopan, Nilton; Nogueira, Mara Corrêa Lelles
2018-06-01
Klebsiella pneumoniae is considered an opportunistic pathogen and an important agent of nosocomial and community infections. It presents the ability to capture and harbour several antimicrobial resistance genes and, in this context, the extensive use of carbapenems to treat serious infections has been responsible for the selection of several resistance genes. This study reports the draft genome sequence of a KPC-2-producing K. pneumoniae strain (Kp10) simultaneously harbouring bla CTX-M-15 and bla CTX-M-59 genes isolated from urine culture of a patient with Parkinson's disease. Classical microbiological methods were applied to isolate and identify the strain, and PCR and sequencing were used to identify and characterise the genes and the genetic environment. Whole-genome sequencing (WGS) was performed using a Nextera XT DNA library and a NextSeq platform. WGS analysis revealed the presence of 5915 coding genes, 46 RNA-encoding genes and 255 pseudogenes. Kp10 belonged to sequence type 340 (ST340) of clonal complex 258 (CC258) and carried 20 transferable genes associated with antimicrobial resistance, comprising seven drug classes. Although the simultaneous presence of different bla CTX-M genes in the same strain is rarely reported, the bla KPC-2 , bla CTX-M-15 and bla CTX-M-59 genes were not associated with the same genetic mobile structure in Kp10. These results confirm the capacity of K. pneumoniae to harbour several antimicrobial resistance genes. Thus, this draft genome could help in future epidemiological studies regarding the dissemination of clinically relevant resistance genes. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Zhong, Xingyu; Tian, Yuqing; Niu, Guoqing; Tan, Huarong
2013-07-01
A draft genome sequence of Streptomyces ansochromogenes 7100 was generated using 454 sequencing technology. In combination with local BLAST searches and gap filling techniques, a comprehensive antiSMASH-based method was adopted to assemble the secondary metabolite biosynthetic gene clusters in the draft genome of S. ansochromogenes. A total of at least 35 putative gene clusters were identified and assembled. Transcriptional analysis showed that 20 of the 35 gene clusters were expressed in either or all of the three different media tested, whereas the other 15 gene clusters were silent in all three different media. This study provides a comprehensive method to identify and assemble secondary metabolite biosynthetic gene clusters in draft genomes of Streptomyces, and will significantly promote functional studies of these secondary metabolite biosynthetic gene clusters.
High-throughput single-cell PCR using microfluidic emulsions
NASA Astrophysics Data System (ADS)
Guo, Mira; Mazutis, Linas; Agresti, Jeremy; Sommer, Morten; Dantas, Gautam; Church, George; Turnbaugh, Peter; Weitz, David
2012-02-01
The human gut and other environmental samples contain large populations of diverse bacteria that are poorly characterized and unculturable, yet have many functions relevant to human health. Our goal is to identify exactly which species carry some gene of interest, such as a carbohydrate metabolism gene. Conventional metagenomic assays sequence DNA extracted in bulk from populations of mixed cell types, and are therefore unable to associate a gene of interest with a species-identifying 16S gene, to determine that the two genes originated from the same cell. We solve this problem by microfluidically encapsulating single bacteria cells in drops, using PCR to amplify the two genes inside any drop whose encapsulated cell contains both genes, and sequencing the DNA from those drops that contain both amplification products.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Huo, Heqiang; Henry, Isabelle M; Coppoolse, Eric R; Verhoef-Post, Miriam; Schut, Johan W; de Rooij, Han; Vogelaar, Aat; Joosen, Ronny V L; Woudenberg, Leo; Comai, Luca; Bradford, Kent J
2016-11-01
Lettuce (Lactuca sativa) seeds exhibit thermoinhibition, or failure to complete germination when imbibed at warm temperatures. Chemical mutagenesis was employed to develop lettuce lines that exhibit germination thermotolerance. Two independent thermotolerant lettuce seed mutant lines, TG01 and TG10, were generated through ethyl methanesulfonate mutagenesis. Genetic and physiological analyses indicated that these two mutations were allelic and recessive. To identify the causal gene(s), we applied bulked segregant analysis by whole genome sequencing. For each mutant, bulked DNA samples of segregating thermotolerant (mutant) seeds were sequenced and analyzed for homozygous single-nucleotide polymorphisms. Two independent candidate mutations were identified at different physical positions in the zeaxanthin epoxidase gene (ABSCISIC ACID DEFICIENT 1/ZEAXANTHIN EPOXIDASE, or ABA1/ZEP) in TG01 and TG10. The mutation in TG01 caused an amino acid replacement, whereas the mutation in TG10 resulted in alternative mRNA splicing. Endogenous abscisic acid contents were reduced in both mutants, and expression of the ABA1 gene from wild-type lettuce under its own promoter fully complemented the TG01 mutant. Conventional genetic mapping confirmed that the causal mutations were located near the ZEP/ABA1 gene, but the bulked segregant whole genome sequencing approach more efficiently identified the specific gene responsible for the phenotype. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Rischewski, J; Schneppenheim, R
2001-01-30
Patients with Fanconi anemia (Fanc) are at risk of developing leukemia. Mutations of the group A gene (FancA) are most common. A multitude of polymorphisms and mutations within the 43 exons of the gene are described. To examine the role of heterozygosity as a risk factor for malignancies, a partially automatized screening method to identify aberrations was needed. We report on our experience with DHPLC (WAVE (Transgenomic)). PCR amplification of all 43 exons from one individual was performed on one microtiter plate on a gradient thermocycler. DHPLC analysis conditions were established via melting curves, prediction software, and test runs with aberrant samples. PCR products were analyzed twice: native, and after adding a WT-PCR product. Retention patterns were compared with previously identified polymorphic PCR products or mutants. We have defined the mutation screening conditions for all 43 exons of FancA using DHPLC. So far, 40 different sequence variations have been detected in more than 100 individuals. The native analysis identifies heterozygous individuals, and the second run detects homozygous aberrations. Retention patterns are specific for the underlying sequence aberration, thus reducing sequencing demand and costs. DHPLC is a valuable tool for reproducible recognition of known sequence aberrations and screening for unknown mutations in the highly polymorphic FancA gene.
Harripaul, R; Vasli, N; Mikhailov, A; Rafiq, M A; Mittal, K; Windpassinger, C; Sheikh, T I; Noor, A; Mahmood, H; Downey, S; Johnson, M; Vleuten, K; Bell, L; Ilyas, M; Khan, F S; Khan, V; Moradi, M; Ayaz, M; Naeem, F; Heidari, A; Ahmed, I; Ghadami, S; Agha, Z; Zeinali, S; Qamar, R; Mozhdehipanah, H; John, P; Mir, A; Ansar, M; French, L; Ayub, M; Vincent, J B
2018-04-01
Approximately 1% of the global population is affected by intellectual disability (ID), and the majority receive no molecular diagnosis. Previous studies have indicated high levels of genetic heterogeneity, with estimates of more than 2500 autosomal ID genes, the majority of which are autosomal recessive (AR). Here, we combined microarray genotyping, homozygosity-by-descent (HBD) mapping, copy number variation (CNV) analysis, and whole exome sequencing (WES) to identify disease genes/mutations in 192 multiplex Pakistani and Iranian consanguineous families with non-syndromic ID. We identified definite or candidate mutations (or CNVs) in 51% of families in 72 different genes, including 26 not previously reported for ARID. The new ARID genes include nine with loss-of-function mutations (ABI2, MAPK8, MPDZ, PIDD1, SLAIN1, TBC1D23, TRAPPC6B, UBA7 and USP44), and missense mutations include the first reports of variants in BDNF or TET1 associated with ID. The genes identified also showed overlap with de novo gene sets for other neuropsychiatric disorders. Transcriptional studies showed prominent expression in the prenatal brain. The high yield of AR mutations for ID indicated that this approach has excellent clinical potential and should inform clinical diagnostics, including clinical whole exome and genome sequencing, for populations in which consanguinity is common. As with other AR disorders, the relevance will also apply to outbred populations.
Licastro, Danilo; Mutarelli, Margherita; Peluso, Ivana; Neveling, Kornelia; Wieskamp, Nienke; Rispoli, Rossella; Vozzi, Diego; Athanasakis, Emmanouil; D'Eustacchio, Angela; Pizzo, Mariateresa; D'Amico, Francesca; Ziviello, Carmela; Simonelli, Francesca; Fabretto, Antonella; Scheffer, Hans; Gasparini, Paolo; Banfi, Sandro; Nigro, Vincenzo
2012-01-01
Usher syndrome (USH) is a clinically and genetically heterogeneous disorder characterized by visual and hearing impairments. Clinically, it is subdivided into three subclasses with nine genes identified so far. In the present study, we investigated whether the currently available Next Generation Sequencing (NGS) technologies are already suitable for molecular diagnostics of USH. We analyzed a total of 12 patients, most of which were negative for previously described mutations in known USH genes upon primer extension-based microarray genotyping. We enriched the NGS template either by whole exome capture or by Long-PCR of the known USH genes. The main NGS sequencing platforms were used: SOLiD for whole exome sequencing, Illumina (Genome Analyzer II) and Roche 454 (GS FLX) for the Long-PCR sequencing. Long-PCR targeting was more efficient with up to 94% of USH gene regions displaying an overall coverage higher than 25×, whereas whole exome sequencing yielded a similar coverage for only 50% of those regions. Overall this integrated analysis led to the identification of 11 novel sequence variations in USH genes (2 homozygous and 9 heterozygous) out of 18 detected. However, at least two cases were not genetically solved. Our result highlights the current limitations in the diagnostic use of NGS for USH patients. The limit for whole exome sequencing is linked to the need of a strong coverage and to the correct interpretation of sequence variations with a non obvious, pathogenic role, whereas the targeted approach suffers from the high genetic heterogeneity of USH that may be also caused by the presence of additional causative genes yet to be identified. PMID:22952768
Wang, Nan; Liu, Zhiyong; Zhang, Yun; Li, Chengyu; Feng, Hui
2018-03-01
Using bulked segregant analysis combined with next-generation sequencing, we delimited the Brnye1 gene responsible for the stay-green trait of nye in pakchoi. Sequence analysis identified Bra019346 as the candidate gene. "Stay-green" refers to a plant trait whereby leaves remain green during senescence. This trait is useful in the cultivation of pakchoi (Brassica campestris L. ssp. chinensis), which is marketed as a green leaf product. This study aimed to identify the gene responsible for the stay-green trait in pakchoi. We identified a stay-green mutant in pakchoi, which we termed "nye". Genetic analysis revealed that the stay-green trait is controlled by a single recessive gene, Brnye1. Using the BSA-seq method, a 3.0-Mb candidate region was mapped on chromosome A03, which helped us localize Brnye1 to an 81.01-kb interval between SSR markers SSRWN27 and SSRWN30 via linkage analysis in an F 2 population. We identified 12 genes in this region, 11 of which were annotated based on the Brassica rapa annotation database, and one was a functionally unknown gene. An orthologous gene of the Arabidopsis gene AtNYE1, Bra019346, was identified as the potential candidate for Brnye1. Sequence analysis revealed a 40-bp insertion in the second exon of Bra019346 in nye, which generated the TAA stop codon. A candidate gene-specific Indel marker in 1561 F 2 individuals showed perfect cosegregation with Brnye1 in the nye mutant. These results provide a foundation for uncovering the molecular mechanism of the stay-green trait in pakchoi.
Kobayashi, Michie; Hiraka, Yukie; Abe, Akira; Yaegashi, Hiroki; Natsume, Satoshi; Kikuchi, Hideko; Takagi, Hiroki; Saitoh, Hiromasa; Win, Joe; Kamoun, Sophien; Terauchi, Ryohei
2017-11-22
Downy mildew, caused by the oomycete pathogen Sclerospora graminicola, is an economically important disease of Gramineae crops including foxtail millet (Setaria italica). Plants infected with S. graminicola are generally stunted and often undergo a transformation of flower organs into leaves (phyllody or witches' broom), resulting in serious yield loss. To establish the molecular basis of downy mildew disease in foxtail millet, we carried out whole-genome sequencing and an RNA-seq analysis of S. graminicola. Sequence reads were generated from S. graminicola using an Illumina sequencing platform and assembled de novo into a draft genome sequence comprising approximately 360 Mbp. Of this sequence, 73% comprised repetitive elements, and a total of 16,736 genes were predicted from the RNA-seq data. The predicted genes included those encoding effector-like proteins with high sequence similarity to those previously identified in other oomycete pathogens. Genes encoding jacalin-like lectin-domain-containing secreted proteins were enriched in S. graminicola compared to other oomycetes. Of a total of 1220 genes encoding putative secreted proteins, 91 significantly changed their expression levels during the infection of plant tissues compared to the sporangia and zoospore stages of the S. graminicola lifecycle. We established the draft genome sequence of a downy mildew pathogen that infects Gramineae plants. Based on this sequence and our transcriptome analysis, we generated a catalog of in planta-induced candidate effector genes, providing a solid foundation from which to identify the effectors causing phyllody.
Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard
2012-01-01
A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985
2018-01-01
FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722
Targeted therapy according to next generation sequencing-based panel sequencing.
Saito, Motonobu; Momma, Tomoyuki; Kono, Koji
2018-04-17
Targeted therapy against actionable gene mutations shows a significantly higher response rate as well as longer survival compared to conventional chemotherapy, and has become a standard therapy for many cancers. Recent progress in next-generation sequencing (NGS) has enabled to identify huge number of genetic aberrations. Based on sequencing results, patients recommend to undergo targeted therapy or immunotherapy. In cases where there are no available approved drugs for the genetic mutations detected in the patients, it is recommended to be facilitate the registration for the clinical trials. For that purpose, a NGS-based sequencing panel that can simultaneously target multiple genes in a single investigation has been used in daily clinical practice. To date, various types of sequencing panels have been developed to investigate genetic aberrations with tumor somatic genome variants (gain-of-function or loss-of-function mutations, high-level copy number alterations, and gene fusions) through comprehensive bioinformatics. Because sequencing panels are efficient and cost-effective, they are quickly being adopted outside the lab, in hospitals and clinics, in order to identify personal targeted therapy for individual cancer patients.
[Isolation and function of genes regulating aphB expression in Vibrio cholerae].
Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao
2012-02-04
We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-01-01
Purpose: Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND. PMID:29133643
Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448
Li, Bin; Pacey, Marissa P.
2017-01-01
We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308
Henssge, Uta; Do, Thuy; Gilbert, Steven C.; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A. J. M.; Radford, David R.; Beighton, David
2011-01-01
Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established. PMID:21738661
Henssge, Uta; Do, Thuy; Gilbert, Steven C; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A J M; Radford, David R; Beighton, David
2011-01-01
Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established.
Kukekova, Anna V; Johnson, Jennifer L; Teiling, Clotilde; Li, Lewyn; Oskina, Irina N; Kharlamova, Anastasiya V; Gulevich, Rimma G; Padte, Ravee; Dubreuil, Michael M; Vladimirova, Anastasiya V; Shepeleva, Darya V; Shikhevich, Svetlana G; Sun, Qi; Ponnala, Lalit; Temnykh, Svetlana V; Trut, Lyudmila N; Acland, Gregory M
2011-10-03
Two strains of the silver fox (Vulpes vulpes), with markedly different behavioral phenotypes, have been developed by long-term selection for behavior. Foxes from the tame strain exhibit friendly behavior towards humans, paralleling the sociability of canine puppies, whereas foxes from the aggressive strain are defensive and exhibit aggression to humans. To understand the genetic differences underlying these behavioral phenotypes fox-specific genomic resources are needed. cDNA from mRNA from pre-frontal cortex of a tame and an aggressive fox was sequenced using the Roche 454 FLX Titanium platform (> 2.5 million reads & 0.9 Gbase of tame fox sequence; >3.3 million reads & 1.2 Gbase of aggressive fox sequence). Over 80% of the fox reads were assembled into contigs. Mapping fox reads against the fox transcriptome assembly and the dog genome identified over 30,000 high confidence fox-specific SNPs. Fox transcripts for approximately 14,000 genes were identified using SwissProt and the dog RefSeq databases. An at least 2-fold expression difference between the two samples (p < 0.05) was observed for 335 genes, fewer than 3% of the total number of genes identified in the fox transcriptome. Transcriptome sequencing significantly expanded genomic resources available for the fox, a species without a sequenced genome. In a very cost efficient manner this yielded a large number of fox-specific SNP markers for genetic studies and provided significant insights into the gene expression profile of the fox pre-frontal cortex; expression differences between the two fox samples; and a catalogue of potentially important gene-specific sequence variants. This result demonstrates the utility of this approach for developing genomic resources in species with limited genomic information.
2011-01-01
Background Two strains of the silver fox (Vulpes vulpes), with markedly different behavioral phenotypes, have been developed by long-term selection for behavior. Foxes from the tame strain exhibit friendly behavior towards humans, paralleling the sociability of canine puppies, whereas foxes from the aggressive strain are defensive and exhibit aggression to humans. To understand the genetic differences underlying these behavioral phenotypes fox-specific genomic resources are needed. Results cDNA from mRNA from pre-frontal cortex of a tame and an aggressive fox was sequenced using the Roche 454 FLX Titanium platform (> 2.5 million reads & 0.9 Gbase of tame fox sequence; >3.3 million reads & 1.2 Gbase of aggressive fox sequence). Over 80% of the fox reads were assembled into contigs. Mapping fox reads against the fox transcriptome assembly and the dog genome identified over 30,000 high confidence fox-specific SNPs. Fox transcripts for approximately 14,000 genes were identified using SwissProt and the dog RefSeq databases. An at least 2-fold expression difference between the two samples (p < 0.05) was observed for 335 genes, fewer than 3% of the total number of genes identified in the fox transcriptome. Conclusions Transcriptome sequencing significantly expanded genomic resources available for the fox, a species without a sequenced genome. In a very cost efficient manner this yielded a large number of fox-specific SNP markers for genetic studies and provided significant insights into the gene expression profile of the fox pre-frontal cortex; expression differences between the two fox samples; and a catalogue of potentially important gene-specific sequence variants. This result demonstrates the utility of this approach for developing genomic resources in species with limited genomic information. PMID:21967120
The Essential Genome of Escherichia coli K-12.
Goodall, Emily C A; Robinson, Ashley; Johnston, Iain G; Jabbari, Sara; Turner, Keith A; Cunningham, Adam F; Lund, Peter A; Cole, Jeffrey A; Henderson, Ian R
2018-02-20
Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. IMPORTANCE Incentives to define lists of genes that are essential for bacterial survival include the identification of potential targets for antibacterial drug development, genes required for rapid growth for exploitation in biotechnology, and discovery of new biochemical pathways. To identify essential genes in Escherichia coli , we constructed a transposon mutant library of unprecedented density. Initial automated analysis of the resulting data revealed many discrepancies compared to the literature. We now report more extensive statistical analysis supported by both literature searches and detailed inspection of high-density TraDIS sequencing data for each putative essential gene for the E. coli model laboratory organism. This paper is important because it provides a better understanding of the essential genes of E. coli , reveals the limitations of relying on automated analysis alone, and provides a new standard for the analysis of TraDIS data. Copyright © 2018 Goodall et al.
Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong
2013-07-04
Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.
Paulo, Paula; Maia, Sofia; Pinto, Carla; Pinto, Pedro; Monteiro, Augusta; Peixoto, Ana; Teixeira, Manuel R
2018-04-01
Considering that mutations in known prostate cancer (PrCa) predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS) in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.
Stabej, P; Leegwater, P A J; Imholz, S; Versteeg, S A; Zijlstra, C; Stokhof, A A; Domanjko-Petriè, A; van Oost, B A
2005-01-01
Dilated cardiomyopathy (DCM) is a common disease of the myocardium recognized in human, dog and experimental animals. Genetic factors are responsible for a large proportion of cases in humans, and 17 genes with DCM causing mutations have been identified. The genetic origin of DCM in the Dobermann dogs has been suggested, but no disease genes have been identified to date. In this paper, we describe the characterization and evaluation of the canine sarcoglycan delta (SGCD), a gene implicated in DCM in human and hamster. Bacterial artificial chromosomes (BACs) containing the canine SGCD gene were isolated with probes for exon 3 and exons 4-8 and were characterized by Southern blot analysis. BAC end sequences were obtained for four BACs. Three of the BACs overlapped and could be ordered relative to each other and the end sequences of all four BACs could be anchored on the preliminary assembly of the dog genome sequence (www. ensembl.org). One of the BACs of the partial contig was localized by fluorescent in situ hybridization to canine chromosome 4q22, in agreement with the dog genome sequence. Two highly informative polymorphic microsatellite markers in intron 7 of the SGCD gene were identified. In 25 DCM-affected and 13 non DCM-affected dogs seven different haplotypes could be distinguished. However, no association between any of the SGCD variants and the disease locus was apparent.
Lomsadze, Alexandre; Gemayel, Karl; Tang, Shiyuyun; Borodovsky, Mark
2018-05-17
In a conventional view of the prokaryotic genome organization, promoters precede operons and ribosome binding sites (RBSs) with Shine-Dalgarno consensus precede genes. However, recent experimental research suggesting a more diverse view motivated us to develop an algorithm with improved gene-finding accuracy. We describe GeneMarkS-2, an ab initio algorithm that uses a model derived by self-training for finding species-specific (native) genes, along with an array of precomputed "heuristic" models designed to identify harder-to-detect genes (likely horizontally transferred). Importantly, we designed GeneMarkS-2 to identify several types of distinct sequence patterns (signals) involved in gene expression control, among them the patterns characteristic for leaderless transcription as well as noncanonical RBS patterns. To assess the accuracy of GeneMarkS-2, we used genes validated by COG (Clusters of Orthologous Groups) annotation, proteomics experiments, and N-terminal protein sequencing. We observed that GeneMarkS-2 performed better on average in all accuracy measures when compared with the current state-of-the-art gene prediction tools. Furthermore, the screening of ∼5000 representative prokaryotic genomes made by GeneMarkS-2 predicted frequent leaderless transcription in both archaea and bacteria. We also observed that the RBS sites in some species with leadered transcription did not necessarily exhibit the Shine-Dalgarno consensus. The modeling of different types of sequence motifs regulating gene expression prompted a division of prokaryotic genomes into five categories with distinct sequence patterns around the gene starts. © 2018 Lomsadze et al.; Published by Cold Spring Harbor Laboratory Press.
Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.
Pietrowski, D; Förster, M
2000-01-01
The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).
Li, Qian; Lin, Sen
2017-01-01
Intramuscular fat (IMF) content and fatty acid composition of longissimus dorsi muscle (LM) change with growth, which partially determines the flavor and nutritional value of goat (Capra hircus) meat. However, unlike cattle, little information is available on the transcriptome-wide changes during different postnatal stages in small ruminants, especially goats. In this study, the sequencing reads of goat LM tissues collected from kid, youth, and adult period were mapped to the goat genome. Results showed that out of total 24 689 Unigenes, 20 435 Unigenes were annotated. Based on expected number of fragments per kilobase of transcript sequence per million base pairs sequenced (FPKM), 111 annotated differentially expressed genes (DEGs) were identified among different postnatal stages, which were subsequently assigned to 16 possible expression patterns by series-cluster analysis. Functional classification by Gene Ontology (GO) analysis was used for selecting the genes showing highest expression related to lipid metabolism. Finally, we identified the node genes for lipid metabolism regulation using co-expression analysis. In conclusion, these data may uncover candidate genes having functional roles in regulation of goat muscle development and lipid metabolism during the various growth stages in goats. PMID:28800357
Lin, Yaqiu; Zhu, Jiangjiang; Wang, Yong; Li, Qian; Lin, Sen
2017-01-01
Intramuscular fat (IMF) content and fatty acid composition of longissimus dorsi muscle (LM) change with growth, which partially determines the flavor and nutritional value of goat (Capra hircus) meat. However, unlike cattle, little information is available on the transcriptome-wide changes during different postnatal stages in small ruminants, especially goats. In this study, the sequencing reads of goat LM tissues collected from kid, youth, and adult period were mapped to the goat genome. Results showed that out of total 24 689 Unigenes, 20 435 Unigenes were annotated. Based on expected number of fragments per kilobase of transcript sequence per million base pairs sequenced (FPKM), 111 annotated differentially expressed genes (DEGs) were identified among different postnatal stages, which were subsequently assigned to 16 possible expression patterns by series-cluster analysis. Functional classification by Gene Ontology (GO) analysis was used for selecting the genes showing highest expression related to lipid metabolism. Finally, we identified the node genes for lipid metabolism regulation using co-expression analysis. In conclusion, these data may uncover candidate genes having functional roles in regulation of goat muscle development and lipid metabolism during the various growth stages in goats.
Jiang, Bo; Zhang, Yong; She, Chang; Zhao, Jiaju; Zhou, Kailong; Zuo, Zhicheng; Zhou, Xiaozhong; Wang, Peiji; Dong, Qirong
2017-09-01
It is well known that moderate to high doses of ionizing radiation have a toxic effect on the organism. However, there are few experimental studies on the mechanisms of LDR ionizing radiation on nerve regeneration after peripheral nerve injury. We established the rats' peripheral nerve injury model via repaired Peripheral nerve injury nerve, vascular endothelial growth factor a and Growth associated protein-43 were detected from different treatment groups. We performed transcriptome sequencing focusing on investigating the differentially expressed genes and gene functions between the control group and 1Gy group. Sequencing was done by using high-throughput RNA-sequencing (RNA-seq) technologies. The results showed the 1Gy group to be the most effective promoting repair. RNA-sequencing identified 619 differently expressed genes between control and treated groups. A Gene Ontology analysis of the differentially expressed genes revealed enrichment in the functional pathways. Among them, candidate genes associated with nerve repair were identified. Pathways involved in cell-substrate adhesion, vascular smooth muscle contraction and cell adhesion molecule signaling may be involved in recovery from peripheral nerve injury. Copyright © 2017. Published by Elsevier B.V.
Application of industrial scale genomics to discovery of therapeutic targets in heart failure.
Mehraban, F; Tomlinson, J E
2001-12-01
In recent years intense activity in both academic and industrial sectors has provided a wealth of information on the human genome with an associated impressive increase in the number of novel gene sequences deposited in sequence data repositories and patent applications. This genomic industrial revolution has transformed the way in which drug target discovery is now approached. In this article we discuss how various differential gene expression (DGE) technologies are being utilized for cardiovascular disease (CVD) drug target discovery. Other approaches such as sequencing cDNA from cardiovascular derived tissues and cells coupled with bioinformatic sequence analysis are used with the aim of identifying novel gene sequences that may be exploited towards target discovery. Additional leverage from gene sequence information is obtained through identification of polymorphisms that may confer disease susceptibility and/or affect drug responsiveness. Pharmacogenomic studies are described wherein gene expression-based techniques are used to evaluate drug response and/or efficacy. Industrial-scale genomics supports and addresses not only novel target gene discovery but also the burgeoning issues in pharmaceutical and clinical cardiovascular medicine relative to polymorphic gene responses.
Mumps virus F gene and HN gene sequencing as a molecular tool to study mumps virus transmission.
Gouma, Sigrid; Cremer, Jeroen; Parkkali, Saara; Veldhuijzen, Irene; van Binnendijk, Rob S; Koopmans, Marion P G
2016-11-01
Various mumps outbreaks have occurred in the Netherlands since 2004, particularly among persons who had received 2 doses of measles, mumps, and rubella (MMR) vaccination. Genomic typing of pathogens can be used to track outbreaks, but the established genotyping of mumps virus based on the small hydrophobic (SH) gene sequences did not provide sufficient resolution. Therefore, we expanded the sequencing to include fusion (F) gene and haemagglutinin-neuraminidase (HN) gene sequences in addition to the SH gene sequences from 109 mumps virus genotype G strains obtained between 2004 and mid 2015 in the Netherlands. When the molecular information from these 3 genes was combined, we were able to identify separate mumps virus clusters and track mumps virus transmission. The analyses suggested that multiple mumps virus introductions occurred in the Netherlands between 2004 and 2015 resulting in several mumps outbreaks throughout this period, whereas during some local outbreaks the molecular data pointed towards endemic circulation. Combined analysis of epidemiological data and sequence data collected in 2015 showed good support for the phylogenetic clustering. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhang, Jianxia; He, Chunmei; Wu, Kunlin; Teixeira da Silva, Jaime A.; Zeng, Songjun; Zhang, Xinhua; Yu, Zhenming; Xia, Haoqiang; Duan, Jun
2016-01-01
Dendrobium officinale is one of the most important Chinese medicinal herbs. Polysaccharides are one of the main active ingredients of D. officinale. To identify the genes that maybe related to polysaccharides synthesis, two cDNA libraries were prepared from juvenile and adult D. officinale, and were named Dendrobium-1 and Dendrobium-2, respectively. Illumina sequencing for Dendrobium-1 generated 102 million high quality reads that were assembled into 93,881 unigenes with an average sequence length of 790 base pairs. The sequencing for Dendrobium-2 generated 86 million reads that were assembled into 114,098 unigenes with an average sequence length of 695 base pairs. Two transcriptome databases were integrated and assembled into a total of 145,791 unigenes. Among them, 17,281 unigenes were assigned to 126 KEGG pathways while 135 unigenes were involved in fructose and mannose metabolism. Gene Ontology analysis revealed that the majority of genes were associated with metabolic and cellular processes. Furthermore, 430 glycosyltransferase and 89 cellulose synthase genes were identified. Comparative analysis of both transcriptome databases revealed a total of 32,794 differential expression genes (DEGs), including 22,051 up-regulated and 10,743 down-regulated genes in Dendrobium-2 compared to Dendrobium-1. Furthermore, a total of 1142 and 7918 unigenes showed unique expression in Dendrobium-1 and Dendrobium-2, respectively. These DEGs were mainly correlated with metabolic pathways and the biosynthesis of secondary metabolites. In addition, 170 DEGs belonged to glycosyltransferase genes, 37 DEGs were related to cellulose synthase genes and 627 DEGs encoded transcription factors. This study substantially expands the transcriptome information for D. officinale and provides valuable clues for identifying candidate genes involved in polysaccharide biosynthesis and elucidating the mechanism of polysaccharide biosynthesis. PMID:26904032
Literature and patent analysis of the cloning and identification of human functional genes in China.
Xia, Yan; Tang, LiSha; Yao, Lei; Wan, Bo; Yang, XianMei; Yu, Long
2012-03-01
The Human Genome Project was launched at the end of the 1980s. Since then, the cloning and identification of functional genes has been a major focus of research across the world. In China too, the potentially profound impact of such studies on the life sciences and on human health was realized, and relevant studies were initiated in the 1990s. To advance China's involvement in the Human Genome Project, in the mid-1990s, Committee of Experts in Biology from National High Technology Research and Development Program of China (863 Program) proposed the "two 1%" goal. This goal envisaged China contributing 1% of the total sequencing work, and cloning and identifying 1% of the total human functional genes. Over the past 20 years, tremendous achievement has been accomplished by Chinese scientists. It is well known that scientists in China finished the 1% of sequencing work of the Human Genome Project, whereas, there is no comprehensive report about "whether China had finished cloning and identifying 1% of human functional genes". In the present study, the GenBank database at the National Center of Biotechnology Information, the PubMed search tool, and the patent database of the State Intellectual Property Office, China, were used to retrieve entries based on two screening standards: (i) Were the newly cloned and identified genes first reported by Chinese scientists? (ii) Were the Chinese scientists awarded the gene sequence patent? Entries were retrieved from the databases up to the cut-off date of 30 June 2011 and the obtained data were analyzed further. The results showed that 589 new human functional genes were first reported by Chinese scientists and 159 gene sequences were patented (http://gene.fudan.sh.cn/introduction/database/chinagene/chinagene.html). This study systematically summarizes China's contributions to human functional genomics research and answers the question "has China finished cloning and identifying 1% of human functional genes?" in the affirmative.
Nowell, Victoria J; Kropinski, Andrew M; Songer, J Glenn; MacInnes, Janet I; Parreira, Valeria R; Prescott, John F
2012-01-01
Clostridium perfringens is a common inhabitant of the avian and mammalian gastrointestinal tracts and can behave commensally or pathogenically. Some enteric diseases caused by type A C. perfringens, including bovine clostridial abomasitis, remain poorly understood. To investigate the potential basis of virulence in strains causing this disease, we sequenced the genome of a type A C. perfringens isolate (strain F262) from a case of bovine clostridial abomasitis. The ∼3.34 Mbp chromosome of C. perfringens F262 is predicted to contain 3163 protein-coding genes, 76 tRNA genes, and an integrated plasmid sequence, Cfrag (∼18 kb). In addition, sequences of two complete circular plasmids, pF262C (4.8 kb) and pF262D (9.1 kb), and two incomplete plasmid fragments, pF262A (48.5 kb) and pF262B (50.0 kb), were identified. Comparison of the chromosome sequence of C. perfringens F262 to complete C. perfringens chromosomes, plasmids and phages revealed 261 unique genes. No novel toxin genes related to previously described clostridial toxins were identified: 60% of the 261 unique genes were hypothetical proteins. There was a two base pair deletion in virS, a gene reported to encode the main sensor kinase involved in virulence gene activation. Despite this frameshift mutation, C. perfringens F262 expressed perfringolysin O, alpha-toxin and the beta2-toxin, suggesting that another regulation system might contribute to the pathogenicity of this strain. Two complete plasmids, pF262C (4.8 kb) and pF262D (9.1 kb), unique to this strain of C. perfringens were identified.
Nowell, Victoria J.; Kropinski, Andrew M.; Songer, J. Glenn; MacInnes, Janet I.; Parreira, Valeria R.; Prescott, John F.
2012-01-01
Clostridium perfringens is a common inhabitant of the avian and mammalian gastrointestinal tracts and can behave commensally or pathogenically. Some enteric diseases caused by type A C. perfringens, including bovine clostridial abomasitis, remain poorly understood. To investigate the potential basis of virulence in strains causing this disease, we sequenced the genome of a type A C. perfringens isolate (strain F262) from a case of bovine clostridial abomasitis. The ∼3.34 Mbp chromosome of C. perfringens F262 is predicted to contain 3163 protein-coding genes, 76 tRNA genes, and an integrated plasmid sequence, Cfrag (∼18 kb). In addition, sequences of two complete circular plasmids, pF262C (4.8 kb) and pF262D (9.1 kb), and two incomplete plasmid fragments, pF262A (48.5 kb) and pF262B (50.0 kb), were identified. Comparison of the chromosome sequence of C. perfringens F262 to complete C. perfringens chromosomes, plasmids and phages revealed 261 unique genes. No novel toxin genes related to previously described clostridial toxins were identified: 60% of the 261 unique genes were hypothetical proteins. There was a two base pair deletion in virS, a gene reported to encode the main sensor kinase involved in virulence gene activation. Despite this frameshift mutation, C. perfringens F262 expressed perfringolysin O, alpha-toxin and the beta2-toxin, suggesting that another regulation system might contribute to the pathogenicity of this strain. Two complete plasmids, pF262C (4.8 kb) and pF262D (9.1 kb), unique to this strain of C. perfringens were identified. PMID:22412860
Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C
2008-06-15
To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.
rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria
Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel
2003-01-01
Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964
Leese, Florian; Mayer, Christoph; Agrawal, Shobhit; Dambach, Johannes; Dietz, Lars; Doemel, Jana S.; Goodall-Copstake, William P.; Held, Christoph; Jackson, Jennifer A.; Lampert, Kathrin P.; Linse, Katrin; Macher, Jan N.; Nolzen, Jennifer; Raupach, Michael J.; Rivera, Nicole T.; Schubart, Christoph D.; Striewski, Sebastian; Tollrian, Ralph; Sands, Chester J.
2012-01-01
High throughput sequencing technologies are revolutionizing genetic research. With this “rise of the machines”, genomic sequences can be obtained even for unknown genomes within a short time and for reasonable costs. This has enabled evolutionary biologists studying genetically unexplored species to identify molecular markers or genomic regions of interest (e.g. micro- and minisatellites, mitochondrial and nuclear genes) by sequencing only a fraction of the genome. However, when using such datasets from non-model species, it is possible that DNA from non-target contaminant species such as bacteria, viruses, fungi, or other eukaryotic organisms may complicate the interpretation of the results. In this study we analysed 14 genomic pyrosequencing libraries of aquatic non-model taxa from four major evolutionary lineages. We quantified the amount of suitable micro- and minisatellites, mitochondrial genomes, known nuclear genes and transposable elements and searched for contamination from various sources using bioinformatic approaches. Our results show that in all sequence libraries with estimated coverage of about 0.02–25%, many appropriate micro- and minisatellites, mitochondrial gene sequences and nuclear genes from different KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways could be identified and characterized. These can serve as markers for phylogenetic and population genetic analyses. A central finding of our study is that several genomic libraries suffered from different biases owing to non-target DNA or mobile elements. In particular, viruses, bacteria or eukaryote endosymbionts contributed significantly (up to 10%) to some of the libraries analysed. If not identified as such, genetic markers developed from high-throughput sequencing data for non-model organisms may bias evolutionary studies or fail completely in experimental tests. In conclusion, our study demonstrates the enormous potential of low-coverage genome survey sequences and suggests bioinformatic analysis workflows. The results also advise a more sophisticated filtering for problematic sequences and non-target genome sequences prior to developing markers. PMID:23185309
Genotyping of Chromobacterium violaceum isolates by recA PCR-RFLP analysis.
Scholz, Holger Christian; Witte, Angela; Tomaso, Herbert; Al Dahouk, Sascha; Neubauer, Heinrich
2005-03-15
Intraspecies variation of Chromobacterium violaceum was examined by comparative sequence - and by restriction fragment length polymorphism analysis of the recombinase A gene (recA-PCR-RFLP). Primers deduced from the known recA gene sequence of the type strain C. violaceum ATCC 12472(T) allowed the specific amplification of a 1040bp recA fragment from each of the 13 C. violaceum strains investigated, whereas other closely related organisms tested negative. HindII-PstI-recA RFLP analysis generated from 13 representative C. violaceum strains enabled us to identify at least three different genospecies. In conclusion, analysis of the recA gene provides a rapid and robust nucleotide sequence-based approach to specifically identify and classify C. violaceum on genospecies level.
Cecconi, Massimiliano; Parodi, Maria I.; Formisano, Francesco; Spirito, Paolo; Autore, Camillo; Musumeci, Maria B.; Favale, Stefano; Forleo, Cinzia; Rapezzi, Claudio; Biagini, Elena; Davì, Sabrina; Canepa, Elisabetta; Pennese, Loredana; Castagnetta, Mauro; Degiorgio, Dario; Coviello, Domenico A.
2016-01-01
Hypertrophic cardiomyopathy (HCM) is mainly associated with myosin, heavy chain 7 (MYH7) and myosin binding protein C, cardiac (MYBPC3) mutations. In order to better explain the clinical and genetic heterogeneity in HCM patients, in this study, we implemented a target-next generation sequencing (NGS) assay. An Ion AmpliSeq™ Custom Panel for the enrichment of 19 genes, of which 9 of these did not encode thick/intermediate and thin myofilament (TTm) proteins and, among them, 3 responsible of HCM phenocopy, was created. Ninety-two DNA samples were analyzed by the Ion Personal Genome Machine: 73 DNA samples (training set), previously genotyped in some of the genes by Sanger sequencing, were used to optimize the NGS strategy, whereas 19 DNA samples (discovery set) allowed the evaluation of NGS performance. In the training set, we identified 72 out of 73 expected mutations and 15 additional mutations: the molecular diagnosis was achieved in one patient with a previously wild-type status and the pre-excitation syndrome was explained in another. In the discovery set, we identified 20 mutations, 5 of which were in genes encoding non-TTm proteins, increasing the diagnostic yield by approximately 20%: a single mutation in genes encoding non-TTm proteins was identified in 2 out of 3 borderline HCM patients, whereas co-occuring mutations in genes encoding TTm and galactosidase alpha (GLA) altered proteins were characterized in a male with HCM and multiorgan dysfunction. Our combined targeted NGS-Sanger sequencing-based strategy allowed the molecular diagnosis of HCM with greater efficiency than using the conventional (Sanger) sequencing alone. Mutant alleles encoding non-TTm proteins may aid in the complete understanding of the genetic and phenotypic heterogeneity of HCM: co-occuring mutations of genes encoding TTm and non-TTm proteins could explain the wide variability of the HCM phenotype, whereas mutations in genes encoding only the non-TTm proteins are identifiable in patients with a milder HCM status. PMID:27600940
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Huang, Chih-Wei; Lin, Si-Min; Wu, Wen-Lung
2016-07-01
The first mitochondrial genome sequences of Aegista and Dolicheulota belonging to Bradybaenidae are described in this report. Mitogenomic sequences were generated from Illumina paired-end sequencing. The complete mitogenome of Aegista diversifamilia was 14,039 bp in length and nearly complete mitogenome of Dolicheulota formosensis was 14,237 bp. Both mitogenomes consisted of 13 protein-coding genes (PCGs), 2 ribosomal RNA genes, and 22 transfer RNA genes. Most genes were overlapped with neighboring genes that the overlapping regions ranged from 2 to 64 bp in A. diversifamilia and from 1 to 45 bp in D. formosensis. Novel gene arrangement, tRNA-Tyr-ND3-tRNA-Trp, was identified in A. diversifamilia, whereas D. formosensis showed identical gene order to other Bradybaenidae mitogenomes. Maximum likelihood phylogenetic tree suggested Aegista as a sister clade to Euhadra and Dolicheulota. Bradybaenidae is monophyly sister clade to Camaenidae.
Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr
2009-07-01
The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.
Identifying metabolic enzymes with multiple types of association evidence
Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M
2006-01-01
Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130
Kwon, Andrew T.; Arenillas, David J.; Hunt, Rebecca Worsley; Wasserman, Wyeth W.
2012-01-01
oPOSSUM-3 is a web-accessible software system for identification of over-represented transcription factor binding sites (TFBS) and TFBS families in either DNA sequences of co-expressed genes or sequences generated from high-throughput methods, such as ChIP-Seq. Validation of the system with known sets of co-regulated genes and published ChIP-Seq data demonstrates the capacity for oPOSSUM-3 to identify mediating transcription factors (TF) for co-regulated genes or co-recovered sequences. oPOSSUM-3 is available at http://opossum.cisreg.ca. PMID:22973536
Kwon, Andrew T; Arenillas, David J; Worsley Hunt, Rebecca; Wasserman, Wyeth W
2012-09-01
oPOSSUM-3 is a web-accessible software system for identification of over-represented transcription factor binding sites (TFBS) and TFBS families in either DNA sequences of co-expressed genes or sequences generated from high-throughput methods, such as ChIP-Seq. Validation of the system with known sets of co-regulated genes and published ChIP-Seq data demonstrates the capacity for oPOSSUM-3 to identify mediating transcription factors (TF) for co-regulated genes or co-recovered sequences. oPOSSUM-3 is available at http://opossum.cisreg.ca.
2014-10-01
INTRODUCTION: Despite tremendous advances in mutation detection with gene panels and exome sequencing the majority of high risk breast...2a. Align reads to the reference sequence (months 4-10) 2b. Identify SNPs, indels, CNVs and rearrangements by bioinformatic tools (months 4-10) 2c
Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An
2017-09-11
The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.
CEP78 is mutated in a distinct type of Usher syndrome.
Fu, Qing; Xu, Mingchu; Chen, Xue; Sheng, Xunlun; Yuan, Zhisheng; Liu, Yani; Li, Huajin; Sun, Zixi; Li, Huiping; Yang, Lizhu; Wang, Keqing; Zhang, Fangxia; Li, Yumei; Zhao, Chen; Sui, Ruifang; Chen, Rui
2017-03-01
Usher syndrome is a genetically heterogeneous disorder featured by combined visual impairment and hearing loss. Despite a dozen of genes involved in Usher syndrome having been identified, the genetic basis remains unknown in 20-30% of patients. In this study, we aimed to identify the novel disease-causing gene of a distinct subtype of Usher syndrome. Ophthalmic examinations and hearing tests were performed on patients with Usher syndrome in two consanguineous families. Target capture sequencing was initially performed to screen causative mutations in known retinal disease-causing loci. Whole exome sequencing (WES) and whole genome sequencing (WGS) were applied for identifying novel disease-causing genes. RT-PCR and Sanger sequencing were performed to evaluate the splicing-altering effect of identified CEP78 variants. Patients from the two independent families show a mild Usher syndrome phenotype featured by juvenile or adult-onset cone-rod dystrophy and sensorineural hearing loss. WES and WGS identified two homozygous rare variants that affect mRNA splicing of a ciliary gene CEP78 . RT-PCR confirmed that the two variants indeed lead to abnormal splicing, resulting in premature stop of protein translation due to frameshift. Our results provide evidence that CEP78 is a novel disease-causing gene for Usher syndrome, demonstrating an additional link between ciliopathy and Usher protein network in photoreceptor cells and inner ear hair cells. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Revealing the transcriptomic complexity of switchgrass by PacBio long-read sequencing.
Zuo, Chunman; Blow, Matthew; Sreedasyam, Avinash; Kuo, Rita C; Ramamoorthy, Govindarajan Kunde; Torres-Jerez, Ivone; Li, Guifen; Wang, Mei; Dilworth, David; Barry, Kerrie; Udvardi, Michael; Schmutz, Jeremy; Tang, Yuhong; Xu, Ying
2018-01-01
Switchgrass ( Panicum virgatum L.) is an important bioenergy crop widely used for lignocellulosic research. While extensive transcriptomic analyses have been conducted on this species using short read-based sequencing techniques, very little has been reliably derived regarding alternatively spliced (AS) transcripts. We present an analysis of transcriptomes of six switchgrass tissue types pooled together, sequenced using Pacific Biosciences (PacBio) single-molecular long-read technology. Our analysis identified 105,419 unique transcripts covering 43,570 known genes and 8795 previously unknown genes. 45,168 are novel transcripts of known genes. A total of 60,096 AS transcripts are identified, 45,628 being novel. We have also predicted 1549 transcripts of genes involved in cell wall construction and remodeling, 639 being novel transcripts of known cell wall genes. Most of the predicted transcripts are validated against Illumina-based short reads. Specifically, 96% of the splice junction sites in all the unique transcripts are validated by at least five Illumina reads. Comparisons between genes derived from our identified transcripts and the current genome annotation revealed that among the gene set predicted by both analyses, 16,640 have different exon-intron structures. Overall, substantial amount of new information is derived from the PacBio RNA data regarding both the transcriptome and the genome of switchgrass.
Oduru, Sreedhar; Campbell, Janee L; Karri, SriTulasi; Hendry, William J; Khan, Shafiq A; Williams, Simon C
2003-01-01
Background Complete genome annotation will likely be achieved through a combination of computer-based analysis of available genome sequences combined with direct experimental characterization of expressed regions of individual genomes. We have utilized a comparative genomics approach involving the sequencing of randomly selected hamster testis cDNAs to begin to identify genes not previously annotated on the human, mouse, rat and Fugu (pufferfish) genomes. Results 735 distinct sequences were analyzed for their relatedness to known sequences in public databases. Eight of these sequences were derived from previously unidentified genes and expression of these genes in testis was confirmed by Northern blotting. The genomic locations of each sequence were mapped in human, mouse, rat and pufferfish, where applicable, and the structure of their cognate genes was derived using computer-based predictions, genomic comparisons and analysis of uncharacterized cDNA sequences from human and macaque. Conclusion The use of a comparative genomics approach resulted in the identification of eight cDNAs that correspond to previously uncharacterized genes in the human genome. The proteins encoded by these genes included a new member of the kinesin superfamily, a SET/MYND-domain protein, and six proteins for which no specific function could be predicted. Each gene was expressed primarily in testis, suggesting that they may play roles in the development and/or function of testicular cells. PMID:12783626
Mutator gene and hereditary non-polyposis colorectal cancer
de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD
2008-02-05
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M
2013-12-01
Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.
Wylie, J L; Worobec, E A
1994-03-01
OprB is a glucose-selective porin known to be produced by Pseudomonas aeruginosa and Pseudomonas putida. We have cloned and sequenced the oprB gene of P. aeruginosa and obtained expression of OprB in Escherichia coli. The mature protein consists of 423 amino acid residues with a deduced molecular mass of 47597 Da. Several clusters of amino acid residues, potentially involved in the structure or function of the protein, were identified. An area of regional homology with E. coli LamB was also identified. Carbohydrate-inducible proteins, potentially homologous to OprB, were identified in several rRNA homology-group-I pseudomonads by sodium dodecyl sulfate/polyacrylamide gel electrophoresis analysis, Western immunoblotting and N-terminal amino acid sequencing. These species also contained DNA that hybridized to a P. aeruginosa oprB gene probe.
Weirather, Jason L; Afshar, Pegah Tootoonchi; Clark, Tyson A; Tseng, Elizabeth; Powers, Linda S; Underwood, Jason G; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai
2015-10-15
We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Massively Parallel DNA Sequencing Facilitates Diagnosis of Patients with Usher Syndrome Type 1
Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-ichi
2014-01-01
Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance. PMID:24618850
The transcriptome of Lutzomyia longipalpis (Diptera: Psychodidae) male reproductive organs.
Azevedo, Renata V D M; Dias, Denise B S; Bretãs, Jorge A C; Mazzoni, Camila J; Souza, Nataly A; Albano, Rodolpho M; Wagner, Glauber; Davila, Alberto M R; Peixoto, Alexandre A
2012-01-01
It has been suggested that genes involved in the reproductive biology of insect disease vectors are potential targets for future alternative methods of control. Little is known about the molecular biology of reproduction in phlebotomine sand flies and there is no information available concerning genes that are expressed in male reproductive organs of Lutzomyia longipalpis, the main vector of American visceral leishmaniasis and a species complex. We generated 2678 high quality ESTs ("Expressed Sequence Tags") of L. longipalpis male reproductive organs that were grouped in 1391 non-redundant sequences (1136 singlets and 255 clusters). BLAST analysis revealed that only 57% of these sequences share similarity with a L. longipalpis female EST database. Although no more than 36% of the non-redundant sequences showed similarity to protein sequences deposited in databases, more than half of them presented the best-match hits with mosquito genes. Gene ontology analysis identified subsets of genes involved in biological processes such as protein biosynthesis and DNA replication, which are probably associated with spermatogenesis. A number of non-redundant sequences were also identified as putative male reproductive gland proteins (mRGPs), also known as male accessory gland protein genes (Acps). The transcriptome analysis of L. longipalpis male reproductive organs is one step further in the study of the molecular basis of the reproductive biology of this important species complex. It has allowed the identification of genes potentially involved in spermatogenesis as well as putative mRGPs sequences, which have been studied in many insect species because of their effects on female post-mating behavior and physiology and their potential role in sexual selection and speciation. These data open a number of new avenues for further research in the molecular and evolutionary reproductive biology of sand flies.
The Transcriptome of Lutzomyia longipalpis (Diptera: Psychodidae) Male Reproductive Organs
Bretãs, Jorge A. C.; Mazzoni, Camila J.; Souza, Nataly A.; Albano, Rodolpho M.; Wagner, Glauber; Davila, Alberto M. R.; Peixoto, Alexandre A.
2012-01-01
Background It has been suggested that genes involved in the reproductive biology of insect disease vectors are potential targets for future alternative methods of control. Little is known about the molecular biology of reproduction in phlebotomine sand flies and there is no information available concerning genes that are expressed in male reproductive organs of Lutzomyia longipalpis, the main vector of American visceral leishmaniasis and a species complex. Methods/Principal Findings We generated 2678 high quality ESTs (“Expressed Sequence Tags”) of L. longipalpis male reproductive organs that were grouped in 1391 non-redundant sequences (1136 singlets and 255 clusters). BLAST analysis revealed that only 57% of these sequences share similarity with a L. longipalpis female EST database. Although no more than 36% of the non-redundant sequences showed similarity to protein sequences deposited in databases, more than half of them presented the best-match hits with mosquito genes. Gene ontology analysis identified subsets of genes involved in biological processes such as protein biosynthesis and DNA replication, which are probably associated with spermatogenesis. A number of non-redundant sequences were also identified as putative male reproductive gland proteins (mRGPs), also known as male accessory gland protein genes (Acps). Conclusions The transcriptome analysis of L. longipalpis male reproductive organs is one step further in the study of the molecular basis of the reproductive biology of this important species complex. It has allowed the identification of genes potentially involved in spermatogenesis as well as putative mRGPs sequences, which have been studied in many insect species because of their effects on female post-mating behavior and physiology and their potential role in sexual selection and speciation. These data open a number of new avenues for further research in the molecular and evolutionary reproductive biology of sand flies. PMID:22496818
Massively parallel DNA sequencing facilitates diagnosis of patients with Usher syndrome type 1.
Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-Ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-Ichi
2014-01-01
Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance.
BMPR1B mutation causes Pierre Robin sequence
Yao, Xu; Zhang, Rong; Yang, Hui; Zhao, Rui; Guo, Jihong; Jin, Ke; Mei, Haibo; Luo, Yongqi; Zhao, Liu; Tu, Ming; Zhu, Yimin
2017-01-01
Background We investigated a large family with Pierre Robin sequence (PRS). Aim of the study This study aims to determine the genetic cause of PRS. Results The reciprocal translocation t(4;6)(q22;p21) was identified to be segregated with PRS in a three-generation family. Whole-genome sequencing and Sanger sequencing successfully detected breakpoints in the intragenic regions of BMRP1B and GRM4. We hypothesized that PRS in this family was caused by (i) haploinsufficiency for BMPR1B or (ii) a gain of function mechanism mediated by the BMPR1B-GRM4 fusion gene. In an unrelated family, we identified another BMPR1B-splicing mutation that co-segregated with PRS. Conclusion We detected two BMPR1B mutations in two unrelated PRS families, suggesting that BMPR1B disruption is probably a cause of human PRS. Methods GTG banding, comparative genomic hybridization, whole-genome sequencing, and Sanger sequencing were performed to identify the gene causing PRS. PMID:28418932
Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R
1988-01-01
We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343
Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei
2003-05-01
We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.
Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.
Rotenberg, D; Whitfield, A E
2010-08-01
Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.
Exome-wide DNA capture and next generation sequencing in domestic and wild species.
Cosart, Ted; Beja-Pereira, Albano; Chen, Shanyuan; Ng, Sarah B; Shendure, Jay; Luikart, Gordon
2011-07-05
Gene-targeted and genome-wide markers are crucial to advance evolutionary biology, agriculture, and biodiversity conservation by improving our understanding of genetic processes underlying adaptation and speciation. Unfortunately, for eukaryotic species with large genomes it remains costly to obtain genome sequences and to develop genome resources such as genome-wide SNPs. A method is needed to allow gene-targeted, next-generation sequencing that is flexible enough to include any gene or number of genes, unlike transcriptome sequencing. Such a method would allow sequencing of many individuals, avoiding ascertainment bias in subsequent population genetic analyses.We demonstrate the usefulness of a recent technology, exon capture, for genome-wide, gene-targeted marker discovery in species with no genome resources. We use coding gene sequences from the domestic cow genome sequence (Bos taurus) to capture (enrich for), and subsequently sequence, thousands of exons of B. taurus, B. indicus, and Bison bison (wild bison). Our capture array has probes for 16,131 exons in 2,570 genes, including 203 candidate genes with known function and of interest for their association with disease and other fitness traits. We successfully sequenced and mapped exon sequences from across the 29 autosomes and X chromosome in the B. taurus genome sequence. Exon capture and high-throughput sequencing identified thousands of putative SNPs spread evenly across all reference chromosomes, in all three individuals, including hundreds of SNPs in our targeted candidate genes. This study shows exon capture can be customized for SNP discovery in many individuals and for non-model species without genomic resources. Our captured exome subset was small enough for affordable next-generation sequencing, and successfully captured exons from a divergent wild species using the domestic cow genome as reference.
Pereiro, Patricia; Balseiro, Pablo; Romero, Alejandro; Dios, Sonia; Forn-Cuni, Gabriel; Fuste, Berta; Planas, Josep V.; Beltran, Sergi; Novoa, Beatriz; Figueras, Antonio
2012-01-01
Background Turbot (Scophthalmus maximus L.) is an important aquacultural resource both in Europe and Asia. However, there is little information on gene sequences available in public databases. Currently, one of the main problems affecting the culture of this flatfish is mortality due to several pathogens, especially viral diseases which are not treatable. In order to identify new genes involved in immune defense, we conducted 454-pyrosequencing of the turbot transcriptome after different immune stimulations. Methodology/Principal Findings Turbot were injected with viral stimuli to increase the expression level of immune-related genes. High-throughput deep sequencing using 454-pyrosequencing technology yielded 915,256 high-quality reads. These sequences were assembled into 55,404 contigs that were subjected to annotation steps. Intriguingly, 55.16% of the deduced protein was not significantly similar to any sequences in the databases used for the annotation and only 0.85% of the BLASTx top-hits matched S. maximus protein sequences. This relatively low level of annotation is possibly due to the limited information for this specie and other flatfish in the database. These results suggest the identification of a large number of new genes in turbot and in fish in general. A more detailed analysis showed the presence of putative members of several innate and specific immune pathways. Conclusions/Significance To our knowledge, this study is the first transcriptome analysis using 454-pyrosequencing for turbot. Previously, there were only 12,471 EST and less of 1,500 nucleotide sequences for S. maximus in NCBI database. Our results provide a rich source of data (55,404 contigs and 181,845 singletons) for discovering and identifying new genes, which will serve as a basis for microarray construction, gene expression characterization and for identification of genetic markers to be used in several applications. Immune stimulation in turbot was very effective, obtaining an enormous variety of sequences belonging to genes involved in the defense mechanisms. PMID:22629298
HuMiChip: Development of a Functional Gene Array for the Study of Human Microbiomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tu, Q.; Deng, Ye; Lin, Lu
Microbiomes play very important roles in terms of nutrition, health and disease by interacting with their hosts. Based on sequence data currently available in public domains, we have developed a functional gene array to monitor both organismal and functional gene profiles of normal microbiota in human and mouse hosts, and such an array is called human and mouse microbiota array, HMM-Chip. First, seed sequences were identified from KEGG databases, and used to construct a seed database (seedDB) containing 136 gene families in 19 metabolic pathways closely related to human and mouse microbiomes. Second, a mother database (motherDB) was constructed withmore » 81 genomes of bacterial strains with 54 from gut and 27 from oral environments, and 16 metagenomes, and used for selection of genes and probe design. Gene prediction was performed by Glimmer3 for bacterial genomes, and by the Metagene program for metagenomes. In total, 228,240 and 801,599 genes were identified for bacterial genomes and metagenomes, respectively. Then the motherDB was searched against the seedDB using the HMMer program, and gene sequences in the motherDB that were highly homologous with seed sequences in the seedDB were used for probe design by the CommOligo software. Different degrees of specific probes, including gene-specific, inclusive and exclusive group-specific probes were selected. All candidate probes were checked against the motherDB and NCBI databases for specificity. Finally, 7,763 probes covering 91.2percent (12,601 out of 13,814) HMMer confirmed sequences from 75 bacterial genomes and 16 metagenomes were selected. This developed HMM-Chip is able to detect the diversity and abundance of functional genes, the gene expression of microbial communities, and potentially, the interactions of microorganisms and their hosts.« less
Parker, Jennifer K.; Havird, Justin C.
2012-01-01
Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though <1 due to high sequence similarity, are significantly greater than housekeeping gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing improved disease management in economically important crops. PMID:22194287
Parker, Jennifer K; Havird, Justin C; De La Fuente, Leonardo
2012-03-01
Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though <1 due to high sequence similarity, are significantly greater than housekeeping gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing improved disease management in economically important crops.
Chung, Hsiao-Hang; Schwinn, Kathy E.; Ngo, Hanh M.; Lewis, David H.; Massey, Baxter; Calcott, Kate E.; Crowhurst, Ross; Joyce, Daryl C.; Gould, Kevin S.; Davies, Kevin M.; Harrison, Dion K.
2015-01-01
Plant betalain pigments are intriguing because they are restricted to the Caryophyllales and are mutually exclusive with the more common anthocyanins. However, betalain biosynthesis is poorly understood compared to that of anthocyanins. In this study, betalain production and betalain-related genes were characterized in Parakeelya mirabilis (Montiaceae). RT-PCR and transcriptomics identified three sequences related to the key biosynthetic enzyme Dopa 4,5-dioxgenase (DOD). In addition to a LigB gene similar to that of non-Caryophyllales species (Class I genes), two other P. mirabilis LigB genes were found (DOD and DOD-like, termed Class II). PmDOD and PmDOD-like had 70% amino acid identity. Only PmDOD was implicated in betalain synthesis based on transient assays of enzyme activity and correlation of transcript abundance to spatio-temporal betalain accumulation. The role of PmDOD-like remains unknown. The striking pigment patterning of the flowers was due to distinct zones of red betacyanin and yellow betaxanthin production. The major betacyanin was the unglycosylated betanidin rather than the commonly found glycosides, an occurrence for which there are a few previous reports. The white petal zones lacked pigment but had DOD activity suggesting alternate regulation of the pathway in this tissue. DOD and DOD-like sequences were also identified in other betalain-producing species but not in examples of anthocyanin-producing Caryophyllales or non-Caryophyllales species. A Class I LigB sequence from the anthocyanin-producing Caryophyllaceae species Dianthus superbus and two DOD-like sequences from the Amaranthaceae species Beta vulgaris and Ptilotus spp. did not show DOD activity in the transient assay. The additional sequences suggests that DOD is part of a larger LigB gene family in betalain-producing Caryophyllales taxa, and the tandem genomic arrangement of two of the three B. vulgaris LigB genes suggests the involvement of duplication in the gene family evolution. PMID:26217353
Hussey, Richard S; Huang, Guozhong; Allen, Rex
2011-01-01
Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.
Prospecting for viral natural enemies of the fire ant Solenopsis invicta in Argentina.
Valles, Steven M; Porter, Sanford D; Calcaterra, Luis A
2018-01-01
Metagenomics and next generation sequencing were employed to discover new virus natural enemies of the fire ant, Solenopsis invicta Buren in its native range (i.e., Formosa, Argentina) with the ultimate goal of testing and releasing new viral pathogens into U.S. S. invicta populations to provide natural, sustainable control of this ant. RNA was purified from worker ants from 182 S. invicta colonies, which was pooled into 4 groups according to location. A library was created from each group and sequenced using Illumina Miseq technology. After a series of winnowing methods to remove S. invicta genes, known S. invicta virus genes, and all other non-virus gene sequences, 61,944 unique singletons were identified with virus identity. These were assembled de novo yielding 171 contiguous sequences with significant identity to non-plant virus genes. Fifteen contiguous sequences exhibited very high expression rates and were detected in all four gene libraries. One contig (Contig_29) exhibited the highest expression level overall and across all four gene libraries. Random amplification of cDNA ends analyses expanded this contiguous sequence yielding a complete virus genome, which we have provisionally named Solenopsis invicta virus 5 (SINV-5). SINV-5 is a positive-sense, single-stranded RNA virus with genome characteristics consistent with insect-infecting viruses from the family Dicistroviridae. Moreover, the replicative genome strand of SINV-5 was detected in worker ants indicating that S. invicta serves as host for the virus. Many additional sequences were identified that are likely of viral origin. These sequences await further investigation to determine their origins and relationship with S. invicta. This study expands knowledge of the RNA virome diversity found within S. invicta populations.
Prospecting for viral natural enemies of the fire ant Solenopsis invicta in Argentina
Porter, Sanford D.; Calcaterra, Luis A.
2018-01-01
Metagenomics and next generation sequencing were employed to discover new virus natural enemies of the fire ant, Solenopsis invicta Buren in its native range (i.e., Formosa, Argentina) with the ultimate goal of testing and releasing new viral pathogens into U.S. S. invicta populations to provide natural, sustainable control of this ant. RNA was purified from worker ants from 182 S. invicta colonies, which was pooled into 4 groups according to location. A library was created from each group and sequenced using Illumina Miseq technology. After a series of winnowing methods to remove S. invicta genes, known S. invicta virus genes, and all other non-virus gene sequences, 61,944 unique singletons were identified with virus identity. These were assembled de novo yielding 171 contiguous sequences with significant identity to non-plant virus genes. Fifteen contiguous sequences exhibited very high expression rates and were detected in all four gene libraries. One contig (Contig_29) exhibited the highest expression level overall and across all four gene libraries. Random amplification of cDNA ends analyses expanded this contiguous sequence yielding a complete virus genome, which we have provisionally named Solenopsis invicta virus 5 (SINV-5). SINV-5 is a positive-sense, single-stranded RNA virus with genome characteristics consistent with insect-infecting viruses from the family Dicistroviridae. Moreover, the replicative genome strand of SINV-5 was detected in worker ants indicating that S. invicta serves as host for the virus. Many additional sequences were identified that are likely of viral origin. These sequences await further investigation to determine their origins and relationship with S. invicta. This study expands knowledge of the RNA virome diversity found within S. invicta populations. PMID:29466388
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nitsche, E.M.; Moquin, A.; Adams, P.S.
1996-05-03
Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less
A Comprehensive Analysis of Transcript-Supported De Novo Genes in Saccharomyces sensu stricto Yeasts
Lu, Tzu-Chiao; Leu, Jun-Yi; Lin, Wen-Chang
2017-01-01
Abstract Novel genes arising from random DNA sequences (de novo genes) have been suggested to be widespread in the genomes of different organisms. However, our knowledge about the origin and evolution of de novo genes is still limited. To systematically understand the general features of de novo genes, we established a robust pipeline to analyze >20,000 transcript-supported coding sequences (CDSs) from the budding yeast Saccharomyces cerevisiae. Our analysis pipeline combined phylogeny, synteny, and sequence alignment information to identify possible orthologs across 20 Saccharomycetaceae yeasts and discovered 4,340 S. cerevisiae-specific de novo genes and 8,871 S. sensu stricto-specific de novo genes. We further combine information on CDS positions and transcript structures to show that >65% of de novo genes arose from transcript isoforms of ancient genes, especially in the upstream and internal regions of ancient genes. Fourteen identified de novo genes with high transcript levels were chosen to verify their protein expressions. Ten of them, including eight transcript isoform-associated CDSs, showed translation signals and five proteins exhibited specific cytosolic localizations. Our results suggest that de novo genes frequently arise in the S. sensu stricto complex and have the potential to be quickly integrated into ancient cellular network. PMID:28981695
Li, Guotian; Jain, Rashmi; Chern, Mawsheng; Pham, Nikki T; Martin, Joel A; Wei, Tong; Schackwitz, Wendy S; Lipzen, Anna M; Duong, Phat Q; Jones, Kyle C; Jiang, Liangrong; Ruan, Deling; Bauer, Diane; Peng, Yi; Barry, Kerrie W; Schmutz, Jeremy; Ronald, Pamela C
2017-06-01
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake ( Oryza sativa ssp japonica ), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. © 2017 American Society of Plant Biologists. All rights reserved.
Li, Guotian; Jain, Rashmi; Chern, Mawsheng; ...
2017-06-02
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportionmore » of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. In conclusion, this work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations.« less
Weber, Stefanie; Büscher, Anja K; Hagmann, Henning; Liebau, Max C; Heberle, Christian; Ludwig, Michael; Rath, Sabine; Alberer, Martin; Beissert, Antje; Zenker, Martin; Hoyer, Peter F; Konrad, Martin; Klein, Hanns-Georg; Hoefele, Julia
2016-01-01
Steroid-resistant nephrotic syndrome (SRNS) is a severe cause of progressive renal disease. Genetic forms of SRNS can present with autosomal recessive or autosomal dominant inheritance. Recent studies have identified mutations in multiple podocyte genes responsible for SRNS. Improved sequencing methods (next-generation sequencing, NGS) now promise rapid mutational testing of SRNS genes. In the present study, a simultaneous screening of ten SRNS genes in 37 SRNS patients was performed by NGS. In 38 % of the patients, causative mutations in one SRNS gene were found. In 22 % of the patients, in addition to these mutations, a secondary variant in a different gene was identified. This high incidence of accumulating sequence variants was unexpected but, although they might have modifier effects, the pathogenic potential of these additional sequence variants seems unclear so far. The example of molecular diagnostics by NGS in SRNS patients shows that these new sequencing technologies might provide further insight into molecular pathogenicity in genetic disorders but will also generate results, which will be difficult to interpret and complicate genetic counseling. Although NGS promises more frequent identification of disease-causing mutations, the identification of causative mutations, the interpretation of incidental findings and possible pitfalls might pose problems, which hopefully will decrease by further experience and elucidation of molecular interactions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Willis, Leslie G.; Siepp, Robyn; Stewart, Taryn M.
2005-08-01
The genome of the Trichoplusia ni single nucleopolyhedrovirus (TnSNPV), a group II NPV which infects the cabbage looper (T. ni), has been completely sequenced and analyzed. The TnSNPV DNA genome consists of 134,394 bp and has an overall G + C content of 39%. Gene analysis predicted 144 open reading frames (ORFs) of 150 nucleotides or greater that showed minimal overlap. Comparisons with previously sequenced baculoviruses indicate that 119 TnSNPV ORFs were homologues of previously reported viral gene sequences. Ninety-four TnSNPV ORFs returned an Autographa californica multiple NPV (AcMNPV) homologue while 25 ORFs returned poor or no sequence matches withmore » the current databases. A putative photolyase gene was also identified that had highest amino acid identity to the photolyase genes of Chrysodeixis chalcites NPV (ChchNPV) (47%) and Danio rerio (zebrafish) (40%). In addition unlike all other baculoviruses no obvious homologous repeat (hr) sequences were identified. Comparison of the TnSNPV and AcMNPV genomes provides a unique opportunity to examine two baculoviruses that are highly virulent for a common insect host (T. ni) yet belong to diverse baculovirus taxonomic groups and possess distinct biological features. In vitro fusion assays demonstrated that the TnSNPV F protein induces membrane fusion and syncytia formation and were compared to syncytia formed by AcMNPV GP64.« less
Whole Gene Capture Analysis of 15 CRC Susceptibility Genes in Suspected Lynch Syndrome Patients.
Jansen, Anne M L; Geilenkirchen, Marije A; van Wezel, Tom; Jagmohan-Changur, Shantie C; Ruano, Dina; van der Klift, Heleen M; van den Akker, Brendy E W M; Laros, Jeroen F J; van Galen, Michiel; Wagner, Anja; Letteboer, Tom G W; Gómez-García, Encarna B; Tops, Carli M J; Vasen, Hans F; Devilee, Peter; Hes, Frederik J; Morreau, Hans; Wijnen, Juul T
2016-01-01
Lynch Syndrome (LS) is caused by pathogenic germline variants in one of the mismatch repair (MMR) genes. However, up to 60% of MMR-deficient colorectal cancer cases are categorized as suspected Lynch Syndrome (sLS) because no pathogenic MMR germline variant can be identified, which leads to difficulties in clinical management. We therefore analyzed the genomic regions of 15 CRC susceptibility genes in leukocyte DNA of 34 unrelated sLS patients and 11 patients with MLH1 hypermethylated tumors with a clear family history. Using targeted next-generation sequencing, we analyzed the entire non-repetitive genomic sequence, including intronic and regulatory sequences, of 15 CRC susceptibility genes. In addition, tumor DNA from 28 sLS patients was analyzed for somatic MMR variants. Of 1979 germline variants found in the leukocyte DNA of 34 sLS patients, one was a pathogenic variant (MLH1 c.1667+1delG). Leukocyte DNA of 11 patients with MLH1 hypermethylated tumors was negative for pathogenic germline variants in the tested CRC susceptibility genes and for germline MLH1 hypermethylation. Somatic DNA analysis of 28 sLS tumors identified eight (29%) cases with two pathogenic somatic variants, one with a VUS predicted to pathogenic and LOH, and nine cases (32%) with one pathogenic somatic variant (n = 8) or one VUS predicted to be pathogenic (n = 1). This is the first study in sLS patients to include the entire genomic sequence of CRC susceptibility genes. An underlying somatic or germline MMR gene defect was identified in ten of 34 sLS patients (29%). In the remaining sLS patients, the underlying genetic defect explaining the MMRdeficiency in their tumors might be found outside the genomic regions harboring the MMR and other known CRC susceptibility genes.
Dou, Wei; Shen, Guang-Mao; Niu, Jin-Zhi; Ding, Tian-Bo; Wei, Dan-Dan; Wang, Jin-Jun
2013-01-01
Recent studies indicate that infestations of psocids pose a new risk for global food security. Among the psocids species, Liposcelis bostrychophila Badonnel has gained recognition in importance because of its parthenogenic reproduction, rapid adaptation, and increased worldwide distribution. To date, the molecular data available for L. bostrychophila is largely limited to genes identified through homology. Also, no transcriptome data relevant to psocids infection is available. In this study, we generated de novo assembly of L. bostrychophila transcriptome performed through the short read sequencing technology (Illumina). In a single run, we obtained more than 51 million sequencing reads that were assembled into 60,012 unigenes (mean size = 711 bp) by Trinity. The transcriptome sequences from different developmental stages of L. bostrychophila including egg, nymph and adult were annotated with non-redundant (Nr) protein database, gene ontology (GO), cluster of orthologous groups of proteins (COG), and KEGG orthology (KO). The analysis revealed three major enzyme families involved in insecticide metabolism as differentially expressed in the L. bostrychophila transcriptome. A total of 49 P450-, 31 GST- and 21 CES-specific genes representing the three enzyme families were identified. Besides, 16 transcripts were identified to contain target site sequences of resistance genes. Furthermore, we profiled gene expression patterns upon insecticide (malathion and deltamethrin) exposure using the tag-based digital gene expression (DGE) method. The L. bostrychophila transcriptome and DGE data provide gene expression data that would further our understanding of molecular mechanisms in psocids. In particular, the findings of this investigation will facilitate identification of genes involved in insecticide resistance and designing of new compounds for control of psocids.
Dou, Wei; Shen, Guang-Mao; Niu, Jin-Zhi; Ding, Tian-Bo; Wei, Dan-Dan; Wang, Jin-Jun
2013-01-01
Background Recent studies indicate that infestations of psocids pose a new risk for global food security. Among the psocids species, Liposcelis bostrychophila Badonnel has gained recognition in importance because of its parthenogenic reproduction, rapid adaptation, and increased worldwide distribution. To date, the molecular data available for L. bostrychophila is largely limited to genes identified through homology. Also, no transcriptome data relevant to psocids infection is available. Methodology and Principal Findings In this study, we generated de novo assembly of L. bostrychophila transcriptome performed through the short read sequencing technology (Illumina). In a single run, we obtained more than 51 million sequencing reads that were assembled into 60,012 unigenes (mean size = 711 bp) by Trinity. The transcriptome sequences from different developmental stages of L. bostrychophila including egg, nymph and adult were annotated with non-redundant (Nr) protein database, gene ontology (GO), cluster of orthologous groups of proteins (COG), and KEGG orthology (KO). The analysis revealed three major enzyme families involved in insecticide metabolism as differentially expressed in the L. bostrychophila transcriptome. A total of 49 P450-, 31 GST- and 21 CES-specific genes representing the three enzyme families were identified. Besides, 16 transcripts were identified to contain target site sequences of resistance genes. Furthermore, we profiled gene expression patterns upon insecticide (malathion and deltamethrin) exposure using the tag-based digital gene expression (DGE) method. Conclusion The L. bostrychophila transcriptome and DGE data provide gene expression data that would further our understanding of molecular mechanisms in psocids. In particular, the findings of this investigation will facilitate identification of genes involved in insecticide resistance and designing of new compounds for control of psocids. PMID:24278202
Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping
2015-01-01
The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.
Sequencing and Characterisation of an Extensive Atlantic Salmon (Salmo salar L.) MicroRNA Repertoire
Bekaert, Michaël; Lowe, Natalie R.; Bishop, Stephen C.; Bron, James E.; Taggart, John B.; Houston, Ross D.
2013-01-01
Atlantic salmon (Salmo salar L.), a member of the family Salmonidae, is a totemic species of ecological and cultural significance that is also economically important in terms of both sports fisheries and aquaculture. These factors have promoted the continuous development of genomic resources for this species, furthering both fundamental and applied research. MicroRNAs (miRNA) are small endogenous non-coding RNA molecules that control spatial and temporal expression of targeted genes through post-transcriptional regulation. While miRNA have been characterised in detail for many other species, this is not yet the case for Atlantic salmon. To identify miRNAs from Atlantic salmon, we constructed whole fish miRNA libraries for 18 individual juveniles (fry, four months post hatch) and characterised them by Illumina high-throughput sequencing (total of 354,505,167 paired-ended reads). We report an extensive and partly novel repertoire of miRNA sequences, comprising 888 miRNA genes (547 unique mature miRNA sequences), quantify their expression levels in basal conditions, examine their homology to miRNAs from other species and identify their predicted target genes. We also identify the location and putative copy number of the miRNA genes in the draft Atlantic salmon reference genome sequence. The Atlantic salmon miRNAs experimentally identified in this study provide a robust large-scale resource for functional genome research in salmonids. There is an opportunity to explore the evolution of salmonid miRNAs following the relatively recent whole genome duplication event in salmonid species and to investigate the role of miRNAs in the regulation of gene expression in particular their contribution to variation in economically and ecologically important traits. PMID:23922936
Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita
2010-12-31
Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.
Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita
2010-01-01
Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215
The bovine lactation genome: Insights into the evolution of mammalian milk
USDA-ARS?s Scientific Manuscript database
The newly assembled Bos Taurus genome sequence enables the linkage of bovine milk and lactation data with other mammalian genomes. Using publicly available milk proteome data and mammary expressed sequence tags, 197 milk protein genes and over 6,000 mammary genes were identified in the bovine genome...
USDA-ARS?s Scientific Manuscript database
We describe a suite of software tools for identifying possible functional changes in gene structure that may result from sequence variants. ACE (“Assessing Changes to Exons”) converts phased genotype calls to a collection of explicit haplotype sequences, maps transcript annotations onto them, detect...
USDA-ARS?s Scientific Manuscript database
Introduction: In an effort to characterize novel bacteriophage with lytic activity against pathogenic E.coli associated with foodborne illness, gene sequencing and mass spectrometry have been used to identify expressed peptides which differentiate isolated bacteriophage from other known phage. Here,...
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Shihui; Vera, Jessica M.; Grass, Jeff
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less
Yang, Shihui; Vera, Jessica M.; Grass, Jeff; ...
2018-05-02
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less
Lee, Byungwook; Kim, Taehyung; Kim, Seon-Kyu; Lee, Kwang H; Lee, Doheon
2007-01-01
With the advent of automated and high-throughput techniques, the number of patent applications containing biological sequences has been increasing rapidly. However, they have attracted relatively little attention compared to other sequence resources. We have built a database server called Patome, which contains biological sequence data disclosed in patents and published applications, as well as their analysis information. The analysis is divided into two steps. The first is an annotation step in which the disclosed sequences were annotated with RefSeq database. The second is an association step where the sequences were linked to Entrez Gene, OMIM and GO databases, and their results were saved as a gene-patent table. From the analysis, we found that 55% of human genes were associated with patenting. The gene-patent table can be used to identify whether a particular gene or disease is related to patenting. Patome is available at http://www.patome.org/; the information is updated bimonthly.
Cappi, C; Brentani, H; Lima, L; Sanders, S J; Zai, G; Diniz, B J; Reis, V N S; Hounie, A G; Conceição do Rosário, M; Mariani, D; Requena, G L; Puga, R; Souza-Duran, F L; Shavitt, R G; Pauls, D L; Miguel, E C; Fernandez, T V
2016-01-01
Studies of rare genetic variation have identified molecular pathways conferring risk for developmental neuropsychiatric disorders. To date, no published whole-exome sequencing studies have been reported in obsessive-compulsive disorder (OCD). We sequenced all the genome coding regions in 20 sporadic OCD cases and their unaffected parents to identify rare de novo (DN) single-nucleotide variants (SNVs). The primary aim of this pilot study was to determine whether DN variation contributes to OCD risk. To this aim, we evaluated whether there is an elevated rate of DN mutations in OCD, which would justify this approach toward gene discovery in larger studies of the disorder. Furthermore, to explore functional molecular correlations among genes with nonsynonymous DN SNVs in OCD probands, a protein–protein interaction (PPI) network was generated based on databases of direct molecular interactions. We applied Degree-Aware Disease Gene Prioritization (DADA) to rank the PPI network genes based on their relatedness to a set of OCD candidate genes from two OCD genome-wide association studies (Stewart et al., 2013; Mattheisen et al., 2014). In addition, we performed a pathway analysis with genes from the PPI network. The rate of DN SNVs in OCD was 2.51 × 10−8 per base per generation, significantly higher than a previous estimated rate in unaffected subjects using the same sequencing platform and analytic pipeline. Several genes harboring DN SNVs in OCD were highly interconnected in the PPI network and ranked high in the DADA analysis. Nearly all the DN SNVs in this study are in genes expressed in the human brain, and a pathway analysis revealed enrichment in immunological and central nervous system functioning and development. The results of this pilot study indicate that further investigation of DN variation in larger OCD cohorts is warranted to identify specific risk genes and to confirm our preliminary finding with regard to PPI network enrichment for particular biological pathways and functions. PMID:27023170
Transcriptome Assembly, Gene Annotation and Tissue Gene Expression Atlas of the Rainbow Trout
Salem, Mohamed; Paneru, Bam; Al-Tobasei, Rafet; Abdouni, Fatima; Thorgaard, Gary H.; Rexroad, Caird E.; Yao, Jianbo
2015-01-01
Efforts to obtain a comprehensive genome sequence for rainbow trout are ongoing and will be complemented by transcriptome information that will enhance genome assembly and annotation. Previously, transcriptome reference sequences were reported using data from different sources. Although the previous work added a great wealth of sequences, a complete and well-annotated transcriptome is still needed. In addition, gene expression in different tissues was not completely addressed in the previous studies. In this study, non-normalized cDNA libraries were sequenced from 13 different tissues of a single doubled haploid rainbow trout from the same source used for the rainbow trout genome sequence. A total of ~1.167 billion paired-end reads were de novo assembled using the Trinity RNA-Seq assembler yielding 474,524 contigs > 500 base-pairs. Of them, 287,593 had homologies to the NCBI non-redundant protein database. The longest contig of each cluster was selected as a reference, yielding 44,990 representative contigs. A total of 4,146 contigs (9.2%), including 710 full-length sequences, did not match any mRNA sequences in the current rainbow trout genome reference. Mapping reads to the reference genome identified an additional 11,843 transcripts not annotated in the genome. A digital gene expression atlas revealed 7,678 housekeeping and 4,021 tissue-specific genes. Expression of about 16,000–32,000 genes (35–71% of the identified genes) accounted for basic and specialized functions of each tissue. White muscle and stomach had the least complex transcriptomes, with high percentages of their total mRNA contributed by a small number of genes. Brain, testis and intestine, in contrast, had complex transcriptomes, with a large numbers of genes involved in their expression patterns. This study provides comprehensive de novo transcriptome information that is suitable for functional and comparative genomics studies in rainbow trout, including annotation of the genome. PMID:25793877
Identifying transcription factor functions and targets by phenotypic activation
Chua, Gordon; Morris, Quaid D.; Sopko, Richelle; Robinson, Mark D.; Ryan, Owen; Chan, Esther T.; Frey, Brendan J.; Andrews, Brenda J.; Boone, Charles; Hughes, Timothy R.
2006-01-01
Mapping transcriptional regulatory networks is difficult because many transcription factors (TFs) are activated only under specific conditions. We describe a generic strategy for identifying genes and pathways induced by individual TFs that does not require knowledge of their normal activation cues. Microarray analysis of 55 yeast TFs that caused a growth phenotype when overexpressed showed that the majority caused increased transcript levels of genes in specific physiological categories, suggesting a mechanism for growth inhibition. Induced genes typically included established targets and genes with consensus promoter motifs, if known, indicating that these data are useful for identifying potential new target genes and binding sites. We identified the sequence 5′-TCACGCAA as a binding sequence for Hms1p, a TF that positively regulates pseudohyphal growth and previously had no known motif. The general strategy outlined here presents a straightforward approach to discovery of TF activities and mapping targets that could be adapted to any organism with transgenic technology. PMID:16880382
Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H
1996-01-01
Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850
Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.
Taylor, Louis J; Strebel, Klaus
2017-01-07
Gene knockouts are a common tool used to study gene function in various organisms. However, designing gene knockouts is complicated in viruses, which frequently contain sequences that code for multiple overlapping genes. Designing mutants that can be traced by the creation of new or elimination of existing restriction sites further compounds the difficulty in experimental design of knockouts of overlapping genes. While software is available to rapidly identify restriction sites in a given nucleotide sequence, no existing software addresses experimental design of mutations involving multiple overlapping amino acid sequences in generating gene knockouts. Pyviko performed well on a test set of over 240,000 gene pairs collected from viral genomes deposited in the National Center for Biotechnology Information Nucleotide database, identifying a point mutation which added a premature stop codon within the first 20 codons of the target gene in 93.2% of all tested gene-overprinted gene pairs. This shows that Pyviko can be used successfully in a wide variety of contexts to facilitate the molecular cloning and study of viral overprinted genes. Pyviko is an extensible and intuitive Python tool for designing knockouts of overlapping genes. Freely available as both a Python package and a web-based interface ( http://louiejtaylor.github.io/pyViKO/ ), Pyviko simplifies the experimental design of gene knockouts in complex viruses with overlapping genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Guotian; Jain, Rashmi; Chern, Mawsheng
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportionmore » of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. In conclusion, this work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations.« less
Li, Haonan; Jin, Peng; Hao, Qian; Zhu, Wei; Chen, Xia; Wang, Ping
2017-11-01
Waardenburg syndrome (WS) is a rare autosomal dominant disorder associated with pigmentation abnormalities and sensorineural hearing loss. In this study, we investigated the genetic cause of WSII in a patient and evaluated the reliability of the targeted next-generation exome sequencing method for the genetic diagnosis of WS. Clinical evaluations were conducted on the patient and targeted next-generation sequencing (NGS) was used to identify the candidate genes responsible for WSII. Multiplex ligation-dependent probe amplification (MLPA) and real-time quantitative polymerase chain reaction (qPCR) were performed to confirm the targeted NGS results. Targeted NGS detected the entire deletion of the coding sequence (CDS) of the SOX10 gene in the WSII patient. MLPA results indicated that all exons of the SOX10 heterozygous deletion were detected; no aberrant copy number in the PAX3 and microphthalmia-associated transcription factor (MITF) genes was found. Real-time qPCR results identified the mutation as a de novo heterozygous deletion. This is the first report of using a targeted NGS method for WS candidate gene sequencing; its accuracy was verified by using the MLPA and qPCR methods. Our research provides a valuable method for the genetic diagnosis of WS.
Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G
1995-01-01
The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961
Bhattacharyya, Anamitra; Stilwagen, Stephanie; Reznik, Gary; Feil, Helene; Feil, William S; Anderson, Iain; Bernal, Axel; D'Souza, Mark; Ivanova, Natalia; Kapatral, Vinayak; Larsen, Niels; Los, Tamara; Lykidis, Athanasios; Selkov, Eugene; Walunas, Theresa L; Purcell, Alexander; Edwards, Rob A; Hawkins, Trevor; Haselkorn, Robert; Overbeek, Ross; Kyrpides, Nikos C; Predki, Paul F
2002-10-01
Draft sequencing is a rapid and efficient method for determining the near-complete sequence of microbial genomes. Here we report a comparative analysis of one complete and two draft genome sequences of the phytopathogenic bacterium, Xylella fastidiosa, which causes serious disease in plants, including citrus, almond, and oleander. We present highlights of an in silico analysis based on a comparison of reconstructions of core biological subsystems. Cellular pathway reconstructions have been used to identify a small number of genes, which are likely to reside within the draft genomes but are not captured in the draft assembly. These represented only a small fraction of all genes and were predominantly large and small ribosomal subunit protein components. By using this approach, some of the inherent limitations of draft sequence can be significantly reduced. Despite the incomplete nature of the draft genomes, it is possible to identify several phage-related genes, which appear to be absent from the draft genomes and not the result of insufficient sequence sampling. This region may therefore identify potential host-specific functions. Based on this first functional reconstruction of a phytopathogenic microbe, we spotlight an unusual respiration machinery as a potential target for biological control. We also predicted and developed a new defined growth medium for Xylella.
The pig X and Y Chromosomes: structure, sequence, and evolution
Skinner, Benjamin M.; Sargent, Carole A.; Churcher, Carol; Hunt, Toby; Herrero, Javier; Loveland, Jane E.; Dunn, Matt; Louzada, Sandra; Fu, Beiyuan; Chow, William; Gilbert, James; Austin-Guest, Siobhan; Beal, Kathryn; Carvalho-Silva, Denise; Cheng, William; Gordon, Daria; Grafham, Darren; Hardy, Matt; Harley, Jo; Hauser, Heidi; Howden, Philip; Howe, Kerstin; Lachani, Kim; Ellis, Peter J.I.; Kelly, Daniel; Kerry, Giselle; Kerwin, James; Ng, Bee Ling; Threadgold, Glen; Wileman, Thomas; Wood, Jonathan M.D.; Yang, Fengtang; Harrow, Jen; Affara, Nabeel A.; Tyler-Smith, Chris
2016-01-01
We have generated an improved assembly and gene annotation of the pig X Chromosome, and a first draft assembly of the pig Y Chromosome, by sequencing BAC and fosmid clones from Duroc animals and incorporating information from optical mapping and fiber-FISH. The X Chromosome carries 1033 annotated genes, 690 of which are protein coding. Gene order closely matches that found in primates (including humans) and carnivores (including cats and dogs), which is inferred to be ancestral. Nevertheless, several protein-coding genes present on the human X Chromosome were absent from the pig, and 38 pig-specific X-chromosomal genes were annotated, 22 of which were olfactory receptors. The pig Y-specific Chromosome sequence generated here comprises 30 megabases (Mb). A 15-Mb subset of this sequence was assembled, revealing two clusters of male-specific low copy number genes, separated by an ampliconic region including the HSFY gene family, which together make up most of the short arm. Both clusters contain palindromes with high sequence identity, presumably maintained by gene conversion. Many of the ancestral X-related genes previously reported in at least one mammalian Y Chromosome are represented either as active genes or partial sequences. This sequencing project has allowed us to identify genes—both single copy and amplified—on the pig Y Chromosome, to compare the pig X and Y Chromosomes for homologous sequences, and thereby to reveal mechanisms underlying pig X and Y Chromosome evolution. PMID:26560630
Identification of rare paired box 3 variant in strabismus by whole exome sequencing
Gong, Hui-Min; Wang, Jing; Xu, Jing; Zhou, Zhan-Yu; Li, Jing-Wen; Chen, Shu-Fang
2017-01-01
AIM To identify the potentially pathogenic gene variants that contributes to the etiology of strabismus. METHODS A Chinese pedigree with strabismus was collected and the exomes of two affected individuals were sequenced using the next-generation sequencing technology. The resulting variants from exome sequencing were filtered by subsequent bioinformatics methods and the candidate mutation was verified as heterozygous in the affected proposita and her mother by sanger sequencing. RESULTS Whole exome sequencing and filtering identified a nonsynonymous mutation c.434G-T transition in paired box 3 (PAX3) in the two affected individuals, which were predicted to be deleterious by more than 4 bioinformatics programs. This altered amino acid residue was located in the conserved PAX domain of PAX3. This gene encodes a member of the PAX family of transcription factors, which play critical roles during fetal development. Mutations in PAX3 were associated with Waardenburg syndrome with strabismus. CONCLUSION Our results report that the c.434G-T mutation (p.R145L) in PAX3 may contribute to strabismus, expanding our understanding of the causally relevant genes for this disorder. PMID:28861346
Identification of rare paired box 3 variant in strabismus by whole exome sequencing.
Gong, Hui-Min; Wang, Jing; Xu, Jing; Zhou, Zhan-Yu; Li, Jing-Wen; Chen, Shu-Fang
2017-01-01
To identify the potentially pathogenic gene variants that contributes to the etiology of strabismus. A Chinese pedigree with strabismus was collected and the exomes of two affected individuals were sequenced using the next-generation sequencing technology. The resulting variants from exome sequencing were filtered by subsequent bioinformatics methods and the candidate mutation was verified as heterozygous in the affected proposita and her mother by sanger sequencing. Whole exome sequencing and filtering identified a nonsynonymous mutation c.434G-T transition in paired box 3 (PAX3) in the two affected individuals, which were predicted to be deleterious by more than 4 bioinformatics programs. This altered amino acid residue was located in the conserved PAX domain of PAX3. This gene encodes a member of the PAX family of transcription factors, which play critical roles during fetal development. Mutations in PAX3 were associated with Waardenburg syndrome with strabismus. Our results report that the c.434G-T mutation (p.R145L) in PAX3 may contribute to strabismus, expanding our understanding of the causally relevant genes for this disorder.
Identification of novel alleles of the rice blast resistance gene Pi54
NASA Astrophysics Data System (ADS)
Vasudevan, Kumar; Gruissem, Wilhelm; Bhullar, Navreet K.
2015-10-01
Rice blast is one of the most devastating rice diseases and continuous resistance breeding is required to control the disease. The rice blast resistance gene Pi54 initially identified in an Indian cultivar confers broad-spectrum resistance in India. We explored the allelic diversity of the Pi54 gene among 885 Indian rice genotypes that were found resistant in our screening against field mixture of naturally existing M. oryzae strains as well as against five unique strains. These genotypes are also annotated as rice blast resistant in the International Rice Genebank database. Sequence-based allele mining was used to amplify and clone the Pi54 allelic variants. Nine new alleles of Pi54 were identified based on the nucleotide sequence comparison to the Pi54 reference sequence as well as to already known Pi54 alleles. DNA sequence analysis of the newly identified Pi54 alleles revealed several single polymorphic sites, three double deletions and an eight base pair deletion. A SNP-rich region was found between a tyrosine kinase phosphorylation site and the nucleotide binding site (NBS) domain. Together, the newly identified Pi54 alleles expand the allelic series and are candidates for rice blast resistance breeding programs.
Zhu, Qihui; Smith, Shavannor M; Ayele, Mulu; Yang, Lixing; Jogi, Ansuya; Chaluvadi, Srinivasa R; Bennetzen, Jeffrey L
2012-11-01
Tef (Eragrostis tef) is a major cereal crop in Ethiopia. Lodging is the primary constraint to increasing productivity in this allotetraploid species, accounting for losses of ∼15-45% in yield each year. As a first step toward identifying semi-dwarf varieties that might have improved lodging resistance, an ∼6× fosmid library was constructed and used to identify both homeologues of the dw3 semi-dwarfing gene of Sorghum bicolor. An EMS mutagenized population, consisting of ∼21,210 tef plants, was planted and leaf materials were collected into 23 superpools. Two dwarfing candidate genes, homeologues of dw3 of sorghum and rht1 of wheat, were sequenced directly from each superpool with 454 technology, and 120 candidate mutations were identified. Out of 10 candidates tested, six independent mutations were validated by Sanger sequencing, including two predicted detrimental mutations in both dw3 homeologues with a potential to improve lodging resistance in tef through further breeding. This study demonstrates that high-throughput sequencing can identify potentially valuable mutations in under-studied plant species like tef and has provided mutant lines that can now be combined and tested in breeding programs for improved lodging resistance.
Mutation Scanning in Wheat by Exon Capture and Next-Generation Sequencing.
King, Robert; Bird, Nicholas; Ramirez-Gonzalez, Ricardo; Coghill, Jane A; Patil, Archana; Hassani-Pak, Keywan; Uauy, Cristobal; Phillips, Andrew L
2015-01-01
Targeted Induced Local Lesions in Genomes (TILLING) is a reverse genetics approach to identify novel sequence variation in genomes, with the aims of investigating gene function and/or developing useful alleles for breeding. Despite recent advances in wheat genomics, most current TILLING methods are low to medium in throughput, being based on PCR amplification of the target genes. We performed a pilot-scale evaluation of TILLING in wheat by next-generation sequencing through exon capture. An oligonucleotide-based enrichment array covering ~2 Mbp of wheat coding sequence was used to carry out exon capture and sequencing on three mutagenised lines of wheat containing previously-identified mutations in the TaGA20ox1 homoeologous genes. After testing different mapping algorithms and settings, candidate SNPs were identified by mapping to the IWGSC wheat Chromosome Survey Sequences. Where sequence data for all three homoeologues were found in the reference, mutant calls were unambiguous; however, where the reference lacked one or two of the homoeologues, captured reads from these genes were mis-mapped to other homoeologues, resulting either in dilution of the variant allele frequency or assignment of mutations to the wrong homoeologue. Competitive PCR assays were used to validate the putative SNPs and estimate cut-off levels for SNP filtering. At least 464 high-confidence SNPs were detected across the three mutagenized lines, including the three known alleles in TaGA20ox1, indicating a mutation rate of ~35 SNPs per Mb, similar to that estimated by PCR-based TILLING. This demonstrates the feasibility of using exon capture for genome re-sequencing as a method of mutation detection in polyploid wheat, but accurate mutation calling will require an improved genomic reference with more comprehensive coverage of homoeologues.
2014-01-01
Background Neisseria meningitidis expresses type four pili (Tfp) which are important for colonisation and virulence. Tfp have been considered as one of the most variable structures on the bacterial surface due to high frequency gene conversion, resulting in amino acid sequence variation of the major pilin subunit (PilE). Meningococci express either a class I or a class II pilE gene and recent work has indicated that class II pilins do not undergo antigenic variation, as class II pilE genes encode conserved pilin subunits. The purpose of this work was to use whole genome sequences to further investigate the frequency and variability of the class II pilE genes in meningococcal isolate collections. Results We analysed over 600 publically available whole genome sequences of N. meningitidis isolates to determine the sequence and genomic organization of pilE. We confirmed that meningococcal strains belonging to a limited number of clonal complexes (ccs, namely cc1, cc5, cc8, cc11 and cc174) harbour a class II pilE gene which is conserved in terms of sequence and chromosomal context. We also identified pilS cassettes in all isolates with class II pilE, however, our analysis indicates that these do not serve as donor sequences for pilE/pilS recombination. Furthermore, our work reveals that the class II pilE locus lacks the DNA sequence motifs that enable (G4) or enhance (Sma/Cla repeat) pilin antigenic variation. Finally, through analysis of pilin genes in commensal Neisseria species we found that meningococcal class II pilE genes are closely related to pilE from Neisseria lactamica and Neisseria polysaccharea, suggesting horizontal transfer among these species. Conclusions Class II pilins can be defined by their amino acid sequence and genomic context and are present in meningococcal isolates which have persisted and spread globally. The absence of G4 and Sma/Cla sequences adjacent to the class II pilE genes is consistent with the lack of pilin subunit variation in these isolates, although horizontal transfer may generate class II pilin diversity. This study supports the suggestion that high frequency antigenic variation of pilin is not universal in pathogenic Neisseria. PMID:24690385
Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.
Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco
2017-01-01
Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.
A dual role for a polyketide synthase in dynemicin enediyne and anthraquinone biosynthesis
NASA Astrophysics Data System (ADS)
Cohen, Douglas R.; Townsend, Craig A.
2018-02-01
Dynemicin A is a member of a subfamily of enediyne antitumour antibiotics characterized by a 10-membered carbocycle fused to an anthraquinone, both of polyketide origin. Sequencing of the dynemicin biosynthetic gene cluster in Micromonospora chersina previously identified an enediyne polyketide synthase (PKS), but no anthraquinone PKS, suggesting gene(s) for biosynthesis of the latter were distant from the core dynemicin cluster. To identify these gene(s), we sequenced and analysed the genome of M. chersina. Sequencing produced a short list of putative PKS candidates, yet CRISPR-Cas9 mutants of each locus retained dynemicin production. Subsequently, deletion of two cytochromes P450 in the dynemicin cluster suggested that the dynemicin enediyne PKS, DynE8, may biosynthesize the anthraquinone. Together with 18O-labelling studies, we now present evidence that DynE8 produces the core scaffolds of both the enediyne and anthraquinone, and provide a working model to account for their formation from the programmed octaketide of the enediyne PKS.
Livernois, Alexandra; Hardy, Kristine; Domaschenz, Renae; Papanicolaou, Alexie; Georges, Arthur; Sarre, Stephen D; Rao, Sudha; Ezaz, Tariq; Deakin, Janine E
2016-10-01
Interleukins are a group of cytokines with complex immunomodulatory functions that are important for regulating immunity in vertebrate species. Reptiles and mammals last shared a common ancestor more than 350 million years ago, so it is not surprising that low sequence identity has prevented divergent interleukin genes from being identified in the central bearded dragon lizard, Pogona vitticeps, in its genome assembly. To determine the complete nucleotide sequences of key interleukin genes, we constructed full-length transcripts, using the Trinity platform, from short paired-end read RNA sequences from stimulated spleen cells. De novo transcript reconstruction and analysis allowed us to identify interleukin genes that are missing from the published P. vitticeps assembly. Identification of key cytokines in P. vitticeps will provide insight into the essential molecular mechanisms and evolution of interleukin gene families and allow for characterization of the immune response in a lizard for comparison with mammals.
Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.
1997-01-07
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.
Diagnostic method employing MSH2 protein
de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.
1998-01-01
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.
1997-01-01
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
Fumagalli, Caterina; Vacirca, Davide; Rappa, Alessandra; Passaro, Antonio; Guarize, Juliana; Rafaniello Raviele, Paola; de Marinis, Filippo; Spaggiari, Lorenzo; Casadio, Chiara; Viale, Giuseppe; Barberis, Massimo; Guerini-Rocco, Elena
2018-03-13
Molecular profiling of advanced non-small cell lung cancers (NSCLC) is essential to identify patients who may benefit from targeted treatments. In the last years, the number of potentially actionable molecular alterations has rapidly increased. Next-generation sequencing allows for the analysis of multiple genes simultaneously. To evaluate the feasibility and the throughput of next-generation sequencing in clinical molecular diagnostics of advanced NSCLC. A single-institution cohort of 535 non-squamous NSCLC was profiled using a next-generation sequencing panel targeting 22 actionable and cancer-related genes. 441 non-squamous NSCLC (82.4%) harboured at least one gene alteration, including 340 cases (63.6%) with clinically relevant molecular aberrations. Mutations have been detected in all but one gene ( FGFR1 ) of the panel. Recurrent alterations were observed in KRAS , TP53 , EGFR , STK11 and MET genes, whereas the remaining genes were mutated in <5% of the cases. Concurrent mutations were detected in 183 tumours (34.2%), mostly impairing KRAS or EGFR in association with TP53 alterations. The study highlights the feasibility of targeted next-generation sequencing in clinical setting. The majority of NSCLC harboured mutations in clinically relevant genes, thus identifying patients who might benefit from different targeted therapies. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Gene Discovery through Genomic Sequencing of Brucella abortus
Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.
2001-01-01
Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Chakrabarty, Sanjiban; Varghese, Vinay Koshy; Sahu, Pranoy; Jayaram, Pradyumna; Shivakumar, Bhadravathi M; Pai, Cannanore Ganesh; Satyamoorthy, Kapaettu
2017-06-27
Long-standing ulcerative colitis (UC) leading to colorectal cancer (CRC) is one of the most serious and life-threatening consequences acknowledged globally. Ulcerative colitis-associated colorectal carcinogenesis showed distinct molecular alterations when compared with sporadic colorectal carcinoma. Targeted sequencing of 409 genes in tissue samples of 18 long-standing UC subjects at high risk of colorectal carcinoma (UCHR) was performed to identify somatic driver mutations, which may be involved in the molecular changes during the transformation of non-dysplastic mucosa to high-grade dysplasia. Findings from the study are also compared with previously published genome wide and exome sequencing data in inflammatory bowel disease-associated and sporadic colorectal carcinoma. Next-generation sequencing analysis identified 1107 mutations in 275 genes in UCHR subjects. In addition to TP53 (17%) and KRAS (22%) mutations, recurrent mutations in APC (33%), ACVR2A (61%), ARID1A (44%), RAF1 (39%) and MTOR (61%) were observed in UCHR subjects. In addition, APC, FGFR3, FGFR2 and PIK3CA driver mutations were identified in UCHR subjects. Recurrent mutations in ARID1A (44%), SMARCA4 (17%), MLL2 (44%), MLL3 (67%), SETD2 (17%) and TET2 (50%) genes involved in histone modification and chromatin remodelling were identified in UCHR subjects. Our study identifies new oncogenic driver mutations which may be involved in the transition of non-dysplastic cells to dysplastic phenotype in the subjects with long-standing UC with high risk of progression into colorectal neoplasia.
New Erwinia-Like Organism Causing Cervical Lymphadenitis▿
Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo
2008-01-01
The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665
Intrinsic and extrinsic approaches for detecting genes in a bacterial genome.
Borodovsky, M; Rudd, K E; Koonin, E V
1994-01-01
The unannotated regions of the Escherichia coli genome DNA sequence from the EcoSeq6 database, totaling 1,278 'intergenic' sequences of the combined length of 359,279 basepairs, were analyzed using computer-assisted methods with the aim of identifying putative unknown genes. The proposed strategy for finding new genes includes two key elements: i) prediction of expressed open reading frames (ORFs) using the GeneMark method based on Markov chain models for coding and non-coding regions of Escherichia coli DNA, and ii) search for protein sequence similarities using programs based on the BLAST algorithm and programs for motif identification. A total of 354 putative expressed ORFs were predicted by GeneMark. Using the BLASTX and TBLASTN programs, it was shown that 208 ORFs located in the unannotated regions of the E. coli chromosome are significantly similar to other protein sequences. Identification of 182 ORFs as probable genes was supported by GeneMark and BLAST, comprising 51.4% of the GeneMark 'hits' and 87.5% of the BLAST 'hits'. 73 putative new genes, comprising 20.6% of the GeneMark predictions, belong to ancient conserved protein families that include both eubacterial and eukaryotic members. This value is close to the overall proportion of highly conserved sequences among eubacterial proteins, indicating that the majority of the putative expressed ORFs that are predicted by GeneMark, but have no significant BLAST hits, nevertheless are likely to be real genes. The majority of the putative genes identified by BLAST search have been described since the release of the EcoSeq6 database, but about 70 genes have not been detected so far. Among these new identifications are genes encoding proteins with a variety of predicted functions including dehydrogenases, kinases, several other metabolic enzymes, ATPases, rRNA methyltransferases, membrane proteins, and different types of regulatory proteins. Images PMID:7984428
Viggor, Signe; Jõesaar, Merike; Vedler, Eve; Kiiker, Riinu; Pärnpuu, Liis; Heinaru, Ain
2015-12-30
Formation of specific oil degrading bacterial communities in diesel fuel, crude oil, heptane and hexadecane supplemented microcosms of the Baltic Sea surface water samples was revealed. The 475 sequences from constructed alkane hydroxylase alkB gene clone libraries were grouped into 30 OPFs. The two largest groups were most similar to Pedobacter sp. (245 from 475) and Limnobacter sp. (112 from 475) alkB gene sequences. From 56 alkane-degrading bacterial strains 41 belonged to the Pseudomonas spp. and 8 to the Rhodococcus spp. having redundant alkB genes. Together 68 alkB gene sequences were identified. These genes grouped into 20 OPFs, half of them being specific only to the isolated strains. Altogether 543 diverse alkB genes were characterized in the brackish Baltic Sea water; some of them representing novel lineages having very low sequence identities with corresponding genes of the reference strains. Copyright © 2015 Elsevier Ltd. All rights reserved.
A 5.8S nuclear ribosomal RNA gene sequence database: applications to ecology and evolution
NASA Technical Reports Server (NTRS)
Cullings, K. W.; Vogler, D. R.
1998-01-01
We complied a 5.8S nuclear ribosomal gene sequence database for animals, plants, and fungi using both newly generated and GenBank sequences. We demonstrate the utility of this database as an internal check to determine whether the target organism and not a contaminant has been sequenced, as a diagnostic tool for ecologists and evolutionary biologists to determine the placement of asexual fungi within larger taxonomic groups, and as a tool to help identify fungi that form ectomycorrhizae.
Molecular diagnosis of putative Stargardt disease probands by exome sequencing
2012-01-01
Background The commonest genetic form of juvenile or early adult onset macular degeneration is Stargardt Disease (STGD) caused by recessive mutations in the gene ABCA4. However, high phenotypic and allelic heterogeneity and a small but non-trivial amount of locus heterogeneity currently impede conclusive molecular diagnosis in a significant proportion of cases. Methods We performed whole exome sequencing (WES) of nine putative Stargardt Disease probands and searched for potentially disease-causing genetic variants in previously identified retinal or macular dystrophy genes. Follow-up dideoxy sequencing was performed for confirmation and to screen for mutations in an additional set of affected individuals lacking a definitive molecular diagnosis. Results Whole exome sequencing revealed seven likely disease-causing variants across four genes, providing a confident genetic diagnosis in six previously uncharacterized participants. We identified four previously missed mutations in ABCA4 across three individuals. Likely disease-causing mutations in RDS/PRPH2, ELOVL, and CRB1 were also identified. Conclusions Our findings highlight the enormous potential of whole exome sequencing in Stargardt Disease molecular diagnosis and research. WES adequately assayed all coding sequences and canonical splice sites of ABCA4 in this study. Additionally, WES enables the identification of disease-related alleles in other genes. This work highlights the importance of collecting parental genetic material for WES testing as the current knowledge of human genome variation limits the determination of causality between identified variants and disease. While larger sample sizes are required to establish the precision and accuracy of this type of testing, this study supports WES for inherited early onset macular degeneration disorders as an alternative to standard mutation screening techniques. PMID:22863181
Norton, Nadine; Li, Duanxiang; Rampersaud, Evadnie; Morales, Ana; Martin, Eden R; Zuchner, Stephan; Guo, Shengru; Gonzalez, Michael; Hedges, Dale J; Robertson, Peggy D; Krumm, Niklas; Nickerson, Deborah A; Hershberger, Ray E
2013-04-01
BACKGROUND- Familial dilated cardiomyopathy (DCM) is a genetically heterogeneous disease with >30 known genes. TTN truncating variants were recently implicated in a candidate gene study to cause 25% of familial and 18% of sporadic DCM cases. METHODS AND RESULTS- We used an unbiased genome-wide approach using both linkage analysis and variant filtering across the exome sequences of 48 individuals affected with DCM from 17 families to identify genetic cause. Linkage analysis ranked the TTN region as falling under the second highest genome-wide multipoint linkage peak, multipoint logarithm of odds, 1.59. We identified 6 TTN truncating variants carried by individuals affected with DCM in 7 of 17 DCM families (logarithm of odds, 2.99); 2 of these 7 families also had novel missense variants that segregated with disease. Two additional novel truncating TTN variants did not segregate with DCM. Nucleotide diversity at the TTN locus, including missense variants, was comparable with 5 other known DCM genes. The average number of missense variants in the exome sequences from the DCM cases or the ≈5400 cases from the Exome Sequencing Project was ≈23 per individual. The average number of TTN truncating variants in the Exome Sequencing Project was 0.014 per individual. We also identified a region (chr9q21.11-q22.31) with no known DCM genes with a maximum heterogeneity logarithm of odds score of 1.74. CONCLUSIONS- These data suggest that TTN truncating variants contribute to DCM cause. However, the lack of segregation of all identified TTN truncating variants illustrates the challenge of determining variant pathogenicity even with full exome sequencing.
Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.
2005-01-01
We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085
2011-01-01
Background Biodiesel or ethanol derived from lipids or starch produced by microalgae may overcome many of the sustainability challenges previously ascribed to petroleum-based fuels and first generation plant-based biofuels. The paucity of microalgae genome sequences, however, limits gene-based biofuel feedstock optimization studies. Here we describe the sequencing and de novo transcriptome assembly for the non-model microalgae species, Dunaliella tertiolecta, and identify pathways and genes of importance related to biofuel production. Results Next generation DNA pyrosequencing technology applied to D. tertiolecta transcripts produced 1,363,336 high quality reads with an average length of 400 bases. Following quality and size trimming, ~ 45% of the high quality reads were assembled into 33,307 isotigs with a 31-fold coverage and 376,482 singletons. Assembled sequences and singletons were subjected to BLAST similarity searches and annotated with Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) orthology (KO) identifiers. These analyses identified the majority of lipid and starch biosynthesis and catabolism pathways in D. tertiolecta. Conclusions The construction of metabolic pathways involved in the biosynthesis and catabolism of fatty acids, triacylglycrols, and starch in D. tertiolecta as well as the assembled transcriptome provide a foundation for the molecular genetics and functional genomics required to direct metabolic engineering efforts that seek to enhance the quantity and character of microalgae-based biofuel feedstock. PMID:21401935
Hiremath, Pavana J; Farmer, Andrew; Cannon, Steven B; Woodward, Jimmy; Kudapa, Himabindu; Tuteja, Reetu; Kumar, Ashish; Bhanuprakash, Amindala; Mulaosmanovic, Benjamin; Gujaria, Neha; Krishnamurthy, Laxmanan; Gaur, Pooran M; Kavikishor, Polavarapu B; Shah, Trushar; Srinivasan, Ramamurthy; Lohse, Marc; Xiao, Yongli; Town, Christopher D; Cook, Douglas R; May, Gregory D; Varshney, Rajeev K
2011-10-01
Chickpea (Cicer arietinum L.) is an important legume crop in the semi-arid regions of Asia and Africa. Gains in crop productivity have been low however, particularly because of biotic and abiotic stresses. To help enhance crop productivity using molecular breeding techniques, next generation sequencing technologies such as Roche/454 and Illumina/Solexa were used to determine the sequence of most gene transcripts and to identify drought-responsive genes and gene-based molecular markers. A total of 103,215 tentative unique sequences (TUSs) have been produced from 435,018 Roche/454 reads and 21,491 Sanger expressed sequence tags (ESTs). Putative functions were determined for 49,437 (47.8%) of the TUSs, and gene ontology assignments were determined for 20,634 (41.7%) of the TUSs. Comparison of the chickpea TUSs with the Medicago truncatula genome assembly (Mt 3.5.1 build) resulted in 42,141 aligned TUSs with putative gene structures (including 39,281 predicted intron/splice junctions). Alignment of ∼37 million Illumina/Solexa tags generated from drought-challenged root tissues of two chickpea genotypes against the TUSs identified 44,639 differentially expressed TUSs. The TUSs were also used to identify a diverse set of markers, including 728 simple sequence repeats (SSRs), 495 single nucleotide polymorphisms (SNPs), 387 conserved orthologous sequence (COS) markers, and 2088 intron-spanning region (ISR) markers. This resource will be useful for basic and applied research for genome analysis and crop improvement in chickpea. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd. No claim to original US government works.
de Oliveira Ceita, Geruza; Vilas-Boas, Laurival Antônio; Castilho, Marcelo Santos; Carazzolle, Marcelo Falsarella; Pirovani, Carlos Priminho; Selbach-Schnadelbach, Alessandra; Gramacho, Karina Peres; Ramos, Pablo Ivan Pereira; Barbosa, Luciana Veiga; Pereira, Gonçalo Amarante Guimarães; Góes-Neto, Aristóteles
2014-10-01
The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.
de Oliveira Ceita, Geruza; Vilas-Boas, Laurival Antônio; Castilho, Marcelo Santos; Carazzolle, Marcelo Falsarella; Pirovani, Carlos Priminho; Selbach-Schnadelbach, Alessandra; Gramacho, Karina Peres; Ramos, Pablo Ivan Pereira; Barbosa, Luciana Veiga; Pereira, Gonçalo Amarante Guimarães; Góes-Neto, Aristóteles
2014-01-01
The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches’ broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea. PMID:25505843
USDA-ARS?s Scientific Manuscript database
Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...
Ribas, Laia; Pardo, Belén G; Fernández, Carlos; Alvarez-Diós, José Antonio; Gómez-Tato, Antonio; Quiroga, María Isabel; Planas, Josep V; Sitjà-Bobadilla, Ariadna; Martínez, Paulino; Piferrer, Francesc
2013-03-15
Genomic resources for plant and animal species that are under exploitation primarily for human consumption are increasingly important, among other things, for understanding physiological processes and for establishing adequate genetic selection programs. Current available techniques for high-throughput sequencing have been implemented in a number of species, including fish, to obtain a proper description of the transcriptome. The objective of this study was to generate a comprehensive transcriptomic database in turbot, a highly priced farmed fish species in Europe, with potential expansion to other areas of the world, for which there are unsolved production bottlenecks, to understand better reproductive- and immune-related functions. This information is essential to implement marker assisted selection programs useful for the turbot industry. Expressed sequence tags were generated by Sanger sequencing of cDNA libraries from different immune-related tissues after several parasitic challenges. The resulting database ("Turbot 2 database") was enlarged with sequences generated from a 454 sequencing run of brain-hypophysis-gonadal axis-derived RNA obtained from turbot at different development stages. The assembly of Sanger and 454 sequences generated 52,427 consensus sequences ("Turbot 3 database"), of which 23,661 were successfully annotated. A total of 1,410 sequences were confirmed to be related to reproduction and key genes involved in sex differentiation and maturation were identified for the first time in turbot (AR, AMH, SRY-related genes, CYP19A, ZPGs, STAR FSHR, etc.). Similarly, 2,241 sequences were related to the immune system and several novel key immune genes were identified (BCL, TRAF, NCK, CD28 and TOLLIP, among others). The number of genes of many relevant reproduction- and immune-related pathways present in the database was 50-90% of the total gene count of each pathway. In addition, 1,237 microsatellites and 7,362 single nucleotide polymorphisms (SNPs) were also compiled. Further, 2,976 putative natural antisense transcripts (NATs) including microRNAs were also identified. The combined sequencing strategies employed here significantly increased the turbot genomic resources available, including 34,400 novel sequences. The generated database contains a larger number of genes relevant for reproduction- and immune-associated studies, with an excellent coverage of most genes present in many relevant physiological pathways. This database also allowed the identification of many microsatellites and SNP markers that will be very useful for population and genome screening and a valuable aid in marker assisted selection programs.
2013-01-01
Background Genomic resources for plant and animal species that are under exploitation primarily for human consumption are increasingly important, among other things, for understanding physiological processes and for establishing adequate genetic selection programs. Current available techniques for high-throughput sequencing have been implemented in a number of species, including fish, to obtain a proper description of the transcriptome. The objective of this study was to generate a comprehensive transcriptomic database in turbot, a highly priced farmed fish species in Europe, with potential expansion to other areas of the world, for which there are unsolved production bottlenecks, to understand better reproductive- and immune-related functions. This information is essential to implement marker assisted selection programs useful for the turbot industry. Results Expressed sequence tags were generated by Sanger sequencing of cDNA libraries from different immune-related tissues after several parasitic challenges. The resulting database (“Turbot 2 database”) was enlarged with sequences generated from a 454 sequencing run of brain-hypophysis-gonadal axis-derived RNA obtained from turbot at different development stages. The assembly of Sanger and 454 sequences generated 52,427 consensus sequences (“Turbot 3 database”), of which 23,661 were successfully annotated. A total of 1,410 sequences were confirmed to be related to reproduction and key genes involved in sex differentiation and maturation were identified for the first time in turbot (AR, AMH, SRY-related genes, CYP19A, ZPGs, STAR FSHR, etc.). Similarly, 2,241 sequences were related to the immune system and several novel key immune genes were identified (BCL, TRAF, NCK, CD28 and TOLLIP, among others). The number of genes of many relevant reproduction- and immune-related pathways present in the database was 50–90% of the total gene count of each pathway. In addition, 1,237 microsatellites and 7,362 single nucleotide polymorphisms (SNPs) were also compiled. Further, 2,976 putative natural antisense transcripts (NATs) including microRNAs were also identified. Conclusions The combined sequencing strategies employed here significantly increased the turbot genomic resources available, including 34,400 novel sequences. The generated database contains a larger number of genes relevant for reproduction- and immune-associated studies, with an excellent coverage of most genes present in many relevant physiological pathways. This database also allowed the identification of many microsatellites and SNP markers that will be very useful for population and genome screening and a valuable aid in marker assisted selection programs. PMID:23497389
Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D.; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario
2016-01-01
The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma. Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines. We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK. Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%. Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression. Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants. In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression. PMID:27009842
Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario
2016-04-19
The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma.Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines.We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK.Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%.Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression.Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants.In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression.
Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.
Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling
2015-06-19
Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.
Rios, Jonathan J; Perelygin, Andrey A; Long, Maureen T; Lear, Teri L; Zharkikh, Andrey A; Brinton, Margo A; Adelson, David L
2007-01-01
Background The mammalian OAS/RNASEL pathway plays an important role in antiviral host defense. A premature stop-codon within the murine Oas1b gene results in the increased susceptibility of mice to a number of flaviviruses, including West Nile virus (WNV). Mutations in either the OAS1 or RNASEL genes may also modulate the outcome of WNV-induced disease or other viral infections in horses. Polymorphisms in the human OAS gene cluster have been previously utilized for case-control analysis of virus-induced disease in humans. No polymorphisms have yet been identified in either the equine OAS1 or RNASEL genes for use in similar case-control studies. Results Genomic sequence for equine OAS1 was obtained from a contig assembly generated from a shotgun subclone library of CHORI-241 BAC 100I10. Specific amplification of regions of the OAS1 gene from 13 horses of various breeds identified 33 single nucleotide polymorphisms (SNP) and two microsatellites. RNASEL cDNA sequences were determined for 8 mammals and utilized in a phylogenetic analysis. The chromosomal location of the RNASEL gene was assigned by FISH to ECA5p17-p16 using two selected CHORI-241 BAC clones. The horse genomic RNASEL sequence was assembled. Specific amplification of regions of the RNASEL gene from 13 horses identified 31 SNPs. Conclusion In this report, two dinucleotide microsatellites and 64 single nucleotide polymorphisms within the equine OAS1 and RNASEL genes were identified. These polymorphisms are the first to be reported for these genes and will facilitate future case-control studies of horse susceptibility to infectious diseases. PMID:17822564
Wang, Ying; Yang, Liandong; Wu, Bo; Song, Zhaobin; He, Shunping
2015-07-10
Triplophysa dalaica, endemic species of Qinghai-Tibetan Plateau, is informative for understanding the genetic basis of adaptation to hypoxic conditions of high altitude habitats. Here, a comprehensive gene repertoire for this plateau fish was generated using the Illumina deep paired-end high-throughput sequencing technology. De novo assembly yielded 145, 256 unigenes with an average length of 1632 bp. Blast searches against GenBank non-redundant database annotated 74,594 (51.4%) unigenes encoding for 30,047 gene descriptions in T. dalaica. Functional annotation and classification of assembled sequences were performed using Gene Ontology (GO), clusters of euKaryotic Orthologous Groups (KOG) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. After comparison with other fish transcriptomes, including silver carp (Hypophthalmichthys molitrix) and mud loach (Misgurnus anguillicaudatus), 2621 high-quality orthologous gene alignments were constructed among these species. 61 (2.3%) of the genes were identified as having undergone positive selection in the T. dalaica lineage. Within the positively selected genes, 13 genes were involved in hypoxia response, of which 11 were listed in HypoxiaDB. Furthermore, duplicated hif-α (hif-1αA/B and hif-2αA/B), EGLN1 and PPARA candidate genes involved in adaptation to hypoxia were identified in T. dalaica transcriptome. Branch-site model in PAML validated that hif-1αB and hif-2αA genes have undergone positive selection in T.dalaica. Finally, 37,501 simple sequence repeats (SSRs) and 19,497 high-quality single nucleotide polymorphisms (SNPs) were identified in T. dalaica. The identified SSR and SNP markers will facilitate the genetic structure, population geography and ecological studies of Triplophysa fishes. Copyright © 2015 Elsevier B.V. All rights reserved.
Aguilera, Patricia M.; Bubillo, Rosana E.; Otegui, Mónica B.; Ducasse, Daniel A.; Zapata, Pedro D.; Marti, Dardo A.
2014-01-01
Yerba mate (Ilex paraguariensis A. St.-Hil.) is an important subtropical tree crop cultivated on 326,000 ha in Argentina, Brazil and Paraguay, with a total yield production of more than 1,000,000 t. Yerba mate presents a strong limitation regarding sequence information. The NCBI GenBank lacks an EST database of yerba mate and depicts only 80 DNA sequences, mostly uncharacterized. In this scenario, in order to elucidate the yerba mate gene landscape by means of NGS, we explored and discovered a vast collection of I. paraguariensis transcripts. Total RNA from I. paraguariensis was sequenced by Illumina HiSeq-2000 obtaining 72,031,388 pair-end 100 bp sequences. High quality reads were de novo assembled into 44,907 transcripts encompassing 40 million bases with an estimated coverage of 180X. Multiple sequence analysis allowed us to predict that yerba mate contains ∼32,355 genes and 12,551 gene variants or isoforms. We identified and categorized members of more than 100 metabolic pathways. Overall, we have identified ∼1,000 putative transcription factors, genes involved in heat and oxidative stress, pathogen response, as well as disease resistance and hormone response. We have also identified, based in sequence homology searches, novel transcripts related to osmotic, drought, salinity and cold stress, senescence and early flowering. We have also pinpointed several members of the gene silencing pathway, and characterized the silencing effector Argonaute1. We predicted a diverse supply of putative microRNA precursors involved in developmental processes. We present here the first draft of the transcribed genomes of the yerba mate chloroplast and mitochondrion. The putative sequence and predicted structure of the caffeine synthase of yerba mate is presented. Moreover, we provide a collection of over 10,800 SSR accessible to the scientific community interested in yerba mate genetic improvement. This contribution broadly expands the limited knowledge of yerba mate genes, and is presented as the first genomic resource of this important crop. PMID:25330175
Shitara, M; Tsuboi, Y; Sekizuka, T; Tazumi, A; Moorei, J E; Millar, B C; Taneike, I; Matsuda, M
2008-01-01
Nucleotide sequences of approximately 3.1 kbp consisting of the full-length open reading frame (ORF) for grpE, a non-coding (NC) region and a putative ORF for the full-length dnaK gene (1860 bp) were identified from a urease-positive thermophilic Campylobacter (UPTC) CF89-12 isolate. Then, following the construction of a new degenerate polymerase chain reaction (PCR) primer pair for amplification of the dnaK structural gene, including the transcription terminator region of C. lari isolates, the dnaK region was amplified successfully, TA-cloned and sequenced in nine C. lari isolates. The dnaK gene sequences commenced with an ATG and terminated with a TAA in all 10 isolates, including CF89-12. In addition, the putative ORFs for the dnaK gene locus from seven UPTC isolates consisted of 1860 bases, and the four urease-negative (UN) C. lari isolates included C. lari RM2100 reference strain 1866. Interestingly, different probable ribosome binding sites and hypothetically intrinsic p-independent terminator structures were identified between the seven UPTC and four UN C. lari isolates, respectively. Moreover, it is interesting to note that 20 out of a total of 28 polymorphic sites occurred among amino acid sequences of the dnaK ORF from 11 C. lari isolates, identified to be alternatively UPTC-specific or UN C. lari-specific. In the neighbour-joining tree based on the nucleotide sequence information of the dnaK gene, C. lari forms two major distinct clusters consisting of UPTC and UN C. lari isolates, respectively, with UN C. lari being more closely related to other thermophilic campylobacters than to UPTC.
Boudreaux, Mary K; Humphries, Drew M
2013-12-01
Platelet alloantigens in horses may play an important role in the development of neonatal alloimmune thrombocytopenia (NAIT). The objective of this study was to evaluate genes encoding major platelet glycoproteins within the Equidae family in an effort to identify potential alloantigens. DNA was isolated from blood samples obtained from Equidae family members, including a Holsteiner-Oldenburg cross, a Quarter horse, a donkey, and a Plains zebra (Equus burchelli). Gene sequences encoding equine platelet membrane glycoproteins IIb, IIIa (integrin subunits αIIb and β3), Ia (integrin subunit α2), and Ibα were determined using PCR. Gene sequences were compared to the equine genome available on GenBank. Polymorphisms that would be predicted to result in amino acid changes on platelet surfaces were documented and compared with known alloantigenic sites documented on human platelets. Amino acid differences were predicted based on nucleotide sequences for all 4 genes. Nine differences were documented for αIIb, 5 differences were documented for β3, 7 differences were documented for α2, and 16 differences were documented for Ibα outside the macroglycopeptide region. This study represents the first effort at identifying potential platelet alloantigens in members of the Equidae Family based on evaluation of gene sequences. The data obtained form the groundwork for identifying potential platelet alloantigens involved in transfusion reactions and neonatal alloimmune thrombocytopenia (NAIT). More work is required to determine whether the predicted amino acid differences documented in this study play a role in alloimmunity, and whether other polymorphisms not detected in this study are present that may result in alloimmunity. © 2013 American Society for Veterinary Clinical Pathology.
Kim, Heon Seok; Lee, Kyungjin; Bae, Sangsu; Park, Jeongbin; Lee, Chong-Kyo; Kim, Meehyein; Kim, Eunji; Kim, Minju; Kim, Seokjoong; Kim, Chonsaeng; Kim, Jin-Soo
2017-06-23
Several groups have used genome-wide libraries of lentiviruses encoding small guide RNAs (sgRNAs) for genetic screens. In most cases, sgRNA expression cassettes are integrated into cells by using lentiviruses, and target genes are statistically estimated by the readout of sgRNA sequences after targeted sequencing. We present a new virus-free method for human gene knockout screens using a genome-wide library of CRISPR/Cas9 sgRNAs based on plasmids and target gene identification via whole-genome sequencing (WGS) confirmation of authentic mutations rather than statistical estimation through targeted amplicon sequencing. We used 30,840 pairs of individually synthesized oligonucleotides to construct the genome-scale sgRNA library, collectively targeting 10,280 human genes ( i.e. three sgRNAs per gene). These plasmid libraries were co-transfected with a Cas9-expression plasmid into human cells, which were then treated with cytotoxic drugs or viruses. Only cells lacking key factors essential for cytotoxic drug metabolism or viral infection were able to survive. Genomic DNA isolated from cells that survived these challenges was subjected to WGS to directly identify CRISPR/Cas9-mediated causal mutations essential for cell survival. With this approach, we were able to identify known and novel genes essential for viral infection in human cells. We propose that genome-wide sgRNA screens based on plasmids coupled with WGS are powerful tools for forward genetics studies and drug target discovery. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Takeda, Itaru; Umemura, Myco; Koike, Hideaki; Asai, Kiyoshi; Machida, Masayuki
2014-08-01
Despite their biological importance, a significant number of genes for secondary metabolite biosynthesis (SMB) remain undetected due largely to the fact that they are highly diverse and are not expressed under a variety of cultivation conditions. Several software tools including SMURF and antiSMASH have been developed to predict fungal SMB gene clusters by finding core genes encoding polyketide synthase, nonribosomal peptide synthetase and dimethylallyltryptophan synthase as well as several others typically present in the cluster. In this work, we have devised a novel comparative genomics method to identify SMB gene clusters that is independent of motif information of the known SMB genes. The method detects SMB gene clusters by searching for a similar order of genes and their presence in nonsyntenic blocks. With this method, we were able to identify many known SMB gene clusters with the core genes in the genomic sequences of 10 filamentous fungi. Furthermore, we have also detected SMB gene clusters without core genes, including the kojic acid biosynthesis gene cluster of Aspergillus oryzae. By varying the detection parameters of the method, a significant difference in the sequence characteristics was detected between the genes residing inside the clusters and those outside the clusters. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
2013-01-01
Background Cymbidium sinense belongs to the Orchidaceae, which is one of the most abundant angiosperm families. C. sinense, a high-grade traditional potted flower, is most prevalent in China and some Southeast Asian countries. The control of flowering time is a major bottleneck in the industrialized development of C. sinense. Little is known about the mechanisms responsible for floral development in this orchid. Moreover, genome references for entire transcriptome sequences do not currently exist for C. sinense. Thus, transcriptome and expression profiling data for this species are needed as an important resource to identify genes and to better understand the biological mechanisms of floral development in C. sinense. Results In this study, de novo transcriptome assembly and gene expression analysis using Illumina sequencing technology were performed. Transcriptome analysis assembles gene-related information related to vegetative and reproductive growth of C. sinense. Illumina sequencing generated 54,248,006 high quality reads that were assembled into 83,580 unigenes with an average sequence length of 612 base pairs, including 13,315 clusters and 70,265 singletons. A total of 41,687 (49.88%) unique sequences were annotated, 23,092 of which were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes (KEGG). Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority of sequenced genes were associated with metabolic and cellular processes, cell and cell parts, catalytic activity and binding. Furthermore, 120 flowering-associated unigenes, 73 MADS-box unigenes and 28 CONSTANS-LIKE (COL) unigenes were identified from our collection. In addition, three digital gene expression (DGE) libraries were constructed for the vegetative phase (VP), floral differentiation phase (FDP) and reproductive phase (RP). The specific expression of many genes in the three development phases was also identified. 32 genes among three sub-libraries with high differential expression were selected as candidates connected with flower development. Conclusion RNA-seq and DGE profiling data provided comprehensive gene expression information at the transcriptional level that could facilitate our understanding of the molecular mechanisms of floral development at three development phases of C. sinense. This data could be used as an important resource for investigating the genetics of the flowering pathway and various biological mechanisms in this orchid. PMID:23617896
Zhang, Jianxia; Wu, Kunlin; Zeng, Songjun; Teixeira da Silva, Jaime A; Zhao, Xiaolan; Tian, Chang-En; Xia, Haoqiang; Duan, Jun
2013-04-24
Cymbidium sinense belongs to the Orchidaceae, which is one of the most abundant angiosperm families. C. sinense, a high-grade traditional potted flower, is most prevalent in China and some Southeast Asian countries. The control of flowering time is a major bottleneck in the industrialized development of C. sinense. Little is known about the mechanisms responsible for floral development in this orchid. Moreover, genome references for entire transcriptome sequences do not currently exist for C. sinense. Thus, transcriptome and expression profiling data for this species are needed as an important resource to identify genes and to better understand the biological mechanisms of floral development in C. sinense. In this study, de novo transcriptome assembly and gene expression analysis using Illumina sequencing technology were performed. Transcriptome analysis assembles gene-related information related to vegetative and reproductive growth of C. sinense. Illumina sequencing generated 54,248,006 high quality reads that were assembled into 83,580 unigenes with an average sequence length of 612 base pairs, including 13,315 clusters and 70,265 singletons. A total of 41,687 (49.88%) unique sequences were annotated, 23,092 of which were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes (KEGG). Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority of sequenced genes were associated with metabolic and cellular processes, cell and cell parts, catalytic activity and binding. Furthermore, 120 flowering-associated unigenes, 73 MADS-box unigenes and 28 CONSTANS-LIKE (COL) unigenes were identified from our collection. In addition, three digital gene expression (DGE) libraries were constructed for the vegetative phase (VP), floral differentiation phase (FDP) and reproductive phase (RP). The specific expression of many genes in the three development phases was also identified. 32 genes among three sub-libraries with high differential expression were selected as candidates connected with flower development. RNA-seq and DGE profiling data provided comprehensive gene expression information at the transcriptional level that could facilitate our understanding of the molecular mechanisms of floral development at three development phases of C. sinense. This data could be used as an important resource for investigating the genetics of the flowering pathway and various biological mechanisms in this orchid.
Liu, Yong; Cao, Yu; Li, Yaxiong; Lei, Dongyun; Li, Lin; Hou, Zong Liu; Han, Shen; Meng, Mingyao; Shi, Jianlin; Zhang, Yayong; Wang, Yi; Niu, Zhaoyi; Xie, Yanhua; Xiao, Benshan; Wang, Yuanfei; Li, Xiao; Yang, Lirong
2018-01-01
Background Recently, mutations in several genes have been described to be associated with sporadic ASD, but some genetic variants remain to be identified. The aim of this study was to use whole-exome sequencing (WES) combined with bioinformatics analysis to identify novel genetic variants in cases of sporadic congenital ASD, followed by validation by Sanger sequencing. Material/Methods Five Han patients with secundum ASD were recruited, and their tissue samples were analyzed by WES, followed by verification by Sanger sequencing of tissue and blood samples. Further evaluation using blood samples included 452 additional patients with sporadic secundum ASD (212 male and 240 female patients) and 519 healthy subjects (252 male and 267 female subjects) for further verification by a multiplexed MassARRAY system. Bioinformatic analyses were performed to identify novel genetic variants associated with sporadic ASD. Results From five patients with sporadic ASD, a total of 181,762 genomic variants in 33 exon loci, validated by Sanger sequencing, were selected and underwent MassARRAY analysis in 452 patients with ASD and 519 healthy subjects. Three loci with high mutation frequencies, the 138665410 FOXL2 gene variant, the 23862952 MYH6 gene variant, and the 71098693 HYDIN gene variant were found to be significantly associated with sporadic ASD (P<0.05); variants in FOXL2 and MYH6 were found in patients with isolated, sporadic ASD (P<5×10−4). Conclusions This was the first study that demonstrated variants in FOXL2 and HYDIN associated with sporadic ASD, and supported the use of WES and bioinformatics analysis to identify disease-associated mutations. PMID:29505555
Liu, Yong; Cao, Yu; Li, Yaxiong; Lei, Dongyun; Li, Lin; Hou, Zong Liu; Han, Shen; Meng, Mingyao; Shi, Jianlin; Zhang, Yayong; Wang, Yi; Niu, Zhaoyi; Xie, Yanhua; Xiao, Benshan; Wang, Yuanfei; Li, Xiao; Yang, Lirong; Wang, Wenju; Jiang, Lihong
2018-03-05
BACKGROUND Recently, mutations in several genes have been described to be associated with sporadic ASD, but some genetic variants remain to be identified. The aim of this study was to use whole-exome sequencing (WES) combined with bioinformatics analysis to identify novel genetic variants in cases of sporadic congenital ASD, followed by validation by Sanger sequencing. MATERIAL AND METHODS Five Han patients with secundum ASD were recruited, and their tissue samples were analyzed by WES, followed by verification by Sanger sequencing of tissue and blood samples. Further evaluation using blood samples included 452 additional patients with sporadic secundum ASD (212 male and 240 female patients) and 519 healthy subjects (252 male and 267 female subjects) for further verification by a multiplexed MassARRAY system. Bioinformatic analyses were performed to identify novel genetic variants associated with sporadic ASD. RESULTS From five patients with sporadic ASD, a total of 181,762 genomic variants in 33 exon loci, validated by Sanger sequencing, were selected and underwent MassARRAY analysis in 452 patients with ASD and 519 healthy subjects. Three loci with high mutation frequencies, the 138665410 FOXL2 gene variant, the 23862952 MYH6 gene variant, and the 71098693 HYDIN gene variant were found to be significantly associated with sporadic ASD (P<0.05); variants in FOXL2 and MYH6 were found in patients with isolated, sporadic ASD (P<5×10^-4). CONCLUSIONS This was the first study that demonstrated variants in FOXL2 and HYDIN associated with sporadic ASD, and supported the use of WES and bioinformatics analysis to identify disease-associated mutations.
Burgos, Mariana; Arenas, Alvaro; Cabrera, Rodrigo
2016-08-01
Inherited long QT syndrome (LQTS) is a cardiac channelopathy characterized by a prolongation of QT interval and the risk of syncope, cardiac arrest, and sudden cardiac death. Genetic diagnosis of LQTS is critical in medical practice as results can guide adequate management of patients and distinguish phenocopies such as catecholaminergic polymorphic ventricular tachycardia (CPVT). However, extensive screening of large genomic regions is required in order to reliably identify genetic causes. Semiconductor whole exome sequencing (WES) is a promising approach for the identification of variants in the coding regions of most human genes. DNA samples from 21 Colombian patients clinically diagnosed with LQTS were enriched for coding regions using multiplex polymerase chain reaction (PCR) and subjected to WES using a semiconductor sequencer. Semiconductor WES showed mean coverage of 93.6 % for all coding regions relevant to LQTS at >10× depth with high intra- and inter-assay depth heterogeneity. Fifteen variants were detected in 12 patients in genes associated with LQTS. Three variants were identified in three patients in genes associated with CPVT. Co-segregation analysis was performed when possible. All variants were analyzed with two pathogenicity prediction algorithms. The overall prevalence of LQTS and CPVT variants in our cohort was 71.4 %. All LQTS variants previously identified through commercial genetic testing were identified. Standardized WES assays can be easily implemented, often at a lower cost than sequencing panels. Our results show that WES can identify LQTS-causing mutations and permits differential diagnosis of related conditions in a real-world clinical setting. However, high heterogeneity in sequencing depth and low coverage in the most relevant genes is expected to be associated with reduced analytical sensitivity.
Emergence of a Novel Chimeric Gene Underlying Grain Number in Rice
Chen, Hao; Tang, Yanyan; Liu, Jianfeng; Tan, Lubin; Jiang, Jiahuan; Wang, Mumu; Zhu, Zuofeng; Sun, Xianyou; Sun, Chuanqing
2017-01-01
Grain number is an important factor in determining grain production of rice (Oryza sativa L.). The molecular genetic basis for grain number is complex. Discovering new genes involved in regulating rice grain number increases our knowledge regarding its molecular mechanisms and aids breeding programs. Here, we identified GRAINS NUMBER 2 (GN2), a novel gene that is responsible for rice grain number, from “Yuanjiang” common wild rice (O. rufipogon Griff.). Transgenic plants overexpressing GN2 showed less grain number, reduced plant height, and later heading date than control plants. Interestingly, GN2 arose through the insertion of a 1094-bp sequence from LOC_Os02g45150 into the third exon of LOC_Os02g56630, and the inserted sequence recruited its nearby sequence to generate the chimeric GN2. The gene structure and expression pattern of GN2 were distinct from those of LOC_Os02g45150 and LOC_Os02g56630. Sequence analysis showed that GN2 may be generated in the natural population of Yuanjiang common wild rice. In this study, we identified a novel functional chimeric gene and also provided information regarding the molecular mechanisms regulating rice grain number. PMID:27986805
Genetic basis of arrhythmogenic cardiomyopathy.
Karmouch, Jennifer; Protonotarios, Alexandros; Syrris, Petros
2018-05-01
To date 16 genes have been associated with arrhythmogenic cardiomyopathy (ACM). Mutations in these genes can lead to a broad spectrum of phenotypic expression ranging from disease affecting predominantly the right or left ventricle, to biventricular subtypes. Understanding the genetic causes of ACM is important in diagnosis and management of the disorder. This review summarizes recent advances in molecular genetics and discusses the application of next-generation sequencing technology in genetic testing in ACM. Use of next-generation sequencing methods has resulted in the identification of novel causative variants and genes for ACM. The involvement of filamin C in ACM demonstrates the genetic overlap between ACM and other types of cardiomyopathy. Putative pathogenic variants have been detected in cadherin 2 gene, a protein involved in cell adhesion. Large genomic rearrangements in desmosome genes have been systematically investigated in a cohort of ACM patients. Recent studies have identified novel causes of ACM providing new insights into the genetic spectrum of the disease and highlighting an overlapping phenotype between ACM and dilated cardiomyopathy. Next-generation sequencing is a useful tool for research and genetic diagnostic screening but interpretation of identified sequence variants requires caution and should be performed in specialized centres.
Characterization of a dam Mutant of Serratia marcescens and Nucleotide Sequence of the dam Region
Ostendorf, Tammo; Cherepanov, Peter; de Vries, Johann; Wackernagel, Wilfried
1999-01-01
The DNA of Serratia marcescens has N6-adenine methylation in GATC sequences. Among 2-aminopurine-sensitive mutants isolated from S. marcescens Sr41, one was identified which lacked GATC methylation. The mutant showed up to 30-fold increased spontaneous mutability and enhanced mutability after treatment with 2-aminopurine, ethyl methanesulfonate, or UV light. The gene (dam) coding for the adenine methyltransferase (Dam enzyme) of S. marcescens was identified on a gene bank plasmid which alleviated the 2-aminopurine sensitivity and the higher mutability of a dam-13::Tn9 mutant of Escherichia coli. Nucleotide sequencing revealed that the deduced amino acid sequence of Dam (270 amino acids; molecular mass, 31.3 kDa) has 72% identity to the Dam enzyme of E. coli. The dam gene is located between flanking genes which are similar to those found to the sides of the E. coli dam gene. The results of complementation studies indicated that like Dam of E. coli and unlike Dam of Vibrio cholerae, the Dam enzyme of S. marcescens plays an important role in mutation avoidance by allowing the mismatch repair enzymes to discriminate between the parental and newly synthesized strands during correction of replication errors. PMID:10383952
Vega, Ana I; Medrano, Celia; Navarrete, Rosa; Desviat, Lourdes R; Merinero, Begoña; Rodríguez-Pombo, Pilar; Vitoria, Isidro; Ugarte, Magdalena; Pérez-Cerdá, Celia; Pérez, Belen
2016-10-01
Glycogen storage disease (GSD) is an umbrella term for a group of genetic disorders that involve the abnormal metabolism of glycogen; to date, 23 types of GSD have been identified. The nonspecific clinical presentation of GSD and the lack of specific biomarkers mean that Sanger sequencing is now widely relied on for making a diagnosis. However, this gene-by-gene sequencing technique is both laborious and costly, which is a consequence of the number of genes to be sequenced and the large size of some genes. This work reports the use of massive parallel sequencing to diagnose patients at our laboratory in Spain using either a customized gene panel (targeted exome sequencing) or the Illumina Clinical-Exome TruSight One Gene Panel (clinical exome sequencing (CES)). Sequence variants were matched against biochemical and clinical hallmarks. Pathogenic mutations were detected in 23 patients. Twenty-two mutations were recognized (mostly loss-of-function mutations), including 11 that were novel in GSD-associated genes. In addition, CES detected five patients with mutations in ALDOB, LIPA, NKX2-5, CPT2, or ANO5. Although these genes are not involved in GSD, they are associated with overlapping phenotypic characteristics such as hepatic, muscular, and cardiac dysfunction. These results show that next-generation sequencing, in combination with the detection of biochemical and clinical hallmarks, provides an accurate, high-throughput means of making genetic diagnoses of GSD and related diseases.Genet Med 18 10, 1037-1043.
2010-01-01
Background Molecular characterization of collagen-VI related myopathies currently relies on standard sequencing, which yields a detection rate approximating 75-79% in Ullrich congenital muscular dystrophy (UCMD) and 60-65% in Bethlem myopathy (BM) patients as PCR-based techniques tend to miss gross genomic rearrangements as well as copy number variations (CNVs) in both the coding sequence and intronic regions. Methods We have designed a custom oligonucleotide CGH array in order to investigate the presence of CNVs in the coding and non-coding regions of COL6A1, A2, A3, A5 and A6 genes and a group of genes functionally related to collagen VI. A cohort of 12 patients with UCMD/BM negative at sequencing analysis and 2 subjects carrying a single COL6 mutation whose clinical phenotype was not explicable by inheritance were selected and the occurrence of allelic and genetic heterogeneity explored. Results A deletion within intron 1A of the COL6A2 gene, occurring in compound heterozygosity with a small deletion in exon 28, previously detected by routine sequencing, was identified in a BM patient. RNA studies showed monoallelic transcription of the COL6A2 gene, thus elucidating the functional effect of the intronic deletion. No pathogenic mutations were identified in the remaining analyzed patients, either within COL6A genes, or in genes functionally related to collagen VI. Conclusions Our custom CGH array may represent a useful complementary diagnostic tool, especially in recessive forms of the disease, when only one mutant allele is detected by standard sequencing. The intronic deletion we identified represents the first example of a pure intronic mutation in COL6A genes. PMID:20302629
Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.
Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J
2017-09-01
Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.
Ma, Yu-Hua; Ye, Gui-Sheng
2018-06-11
In this study, we screened differentially expressed genes in a multidrug-resistant isolate strain of Clostridium perfringens by RNA sequencing. We also separated and identified differentially expressed proteins (DEPs) in the isolate strain by two-dimensional electrophoresis (2-DE) and mass spectrometry (MS). The RNA sequencing results showed that, compared with the control strain, 1128 genes were differentially expressed in the isolate strain, and these included 227 up-regulated genes and 901 down-regulated genes. Bioinformatics analysis identified the following genes and gene categories that are potentially involved in multidrug resistance (MDR) in the isolate strain: drug transport, drug response, hydrolase activity, transmembrane transporter, transferase activity, amidase transmembrane transporter, efflux transmembrane transporter, bacterial chemotaxis, ABC transporter, and others. The results of the 2-DE showed that 70 proteins were differentially expressed in the isolate strain, 45 of which were up-regulated and 25 down-regulated. Twenty-seven DEPs were identified by MS and these included the following protein categories: ribosome, antimicrobial peptide resistance, and ABC transporter, all of which may be involved in MDR in the isolate strain of C. perfringens. The results provide reference data for further investigations on the drug resistant molecular mechanisms of C. perfringens.
Brulle, Franck; Jeffroy, Fanny; Madec, Stéphanie; Nicolas, Jean-Louis; Paillard, Christine
2012-10-01
The Manila clam, Ruditapes philippinarum, is an economically-important, commercial shellfish; harvests are diminished in some European waters by a pathogenic bacterium, Vibrio tapetis, that causes Brown Ring disease. To identify molecular characteristics associated with susceptibility or resistance to Brown Ring disease, Suppression Subtractive Hybridization (SSH) analyzes were performed to construct cDNA libraries enriched in up- or down-regulated transcripts from clam immune cells, hemocytes, after a 3-h in vitro challenge with cultured V. tapetis. Nine hundred and ninety eight sequences from the two libraries were sequenced, and an in silico analysis identified 235 unique genes. BLAST and "Gene ontology" classification analyzes revealed that 60.4% of the Expressed Sequence Tags (ESTs) have high similarities with genes involved in various physiological functions, such as immunity, apoptosis and cytoskeleton organization; whereas, 39.6% remain unidentified. From the 235 unique genes, we selected 22 candidates based upon physiological function and redundancy in the libraries. Then, Real-Time PCR analysis identified 3 genes related to cytoskeleton organization showing significant variation in expression attributable to V. tapetis exposure. Disruption in regulation of these genes is consistent with the etiologic agent of Brown Ring disease in Manila clams. Copyright © 2012 Elsevier Ltd. All rights reserved.
Stevens, Todd M; Morlote, Diana; Swensen, Jeff; Ellis, Michelle; Harada, Shuko; Spencer, Sharon; Prieto-Granada, Carlos N; Folpe, Andrew L; Gatalica, Zoran
2018-05-07
Spindle epithelial tumor with thymus-like differentiation (SETTLE) is a malignant biphasic neoplasm of the thyroid or neck with propensity for late metastasis. Unlike synovial sarcoma, its main morphologic mimic, SETTLE lacks synovial sarcoma-associated translocations. A single case of SETTLE has shown a KRAS mutation but to date no comprehensive next generation sequencing studies of this rare neoplasm have been undertaken. Herein, we subjected 5 well defined cases of SETTLE to direct sequence analysis of 592 genes and fusion gene analysis of 52 genes frequently rearranged in human cancers. We identified one case with two pathogenic variants in the KMT2D gene, one being in an intron splice site (c.674-1A>G) and the other being a frameshift variant (p.M2829fs). This same case also had a pathogenic nonsense variant in the KMT2C gene (p.R1237*). A second case of SETTLE carried a pathogenic NRAS missense variant, Q61R. No other molecular alterations, microsatellite instability, gene fusions or amplifications were identified.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Exome Sequencing Identifies Three Novel Candidate Genes Implicated in Intellectual Disability
Azam, Maleeha; Ayub, Humaira; Vissers, Lisenka E. L. M.; Gilissen, Christian; Ali, Syeda Hafiza Benish; Riaz, Moeen; Veltman, Joris A.; Pfundt, Rolph; van Bokhoven, Hans; Qamar, Raheel
2014-01-01
Intellectual disability (ID) is a major health problem mostly with an unknown etiology. Recently exome sequencing of individuals with ID identified novel genes implicated in the disease. Therefore the purpose of the present study was to identify the genetic cause of ID in one syndromic and two non-syndromic Pakistani families. Whole exome of three ID probands was sequenced. Missense variations in two plausible novel genes implicated in autosomal recessive ID were identified: lysine (K)-specific methyltransferase 2B (KMT2B), zinc finger protein 589 (ZNF589), as well as hedgehog acyltransferase (HHAT) with a de novo mutation with autosomal dominant mode of inheritance. The KMT2B recessive variant is the first report of recessive Kleefstra syndrome-like phenotype. Identification of plausible causative mutations for two recessive and a dominant type of ID, in genes not previously implicated in disease, underscores the large genetic heterogeneity of ID. These results also support the viewpoint that large number of ID genes converge on limited number of common networks i.e. ZNF589 belongs to KRAB-domain zinc-finger proteins previously implicated in ID, HHAT is predicted to affect sonic hedgehog, which is involved in several disorders with ID, KMT2B associated with syndromic ID fits the epigenetic module underlying the Kleefstra syndromic spectrum. The association of these novel genes in three different Pakistani ID families highlights the importance of screening these genes in more families with similar phenotypes from different populations to confirm the involvement of these genes in pathogenesis of ID. PMID:25405613
Camps, Carme; Petousi, Nayia; Bento, Celeste; Cario, Holger; Copley, Richard R.; McMullin, Mary Frances; van Wijk, Richard; Ratcliffe, Peter J.; Robbins, Peter A.; Taylor, Jenny C.
2016-01-01
Erythrocytosis is a rare disorder characterized by increased red cell mass and elevated hemoglobin concentration and hematocrit. Several genetic variants have been identified as causes for erythrocytosis in genes belonging to different pathways including oxygen sensing, erythropoiesis and oxygen transport. However, despite clinical investigation and screening for these mutations, the cause of disease cannot be found in a considerable number of patients, who are classified as having idiopathic erythrocytosis. In this study, we developed a targeted next-generation sequencing panel encompassing the exonic regions of 21 genes from relevant pathways (~79 Kb) and sequenced 125 patients with idiopathic erythrocytosis. The panel effectively screened 97% of coding regions of these genes, with an average coverage of 450×. It identified 51 different rare variants, all leading to alterations of protein sequence, with 57 out of 125 cases (45.6%) having at least one of these variants. Ten of these were known erythrocytosis-causing variants, which had been missed following existing diagnostic algorithms. Twenty-two were novel variants in erythrocytosis-associated genes (EGLN1, EPAS1, VHL, BPGM, JAK2, SH2B3) and in novel genes included in the panel (e.g. EPO, EGLN2, HIF3A, OS9), some with a high likelihood of functionality, for which future segregation, functional and replication studies will be useful to provide further evidence for causality. The rest were classified as polymorphisms. Overall, these results demonstrate the benefits of using a gene panel rather than existing methods in which focused genetic screening is performed depending on biochemical measurements: the gene panel improves diagnostic accuracy and provides the opportunity for discovery of novel variants. PMID:27651169
Camps, Carme; Petousi, Nayia; Bento, Celeste; Cario, Holger; Copley, Richard R; McMullin, Mary Frances; van Wijk, Richard; Ratcliffe, Peter J; Robbins, Peter A; Taylor, Jenny C
2016-11-01
Erythrocytosis is a rare disorder characterized by increased red cell mass and elevated hemoglobin concentration and hematocrit. Several genetic variants have been identified as causes for erythrocytosis in genes belonging to different pathways including oxygen sensing, erythropoiesis and oxygen transport. However, despite clinical investigation and screening for these mutations, the cause of disease cannot be found in a considerable number of patients, who are classified as having idiopathic erythrocytosis. In this study, we developed a targeted next-generation sequencing panel encompassing the exonic regions of 21 genes from relevant pathways (~79 Kb) and sequenced 125 patients with idiopathic erythrocytosis. The panel effectively screened 97% of coding regions of these genes, with an average coverage of 450×. It identified 51 different rare variants, all leading to alterations of protein sequence, with 57 out of 125 cases (45.6%) having at least one of these variants. Ten of these were known erythrocytosis-causing variants, which had been missed following existing diagnostic algorithms. Twenty-two were novel variants in erythrocytosis-associated genes (EGLN1, EPAS1, VHL, BPGM, JAK2, SH2B3) and in novel genes included in the panel (e.g. EPO, EGLN2, HIF3A, OS9), some with a high likelihood of functionality, for which future segregation, functional and replication studies will be useful to provide further evidence for causality. The rest were classified as polymorphisms. Overall, these results demonstrate the benefits of using a gene panel rather than existing methods in which focused genetic screening is performed depending on biochemical measurements: the gene panel improves diagnostic accuracy and provides the opportunity for discovery of novel variants. Copyright© Ferrata Storti Foundation.
Khamis, Atieh; Raoult, Didier; La Scola, Bernard
2005-01-01
Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024
Gross deletions in TCOF1 are a cause of Treacher–Collins–Franceschetti syndrome
Bowman, Michael; Oldridge, Michael; Archer, Caroline; O'Rourke, Anthony; McParland, Joanna; Brekelmans, Roel; Seller, Anneke; Lester, Tracy
2012-01-01
Treacher–Collins–Franceschetti syndrome (TCS) is an autosomal dominant craniofacial disorder characterised by midface hypoplasia, micrognathia, downslanting palpebral fissures, eyelid colobomata, and ear deformities that often lead to conductive deafness. A total of 182 patients with signs consistent with a diagnosis of TCS were screened by DNA sequence and dosage analysis of the TCOF1 gene. In all, 92 cases were found to have a pathogenic mutation by sequencing and 5 to have a partial gene deletion. A further case had a novel in-frame deletion in the alternatively spliced exon 6A of uncertain pathogenicity. The majority of the pathogenic sequence changes were found to predict premature protein termination, however, four novel missense changes in the LIS1 homology motif at the 5′ end of the gene were identified. The partial gene deletions of different sizes represent ∼5.2% of all the pathogenic TCOF1 mutations identified, indicating that gene rearrangements account for a significant proportion of TCS cases. This is the first report of gene rearrangements resulting in TCS. These findings expand the TCOF1 mutation spectrum indicating that dosage analysis should be performed together with sequence analysis, a strategy that is predicted to have a sensitivity of 71% for patients in whom TCS is strongly suspected. PMID:22317976
Gross deletions in TCOF1 are a cause of Treacher-Collins-Franceschetti syndrome.
Bowman, Michael; Oldridge, Michael; Archer, Caroline; O'Rourke, Anthony; McParland, Joanna; Brekelmans, Roel; Seller, Anneke; Lester, Tracy
2012-07-01
Treacher-Collins-Franceschetti syndrome (TCS) is an autosomal dominant craniofacial disorder characterised by midface hypoplasia, micrognathia, downslanting palpebral fissures, eyelid colobomata, and ear deformities that often lead to conductive deafness. A total of 182 patients with signs consistent with a diagnosis of TCS were screened by DNA sequence and dosage analysis of the TCOF1 gene. In all, 92 cases were found to have a pathogenic mutation by sequencing and 5 to have a partial gene deletion. A further case had a novel in-frame deletion in the alternatively spliced exon 6A of uncertain pathogenicity. The majority of the pathogenic sequence changes were found to predict premature protein termination, however, four novel missense changes in the LIS1 homology motif at the 5' end of the gene were identified. The partial gene deletions of different sizes represent ~5.2% of all the pathogenic TCOF1 mutations identified, indicating that gene rearrangements account for a significant proportion of TCS cases. This is the first report of gene rearrangements resulting in TCS. These findings expand the TCOF1 mutation spectrum indicating that dosage analysis should be performed together with sequence analysis, a strategy that is predicted to have a sensitivity of 71% for patients in whom TCS is strongly suspected.
Patiño, Liliana Catherine; Beau, Isabelle; Carlosama, Carolina; Buitrago, July Constanza; González, Ronald; Suárez, Carlos Fernando; Patarroyo, Manuel Alfonso; Delemer, Brigitte; Young, Jacques; Binart, Nadine; Laissue, Paul
2017-07-01
Is it possible to identify new mutations potentially associated with non-syndromic primary ovarian insufficiency (POI) via whole-exome sequencing (WES)? WES is an efficient tool to study genetic causes of POI as we have identified new mutations, some of which lead to protein destablization potentially contributing to the disease etiology. POI is a frequently occurring complex pathology leading to infertility. Mutations in only few candidate genes, mainly identified by Sanger sequencing, have been definitively related to the pathogenesis of the disease. This is a retrospective cohort study performed on 69 women affected by POI. WES and an innovative bioinformatics analysis were used on non-synonymous sequence variants in a subset of 420 selected POI candidate genes. Mutations in BMPR1B and GREM1 were modeled by using fragment molecular orbital analysis. Fifty-five coding variants in 49 genes potentially related to POI were identified in 33 out of 69 patients (48%). These genes participate in key biological processes in the ovary, such as meiosis, follicular development, granulosa cell differentiation/proliferation and ovulation. The presence of at least two mutations in distinct genes in 42% of the patients argued in favor of a polygenic nature of POI. It is possible that regulatory regions, not analyzed in the present study, carry further variants related to POI. WES and the in silico analyses presented here represent an efficient approach for mapping variants associated with POI etiology. Sequence variants presented here represents potential future genetic biomarkers. This study was supported by the Universidad del Rosario and Colciencias (Grants CS/CIGGUR-ABN062-2016 and 672-2014). Colciencias supported Liliana Catherine Patiño´s work (Fellowship: 617, 2013). The authors declare no conflict of interest. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Miller, Michelle E; Allen, Victoria M; Brock, Jo-Ann K
2018-03-01
Fetal echogenic bowel (echogenic bowel) is associated with cystic fibrosis (CF), with a reported incidence ranging from 1% to 13%. Prenatal testing for CF in the setting of echogenic bowel can be done by screening parental or fetal samples for pathogenic CFTR variants. If only one pathogenic variant is identified, sequencing of the CFTR gene can be undertaken, to identify a second pathogenic variant not covered in the standard screening panel. Full gene sequencing, however, also introduces the potential to identify variants of uncertain significance (VUSs) that can create counselling challenges and cause parental anxiety. To provide accurate counselling for families in the study population, the incidence of CF associated with echogenic bowel and the carrier frequency of CFTR variants were investigated. All pregnancies for which CF testing was undertaken for the indication of echogenic bowel (from Nova Scotia and Prince Edward Island) were identified (January 2007-July 2017). The CFTR screening and sequencing results were reviewed, and fetal outcomes related to CF were assessed. A total of 463 pregnancies with echogenic bowel were tested. Four were confirmed to be affected with CF, giving an incidence of 0.9% in this cohort. The carrier frequency of CF among all parents in the cohort was 5.0% (1 in 20); however, when excluding parents of affected fetuses, the carrier frequency for the population was estimated at 4.1% (1 in 25). CFTR gene sequencing identified an additional VUS in two samples. The incidence of CF in pregnancies with echogenic bowel in Nova Scotia and Prince Edward Island is 0.9%, with an estimated population carrier frequency of 4.1%. These results provide the basis for improved counselling to assess the risk of CF in the pregnancy, after parental carrier screening, using Bayesian probability. Counselling regarding VUSs should be undertaken before gene sequencing. Copyright © 2017 Society of Obstetricians and Gynaecologists of Canada. Published by Elsevier Inc. All rights reserved.
2012-01-01
Background MicroRNAs (miRNAs) are a class of endogenous, small, non-coding RNAs that regulate gene expression by mediating gene silencing at transcriptional and post-transcriptional levels in high plants. However, the diversity of miRNAs and their roles in floral development in Japanese apricot (Prunus mume Sieb. et Zucc) remains largely unexplored. Imperfect flowers with pistil abortion seriously decrease production yields. To understand the role of miRNAs in pistil development, pistil development-related miRNAs were identified by Solexa sequencing in Japanese apricot. Results Solexa sequencing was used to identify and quantitatively profile small RNAs from perfect and imperfect flower buds of Japanese apricot. A total of 22,561,972 and 24,952,690 reads were sequenced from two small RNA libraries constructed from perfect and imperfect flower buds, respectively. Sixty-one known miRNAs, belonging to 24 families, were identified. Comparative profiling revealed that seven known miRNAs exhibited significant differential expression between perfect and imperfect flower buds. A total of 61 potentially novel miRNAs/new members of known miRNA families were also identified by the presence of mature miRNAs and corresponding miRNA*s in the sRNA libraries. Comparative analysis showed that six potentially novel miRNAs were differentially expressed between perfect and imperfect flower buds. Target predictions of the 13 differentially expressed miRNAs resulted in 212 target genes. Gene ontology (GO) annotation revealed that high-ranking miRNA target genes are those implicated in the developmental process, the regulation of transcription and response to stress. Conclusions This study represents the first comparative identification of miRNAomes between perfect and imperfect Japanese apricot flowers. Seven known miRNAs and six potentially novel miRNAs associated with pistil development were identified, using high-throughput sequencing of small RNAs. The findings, both computationally and experimentally, provide valuable information for further functional characterisation of miRNAs associated with pistil development in plants. PMID:22863067
Wysocki, William P; Ruiz-Sanchez, Eduardo; Yin, Yanbin; Duvall, Melvin R
2016-05-20
Next-generation sequencing now allows for total RNA extracts to be sequenced in non-model organisms such as bamboos, an economically and ecologically important group of grasses. Bamboos are divided into three lineages, two of which are woody perennials with bisexual flowers, which undergo gregarious monocarpy. The third lineage, which are herbaceous perennials, possesses unisexual flowers that undergo annual flowering events. Transcriptomes were assembled using both reference-based and de novo methods. These two methods were tested by characterizing transcriptome content using sequence alignment to previously characterized reference proteomes and by identifying Pfam domains. Because of the striking differences in floral morphology and phenology between the herbaceous and woody bamboo lineages, MADS-box genes, transcription factors that control floral development and timing, were characterized and analyzed in this study. Transcripts were identified using phylogenetic methods and categorized as A, B, C, D or E-class genes, which control floral development, or SOC or SVP-like genes, which control the timing of flowering events. Putative nuclear orthologues were also identified in bamboos to use as phylogenetic markers. Instances of gene copies exhibiting topological patterns that correspond to shared phenotypes were observed in several gene families including floral development and timing genes. Alignments and phylogenetic trees were generated for 3,878 genes and for all genes in a concatenated analysis. Both the concatenated analysis and those of 2,412 separate gene trees supported monophyly among the woody bamboos, which is incongruent with previous phylogenetic studies using plastid markers.
USDA-ARS?s Scientific Manuscript database
Previous research identified that the 5S ribosomal (rrn) gene and associated flanking sequences that are closely linked to the dkgB gene of Salmonella enterica were highly variable between serotypes, but not between subpopulations within the same serotype (PMID: 17005008). The degree of variability ...
USDA-ARS?s Scientific Manuscript database
Resistance gene analogs (RGAs) were searched bioinformatically in the sugar beet (Beta vulgaris L.) genome as potential candidates for improving resistance against different diseases. In the present study, Ion Torrent sequencing technology was used to identify mutations in 21 RGAs. The DNA samples o...
Overview Article: Identifying transcriptional cis-regulatory modules in animal genomes
Suryamohan, Kushal; Halfon, Marc S.
2014-01-01
Gene expression is regulated through the activity of transcription factors and chromatin modifying proteins acting on specific DNA sequences, referred to as cis-regulatory elements. These include promoters, located at the transcription initiation sites of genes, and a variety of distal cis-regulatory modules (CRMs), the most common of which are transcriptional enhancers. Because regulated gene expression is fundamental to cell differentiation and acquisition of new cell fates, identifying, characterizing, and understanding the mechanisms of action of CRMs is critical for understanding development. CRM discovery has historically been challenging, as CRMs can be located far from the genes they regulate, have few readily-identifiable sequence characteristics, and for many years were not amenable to high-throughput discovery methods. However, the recent availability of complete genome sequences and the development of next-generation sequencing methods has led to an explosion of both computational and empirical methods for CRM discovery in model and non-model organisms alike. Experimentally, CRMs can be identified through chromatin immunoprecipitation directed against transcription factors or histone post-translational modifications, identification of nucleosome-depleted “open” chromatin regions, or sequencing-based high-throughput functional screening. Computational methods include comparative genomics, clustering of known or predicted transcription factor binding sites, and supervised machine-learning approaches trained on known CRMs. All of these methods have proven effective for CRM discovery, but each has its own considerations and limitations, and each is subject to a greater or lesser number of false-positive identifications. Experimental confirmation of predictions is essential, although shortcomings in current methods suggest that additional means of validation need to be developed. PMID:25704908
IFRD1 Is a Candidate Gene for SMNA on Chromosome 7q22-q23
Brkanac, Zoran; Spencer, David; Shendure, Jay; Robertson, Peggy D.; Matsushita, Mark; Vu, Tiffany; Bird, Thomas D.; Olson, Maynard V.; Raskind, Wendy H.
2009-01-01
We have established strong linkage evidence that supports mapping autosomal-dominant sensory/motor neuropathy with ataxia (SMNA) to chromosome 7q22-q32. SMNA is a rare neurological disorder whose phenotype encompasses both the central and the peripheral nervous system. In order to identify a gene responsible for SMNA, we have undertaken a comprehensive genomic evaluation of the region of linkage, including evaluation for repeat expansion and small deletions or duplications, capillary sequencing of candidate genes, and massively parallel sequencing of all coding exons. We excluded repeat expansion and small deletions or duplications as causative, and through microarray-based hybrid capture and massively parallel short-read sequencing, we identified a nonsynonymous variant in the human interferon-related developmental regulator gene 1 (IFRD1) as a disease-causing candidate. Sequence conservation, animal models, and protein structure evaluation support the involvement of IFRD1 in SMNA. Mutation analysis of IFRD1 in additional patients with similar phenotypes is needed for demonstration of causality and further evaluation of its importance in neurological diseases. PMID:19409521
Ahmad, Aftab; Niwa, Yasuo; Goto, Shingo; Ogawa, Takeshi; Shimizu, Masanori; Suzuki, Akane; Kobayashi, Kyoko; Kobayashi, Hirokazu
2015-01-01
An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8) as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO) lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX) of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP) fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'). The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.
Simm, Franziska; Griesbeck, Anne; Choukair, Daniela; Weiß, Birgit; Paramasivam, Nagarajan; Klammt, Jürgen; Schlesner, Matthias; Wiemann, Stefan; Martinez, Cristina; Hoffmann, Georg F; Pfäffle, Roland W; Bettendorf, Markus; Rappold, Gudrun A
2017-10-26
PurposeCombined pituitary hormone deficiency (CPHD) is characterized by a malformed or underdeveloped pituitary gland resulting in an impaired pituitary hormone secretion. Several transcription factors have been described in its etiology, but defects in known genes account for only a small proportion of cases.MethodsTo identify novel genetic causes for congenital hypopituitarism, we performed exome-sequencing studies on 10 patients with CPHD and their unaffected parents. Two candidate genes were sequenced in further 200 patients. Genotype data of known hypopituitary genes are reviewed.ResultsWe discovered 51 likely damaging variants in 38 genes; 12 of the 51 variants represent de novo events (24%); 11 of the 38 genes (29%) were present in the E12.5/E14.5 pituitary transcriptome. Targeted sequencing of two candidate genes, SLC20A1 and SLC15A4, of the solute carrier membrane transport protein family in 200 additional patients demonstrated two further variants predicted as damaging. We also found combinations of de novo (SLC20A1/SLC15A4) and transmitted variants (GLI2/LHX3) in the same individuals, leading to the full-blown CPHD phenotype.ConclusionThese data expand the pituitary target genes repertoire for diagnostics and further functional studies. Exome sequencing has identified a combination of rare variants in different genes that might explain incomplete penetrance in CPHD.Genetics in Medicine advance online publication, 26 October 2017; doi:10.1038/gim.2017.165.
Dicks, Ed; Song, Honglin; Ramus, Susan J; Oudenhove, Elke Van; Tyrer, Jonathan P; Intermaggio, Maria P; Kar, Siddhartha; Harrington, Patricia; Bowtell, David D; Group, Aocs Study; Cicek, Mine S; Cunningham, Julie M; Fridley, Brooke L; Alsop, Jennifer; Jimenez-Linan, Mercedes; Piskorz, Anna; Goranova, Teodora; Kent, Emma; Siddiqui, Nadeem; Paul, James; Crawford, Robin; Poblete, Samantha; Lele, Shashi; Sucheston-Campbell, Lara; Moysich, Kirsten B; Sieh, Weiva; McGuire, Valerie; Lester, Jenny; Odunsi, Kunle; Whittemore, Alice S; Bogdanova, Natalia; Dürst, Matthias; Hillemanns, Peter; Karlan, Beth Y; Gentry-Maharaj, Aleksandra; Menon, Usha; Tischkowitz, Marc; Levine, Douglas; Brenton, James D; Dörk, Thilo; Goode, Ellen L; Gayther, Simon A; Pharoah, D P Paul
2017-08-01
We analyzed whole exome sequencing data in germline DNA from 412 high grade serous ovarian cancer (HGSOC) cases from The Cancer Genome Atlas Project and identified 5,517 genes harboring a predicted deleterious germline coding mutation in at least one HGSOC case. Gene-set enrichment analysis showed enrichment for genes involved in DNA repair (p = 1.8×10 -3 ). Twelve DNA repair genes - APEX1, APLF, ATX, EME1, FANCL, FANCM, MAD2L2, PARP2, PARP3, POLN, RAD54L and SMUG1 - were prioritized for targeted sequencing in up to 3,107 HGSOC cases, 1,491 cases of other epithelial ovarian cancer (EOC) subtypes and 3,368 unaffected controls of European origin. We estimated mutation prevalence for each gene and tested for associations with disease risk. Mutations were identified in both cases and controls in all genes except MAD2L2 , where we found no evidence of mutations in controls. In FANCM we observed a higher mutation frequency in HGSOC cases compared to controls (29/3,107 cases, 0.96 percent; 13/3,368 controls, 0.38 percent; P=0.008) with little evidence for association with other subtypes (6/1,491, 0.40 percent; P=0.82). The relative risk of HGSOC associated with deleterious FANCM mutations was estimated to be 2.5 (95% CI 1.3 - 5.0; P=0.006). In summary, whole exome sequencing of EOC cases with large-scale replication in case-control studies has identified FANCM as a likely novel susceptibility gene for HGSOC, with mutations associated with a moderate increase in risk. These data may have clinical implications for risk prediction and prevention approaches for high-grade serous ovarian cancer in the future and a significant impact on reducing disease mortality.
Fluorescent in situ hybridisation to amphioxus chromosomes.
Castro, Luis Filipe Costa; Holland, Peter William Harold
2002-12-01
We describe an efficient protocol for mapping genes and other DNA sequences to amphioxus chromosomes using fluorescent in situ hybridisation. We apply this method to identify the number and location of ribosomal DNA gene clusters and telomere sequences in metaphase spreads of Branchiostoma floridae. We also describe how the locations of two single copy genes can be mapped relative to each other, and demonstrate this by mapping an amphioxus Pax gene relative to a homologue of the Notch gene. These methods have great potential for performing comparative genomics between amphioxus and vertebrates.
Wang, Zhao-Xin; Li, Shu-Ming; Heide, Lutz
2000-01-01
The biosynthetic gene cluster of the aminocoumarin antibiotic coumermycin A1 was cloned by screening of a cosmid library of Streptomyces rishiriensis DSM 40489 with heterologous probes from a dTDP-glucose 4,6-dehydratase gene, involved in deoxysugar biosynthesis, and from the aminocoumarin resistance gyrase gene gyrBr. Sequence analysis of a 30.8-kb region upstream of gyrBr revealed the presence of 28 complete open reading frames (ORFs). Fifteen of the identified ORFs showed, on average, 84% identity to corresponding ORFs in the biosynthetic gene cluster of novobiocin, another aminocoumarin antibiotic. Possible functions of 17 ORFs in the biosynthesis of coumermycin A1 could be assigned by comparison with sequences in GenBank. Experimental proof for the function of the identified gene cluster was provided by an insertional gene inactivation experiment, which resulted in an abolishment of coumermycin A1 production. PMID:11036020
Fishman, G A; Stone, E M; Grover, S; Derlacki, D J; Haines, H L; Hockey, R R
1999-04-01
To report the spectrum of ophthalmic findings in patients with Stargardt dystrophy or fundus flavimaculatus who have a specific sequence variation in the ABCR gene. Twenty-nine patients with Stargardt dystrophy or fundus flavimaculatus from different pedigrees were identified with possible disease-causing sequence variations in the ABCR gene from a group of 66 patients who were screened for sequence variations in this gene. Patients underwent a routine ocular examination, including slitlamp biomicroscopy and a dilated fundus examination. Fluorescein angiography was performed on 22 patients, and electroretinographic measurements were obtained on 24 of 29 patients. Kinetic visual fields were measured with a Goldmann perimeter in 26 patients. Single-strand conformation polymorphism analysis and DNA sequencing were used to identify variations in coding sequences of the ABCR gene. Three clinical phenotypes were observed among these 29 patients. In phenotype I, 9 of 12 patients had a sequence change in exon 42 of the ABCR gene in which the amino acid glutamic acid was substituted for glycine (Gly1961Glu). In only 4 of these 9 patients was a second possible disease-causing mutation found on the other ABCR allele. In addition to an atrophic-appearing macular lesion, phenotype I was characterized by localized perifoveal yellowish white flecks, the absence of a dark choroid, and normal electroretinographic amplitudes. Phenotype II consisted of 10 patients who showed a dark choroid and more diffuse yellowish white flecks in the fundus. None exhibited the Gly1961Glu change. Phenotype III consisted of 7 patients who showed extensive atrophic-appearing changes of the retinal pigment epithelium. Electroretinographic cone and rod amplitudes were reduced. One patient showed the Gly1961Glu change. A wide variation in clinical phenotype can occur in patients with sequence changes in the ABCR gene. In individual patients, a certain phenotype seems to be associated with the presence of a Gly1961Glu change in exon 42 of the ABCR gene. The identification of correlations between specific mutations in the ABCR gene and clinical phenotypes will better facilitate the counseling of patients on their visual prognosis. This information will also likely be important for future therapeutic trials in patients with Stargardt dystrophy.
2014-01-01
Background X-linked intellectual disability (XLID) is a group of genetically heterogeneous disorders characterized by substantial impairment in cognitive abilities, social and behavioral adaptive skills. Next generation sequencing technologies have become a powerful approach for identifying molecular gene mutations relevant for diagnosis. Methods & objectives Enrichment of X-chromosome specific exons and massively parallel sequencing was performed for identifying the causative mutations in 14 Finnish families, each of them having several males affected with intellectual disability of unknown cause. Results We found four novel mutations in known XLID genes. Two mutations; one previously reported missense mutation (c.1111C > T), and one novel frameshift mutation (c. 990_991insGCTGC) were identified in SLC16A2, a gene that has been linked to Allan-Herndon-Dudley syndrome (AHDS). One novel missense mutation (c.1888G > C) was found in GRIA3 and two novel splice donor site mutations (c.357 + 1G > C and c.985 + 1G > C) were identified in the DLG3 gene. One missense mutation (c.1321C > T) was identified in the candidate gene ZMYM3 in three affected males with a previously unrecognized syndrome characterized by unique facial features, aortic stenosis and hypospadia was detected. All of the identified mutations segregated in the corresponding families and were absent in > 100 Finnish controls and in the publicly available databases. In addition, a previously reported benign variant (c.877G > A) in SYP was identified in a large family with nine affected males in three generations, who have a syndromic phenotype. Conclusions All of the mutations found in this study are being reported for the first time in Finnish families with several affected male patients whose etiological diagnoses have remained unknown to us, in some families, for more than 30 years. This study illustrates the impact of X-exome sequencing to identify rare gene mutations and the challenges of interpreting the results. Further functional studies are required to confirm the cause of the syndromic phenotypes associated with ZMYM3 and SYP in this study. PMID:24721225
Comparative Analysis and Distribution of Omega-3 lcPUFA Biosynthesis Genes in Marine Molluscs
Surm, Joachim M.; Prentis, Peter J.; Pavasovic, Ana
2015-01-01
Recent research has identified marine molluscs as an excellent source of omega-3 long-chain polyunsaturated fatty acids (lcPUFAs), based on their potential for endogenous synthesis of lcPUFAs. In this study we generated a representative list of fatty acyl desaturase (Fad) and elongation of very long-chain fatty acid (Elovl) genes from major orders of Phylum Mollusca, through the interrogation of transcriptome and genome sequences, and various publicly available databases. We have identified novel and uncharacterised Fad and Elovl sequences in the following species: Anadara trapezia, Nerita albicilla, Nerita melanotragus, Crassostrea gigas, Lottia gigantea, Aplysia californica, Loligo pealeii and Chlamys farreri. Based on alignments of translated protein sequences of Fad and Elovl genes, the haeme binding motif and histidine boxes of Fad proteins, and the histidine box and seventeen important amino acids in Elovl proteins, were highly conserved. Phylogenetic analysis of aligned reference sequences was used to reconstruct the evolutionary relationships for Fad and Elovl genes separately. Multiple, well resolved clades for both the Fad and Elovl sequences were observed, suggesting that repeated rounds of gene duplication best explain the distribution of Fad and Elovl proteins across the major orders of molluscs. For Elovl sequences, one clade contained the functionally characterised Elovl5 proteins, while another clade contained proteins hypothesised to have Elovl4 function. Additional well resolved clades consisted only of uncharacterised Elovl sequences. One clade from the Fad phylogeny contained only uncharacterised proteins, while the other clade contained functionally characterised delta-5 desaturase proteins. The discovery of an uncharacterised Fad clade is particularly interesting as these divergent proteins may have novel functions. Overall, this paper presents a number of novel Fad and Elovl genes suggesting that many mollusc groups possess most of the required enzymes for the synthesis of lcPUFAs. PMID:26308548
Yan, Xiuqin; Zhang, Xue; Lu, Min; He, Yong; An, Huaming
2015-04-25
Rosa roxburghii Tratt. is a well-known ornamental rose species native to China. In addition, the fruits of this species are valued for their nutritional and medicinal characteristics, especially their high ascorbic acid (AsA) levels. Nevertheless, AsA biosynthesis in R. roxburghii fruit has not been explored in detail because of a lack of genomic resources for this species. High-throughput transcriptomic sequencing generating large volumes of transcript sequence data can aid in gene discovery and molecular marker development. In this study, we generated more than 53 million clean reads using Illumina paired-end sequencing technology. De novo assembly yielded 106,590 unigenes, with an average length of 343 bp. On the basis of sequence similarity to known proteins, 9301 and 2393 unigenes were classified into Gene Ontology and Clusters of Orthologous Group categories, respectively. There were 7480 unigenes assigned to 124 pathways in the Kyoto Encyclopedia of Gene and Genome pathway database. BLASTx searches identified 498 unique putative transcripts encoding various transcription factors, some known to regulate fruit development. qRT-PCR validated the expressions of most of the genes encoding the main enzymes involved in ascorbate biosynthesis. In addition, 9131 potential simple sequence repeat (SSR) loci were identified among the unigenes. One hundred and two primer pairs were synthesized and 71 pairs produced an amplification product during initial screening. Among the amplified products, 30 were polymorphic in the 16 R. roxburghii germplasms tested. Our study was the first to produce a large volume of transcriptome data from R. roxburghii. The resulting sequence collection is a valuable resource for gene discovery and marker-assisted selective breeding in this rose species. Copyright © 2015 Elsevier B.V. All rights reserved.
Lo, David; Weng, Jingning; Liu, xiaohong; Yang, Juhua; He, Fen; Wang, Yun; Liu, Xuyang
2016-01-01
PURPOSE To detect the disease-causing gene in a Chinese pedigree with autosomal-recessive retinitis pigmentosa (ARRP). METHODS All subjects in this family underwent a complete ophthalmic examination. Targeted-capture next generation sequencing (NGS) was performed on the proband to detect variants. All variants were verified in the remaining family members by PCR amplification and Sanger sequencing. RESULTS All the affected subjects in this pedigree were diagnosed with retinitis pigmentosa (RP). The compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations in the Crumbs homolog 1 (CRB1) gene were identified in all the affected patients but not in the unaffected individuals in this family. These mutations were inherited from their parents, respectively. CONCLUSION The novel compound heterozygous mutations in CRB1 were identified in a Chinese pedigree with ARRP using targeted-capture next generation sequencing. After evaluating the significant heredity and impaired protein function, the compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations are the causal genes of early onset ARRP in this pedigree. To the best of our knowledge, there is no previous report regarding the compound mutations. PMID:27806333
Diagnostic method employing MSH2 nucleic acids
de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.
1997-01-01
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
Diagnostic method employing MSH2 nucleic acids
Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.
1997-12-02
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +}(RER{sup +}) tumor cells. 19 figs.
Diagnostic method employing MSH2 protein
Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.
1998-11-17
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.
Transcriptome analysis by strand-specific sequencing of complementary DNA
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-01-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212
Transcriptome analysis by strand-specific sequencing of complementary DNA.
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-10-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larsen, P. E.; Trivedi, G.; Sreedasyam, A.
2010-07-06
Accurate structural annotation is important for prediction of function and required for in vitro approaches to characterize or validate the gene expression products. Despite significant efforts in the field, determination of the gene structure from genomic data alone is a challenging and inaccurate process. The ease of acquisition of transcriptomic sequence provides a direct route to identify expressed sequences and determine the correct gene structure. We developed methods to utilize RNA-seq data to correct errors in the structural annotation and extend the boundaries of current gene models using assembly approaches. The methods were validated with a transcriptomic data set derivedmore » from the fungus Laccaria bicolor, which develops a mycorrhizal symbiotic association with the roots of many tree species. Our analysis focused on the subset of 1501 gene models that are differentially expressed in the free living vs. mycorrhizal transcriptome and are expected to be important elements related to carbon metabolism, membrane permeability and transport, and intracellular signaling. Of the set of 1501 gene models, 1439 (96%) successfully generated modified gene models in which all error flags were successfully resolved and the sequences aligned to the genomic sequence. The remaining 4% (62 gene models) either had deviations from transcriptomic data that could not be spanned or generated sequence that did not align to genomic sequence. The outcome of this process is a set of high confidence gene models that can be reliably used for experimental characterization of protein function. 69% of expressed mycorrhizal JGI 'best' gene models deviated from the transcript sequence derived by this method. The transcriptomic sequence enabled correction of a majority of the structural inconsistencies and resulted in a set of validated models for 96% of the mycorrhizal genes. The method described here can be applied to improve gene structural annotation in other species, provided that there is a sequenced genome and a set of gene models.« less
Guillet-Claude, Carine; Isabel, Nathalie; Pelgas, Betty; Bousquet, Jean
2004-12-01
Class I knox genes code for transcription factors that play an essential role in plant growth and development as central regulators of meristem cell identity. Based on the analysis of new cDNA sequences from various tissues and genomic DNA sequences, we identified a highly diversified group of class I knox genes in conifers. Phylogenetic analyses of complete amino acid sequences from various seed plants indicated that all conifer sequences formed a monophyletic group. Within conifers, four subgroups here named genes KN1 to KN4 were well delineated, each regrouping pine and spruce sequences. KN4 was sister group to KN3, which was sister group to KN1 and KN2. Genetic mapping on the genomes of two divergent Picea species indicated that KN1 and KN2 are located close to each other on the same linkage group, whereas KN3 and KN4 mapped on different linkage groups, correlating the more ancient divergence of these two genes. The proportion of synonymous and nonsynonymous substitutions suggested intense purifying selection for the four genes. However, rates of substitution per year indicated an evolution in two steps: faster rates were noted after gene duplications, followed subsequently by lower rates. Positive directional selection was detected for most of the internal branches harboring an accelerated rate of evolution. In addition, many sites with highly significant amino acid rate shift were identified between these branches. However, the tightly linked KN1 and KN2 did not diverge as much from each other. The implications of the correlation between phylogenetic, structural, and functional information are discussed in relation to the diversification of the knox-I gene family in conifers.
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
[Identification of lactic acid bacteria in commercial yogurt and their antibiotic resistance].
Qin, Yuxuan; Li, Jing; Wang, Qiuya; Gao, Kexin; Zhu, Baoli; Lv, Na
2013-08-04
To identify lactic acid bacteria (LAB) in commercial yogurts and investigate their antibiotic resistance. LABs were cultured from 5 yogurt brands and the isolates were identified at the species level by 16S rRNA sequence. Genotyping was performed by repetitive extragenic palindromic PCR (rep-PCR). The sensitivity to 7 antibiotics was tested for all LAB isolates by Kirby-Bauer paper diffusion (K-B method). Meanwhile, 9 antibiotic resistance genes (ARGs), including erythromycin resistance genes (ermA and ermB) and tetracycline resistance genes (tetM, tetK, tetS, tetQ, tetO, tetL and tetW), were detected by PCR amplification in the identified LAB isolates. The PCR products were confirmed by sequencing. Total 100 LABs were isolated, including 23 Lactobacillus delbrueckii ssp. bulgaricus, 26 Lactobacillus casei, 30 Streptococcus thermophilus, 5 Lactobacillus acidophilus, 6 Lactobacillus plantarum, and 10 Lactobacillus paracasei. The drug susceptibility test shows that all 100 isolates were resistant to gentamicin and streptomycin, 42 isolates were resistant to vancomycin, and on the contrary all were sensitive to cefalexin, erythromycin, tetracycline and oxytetracycline. Moreover, 5 ARGs were found in the 28 sequencing confirmed isolates, ermB gene was detected in 8 isolates, tet K in 4 isolates, tetL in 2 isolates, tetM in 4 isolates, tetO in 2 isolates. erm A, tet S, tet Q and tet W genes were not detected in the isolates. Antibiotic resistance genes were found in 53.57% (15/28) sequenced isolates, 2 -3 antibiotic resistance genes were detected in 4 isolates of L. delbrueckii ssp. bulgaricus. Some LABs were not labeled in commercial yogurt products. Antibiotic resistance genes tend to be found in the starter culture of L. delbrueckii ssp. Bulgaricus and S. thermophilus. All the LAB isolates were sensitive to erythromycin and tetracycline, even though some carried erythromycin and/or tetracycline resistance genes. We proved again that LAB could carry antibiotic resistance gene(s) though it is sensitive to antibiotics.
Li, Yunhai; Lee, Kee Khoon; Walsh, Sean; Smith, Caroline; Hadingham, Sophie; Sorefan, Karim; Cawley, Gavin; Bevan, Michael W
2006-03-01
Establishing transcriptional regulatory networks by analysis of gene expression data and promoter sequences shows great promise. We developed a novel promoter classification method using a Relevance Vector Machine (RVM) and Bayesian statistical principles to identify discriminatory features in the promoter sequences of genes that can correctly classify transcriptional responses. The method was applied to microarray data obtained from Arabidopsis seedlings treated with glucose or abscisic acid (ABA). Of those genes showing >2.5-fold changes in expression level, approximately 70% were correctly predicted as being up- or down-regulated (under 10-fold cross-validation), based on the presence or absence of a small set of discriminative promoter motifs. Many of these motifs have known regulatory functions in sugar- and ABA-mediated gene expression. One promoter motif that was not known to be involved in glucose-responsive gene expression was identified as the strongest classifier of glucose-up-regulated gene expression. We show it confers glucose-responsive gene expression in conjunction with another promoter motif, thus validating the classification method. We were able to establish a detailed model of glucose and ABA transcriptional regulatory networks and their interactions, which will help us to understand the mechanisms linking metabolism with growth in Arabidopsis. This study shows that machine learning strategies coupled to Bayesian statistical methods hold significant promise for identifying functionally significant promoter sequences.
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Guo, Baozhu; Chen, Xiaoping; Dang, Phat; Scully, Brian T; Liang, Xuanqiang; Holbrook, C Corley; Yu, Jiujiang; Culbreath, Albert K
2008-01-01
Background Peanut (Arachis hypogaea L.) is an important crop economically and nutritionally, and is one of the most susceptible host crops to colonization of Aspergillus parasiticus and subsequent aflatoxin contamination. Knowledge from molecular genetic studies could help to devise strategies in alleviating this problem; however, few peanut DNA sequences are available in the public database. In order to understand the molecular basis of host resistance to aflatoxin contamination, a large-scale project was conducted to generate expressed sequence tags (ESTs) from developing seeds to identify resistance-related genes involved in defense response against Aspergillus infection and subsequent aflatoxin contamination. Results We constructed six different cDNA libraries derived from developing peanut seeds at three reproduction stages (R5, R6 and R7) from a resistant and a susceptible cultivated peanut genotypes, 'Tifrunner' (susceptible to Aspergillus infection with higher aflatoxin contamination and resistant to TSWV) and 'GT-C20' (resistant to Aspergillus with reduced aflatoxin contamination and susceptible to TSWV). The developing peanut seed tissues were challenged by A. parasiticus and drought stress in the field. A total of 24,192 randomly selected cDNA clones from six libraries were sequenced. After removing vector sequences and quality trimming, 21,777 high-quality EST sequences were generated. Sequence clustering and assembling resulted in 8,689 unique EST sequences with 1,741 tentative consensus EST sequences (TCs) and 6,948 singleton ESTs. Functional classification was performed according to MIPS functional catalogue criteria. The unique EST sequences were divided into twenty-two categories. A similarity search against the non-redundant protein database available from NCBI indicated that 84.78% of total ESTs showed significant similarity to known proteins, of which 165 genes had been previously reported in peanuts. There were differences in overall expression patterns in different libraries and genotypes. A number of sequences were expressed throughout all of the libraries, representing constitutive expressed sequences. In order to identify resistance-related genes with significantly differential expression, a statistical analysis to estimate the relative abundance (R) was used to compare the relative abundance of each gene transcripts in each cDNA library. Thirty six and forty seven unique EST sequences with threshold of R > 4 from libraries of 'GT-C20' and 'Tifrunner', respectively, were selected for examination of temporal gene expression patterns according to EST frequencies. Nine and eight resistance-related genes with significant up-regulation were obtained in 'GT-C20' and 'Tifrunner' libraries, respectively. Among them, three genes were common in both genotypes. Furthermore, a comparison of our EST sequences with other plant sequences in the TIGR Gene Indices libraries showed that the percentage of peanut EST matched to Arabidopsis thaliana, maize (Zea mays), Medicago truncatula, rapeseed (Brassica napus), rice (Oryza sativa), soybean (Glycine max) and wheat (Triticum aestivum) ESTs ranged from 33.84% to 79.46% with the sequence identity ≥ 80%. These results revealed that peanut ESTs are more closely related to legume species than to cereal crops, and more homologous to dicot than to monocot plant species. Conclusion The developed ESTs can be used to discover novel sequences or genes, to identify resistance-related genes and to detect the differences among alleles or markers between these resistant and susceptible peanut genotypes. Additionally, this large collection of cultivated peanut EST sequences will make it possible to construct microarrays for gene expression studies and for further characterization of host resistance mechanisms. It will be a valuable genomic resource for the peanut community. The 21,777 ESTs have been deposited to the NCBI GenBank database with accession numbers ES702769 to ES724546. PMID:18248674
2013-01-01
Background Salamanders are unique among vertebrates in their ability to completely regenerate amputated limbs through the mediation of blastema cells located at the stump ends. This regeneration is nerve-dependent because blastema formation and regeneration does not occur after limb denervation. To obtain the genomic information of blastema tissues, de novo transcriptomes from both blastema tissues and denervated stump ends of Ambystoma mexicanum (axolotls) 14 days post-amputation were sequenced and compared using Solexa DNA sequencing. Results The sequencing done for this study produced 40,688,892 reads that were assembled into 307,345 transcribed sequences. The N50 of transcribed sequence length was 562 bases. A similarity search with known proteins identified 39,200 different genes to be expressed during limb regeneration with a cut-off E-value exceeding 10-5. We annotated assembled sequences by using gene descriptions, gene ontology, and clusters of orthologous group terms. Targeted searches using these annotations showed that the majority of the genes were in the categories of essential metabolic pathways, transcription factors and conserved signaling pathways, and novel candidate genes for regenerative processes. We discovered and confirmed numerous sequences of the candidate genes by using quantitative polymerase chain reaction and in situ hybridization. Conclusion The results of this study demonstrate that de novo transcriptome sequencing allows gene expression analysis in a species lacking genome information and provides the most comprehensive mRNA sequence resources for axolotls. The characterization of the axolotl transcriptome can help elucidate the molecular mechanisms underlying blastema formation during limb regeneration. PMID:23815514
Kim, Seungill; Kim, Myung-Shin; Kim, Yong-Min; Yeom, Seon-In; Cheong, Kyeongchae; Kim, Ki-Tae; Jeon, Jongbum; Kim, Sunggil; Kim, Do-Sun; Sohn, Seong-Han; Lee, Yong-Hwan; Choi, Doil
2015-01-01
The onion (Allium cepa L.) is one of the most widely cultivated and consumed vegetable crops in the world. Although a considerable amount of onion transcriptome data has been deposited into public databases, the sequences of the protein-coding genes are not accurate enough to be used, owing to non-coding sequences intermixed with the coding sequences. We generated a high-quality, annotated onion transcriptome from de novo sequence assembly and intensive structural annotation using the integrated structural gene annotation pipeline (ISGAP), which identified 54,165 protein-coding genes among 165,179 assembled transcripts totalling 203.0 Mb by eliminating the intron sequences. ISGAP performed reliable annotation, recognizing accurate gene structures based on reference proteins, and ab initio gene models of the assembled transcripts. Integrative functional annotation and gene-based SNP analysis revealed a whole biological repertoire of genes and transcriptomic variation in the onion. The method developed in this study provides a powerful tool for the construction of reference gene sets for organisms based solely on de novo transcriptome data. Furthermore, the reference genes and their variation described here for the onion represent essential tools for molecular breeding and gene cloning in Allium spp. PMID:25362073
Zeiger, William A; Jamal, Nasheed I; Scheuner, Maren T; Pittman, Patricia; Raymond, Kimiyo M; Morra, Massimo; Mishra, Shri K
2018-02-17
Here, we present a case of a 31-year-old man with progressive cognitive decline, ataxia, and dystonia. Extensive laboratory, radiographic, and targeted genetic studies over the course of several years failed to yield a diagnosis. Initial whole exome sequencing through a commercial laboratory identified several variants of uncertain significance; however, follow-up clinical examination and testing ruled each of these out. Eventually, repeat whole exome sequencing identified a known pathogenic intronic variant in the NPC1 gene (NM_000271.4, c.1554-1009G>A) and an additional heterozygous exonic variant of uncertain significance in the NPC1 gene (NM_000271.4, c.2524T>C). Follow-up biochemical testing was consistent with a diagnosis of probable Niemann-Pick disease Type C (NP-C). This case illustrates the potential of whole exome sequencing for diagnosing rare complex neurologic diseases. It also identifies several potential common pitfalls that must be navigated by clinicians when interpreting commercial whole exome sequencing results.
Hamond, C; Pestana, C P; Medeiros, M A; Lilenbaum, W
2016-01-01
The aim of this study was to identify Leptospira in urine samples of cattle by direct sequencing of the secY gene. The validity of this approach was assessed using ten Leptospira strains obtained from cattle in Brazil and 77 DNA samples previously extracted from cattle urine, that were positive by PCR for the genus-specific lipL32 gene of Leptospira. Direct sequencing identified 24 (31·1%) interpretable secY sequences and these were identical to those obtained from direct DNA sequencing of the urine samples from which they were recovered. Phylogenetic analyses identified four species: L. interrogans, L. borgpetersenii, L. noguchii, and L. santarosai with the most prevalent genotypes being associated with L. borgpetersenii. While direct sequencing cannot, as yet, replace culturing of leptospires, it is a valid additional tool for epidemiological studies. An unexpected finding from this study was the genetic diversity of Leptospira infecting Brazilian cattle.
Emond, Mary J; Louie, Tin; Emerson, Julia; Zhao, Wei; Mathias, Rasika A; Knowles, Michael R; Wright, Fred A; Rieder, Mark J; Tabor, Holly K; Nickerson, Deborah A; Barnes, Kathleen C; Gibson, Ronald L; Bamshad, Michael J
2012-07-08
Exome sequencing has become a powerful and effective strategy for the discovery of genes underlying Mendelian disorders. However, use of exome sequencing to identify variants associated with complex traits has been more challenging, partly because the sample sizes needed for adequate power may be very large. One strategy to increase efficiency is to sequence individuals who are at both ends of a phenotype distribution (those with extreme phenotypes). Because the frequency of alleles that contribute to the trait are enriched in one or both phenotype extremes, a modest sample size can potentially be used to identify novel candidate genes and/or alleles. As part of the National Heart, Lung, and Blood Institute (NHLBI) Exome Sequencing Project (ESP), we used an extreme phenotype study design to discover that variants in DCTN4, encoding a dynactin protein, are associated with time to first P. aeruginosa airway infection, chronic P. aeruginosa infection and mucoid P. aeruginosa in individuals with cystic fibrosis.
Lange, Leslie A.; Hu, Youna; Zhang, He; Xue, Chenyi; Schmidt, Ellen M.; Tang, Zheng-Zheng; Bizon, Chris; Lange, Ethan M.; Smith, Joshua D.; Turner, Emily H.; Jun, Goo; Kang, Hyun Min; Peloso, Gina; Auer, Paul; Li, Kuo-ping; Flannick, Jason; Zhang, Ji; Fuchsberger, Christian; Gaulton, Kyle; Lindgren, Cecilia; Locke, Adam; Manning, Alisa; Sim, Xueling; Rivas, Manuel A.; Holmen, Oddgeir L.; Gottesman, Omri; Lu, Yingchang; Ruderfer, Douglas; Stahl, Eli A.; Duan, Qing; Li, Yun; Durda, Peter; Jiao, Shuo; Isaacs, Aaron; Hofman, Albert; Bis, Joshua C.; Correa, Adolfo; Griswold, Michael E.; Jakobsdottir, Johanna; Smith, Albert V.; Schreiner, Pamela J.; Feitosa, Mary F.; Zhang, Qunyuan; Huffman, Jennifer E.; Crosby, Jacy; Wassel, Christina L.; Do, Ron; Franceschini, Nora; Martin, Lisa W.; Robinson, Jennifer G.; Assimes, Themistocles L.; Crosslin, David R.; Rosenthal, Elisabeth A.; Tsai, Michael; Rieder, Mark J.; Farlow, Deborah N.; Folsom, Aaron R.; Lumley, Thomas; Fox, Ervin R.; Carlson, Christopher S.; Peters, Ulrike; Jackson, Rebecca D.; van Duijn, Cornelia M.; Uitterlinden, André G.; Levy, Daniel; Rotter, Jerome I.; Taylor, Herman A.; Gudnason, Vilmundur; Siscovick, David S.; Fornage, Myriam; Borecki, Ingrid B.; Hayward, Caroline; Rudan, Igor; Chen, Y. Eugene; Bottinger, Erwin P.; Loos, Ruth J.F.; Sætrom, Pål; Hveem, Kristian; Boehnke, Michael; Groop, Leif; McCarthy, Mark; Meitinger, Thomas; Ballantyne, Christie M.; Gabriel, Stacey B.; O’Donnell, Christopher J.; Post, Wendy S.; North, Kari E.; Reiner, Alexander P.; Boerwinkle, Eric; Psaty, Bruce M.; Altshuler, David; Kathiresan, Sekar; Lin, Dan-Yu; Jarvik, Gail P.; Cupples, L. Adrienne; Kooperberg, Charles; Wilson, James G.; Nickerson, Deborah A.; Abecasis, Goncalo R.; Rich, Stephen S.; Tracy, Russell P.; Willer, Cristen J.; Gabriel, Stacey B.; Altshuler, David M.; Abecasis, Gonçalo R.; Allayee, Hooman; Cresci, Sharon; Daly, Mark J.; de Bakker, Paul I.W.; DePristo, Mark A.; Do, Ron; Donnelly, Peter; Farlow, Deborah N.; Fennell, Tim; Garimella, Kiran; Hazen, Stanley L.; Hu, Youna; Jordan, Daniel M.; Jun, Goo; Kathiresan, Sekar; Kang, Hyun Min; Kiezun, Adam; Lettre, Guillaume; Li, Bingshan; Li, Mingyao; Newton-Cheh, Christopher H.; Padmanabhan, Sandosh; Peloso, Gina; Pulit, Sara; Rader, Daniel J.; Reich, David; Reilly, Muredach P.; Rivas, Manuel A.; Schwartz, Steve; Scott, Laura; Siscovick, David S.; Spertus, John A.; Stitziel, Nathaniel O.; Stoletzki, Nina; Sunyaev, Shamil R.; Voight, Benjamin F.; Willer, Cristen J.; Rich, Stephen S.; Akylbekova, Ermeg; Atwood, Larry D.; Ballantyne, Christie M.; Barbalic, Maja; Barr, R. Graham; Benjamin, Emelia J.; Bis, Joshua; Boerwinkle, Eric; Bowden, Donald W.; Brody, Jennifer; Budoff, Matthew; Burke, Greg; Buxbaum, Sarah; Carr, Jeff; Chen, Donna T.; Chen, Ida Y.; Chen, Wei-Min; Concannon, Pat; Crosby, Jacy; Cupples, L. Adrienne; D’Agostino, Ralph; DeStefano, Anita L.; Dreisbach, Albert; Dupuis, Josée; Durda, J. Peter; Ellis, Jaclyn; Folsom, Aaron R.; Fornage, Myriam; Fox, Caroline S.; Fox, Ervin; Funari, Vincent; Ganesh, Santhi K.; Gardin, Julius; Goff, David; Gordon, Ora; Grody, Wayne; Gross, Myron; Guo, Xiuqing; Hall, Ira M.; Heard-Costa, Nancy L.; Heckbert, Susan R.; Heintz, Nicholas; Herrington, David M.; Hickson, DeMarc; Huang, Jie; Hwang, Shih-Jen; Jacobs, David R.; Jenny, Nancy S.; Johnson, Andrew D.; Johnson, Craig W.; Kawut, Steven; Kronmal, Richard; Kurz, Raluca; Lange, Ethan M.; Lange, Leslie A.; Larson, Martin G.; Lawson, Mark; Lewis, Cora E.; Levy, Daniel; Li, Dalin; Lin, Honghuang; Liu, Chunyu; Liu, Jiankang; Liu, Kiang; Liu, Xiaoming; Liu, Yongmei; Longstreth, William T.; Loria, Cay; Lumley, Thomas; Lunetta, Kathryn; Mackey, Aaron J.; Mackey, Rachel; Manichaikul, Ani; Maxwell, Taylor; McKnight, Barbara; Meigs, James B.; Morrison, Alanna C.; Musani, Solomon K.; Mychaleckyj, Josyf C.; Nettleton, Jennifer A.; North, Kari; O’Donnell, Christopher J.; O’Leary, Daniel; Ong, Frank; Palmas, Walter; Pankow, James S.; Pankratz, Nathan D.; Paul, Shom; Perez, Marco; Person, Sharina D.; Polak, Joseph; Post, Wendy S.; Psaty, Bruce M.; Quinlan, Aaron R.; Raffel, Leslie J.; Ramachandran, Vasan S.; Reiner, Alexander P.; Rice, Kenneth; Rotter, Jerome I.; Sanders, Jill P.; Schreiner, Pamela; Seshadri, Sudha; Shea, Steve; Sidney, Stephen; Silverstein, Kevin; Smith, Nicholas L.; Sotoodehnia, Nona; Srinivasan, Asoke; Taylor, Herman A.; Taylor, Kent; Thomas, Fridtjof; Tracy, Russell P.; Tsai, Michael Y.; Volcik, Kelly A.; Wassel, Chrstina L.; Watson, Karol; Wei, Gina; White, Wendy; Wiggins, Kerri L.; Wilk, Jemma B.; Williams, O. Dale; Wilson, Gregory; Wilson, James G.; Wolf, Phillip; Zakai, Neil A.; Hardy, John; Meschia, James F.; Nalls, Michael; Singleton, Andrew; Worrall, Brad; Bamshad, Michael J.; Barnes, Kathleen C.; Abdulhamid, Ibrahim; Accurso, Frank; Anbar, Ran; Beaty, Terri; Bigham, Abigail; Black, Phillip; Bleecker, Eugene; Buckingham, Kati; Cairns, Anne Marie; Caplan, Daniel; Chatfield, Barbara; Chidekel, Aaron; Cho, Michael; Christiani, David C.; Crapo, James D.; Crouch, Julia; Daley, Denise; Dang, Anthony; Dang, Hong; De Paula, Alicia; DeCelie-Germana, Joan; Drumm, Allen DozorMitch; Dyson, Maynard; Emerson, Julia; Emond, Mary J.; Ferkol, Thomas; Fink, Robert; Foster, Cassandra; Froh, Deborah; Gao, Li; Gershan, William; Gibson, Ronald L.; Godwin, Elizabeth; Gondor, Magdalen; Gutierrez, Hector; Hansel, Nadia N.; Hassoun, Paul M.; Hiatt, Peter; Hokanson, John E.; Howenstine, Michelle; Hummer, Laura K.; Kanga, Jamshed; Kim, Yoonhee; Knowles, Michael R.; Konstan, Michael; Lahiri, Thomas; Laird, Nan; Lange, Christoph; Lin, Lin; Lin, Xihong; Louie, Tin L.; Lynch, David; Make, Barry; Martin, Thomas R.; Mathai, Steve C.; Mathias, Rasika A.; McNamara, John; McNamara, Sharon; Meyers, Deborah; Millard, Susan; Mogayzel, Peter; Moss, Richard; Murray, Tanda; Nielson, Dennis; Noyes, Blakeslee; O’Neal, Wanda; Orenstein, David; O’Sullivan, Brian; Pace, Rhonda; Pare, Peter; Parker, H. Worth; Passero, Mary Ann; Perkett, Elizabeth; Prestridge, Adrienne; Rafaels, Nicholas M.; Ramsey, Bonnie; Regan, Elizabeth; Ren, Clement; Retsch-Bogart, George; Rock, Michael; Rosen, Antony; Rosenfeld, Margaret; Ruczinski, Ingo; Sanford, Andrew; Schaeffer, David; Sell, Cindy; Sheehan, Daniel; Silverman, Edwin K.; Sin, Don; Spencer, Terry; Stonebraker, Jackie; Tabor, Holly K.; Varlotta, Laurie; Vergara, Candelaria I.; Weiss, Robert; Wigley, Fred; Wise, Robert A.; Wright, Fred A.; Wurfel, Mark M.; Zanni, Robert; Zou, Fei; Nickerson, Deborah A.; Rieder, Mark J.; Green, Phil; Shendure, Jay; Akey, Joshua M.; Bustamante, Carlos D.; Crosslin, David R.; Eichler, Evan E.; Fox, P. Keolu; Fu, Wenqing; Gordon, Adam; Gravel, Simon; Jarvik, Gail P.; Johnsen, Jill M.; Kan, Mengyuan; Kenny, Eimear E.; Kidd, Jeffrey M.; Lara-Garduno, Fremiet; Leal, Suzanne M.; Liu, Dajiang J.; McGee, Sean; O’Connor, Timothy D.; Paeper, Bryan; Robertson, Peggy D.; Smith, Joshua D.; Staples, Jeffrey C.; Tennessen, Jacob A.; Turner, Emily H.; Wang, Gao; Yi, Qian; Jackson, Rebecca; Peters, Ulrike; Carlson, Christopher S.; Anderson, Garnet; Anton-Culver, Hoda; Assimes, Themistocles L.; Auer, Paul L.; Beresford, Shirley; Bizon, Chris; Black, Henry; Brunner, Robert; Brzyski, Robert; Burwen, Dale; Caan, Bette; Carty, Cara L.; Chlebowski, Rowan; Cummings, Steven; Curb, J. David; Eaton, Charles B.; Ford, Leslie; Franceschini, Nora; Fullerton, Stephanie M.; Gass, Margery; Geller, Nancy; Heiss, Gerardo; Howard, Barbara V.; Hsu, Li; Hutter, Carolyn M.; Ioannidis, John; Jiao, Shuo; Johnson, Karen C.; Kooperberg, Charles; Kuller, Lewis; LaCroix, Andrea; Lakshminarayan, Kamakshi; Lane, Dorothy; Lasser, Norman; LeBlanc, Erin; Li, Kuo-Ping; Limacher, Marian; Lin, Dan-Yu; Logsdon, Benjamin A.; Ludlam, Shari; Manson, JoAnn E.; Margolis, Karen; Martin, Lisa; McGowan, Joan; Monda, Keri L.; Kotchen, Jane Morley; Nathan, Lauren; Ockene, Judith; O’Sullivan, Mary Jo; Phillips, Lawrence S.; Prentice, Ross L.; Robbins, John; Robinson, Jennifer G.; Rossouw, Jacques E.; Sangi-Haghpeykar, Haleh; Sarto, Gloria E.; Shumaker, Sally; Simon, Michael S.; Stefanick, Marcia L.; Stein, Evan; Tang, Hua; Taylor, Kira C.; Thomson, Cynthia A.; Thornton, Timothy A.; Van Horn, Linda; Vitolins, Mara; Wactawski-Wende, Jean; Wallace, Robert; Wassertheil-Smoller, Sylvia; Zeng, Donglin; Applebaum-Bowden, Deborah; Feolo, Michael; Gan, Weiniu; Paltoo, Dina N.; Sholinsky, Phyliss; Sturcke, Anne
2014-01-01
Elevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency variants. To determine whether rare or low-frequency coding variants are associated with LDL-C, we exome sequenced 2,005 individuals, including 554 individuals selected for extreme LDL-C (>98th or <2nd percentile). Follow-up analyses included sequencing of 1,302 additional individuals and genotype-based analysis of 52,221 individuals. We observed significant evidence of association between LDL-C and the burden of rare or low-frequency variants in PNPLA5, encoding a phospholipase-domain-containing protein, and both known and previously unidentified variants in PCSK9, LDLR and APOB, three known lipid-related genes. The effect sizes for the burden of rare variants for each associated gene were substantially higher than those observed for individual SNPs identified from GWASs. We replicated the PNPLA5 signal in an independent large-scale sequencing study of 2,084 individuals. In conclusion, this large whole-exome-sequencing study for LDL-C identified a gene not known to be implicated in LDL-C and provides unique insight into the design and analysis of similar experiments. PMID:24507775
Lange, Leslie A; Hu, Youna; Zhang, He; Xue, Chenyi; Schmidt, Ellen M; Tang, Zheng-Zheng; Bizon, Chris; Lange, Ethan M; Smith, Joshua D; Turner, Emily H; Jun, Goo; Kang, Hyun Min; Peloso, Gina; Auer, Paul; Li, Kuo-Ping; Flannick, Jason; Zhang, Ji; Fuchsberger, Christian; Gaulton, Kyle; Lindgren, Cecilia; Locke, Adam; Manning, Alisa; Sim, Xueling; Rivas, Manuel A; Holmen, Oddgeir L; Gottesman, Omri; Lu, Yingchang; Ruderfer, Douglas; Stahl, Eli A; Duan, Qing; Li, Yun; Durda, Peter; Jiao, Shuo; Isaacs, Aaron; Hofman, Albert; Bis, Joshua C; Correa, Adolfo; Griswold, Michael E; Jakobsdottir, Johanna; Smith, Albert V; Schreiner, Pamela J; Feitosa, Mary F; Zhang, Qunyuan; Huffman, Jennifer E; Crosby, Jacy; Wassel, Christina L; Do, Ron; Franceschini, Nora; Martin, Lisa W; Robinson, Jennifer G; Assimes, Themistocles L; Crosslin, David R; Rosenthal, Elisabeth A; Tsai, Michael; Rieder, Mark J; Farlow, Deborah N; Folsom, Aaron R; Lumley, Thomas; Fox, Ervin R; Carlson, Christopher S; Peters, Ulrike; Jackson, Rebecca D; van Duijn, Cornelia M; Uitterlinden, André G; Levy, Daniel; Rotter, Jerome I; Taylor, Herman A; Gudnason, Vilmundur; Siscovick, David S; Fornage, Myriam; Borecki, Ingrid B; Hayward, Caroline; Rudan, Igor; Chen, Y Eugene; Bottinger, Erwin P; Loos, Ruth J F; Sætrom, Pål; Hveem, Kristian; Boehnke, Michael; Groop, Leif; McCarthy, Mark; Meitinger, Thomas; Ballantyne, Christie M; Gabriel, Stacey B; O'Donnell, Christopher J; Post, Wendy S; North, Kari E; Reiner, Alexander P; Boerwinkle, Eric; Psaty, Bruce M; Altshuler, David; Kathiresan, Sekar; Lin, Dan-Yu; Jarvik, Gail P; Cupples, L Adrienne; Kooperberg, Charles; Wilson, James G; Nickerson, Deborah A; Abecasis, Goncalo R; Rich, Stephen S; Tracy, Russell P; Willer, Cristen J
2014-02-06
Elevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency variants. To determine whether rare or low-frequency coding variants are associated with LDL-C, we exome sequenced 2,005 individuals, including 554 individuals selected for extreme LDL-C (>98(th) or <2(nd) percentile). Follow-up analyses included sequencing of 1,302 additional individuals and genotype-based analysis of 52,221 individuals. We observed significant evidence of association between LDL-C and the burden of rare or low-frequency variants in PNPLA5, encoding a phospholipase-domain-containing protein, and both known and previously unidentified variants in PCSK9, LDLR and APOB, three known lipid-related genes. The effect sizes for the burden of rare variants for each associated gene were substantially higher than those observed for individual SNPs identified from GWASs. We replicated the PNPLA5 signal in an independent large-scale sequencing study of 2,084 individuals. In conclusion, this large whole-exome-sequencing study for LDL-C identified a gene not known to be implicated in LDL-C and provides unique insight into the design and analysis of similar experiments. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Yang, Fengxi; Zhu, Genfa
2015-01-01
Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL) unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms underlying floral patterning of Cymbidium and supports a valuable resource for molecular breeding of the orchid plant. PMID:26580566
He, Ruifeng; Kim, Min-Jeong; Nelson, William; Balbuena, Tiago S; Kim, Ryan; Kramer, Robin; Crow, John A; May, Greg D; Thelen, Jay J; Soderlund, Carol A; Gang, David R
2012-02-01
The common reed (Phragmites australis), one of the most widely distributed of all angiosperms, uses its rhizomes (underground stems) to invade new territory, making it one of the most successful weedy species worldwide. Characterization of the rhizome transcriptome and proteome is needed to identify candidate genes and proteins involved in rhizome growth, development, metabolism, and invasiveness. We employed next-generation sequencing technologies including 454 and Illumina platforms to characterize the reed rhizome transcriptome and used quantitative proteomics techniques to identify the rhizome proteome. Combining 336514 Roche 454 Titanium reads and 103350802 Illumina paired-end reads in a de novo hybrid assembly yielded 124450 unique transcripts with an average length of 549 bp, of which 54317 were annotated. Rhizome-specific and differentially expressed transcripts were identified between rhizome apical tips (apical meristematic region) and rhizome elongation zones. A total of 1280 nonredundant proteins were identified and quantified using GeLC-MS/MS based label-free proteomics, where 174 and 77 proteins were preferentially expressed in the rhizome elongation zone and apical tip tissues, respectively. Genes involved in allelopathy and in controlling development and potentially invasiveness were identified. In addition to being a valuable sequence and protein data resource for studying plant rhizome species, our results provide useful insights into identifying specific genes and proteins with potential roles in rhizome differentiation, development, and function.
TP53, PIK3CA, FBXW7 and KRAS Mutations in Esophageal Cancer Identified by Targeted Sequencing.
Zheng, Huili; Wang, Yan; Tang, Chuanning; Jones, Lindsey; Ye, Hua; Zhang, Guangchun; Cao, Weihai; Li, Jingwen; Liu, Lifeng; Liu, Zhencong; Zhang, Chao; Lou, Feng; Liu, Zhiyuan; Li, Yangyang; Shi, Zhenfen; Zhang, Jingbo; Zhang, Dandan; Sun, Hong; Dong, Haichao; Dong, Zhishou; Guo, Baishuai; Yan, H E; Lu, Qingyu; Huang, Xue; Chen, Si-Yi
2016-01-01
Esophageal cancer (EC) is a common malignancy with significant morbidity and mortality. As individual cancers exhibit unique mutation patterns, identifying and characterizing gene mutations in EC that may serve as biomarkers might help predict patient outcome and guide treatment. Traditionally, personalized cancer DNA sequencing was impractical and expensive. Recent technological advancements have made targeted DNA sequencing more cost- and time-effective with reliable results. This technology may be useful for clinicians to direct patient treatment. The Ion PGM and AmpliSeq Cancer Panel was used to identify mutations at 737 hotspot loci of 45 cancer-related genes in 64 EC samples from Chinese patients. Frequent mutations were found in TP53 and less frequent mutations in PIK3CA, FBXW7 and KRAS. These results demonstrate that targeted sequencing can reliably identify mutations in individual tumors that make this technology a possibility for clinical use. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.
Identification of pathogenicity‐related genes in Fusarium oxysporum f. sp. cepae
Vágány, Viktória; Jackson, Alison C.; Harrison, Richard J.; Rainoni, Alessandro; Clarkson, John P.
2016-01-01
Summary Pathogenic isolates of Fusarium oxysporum, distinguished as formae speciales (f. spp.) on the basis of their host specificity, cause crown rots, root rots and vascular wilts on many important crops worldwide. Fusarium oxysporum f. sp. cepae (FOC) is particularly problematic to onion growers worldwide and is increasing in prevalence in the UK. We characterized 31 F. oxysporum isolates collected from UK onions using pathogenicity tests, sequencing of housekeeping genes and identification of effectors. In onion seedling and bulb tests, 21 isolates were pathogenic and 10 were non‐pathogenic. The molecular characterization of these isolates, and 21 additional isolates comprising other f. spp. and different Fusarium species, was carried out by sequencing three housekeeping genes. A concatenated tree separated the F. oxysporum isolates into six clades, but did not distinguish between pathogenic and non‐pathogenic isolates. Ten putative effectors were identified within FOC, including seven Secreted In Xylem (SIX) genes first reported in F. oxysporum f. sp. lycopersici. Two highly homologous proteins with signal peptides and RxLR motifs (CRX1/CRX2) and a gene with no previously characterized domains (C5) were also identified. The presence/absence of nine of these genes was strongly related to pathogenicity against onion and all were shown to be expressed in planta. Different SIX gene complements were identified in other f. spp., but none were identified in three other Fusarium species from onion. Although the FOC SIX genes had a high level of homology with other f. spp., there were clear differences in sequences which were unique to FOC, whereas CRX1 and C5 genes appear to be largely FOC specific. PMID:26609905
Li, Qian; Cao, Xi; Qiu, Hai-Yan; Lu, Jing; Gao, Rui; Liu, Chao; Yuan, Ming-Xia; Yang, Guang-Ran; Yang, Jin-Kui
2016-08-22
To establish a three-step programmed method to find gene mutations related to maturity onset diabetes of the young (MODY). Target region capture and next-generation sequencing (NGS) were performed using customized oligonucleotide probes designed to capture suspected genes for MODY in 11 probands with clinically diagnosed MODY. The suspected associations of certain genes with MODY were then confirmed by Sanger sequencing in the probands and their family members. Finally, to validate variants of one of the genes of interest (glucokinase, GCK) as pathogenic mutations, protein function editing by the variant genes was assessed. In the target region capture and NGS phase, a total of nine variants of seven genes (GCK, WFS1, SLC19A2, SH2B1, SERPINB4, RFX6, and GATA6) were identified in eight probands. Two heterozygous GCK mutations located on the same allele (p.Leu77Arg and p.Val101Met) were identified in a MODY family. Sanger sequencing was used to confirm the variants identified by NGS to be present in probands and their diabetic family members, but not in non-diabetic family members. Finally, enzyme kinetic and thermal stability analyses revealed that the p.Leu77Arg mutation or the p.Leu77Arg mutation in combination with the p.Val101Met mutation inactivates GCK function and stability, while mutation of p.Val101Met alone does not. The p.Leu77Arg but not p.Val101Met GCK mutation is therefore considered a pathogenic mutation associated with MODY. Genetic screening coupled with gene-editing protein function testing is an effective and reliable method by which causative gene mutations of MODY can be identified. Copyright © 2016 Elsevier B.V. All rights reserved.
Identification of pathogenicity-related genes in Fusarium oxysporum f. sp. cepae.
Taylor, Andrew; Vágány, Viktória; Jackson, Alison C; Harrison, Richard J; Rainoni, Alessandro; Clarkson, John P
2016-09-01
Pathogenic isolates of Fusarium oxysporum, distinguished as formae speciales (f. spp.) on the basis of their host specificity, cause crown rots, root rots and vascular wilts on many important crops worldwide. Fusarium oxysporum f. sp. cepae (FOC) is particularly problematic to onion growers worldwide and is increasing in prevalence in the UK. We characterized 31 F. oxysporum isolates collected from UK onions using pathogenicity tests, sequencing of housekeeping genes and identification of effectors. In onion seedling and bulb tests, 21 isolates were pathogenic and 10 were non-pathogenic. The molecular characterization of these isolates, and 21 additional isolates comprising other f. spp. and different Fusarium species, was carried out by sequencing three housekeeping genes. A concatenated tree separated the F. oxysporum isolates into six clades, but did not distinguish between pathogenic and non-pathogenic isolates. Ten putative effectors were identified within FOC, including seven Secreted In Xylem (SIX) genes first reported in F. oxysporum f. sp. lycopersici. Two highly homologous proteins with signal peptides and RxLR motifs (CRX1/CRX2) and a gene with no previously characterized domains (C5) were also identified. The presence/absence of nine of these genes was strongly related to pathogenicity against onion and all were shown to be expressed in planta. Different SIX gene complements were identified in other f. spp., but none were identified in three other Fusarium species from onion. Although the FOC SIX genes had a high level of homology with other f. spp., there were clear differences in sequences which were unique to FOC, whereas CRX1 and C5 genes appear to be largely FOC specific. © 2015 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sobell, J.L.; Lind, T.J.; Sommer, S.S.
To determine whether mutations in the D{sub 5} dopamine receptor (D{sub 5}DR) gene are associated with schizophrenia, the gene was examined in 78 unrelated schizophrenic individuals. After amplification by the polymerase chain reaction, products were examined by dideoxy fingerprinting (ddF), a highly sensitive screening method related to single strand conformational polymorphism analysis. All samples with unusual ddF patterns were sequenced to precisely identify the sequence change. In the 156 D{sub 5}DR alleles examined, nine sequence changes were identified. Four of the nine did not affect protein structure; of these, three were silent changes and one was a transition in themore » 3{prime} untranslated region. The remaining five sequence changes result in protein alterations: of these, one is a missense change in a non-conserved amino acid, 3 are missense changes in amino acids that are conserved in some dopamine D{sub 5} receptors and the last is a nonsense mutation. To investigate whether the nonsense mutation was associated with schizophrenia, 400 additional schizophrenic cases of western European descent and 1914 ethnically-similar controls were screened for the change. One additional schizophrenic carrier was identified and verified by direct genomic sequencing (allele frequency: .0013), but eight carriers also were found and confirmed among the non-schizophrenics (allele frequency: .0021)(p>.25). The gene was re-examined in all newly identified carriers of the nonsense mutation by direct sequencing and/or ddF in search of additional mutations. None were identified. Family studies also were conducted to investigate possible cosegregation of the mutation with other neuropsychiatric diseases, but this was not demonstrated. Thus, the mutation does not appear to be associated with an increased risk of schizophrenia nor does an initial analysis suggest cosegregation with other neuropsychiatric disorders or symptom complexes.« less
Drancourt, Michel; Roux, Véronique; Fournier, Pierre-Edouard; Raoult, Didier
2004-01-01
We developed a new molecular tool based on rpoB gene (encoding the beta subunit of RNA polymerase) sequencing to identify streptococci. We first sequenced the complete rpoB gene for Streptococcus anginosus, S. equinus, and Abiotrophia defectiva. Sequences were aligned with these of S. pyogenes, S. agalactiae, and S. pneumoniae available in GenBank. Using an in-house analysis program (SVARAP), we identified a 740-bp variable region surrounded by conserved, 20-bp zones and, by using these conserved zones as PCR primer targets, we amplified and sequenced this variable region in an additional 30 Streptococcus, Enterococcus, Gemella, Granulicatella, and Abiotrophia species. This region exhibited 71.2 to 99.3% interspecies homology. We therefore applied our identification system by PCR amplification and sequencing to a collection of 102 streptococci and 60 bacterial isolates belonging to other genera. Amplicons were obtained in streptococci and Bacillus cereus, and sequencing allowed us to make a correct identification of streptococci. Molecular signatures were determined for the discrimination of closely related species within the S. pneumoniae-S. oralis-S. mitis group and the S. agalactiae-S. difficile group. These signatures allowed us to design a S. pneumoniae-specific PCR and sequencing primer pair. PMID:14766807
2010-01-01
Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644
Geoseq: a tool for dissecting deep-sequencing datasets.
Gurtowski, James; Cancio, Anthony; Shah, Hardik; Levovitz, Chaya; George, Ajish; Homann, Robert; Sachidanandam, Ravi
2010-10-12
Datasets generated on deep-sequencing platforms have been deposited in various public repositories such as the Gene Expression Omnibus (GEO), Sequence Read Archive (SRA) hosted by the NCBI, or the DNA Data Bank of Japan (ddbj). Despite being rich data sources, they have not been used much due to the difficulty in locating and analyzing datasets of interest. Geoseq http://geoseq.mssm.edu provides a new method of analyzing short reads from deep sequencing experiments. Instead of mapping the reads to reference genomes or sequences, Geoseq maps a reference sequence against the sequencing data. It is web-based, and holds pre-computed data from public libraries. The analysis reduces the input sequence to tiles and measures the coverage of each tile in a sequence library through the use of suffix arrays. The user can upload custom target sequences or use gene/miRNA names for the search and get back results as plots and spreadsheet files. Geoseq organizes the public sequencing data using a controlled vocabulary, allowing identification of relevant libraries by organism, tissue and type of experiment. Analysis of small sets of sequences against deep-sequencing datasets, as well as identification of public datasets of interest, is simplified by Geoseq. We applied Geoseq to, a) identify differential isoform expression in mRNA-seq datasets, b) identify miRNAs (microRNAs) in libraries, and identify mature and star sequences in miRNAS and c) to identify potentially mis-annotated miRNAs. The ease of using Geoseq for these analyses suggests its utility and uniqueness as an analysis tool.
Genetic signatures of adaptation revealed from transcriptome sequencing of Arctic and red foxes.
Kumar, Vikas; Kutschera, Verena E; Nilsson, Maria A; Janke, Axel
2015-08-07
The genus Vulpes (true foxes) comprises numerous species that inhabit a wide range of habitats and climatic conditions, including one species, the Arctic fox (Vulpes lagopus) which is adapted to the arctic region. A close relative to the Arctic fox, the red fox (Vulpes vulpes), occurs in subarctic to subtropical habitats. To study the genetic basis of their adaptations to different environments, transcriptome sequences from two Arctic foxes and one red fox individual were generated and analyzed for signatures of positive selection. In addition, the data allowed for a phylogenetic analysis and divergence time estimate between the two fox species. The de novo assembly of reads resulted in more than 160,000 contigs/transcripts per individual. Approximately 17,000 homologous genes were identified using human and the non-redundant databases. Positive selection analyses revealed several genes involved in various metabolic and molecular processes such as energy metabolism, cardiac gene regulation, apoptosis and blood coagulation to be under positive selection in foxes. Branch site tests identified four genes to be under positive selection in the Arctic fox transcriptome, two of which are fat metabolism genes. In the red fox transcriptome eight genes are under positive selection, including molecular process genes, notably genes involved in ATP metabolism. Analysis of the three transcriptomes and five Sanger re-sequenced genes in additional individuals identified a lower genetic variability within Arctic foxes compared to red foxes, which is consistent with distribution range differences and demographic responses to past climatic fluctuations. A phylogenomic analysis estimated that the Arctic and red fox lineages diverged about three million years ago. Transcriptome data are an economic way to generate genomic resources for evolutionary studies. Despite not representing an entire genome, this transcriptome analysis identified numerous genes that are relevant to arctic adaptation in foxes. Similar to polar bears, fat metabolism seems to play a central role in adaptation of Arctic foxes to the cold climate, as has been identified in the polar bear, another arctic specialist.
González, Víctor M; Aventín, Núria; Centeno, Emilio; Puigdomènech, Pere
2014-12-17
Plant NBS-LRR -resistance genes tend to be found in clusters, which have been shown to be hot spots of genome variability. In melon, half of the 81 predicted NBS-LRR genes group in nine clusters, and a 1 Mb region on linkage group V contains the highest density of R-genes and presence/absence gene polymorphisms found in the melon genome. This region is known to contain the locus of Vat, an agronomically important gene that confers resistance to aphids. However, the presence of duplications makes the sequencing and annotation of R-gene clusters difficult, usually resulting in multi-gapped sequences with higher than average errors. A 1-Mb sequence that contains the largest NBS-LRR gene cluster found in melon was improved using a strategy that combines Illumina paired-end mapping and PCR-based gap closing. Unknown sequence was decreased by 70% while about 3,000 SNPs and small indels were corrected. As a result, the annotations of 18 of a total of 23 NBS-LRR genes found in this region were modified, including additional coding sequences, amino acid changes, correction of splicing boundaries, or fussion of ORFs in common transcription units. A phylogeny analysis of the R-genes and their comparison with syntenic sequences in other cucurbits point to a pattern of local gene amplifications since the diversification of cucurbits from other families, and through speciation within the family. A candidate Vat gene is proposed based on the sequence similarity between a reported Vat gene from a Korean melon cultivar and a sequence fragment previously absent in the unrefined sequence. A sequence refinement strategy allowed substantial improvement of a 1 Mb fragment of the melon genome and the re-annotation of the largest cluster of NBS-LRR gene homologues found in melon. Analysis of the cluster revealed that resistance genes have been produced by sequence duplication in adjacent genome locations since the divergence of cucurbits from other close families, and through the process of speciation within the family a candidate Vat gene was also identified using sequence previously unavailable, which demonstrates the advantages of genome assembly refinements when analyzing complex regions such as those containing clusters of highly similar genes.
Yoo, Seungyeul; Wang, Wenhui; Wang, Qin; Fiel, M Isabel; Lee, Eunjee; Hiotis, Spiros P; Zhu, Jun
2017-12-07
Chronic hepatitis B virus (HBV) infection leads to liver fibrosis, which is a major risk factor in hepatocellular carcinoma (HCC) and an independent risk factor of recurrence after HCC tumor resection. The HBV genome can be inserted into the human genome, and chronic inflammation may trigger somatic mutations. However, how HBV integration and other genomic changes contribute to the risk of tumor recurrence with regards to the different degree of liver fibrosis is not clearly understood. We sequenced mRNAs of 21 pairs of tumor and distant non-neoplastic liver tissues of HBV-HCC patients and performed comprehensive genomic analyses of our RNAseq data and public available HBV-HCC sequencing data. We developed a robust pipeline for sensitively identifying HBV integration sites based on sequencing data. Simulations showed that our method outperformed existing methods. Applying it to our data, 374 and 106 HBV host genes were identified in non-neoplastic liver and tumor tissues, respectively. When applying it to other RNA sequencing datasets, consistently more HBV integrations were identified in non-neoplastic liver than in tumor tissues. HBV host genes identified in non-neoplastic liver samples significantly overlapped with known tumor suppressor genes. More significant enrichment of tumor suppressor genes was observed among HBV host genes identified from patients with tumor recurrence, indicating the potential risk of tumor recurrence driven by HBV integration in non-neoplastic liver tissues. We also compared SNPs of each sample with SNPs in a cancer census database and inferred samples' pathogenic SNP loads. Pathogenic SNP loads in non-neoplastic liver tissues were consistently higher than those in normal liver tissues. Additionally, HBV host genes identified in non-neoplastic liver tissues significantly overlapped with pathogenic somatic mutations, suggesting that HBV integration and somatic mutations targeting the same set of genes are important to tumorigenesis. HBV integrations and pathogenic mutations showed distinct patterns between low and high liver fibrosis patients with regards to tumor recurrence. The results suggest that HBV integrations and pathogenic SNPs in non-neoplastic tissues are important for tumorigenesis and different recurrence risk models are needed for patients with low and high degrees of liver fibrosis.
Generation, annotation and analysis of ESTs from Trichoderma harzianum CECT 2413
Vizcaíno, Juan Antonio; González, Francisco Javier; Suárez, M Belén; Redondo, José; Heinrich, Julian; Delgado-Jarana, Jesús; Hermosa, Rosa; Gutiérrez, Santiago; Monte, Enrique; Llobell, Antonio; Rey, Manuel
2006-01-01
Background The filamentous fungus Trichoderma harzianum is used as biological control agent of several plant-pathogenic fungi. In order to study the genome of this fungus, a functional genomics project called "TrichoEST" was developed to give insights into genes involved in biological control activities using an approach based on the generation of expressed sequence tags (ESTs). Results Eight different cDNA libraries from T. harzianum strain CECT 2413 were constructed. Different growth conditions involving mainly different nutrient conditions and/or stresses were used. We here present the analysis of the 8,710 ESTs generated. A total of 3,478 unique sequences were identified of which 81.4% had sequence similarity with GenBank entries, using the BLASTX algorithm. Using the Gene Ontology hierarchy, we performed the annotation of 51.1% of the unique sequences and compared its distribution among the gene libraries. Additionally, the InterProScan algorithm was used in order to further characterize the sequences. The identification of the putatively secreted proteins was also carried out. Later, based on the EST abundance, we examined the highly expressed genes and a hydrophobin was identified as the gene expressed at the highest level. We compared our collection of ESTs with the previous collections obtained from Trichoderma species and we also compared our sequence set with different complete eukaryotic genomes from several animals, plants and fungi. Accordingly, the presence of similar sequences in different kingdoms was also studied. Conclusion This EST collection and its annotation provide a significant resource for basic and applied research on T. harzianum, a fungus with a high biotechnological interest. PMID:16872539
Itzhaki, H; Maxson, J M; Woodson, W R
1994-09-13
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.
Mukda, Ekchol; Trachoo, Objoon; Pasomsub, Ekawat; Tiyasirichokchai, Rawiphorn; Iemwimangsa, Nareenart; Sosothikul, Darintr; Chantratita, Wasun; Pakakasama, Samart
2017-08-01
In the present study, we used exome sequencing to analyze PRF1, UNC13D, STX11, and STXBP2, as well as genes associated with primary immunodeficiency disease (RAB27A, LYST, AP3B1, SH2D1A, ITK, CD27, XIAP, and MAGT1) in Thai children with hemophagocytic lymphohistiocytosis (HLH). We performed mutation analysis of HLH-associated genes in 25 Thai children using an exome sequencing method. Genetic variations found within these target genes were compared to exome sequencing data from 133 healthy individuals. Variants identified with minor allele frequencies <5% and novel mutations were confirmed using Sanger sequencing. Exome sequencing data revealed 101 non-synonymous single nucleotide polymorphisms (SNPs) in all subjects. These SNPs were classified as pathogenic (n = 1), likely pathogenic (n = 16), variant of unknown significance (n = 12), or benign variant (n = 72). Homozygous, compound heterozygous, and double-gene heterozygous variants, involving mutations in PRF1 (n = 3), UNC13D (n = 2), STXBP2 (n = 3), LYST (n = 3), XIAP (n = 2), AP3B1 (n = 1), RAB27A (n = 1), and MAGT1 (n = 1), were demonstrated in 12 patients. Novel mutations were found in most patients in this study. In conclusion, exome sequencing demonstrated the ability to identify rare genetic variants in HLH patients. This method is useful in the detection of mutations in multi-gene associated diseases.
Efficient analysis of mouse genome sequences reveal many nonsense variants
Steeland, Sophie; Timmermans, Steven; Van Ryckeghem, Sara; Hulpiau, Paco; Saeys, Yvan; Van Montagu, Marc; Vandenbroucke, Roosmarijn E.; Libert, Claude
2016-01-01
Genetic polymorphisms in coding genes play an important role when using mouse inbred strains as research models. They have been shown to influence research results, explain phenotypical differences between inbred strains, and increase the amount of interesting gene variants present in the many available inbred lines. SPRET/Ei is an inbred strain derived from Mus spretus that has ∼1% sequence difference with the C57BL/6J reference genome. We obtained a listing of all SNPs and insertions/deletions (indels) present in SPRET/Ei from the Mouse Genomes Project (Wellcome Trust Sanger Institute) and processed these data to obtain an overview of all transcripts having nonsynonymous coding sequence variants. We identified 8,883 unique variants affecting 10,096 different transcripts from 6,328 protein-coding genes, which is about 28% of all coding genes. Because only a subset of these variants results in drastic changes in proteins, we focused on variations that are nonsense mutations that ultimately resulted in a gain of a stop codon. These genes were identified by in silico changing the C57BL/6J coding sequences to the SPRET/Ei sequences, converting them to amino acid (AA) sequences, and comparing the AA sequences. All variants and transcripts affected were also stored in a database, which can be browsed using a SPRET/Ei M. spretus variants web tool (www.spretus.org), including a manual. We validated the tool by demonstrating the loss of function of three proteins predicted to be severely truncated, namely Fas, IRAK2, and IFNγR1. PMID:27147605
Molecular analysis of an enhancin gene in the Lymantria dispar nuclear polyhedrosis virus
David S. Bischoff; James M. Slavicek
1997-01-01
A Lymantria dispar nuclear polyhedrosis virus (LdMNPV) gene has been identified that encodes a homolog to the granulovirus (GV) enhancin proteins that are capable of enhancing the infection of other baculoviruses. Enhancin genes have been identified and sequenced for three species of GVs but have not been found in any other nuclear...
Pomerantz, Aaron F; Hoy, Marjorie A; Kawahara, Akito Y
2015-01-01
Little is known about the process of sex determination at the molecular level in species belonging to the subclass Acari, a taxon of arachnids that contains mites and ticks. The recent sequencing of the transcriptome and genome of the western orchard predatory mite Metaseiulus occidentalis allows investigation of molecular mechanisms underlying the biological processes of sex determination in this predator of phytophagous pest mites. We identified four doublesex-and-mab-3-related transcription factor (dmrt) genes, one transformer-2 gene, one intersex gene, and two fruitless-like genes in M. occidentalis. Phylogenetic analyses were conducted to infer the molecular relationships to sequences from species of arthropods, including insects, crustaceans, acarines, and a centipede, using available genomic data. Comparative analyses revealed high sequence identity within functional domains and confirmed that the architecture for certain sex-determination genes is conserved in arthropods. This study provides a framework for identifying potential target genes that could be implicated in the process of sex determination in M. occidentalis and provides insight into the conservation and change of the molecular components of sex determination in arthropods.
The Complete Plastome Sequence of an Antarctic Bryophyte Sanionia uncinata (Hedw.) Loeske
Park, Mira; Park, Hyun; Lee, Hyoungseok; Lee, Byeong-ha
2018-01-01
Organellar genomes of bryophytes are poorly represented with chloroplast genomes of only four mosses, four liverworts and two hornworts having been sequenced and annotated. Moreover, while Antarctic vegetation is dominated by the bryophytes, there are few reports on the plastid genomes for the Antarctic bryophytes. Sanionia uncinata (Hedw.) Loeske is one of the most dominant moss species in the maritime Antarctic. It has been researched as an important marker for ecological studies and as an extremophile plant for studies on stress tolerance. Here, we report the complete plastome sequence of S. uncinata, which can be exploited in comparative studies to identify the lineage-specific divergence across different species. The complete plastome of S. uncinata is 124,374 bp in length with a typical quadripartite structure of 114 unique genes including 82 unique protein-coding genes, 37 tRNA genes and four rRNA genes. However, two genes encoding the α subunit of RNA polymerase (rpoA) and encoding the cytochrome b6/f complex subunit VIII (petN) were absent. We could identify nuclear genes homologous to those genes, which suggests that rpoA and petN might have been relocated from the chloroplast genome to the nuclear genome. PMID:29494552
Li, Dora A; Walker, Esther; Francki, Michael G
2015-12-01
Carotenoids (especially lutein) are known to be the pigment source for flour b* colour in bread wheat. Flour b* colour variation is controlled by a quantitative trait locus (QTL) on wheat chromosome 7AL and one gene from the carotenoid pathway, phytoene synthase, was functionally associated with the QTL on 7AL in some, but not all, wheat genotypes. A SNP marker within a sequence similar to catalase (Cat3-A1snp) derived from full-length (FL) cDNA (AK332460), however, was consistently associated with the QTL on 7AL and implicated in regulating hydrogen peroxide (H2O2) to control carotenoid accumulation affecting flour b* colour. The number of catalase genes on chromosome 7AL was investigated in this study to identify which gene may be implicated in flour b* variation and two were identified through interrogation of the draft wheat genome survey sequence consisting of five exons and a further two members having eight exons identified through comparative analysis with the single catalase gene on rice chromosome 6, PCR amplification and sequencing. It was evident that the catalase genes on chromosome 7A had duplicated and diverged during evolution relative to its counterpart on rice chromosome 6. The detection of transcripts in seeds, the co-location with Cat3-A1snp marker and maximised alignment of FL-cDNA (AK332460) with cognate genomic sequence indicated that TaCat3-A1 was the member of the catalase gene family associated with flour b* colour variation. Re-sequencing identified three alleles from three wheat varieties, TaCat3-A1a, TaCat3-A1b and TaCat3-A1c, and their predicted protein identified differences in peroxisomal targeting signal tri-peptide domain in the carboxyl terminal end providing new insights into their potential role in regulating cellular H2O2 that contribute to flour b* colour variation.
Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth
2015-01-01
ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644
Gruel, Jérémy; LeBorgne, Michel; LeMeur, Nolwenn; Théret, Nathalie
2011-09-12
Regulation of gene expression plays a pivotal role in cellular functions. However, understanding the dynamics of transcription remains a challenging task. A host of computational approaches have been developed to identify regulatory motifs, mainly based on the recognition of DNA sequences for transcription factor binding sites. Recent integration of additional data from genomic analyses or phylogenetic footprinting has significantly improved these methods. Here, we propose a different approach based on the compilation of Simple Shared Motifs (SSM), groups of sequences defined by their length and similarity and present in conserved sequences of gene promoters. We developed an original algorithm to search and count SSM in pairs of genes. An exceptional number of SSM is considered as a common regulatory pattern. The SSM approach is applied to a sample set of genes and validated using functional gene-set enrichment analyses. We demonstrate that the SSM approach selects genes that are over-represented in specific biological categories (Ontology and Pathways) and are enriched in co-expressed genes. Finally we show that genes co-expressed in the same tissue or involved in the same biological pathway have increased SSM values. Using unbiased clustering of genes, Simple Shared Motifs analysis constitutes an original contribution to provide a clearer definition of expression networks.
2011-01-01
Background Regulation of gene expression plays a pivotal role in cellular functions. However, understanding the dynamics of transcription remains a challenging task. A host of computational approaches have been developed to identify regulatory motifs, mainly based on the recognition of DNA sequences for transcription factor binding sites. Recent integration of additional data from genomic analyses or phylogenetic footprinting has significantly improved these methods. Results Here, we propose a different approach based on the compilation of Simple Shared Motifs (SSM), groups of sequences defined by their length and similarity and present in conserved sequences of gene promoters. We developed an original algorithm to search and count SSM in pairs of genes. An exceptional number of SSM is considered as a common regulatory pattern. The SSM approach is applied to a sample set of genes and validated using functional gene-set enrichment analyses. We demonstrate that the SSM approach selects genes that are over-represented in specific biological categories (Ontology and Pathways) and are enriched in co-expressed genes. Finally we show that genes co-expressed in the same tissue or involved in the same biological pathway have increased SSM values. Conclusions Using unbiased clustering of genes, Simple Shared Motifs analysis constitutes an original contribution to provide a clearer definition of expression networks. PMID:21910886
Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1
Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming
2006-01-01
Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656
Coordinate cytokine regulatory sequences
Frazer, Kelly A.; Rubin, Edward M.; Loots, Gabriela G.
2005-05-10
The present invention provides CNS sequences that regulate the cytokine gene expression, expression cassettes and vectors comprising or lacking the CNS sequences, host cells and non-human transgenic animals comprising the CNS sequences or lacking the CNS sequences. The present invention also provides methods for identifying compounds that modulate the functions of CNS sequences as well as methods for diagnosing defects in the CNS sequences of patients.
Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.
Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun
2012-01-01
The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.
Favre, Patrick; Bapaume, Laure; Bossolini, Eligio; Delorenzi, Mauro; Falquet, Laurent; Reinhardt, Didier
2014-12-03
Genes involved in arbuscular mycorrhizal (AM) symbiosis have been identified primarily by mutant screens, followed by identification of the mutated genes (forward genetics). In addition, a number of AM-related genes has been identified by their AM-related expression patterns, and their function has subsequently been elucidated by knock-down or knock-out approaches (reverse genetics). However, genes that are members of functionally redundant gene families, or genes that have a vital function and therefore result in lethal mutant phenotypes, are difficult to identify. If such genes are constitutively expressed and therefore escape differential expression analyses, they remain elusive. The goal of this study was to systematically search for AM-related genes with a bioinformatics strategy that is insensitive to these problems. The central element of our approach is based on the fact that many AM-related genes are conserved only among AM-competent species. Our approach involves genome-wide comparisons at the proteome level of AM-competent host species with non-mycorrhizal species. Using a clustering method we first established orthologous/paralogous relationships and subsequently identified protein clusters that contain members only of the AM-competent species. Proteins of these clusters were then analyzed in an extended set of 16 plant species and ranked based on their relatedness among AM-competent monocot and dicot species, relative to non-mycorrhizal species. In addition, we combined the information on the protein-coding sequence with gene expression data and with promoter analysis. As a result we present a list of yet uncharacterized proteins that show a strongly AM-related pattern of sequence conservation, indicating that the respective genes may have been under selection for a function in AM. Among the top candidates are three genes that encode a small family of similar receptor-like kinases that are related to the S-locus receptor kinases involved in sporophytic self-incompatibility. We present a new systematic strategy of gene discovery based on conservation of the protein-coding sequence that complements classical forward and reverse genetics. This strategy can be applied to diverse other biological phenomena if species with established genome sequences fall into distinguished groups that differ in a defined functional trait of interest.
Blazier, J Chris; Ruhlman, Tracey A; Weng, Mao-Lun; Rehman, Sumaiyah K; Sabir, Jamal S M; Jansen, Robert K
2016-04-18
Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA.
Molecular evaluation of five cardiac genes in Doberman Pinschers with dilated cardiomyopathy.
Meurs, Kathryn M; Hendrix, Kristina P; Norgard, Michelle M
2008-08-01
To sequence the exonic and splice site regions of 5 cardiac genes associated with the human form of familial dilated cardiomyopathy (DCM) in Doberman Pinschers with DCM and to identify a causative mutation. 5 unrelated Doberman Pinschers with DCM and 2 unaffected Labrador Retrievers (control dogs). Exonic and splice site regions of the 5 genes encoding the cardiac proteins troponin C, lamin A/C, cysteine- and glycine-rich protein 3, cardiac troponin T, and the beta-myosin heavy chain were sequenced. Sequences were compared for nucleotide changes between affected dogs and the published canine sequences and 2 control dogs. Base pair changes were considered to be causative for DCM if they were present in an affected dog but not in the control dogs or published sequences and if they involved a conserved amino acid and changed that amino acid to a different polarity, acid-base status, or structure. A causative mutation for DCM in Doberman Pinschers was not identified, although single nucleotide polymorphisms were detected in some dogs in the cysteine- and glycine-rich protein 3, beta-myosin heavy chain, and troponin T genes. Mutations in 5 of the cardiac genes associated with the development of DCM in humans did not appear to be causative for DCM in Doberman Pinschers. Continued evaluation of additional candidate genes or a focused approach with an association analysis is warranted to elucidate the molecular cause of this important cardiac disease in Doberman Pinschers.
Identification of Genetic Elements Associated with EPSPS Gene Amplification
Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.
2013-01-01
Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434
Evolution dynamics of a model for gene duplication under adaptive conflict
NASA Astrophysics Data System (ADS)
Ancliff, Mark; Park, Jeong-Man
2014-06-01
We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.
Chuang, Duen-yau; Chien, Yung-chei; Wu, Huang-Pin
2007-01-01
The purpose of this study was to clone the carocin S1 gene and express it in a non-carocin-producing strain of Erwinia carotovora. A mutant, TH22-10, which produced a high-molecular-weight bacteriocin but not a low-molecular-weight bacteriocin, was obtained by Tn5 insertional mutagenesis using H-rif-8-2 (a spontaneous rifampin-resistant mutant of Erwinia carotovora subsp. carotovora 89-H-4). Using thermal asymmetric interlaced PCR, the DNA sequence from the Tn5 insertion site and the DNA sequence of the contiguous 2,280-bp region were determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequence fragment. ORF2 and ORF3 were identified with the carocin S1 genes, caroS1K (ORF2) and caroS1I (ORF3), which, respectively, encode a killing protein (CaroS1K) and an immunity protein (CaroS1I). These genes were homologous to the pyocin S3 gene and the pyocin AP41 gene. Carocin S1 was expressed in E. carotovora subsp. carotovora Ea1068 and replicated in TH22-10 but could not be expressed in Escherichia coli (JM101) because a consensus sequence resembling an SOS box was absent. A putative sequence similar to the consensus sequence for the E. coli cyclic AMP receptor protein binding site (−312 bp) was found upstream of the start codon. Production of this bacteriocin was also induced by glucose and lactose. The homology search results indicated that the carocin S1 gene (between bp 1078 and bp 1704) was homologous to the pyocin S3 and pyocin AP41 genes in Pseudomonas aeruginosa. These genes encode proteins with nuclease activity (domain 4). This study found that carocin S1 also has nuclease activity. PMID:17071754
Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.
2013-01-01
High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572