Science.gov

Sample records for gene sequences regulatory

  1. Polymorphism in regulatory gene sequences

    PubMed Central

    Mitchison, N A

    2001-01-01

    The extensive polymorphism revealed in non-coding gene-regulatory sequences, particularly in the immune system, suggests that this type of genetic variation is functionally and evolutionarily far more important than has been suspected, and provides a lead to new therapeutic strategies. PMID:11178274

  2. Regulatory sequence of cupin family gene

    DOEpatents

    Hood, Elizabeth; Teoh, Thomas

    2017-07-25

    This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

  3. Learning gene regulatory networks from next generation sequencing data.

    PubMed

    Jia, Bochao; Xu, Suwa; Xiao, Guanghua; Lamba, Vishal; Liang, Faming

    2017-03-10

    In recent years, next generation sequencing (NGS) has gradually replaced microarray as the major platform in measuring gene expressions. Compared to microarray, NGS has many advantages, such as less noise and higher throughput. However, the discreteness of NGS data also challenges the existing statistical methodology. In particular, there still lacks an appropriate statistical method for reconstructing gene regulatory networks using NGS data in the literature. The existing local Poisson graphical model method is not consistent and can only infer certain local structures of the network. In this article, we propose a random effect model-based transformation to continuize NGS data and then we transform the continuized data to Gaussian via a semiparametric transformation and apply an equivalent partial correlation selection method to reconstruct gene regulatory networks. The proposed method is consistent. The numerical results indicate that the proposed method can lead to much more accurate inference of gene regulatory networks than the local Poisson graphical model and other existing methods. The proposed data-continuized transformation fills the theoretical gap for how to transform discrete data to continuous data and facilitates NGS data analysis. The proposed data-continuized transformation also makes it feasible to integrate different types of data, such as microarray and RNA-seq data, in reconstruction of gene regulatory networks.

  4. Regulatory sequences of duck hepatitis B virus C gene transcription.

    PubMed Central

    Schneider, R; Will, H

    1991-01-01

    The regulatory elements involved in transcription of the C gene of duck hepatitis B virus (DHBV) were investigated. Several DHBV DNA fragments were assayed for C gene promoter, enhancer, and silencer activity by using a chloramphenicol acetyltransferase (CAT) reporter gene and transfection of established liver and nonliver cell lines. A major transcript initiating at nucleotide positions 2532 and 2533 and three minor transcripts initiating at positions 2453/2454 and 2461 were identified in cells containing these constructs. These positions correspond to the 5' end of the C mRNA and were close to that of the pre-C mRNAs, respectively, found in infected livers. The pre-C mRNAs were only detected when sequences located between the initiation sites of the pre-C and C mRNAs were deleted. These sequences downregulated, in an orientation-independent fashion, a heterologous promoter and were found to contain a consensus motif common to negative transcriptional regulatory elements previously characterized in other cellular and viral genes. C gene promoter activity was only observed in highly differentiated liver cells and was dependent on a short DHBV DNA fragment containing an enhancer core consensus motif. These data indicate that transcription of the DHBV C gene is regulated by positive, negative, and differentiation factor-responsive elements. Images PMID:1920612

  5. Regulatory sequences for expressing genes in oomycete fungi.

    PubMed

    Judelson, H S; Tyler, B M; Michelmore, R W

    1992-07-01

    Promoter and terminator sequences from a range of species were tested for activity in the oomycetes, a group of lower fungi that bear an uncertain taxonomic affinity to other organisms and in which little is known of the sequences required for transcription. Transient assays, using the reporter gene beta-glucuronidase (GUS), were used to examine the function of these promoters and terminators in the plant pathogens Phytophthora infestans and P. megasperma f. sp. glycinea, and in the saprophytic water mold, Achlya ambisexualis. Oomycete promoters, isolated from the ham34 and hsp70 genes of Bremia lactucae and the actin gene of P. megasperma f. sp. glycinea, resulted in high levels of GUS accumulation in each of the three oomycetes. In contrast, little or no activity was detected when promoters from higher fungi (four ascomycetes and one basidiomycete), plants, and animals were tested. The terminator from the ham34 gene resulted in much higher levels of GUS accumulation than did others, although an oomycete terminator was not absolutely required for expression. Transcript mapping of RNA from stable transformants confirmed accurate initiation from the B. lactucae hsp70 promoter and termination within 3' ham34 sequences in P. infestans. Our results indicate that the transcriptional machinery of the oomycetes differs significantly from that of the higher fungi, but that enough conservation exists within the class to allow vectors developed from one oomycete species to be used for others.

  6. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity.

    PubMed

    Petrovski, Slavé; Gussow, Ayal B; Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H; Allen, Andrew S; Goldstein, David B

    2015-09-01

    Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene's proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene's regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen's Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, nc

  7. The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity

    PubMed Central

    Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H.; Allen, Andrew S.; Goldstein, David B.

    2015-01-01

    Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene’s proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene’s regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen’s Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance

  8. Phylogenetic Relationships and the Evolution of Regulatory Gene Sequences in the Parrotfishes

    PubMed Central

    Smith, Lydia L.; Fessler, Jennifer L.; Alfaro, Michael E.; Streelman, J. Todd; Westneat, Mark W.

    2008-01-01

    Regulatory genes control the expression of other genes and are key components of developmental processes such as segmentation and embryonic construction of the skull in vertebrates. Here we examine the variability and evolution of three vertebrate regulatory genes, addressing issues of their utility for phylogenetics and comparing the rates of genetic change seen in regulatory loci to the rates seen in other genes in the parrotfishes. The parrotfishes are a diverse group of colorful fishes from coral reefs and seagrasses worldwide and have been placed phylogenetically within the family Labridae. We tested phylogenetic hypotheses among the parrotfishes, with a focus on the genera Chlorurus and Scarus, by analyzing eight gene fragments for 42 parrotfishes and eight outgroup species. We sequenced mitochondrial 12s rRNA (967 bp), 16s rRNA (577 bp), and cytochrome b (477 bp). From the nuclear genome, we sequenced part of the protein-coding genes rag2 (715 bp), tmo4c4 (485 bp), and the developmental regulatory genes otx1 (672 bp), bmp4 (488 bp), and dlx2 (522 bp). Bayesian, likelihood, and parsimony analyses on the resulting 4903 bp of DNA sequence produced similar topologies that confirm the monophyly of the scarines and provide a phylogeny at the species level for portions of the genera Scarus and Chlorurus. Four major clades of Scarus were recovered, with three distributed in the Indo-Pacific and one containing Caribbean/Atlantic taxa. Molecular rates suggest a Miocene origin of the parrotfishes (22 mya) and a recent divergence of species within Scarus and Chlorurus, within the past 5 million years. Developmentally important genes made a significant contribution to phylogenetic structure, and rates of genetic evolution were high in bmp4, similar to other coding nuclear genes, but low in otx1 and the dlx2 exons. Synonymous and nonsynonymous substitution patterns in developmental regulatory genes support the hypothesis of stabilizing selection during the history of

  9. High sequence turnover in the regulatory regions of the developmental gene hunchback in insects.

    PubMed

    Hancock, J M; Shaw, P J; Bonneton, F; Dover, G A

    1999-02-01

    Extensive sequence analysis of the developmental gene hunchback and its 5' and 3' regulatory regions in Drosophila melanogaster, Drosophila virilis, Musca domestica, and Tribolium castaneum, using a variety of computer algorithms, reveals regions of high sequence simplicity probably generated by slippage-like mechanisms of turnover. No regions are entirely refractory to the action of slippage, although the density and composition of simple sequence motifs varies from region to region. Interestingly, the 5' and 3' flanking regions share short repetitive motifs despite their separation by the gene itself, and the motifs are different in composition from those in the exons and introns. Furthermore, there are high levels of conservation of motifs in equivalent orthologous regions. Detailed sequence analysis of the P2 promoter and DNA footprinting assays reveal that the number, orientation, sequence, spacing, and protein-binding affinities of the BICOID-binding sites varies between species and that the 'P2' promoter, the nanos response element in the 3' untranslated region, and several conserved boxes of sequence in the gene (e.g., the two zinc-finger regions) are surrounded by cryptically-simple-sequence DNA. We argue that high sequence turnover and genetic redundancy permit both the general maintenance of promoter functions through the establishment of coevolutionary (compensatory) changes in cis- and trans-acting genetic elements and, at the same time, the possibility of subtle changes in the regulation of hunchback in the different species.

  10. Two lamprey Hedgehog genes share non-coding regulatory sequences and expression patterns with gnathostome Hedgehogs.

    PubMed

    Kano, Shungo; Xiao, Jin-Hua; Osório, Joana; Ekker, Marc; Hadzhiev, Yavor; Müller, Ferenc; Casane, Didier; Magdelenat, Ghislaine; Rétaux, Sylvie

    2010-10-13

    Hedgehog (Hh) genes play major roles in animal development and studies of their evolution, expression and function point to major differences among chordates. Here we focused on Hh genes in lampreys in order to characterize the evolution of Hh signalling at the emergence of vertebrates. Screening of a cosmid library of the river lamprey Lampetra fluviatilis and searching the preliminary genome assembly of the sea lamprey Petromyzon marinus indicate that lampreys have two Hh genes, named Hha and Hhb. Phylogenetic analyses suggest that Hha and Hhb are lamprey-specific paralogs closely related to Sonic/Indian Hh genes. Expression analysis indicates that Hha and Hhb are expressed in a Sonic Hh-like pattern. The two transcripts are expressed in largely overlapping but not identical domains in the lamprey embryonic brain, including a newly-described expression domain in the nasohypophyseal placode. Global alignments of genomic sequences and local alignment with known gnathostome regulatory motifs show that lamprey Hhs share conserved non-coding elements (CNE) with gnathostome Hhs albeit with sequences that have significantly diverged and dispersed. Functional assays using zebrafish embryos demonstrate gnathostome-like midline enhancer activity for CNEs contained in intron2. We conclude that lamprey Hh genes are gnathostome Shh-like in terms of expression and regulation. In addition, they show some lamprey-specific features, including duplication and structural (but not functional) changes in the intronic/regulatory sequences.

  11. Two Lamprey Hedgehog Genes Share Non-Coding Regulatory Sequences and Expression Patterns with Gnathostome Hedgehogs

    PubMed Central

    Ekker, Marc; Hadzhiev, Yavor; Müller, Ferenc; Casane, Didier; Magdelenat, Ghislaine; Rétaux, Sylvie

    2010-01-01

    Hedgehog (Hh) genes play major roles in animal development and studies of their evolution, expression and function point to major differences among chordates. Here we focused on Hh genes in lampreys in order to characterize the evolution of Hh signalling at the emergence of vertebrates. Screening of a cosmid library of the river lamprey Lampetra fluviatilis and searching the preliminary genome assembly of the sea lamprey Petromyzon marinus indicate that lampreys have two Hh genes, named Hha and Hhb. Phylogenetic analyses suggest that Hha and Hhb are lamprey-specific paralogs closely related to Sonic/Indian Hh genes. Expression analysis indicates that Hha and Hhb are expressed in a Sonic Hh-like pattern. The two transcripts are expressed in largely overlapping but not identical domains in the lamprey embryonic brain, including a newly-described expression domain in the nasohypophyseal placode. Global alignments of genomic sequences and local alignment with known gnathostome regulatory motifs show that lamprey Hhs share conserved non-coding elements (CNE) with gnathostome Hhs albeit with sequences that have significantly diverged and dispersed. Functional assays using zebrafish embryos demonstrate gnathostome-like midline enhancer activity for CNEs contained in intron2. We conclude that lamprey Hh genes are gnathostome Shh-like in terms of expression and regulation. In addition, they show some lamprey-specific features, including duplication and structural (but not functional) changes in the intronic/regulatory sequences. PMID:20967201

  12. Cloning and nucleotide sequence of luxR, a regulatory gene controlling bioluminescence in Vibrio harveyi.

    PubMed Central

    Showalter, R E; Martin, M O; Silverman, M R

    1990-01-01

    Mutagenesis with transposon mini-Mulac was used previously to identify a regulatory locus necessary for expression of bioluminescence genes, lux, in Vibrio harveyi (M. Martin, R. Showalter, and M. Silverman, J. Bacteriol. 171:2406-2414, 1989). Mutants with transposon insertions in this regulatory locus were used to construct a hybridization probe which was used in this study to detect recombinants in a cosmid library containing the homologous DNA. Recombinant cosmids with this DNA stimulated expression of the genes encoding enzymes for luminescence, i.e., the luxCDABE operon, which were positioned in trans on a compatible replicon in Escherichia coli. Transposon mutagenesis and analysis of the DNA sequence of the cloned DNA indicated that regulatory function resided in a single gene of about 0.6-kilobases named luxR. Expression of bioluminescence in V. harveyi and in the fish light-organ symbiont Vibrio fischeri is controlled by density-sensing mechanisms involving the accumulation of small signal molecules called autoinducers, but similarity of the two luminescence systems at the molecular level was not apparent in this study. The amino acid sequence of the LuxR product of V. harveyi, which indicates a structural relationship to some DNA-binding proteins, is not similar to the sequence of the protein that regulates expression of luminescence in V. fischeri. In addition, reconstitution of autoinducer-controlled luminescence in recombinant E. coli, already achieved with lux genes cloned from V. fischeri, was not accomplished with the isolation of luxR from V. harveyi, suggesting a requirement for an additional regulatory component. PMID:2160932

  13. Variation in sequence and organization of splicing regulatory elements in vertebrate genes

    PubMed Central

    Yeo, Gene; Hoon, Shawn; Venkatesh, Byrappa; Burge, Christopher B.

    2004-01-01

    Although core mechanisms and machinery of premRNA splicing are conserved from yeast to human, the details of intron recognition often differ, even between closely related organisms. For example, genes from the pufferfish Fugu rubripes generally contain one or more introns that are not properly spliced in mouse cells. Exploiting available genome sequence data, a battery of sequence analysis techniques was used to reach several conclusions about the organization and evolution of splicing regulatory elements in vertebrate genes. The classical splice site and putative branch site signals are completely conserved across the vertebrates studied (human, mouse, pufferfish, and zebrafish), and exonic splicing enhancers also appear broadly conserved in vertebrates. However, another class of splicing regulatory elements, the intronic splicing enhancers, appears to differ substantially between mammals and fish, with G triples (GGG) very abundant in mammalian introns but comparatively rare in fish. Conversely, short repeats of AC and GT are predicted to function as intronic splicing enhancers in fish but are not enriched in mammalian introns. Consistent with this pattern, exonic splicing enhancer-binding SR proteins are highly conserved across all vertebrates, whereas heterogeneous nuclear ribonucleoproteins, which bind many intronic sequences, vary in domain structure and even presence/absence between mammals and fish. Exploiting differences in intronic sequence composition, a statistical model was developed to predict the splicing phenotype of Fugu introns in mammalian systems and was used to engineer the spliceability of a Fugu intron in human cells by insertion of specific sequences, thereby rescuing splicing in human cells. PMID:15505203

  14. Divergence in cis-regulatory sequences surrounding the opsin gene arrays of African cichlid fishes

    PubMed Central

    2011-01-01

    Background Divergence within cis-regulatory sequences may contribute to the adaptive evolution of gene expression, but functional alleles in these regions are difficult to identify without abundant genomic resources. Among African cichlid fishes, the differential expression of seven opsin genes has produced adaptive differences in visual sensitivity. Quantitative genetic analysis suggests that cis-regulatory alleles near the SWS2-LWS opsins may contribute to this variation. Here, we sequence BACs containing the opsin genes of two cichlids, Oreochromis niloticus and Metriaclima zebra. We use phylogenetic footprinting and shadowing to examine divergence in conserved non-coding elements, promoter sequences, and 3'-UTRs surrounding each opsin in search of candidate cis-regulatory sequences that influence cichlid opsin expression. Results We identified 20 conserved non-coding elements surrounding the opsins of cichlids and other teleosts, including one known enhancer and a retinal microRNA. Most conserved elements contained computationally-predicted binding sites that correspond to transcription factors that function in vertebrate opsin expression; O. niloticus and M. zebra were significantly divergent in two of these. Similarly, we found a large number of relevant transcription factor binding sites within each opsin's proximal promoter, and identified five opsins that were considerably divergent in both expression and the number of transcription factor binding sites shared between O. niloticus and M. zebra. We also found several microRNA target sites within the 3'-UTR of each opsin, including two 3'-UTRs that differ significantly between O. niloticus and M. zebra. Finally, we examined interspecific divergence among 18 phenotypically diverse cichlids from Lake Malawi for one conserved non-coding element, two 3'-UTRs, and five opsin proximal promoters. We found that all regions were highly conserved with some evidence of CRX transcription factor binding site turnover. We

  15. Divergence in cis-regulatory sequences surrounding the opsin gene arrays of African cichlid fishes.

    PubMed

    O'Quin, Kelly E; Smith, Daniel; Naseer, Zan; Schulte, Jane; Engel, Samuel D; Loh, Yong-Hwee E; Streelman, J Todd; Boore, Jeffrey L; Carleton, Karen L

    2011-05-09

    Divergence within cis-regulatory sequences may contribute to the adaptive evolution of gene expression, but functional alleles in these regions are difficult to identify without abundant genomic resources. Among African cichlid fishes, the differential expression of seven opsin genes has produced adaptive differences in visual sensitivity. Quantitative genetic analysis suggests that cis-regulatory alleles near the SWS2-LWS opsins may contribute to this variation. Here, we sequence BACs containing the opsin genes of two cichlids, Oreochromis niloticus and Metriaclima zebra. We use phylogenetic footprinting and shadowing to examine divergence in conserved non-coding elements, promoter sequences, and 3'-UTRs surrounding each opsin in search of candidate cis-regulatory sequences that influence cichlid opsin expression. We identified 20 conserved non-coding elements surrounding the opsins of cichlids and other teleosts, including one known enhancer and a retinal microRNA. Most conserved elements contained computationally-predicted binding sites that correspond to transcription factors that function in vertebrate opsin expression; O. niloticus and M. zebra were significantly divergent in two of these. Similarly, we found a large number of relevant transcription factor binding sites within each opsin's proximal promoter, and identified five opsins that were considerably divergent in both expression and the number of transcription factor binding sites shared between O. niloticus and M. zebra. We also found several microRNA target sites within the 3'-UTR of each opsin, including two 3'-UTRs that differ significantly between O. niloticus and M. zebra. Finally, we examined interspecific divergence among 18 phenotypically diverse cichlids from Lake Malawi for one conserved non-coding element, two 3'-UTRs, and five opsin proximal promoters. We found that all regions were highly conserved with some evidence of CRX transcription factor binding site turnover. We also found three

  16. Detecting Functional Divergence after Gene Duplication through Evolutionary Changes in Posttranslational Regulatory Sequences

    PubMed Central

    Nguyen Ba, Alex N.; Strome, Bob; Hua, Jun Jie; Desmond, Jonathan; Gagnon-Arsenault, Isabelle; Weiss, Eric L.; Landry, Christian R.; Moses, Alan M.

    2014-01-01

    Gene duplication is an important evolutionary mechanism that can result in functional divergence in paralogs due to neo-functionalization or sub-functionalization. Consistent with functional divergence after gene duplication, recent studies have shown accelerated evolution in retained paralogs. However, little is known in general about the impact of this accelerated evolution on the molecular functions of retained paralogs. For example, do new functions typically involve changes in enzymatic activities, or changes in protein regulation? Here we study the evolution of posttranslational regulation by examining the evolution of important regulatory sequences (short linear motifs) in retained duplicates created by the whole-genome duplication in budding yeast. To do so, we identified short linear motifs whose evolutionary constraint has relaxed after gene duplication with a likelihood-ratio test that can account for heterogeneity in the evolutionary process by using a non-central chi-squared null distribution. We find that short linear motifs are more likely to show changes in evolutionary constraints in retained duplicates compared to single-copy genes. We examine changes in constraints on known regulatory sequences and show that for the Rck1/Rck2, Fkh1/Fkh2, Ace2/Swi5 paralogs, they are associated with previously characterized differences in posttranslational regulation. Finally, we experimentally confirm our prediction that for the Ace2/Swi5 paralogs, Cbk1 regulated localization was lost along the lineage leading to SWI5 after gene duplication. Our analysis suggests that changes in posttranslational regulation mediated by short regulatory motifs systematically contribute to functional divergence after gene duplication. PMID:25474245

  17. Detecting functional divergence after gene duplication through evolutionary changes in posttranslational regulatory sequences.

    PubMed

    Nguyen Ba, Alex N; Strome, Bob; Hua, Jun Jie; Desmond, Jonathan; Gagnon-Arsenault, Isabelle; Weiss, Eric L; Landry, Christian R; Moses, Alan M

    2014-12-01

    Gene duplication is an important evolutionary mechanism that can result in functional divergence in paralogs due to neo-functionalization or sub-functionalization. Consistent with functional divergence after gene duplication, recent studies have shown accelerated evolution in retained paralogs. However, little is known in general about the impact of this accelerated evolution on the molecular functions of retained paralogs. For example, do new functions typically involve changes in enzymatic activities, or changes in protein regulation? Here we study the evolution of posttranslational regulation by examining the evolution of important regulatory sequences (short linear motifs) in retained duplicates created by the whole-genome duplication in budding yeast. To do so, we identified short linear motifs whose evolutionary constraint has relaxed after gene duplication with a likelihood-ratio test that can account for heterogeneity in the evolutionary process by using a non-central chi-squared null distribution. We find that short linear motifs are more likely to show changes in evolutionary constraints in retained duplicates compared to single-copy genes. We examine changes in constraints on known regulatory sequences and show that for the Rck1/Rck2, Fkh1/Fkh2, Ace2/Swi5 paralogs, they are associated with previously characterized differences in posttranslational regulation. Finally, we experimentally confirm our prediction that for the Ace2/Swi5 paralogs, Cbk1 regulated localization was lost along the lineage leading to SWI5 after gene duplication. Our analysis suggests that changes in posttranslational regulation mediated by short regulatory motifs systematically contribute to functional divergence after gene duplication.

  18. The PAZAR database of gene regulatory information coupled to the ORCA toolkit for the study of regulatory sequences

    PubMed Central

    Portales-Casamar, Elodie; Arenillas, David; Lim, Jonathan; Swanson, Magdalena I.; Jiang, Steven; McCallum, Anthony; Kirov, Stefan; Wasserman, Wyeth W.

    2009-01-01

    The PAZAR database unites independently created and maintained data collections of transcription factor and regulatory sequence annotation. The flexible PAZAR schema permits the representation of diverse information derived from experiments ranging from biochemical protein–DNA binding to cellular reporter gene assays. Data collections can be made available to the public, or restricted to specific system users. The data ‘boutiques’ within the shopping-mall-inspired system facilitate the analysis of genomics data and the creation of predictive models of gene regulation. Since its initial release, PAZAR has grown in terms of data, features and through the addition of an associated package of software tools called the ORCA toolkit (ORCAtk). ORCAtk allows users to rapidly develop analyses based on the information stored in the PAZAR system. PAZAR is available at http://www.pazar.info. ORCAtk can be accessed through convenient buttons located in the PAZAR pages or via our website at http://www.cisreg.ca/ORCAtk. PMID:18971253

  19. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  20. Use of H19 Gene Regulatory Sequences in DNA-Based Therapy for Pancreatic Cancer

    PubMed Central

    Scaiewicz, V.; Sorin, V.; Fellig, Y.; Birman, T.; Mizrahi, A.; Galula, J.; Abu-lail, R.; Shneider, T.; Ohana, P.; Buscail, L.; Hochberg, A.; Czerniak, A.

    2010-01-01

    Pancreatic cancer is the eighth most common cause of death from cancer in the world, for which palliative treatments are not effective and frequently accompanied by severe side effects. We propose a DNA-based therapy for pancreatic cancer using a nonviral vector, expressing the diphtheria toxin A chain under the control of the H19 gene regulatory sequences. The H19 gene is an oncofetal RNA expressed during embryo development and in several types of cancer. We tested the expression of H19 gene in patients, and found that 65% of human pancreatic tumors analyzed showed moderated to strong expression of the gene. In vitro experiments showed that the vector was effective in reducing Luciferase protein activity on pancreatic carcinoma cell lines. In vivo experiment results revealed tumor growth arrest in different animal models for pancreatic cancer. Differences in tumor size between control and treated groups reached a 75% in the heterotopic model (P = .037) and 50% in the orthotopic model (P = .007). In addition, no visible metastases were found in the treated group of the orthotopic model. These results indicate that the treatment with the vector DTA-H19 might be a viable new therapeutic option for patients with unresectable pancreatic cancer. PMID:21052499

  1. Coordinate cytokine regulatory sequences

    DOEpatents

    Frazer, Kelly A.; Rubin, Edward M.; Loots, Gabriela G.

    2005-05-10

    The present invention provides CNS sequences that regulate the cytokine gene expression, expression cassettes and vectors comprising or lacking the CNS sequences, host cells and non-human transgenic animals comprising the CNS sequences or lacking the CNS sequences. The present invention also provides methods for identifying compounds that modulate the functions of CNS sequences as well as methods for diagnosing defects in the CNS sequences of patients.

  2. Sequence analysis of the myosin regulatory light chain gene of the vestimentiferan Riftia pachyptila.

    PubMed

    Ravaux, J; Hassanin, A; Deutsch, J; Gaill, F; Markmann-Mulisch, U

    2001-01-24

    We have isolated and characterized a cDNA (DNA complementary to RNA) clone (Rf69) from the vestimentiferan Riftia pachyptila. The cDNA insert consists of 1169 base pairs. The aminoacid sequence deduced from the longest reading frame is 193 residues in length, and clearly characterized it as a myosin regulatory light chain (RLC). The RLC primary structure is described in relation to its function in muscle contraction. The comparison with other RLCs suggested that Riftia myosin is probably regulated through its RLC either by phosphorylation like the vertebrate smooth muscle myosins, and/or by Ca2+-binding like the mollusk myosins. Riftia RLC possesses a N-terminal extension lacking in all other species besides the earthworm Lumbricus terrestris. Aminoacid sequence comparisons with a number of RLCs from vertebrates and invertebrates revealed a relatively high identity score (64%) between Riftia RLC and the homologous gene from Lumbricus. The relationships between the members of the myosin RLCs were examined by two phylogenetic methods, i.e. distance matrix and maximum parsimony. The resulting trees depict the grouping of the RLCs according to their role in myosin activity regulation. In all trees, Riftia RLC groups with RLCs that depend on Ca2+-binding for myosin activity regulation.

  3. MoD Tools: regulatory motif discovery in nucleotide sequences from co-regulated or homologous genes

    PubMed Central

    Pavesi, Giulio; Mereghetti, Paolo; Zambelli, Federico; Stefani, Marco; Mauri, Giancarlo; Pesole, Graziano

    2006-01-01

    Understanding the complex mechanisms regulating gene expression at the transcriptional and post-transcriptional levels is one of the greatest challenges of the post-genomic era. The MoD (MOtif Discovery) Tools web server comprises a set of tools for the discovery of novel conserved sequence and structure motifs in nucleotide sequences, motifs that in turn are good candidates for regulatory activity. The server includes the following programs: Weeder, for the discovery of conserved transcription factor binding sites (TFBSs) in nucleotide sequences from co-regulated genes; WeederH, for the discovery of conserved TFBSs and distal regulatory modules in sequences from homologous genes; RNAProfile, for the discovery of conserved secondary structure motifs in unaligned RNA sequences whose secondary structure is not known. In this way, a given gene can be compared with other co-regulated genes or with its homologs, or its mRNA can be analyzed for conserved motifs regulating its post-transcriptional fate. The web server thus provides researchers with different strategies and methods to investigate the regulation of gene expression, at both the transcriptional and post-transcriptional levels. Available at and . PMID:16845071

  4. A Catalog of Regulatory Sequences for Trait Gene for the Genome Editing of Wheat.

    PubMed

    Makai, Szabolcs; Tamás, László; Juhász, Angéla

    2016-01-01

    Wheat has been cultivated for 10000 years and ever since the origin of hexaploid wheat it has been exempt from natural selection. Instead, it was under the constant selective pressure of human agriculture from harvest to sowing during every year, producing a vast array of varieties. Wheat has been adopted globally, accumulating variation for genes involved in yield traits, environmental adaptation and resistance. However, one small but important part of the wheat genome has hardly changed: the regulatory regions of both the x- and y-type high molecular weight glutenin subunit (HMW-GS) genes, which are alone responsible for approximately 12% of the grain protein content. The phylogeny of the HMW-GS regulatory regions of the Triticeae demonstrates that a genetic bottleneck may have led to its decreased diversity during domestication and the subsequent cultivation. It has also highlighted the fact that the wild relatives of wheat may offer an unexploited genetic resource for the regulatory region of these genes. Significant research efforts have been made in the public sector and by international agencies, using wild crosses to exploit the available genetic variation, and as a result synthetic hexaploids are now being utilized by a number of breeding companies. However, a newly emerging tool of genome editing provides significantly improved efficiency in exploiting the natural variation in HMW-GS genes and incorporating this into elite cultivars and breeding lines. Recent advancement in the understanding of the regulation of these genes underlines the needs for an overview of the regulatory elements for genome editing purposes.

  5. A Catalog of Regulatory Sequences for Trait Gene for the Genome Editing of Wheat

    PubMed Central

    Makai, Szabolcs; Tamás, László; Juhász, Angéla

    2016-01-01

    Wheat has been cultivated for 10000 years and ever since the origin of hexaploid wheat it has been exempt from natural selection. Instead, it was under the constant selective pressure of human agriculture from harvest to sowing during every year, producing a vast array of varieties. Wheat has been adopted globally, accumulating variation for genes involved in yield traits, environmental adaptation and resistance. However, one small but important part of the wheat genome has hardly changed: the regulatory regions of both the x- and y-type high molecular weight glutenin subunit (HMW-GS) genes, which are alone responsible for approximately 12% of the grain protein content. The phylogeny of the HMW-GS regulatory regions of the Triticeae demonstrates that a genetic bottleneck may have led to its decreased diversity during domestication and the subsequent cultivation. It has also highlighted the fact that the wild relatives of wheat may offer an unexploited genetic resource for the regulatory region of these genes. Significant research efforts have been made in the public sector and by international agencies, using wild crosses to exploit the available genetic variation, and as a result synthetic hexaploids are now being utilized by a number of breeding companies. However, a newly emerging tool of genome editing provides significantly improved efficiency in exploiting the natural variation in HMW-GS genes and incorporating this into elite cultivars and breeding lines. Recent advancement in the understanding of the regulation of these genes underlines the needs for an overview of the regulatory elements for genome editing purposes. PMID:27766102

  6. Inverted duplication of histone genes in chicken and disposition of regulatory sequences.

    PubMed Central

    Wang, S W; Robins, A J; d'Andrea, R; Wells, J R

    1985-01-01

    Sequence analysis of an 8.4 kb fragment containing five chicken histone genes shows that an H4-H2A gene pair is duplicated and inverted around a central H3 gene. A left and right region, each of 2.1 kb are 97% homologous and the boundaries of homology coincide with ten base pair repeats. These boundary regions also contain highly conserved gene promoter elements, suggesting that interaction of transcriptional machinery with histone genes may be connected with recombination in promoter regions, resulting in the inverted duplication structure seen in this cluster. PMID:4000938

  7. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.

    1995-10-10

    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  8. cGRNB: a web server for building combinatorial gene regulatory networks through integrated engineering of seed-matching sequence information and gene expression datasets.

    PubMed

    Xu, Huayong; Yu, Hui; Tu, Kang; Shi, Qianqian; Wei, Chaochun; Li, Yuan-Yuan; Li, Yi-Xue

    2013-01-01

    We are witnessing rapid progress in the development of methodologies for building the combinatorial gene regulatory networks involving both TFs (Transcription Factors) and miRNAs (microRNAs). There are a few tools available to do these jobs but most of them are not easy to use and not accessible online. A web server is especially needed in order to allow users to upload experimental expression datasets and build combinatorial regulatory networks corresponding to their particular contexts. In this work, we compiled putative TF-gene, miRNA-gene and TF-miRNA regulatory relationships from forward-engineering pipelines and curated them as built-in data libraries. We streamlined the R codes of our two separate forward-and-reverse engineering algorithms for combinatorial gene regulatory network construction and formalized them as two major functional modules. As a result, we released the cGRNB (combinatorial Gene Regulatory Networks Builder): a web server for constructing combinatorial gene regulatory networks through integrated engineering of seed-matching sequence information and gene expression datasets. The cGRNB enables two major network-building modules, one for MPGE (miRNA-perturbed gene expression) datasets and the other for parallel miRNA/mRNA expression datasets. A miRNA-centered two-layer combinatorial regulatory cascade is the output of the first module and a comprehensive genome-wide network involving all three types of combinatorial regulations (TF-gene, TF-miRNA, and miRNA-gene) are the output of the second module. In this article we propose cGRNB, a web server for building combinatorial gene regulatory networks through integrated engineering of seed-matching sequence information and gene expression datasets. Since parallel miRNA/mRNA expression datasets are rapidly accumulated by the advance of next-generation sequencing techniques, cGRNB will be very useful tool for researchers to build combinatorial gene regulatory networks based on expression datasets

  9. GeneMarkS: a self-training method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions

    PubMed Central

    Besemer, John; Lomsadze, Alexandre; Borodovsky, Mark

    2001-01-01

    Improving the accuracy of prediction of gene starts is one of a few remaining open problems in computer prediction of prokaryotic genes. Its difficulty is caused by the absence of relatively strong sequence patterns identifying true translation initiation sites. In the current paper we show that the accuracy of gene start prediction can be improved by combining models of protein-coding and non-coding regions and models of regulatory sites near gene start within an iterative Hidden Markov model based algorithm. The new gene prediction method, called GeneMarkS, utilizes a non-supervised training procedure and can be used for a newly sequenced prokaryotic genome with no prior knowledge of any protein or rRNA genes. The GeneMarkS implementation uses an improved version of the gene finding program GeneMark.hmm, heuristic Markov models of coding and non-coding regions and the Gibbs sampling multiple alignment program. GeneMarkS predicted precisely 83.2% of the translation starts of GenBank annotated Bacillus subtilis genes and 94.4% of translation starts in an experimentally validated set of Escherichia coli genes. We have also observed that GeneMarkS detects prokaryotic genes, in terms of identifying open reading frames containing real genes, with an accuracy matching the level of the best currently used gene detection methods. Accurate translation start prediction, in addition to the refinement of protein sequence N-terminal data, provides the benefit of precise positioning of the sequence region situated upstream to a gene start. Therefore, sequence motifs related to transcription and translation regulatory sites can be revealed and analyzed with higher precision. These motifs were shown to possess a significant variability, the functional and evolutionary connections of which are discussed. PMID:11410670

  10. Organization of the lexA gene of Escherichia coli and nucleotide sequence of the regulatory region.

    PubMed Central

    Miki, T; Ebina, Y; Kishi, F; Nakazawa, A

    1981-01-01

    The product of the lexA gene of Escherichia coli has been shown to regulate expression of the several cellular functions (SOS functions) induced by treatments which abruptly inhibit DNA synthesis. We have cloned and mapped the lexA gene on a small segment of approximately 600 base pairs. The lexA promotor was located by transcription R-loop analysis, and the lexA product of 22,000 daltons was identified by protein synthesis in vitro. An unknown gene was found which directed the synthesis of a protein of 35,000 daltons in a region downstream from the lexA gene. Nucleotide sequence of the regulatory region of the lexA gene was determined. The sequence contained inverted repeats homologous to that of the recA regulatory region. These inverted repeats may be recognized by the lexA protein, because the protein is considered to repress both the genes as a common repressor. Images PMID:6261224

  11. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    PubMed Central

    Kuosmanen, Suvi M.; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke-Baldacchino, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa

    2016-01-01

    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding sequence of NRF2, in order to identify both genome-wide binding sites for NRF2 and disease-associated regulatory SNPs (rSNPs) with drastic effects on NRF2 binding. Interactions between NRF2 and DNA were studied using molecular modelling, and NRF2 chromatin immunoprecipitation-sequence datasets together with protein binding microarray measurements were utilized to study binding sequence variation in detail. The binding model thus generated was used to identify genome-wide binding sites for NRF2, and genomic binding sites with rSNPs that have strong effects on NRF2 binding and reside on active regulatory elements in human cells. As a proof of concept, miR-126–3p and -5p were identified as NRF2 target microRNAs, and a rSNP (rs113067944) residing on NRF2 target gene (Ferritin, light polypeptide, FTL) promoter was experimentally verified to decrease NRF2 binding and result in decreased transcriptional activity. PMID:26826707

  12. Identification of regulatory sequences in the gene for 5-aminolevulinate synthase from rat.

    PubMed

    Braidotti, G; Borthwick, I A; May, B K

    1993-01-15

    The housekeeping enzyme 5-aminolevulinate synthase (ALAS) regulates the supply of heme for respiratory cytochromes. Here we report on the isolation of a genomic clone for the rat ALAS gene. The 5'-flanking region was fused to the chloramphenicol acetyltransferase gene and transient expression analysis revealed the presence of both positive and negative cis-acting sequences. Expression was substantially increased by the inclusion of the first intron located in the 5'-untranslated region. Sequence analysis of the promoter identified two elements at positions -59 and -88 bp with strong similarity to the binding site for nuclear respiratory factor 1 (NRF-1). Gel shift analysis revealed that both NRF-1 elements formed nucleoprotein complexes which could be abolished by an authentic NRF-1 oligomer. Mutagenesis of each NRF-1 motif in the ALAS promoter gave substantially lowered levels of chloramphenicol acetyltransferase expression, whereas mutagenesis of both NRF-1 motifs resulted in the almost complete loss of expression. These results establish that the NRF-1 motifs in the ALAS promoter are critical for promoter activity. NRF-1 binding sites have been identified in the promoters of several nuclear genes encoding mitochondrial proteins concerned with oxidative phosphorylation. The present studies suggest that NRF-1 may co-ordinate the supply of mitochondrial heme with the synthesis of respiratory cytochromes by regulating expression of ALAS. In erythroid cells, NRF-1 may be less important for controlling heme levels since an erythroid ALAS gene is strongly expressed and the promoter for this gene apparently lacks NRF-1 binding sites.

  13. Population sequencing of two endocannabinoid metabolic genes identifies rare and common regulatory variants associated with extreme obesity and metabolite level

    PubMed Central

    2010-01-01

    Background Targeted re-sequencing of candidate genes in individuals at the extremes of a quantitative phenotype distribution is a method of choice to gain information on the contribution of rare variants to disease susceptibility. The endocannabinoid system mediates signaling in the brain and peripheral tissues involved in the regulation of energy balance, is highly active in obese patients, and represents a strong candidate pathway to examine for genetic association with body mass index (BMI). Results We sequenced two intervals (covering 188 kb) encoding the endocannabinoid metabolic enzymes fatty-acid amide hydrolase (FAAH) and monoglyceride lipase (MGLL) in 147 normal controls and 142 extremely obese cases. After applying quality filters, we called 1,393 high quality single nucleotide variants, 55% of which are rare, and 143 indels. Using single marker tests and collapsed marker tests, we identified four intervals associated with BMI: the FAAH promoter, the MGLL promoter, MGLL intron 2, and MGLL intron 3. Two of these intervals are composed of rare variants and the majority of the associated variants are located in promoter sequences or in predicted transcriptional enhancers, suggesting a regulatory role. The set of rare variants in the FAAH promoter associated with BMI is also associated with increased level of FAAH substrate anandamide, further implicating a functional role in obesity. Conclusions Our study, which is one of the first reports of a sequence-based association study using next-generation sequencing of candidate genes, provides insights into study design and analysis approaches and demonstrates the importance of examining regulatory elements rather than exclusively focusing on exon sequences. PMID:21118518

  14. Integrating sequence, evolution and functional genomics in regulatory genomics

    PubMed Central

    Vingron, Martin; Brazma, Alvis; Coulson, Richard; van Helden, Jacques; Manke, Thomas; Palin, Kimmo; Sand, Olivier; Ukkonen, Esko

    2009-01-01

    With genome analysis expanding from the study of genes to the study of gene regulation, 'regulatory genomics' utilizes sequence information, evolution and functional genomics measurements to unravel how regulatory information is encoded in the genome. PMID:19226437

  15. Characterization of the bovine pregnancy-associated glycoprotein gene family--analysis of gene sequences, regulatory regions within the promoter and expression of selected genes.

    PubMed

    Telugu, Bhanu Prakash V L; Walker, Angela M; Green, Jonathan A

    2009-04-24

    The Pregnancy-associated glycoproteins (PAGs) belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1) we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2) we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3) we determined relative transcript abundance of selected PAGs during pregnancy and, 4) we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo) PAG-2. From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs), were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed differences in spatial and temporal expression. We also

  16. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    PubMed Central

    Telugu, Bhanu Prakash VL; Walker, Angela M; Green, Jonathan A

    2009-01-01

    Background The Pregnancy-associated glycoproteins (PAGs) belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1) we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2) we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3) we determined relative transcript abundance of selected PAGs during pregnancy and, 4) we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo) PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs), were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed differences in spatial

  17. Nucleotide sequence conservation of novel and established cis-regulatory sites within the tyrosine hydroxylase gene promoter

    PubMed Central

    Wang, Meng; Banerjee, Kasturi; Baker, Harriet; Cave, John W.

    2015-01-01

    Tyrosine hydroxylase (TH) is the rate-limiting enzyme in catecholamine biosynthesis and its gene proximal promoter ( < 1 kb upstream from the transcription start site) is essential for regulating transcription in both the developing and adult nervous systems. Several putative regulatory elements within the TH proximal promoter have been reported, but evolutionary conservation of these elements has not been thoroughly investigated. Since many vertebrate species are used to model development, function and disorders of human catecholaminergic neurons, identifying evolutionarily conserved transcription regulatory mechanisms is a high priority. In this study, we align TH proximal promoter nucleotide sequences from several vertebrate species to identify evolutionarily conserved motifs. This analysis identified three elements (a TATA box, cyclic AMP response element (CRE) and a 5′-GGTGG-3′ site) that constitute the core of an ancient vertebrate TH promoter. Focusing on only eutherian mammals, two regions of high conservation within the proximal promoter were identified: a ∼250 bp region adjacent to the transcription start site and a ∼85 bp region located approximately 350 bp further upstream. Within both regions, conservation of previously reported cis-regulatory motifs and human single nucleotide variants was evaluated. Transcription reporter assays in a TH -expressing cell line demonstrated the functionality of highly conserved motifs in the proximal promoter regions and electromobility shift assays showed that brain-region specific complexes assemble on these motifs. These studies also identified a non-canonical CRE binding (CREB) protein recognition element in the proximal promoter. Together, these studies provide a detailed analysis of evolutionary conservation within the TH promoter and identify potential cis-regulatory motifs that underlie a core set of regulatory mechanisms in mammals. PMID:25774193

  18. Mutation analysis of TRPS1 gene including core promoter, 5'UTR, and 3'UTR regulatory sequences with insight into their organization.

    PubMed

    Solc, Roman; Klugerova, Michaela; Vcelak, Josef; Baxova, Alice; Kuklik, Miloslav; Vseticka, Jan; Beharka, Rastislav; Hirschfeldova, Katerina

    2017-01-01

    The TRPS1 protein is a potent regulator of proliferation, differentiation, and apoptosis. The TRPS1 gene aberrations are strongly associated with rare trichorhinophalangeal syndrome (TRPS) development. We have conducted MLPA analysis to capture deletion within the crucial 8q24.1 chromosomal region in combination with mutation analysis of TRPS1 gene including core promoter, 5'UTR, and 3'UTR sequences in nine TRPS patients. Low complexity or extent of untranslated regulatory sequences avoided them from analysis in previous studies. Amplicon based next generation sequencing used in our study bridge over these technical limitations. Finally, we have made extended in silico analysis of TRPS1 gene regulatory sequences organization. Single contiguous deletion and an intragenic deletion intervening several exons were detected. Mutation analysis revealed five TRPS1 gene aberrations (two structural rearrangements, two nonsense mutations, and one missense substitution) reaching the overall detection rate of 78%. Several polymorphic variants were detected within the analysed regulatory sequences but without proposed pathogenic effect. In silico analysis suggested alternative promoter usage and diverse expression effectivity for different TRPS1 transcripts. Haploinsufficiency of TRPS1 gene was responsible for most of the TRPS phenotype. Structure of TRPS1 gene regulatory sequences is indicative of generally low single allele expression and its tight control.

  19. Sox2 regulatory region 2 sequence works as a DNA nuclear targeting sequence enhancing the efficiency of an exogenous gene expression in ES cells.

    PubMed

    Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako; Matsuoka, Hideaki

    2010-10-01

    In this report, the effects of two DNA nuclear targeting sequence (DTS) candidates on the gene expression efficiency in ES cells were investigated. Reporter plasmids containing the simian virus 40 (SV40) promoter/enhancer sequence (SV40-DTS), a DTS for various types of cells but not being reported yet for ES cells, and the 81 base pairs of Sox2 regulatory region 2 (SRR2) where two transcriptional factors in ES cells, Oct3/4 and Sox2, are bound (SRR2-DTS), were introduced into cytoplasm in living cells by femtoinjection. The gene expression efficiencies of each plasmid in mouse insulinoma cell line MIN6 cells and mouse ES cells were then evaluated. Plasmids including SV40-DTS and SRR2-DTS exhibited higher gene expression efficiency comparing to plasmids without these DTSs, and thus it was concluded that both sequences work as a DTS in ES cells. In addition, it was suggested that SRR2-DTS works as an ES cell-specific DTS. To the best of our knowledge, this is the first report to confirm the function of DTSs in ES cells.

  20. Oxytocin receptor gene sequences in owl monkeys and other primates show remarkable interspecific regulatory and protein coding variation.

    PubMed

    Babb, Paul L; Fernandez-Duque, Eduardo; Schurr, Theodore G

    2015-10-01

    The oxytocin (OT) hormone pathway is involved in numerous physiological processes, and one of its receptor genes (OXTR) has been implicated in pair bonding behavior in mammalian lineages. This observation is important for understanding social monogamy in primates, which occurs in only a small subset of taxa, including Azara's owl monkey (Aotus azarae). To examine the potential relationship between social monogamy and OXTR variation, we sequenced its 5' regulatory (4936bp) and coding (1167bp) regions in 25 owl monkeys from the Argentinean Gran Chaco, and examined OXTR sequences from 1092 humans from the 1000 Genomes Project. We also assessed interspecific variation of OXTR in 25 primate and rodent species that represent a set of phylogenetically and behaviorally disparate taxa. Our analysis revealed substantial variation in the putative 5' regulatory region of OXTR, with marked structural differences across primate taxa, particularly for humans and chimpanzees, which exhibited unique patterns of large motifs of dinucleotide A+T repeats upstream of the OXTR 5' UTR. In addition, we observed a large number of amino acid substitutions in the OXTR CDS region among New World primate taxa that distinguish them from Old World primates. Furthermore, primate taxa traditionally defined as socially monogamous (e.g., gibbons, owl monkeys, titi monkeys, and saki monkeys) all exhibited different amino acid motifs for their respective OXTR protein coding sequences. These findings support the notion that monogamy has evolved independently in Old World and New World primates, and that it has done so through different molecular mechanisms, not exclusively through the oxytocin pathway. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. A regulatory sequence from the retinoid X receptor γ gene directs expression to horizontal cells and photoreceptors in the embryonic chicken retina

    PubMed Central

    Blixt, Maria K. E.

    2016-01-01

    Purpose Combining techniques of episomal vector gene-specific Cre expression and genomic integration using the piggyBac transposon system enables studies of gene expression–specific cell lineage tracing in the chicken retina. In this work, we aimed to target the retinal horizontal cell progenitors. Methods A 208 bp gene regulatory sequence from the chicken retinoid X receptor γ gene (RXRγ208) was used to drive Cre expression. RXRγ is expressed in progenitors and photoreceptors during development. The vector was combined with a piggyBac “donor” vector containing a floxed STOP sequence followed by enhanced green fluorescent protein (EGFP), as well as a piggyBac helper vector for efficient integration into the host cell genome. The vectors were introduced into the embryonic chicken retina with in ovo electroporation. Tissue electroporation targets specific developmental time points and in specific structures. Results Cells that drove Cre expression from the regulatory RXRγ208 sequence excised the floxed STOP-sequence and expressed GFP. The approach generated a stable lineage with robust expression of GFP in retinal cells that have activated transcription from the RXRγ208 sequence. Furthermore, GFP was expressed in cells that express horizontal or photoreceptor markers when electroporation was performed between developmental stages 22 and 28. Electroporation of a stage 12 optic cup gave multiple cell types in accordance with RXRγ gene expression in the early retina. Conclusions In this study, we describe an easy, cost-effective, and time-efficient method for testing regulatory sequences in general. More specifically, our results open up the possibility for further studies of the RXRγ-gene regulatory network governing the formation of photoreceptor and horizontal cells. In addition, the method presents approaches to target the expression of effector genes, such as regulators of cell fate or cell cycle progression, to these cells and their progenitor. PMID

  2. The mouse p97 (CDC48) gene. Genomic structure, definition of transcriptional regulatory sequences, gene expression, and characterization of a pseudogene.

    PubMed

    Müller, J M; Meyer, H H; Ruhrberg, C; Stamp, G W; Warren, G; Shima, D T

    1999-04-09

    Here we present the first description of the genomic organization, transcriptional regulatory sequences, and adult and embryonic gene expression for the mouse p97(CDC48) AAA ATPase. Clones representing two distinct p97 genes were isolated in a genomic library screen, one of them likely representing a non-functional processed pseudogene. The coding region of the gene encoding the functional mRNA is interrupted by 16 introns and encompasses 20.4 kilobase pairs. Definition of the transcriptional initiation site and sequence analysis showed that the gene contains a TATA-less, GC-rich promoter region with an initiator element spanning the transcription start site. Cis-acting elements necessary for basal transcription activity reside within 410 base pairs of the flanking region as determined by transient transfection assays. In immunohistological analyses, p97 was widely expressed in embryos and adults, but protein levels were tightly controlled in a cell type- and cell differentiation-dependent manner. A remarkable heterogeneity in p97 immunostaining was found on a cellular level within a given tissue, and protein amounts in the cytoplasm and nucleus varied widely, suggesting a highly regulated and intermittent function for p97. This study provides the basis for a detailed analysis of the complex regulation of p97 and the reagents required for assessing its functional significance using targeted gene manipulation in the mouse.

  3. Identification of co-expression gene networks, regulatory genes and pathways for obesity based on adipose tissue RNA Sequencing in a porcine model.

    PubMed

    Kogelman, Lisette J A; Cirera, Susanna; Zhernakova, Daria V; Fredholm, Merete; Franke, Lude; Kadarmideen, Haja N

    2014-09-30

    Obesity is a complex metabolic condition in strong association with various diseases, like type 2 diabetes, resulting in major public health and economic implications. Obesity is the result of environmental and genetic factors and their interactions, including genome-wide genetic interactions. Identification of co-expressed and regulatory genes in RNA extracted from relevant tissues representing lean and obese individuals provides an entry point for the identification of genes and pathways of importance to the development of obesity. The pig, an omnivorous animal, is an excellent model for human obesity, offering the possibility to study in-depth organ-level transcriptomic regulations of obesity, unfeasible in humans. Our aim was to reveal adipose tissue co-expression networks, pathways and transcriptional regulations of obesity using RNA Sequencing based systems biology approaches in a porcine model. We selected 36 animals for RNA Sequencing from a previously created F2 pig population representing three extreme groups based on their predicted genetic risks for obesity. We applied Weighted Gene Co-expression Network Analysis (WGCNA) to detect clusters of highly co-expressed genes (modules). Additionally, regulator genes were detected using Lemon-Tree algorithms. WGCNA revealed five modules which were strongly correlated with at least one obesity-related phenotype (correlations ranging from -0.54 to 0.72, P < 0.001). Functional annotation identified pathways enlightening the association between obesity and other diseases, like osteoporosis (osteoclast differentiation, P = 1.4E-7), and immune-related complications (e.g. Natural killer cell mediated cytotoxity, P = 3.8E-5; B cell receptor signaling pathway, P = 7.2E-5). Lemon-Tree identified three potential regulator genes, using confident scores, for the WGCNA module which was associated with osteoclast differentiation: CCR1, MSR1 and SI1 (probability scores respectively 95.30, 62.28, and 34.58). Moreover, detection

  4. Identification of co-expression gene networks, regulatory genes and pathways for obesity based on adipose tissue RNA Sequencing in a porcine model

    PubMed Central

    2014-01-01

    Background Obesity is a complex metabolic condition in strong association with various diseases, like type 2 diabetes, resulting in major public health and economic implications. Obesity is the result of environmental and genetic factors and their interactions, including genome-wide genetic interactions. Identification of co-expressed and regulatory genes in RNA extracted from relevant tissues representing lean and obese individuals provides an entry point for the identification of genes and pathways of importance to the development of obesity. The pig, an omnivorous animal, is an excellent model for human obesity, offering the possibility to study in-depth organ-level transcriptomic regulations of obesity, unfeasible in humans. Our aim was to reveal adipose tissue co-expression networks, pathways and transcriptional regulations of obesity using RNA Sequencing based systems biology approaches in a porcine model. Methods We selected 36 animals for RNA Sequencing from a previously created F2 pig population representing three extreme groups based on their predicted genetic risks for obesity. We applied Weighted Gene Co-expression Network Analysis (WGCNA) to detect clusters of highly co-expressed genes (modules). Additionally, regulator genes were detected using Lemon-Tree algorithms. Results WGCNA revealed five modules which were strongly correlated with at least one obesity-related phenotype (correlations ranging from -0.54 to 0.72, P < 0.001). Functional annotation identified pathways enlightening the association between obesity and other diseases, like osteoporosis (osteoclast differentiation, P = 1.4E-7), and immune-related complications (e.g. Natural killer cell mediated cytotoxity, P = 3.8E-5; B cell receptor signaling pathway, P = 7.2E-5). Lemon-Tree identified three potential regulator genes, using confident scores, for the WGCNA module which was associated with osteoclast differentiation: CCR1, MSR1 and SI1 (probability scores respectively 95.30, 62.28, and

  5. Identification of lignin genes and regulatory sequences involved in secondary cell wall formation in Acacia auriculiformis and Acacia mangium via de novo transcriptome sequencing

    PubMed Central

    2011-01-01

    useful markers for population genetics studies and marker-assisted selection. Conclusion We have produced the first comprehensive transcriptome-wide analysis in A. auriculiformis and A. mangium using de novo assembly techniques. Our high quality and comprehensive assemblies allowed the identification of many genes in the lignin biosynthesis and secondary cell wall formation in Acacia hybrids. Our results demonstrated that Next Generation Sequencing is a cost-effective method for gene discovery, identification of regulatory sequences, and informative markers in a non-model plant. PMID:21729267

  6. Identification of lignin genes and regulatory sequences involved in secondary cell wall formation in Acacia auriculiformis and Acacia mangium via de novo transcriptome sequencing.

    PubMed

    Wong, Melissa M L; Cannon, Charles H; Wickneswari, Ratnam

    2011-07-05

    population genetics studies and marker-assisted selection. We have produced the first comprehensive transcriptome-wide analysis in A. auriculiformis and A. mangium using de novo assembly techniques. Our high quality and comprehensive assemblies allowed the identification of many genes in the lignin biosynthesis and secondary cell wall formation in Acacia hybrids. Our results demonstrated that Next Generation Sequencing is a cost-effective method for gene discovery, identification of regulatory sequences, and informative markers in a non-model plant.

  7. Poisson approach to clustering analysis of regulatory sequences.

    PubMed

    Wang, Haiying; Zheng, Huiru; Hu, Jinglu

    2008-01-01

    The presence of similar patterns in regulatory sequences may aid users in identifying co-regulated genes or inferring regulatory modules. By modelling pattern occurrences in regulatory regions with Poisson statistics, this paper presents a log likelihood ratio statistics-based distance measure to calculate pair-wise similarities between regulatory sequences. We employed it within three clustering algorithms: hierarchical clustering, Self-Organising Map, and a self-adaptive neural network. The results indicate that, in comparison to traditional clustering algorithms, the incorporation of the log likelihood ratio statistics-based distance into the learning process may offer considerable improvements in the process of regulatory sequence-based classification of genes.

  8. Nucleotide sequence analysis reveals linked N-acetyl hydrolase, thioesterase, transport, and regulatory genes encoded by the bialaphos biosynthetic gene cluster of Streptomyces hygroscopicus.

    PubMed Central

    Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J

    1991-01-01

    Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide

  9. Plant nitrogen regulatory P-PII genes

    DOEpatents

    Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

    2001-01-01

    The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

  10. [Cloning and function identification of gene 'admA' and up-stream regulatory sequence related to antagonistic activity of Enterobacter cloacae B8].

    PubMed

    Zhu, Jun-Li; Li, De-Bao; Yu, Xu-Ping

    2012-04-01

    To reveal the antagonistic mechanism of B8 strain to Xanthomonas oryzae pv. oryzae, transposon tagging method and chromosome walking were deployed to clone antagonistic related fragments around Tn5 insertion site in the mutant strain B8B. The function of up-stream regulatory sequence of gene 'admA' involved in the antagonistic activity was further identified by gene knocking out technique. An antagonistic related left fragment of Tn5 insertion site, 2 608 bp in length, was obtained by tagging with Kan resistance gene of Tn5. A 2 354 bp right fragment of Tn5 insertion site was amplified with 2 rounds of chromosome walking. The length of the B contig around the Tn5 insertion site was 4 611 bp, containing 7 open reading frames (ORFs). Bioinformatic analysis revealed that these ORFs corresponded to the partial coding regions of glyceraldehyde-3-phosphate dehydrogenase, two LysR family transcriptional regulators, hypothetical protein VSWAT3-20465 of Vibrionales and admA, admB, and partial sequence of admC gene of Pantoea agglomerans biosynthetic gene cluster, respectively. Tn5 was inserted in the up-stream of 200 bp or 894 bp of the sequence corresponding to anrP ORF or admA gene on B8B, respectively. The B-1 and B-2 mutants that lost antagonistic activity were selected by homeologuous recombination technology in association with knocking out plasmid pMB-BG. These results suggested that the transcription and expression of anrP gene might be disrupted as a result of the knocking out of up-stream regulatory sequence by Tn5 in B8B strain, further causing biosythesis regulation of the antagonistic related gene cluster. Thus, the antagonistic related genes in B8 strain is a gene family similar as andrimid biosynthetic gene cluster, and the upstream regulatory region appears to be critical for the antibiotics biosynthesis.

  11. Epigenetic Modifications of Distinct Sequences of the p1 Regulatory Gene Specify Tissue-Specific Expression Patterns in Maize

    PubMed Central

    Sekhon, Rajandeep S.; Peterson, Thomas; Chopra, Surinder

    2007-01-01

    Tandemly repeated endogenous genes are common in plants, but their transcriptional regulation is not well characterized. In maize, the P1-wr allele of pericarp color1 is composed of multiple copies arranged in a head-to-tail fashion. P1-wr confers a white kernel pericarp and red cob glume pigment phenotype that is stably inherited over generations. To understand the molecular mechanisms that regulate tissue-specific expression of P1-wr, we have characterized P1-wr*, a spontaneous loss-of-function epimutation that shows a white kernel pericarp and white cob glume phenotype. As compared to its progenitor P1-wr, the P1-wr* is hypermethylated in exon 1 and intron 2 regions. In the presence of the epigenetic modifier Ufo1 (Unstable factor for orange1), P1-wr* plants exhibit a range of cob glume pigmentation whereas pericarps remain colorless. In these plants, the level of cob pigmentation directly correlates with the degree of DNA demethylation in the intron 2 region of p1. Further, genomic bisulfite sequencing indicates that a 168-bp region of intron 2 is significantly hypomethylated in both CG and CNG context in P1-wr* Ufo1 plants. Interestingly, P1-wr* Ufo1 plants did not show any methylation change in a distal enhancer region that has previously been implicated in Ufo1-induced gain of pericarp pigmentation of the P1-wr allele. These results suggest that distinct regulatory sequences in the P1-wr promoter and intron 2 regions can undergo independent epigenetic modifications to generate tissue-specific expression patterns. PMID:17179091

  12. p38 MAPK down-regulates fibulin 3 expression through methylation of gene regulatory sequences: role in migration and invasion.

    PubMed

    Arechederra, María; Priego, Neibla; Vázquez-Carballo, Ana; Sequera, Celia; Gutiérrez-Uzquiza, Álvaro; Cerezo-Guisado, María Isabel; Ortiz-Rivero, Sara; Roncero, Cesáreo; Cuenda, Ana; Guerrero, Carmen; Porras, Almudena

    2015-02-13

    p38 MAPKs regulate migration and invasion. However, the mechanisms involved are only partially known. We had previously identified fibulin 3, which plays a role in migration, invasion, and tumorigenesis, as a gene regulated by p38α. We have characterized in detail how p38 MAPK regulates fibulin 3 expression and its role. We describe here for the first time that p38α, p38γ, and p38δ down-regulate fibulin 3 expression. p38α has a stronger effect, and it does so through hypermethylation of CpG sites in the regulatory sequences of the gene. This would be mediated by the DNA methylase, DNMT3A, which is down-regulated in cells lacking p38α, but once re-introduced represses Fibulin 3 expression. p38α through HuR stabilizes dnmt3a mRNA leading to an increase in DNMT3A protein levels. Moreover, by knocking-down fibulin 3, we have found that Fibulin 3 inhibits migration and invasion in MEFs by mechanisms involving p38α/β inhibition. Hence, p38α pro-migratory/invasive effect might be, at least in part, mediated by fibulin 3 down-regulation in MEFs. In contrast, in HCT116 cells, Fibulin 3 promotes migration and invasion through a mechanism dependent on p38α and/or p38β activation. Furthermore, Fibulin 3 promotes in vitro and in vivo tumor growth of HCT116 cells through a mechanism dependent on p38α, which surprisingly acts as a potent inducer of tumor growth. At the same time, p38α limits fibulin 3 expression, which might represent a negative feed-back loop.

  13. The upstream regulatory sequence of the light harvesting complex Lhcf2 gene of the marine diatom Phaeodactylum tricornutum enhances transcription in an orientation- and distance-independent fashion.

    PubMed

    Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela

    2015-12-01

    Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study.

  14. Two distinct nuclear factors bind the conserved regulatory sequences of a rabbit major histocompatibility complex class II gene.

    PubMed Central

    Sittisombut, N

    1988-01-01

    The constitutive coexpression of the major histocompatibility complex (MHC) class II genes in B lymphocytes requires positive, trans-acting transcriptional factors. The need for these trans-acting factors has been suggested by the reversion of the MHC class II-negative phenotype of rare B-lymphocyte mutants through somatic cell fusion with B cells or T-cell lines. The mechanism by which the trans-acting factors exert their effect on gene transcription is unknown. The possibility that two highly conserved DNA sequences, located 90 to 100 base pairs (bp) (the A sequence) and 60 to 70 bp (the B sequence) upstream of the transcription start site of the class II genes, are recognized by the trans-acting factors was investigated in this study. By using the gel electrophoresis retardation assay, a minimum of two proteins which specifically bound the conserved A or B sequence of a rabbit DP beta gene were identified in murine nuclear extracts of a B-lymphoma cell line, A20-2J. Fractionation of nuclear extract through a heparin-agarose column allowed the identification of one protein, designated NF-MHCIIB, which bound an oligonucleotide containing the B sequence and protected the entire B sequence in the DNase I protection analysis. Another protein, designated NF-MHCIIA, which bound an oligonucleotide containing the A sequence and partially protected the 3' half of this sequence, was also identified. NF-MHCIIB did not protect a CCAAT sequence located 17 bp downstream of the B sequence. The possible relationship between these DNA-binding factors and the trans-acting factors identified in the cell fusion experiments is discussed. Images PMID:3133552

  15. Epithelial and endothelial expression of the green fluorescent protein reporter gene under the control of bovine prion protein (PrP) gene regulatory sequences in transgenic mice

    NASA Astrophysics Data System (ADS)

    Lemaire-Vieille, Catherine; Schulze, Tobias; Podevin-Dimster, Valérie; Follet, Jérome; Bailly, Yannick; Blanquet-Grossard, Françoise; Decavel, Jean-Pierre; Heinen, Ernst; Cesbron, Jean-Yves

    2000-05-01

    The expression of the cellular form of the prion protein (PrPc) gene is required for prion replication and neuroinvasion in transmissible spongiform encephalopathies. The identification of the cell types expressing PrPc is necessary to understanding how the agent replicates and spreads from peripheral sites to the central nervous system. To determine the nature of the cell types expressing PrPc, a green fluorescent protein reporter gene was expressed in transgenic mice under the control of 6.9 kb of the bovine PrP gene regulatory sequences. It was shown that the bovine PrP gene is expressed as two populations of mRNA differing by alternative splicing of one 115-bp 5' untranslated exon in 17 different bovine tissues. The analysis of transgenic mice showed reporter gene expression in some cells that have been identified as expressing PrP, such as cerebellar Purkinje cells, lymphocytes, and keratinocytes. In addition, expression of green fluorescent protein was observed in the plexus of the enteric nervous system and in a restricted subset of cells not yet clearly identified as expressing PrP: the epithelial cells of the thymic medullary and the endothelial cells of both the mucosal capillaries of the intestine and the renal capillaries. These data provide valuable information on the distribution of PrPc at the cellular level and argue for roles of the epithelial and endothelial cells in the spread of infection from the periphery to the brain. Moreover, the transgenic mice described in this paper provide a model that will allow for the study of the transcriptional activity of the PrP gene promoter in response to scrapie infection.

  16. Identification of an upstream regulatory sequence that mediates the transcription of mox genes in Methylobacterium extorquens AM1.

    PubMed

    Zhang, Meng; FitzGerald, Kelly A; Lidstrom, Mary E

    2005-11-01

    A multiple A-tract sequence has been identified in the promoter regions for the mxaF, pqqA, mxaW, mxbD and mxcQ genes involved in methanol oxidation in Methylobacterium extorquens AM1, a facultative methylotroph. Site-directed mutagenesis was exploited to delete or change this conserved sequence. Promoter-xylE transcriptional fusions were used to assess promoter activity in these mutants. A fiftyfold drop in the XylE activity was observed for the mxaF and pqqA promoters without this sequence, and a five- to sixfold drop in the XylE activity was observed for the mxbD and mxcQ promoters without this sequence. Mutants were generated in the chromosomal copies in which this sequence was either deleted or altered, and these mutants were unable to grow on methanol. When one of these sequences was added to Plac of Escherichia coli, which is a weak constitutive promoter in M. extorquens AM1, the activity increased two- to threefold. These results suggest that this sequence is essential for normal expression of these genes in M. extorquens AM1, and may serve as a general enhancer element for genetic constructs in this bacterium.

  17. Identification of regulatory networks and hub genes controlling soybean seed set and size using RNA sequencing analysis.

    PubMed

    Du, Juan; Wang, Shoudong; He, Cunman; Zhou, Bin; Ruan, Yong-Ling; Shou, Huixia

    2017-04-01

    To understand the gene expression networks controlling soybean seed set and size, transcriptome analyses were performed in three early seed developmental stages, using two genotypes with contrasting seed size. The two-dimensional data set provides a comprehensive and systems-level view on dynamic gene expression networks underpinning soybean seed set and subsequent development. Using pairwise comparisons and weighted gene coexpression network analyses, we identified modules of coexpressed genes and hub genes for each module. Of particular importance are the discoveries of specific modules for the large seed size variety and for seed developmental stages. A large number of candidate regulators for seed size, including those involved in hormonal signaling pathways and transcription factors, were transiently and specifically induced in the early developmental stages. The soybean homologs of a brassinosteroid signaling receptor kinase, a brassinosteroid-signaling kinase, were identified as hub genes operating in the seed coat network in the early seed maturation stage. Overexpression of a candidate seed size regulatory gene, GmCYP78A5, in transgenic soybean resulted in increased seed size and seed weight. Together, these analyses identified a large number of potential key regulators controlling soybean seed set, seed size, and, consequently, yield potential, thereby providing new insights into the molecular networks underlying soybean seed development. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. Exome Sequencing and cis-Regulatory Mapping Identify Mutations in MAK, a Gene Encoding a Regulator of Ciliary Length, as a Cause of Retinitis Pigmentosa

    PubMed Central

    Özgül, Rıza Köksal; Siemiatkowska, Anna M.; Yücel, Didem; Myers, Connie A.; Collin, Rob W.J.; Zonneveld, Marijke N.; Beryozkin, Avigail; Banin, Eyal; Hoyng, Carel B.; van den Born, L. Ingeborgh; Bose, Ron; Shen, Wei; Sharon, Dror; Cremers, Frans P.M.; Klevering, B. Jeroen; den Hollander, Anneke I.; Corbo, Joseph C.

    2011-01-01

    A fundamental challenge in analyzing exome-sequence data is distinguishing pathogenic mutations from background polymorphisms. To address this problem in the context of a genetically heterogeneous disease, retinitis pigmentosa (RP), we devised a candidate-gene prioritization strategy called cis-regulatory mapping that utilizes ChIP-seq data for the photoreceptor transcription factor CRX to rank candidate genes. Exome sequencing combined with this approach identified a homozygous nonsense mutation in male germ cell-associated kinase (MAK) in the single affected member of a consanguineous Turkish family with RP. MAK encodes a cilium-associated mitogen-activated protein kinase whose function is conserved from the ciliated alga, Chlamydomonas reinhardtii, to humans. Mutations in MAK orthologs in mice and other model organisms result in abnormally long cilia and, in mice, rapid photoreceptor degeneration. Subsequent sequence analyses of additional individuals with RP identified five probands with missense mutations in MAK. Two of these mutations alter amino acids that are conserved in all known kinases, and an in vitro kinase assay indicates that these mutations result in a loss of kinase activity. Thus, kinase activity appears to be critical for MAK function in humans. This study highlights a previously underappreciated role for CRX as a direct transcriptional regulator of ciliary genes in photoreceptors. In addition, it demonstrates the effectiveness of CRX-based cis-regulatory mapping in prioritizing candidate genes from exome data and suggests that this strategy should be generally applicable to a range of retinal diseases. PMID:21835304

  19. DNA sequence of Rhizobium trifolii nodulation genes reveals a reiterated and potentially regulatory sequence preceding nodABC and nodFE.

    PubMed Central

    Schofield, P R; Watson, J M

    1986-01-01

    The Rhizobium trifolii nod genes required for host-specific nodulation of clovers are located on 14 kb of Sym (symbiotic) plasmid DNA. Analysis of the nucleotide sequence of a 3.7 kb portion of this region has revealed open reading frames corresponding to the nodABCDEF genes. A DNA sequencing technique, using primer extension from within Tn5, has been used to determine the precise locations of Tn5 mutations within the nod genes and the phenotypes of the corresponding mutants correlate with their mapped locations. The predicted nodA and nodB genes overlap by four nucleotides and the nod F and nodE genes overlap by a single nucleotide, suggesting that translational coupling may ensure the synthesis of equimolar amounts of these gene products. The nodABC and nodFE genes constitute separate transcriptional units and each is preceded by a conserved 76-bp sequence which may be involved in the regulation of expression of these genes. Images PMID:3008100

  20. De novo sequencing and assembly of Centella asiatica leaf transcriptome for mapping of structural, functional and regulatory genes with special reference to secondary metabolism.

    PubMed

    Sangwan, Rajender S; Tripathi, Sandhya; Singh, Jyoti; Narnoliya, Lokesh K; Sangwan, Neelam S

    2013-08-01

    Centella asiatica (L.) Urban is an important medicinal plant and has been used since ancient times in traditional systems of medicine. C. asiatica mainly contains ursane skeleton based triterpenoid sapogenins and saponins predominantly in its leaves. This investigation employed Illumina next generation sequencing (NGS) strategy on a pool of three cDNAs from expanding leaf of C. asiatica and developed an assembled transcriptome sequence resource of the plant. The short transcript reads (STRs) generated and assembled into contigs and singletons, representing majority of the genes expressed in C. asiatica, were termed as 'tentative unique transcripts' (TUTs). The TUT dataset was analyzed with the objectives of (i) development of a transcriptome assembly of C. asiatica, and (ii) classification/characterization of the genes into categories like structural, functional, regulatory etc. based on their function. Overall, 68.49% of the 46,171,131 reads generated in the NGS process could be assembled into a total of 79,041 contigs. Gene ontology and functional annotation of sequences resulted into the identification of genes related to different sets of cellular functions including identification of genes related to primary and secondary metabolism. The wet lab validation of seventeen assembled gene sequences identified to be involved in secondary metabolic pathways and control of reactive oxygen species (ROS) was established by semi-quantitative and real time PCR (qRT-PCR). The validation also included sequencing/size matching of a set of semi-quantitative PCR amplicons with their in silico assembled contig/gene. This confirmed the appropriateness of assembling the reads and contigs. Thus, the present study constitutes the largest report to date on C. asiatica transcriptome based gene resource that may contribute substantially to the understanding of the basal biological functions and biochemical pathways of secondary metabolites as well as the transcriptional regulatory

  1. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  2. Identifying Distal cis-acting Gene-Regulatory Sequences by Expressing BACs Functionalized with loxP-Tn10 Transposons in Zebrafish.

    PubMed

    Chatterjee, Pradeep K; Shakes, Leighcraft A; Wolf, Hope M; Mujalled, Mohammad A; Zhou, Constance; Hatcher, Charles; Norford, Derek C

    2013-06-21

    Bacterial Artificial Chromosomes (BACs) are large pieces of DNA from the chromosomes of organisms propagated faithfully in bacteria as large extra-chromosomal plasmids. Expression of genes contained in BACs can be monitored after functionalizing the BAC DNA with reporter genes and other sequences that allow stable maintenance and propagation of the DNA in the new host organism. The DNA in BACs can be altered within its bacterial host in several ways. Here we discuss one such approach, using Tn10 mini-transposons, to introduce exogenous sequences into BACs for a variety of purposes. The largely random insertions of Tn10 transposons carrying lox sites have been used to position mammalian cell-selectable antibiotic resistance genes, enhancer-traps and inverted repeat ends of the vertebrate transposon Tol2 precisely at the ends of the genomic DNA insert in BACs. These modified BACs are suitable for expression in zebrafish or mouse, and have been used to functionally identify important long-range gene regulatory sequences in both species. Enhancer-trapping using BACs should prove uniquely useful in analyzing multiple discontinuous DNA domains that act in concert to regulate expression of a gene, and is not limited by genome accessibility issues of traditional enhancer-trapping methods.

  3. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans

    PubMed Central

    Khachatoorian, Careen; Judelson, Howard S.

    2015-01-01

    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies. PMID:26716454

  4. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans.

    PubMed

    Poidevin, Laetitia; Andreeva, Kalina; Khachatoorian, Careen; Judelson, Howard S

    2015-01-01

    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies.

  5. Identification and sequence analysis of two regulatory genes involved in anaerobic toluene metabolism by strain T1.

    PubMed Central

    Coschigano, P W; Young, L Y

    1997-01-01

    T1 is a denitrifying bacterium isolated for its ability to grow with toluene serving as the sole carbon source. Mutants of this strain that have defects in the toluene utilization pathway have been isolated and have been separated into classes based on growth phenotypes. A cosmid clone has been isolated by complementing the tutB16 (for toluene utilization) mutation. The complementing gene has been localized to a 3.3-kb DNA fragment. An additional open reading frame upstream of the tutB gene has also been identified and is designated tutC. The nucleotide sequence and the predicted amino acid translation of the 6.4-kb DNA fragment that contains these genes are presented. The tutB and tutC gene products of strain T1 have homology to members of the two-component sensor-regulator family and are proposed to play a role in the regulation of toluene metabolic genes of strain T1. To our knowledge, this is the first published report of the isolation of mutants defective in anaerobic aromatic hydrocarbon degradation. Additionally, we report for the first time the cloning of genes involved in an anaerobic aromatic hydrocarbon degradation pathway. PMID:9023943

  6. Developmental appearance of factors that bind specifically to cis-regulatory sequences of a gene expressed in the sea urchin embryo.

    PubMed

    Calzone, F J; Thézé, N; Thiebaud, P; Hill, R L; Britten, R J; Davidson, E H

    1988-09-01

    Previous gene-transfer experiments have identified a 2500-nucleotide 5' domain of the CyIIIa cytoskeletal actin gene, which contains cis-regulatory sequences that are necessary and sufficient for spatial and temporal control of CyIIIa gene expression during embryogenesis. This gene is activated in late cleavage, exclusively in aboral ectoderm cell lineages. In this study, we focus on interactions demonstrated in vitro between sequences of the regulatory domain and proteins present in crude extracts derived from sea urchin embryo nuclei and from unfertilized eggs. Quantitative gel-shift measurements are utilized to estimate minimum numbers of factor molecules per embryo at 24 hr postfertilization, when the CyIIIa gene is active, at 7 hr, when it is still silent, and in the unfertilized egg. We also estimate the binding affinity preferences (Kr) of the various factors for their respective sites, relative to their affinity for synthetic DNA competitors. At least 14 different specific interactions occur within the regulatory regions, some of which produce multiple DNA-protein complexes. Values of Kr range from approximately 2 x 10(4) to approximately 2 x 10(6) for these factors under the conditions applied. With one exception, the minimum factor prevalences that we measured in the 400-cell 24-hr embryo nuclear extracts fell within the range of 2 x 10(5) to 2 x 10(6) molecules per embryo, i.e., a few hundred to a few thousand molecules per nucleus. Three developmental patterns were observed with respect to factor prevalence: Factors reacting at one site were found in unfertilized egg cytoplasm at about the same level per egg or embryo as in 24-hr embryo nuclei; factors reacting with five other regions of the regulatory domain are not detectable in egg cytoplasm but in 7-hr mid-cleavage-stage embryo, nuclei are already at or close to their concentrations in the 24-hr embryo nuclei; and factors reacting with five additional regions are not detectable in egg cytoplasm and

  7. Analysis of sequences involved in IE2 transactivation of a baculovirus immediate-early gene promoter and identification of a new regulatory motif.

    PubMed

    Shippam-Brett, C E; Willis, L G; Theilmann, D A

    2001-05-01

    Opep-2 is a unique baculovirus early gene that has only been identified in the Orgyia pseudotsugata multiple capsid nucleopolyhedrovirus (OpMNPV). Previous analyses have shown this gene is expressed at very early times post-infection (p.i.) but is shut down by 36-48 h p.i. The promoter of opep-2 therefore, represents a class of early genes that is temporally regulated. In this study, a detailed analysis of the opep-2 promoter is performed to analyze the role individual motifs play in early gene expression. A new 13 base pair regulatory element was identified and shown to be essential in controlling high-level expression of this gene. In addition, mutational analysis revealed that GATA and CACGTG motifs, which have been shown to bind cellular factors in Sf9 and Ld652Y cells, played minor roles in influencing opep-2 expression in the absence of other viral factors. The OpMNPV transactivator IE2 causes a significant activation of the opep-2 promoter. Cotransfection of an extensive number of promoter deletions and mutations did not show any sequence specificity for IE2 transactivation. This is the first detailed analysis of the sequence requirements for IE2 transactivation, and these results suggest that IE2 does not bind directly to specific elements in the opep-2 promoter.

  8. A Distinct Regulatory Sequence Is Essential for the Expression of a Subset of nle Genes in Attaching and Effacing Escherichia coli

    PubMed Central

    García-Angulo, Víctor A.; Martínez-Santos, Verónica I.; Villaseñor, Tomás; Santana, Francisco J.; Huerta-Saquero, Alejandro; Martínez, Luary C.; Jiménez, Rafael; Lara-Ochoa, Cristina; Téllez-Sosa, Juan; Bustamante, Víctor H.

    2012-01-01

    Enteropathogenic Escherichia coli uses a type III secretion system (T3SS), encoded in the locus of enterocyte effacement (LEE) pathogenicity island, to translocate a wide repertoire of effector proteins into the host cell in order to subvert cell signaling cascades and promote bacterial colonization and survival. Genes encoding type III-secreted effectors are located in the LEE and scattered throughout the chromosome. While LEE gene regulation is better understood, the conditions and factors involved in the expression of effectors encoded outside the LEE are just starting to be elucidated. Here, we identified a highly conserved sequence containing a 13-bp inverted repeat (IR), located upstream of a subset of genes coding for different non-LEE-encoded effectors in A/E pathogens. Site-directed mutagenesis and deletion analysis of the nleH1 and nleB2 regulatory regions revealed that this IR is essential for the transcriptional activation of both genes. Growth conditions that favor the expression of LEE genes also facilitate the activation of nleH1 and nleB2; however, their expression is independent of the LEE-encoded positive regulators Ler and GrlA but is repressed by GrlR and the global regulator H-NS. In contrast, GrlA and Ler are required for nleA expression, while H-NS silences it. Consistent with their role in the regulation of nleA, purified Ler and H-NS bound to the regulatory region of nleA upstream of its promoter. This work shows that at least two modes of regulation control the expression of effector genes in attaching and effacing (A/E) pathogens, suggesting that a subset of effector functions may be coordinately expressed in a particular niche or time during infection. PMID:22904277

  9. A distinct regulatory sequence is essential for the expression of a subset of nle genes in attaching and effacing Escherichia coli.

    PubMed

    García-Angulo, Víctor A; Martínez-Santos, Verónica I; Villaseñor, Tomás; Santana, Francisco J; Huerta-Saquero, Alejandro; Martínez, Luary C; Jiménez, Rafael; Lara-Ochoa, Cristina; Téllez-Sosa, Juan; Bustamante, Víctor H; Puente, José L

    2012-10-01

    Enteropathogenic Escherichia coli uses a type III secretion system (T3SS), encoded in the locus of enterocyte effacement (LEE) pathogenicity island, to translocate a wide repertoire of effector proteins into the host cell in order to subvert cell signaling cascades and promote bacterial colonization and survival. Genes encoding type III-secreted effectors are located in the LEE and scattered throughout the chromosome. While LEE gene regulation is better understood, the conditions and factors involved in the expression of effectors encoded outside the LEE are just starting to be elucidated. Here, we identified a highly conserved sequence containing a 13-bp inverted repeat (IR), located upstream of a subset of genes coding for different non-LEE-encoded effectors in A/E pathogens. Site-directed mutagenesis and deletion analysis of the nleH1 and nleB2 regulatory regions revealed that this IR is essential for the transcriptional activation of both genes. Growth conditions that favor the expression of LEE genes also facilitate the activation of nleH1 and nleB2; however, their expression is independent of the LEE-encoded positive regulators Ler and GrlA but is repressed by GrlR and the global regulator H-NS. In contrast, GrlA and Ler are required for nleA expression, while H-NS silences it. Consistent with their role in the regulation of nleA, purified Ler and H-NS bound to the regulatory region of nleA upstream of its promoter. This work shows that at least two modes of regulation control the expression of effector genes in attaching and effacing (A/E) pathogens, suggesting that a subset of effector functions may be coordinately expressed in a particular niche or time during infection.

  10. Identification of DVA interneuron regulatory sequences in Caenorhabditis elegans.

    PubMed

    Puckett Robinson, Carmie; Schwarz, Erich M; Sternberg, Paul W

    2013-01-01

    The identity of each neuron is determined by the expression of a distinct group of genes comprising its terminal gene battery. The regulatory sequences that control the expression of such terminal gene batteries in individual neurons is largely unknown. The existence of a complete genome sequence for C. elegans and draft genomes of other nematodes let us use comparative genomics to identify regulatory sequences directing expression in the DVA interneuron. Using phylogenetic comparisons of multiple Caenorhabditis species, we identified conserved non-coding sequences in 3 of 10 genes (fax-1, nmr-1, and twk-16) that direct expression of reporter transgenes in DVA and other neurons. The conserved region and flanking sequences in an 85-bp intronic region of the twk-16 gene directs highly restricted expression in DVA. Mutagenesis of this 85 bp region shows that it has at least four regions. The central 53 bp region contains a 29 bp region that represses expression and a 24 bp region that drives broad neuronal expression. Two short flanking regions restrict expression of the twk-16 gene to DVA. A shared GA-rich motif was identified in three of these genes but had opposite effects on expression when mutated in the nmr-1 and twk-16 DVA regulatory elements. We identified by multi-species conservation regulatory regions within three genes that direct expression in the DVA neuron. We identified four contiguous regions of sequence of the twk-16 gene enhancer with positive and negative effects on expression, which combined to restrict expression to the DVA neuron. For this neuron a single binding site may thus not achieve sufficient specificity for cell specific expression. One of the positive elements, an 8-bp sequence required for expression was identified in silico by sequence comparisons of seven nematode species, demonstrating the potential resolution of expanded multi-species phylogenetic comparisons.

  11. Identification of DVA Interneuron Regulatory Sequences in Caenorhabditis elegans

    PubMed Central

    Puckett Robinson, Carmie; Schwarz, Erich M.; Sternberg, Paul W.

    2013-01-01

    Background The identity of each neuron is determined by the expression of a distinct group of genes comprising its terminal gene battery. The regulatory sequences that control the expression of such terminal gene batteries in individual neurons is largely unknown. The existence of a complete genome sequence for C. elegans and draft genomes of other nematodes let us use comparative genomics to identify regulatory sequences directing expression in the DVA interneuron. Methodology/Principal Findings Using phylogenetic comparisons of multiple Caenorhabditis species, we identified conserved non-coding sequences in 3 of 10 genes (fax-1, nmr-1, and twk-16) that direct expression of reporter transgenes in DVA and other neurons. The conserved region and flanking sequences in an 85-bp intronic region of the twk-16 gene directs highly restricted expression in DVA. Mutagenesis of this 85 bp region shows that it has at least four regions. The central 53 bp region contains a 29 bp region that represses expression and a 24 bp region that drives broad neuronal expression. Two short flanking regions restrict expression of the twk-16 gene to DVA. A shared GA-rich motif was identified in three of these genes but had opposite effects on expression when mutated in the nmr-1 and twk-16 DVA regulatory elements. Conclusions/Significance We identified by multi-species conservation regulatory regions within three genes that direct expression in the DVA neuron. We identified four contiguous regions of sequence of the twk-16 gene enhancer with positive and negative effects on expression, which combined to restrict expression to the DVA neuron. For this neuron a single binding site may thus not achieve sufficient specificity for cell specific expression. One of the positive elements, an 8-bp sequence required for expression was identified in silico by sequence comparisons of seven nematode species, demonstrating the potential resolution of expanded multi-species phylogenetic comparisons. PMID

  12. Vision from next generation sequencing: multi-dimensional genome-wide analysis for producing gene regulatory networks underlying retinal development, aging and disease.

    PubMed

    Yang, Hyun-Jin; Ratnapriya, Rinki; Cogliati, Tiziana; Kim, Jung-Woong; Swaroop, Anand

    2015-05-01

    Genomics and genetics have invaded all aspects of biology and medicine, opening uncharted territory for scientific exploration. The definition of "gene" itself has become ambiguous, and the central dogma is continuously being revised and expanded. Computational biology and computational medicine are no longer intellectual domains of the chosen few. Next generation sequencing (NGS) technology, together with novel methods of pattern recognition and network analyses, has revolutionized the way we think about fundamental biological mechanisms and cellular pathways. In this review, we discuss NGS-based genome-wide approaches that can provide deeper insights into retinal development, aging and disease pathogenesis. We first focus on gene regulatory networks (GRNs) that govern the differentiation of retinal photoreceptors and modulate adaptive response during aging. Then, we discuss NGS technology in the context of retinal disease and develop a vision for therapies based on network biology. We should emphasize that basic strategies for network construction and analyses can be transported to any tissue or cell type. We believe that specific and uniform guidelines are required for generation of genome, transcriptome and epigenome data to facilitate comparative analysis and integration of multi-dimensional data sets, and for constructing networks underlying complex biological processes. As cellular homeostasis and organismal survival are dependent on gene-gene and gene-environment interactions, we believe that network-based biology will provide the foundation for deciphering disease mechanisms and discovering novel drug targets for retinal neurodegenerative diseases. Published by Elsevier Ltd.

  13. Vision from next generation sequencing: Multi-dimensional genome-wide analysis for producing gene regulatory networks underlying retinal development, aging and disease

    PubMed Central

    Yang, Hyun-Jin; Ratnapriya, Rinki; Cogliati, Tiziana; Kim, Jung-Woong; Swaroop, Anand

    2015-01-01

    Genomics and genetics have invaded all aspects of biology and medicine, opening uncharted territory for scientific exploration. The definition of “gene” itself has become ambiguous, and the central dogma is continuously being revised and expanded. Computational biology and computational medicine are no longer intellectual domains of the chosen few. Next generation sequencing (NGS) technology, together with novel methods of pattern recognition and network analyses, has revolutionized the way we think about fundamental biological mechanisms and cellular pathways. In this review, we discuss NGS-based genome-wide approaches that can provide deeper insights into retinal development, aging and disease pathogenesis. We first focus on gene regulatory networks (GRNs) that govern the differentiation of retinal photoreceptors and modulate adaptive response during aging. Then, we discuss NGS technology in the context of retinal disease and develop a vision for therapies based on network biology. We should emphasize that basic strategies for network construction and analyses can be transported to any tissue or cell type. We believe that specific and uniform guidelines are required for generation of genome, transcriptome and epigenome data to facilitate comparative analysis and integration of multi-dimensional data sets, and for constructing networks underlying complex biological processes. As cellular homeostasis and organismal survival are dependent on gene-gene and gene-environment interactions, we believe that network-based biology will provide the foundation for deciphering disease mechanisms and discovering novel drug targets for retinal neurodegenerative diseases. PMID:25668385

  14. Nucleotide sequence of the Escherichia coli regulatory gene mprA and construction and characterization of mprA-deficient mutants.

    PubMed Central

    del Castillo, I; González-Pastor, J E; San Millán, J L; Moreno, F

    1991-01-01

    In high copy number, the Escherichia coli mprA gene reduces the synthesis of peptide microcins B17 and C7 (MccB17 and MccC7) and blocks the osmoinduction of the proU operon at the transcriptional level. mprA has been sequenced and shown to encode a polypeptide of 176 amino acids (Mr, 20,563). Insertion and deletion mutant mprA alleles were constructed and then transferred to the chromosome by allelic replacement. In these mutants, expression of two mcb-lacZ fusions was fivefold derepressed, indicating a negative regulatory role of mprA on the mcb operon (MccB17). In contrast, no effect of the MprA- mutations on the expression of mcc operon (MccC7) or on the osmoinduction of proU operon was observed. PMID:1840583

  15. A site-specific, single-copy transgenesis strategy to identify 5' regulatory sequences of the mouse testis-determining gene Sry.

    PubMed

    Quinn, Alexander; Kashimada, Kenichi; Davidson, Tara-Lynne; Ng, Ee Ting; Chawengsaksophak, Kallayanee; Bowles, Josephine; Koopman, Peter

    2014-01-01

    The Y-chromosomal gene SRY acts as the primary trigger for male sex determination in mammalian embryos. Correct regulation of SRY is critical: aberrant timing or level of Sry expression is known to disrupt testis development in mice and we hypothesize that mutations that affect regulation of human SRY may account for some of the many cases of XY gonadal dysgenesis that currently remain unexplained. However, the cis-sequences involved in regulation of Sry have not been identified, precluding a test of this hypothesis. Here, we used a transgenic mouse approach aimed at identifying mouse Sry 5' flanking regulatory sequences within 8 kb of the Sry transcription start site (TSS). To avoid problems associated with conventional pronuclear injection of transgenes, we used a published strategy designed to yield single-copy transgene integration at a defined, transcriptionally open, autosomal locus, Col1a1. None of the Sry transgenes tested was expressed at levels compatible with activation of Sox9 or XX sex reversal. Our findings indicate either that the Col1a1 locus does not provide an appropriate context for the correct expression of Sry transgenes, or that the cis-sequences required for Sry expression in the developing gonads lie beyond 8 kb 5' of the TSS.

  16. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  17. [Gene and gene sequence patenting].

    PubMed

    Bergel, S D

    1998-01-01

    According to the author, the patenting of elements isolated or copied from the human body boils down to the issue of genes and gene sequences. He describes the current situation from the comparative law standpoint (U.S. and Spanish law mainly) and then esamines the biotechnology industry's position.

  18. RSAT 2015: Regulatory Sequence Analysis Tools

    PubMed Central

    Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A.; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M.; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

    2015-01-01

    RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/. PMID:25904632

  19. RSAT 2015: Regulatory Sequence Analysis Tools.

    PubMed

    Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

    2015-07-01

    RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/.

  20. Comparison of loline alkaloid gene clusters across fungal endophytes: predicting the co-regulatory sequence motifs and the evolutionary history.

    PubMed

    Kutil, Brandi L; Greenwald, Charles; Liu, Gang; Spiering, Martin J; Schardl, Christopher L; Wilkinson, Heather H

    2007-10-01

    LOL, a fungal secondary metabolite gene cluster found in Epichloë and Neotyphodium species, is responsible for production of insecticidal loline alkaloids. To analyze the genetic architecture and to predict the evolutionary history of LOL, we compared five clusters from four fungal species (single clusters from Epichloë festucae, Neotyphodium sp. PauTG-1, Neotyphodium coenophialum, and two clusters we previously characterized in Neotyphodium uncinatum). Using PhyloCon to compare putative lol gene promoter regions, we have identified four motifs conserved across the lol genes in all five clusters. Each motif has significant similarity to known fungal transcription factor binding sites in the TRANSFAC database. Conservation of these motifs is further support for the hypothesis that the lol genes are co-regulated. Interestingly, the history of asexual Neotyphodium spp. includes multiple interspecific hybridization events. Comparing clusters from three Neotyphodium species and E. festucae allowed us to determine which Epichloë ancestors are the most likely contributors of LOL in these asexual species. For example, while no present day Epichloë typhina isolates are known to produce lolines, our data support the hypothesis that the E. typhina ancestor(s) of three asexual endophyte species contained a LOL gene cluster. Thus, these data support a model of evolution in which the polymorphism in loline alkaloid production phenotypes among endophyte species is likely due to the loss of the trait over time.

  1. Therapeutic gene editing: delivery and regulatory perspectives

    PubMed Central

    Shim, Gayong; Kim, Dongyoon; Park, Gyu Thae; Jin, Hyerim; Suh, Soo-Kyung; Oh, Yu-Kyoung

    2017-01-01

    Gene-editing technology is an emerging therapeutic modality for manipulating the eukaryotic genome by using target-sequence-specific engineered nucleases. Because of the exceptional advantages that gene-editing technology offers in facilitating the accurate correction of sequences in a genome, gene editing-based therapy is being aggressively developed as a next-generation therapeutic approach to treat a wide range of diseases. However, strategies for precise engineering and delivery of gene-editing nucleases, including zinc finger nucleases, transcription activator-like effector nuclease, and CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats-associated nuclease Cas9), present major obstacles to the development of gene-editing therapies, as with other gene-targeting therapeutics. Currently, viral and non-viral vectors are being studied for the delivery of these nucleases into cells in the form of DNA, mRNA, or proteins. Clinical trials are already ongoing, and in vivo studies are actively investigating the applicability of CRISPR/Cas9 techniques. However, the concept of correcting the genome poses major concerns from a regulatory perspective, especially in terms of safety. This review addresses current research trends and delivery strategies for gene editing-based therapeutics in non-clinical and clinical settings and considers the associated regulatory issues. PMID:28392568

  2. Therapeutic gene editing: delivery and regulatory perspectives.

    PubMed

    Shim, Gayong; Kim, Dongyoon; Park, Gyu Thae; Jin, Hyerim; Suh, Soo-Kyung; Oh, Yu-Kyoung

    2017-04-10

    Gene-editing technology is an emerging therapeutic modality for manipulating the eukaryotic genome by using target-sequence-specific engineered nucleases. Because of the exceptional advantages that gene-editing technology offers in facilitating the accurate correction of sequences in a genome, gene editing-based therapy is being aggressively developed as a next-generation therapeutic approach to treat a wide range of diseases. However, strategies for precise engineering and delivery of gene-editing nucleases, including zinc finger nucleases, transcription activator-like effector nuclease, and CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats-associated nuclease Cas9), present major obstacles to the development of gene-editing therapies, as with other gene-targeting therapeutics. Currently, viral and non-viral vectors are being studied for the delivery of these nucleases into cells in the form of DNA, mRNA, or proteins. Clinical trials are already ongoing, and in vivo studies are actively investigating the applicability of CRISPR/Cas9 techniques. However, the concept of correcting the genome poses major concerns from a regulatory perspective, especially in terms of safety. This review addresses current research trends and delivery strategies for gene editing-based therapeutics in non-clinical and clinical settings and considers the associated regulatory issues.

  3. Plant Evolution: Evolving Antagonistic Gene Regulatory Networks.

    PubMed

    Cooper, Endymion D

    2016-06-20

    Developing a structurally complex phenotype requires a complex regulatory network. A new study shows how gene duplication provides a potential source of antagonistic interactions, an important component of gene regulatory networks.

  4. RSAT 2011: regulatory sequence analysis tools

    PubMed Central

    Thomas-Chollier, Morgane; Defrance, Matthieu; Medina-Rivera, Alejandra; Sand, Olivier; Herrmann, Carl; Thieffry, Denis

    2011-01-01

    RSAT (Regulatory Sequence Analysis Tools) comprises a wide collection of modular tools for the detection of cis-regulatory elements in genome sequences. Thirteen new programs have been added to the 30 described in the 2008 NAR Web Software Issue, including an automated sequence retrieval from EnsEMBL (retrieve-ensembl-seq), two novel motif discovery algorithms (oligo-diff and info-gibbs), a 100-times faster version of matrix-scan enabling the scanning of genome-scale sequence sets, and a series of facilities for random model generation and statistical evaluation (random-genome-fragments, random-motifs, random-sites, implant-sites, sequence-probability, permute-matrix). Our most recent work also focused on motif comparison (compare-matrices) and evaluation of motif quality (matrix-quality) by combining theoretical and empirical measures to assess the predictive capability of position-specific scoring matrices. To process large collections of peak sequences obtained from ChIP-seq or related technologies, RSAT provides a new program (peak-motifs) that combines several efficient motif discovery algorithms to predict transcription factor binding motifs, match them against motif databases and predict their binding sites. Availability (web site, stand-alone programs and SOAP/WSDL (Simple Object Access Protocol/Web Services Description Language) web services): http://rsat.ulb.ac.be/rsat/. PMID:21715389

  5. Analysis of transcriptional and upstream regulatory sequence activity of two environmental stress-inducible genes, NBS-Str1 and BLEC-Str8, of rice.

    PubMed

    Ray, Swatismita; Kapoor, Sanjay; Tyagi, Akhilesh K

    2012-04-01

    Two abiotic stress-inducible upstream regulatory sequences (URSs) from rice have been identified and functionally characterized in rice. NBS-Str1 and BLEC-Str8 genes have been identified, by analysing the transcriptome data of cold, salt and desiccation stress-treated 7-day-old rice (Oryza sativa L. var. IR64) seedling, to be preferentially responsive to desiccation and salt stress, respectively. NBS-Str1 and BLEC-Str8 genes code for putative NBS (nucleotide binding site)-LRR (leucine rich repeat) and β-lectin domain protein, respectively. NBS-Str1 URS is induced in root tissue, preferentially in vascular bundle, during 3 and 24 h of desiccation stress condition in transgenic 7-day-old rice seedling. In mature transgenic plants, this URS shows induction in root and shoot tissue under desiccation stress as well as under prolonged (1 and 2 day) salt stress. BLEC-Str8 URS shows basal activity under un-stressed condition, however, it is inducible under salt stress condition in both root and leaf tissues in young seedling and mature plants. Activity of BLEC-Str8 URS has been found to be vascular tissue preferential, however, under salt stress condition its activity is also found in the mesophyll tissue. NBS-Str1 and BLEC-Str8 URSs are inducible by heavy metal, copper and manganese. Interestingly, both the URSs have been found to be non responsive to ABA treatment, implying them to be part of ABA-independent abiotic stress response pathway. These URSs could prove useful for expressing a transgene in a stress responsive manner for development of stress tolerant transgenic systems.

  6. Pleiotropy constrains the evolution of protein but not regulatory sequences in a transcription regulatory network influencing complex social behaviors

    PubMed Central

    Molodtsova, Daria; Harpur, Brock A.; Kent, Clement F.; Seevananthan, Kajendra; Zayed, Amro

    2014-01-01

    It is increasingly apparent that genes and networks that influence complex behavior are evolutionary conserved, which is paradoxical considering that behavior is labile over evolutionary timescales. How does adaptive change in behavior arise if behavior is controlled by conserved, pleiotropic, and likely evolutionary constrained genes? Pleiotropy and connectedness are known to constrain the general rate of protein evolution, prompting some to suggest that the evolution of complex traits, including behavior, is fuelled by regulatory sequence evolution. However, we seldom have data on the strength of selection on mutations in coding and regulatory sequences, and this hinders our ability to study how pleiotropy influences coding and regulatory sequence evolution. Here we use population genomics to estimate the strength of selection on coding and regulatory mutations for a transcriptional regulatory network that influences complex behavior of honey bees. We found that replacement mutations in highly connected transcription factors and target genes experience significantly stronger negative selection relative to weakly connected transcription factors and targets. Adaptively evolving proteins were significantly more likely to reside at the periphery of the regulatory network, while proteins with signs of negative selection were near the core of the network. Interestingly, connectedness and network structure had minimal influence on the strength of selection on putative regulatory sequences for both transcription factors and their targets. Our study indicates that adaptive evolution of complex behavior can arise because of positive selection on protein-coding mutations in peripheral genes, and on regulatory sequence mutations in both transcription factors and their targets throughout the network. PMID:25566318

  7. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  8. Interrogating transcriptional regulatory sequences in Tol2-mediated Xenopus transgenics.

    PubMed

    Loots, Gabriela G; Bergmann, Anne; Hum, Nicholas R; Oldenburg, Catherine E; Wills, Andrea E; Hu, Na; Ovcharenko, Ivan; Harland, Richard M

    2013-01-01

    Identifying gene regulatory elements and their target genes in vertebrates remains a significant challenge. It is now recognized that transcriptional regulatory sequences are critical in orchestrating dynamic controls of tissue-specific gene expression during vertebrate development and in adult tissues, and that these elements can be positioned at great distances in relation to the promoters of the genes they control. While significant progress has been made in mapping DNA binding regions by combining chromatin immunoprecipitation and next generation sequencing, functional validation remains a limiting step in improving our ability to correlate in silico predictions with biological function. We recently developed a computational method that synergistically combines genome-wide gene-expression profiling, vertebrate genome comparisons, and transcription factor binding-site analysis to predict tissue-specific enhancers in the human genome. We applied this method to 270 genes highly expressed in skeletal muscle and predicted 190 putative cis-regulatory modules. Furthermore, we optimized Tol2 transgenic constructs in Xenopus laevis to interrogate 20 of these elements for their ability to function as skeletal muscle-specific transcriptional enhancers during embryonic development. We found 45% of these elements expressed only in the fast muscle fibers that are oriented in highly organized chevrons in the Xenopus laevis tadpole. Transcription factor binding site analysis identified >2 Mef2/MyoD sites within ~200 bp regions in 6 of the validated enhancers, and systematic mutagenesis of these sites revealed that they are critical for the enhancer function. The data described herein introduces a new reporter system suitable for interrogating tissue-specific cis-regulatory elements which allows monitoring of enhancer activity in real time, throughout early stages of embryonic development, in Xenopus.

  9. Transcriptome sequencing from diverse human populations reveals differentiated regulatory architecture.

    PubMed

    Martin, Alicia R; Costa, Helio A; Lappalainen, Tuuli; Henn, Brenna M; Kidd, Jeffrey M; Yee, Muh-Ching; Grubert, Fabian; Cann, Howard M; Snyder, Michael; Montgomery, Stephen B; Bustamante, Carlos D

    2014-08-01

    Large-scale sequencing efforts have documented extensive genetic variation within the human genome. However, our understanding of the origins, global distribution, and functional consequences of this variation is far from complete. While regulatory variation influencing gene expression has been studied within a handful of populations, the breadth of transcriptome differences across diverse human populations has not been systematically analyzed. To better understand the spectrum of gene expression variation, alternative splicing, and the population genetics of regulatory variation in humans, we have sequenced the genomes, exomes, and transcriptomes of EBV transformed lymphoblastoid cell lines derived from 45 individuals in the Human Genome Diversity Panel (HGDP). The populations sampled span the geographic breadth of human migration history and include Namibian San, Mbuti Pygmies of the Democratic Republic of Congo, Algerian Mozabites, Pathan of Pakistan, Cambodians of East Asia, Yakut of Siberia, and Mayans of Mexico. We discover that approximately 25.0% of the variation in gene expression found amongst individuals can be attributed to population differences. However, we find few genes that are systematically differentially expressed among populations. Of this population-specific variation, 75.5% is due to expression rather than splicing variability, and we find few genes with strong evidence for differential splicing across populations. Allelic expression analyses indicate that previously mapped common regulatory variants identified in eight populations from the International Haplotype Map Phase 3 project have similar effects in our seven sampled HGDP populations, suggesting that the cellular effects of common variants are shared across diverse populations. Together, these results provide a resource for studies analyzing functional differences across populations by estimating the degree of shared gene expression, alternative splicing, and regulatory genetics

  10. Interrogating Transcriptional Regulatory Sequences in Tol2-Mediated Xenopus Transgenics

    PubMed Central

    Loots, Gabriela G.; Bergmann, Anne; Hum, Nicholas R.; Oldenburg, Catherine E.; Wills, Andrea E.; Hu, Na; Ovcharenko, Ivan; Harland, Richard M.

    2013-01-01

    Identifying gene regulatory elements and their target genes in vertebrates remains a significant challenge. It is now recognized that transcriptional regulatory sequences are critical in orchestrating dynamic controls of tissue-specific gene expression during vertebrate development and in adult tissues, and that these elements can be positioned at great distances in relation to the promoters of the genes they control. While significant progress has been made in mapping DNA binding regions by combining chromatin immunoprecipitation and next generation sequencing, functional validation remains a limiting step in improving our ability to correlate in silico predictions with biological function. We recently developed a computational method that synergistically combines genome-wide gene-expression profiling, vertebrate genome comparisons, and transcription factor binding-site analysis to predict tissue-specific enhancers in the human genome. We applied this method to 270 genes highly expressed in skeletal muscle and predicted 190 putative cis-regulatory modules. Furthermore, we optimized Tol2 transgenic constructs in Xenopus laevis to interrogate 20 of these elements for their ability to function as skeletal muscle-specific transcriptional enhancers during embryonic development. We found 45% of these elements expressed only in the fast muscle fibers that are oriented in highly organized chevrons in the Xenopus laevis tadpole. Transcription factor binding site analysis identified >2 Mef2/MyoD sites within ∼200 bp regions in 6 of the validated enhancers, and systematic mutagenesis of these sites revealed that they are critical for the enhancer function. The data described herein introduces a new reporter system suitable for interrogating tissue-specific cis-regulatory elements which allows monitoring of enhancer activity in real time, throughout early stages of embryonic development, in Xenopus. PMID:23874664

  11. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  12. Evolutionary conservation of regulatory elements in vertebrate Hox gene clusters.

    PubMed

    Santini, Simona; Boore, Jeffrey L; Meyer, Axel

    2003-06-01

    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aalpha or Abeta duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes.

  13. Evolutionary Conservation of Regulatory Elements in Vertebrate Hox Gene Clusters

    PubMed Central

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-01-01

    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aα or Aβ duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes. PMID:12799348

  14. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  15. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.

    PubMed

    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L

    2013-10-01

    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  16. An internal regulatory element controls troponin I gene expression

    SciTech Connect

    Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F. . Dept. of Biological Sciences)

    1989-04-01

    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.

  17. On attractors in gene regulatory systems

    NASA Astrophysics Data System (ADS)

    Brokan, E.; Sadyrbaev, F. Zh.

    2017-02-01

    We describe attracting sets for differential systems appearing in mathematical models of gene regulatory systems. The relation of elements in such systems can be described by regulatory matrices containing elements -1, 0 or 1 corresponding to inhibition, no relation or activation respectively. Four types of regulatory matrices are considered. The respective examples are discussed and the attractive sets are described.

  18. Characterization of DNA sequences that mediate nuclear protein binding to the regulatory region of the Pisum sativum (pea) chlorophyl a/b binding protein gene AB80: identification of a repeated heptamer motif.

    PubMed

    Argüello, G; García-Hernández, E; Sánchez, M; Gariglio, P; Herrera-Estrella, L; Simpson, J

    1992-05-01

    Two protein factors binding to the regulatory region of the pea chlorophyl a/b binding protein gene AB80 have been identified. One of these factors is found only in green tissue but not in etiolated or root tissue. The second factor (denominated ABF-2) binds to a DNA sequence element that contains a direct heptamer repeat TCTCAAA. It was found that presence of both of the repeats is essential for binding. ABF-2 is present in both green and etiolated tissue and in roots and factors analogous to ABF-2 are present in several plant species. Computer analysis showed that the TCTCAAA motif is present in the regulatory region of several plant genes.

  19. Regulatory genes in the ancestral chordate genomes.

    PubMed

    Satou, Yutaka; Wada, Shuichi; Sasakura, Yasunori; Satoh, Nori

    2008-12-01

    Changes or innovations in gene regulatory networks for the developmental program in the ancestral chordate genome appear to be a major component in the evolutionary process in which tadpole-type larvae, a unique characteristic of chordates, arose. These alterations may include new genetic interactions as well as the acquisition of new regulatory genes. Previous analyses of the Ciona genome revealed that many genes may have emerged after the divergence of the tunicate and vertebrate lineages. In this paper, we examined this possibility by examining a second non-vertebrate chordate genome. We conclude from this analysis that the ancient chordate included almost the same repertory of regulatory genes, but less redundancy than extant vertebrates, and that approximately 10% of vertebrate regulatory genes were innovated after the emergence of vertebrates. Thus, refined regulatory networks arose during vertebrate evolution mainly as preexisting regulatory genes multiplied rather than by generating new regulatory genes. The inferred regulatory gene sets of the ancestral chordate would be an important foundation for understanding how tadpole-type larvae, a unique characteristic of chordates, evolved.

  20. Sequence and expression of GLN3, a positive nitrogen regulatory gene of Saccharomyces cerevisiae encoding a protein with a putative zinc finger DNA-binding domain.

    PubMed Central

    Minehart, P L; Magasanik, B

    1991-01-01

    The GLN3 gene of Saccharomyces cerevisiae is required for the activation of transcription of a number of genes in response to the replacement of glutamine by glutamate as source of nitrogen. We cloned the GLN3 gene and constructed null alleles by gene disruption. GLN3 is not essential for growth, but increased copies of GLN3 lead to a drastic decrease in growth rate. The complete nucleotide sequence of the GLN3 gene was determined, revealing one open reading frame encoding a polypeptide of 730 amino acids, with a molecular weight of approximately 80,000. The GLN3 protein contains a single putative Cys2/Cys2 zinc finger which has homology to the Neurospora crassa NIT2 protein, the Aspergillus nidulans AREA protein, and the erythroid-specific transcription factor GATA-1. Immunoprecipitation experiments indicated that the GLN3 protein binds the nitrogen upstream activation sequence of GLN1, the gene encoding glutamine synthetase. Neither control of transcription nor control of initiation of translation of GLN3 is important for regulation in response to glutamine availability. Images PMID:1682800

  1. Evolving Robust Gene Regulatory Networks

    PubMed Central

    Noman, Nasimul; Monjo, Taku; Moscato, Pablo; Iba, Hitoshi

    2015-01-01

    Design and implementation of robust network modules is essential for construction of complex biological systems through hierarchical assembly of ‘parts’ and ‘devices’. The robustness of gene regulatory networks (GRNs) is ascribed chiefly to the underlying topology. The automatic designing capability of GRN topology that can exhibit robust behavior can dramatically change the current practice in synthetic biology. A recent study shows that Darwinian evolution can gradually develop higher topological robustness. Subsequently, this work presents an evolutionary algorithm that simulates natural evolution in silico, for identifying network topologies that are robust to perturbations. We present a Monte Carlo based method for quantifying topological robustness and designed a fitness approximation approach for efficient calculation of topological robustness which is computationally very intensive. The proposed framework was verified using two classic GRN behaviors: oscillation and bistability, although the framework is generalized for evolving other types of responses. The algorithm identified robust GRN architectures which were verified using different analysis and comparison. Analysis of the results also shed light on the relationship among robustness, cooperativity and complexity. This study also shows that nature has already evolved very robust architectures for its crucial systems; hence simulation of this natural process can be very valuable for designing robust biological systems. PMID:25616055

  2. Modeling of hysteresis in gene regulatory networks.

    PubMed

    Hu, J; Qin, K R; Xiang, C; Lee, T H

    2012-08-01

    Hysteresis, observed in many gene regulatory networks, has a pivotal impact on biological systems, which enhances the robustness of cell functions. In this paper, a general model is proposed to describe the hysteretic gene regulatory network by combining the hysteresis component and the transient dynamics. The Bouc-Wen hysteresis model is modified to describe the hysteresis component in the mammalian gene regulatory networks. Rigorous mathematical analysis on the dynamical properties of the model is presented to ensure the bounded-input-bounded-output (BIBO) stability and demonstrates that the original Bouc-Wen model can only generate a clockwise hysteresis loop while the modified model can describe both clockwise and counter clockwise hysteresis loops. Simulation studies have shown that the hysteresis loops from our model are consistent with the experimental observations in three mammalian gene regulatory networks and two E.coli gene regulatory networks, which demonstrate the ability and accuracy of the mathematical model to emulate natural gene expression behavior with hysteresis. A comparison study has also been conducted to show that this model fits the experiment data significantly better than previous ones in the literature. The successful modeling of the hysteresis in all the five hysteretic gene regulatory networks suggests that the new model has the potential to be a unified framework for modeling hysteresis in gene regulatory networks and provide better understanding of the general mechanism that drives the hysteretic function.

  3. The complete genome sequence of Corynebacterium pseudotuberculosis FRC41 isolated from a 12-year-old girl with necrotizing lymphadenitis reveals insights into gene-regulatory networks contributing to virulence

    PubMed Central

    2010-01-01

    Background Corynebacterium pseudotuberculosis is generally regarded as an important animal pathogen that rarely infects humans. Clinical strains are occasionally recovered from human cases of lymphadenitis, such as C. pseudotuberculosis FRC41 that was isolated from the inguinal lymph node of a 12-year-old girl with necrotizing lymphadenitis. To detect potential virulence factors and corresponding gene-regulatory networks in this human isolate, the genome sequence of C. pseudotuberculosis FCR41 was determined by pyrosequencing and functionally annotated. Results Sequencing and assembly of the C. pseudotuberculosis FRC41 genome yielded a circular chromosome with a size of 2,337,913 bp and a mean G+C content of 52.2%. Specific gene sets associated with iron and zinc homeostasis were detected among the 2,110 predicted protein-coding regions and integrated into a gene-regulatory network that is linked with both the central metabolism and the oxidative stress response of FRC41. Two gene clusters encode proteins involved in the sortase-mediated polymerization of adhesive pili that can probably mediate the adherence to host tissue to facilitate additional ligand-receptor interactions and the delivery of virulence factors. The prominent virulence factors phospholipase D (Pld) and corynebacterial protease CP40 are encoded in the genome of this human isolate. The genome annotation revealed additional serine proteases, neuraminidase H, nitric oxide reductase, an invasion-associated protein, and acyl-CoA carboxylase subunits involved in mycolic acid biosynthesis as potential virulence factors. The cAMP-sensing transcription regulator GlxR plays a key role in controlling the expression of several genes contributing to virulence. Conclusion The functional data deduced from the genome sequencing and the extended knowledge of virulence factors indicate that the human isolate C. pseudotuberculosis FRC41 is equipped with a distinct gene set promoting its survival under unfavorable

  4. Definition of a GC-rich motif as regulatory sequence of the human IL-3 gene: coordinate regulation of the IL-3 gene by CLE2/GC box of the GM-CSF gene in T cell activation.

    PubMed

    Nishida, J; Yoshida, M; Arai, K; Yokota, T

    1991-03-01

    The human IL-3 gene, located on chromosome 5, contains several cis-acting DNA sequences, i.e. CLE (conserved lymphokine element) and a GC-rich region, similar to the GM-CSF gene. To investigate the role of these elements, the 5' flanking region of the IL-3 gene was attached to a bacterial chloramphenicol acetyltransferase (CAT) gene. The fusion plasmids were analyzed by an in vitro transcription system using Jurkat cell nuclear extract prepared from cells stimulated with phorbol-12-myristate-13-acetate and calcium ionophore (PMA/A23187), introduced into Jurkat cells, expressed transiently, and stimulated by co-transfection of human T cell leukemia virus type I (HTLV-I) encoded transactivator, p40tax. The GC-rich region enhanced TATA-dependent transcription in the in vitro transcription system and also strongly responded to p40tax stimulation in the in vivo cotransfection assay. Using this GC-rich region as a probe, we identified a constitutive DNA-protein complex, alpha, whose binding specificity correlates with transcription activity. However, this element is not sufficient for the expression of the IL-3 gene in response to T cell activation signals (PMA/A23187) and no sequence was found within the IL-3 gene which mediates the response to PMA/A23187. The enhancer sequence which responds to T cell activation signals may be located outside the IL-3 gene and may be shared by other lymphokines, possibly by GM-CSF. We propose that the GM-CSF enhancer (CLE2/GC box) which mediates the response to T cell activation signals may stimulate the expression of the IL-3 gene.

  5. Major histocompatibility class I gene transcription in thyrocytes: a series of interacting regulatory DNA sequence elements mediate thyrotropin/cyclic adenosine 3',5'-monophosphate repression.

    PubMed

    Kirshner, S; Palmer, L; Bodor, J; Saji, M; Kohn, L D; Singer, D S

    2000-01-01

    In response to TSH, thyroid cells decrease major histocompatibility (MHC) class I expression and transcription, providing an excellent model for studying the dynamic modulation of transcription of MHC class I genes. Here we show that protein kinase A (PKA), a downstream effector of the TSH/cAMP pathway, reproduces the effects of TSH in repressing class I transcription. PKA/cAMP-mediated repression of transcription involves multiple interacting upstream response elements in the class I promoter: an element extending from -127 to -90 bp containing a CRE-like core, and at least two elements within an upstream 30-bp segment (-160 to -130 bp), which overlaps with the interferon regulatory element. ICER (inducible cAMP early response), a transcriptional repressor induced by TSH/cAMP can decrease class I promoter activity when introduced into FRTL-5 thyroid cells in the absence of TSH/cAMP. ICER binds to both the CRE-like element and the upstream 30-bp segment, generating a novel TSH-induced ternary complex. The present studies led to the proposal that TSH-mediated repression of class I transcription is the result of integrating signals from transcription factors through the higher order interactions of multiple regulatory elements.

  6. On the Concept of Cis-regulatory Information: From Sequence Motifs to Logic Functions

    NASA Astrophysics Data System (ADS)

    Tarpine, Ryan; Istrail, Sorin

    The regulatory genome is about the “system level organization of the core genomic regulatory apparatus, and how this is the locus of causality underlying the twin phenomena of animal development and animal evolution” (E.H. Davidson. The Regulatory Genome: Gene Regulatory Networks in Development and Evolution, Academic Press, 2006). Information processing in the regulatory genome is done through regulatory states, defined as sets of transcription factors (sequence-specific DNA binding proteins which determine gene expression) that are expressed and active at the same time. The core information processing machinery consists of modular DNA sequence elements, called cis-modules, that interact with transcription factors. The cis-modules “read” the information contained in the regulatory state of the cell through transcription factor binding, “process” it, and directly or indirectly communicate with the basal transcription apparatus to determine gene expression. This endowment of each gene with the information-receiving capacity through their cis-regulatory modules is essential for the response to every possible regulatory state to which it might be exposed during all phases of the life cycle and in all cell types. We present here a set of challenges addressed by our CYRENE research project aimed at studying the cis-regulatory code of the regulatory genome. The CYRENE Project is devoted to (1) the construction of a database, the cis-Lexicon, containing comprehensive information across species about experimentally validated cis-regulatory modules; and (2) the software development of a next-generation genome browser, the cis-Browser, specialized for the regulatory genome. The presentation is anchored on three main computational challenges: the Gene Naming Problem, the Consensus Sequence Bottleneck Problem, and the Logic Function Inference Problem.

  7. Identification of regulatory sequences and expression analysis of OmpR gene under different stress conditions in the antarctic bacterium Psychrobacter sp. G.

    PubMed

    Song, Weizhi; Lin, Xuezheng; Che, Shuai

    2013-03-01

    An OmpR gene, named OmpR503, was cloned from the Antarctic psychrotrophic bacterium Psychrobacter sp. G according to its genomic draft. The deduced amino acid sequences of OmpR503 were highly conserved with other known protein members of OmpR family. qRT-PCR analysis showed that the expression of OmpR503 gene was significantly enhanced by high salinity (90, 120). The expression of OmpR503 gene was also significantly increased at low temperature (0, 10 °C), whereas depressed at high temperature (30 °C). When the strain was subjected to combined stress (0 °C with a salinity of 90), the expression of OmpR503 gene was increased significantly, which was up to 3.0-fold. In Antarctica, freezing tolerance of psychrotrophic bacteria is often accompanied by tolerance to osmotic stress caused by a lack of free water, thus the cold inducibility of OmpR503 gene might help the strain adapt to the harsh environment more efficiently.

  8. ASSEMBLING NEURAL CREST REGULATORY CIRCUITS INTO A GENE REGULATORY NETWORK

    PubMed Central

    Betancur, Paola; Bronner-Fraser, Marianne; Sauka-Spengler, Tatjana

    2014-01-01

    The neural crest is a multipotent stem cell--like population that gives rise to a wide range of derivatives in vertebrate embryo including elements of the craniofacial skeleton and peripheral nervous system as well as melanocytes. The neural crest forms in a series of regulatory steps that include induction and specification of the prospective neural crest territory--neural plate border, specification of bona fide neural crest progenitors, and differentiation into diverse derivatives. These individual processes during neural crest ontogeny are controlled by regulatory circuits that can be assembled into a hierarchical gene regulatory network (GRN). Here we present an overview of the GRN that orchestrates the formation of cranial neural crest cells. Formulation of this network relies on information largely inferred from gene perturbation studies performed in several vertebrate model organisms. Our representation of the cranial neural crest GRN also includes information about direct regulatory interactions obtained from the cis-regulatory analyses performed to date, which increases the resolution of the architectural circuitry within the network. PMID:19575671

  9. A cis-Regulatory Signature for Chordate Anterior Neuroectodermal Genes

    PubMed Central

    Christiaen, Lionel; Joly, Jean-Stéphane

    2010-01-01

    One of the striking findings of comparative developmental genetics was that expression patterns of core transcription factors are extraordinarily conserved in bilaterians. However, it remains unclear whether cis-regulatory elements of their target genes also exhibit common signatures associated with conserved embryonic fields. To address this question, we focused on genes that are active in the anterior neuroectoderm and non-neural ectoderm of the ascidian Ciona intestinalis. Following the dissection of a prototypic anterior placodal enhancer, we searched all genomic conserved non-coding elements for duplicated motifs around genes showing anterior neuroectodermal expression. Strikingly, we identified an over-represented pentamer motif corresponding to the binding site of the homeodomain protein OTX, which plays a pivotal role in the anterior development of all bilaterian species. Using an in vivo reporter gene assay, we observed that 10 of 23 candidate cis-regulatory elements containing duplicated OTX motifs are active in the anterior neuroectoderm, thus showing that this cis-regulatory signature is predictive of neuroectodermal enhancers. These results show that a common cis-regulatory signature corresponding to K50-Paired homeodomain transcription factors is found in non-coding sequences flanking anterior neuroectodermal genes in chordate embryos. Thus, field-specific selector genes impose architectural constraints in the form of combinations of short tags on their target enhancers. This could account for the strong evolutionary conservation of the regulatory elements controlling field-specific selector genes responsible for body plan formation. PMID:20419150

  10. Formation of Regulatory Modules by Local Sequence Duplication

    PubMed Central

    Nourmohammad, Armita; Lässig, Michael

    2011-01-01

    Turnover of regulatory sequence and function is an important part of molecular evolution. But what are the modes of sequence evolution leading to rapid formation and loss of regulatory sites? Here we show that a large fraction of neighboring transcription factor binding sites in the fly genome have formed from a common sequence origin by local duplications. This mode of evolution is found to produce regulatory information: duplications can seed new sites in the neighborhood of existing sites. Duplicate seeds evolve subsequently by point mutations, often towards binding a different factor than their ancestral neighbor sites. These results are based on a statistical analysis of 346 cis-regulatory modules in the Drosophila melanogaster genome, and a comparison set of intergenic regulatory sequence in Saccharomyces cerevisiae. In fly regulatory modules, pairs of binding sites show significantly enhanced sequence similarity up to distances of about 50 bp. We analyze these data in terms of an evolutionary model with two distinct modes of site formation: (i) evolution from independent sequence origin and (ii) divergent evolution following duplication of a common ancestor sequence. Our results suggest that pervasive formation of binding sites by local sequence duplications distinguishes the complex regulatory architecture of higher eukaryotes from the simpler architecture of unicellular organisms. PMID:21998564

  11. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

    PubMed

    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

    2015-01-01

    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  12. Nitrogen fixation specific regulatory genes of Klebsiella pneumoniae and Rhizobium meliloti share homology with the general nitrogen regulatory gene ntrC of K. pneumoniae.

    PubMed Central

    Buikema, W J; Szeto, W W; Lemley, P V; Orme-Johnson, W H; Ausubel, F M

    1985-01-01

    We have determined the complete nucleotide sequences of three functionally related nitrogen assimilation regulatory genes from Klebsiella pneumoniae and Rhizobium meliloti. These genes are: 1) The K. pneumoniae general nitrogen assimilation regulatory gene ntrC (formerly called glnG), 2) the K. pneumoniae nif-specific regulatory gene nifA, and 3) an R. meliloti nif-specific regulatory gene that appears to be functionally analogous to the K. pneumoniae nifA gene. In addition to the DNA sequence data, gel-purified K. pneumoniae nifA protein was used to determine the amino acid composition of the nifA protein. The K. pneumoniae ntrC and nifA genes code for proteins of 52,259 and 53,319 d respectively. The R. meliloti nifA gene codes for a 59,968 d protein. A central region within each polypeptide, consisting of approximately 200 amino acids, is between 52% and 58% conserved among the three proteins. Neither the amino termini nor the carboxy termini show any conserved sequences. Together with data that shows that the three regulatory proteins activate promoters that share a common consensus sequence in the -10 (5'-TTGCA-3') and -23 (5'-CTGG-3') regions, the sequence data presented here suggest a common evolutionary origin for the three regulatory genes. Images PMID:2989799

  13. Genetic Relatedness of Clostridium difficile Isolates from Various Origins Determined by Triple-Locus Sequence Analysis Based on Toxin Regulatory Genes tcdC, tcdR, and cdtR▿

    PubMed Central

    Bouvet, Philippe J. M.; Popoff, Michel R.

    2008-01-01

    A triple-locus nucleotide sequence analysis based on toxin regulatory genes tcdC, tcdR and cdtR was initiated to assess the sequence variability of these genes among Clostridium difficile isolates and to study the genetic relatedness between isolates. A preliminary investigation of the variability of the tcdC gene was done with 57 clinical and veterinary isolates. Twenty-three isolates representing nine main clusters were selected for tcdC, tcdR, and cdtR analysis. The numbers of alleles found for tcdC, tcdR and cdtR were nine, six, and five, respectively. All strains possessed the cdtR gene except toxin A-negative toxin B-positive variants. All but one binary toxin CDT-positive isolate harbored a deletion (>1 bp) in the tcdC gene. The combined analyses of the three genes allowed us to distinguish five lineages correlated with the different types of deletion in tcdC, i.e., 18 bp (associated or not with a deletion at position 117), 36 bp, 39 bp, and 54 bp, and with the wild-type tcdC (no deletion). The tcdR and tcdC genes, though located within the same pathogenicity locus, were found to have evolved separately. Coevolution of the three genes was noted only with strains harboring a 39-bp or a 54-bp deletion in tcdC that formed two homogeneous, separate divergent clusters. Our study supported the existence of the known clones (PCR ribotype 027 isolates and toxin A-negative toxin B-positive C. difficile variants) and evidence for clonality of isolates with a 39-bp deletion (toxinotype V, PCR ribotype 078) that are frequently isolated worldwide from human infections and from food animals. PMID:18832125

  14. Modeling gene regulatory network motifs using statecharts

    PubMed Central

    2012-01-01

    Background Gene regulatory networks are widely used by biologists to describe the interactions among genes, proteins and other components at the intra-cellular level. Recently, a great effort has been devoted to give gene regulatory networks a formal semantics based on existing computational frameworks. For this purpose, we consider Statecharts, which are a modular, hierarchical and executable formal model widely used to represent software systems. We use Statecharts for modeling small and recurring patterns of interactions in gene regulatory networks, called motifs. Results We present an improved method for modeling gene regulatory network motifs using Statecharts and we describe the successful modeling of several motifs, including those which could not be modeled or whose models could not be distinguished using the method of a previous proposal. We model motifs in an easy and intuitive way by taking advantage of the visual features of Statecharts. Our modeling approach is able to simulate some interesting temporal properties of gene regulatory network motifs: the delay in the activation and the deactivation of the "output" gene in the coherent type-1 feedforward loop, the pulse in the incoherent type-1 feedforward loop, the bistability nature of double positive and double negative feedback loops, the oscillatory behavior of the negative feedback loop, and the "lock-in" effect of positive autoregulation. Conclusions We present a Statecharts-based approach for the modeling of gene regulatory network motifs in biological systems. The basic motifs used to build more complex networks (that is, simple regulation, reciprocal regulation, feedback loop, feedforward loop, and autoregulation) can be faithfully described and their temporal dynamics can be analyzed. PMID:22536967

  15. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence

    PubMed Central

    Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya

    2015-01-01

    Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930

  16. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence.

    PubMed

    Gordon, Kacy L; Arthur, Robert K; Ruvinsky, Ilya

    2015-05-01

    Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements.

  17. Regulatory mechanisms for floral homeotic gene expression.

    PubMed

    Liu, Zhongchi; Mara, Chloe

    2010-02-01

    Proper regulation of floral homeotic gene (or ABCE gene) expression ensures the development of floral organs in the correct number, type, and precise spatial arrangement. This review summarizes recent advances on the regulation of floral homeotic genes, highlighting the variety and the complexity of the regulatory mechanisms involved. As flower development is one of the most well characterized developmental processes in higher plants, it facilitates the discovery of novel regulatory mechanisms. To date, mechanisms for the regulation of floral homeotic genes range from transcription to post-transcription, from activators to repressors, and from microRNA- to ubiquitin-mediated post-transcriptional regulation. Region-specific activation of floral homeotic genes is dependent on the integration of a flower-specific activity provided by LEAFY (LFY) and a region- and stage-specific activating function provided by one of the LFY cofactors. Two types of regulatory loops, the feed-forward and the feedback loop, provide properly timed gene activation and subsequent maintenance and refinement in proper spatial and temporal domains of ABCE genes. Two different microRNA/target modules may have been independently recruited in different plant species to regulate C gene expression. Additionally, competition among different MADS box proteins for common interacting partners may represent a mechanism in whorl boundary demarcation. Future work using systems approaches and the development of non-model plants will provide integrated views on floral homeotic gene regulation and insights into the evolution of morphological diversity in flowering plants. Copyright 2009 Elsevier Ltd. All rights reserved.

  18. Regulatory myosin light-chain genes of Caenorhabditis elegans.

    PubMed Central

    Cummins, C; Anderson, P

    1988-01-01

    We have cloned and analyzed the Caenorhabditis elegans regulatory myosin light-chain genes. C. elegans contains two such genes, which we have designated mlc-1 and mlc-2. The two genes are separated by 2.6 kilobases and are divergently transcribed. We determined the complete nucleotide sequences of both mlc-1 and mlc-2. A single, conservative amino acid substitution distinguishes the sequences of the two proteins. The C. elegans proteins are strongly homologous to regulatory myosin light chains of Drosophila melanogaster and vertebrates and weakly homologous to a superfamily of eucaryotic calcium-binding proteins. Both mlc-1 and mlc-2 encode abundant mRNAs. We mapped the 5' termini of these transcripts by using primer extension sequencing of mRNA templates. mlc-1 mRNAs initiate within conserved hexanucleotides at two different positions, located at -28 and -38 relative to the start of translation. The 5' terminus of mlc-2 mRNA is not encoded in the 4.8-kilobase genomic region upstream of mlc-2. Rather, mlc-2 mRNA contains at its 5' end a short, untranslated leader sequence that is identical to the trans-spliced leader sequence of three C. elegans actin genes. Images PMID:3244358

  19. A gene regulatory network controlling the embryonic specification of endoderm.

    PubMed

    Peter, Isabelle S; Davidson, Eric H

    2011-05-29

    Specification of endoderm is the prerequisite for gut formation in the embryogenesis of bilaterian organisms. Modern lineage labelling studies have shown that in the sea urchin embryo model system, descendants of the veg1 and veg2 cell lineages produce the endoderm, and that the veg2 lineage also gives rise to mesodermal cell types. It is known that Wnt/β-catenin signalling is required for endoderm specification and Delta/Notch signalling is required for mesoderm specification. Some direct cis-regulatory targets of these signals have been found and various phenomenological patterns of gene expression have been observed in the pre-gastrular endomesoderm. However, no comprehensive, causal explanation of endoderm specification has been conceived for sea urchins, nor for any other deuterostome. Here we propose a model, on the basis of the underlying genomic control system, that provides such an explanation, built at several levels of biological organization. The hardwired core of the control system consists of the cis-regulatory apparatus of endodermal regulatory genes, which determine the relationship between the inputs to which these genes are exposed and their outputs. The architecture of the network circuitry controlling the dynamic process of endoderm specification then explains, at the system level, a sequence of developmental logic operations, which generate the biological process. The control system initiates non-interacting endodermal and mesodermal gene regulatory networks in veg2-derived cells and extinguishes the endodermal gene regulatory network in mesodermal precursors. It also generates a cross-regulatory network that specifies future anterior endoderm in veg2 descendants and institutes a distinct network specifying posterior endoderm in veg1-derived cells. The network model provides an explanatory framework that relates endoderm specification to the genomic regulatory code.

  20. Evolutionary conservation of the eumetazoan gene regulatory landscape

    PubMed Central

    Schwaiger, Michaela; Schönauer, Anna; Rendeiro, André F.; Pribitzer, Carina; Schauer, Alexandra; Gilles, Anna F.; Schinko, Johannes B.; Renfer, Eduard; Fredman, David; Technau, Ulrich

    2014-01-01

    Despite considerable differences in morphology and complexity of body plans among animals, a great part of the gene set is shared among Bilateria and their basally branching sister group, the Cnidaria. This suggests that the common ancestor of eumetazoans already had a highly complex gene repertoire. At present it is therefore unclear how morphological diversification is encoded in the genome. Here we address the possibility that differences in gene regulation could contribute to the large morphological divergence between cnidarians and bilaterians. To this end, we generated the first genome-wide map of gene regulatory elements in a nonbilaterian animal, the sea anemone Nematostella vectensis. Using chromatin immunoprecipitation followed by deep sequencing of five chromatin modifications and a transcriptional cofactor, we identified over 5000 enhancers in the Nematostella genome and could validate 75% of the tested enhancers in vivo. We found that in Nematostella, but not in yeast, enhancers are characterized by the same combination of histone modifications as in bilaterians, and these enhancers preferentially target developmental regulatory genes. Surprisingly, the distribution and abundance of gene regulatory elements relative to these genes are shared between Nematostella and bilaterian model organisms. Our results suggest that complex gene regulation originated at least 600 million yr ago, predating the common ancestor of eumetazoans. PMID:24642862

  1. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.

    2016-01-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  2. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.

    PubMed

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R

    2016-09-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa.

  3. Gene regulatory elements of the cardiac conduction system.

    PubMed

    van Duijvenboden, Karel; Ruijter, Jan M; Christoffels, Vincent M

    2014-01-01

    The coordinated contraction of the heart relies on the generation and conduction of the electrical impulse. Aberrations of the function of the cardiac conduction system have been associated with various arrhythmogenic disorders and increased risk of sudden cardiac death. The genetics underlying conduction system function have been investigated using functional studies and genome-wide association studies. Both methods point towards the involvement of ion channel genes and the transcription factors that govern their activity. A large fraction of disease- and trait-associated sequence variants lie within non-coding sequences, enriched with epigenetic marks indicative of regulatory DNA. Although sequence conservation as a result of functional constraint has been a useful property to identify transcriptional enhancers, this identification process has been advanced through the development of techniques such as ChIP-seq and chromatin conformation capture technologies. The role of variation in gene regulatory elements in the cardiac conduction system has recently been demonstrated by studies on enhancers of SCN5A/SCN10A and TBX5. In both studies, a region harbouring a functionally implicated single-nucleotide polymorphism was shown to drive reproducible cardiac expression in a reporter gene assay. Furthermore, the risk variant of the allele abrogated enhancer function in both cases. Functional studies on regulatory DNA will likely receive a boost through recent developments in genome modification technologies.

  4. Efficiently finding regulatory elements using correlation with gene expression.

    PubMed

    Bannai, Hideo; Inenaga, Shunsuke; Shinohara, Ayumi; Takeda, Masayuki; Miyano, Satoru

    2004-06-01

    We present an efficient algorithm for detecting putative regulatory elements in the upstream DNA sequences of genes, using gene expression information obtained from microarray experiments. Based on a generalized suffix tree, our algorithm looks for motif patterns whose appearance in the upstream region is most correlated with the expression levels of the genes. We are able to find the optimal pattern, in time linear in the total length of the upstream sequences. We implement and apply our algorithm to publicly available microarray gene expression data, and show that our method is able to discover biologically significant motifs, including various motifs which have been reported previously using the same data set. We further discuss applications for which the efficiency of the method is essential, as well as possible extensions to our algorithm.

  5. Latent phenotypes pervade gene regulatory circuits

    PubMed Central

    2014-01-01

    Background Latent phenotypes are non-adaptive byproducts of adaptive phenotypes. They exist in biological systems as different as promiscuous enzymes and genome-scale metabolic reaction networks, and can give rise to evolutionary adaptations and innovations. We know little about their prevalence in the gene expression phenotypes of regulatory circuits, important sources of evolutionary innovations. Results Here, we study a space of more than sixteen million three-gene model regulatory circuits, where each circuit is represented by a genotype, and has one or more functions embodied in one or more gene expression phenotypes. We find that the majority of circuits with single functions have latent expression phenotypes. Moreover, the set of circuits with a given spectrum of functions has a repertoire of latent phenotypes that is much larger than that of any one circuit. Most of this latent repertoire can be easily accessed through a series of small genetic changes that preserve a circuit’s main functions. Both circuits and gene expression phenotypes that are robust to genetic change are associated with a greater number of latent phenotypes. Conclusions Our observations suggest that latent phenotypes are pervasive in regulatory circuits, and may thus be an important source of evolutionary adaptations and innovations involving gene regulation. PMID:24884746

  6. Latent phenotypes pervade gene regulatory circuits.

    PubMed

    Payne, Joshua L; Wagner, Andreas

    2014-05-30

    Latent phenotypes are non-adaptive byproducts of adaptive phenotypes. They exist in biological systems as different as promiscuous enzymes and genome-scale metabolic reaction networks, and can give rise to evolutionary adaptations and innovations. We know little about their prevalence in the gene expression phenotypes of regulatory circuits, important sources of evolutionary innovations. Here, we study a space of more than sixteen million three-gene model regulatory circuits, where each circuit is represented by a genotype, and has one or more functions embodied in one or more gene expression phenotypes. We find that the majority of circuits with single functions have latent expression phenotypes. Moreover, the set of circuits with a given spectrum of functions has a repertoire of latent phenotypes that is much larger than that of any one circuit. Most of this latent repertoire can be easily accessed through a series of small genetic changes that preserve a circuit's main functions. Both circuits and gene expression phenotypes that are robust to genetic change are associated with a greater number of latent phenotypes. Our observations suggest that latent phenotypes are pervasive in regulatory circuits, and may thus be an important source of evolutionary adaptations and innovations involving gene regulation.

  7. Phenotypic switching in gene regulatory networks.

    PubMed

    Thomas, Philipp; Popović, Nikola; Grima, Ramon

    2014-05-13

    Noise in gene expression can lead to reversible phenotypic switching. Several experimental studies have shown that the abundance distributions of proteins in a population of isogenic cells may display multiple distinct maxima. Each of these maxima may be associated with a subpopulation of a particular phenotype, the quantification of which is important for understanding cellular decision-making. Here, we devise a methodology which allows us to quantify multimodal gene expression distributions and single-cell power spectra in gene regulatory networks. Extending the commonly used linear noise approximation, we rigorously show that, in the limit of slow promoter dynamics, these distributions can be systematically approximated as a mixture of Gaussian components in a wide class of networks. The resulting closed-form approximation provides a practical tool for studying complex nonlinear gene regulatory networks that have thus far been amenable only to stochastic simulation. We demonstrate the applicability of our approach in a number of genetic networks, uncovering previously unidentified dynamical characteristics associated with phenotypic switching. Specifically, we elucidate how the interplay of transcriptional and translational regulation can be exploited to control the multimodality of gene expression distributions in two-promoter networks. We demonstrate how phenotypic switching leads to birhythmical expression in a genetic oscillator, and to hysteresis in phenotypic induction, thus highlighting the ability of regulatory networks to retain memory.

  8. Contrasting Frequencies and Effects of cis- and trans-Regulatory Mutations Affecting Gene Expression

    PubMed Central

    Metzger, Brian P. H.; Duveau, Fabien; Yuan, David C.; Tryban, Stephen; Yang, Bing; Wittkopp, Patricia J.

    2016-01-01

    Heritable differences in gene expression are caused by mutations in DNA sequences encoding cis-regulatory elements and trans-regulatory factors. These two classes of regulatory change differ in their relative contributions to expression differences in natural populations because of the combined effects of mutation and natural selection. Here, we investigate how new mutations create the regulatory variation upon which natural selection acts by quantifying the frequencies and effects of hundreds of new cis- and trans-acting mutations altering activity of the TDH3 promoter in the yeast Saccharomyces cerevisiae in the absence of natural selection. We find that cis-regulatory mutations have larger effects on expression than trans-regulatory mutations and that while trans-regulatory mutations are more common overall, cis- and trans-regulatory changes in expression are equally abundant when only the largest changes in expression are considered. In addition, we find that cis-regulatory mutations are skewed toward decreased expression while trans-regulatory mutations are skewed toward increased expression. We also measure the effects of cis- and trans-regulatory mutations on the variability in gene expression among genetically identical cells, a property of gene expression known as expression noise, finding that trans-regulatory mutations are much more likely to decrease expression noise than cis-regulatory mutations. Because new mutations are the raw material upon which natural selection acts, these differences in the frequencies and effects of cis- and trans-regulatory mutations should be considered in models of regulatory evolution. PMID:26782996

  9. Identification of key player genes in gene regulatory networks.

    PubMed

    Nazarieh, Maryam; Wiese, Andreas; Will, Thorsten; Hamed, Mohamed; Helms, Volkhard

    2016-09-06

    Identifying the gene regulatory networks governing the workings and identity of cells is one of the main challenges in understanding processes such as cellular differentiation, reprogramming or cancerogenesis. One particular challenge is to identify the main drivers and master regulatory genes that control such cell fate transitions. In this work, we reformulate this problem as the optimization problems of computing a Minimum Dominating Set and a Minimum Connected Dominating Set for directed graphs. Both MDS and MCDS are applied to the well-studied gene regulatory networks of the model organisms E. coli and S. cerevisiae and to a pluripotency network for mouse embryonic stem cells. The results show that MCDS can capture most of the known key player genes identified so far in the model organisms. Moreover, this method suggests an additional small set of transcription factors as novel key players for governing the cell-specific gene regulatory network which can also be investigated with regard to diseases. To this aim, we investigated the ability of MCDS to define key drivers in breast cancer. The method identified many known drug targets as members of the MDS and MCDS. This paper proposes a new method to identify key player genes in gene regulatory networks. The Java implementation of the heuristic algorithm explained in this paper is available as a Cytoscape plugin at http://apps.cytoscape.org/apps/mcds . The SageMath programs for solving integer linear programming formulations used in the paper are available at https://github.com/maryamNazarieh/KeyRegulatoryGenes and as supplementary material.

  10. Binding of tissue-specific forms of alpha A-CRYBP1 to their regulatory sequence in the mouse alpha A-crystallin-encoding gene: double-label immunoblotting of UV-crosslinked complexes.

    PubMed

    Kantorow, M; Becker, K; Sax, C M; Ozato, K; Piatigorsky, J

    1993-09-15

    The alpha A-CRYBP1 regulatory sequence (alpha A-CRYBP1RS), at nucleotides -66 to -57 of the mouse alpha A-crystallin-encoding gene (alpha A-CRY) promoter, is an important control element involved in the regulation of mouse alpha A-CRY expression. The gene encoding a protein (alpha A-CRYBP1) that specifically binds to the alpha A-CRYBP1RS sequence has been cloned from a cultured mouse lens cell line. In the present study, we have used an antibody (specific to the alpha A-CRYBP1 protein and made against a synthetic peptide) to directly identify UV-crosslinked protein-DNA complexes via a double-label immunoblotting technique. Multiple alpha A-CRYB1 antigenically related proteins interacted with alpha A-CRYBP1RS in nuclear extracts from both a cloned mouse lens cell line (alpha TN4-1) that expresses alpha A-CRY and a mouse fibroblast line (L929) that does not express the gene. Two sizes (50 kDa and 90 kDa) of proteins reacting with the alpha A-CRYBP1-specific Ab were detected in both cell lines and, in addition, a > 200-kDa protein reacting with the Ab was unique to the fibroblast line. Thus, alpha A-CRYBP1 antigenically related proteins interact with alpha A-CRYBP1RS regardless of alpha A-CRY expression. Moreover, differential processing of the alpha A-CRYBP1 protein and/or alternative splicing of the alpha A-CRY transcript may affect expression of alpha A-CRY.

  11. Gene regulatory networks and the underlying biology of developmental toxicity

    EPA Science Inventory

    Embryonic cells are specified by large-scale networks of functionally linked regulatory genes. Knowledge of the relevant gene regulatory networks is essential for understanding phenotypic heterogeneity that emerges from disruption of molecular functions, cellular processes or sig...

  12. Gene regulatory networks and the underlying biology of developmental toxicity

    EPA Science Inventory

    Embryonic cells are specified by large-scale networks of functionally linked regulatory genes. Knowledge of the relevant gene regulatory networks is essential for understanding phenotypic heterogeneity that emerges from disruption of molecular functions, cellular processes or sig...

  13. Autonomous Boolean modeling of gene regulatory networks

    NASA Astrophysics Data System (ADS)

    Socolar, Joshua; Sun, Mengyang; Cheng, Xianrui

    2014-03-01

    In cases where the dynamical properties of gene regulatory networks are important, a faithful model must include three key features: a network topology; a functional response of each element to its inputs; and timing information about the transmission of signals across network links. Autonomous Boolean network (ABN) models are efficient representations of these elements and are amenable to analysis. We present an ABN model of the gene regulatory network governing cell fate specification in the early sea urchin embryo, which must generate three bands of distinct tissue types after several cell divisions, beginning from an initial condition with only two distinct cell types. Analysis of the spatial patterning problem and the dynamics of a network constructed from available experimental results reveals that a simple mechanism is at work in this case. Supported by NSF Grant DMS-10-68602

  14. A web site for the computational analysis of yeast regulatory sequences.

    PubMed

    van Helden, J; André, B; Collado-Vides, J

    2000-01-30

    A series of computer programs were developed for the analysis of regulatory sequences, with a special focus on yeast. These tools are publicly available on the web (http://copan.cifn.unam. mx/Computational_Biology/yeast-tools or http://www.ucmb.ulb.ac. be/bioinformatics/rsa-tools/). Basically, three classical problems can be addressed: (a) search for known regulatory patterns in the upstream regions of known genes; (b) discovery of unknown regulatory patterns within a set of upstream regions known to be co-regulated; (c) search for unknown genes potentially regulated by a known transcription factor. Each of these tasks can be performed on basis of a simple (string) or more refined (matrix) description of the regulatory patterns. A feature-map program automatically generates visual representations of the positions at which patterns were found. The site also provides a series of general utilities, such as generation of random sequence, automatic drawing of XY graphs, interconversions between sequence formats, etc. Several tools are linked together to allow their sequential utilization (piping), but each one can also be used independently by filling the web form with external data. This widens the scope of the site to the analysis of non-regulatory and/or non-yeast sequences. Copyright 2000 John Wiley & Sons, Ltd.

  15. Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks.

    PubMed

    Narang, Vipin; Ramli, Muhamad Azfar; Singhal, Amit; Kumar, Pavanish; de Libero, Gennaro; Poidinger, Michael; Monterola, Christopher

    2015-01-01

    Human gene regulatory networks (GRN) can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs). Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data) accompanying this manuscript.

  16. Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks

    PubMed Central

    Singhal, Amit; Kumar, Pavanish; de Libero, Gennaro; Poidinger, Michael; Monterola, Christopher

    2015-01-01

    Human gene regulatory networks (GRN) can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs). Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data) accompanying this manuscript. PMID:26393364

  17. Computational Genomics: From Genome Sequence To Global Gene Regulation

    NASA Astrophysics Data System (ADS)

    Li, Hao

    2000-03-01

    As various genome projects are shifting to the post-sequencing phase, it becomes a big challenge to analyze the sequence data and extract biological information using computational tools. In the past, computational genomics has mainly focused on finding new genes and mapping out their biological functions. With the rapid accumulation of experimental data on genome-wide gene activities, it is now possible to understand how genes are regulated on a genomic scale. A major mechanism for gene regulation is to control the level of transcription, which is achieved by regulatory proteins that bind to short DNA sequences - the regulatory elements. We have developed a new approach to identifying regulatory elements in genomes. The approach formalizes how one would proceed to decipher a ``text'' consisting of a long string of letters written in an unknown language that did not delineate words. The algorithm is based on a statistical mechanics model in which the sequence is segmented probabilistically into ``words'' and a ``dictionary'' of ``words'' is built concurrently. For the control regions in the yeast genome, we built a ``dictionary'' of about one thousand words which includes many known as well as putative regulatory elements. I will discuss how we can use this dictionary to search for genes that are likely to be regulated in a similar fashion and to analyze gene expression data generated from DNA micro-array experiments.

  18. Gene regulatory logic of dopaminergic neuron differentiation

    PubMed Central

    Flames, Nuria; Hobert, Oliver

    2009-01-01

    Dopamine signaling regulates a variety of complex behaviors and defects in dopaminergic neuron function or survival result in severe human pathologies, such as Parkinson's disease 1. The common denominator of all dopaminergic neurons is the expression of dopamine pathway genes, which code for a set of phylogenetically conserved proteins involved in dopamine synthesis and transport. Gene regulatory mechanisms that result in the activation of dopamine pathway genes and thereby ultimately determine the identity of dopaminergic neurons are poorly understood in any system studied to date 2. We show here that a simple cis-regulatory element, the DA motif, controls the expression of all dopamine pathway genes in all dopaminergic cell types in C. elegans. The DA motif is activated by the ETS transcription factor, AST-1. Loss of ast-1 results in the failure of all distinct dopaminergic neuronal subtypes to terminally differentiate. Ectopic expression of ast-1 is sufficient to activate the dopamine production pathway in some cellular contexts. Vertebrate dopaminergic pathway genes also contain phylogenetically conserved DA motifs that can be activated by the mouse ETS transcription factor Etv1/ER81 and a specific class of dopaminergic neurons fails to differentiate in mice lacking Etv1/ER81. Moreover, ectopic Etv1/ER81 expression induces dopaminergic fate marker expression in neuronal primary cultures. Mouse Etv1/ER81 can also functionally substitute for ast-1 in C.elegans. Our studies reveal an astoundingly simple and apparently conserved regulatory logic of dopaminergic neuron terminal differentiation and may provide new entry points into the diagnosis or therapy of conditions in which dopamine neurons are defective. PMID:19287374

  19. Dynamic Gene Regulatory Networks of Human Myeloid Differentiation.

    PubMed

    Ramirez, Ricardo N; El-Ali, Nicole C; Mager, Mikayla Anne; Wyman, Dana; Conesa, Ana; Mortazavi, Ali

    2017-03-27

    The reconstruction of gene regulatory networks underlying cell differentiation from high-throughput gene expression and chromatin data remains a challenge. Here, we derive dynamic gene regulatory networks for human myeloid differentiation using a 5-day time series of RNA-seq and ATAC-seq data. We profile HL-60 promyelocytes differentiating into macrophages, neutrophils, monocytes, and monocyte-derived macrophages. We find a rapid response in the expression of key transcription factors and lineage markers that only regulate a subset of their targets at a given time, which is followed by chromatin accessibility changes that occur later along with further gene expression changes. We observe differences between promyelocyte- and monocyte-derived macrophages at both the transcriptional and chromatin landscape level, despite using the same differentiation stimulus, which suggest that the path taken by cells in the differentiation landscape defines their end cell state. More generally, our approach of combining neighboring time points and replicates to achieve greater sequencing depth can efficiently infer footprint-based regulatory networks from long series data.

  20. Regulatory Features for Odorant Receptor Genes in the Mouse Genome.

    PubMed

    Degl'Innocenti, Andrea; D'Errico, Anna

    2017-01-01

    The odorant receptor genes, seven transmembrane receptor genes constituting the vastest mammalian gene multifamily, are expressed monogenically and monoallelicaly in each sensory neuron in the olfactory epithelium. This characteristic, often referred to as the one neuron-one receptor rule, is driven by mostly uncharacterized molecular dynamics, generally named odorant receptor gene choice. Much attention has been paid by the scientific community to the identification of sequences regulating the expression of odorant receptor genes within their loci, where related genes are usually arranged in genomic clusters. A number of studies identified transcription factor binding sites on odorant receptor promoter sequences. Similar binding sites were also found on a number of enhancers that regulate in cis their transcription, but have been proposed to form interchromosomal networks. Odorant receptor gene choice seems to occur via the local removal of strongly repressive epigenetic markings, put in place during the maturation of the sensory neuron on each odorant receptor locus. Here we review the fast-changing state of art for the study of regulatory features for odorant receptor genes.

  1. Regulatory Features for Odorant Receptor Genes in the Mouse Genome

    PubMed Central

    Degl’Innocenti, Andrea; D’Errico, Anna

    2017-01-01

    The odorant receptor genes, seven transmembrane receptor genes constituting the vastest mammalian gene multifamily, are expressed monogenically and monoallelicaly in each sensory neuron in the olfactory epithelium. This characteristic, often referred to as the one neuron–one receptor rule, is driven by mostly uncharacterized molecular dynamics, generally named odorant receptor gene choice. Much attention has been paid by the scientific community to the identification of sequences regulating the expression of odorant receptor genes within their loci, where related genes are usually arranged in genomic clusters. A number of studies identified transcription factor binding sites on odorant receptor promoter sequences. Similar binding sites were also found on a number of enhancers that regulate in cis their transcription, but have been proposed to form interchromosomal networks. Odorant receptor gene choice seems to occur via the local removal of strongly repressive epigenetic markings, put in place during the maturation of the sensory neuron on each odorant receptor locus. Here we review the fast-changing state of art for the study of regulatory features for odorant receptor genes. PMID:28270833

  2. Identification of regulatory sequence elements within the transcription promoter region of NpABC1, a gene encoding a plant ABC transporter induced by diterpenes.

    PubMed

    Grec, Sébastien; Vanham, Delphine; de Ribaucourt, Jeoffrey Christyn; Purnelle, Bénédicte; Boutry, Marc

    2003-07-01

    Expression of NpABC1, a gene encoding a plasma membrane ATP binding cassette (ABC) transporter in Nicotiana plumbaginifolia, is induced by sclareol, an antifungal diterpene produced at the leaf surface, as well as by sclareolide, a close analog. A genomic fragment including the 1282-bp region upstream of the NpABC1 transcription start was fused to the reporter beta-glucuronidase (gus) gene and introduced into N. tabacum BY2 cells for stable transformation. A 25-fold increase in gus expression was observed when cells were treated with sclareolide and some other terpenes. The combined use of 5'-deletion promoter analysis, gel mobility shift assays, DNase I footprinting, and site-directed mutagenesis allowed us to identify three cis-elements (sclareol box 1 (SB1), SB2, and SB3) located, respectively, within nucleotides -827 to -802, -278 to -243, and -216 to -190 upstream of the NpABC1 transcription start. In vivo evaluation of these elements on sclareolide-induced expression showed that mutation of SB1 reduced expression by twofold, while that of SB2 had no effect. On the other hand, SB3 had a marked effect as it completely abolished sclareolide-mediated expression. NpABC1-gus expression was not induced by the stress signals, salicylic acid and ethylene, but was mediated, to some extent, by methyl jasmonate, which is known to promote diterpene synthesis.

  3. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  4. Genome-wide network of regulatory genes for construction of a chordate embryo.

    PubMed

    Shoguchi, Eiichi; Hamaguchi, Makoto; Satoh, Nori

    2008-04-15

    Animal development is controlled by gene regulation networks that are composed of sequence-specific transcription factors (TF) and cell signaling molecules (ST). Although housekeeping genes have been reported to show clustering in the animal genomes, whether the genes comprising a given regulatory network are physically clustered on a chromosome is uncertain. We examined this question in the present study. Ascidians are the closest living relatives of vertebrates, and their tadpole-type larva represents the basic body plan of chordates. The Ciona intestinalis genome contains 390 core TF genes and 119 major ST genes. Previous gene disruption assays led to the formulation of a basic chordate embryonic blueprint, based on over 3000 genetic interactions among 79 zygotic regulatory genes. Here, we mapped the regulatory genes, including all 79 regulatory genes, on the 14 pairs of Ciona chromosomes by fluorescent in situ hybridization (FISH). Chromosomal localization of upstream and downstream regulatory genes demonstrates that the components of coherent developmental gene networks are evenly distributed over the 14 chromosomes. Thus, this study provides the first comprehensive evidence that the physical clustering of regulatory genes, or their target genes, is not relevant for the genome-wide control of gene expression during development.

  5. Identification of cis-regulatory mutations generating de novo edges in personalized cancer gene regulatory networks.

    PubMed

    Kalender Atak, Zeynep; Imrichova, Hana; Svetlichnyy, Dmitry; Hulselmans, Gert; Christiaens, Valerie; Reumers, Joke; Ceulemans, Hugo; Aerts, Stein

    2017-08-30

    The identification of functional non-coding mutations is a key challenge in the field of genomics. Here we introduce μ-cisTarget to filter, annotate and prioritize cis-regulatory mutations based on their putative effect on the underlying "personal" gene regulatory network. We validated μ-cisTarget by re-analyzing the TAL1 and LMO1 enhancer mutations in T-ALL, and the TERT promoter mutation in melanoma. Next, we re-sequenced the full genomes of ten cancer cell lines and used matched transcriptome data and motif discovery to identify master regulators with de novo binding sites that result in the up-regulation of nearby oncogenic drivers. μ-cisTarget is available from http://mucistarget.aertslab.org .

  6. Beyond antioxidant genes in the ancient NRF2 regulatory network

    PubMed Central

    Lacher, Sarah E.; Lee, Joslynn S.; Wang, Xuting; Campbell, Michelle R.; Bell, Douglas A.; Slattery, Matthew

    2016-01-01

    NRF2, a basic leucine zipper transcription factor encoded by the gene NFE2L2, is a master regulator of the transcriptional response to oxidative stress. NRF2 is structurally and functionally conserved from insects to humans, and it heterodimerizes with the small MAF transcription factors to bind a consensus DNA sequence (the antioxidant response element, or ARE) and regulate gene expression. We have used genome-wide chromatin immunoprecipitation (ChIP-seq) and gene expression data to identify direct NRF2 target genes in Drosophila and humans. These data have allowed us to construct the deeply conserved ancient NRF2 regulatory network – target genes that are conserved from Drosophila to human. The ancient network consists of canonical antioxidant genes, as well as genes related to proteasomal pathways, metabolism, and a number of less expected genes. We have also used enhancer reporter assays and electrophoretic mobility shift assays to confirm NRF2-mediated regulation of ARE (antioxidant response element) activity at a number of these novel target genes. Interestingly, the ancient network also highlights a prominent negative feedback loop; this, combined with the finding that and NRF2-mediated regulatory output is tightly linked to the quality of the ARE it is targeting, suggests that precise regulation of nuclear NRF2 concentration is necessary to achieve proper quantitative regulation of distinct gene sets. Together, these findings highlight the importance of balance in the NRF2-ARE pathway, and indicate that NRF2-mediated regulation of xenobiotic metabolism, glucose metabolism, and proteostasis have been central to this pathway since its inception. PMID:26163000

  7. Genome-Wide Identification of Regulatory Sequences Undergoing Accelerated Evolution in the Human Genome.

    PubMed

    Dong, Xinran; Wang, Xiao; Zhang, Feng; Tian, Weidong

    2016-10-01

    Accelerated evolution of regulatory sequence can alter the expression pattern of target genes, and cause phenotypic changes. In this study, we used DNase I hypersensitive sites (DHSs) to annotate putative regulatory sequences in the human genome, and conducted a genome-wide analysis of the effects of accelerated evolution on regulatory sequences. Working under the assumption that local ancient repeat elements of DHSs are under neutral evolution, we discovered that ∼0.44% of DHSs are under accelerated evolution (ace-DHSs). We found that ace-DHSs tend to be more active than background DHSs, and are strongly associated with epigenetic marks of active transcription. The target genes of ace-DHSs are significantly enriched in neuron-related functions, and their expression levels are positively selected in the human brain. Thus, these lines of evidences strongly suggest that accelerated evolution on regulatory sequences plays important role in the evolution of human-specific phenotypes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. A Provisional Gene Regulatory Atlas for Mouse Heart Development

    PubMed Central

    Chen, Hailin; VanBuren, Vincent

    2014-01-01

    Congenital Heart Disease (CHD) is one of the most common birth defects. Elucidating the molecular mechanisms underlying normal cardiac development is an important step towards early identification of abnormalities during the developmental program and towards the creation of early intervention strategies. We developed a novel computational strategy for leveraging high-content data sets, including a large selection of microarray data associated with mouse cardiac development, mouse genome sequence, ChIP-seq data of selected mouse transcription factors and Y2H data of mouse protein-protein interactions, to infer the active transcriptional regulatory network of mouse cardiac development. We identified phase-specific expression activity for 765 overlapping gene co-expression modules that were defined for obtained cardiac lineage microarray data. For each co-expression module, we identified the phase of cardiac development where gene expression for that module was higher than other phases. Co-expression modules were found to be consistent with biological pathway knowledge in Wikipathways, and met expectations for enrichment of pathways involved in heart lineage development. Over 359,000 transcription factor-target relationships were inferred by analyzing the promoter sequences within each gene module for overrepresentation against the JASPAR database of Transcription Factor Binding Site (TFBS) motifs. The provisional regulatory network will provide a framework of studying the genetic basis of CHD. PMID:24421884

  9. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    SciTech Connect

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A. . E-mail: BELL1@niehs.nih.gov

    2005-09-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes.

  10. Generation of oscillating gene regulatory network motifs

    NASA Astrophysics Data System (ADS)

    van Dorp, M.; Lannoo, B.; Carlon, E.

    2013-07-01

    Using an improved version of an evolutionary algorithm originally proposed by François and Hakim [Proc. Natl. Acad. Sci. USAPNASA60027-842410.1073/pnas.0304532101 101, 580 (2004)], we generated small gene regulatory networks in which the concentration of a target protein oscillates in time. These networks may serve as candidates for oscillatory modules to be found in larger regulatory networks and protein interaction networks. The algorithm was run for 105 times to produce a large set of oscillating modules, which were systematically classified and analyzed. The robustness of the oscillations against variations of the kinetic rates was also determined, to filter out the least robust cases. Furthermore, we show that the set of evolved networks can serve as a database of models whose behavior can be compared to experimentally observed oscillations. The algorithm found three smallest (core) oscillators in which nonlinearities and number of components are minimal. Two of those are two-gene modules: the mixed feedback loop, already discussed in the literature, and an autorepressed gene coupled with a heterodimer. The third one is a single gene module which is competitively regulated by a monomer and a dimer. The evolutionary algorithm also generated larger oscillating networks, which are in part extensions of the three core modules and in part genuinely new modules. The latter includes oscillators which do not rely on feedback induced by transcription factors, but are purely of post-transcriptional type. Analysis of post-transcriptional mechanisms of oscillation may provide useful information for circadian clock research, as recent experiments showed that circadian rhythms are maintained even in the absence of transcription.

  11. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.

    1999-01-01

    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  12. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.

    1999-01-01

    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  13. Identifying genes of gene regulatory networks using formal concept analysis.

    PubMed

    Gebert, Jutta; Motameny, Susanne; Faigle, Ulrich; Forst, Christian V; Schrader, Rainer

    2008-03-01

    In order to understand the behavior of a gene regulatory network, it is essential to know the genes that belong to it. Identifying the correct members (e.g., in order to build a model) is a difficult task even for small subnetworks. Usually only few members of a network are known and one needs to guess the missing members based on experience or informed speculation. It is beneficial if one can additionally rely on experimental data to support this guess. In this work we present a new method based on formal concept analysis to detect unknown members of a gene regulatory network from gene expression time series data. We show that formal concept analysis is able to find a list of candidate genes for inclusion into a partially known basic network. This list can then be reduced by a statistical analysis so that the resulting genes interact strongly with the basic network and therefore should be included when modeling the network. The method has been applied to the DNA repair system of Mycobacterium tuberculosis. In this application, our method produces comparable results to an already existing method of component selection while it is applicable to a broader range of problems.

  14. Population genetics of cis-regulatory sequences that operate during embryonic development in the sea urchin Strongylocentrotus purpuratus.

    PubMed

    Garfield, David; Haygood, Ralph; Nielsen, William J; Wray, Gregory A

    2012-01-01

    Despite the fact that noncoding sequences comprise a substantial fraction of functional sites within all genomes, the evolutionary mechanisms that operate on genetic variation within regulatory elements remain poorly understood. In this study, we examine the population genetics of the core, upstream cis-regulatory regions of eight genes (AN, CyIIa, CyIIIa, Endo16, FoxB, HE, SM30 a, and SM50) that function during the early development of the purple sea urchin, Strongylocentrotus purpuratus. Quantitative and qualitative measures of segregating variation are not conspicuously different between cis-regulatory and closely linked "proxy neutral" noncoding regions containing no known functional sites. Length and compound mutations are common in noncoding sequences; conventional descriptive statistics ignore such mutations, under-representing true genetic variation by approximately 28% for these loci in this population. Patterns of variation in the cis-regulatory regions of six of the genes examined (CyIIa, CyIIIa, Endo16, FoxB, AN, and HE) are consistent with directional selection. Genetic variation within annotated transcription factor binding sites is comparable to, and frequently greater than, that of surrounding sequences. Comparisons of two paralog pairs (CyIIa/CyIIIa and AN/HE) suggest that distinct evolutionary processes have operated on their cis-regulatory regions following gene duplication. Together, these analyses provide a detailed view of the evolutionary mechanisms operating on noncoding sequences within a natural population, and underscore how little is known about how these processes operate on cis-regulatory sequences.

  15. A yeast one-hybrid and microfluidics-based pipeline to map mammalian gene regulatory networks

    PubMed Central

    Gubelmann, Carine; Waszak, Sebastian M; Isakova, Alina; Holcombe, Wiebke; Hens, Korneel; Iagovitina, Antonina; Feuz, Jean-Daniel; Raghav, Sunil K; Simicevic, Jovan; Deplancke, Bart

    2013-01-01

    The comprehensive mapping of gene promoters and enhancers has significantly improved our understanding of how the mammalian regulatory genome is organized. An important challenge is to elucidate how these regulatory elements contribute to gene expression by identifying their trans-regulatory inputs. Here, we present the generation of a mouse-specific transcription factor (TF) open-reading frame clone library and its implementation in yeast one-hybrid assays to enable large-scale protein–DNA interaction detection with mouse regulatory elements. Once specific interactions are identified, we then use a microfluidics-based method to validate and precisely map them within the respective DNA sequences. Using well-described regulatory elements as well as orphan enhancers, we show that this cross-platform pipeline characterizes known and uncovers many novel TF–DNA interactions. In addition, we provide evidence that several of these novel interactions are relevant in vivo and aid in elucidating the regulatory architecture of enhancers. PMID:23917988

  16. SNPs in putative regulatory regions identified by human mouse comparative sequencing and transcription factor binding site data

    SciTech Connect

    Banerjee, Poulabi; Bahlo, Melanie; Schwartz, Jody R.; Loots, Gabriela G.; Houston, Kathryn A.; Dubchak, Inna; Speed, Terence P.; Rubin, Edward M.

    2002-01-01

    Genome wide disease association analysis using SNPs is being explored as a method for dissecting complex genetic traits and a vast number of SNPs have been generated for this purpose. As there are cost and throughput limitations of genotyping large numbers of SNPs and statistical issues regarding the large number of dependent tests on the same data set, to make association analysis practical it has been proposed that SNPs should be prioritized based on likely functional importance. The most easily identifiable functional SNPs are coding SNPs (cSNPs) and accordingly cSNPs have been screened in a number of studies. SNPs in gene regulatory sequences embedded in noncoding DNA are another class of SNPs suggested for prioritization due to their predicted quantitative impact on gene expression. The main challenge in evaluating these SNPs, in contrast to cSNPs is a lack of robust algorithms and databases for recognizing regulatory sequences in noncoding DNA. Approaches that have been previously used to delineate noncoding sequences with gene regulatory activity include cross-species sequence comparisons and the search for sequences recognized by transcription factors. We combined these two methods to sift through mouse human genomic sequences to identify putative gene regulatory elements and subsequently localized SNPs within these sequences in a 1 Megabase (Mb) region of human chromosome 5q31, orthologous to mouse chromosome 11 containing the Interleukin cluster.

  17. Prediction of transcriptional regulatory sites in the complete genome sequence of Escherichia coli K-12.

    PubMed

    Thieffry, D; Salgado, H; Huerta, A M; Collado-Vides, J

    1998-06-01

    As one of the best-characterized free-living organisms, Escherichia coli and its recently completed genomic sequence offer a special opportunity to exploit systematically the variety of regulatory data available in the literature in order to make a comprehensive set of regulatory predictions in the whole genome. The complete genome sequence of E.coli was analyzed for the binding of transcriptional regulators upstream of coding sequences. The biological information contained in RegulonDB (Huerta, A.M. et al., Nucleic Acids Res.,26,55-60, 1998) for 56 different transcriptional proteins was the support to implement a stringent strategy combining string search and weight matrices. We estimate that our search included representatives of 15-25% of the total number of regulatory binding proteins in E.coli. This search was performed on the set of 4288 putative regulatory regions, each 450 bp long. Within the regions with predicted sites, 89% are regulated by one protein and 81% involve only one site. These numbers are reasonably consistent with the distribution of experimental regulatory sites. Regulatory sites are found in 603 regions corresponding to 16% of operon regions and 10% of intra-operonic regions. Additional evidence gives stronger support to some of these predictions, including the position of the site, biological consistency with the function of the downstream gene, as well as genetic evidence for the regulatory interaction. The predictions described here were incorporated into the map presented in the paper describing the complete E.coli genome (Blattner,F.R. et al., Science, 277, 1453-1461, 1997). The complete set of predictions in GenBank format is available at the url: http://www. cifn.unam.mx/Computational_Biology/E.coli-predictions ecoli-reg@cifn.unam.mx, collado@cifn.unam.mx

  18. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA.

    PubMed

    Turner, Tychele N; Hormozdiari, Fereydoun; Duyzend, Michael H; McClymont, Sarah A; Hook, Paul W; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A; Zody, Michael C; Nelson, Bradley J; Huddleston, John; Sandstrom, Richard; Smith, Joshua D; Hanna, David; Swanson, James M; Faustman, Elaine M; Bamshad, Michael J; Stamatoyannopoulos, John; Nickerson, Deborah A; McCallion, Andrew S; Darnell, Robert; Eichler, Evan E

    2016-01-07

    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  19. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA

    PubMed Central

    Turner, Tychele N.; Hormozdiari, Fereydoun; Duyzend, Michael H.; McClymont, Sarah A.; Hook, Paul W.; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A.; Zody, Michael C.; Nelson, Bradley J.; Huddleston, John; Sandstrom, Richard; Smith, Joshua D.; Hanna, David; Swanson, James M.; Faustman, Elaine M.; Bamshad, Michael J.; Stamatoyannopoulos, John; Nickerson, Deborah A.; McCallion, Andrew S.; Darnell, Robert; Eichler, Evan E.

    2016-01-01

    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  20. Regulatory gene networks and the properties of the developmental process

    NASA Technical Reports Server (NTRS)

    Davidson, Eric H.; McClay, David R.; Hood, Leroy

    2003-01-01

    Genomic instructions for development are encoded in arrays of regulatory DNA. These specify large networks of interactions among genes producing transcription factors and signaling components. The architecture of such networks both explains and predicts developmental phenomenology. Although network analysis is yet in its early stages, some fundamental commonalities are already emerging. Two such are the use of multigenic feedback loops to ensure the progressivity of developmental regulatory states and the prevalence of repressive regulatory interactions in spatial control processes. Gene regulatory networks make it possible to explain the process of development in causal terms and eventually will enable the redesign of developmental regulatory circuitry to achieve different outcomes.

  1. Regulatory gene networks and the properties of the developmental process

    NASA Technical Reports Server (NTRS)

    Davidson, Eric H.; McClay, David R.; Hood, Leroy

    2003-01-01

    Genomic instructions for development are encoded in arrays of regulatory DNA. These specify large networks of interactions among genes producing transcription factors and signaling components. The architecture of such networks both explains and predicts developmental phenomenology. Although network analysis is yet in its early stages, some fundamental commonalities are already emerging. Two such are the use of multigenic feedback loops to ensure the progressivity of developmental regulatory states and the prevalence of repressive regulatory interactions in spatial control processes. Gene regulatory networks make it possible to explain the process of development in causal terms and eventually will enable the redesign of developmental regulatory circuitry to achieve different outcomes.

  2. Gene regulatory networks elucidating huanglongbing disease mechanisms.

    PubMed

    Martinelli, Federico; Reagan, Russell L; Uratsu, Sandra L; Phu, My L; Albrecht, Ute; Zhao, Weixiang; Davis, Cristina E; Bowman, Kim D; Dandekar, Abhaya M

    2013-01-01

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional RNA-Seq data in three tissues: immature fruit, and young and mature leaves. Four categories of orchard trees were studied: symptomatic, asymptomatic, apparently healthy, and healthy. Principal component analysis found distinct expression patterns between immature and mature fruits and leaf samples for all four categories of trees. A predicted protein - protein interaction network identified HLB-regulated genes for sugar transporters playing key roles in the overall plant responses. Gene set and pathway enrichment analyses highlight the role of sucrose and starch metabolism in disease symptom development in all tissues. HLB-regulated genes (glucose-phosphate-transporter, invertase, starch-related genes) would likely determine the source-sink relationship disruption. In infected leaves, transcriptomic changes were observed for light reactions genes (downregulation), sucrose metabolism (upregulation), and starch biosynthesis (upregulation). In parallel, symptomatic fruits over-expressed genes involved in photosynthesis, sucrose and raffinose metabolism, and downregulated starch biosynthesis. We visualized gene networks between tissues inducing a source-sink shift. CaLas alters the hormone crosstalk, resulting in weak and ineffective tissue-specific plant immune responses necessary for bacterial clearance. Accordingly, expression of WRKYs (including WRKY70) was higher in fruits than in leaves. Systemic acquired responses were inadequately activated in young leaves, generally considered the sites where most new infections occur.

  3. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  4. A provisional regulatory gene network for specification of endomesoderm in the sea urchin embryo

    NASA Technical Reports Server (NTRS)

    Davidson, Eric H.; Rast, Jonathan P.; Oliveri, Paola; Ransick, Andrew; Calestani, Cristina; Yuh, Chiou-Hwa; Minokawa, Takuya; Amore, Gabriele; Hinman, Veronica; Arenas-Mena, Cesar; Otim, Ochan; Brown, C. Titus; Livi, Carolina B.; Lee, Pei Yun; Revilla, Roger; Schilstra, Maria J.; Clarke, Peter J C.; Rust, Alistair G.; Pan, Zhengjun; Arnone, Maria I.; Rowen, Lee; Cameron, R. Andrew; McClay, David R.; Hood, Leroy; Bolouri, Hamid

    2002-01-01

    We present the current form of a provisional DNA sequence-based regulatory gene network that explains in outline how endomesodermal specification in the sea urchin embryo is controlled. The model of the network is in a continuous process of revision and growth as new genes are added and new experimental results become available; see http://www.its.caltech.edu/mirsky/endomeso.htm (End-mes Gene Network Update) for the latest version. The network contains over 40 genes at present, many newly uncovered in the course of this work, and most encoding DNA-binding transcriptional regulatory factors. The architecture of the network was approached initially by construction of a logic model that integrated the extensive experimental evidence now available on endomesoderm specification. The internal linkages between genes in the network have been determined functionally, by measurement of the effects of regulatory perturbations on the expression of all relevant genes in the network. Five kinds of perturbation have been applied: (1) use of morpholino antisense oligonucleotides targeted to many of the key regulatory genes in the network; (2) transformation of other regulatory factors into dominant repressors by construction of Engrailed repressor domain fusions; (3) ectopic expression of given regulatory factors, from genetic expression constructs and from injected mRNAs; (4) blockade of the beta-catenin/Tcf pathway by introduction of mRNA encoding the intracellular domain of cadherin; and (5) blockade of the Notch signaling pathway by introduction of mRNA encoding the extracellular domain of the Notch receptor. The network model predicts the cis-regulatory inputs that link each gene into the network. Therefore, its architecture is testable by cis-regulatory analysis. Strongylocentrotus purpuratus and Lytechinus variegatus genomic BAC recombinants that include a large number of the genes in the network have been sequenced and annotated. Tests of the cis-regulatory predictions of

  5. A provisional regulatory gene network for specification of endomesoderm in the sea urchin embryo

    NASA Technical Reports Server (NTRS)

    Davidson, Eric H.; Rast, Jonathan P.; Oliveri, Paola; Ransick, Andrew; Calestani, Cristina; Yuh, Chiou-Hwa; Minokawa, Takuya; Amore, Gabriele; Hinman, Veronica; Arenas-Mena, Cesar; hide

    2002-01-01

    We present the current form of a provisional DNA sequence-based regulatory gene network that explains in outline how endomesodermal specification in the sea urchin embryo is controlled. The model of the network is in a continuous process of revision and growth as new genes are added and new experimental results become available; see http://www.its.caltech.edu/mirsky/endomeso.htm (End-mes Gene Network Update) for the latest version. The network contains over 40 genes at present, many newly uncovered in the course of this work, and most encoding DNA-binding transcriptional regulatory factors. The architecture of the network was approached initially by construction of a logic model that integrated the extensive experimental evidence now available on endomesoderm specification. The internal linkages between genes in the network have been determined functionally, by measurement of the effects of regulatory perturbations on the expression of all relevant genes in the network. Five kinds of perturbation have been applied: (1) use of morpholino antisense oligonucleotides targeted to many of the key regulatory genes in the network; (2) transformation of other regulatory factors into dominant repressors by construction of Engrailed repressor domain fusions; (3) ectopic expression of given regulatory factors, from genetic expression constructs and from injected mRNAs; (4) blockade of the beta-catenin/Tcf pathway by introduction of mRNA encoding the intracellular domain of cadherin; and (5) blockade of the Notch signaling pathway by introduction of mRNA encoding the extracellular domain of the Notch receptor. The network model predicts the cis-regulatory inputs that link each gene into the network. Therefore, its architecture is testable by cis-regulatory analysis. Strongylocentrotus purpuratus and Lytechinus variegatus genomic BAC recombinants that include a large number of the genes in the network have been sequenced and annotated. Tests of the cis-regulatory predictions of

  6. Repetitive sequence environment distinguishes housekeeping genes

    PubMed Central

    Eller, C. Daniel; Regelson, Moira; Merriman, Barry; Nelson, Stan; Horvath, Steve; Marahrens, York

    2007-01-01

    Housekeeping genes are expressed across a wide variety of tissues. Since repetitive sequences have been reported to influence the expression of individual genes, we employed a novel approach to determine whether housekeeping genes can be distinguished from tissue-specific genes their repetitive sequence context. We show that Alu elements are more highly concentrated around housekeeping genes while various longer (>400-bp) repetitive sequences ("repeats"), including Long Interspersed Nuclear Element 1 (LINE-1) elements, are excluded from these regions. We further show that isochore membership does not distinguish housekeeping genes from tissue-specific genes and that repetitive sequence environment distinguishes housekeeping genes from tissue-specific genes in every isochore. The distinct repetitive sequence environment, in combination with other previously published sequence properties of housekeeping genes, were used to develop a method of predicting housekeeping genes on the basis of DNA sequence alone. Using expression across tissue types as a measure of success, we demonstrate that repetitive sequence environment is by far the most important sequence feature identified to date for distinguishing housekeeping genes. PMID:17141428

  7. Discovering Study-Specific Gene Regulatory Networks

    PubMed Central

    Bo, Valeria; Curtis, Tanya; Lysenko, Artem; Saqi, Mansoor; Swift, Stephen; Tucker, Allan

    2014-01-01

    Microarrays are commonly used in biology because of their ability to simultaneously measure thousands of genes under different conditions. Due to their structure, typically containing a high amount of variables but far fewer samples, scalable network analysis techniques are often employed. In particular, consensus approaches have been recently used that combine multiple microarray studies in order to find networks that are more robust. The purpose of this paper, however, is to combine multiple microarray studies to automatically identify subnetworks that are distinctive to specific experimental conditions rather than common to them all. To better understand key regulatory mechanisms and how they change under different conditions, we derive unique networks from multiple independent networks built using glasso which goes beyond standard correlations. This involves calculating cluster prediction accuracies to detect the most predictive genes for a specific set of conditions. We differentiate between accuracies calculated using cross-validation within a selected cluster of studies (the intra prediction accuracy) and those calculated on a set of independent studies belonging to different study clusters (inter prediction accuracy). Finally, we compare our method's results to related state-of-the art techniques. We explore how the proposed pipeline performs on both synthetic data and real data (wheat and Fusarium). Our results show that subnetworks can be identified reliably that are specific to subsets of studies and that these networks reflect key mechanisms that are fundamental to the experimental conditions in each of those subsets. PMID:25191999

  8. Regulatory considerations for translating gene therapy: a European Union perspective.

    PubMed

    Galli, Maria Cristina

    2009-11-11

    A preclinical study on a gene therapy approach for treatment of the severe muscle weakness associated with a variety of neuromuscular disorders provides a forum to discuss the translational challenges of gene therapy from a regulatory point of view. In this Perspective, the findings are considered from the view of European regulatory requirements for first clinical use.

  9. Modeling stochastic noise in gene regulatory systems.

    PubMed

    Meister, Arwen; Du, Chao; Li, Ye Henry; Wong, Wing Hung

    2014-03-01

    The Master equation is considered the gold standard for modeling the stochastic mechanisms of gene regulation in molecular detail, but it is too complex to solve exactly in most cases, so approximation and simulation methods are essential. However, there is still a lack of consensus about the best way to carry these out. To help clarify the situation, we review Master equation models of gene regulation, theoretical approximations based on an expansion method due to N.G. van Kampen and R. Kubo, and simulation algorithms due to D.T. Gillespie and P. Langevin. Expansion of the Master equation shows that for systems with a single stable steady-state, the stochastic model reduces to a deterministic model in a first-order approximation. Additional theory, also due to van Kampen, describes the asymptotic behavior of multistable systems. To support and illustrate the theory and provide further insight into the complex behavior of multistable systems, we perform a detailed simulation study comparing the various approximation and simulation methods applied to synthetic gene regulatory systems with various qualitative characteristics. The simulation studies show that for large stochastic systems with a single steady-state, deterministic models are quite accurate, since the probability distribution of the solution has a single peak tracking the deterministic trajectory whose variance is inversely proportional to the system size. In multistable stochastic systems, large fluctuations can cause individual trajectories to escape from the domain of attraction of one steady-state and be attracted to another, so the system eventually reaches a multimodal probability distribution in which all stable steady-states are represented proportional to their relative stability. However, since the escape time scales exponentially with system size, this process can take a very long time in large systems.

  10. Modeling stochastic noise in gene regulatory systems

    PubMed Central

    Meister, Arwen; Du, Chao; Li, Ye Henry; Wong, Wing Hung

    2014-01-01

    The Master equation is considered the gold standard for modeling the stochastic mechanisms of gene regulation in molecular detail, but it is too complex to solve exactly in most cases, so approximation and simulation methods are essential. However, there is still a lack of consensus about the best way to carry these out. To help clarify the situation, we review Master equation models of gene regulation, theoretical approximations based on an expansion method due to N.G. van Kampen and R. Kubo, and simulation algorithms due to D.T. Gillespie and P. Langevin. Expansion of the Master equation shows that for systems with a single stable steady-state, the stochastic model reduces to a deterministic model in a first-order approximation. Additional theory, also due to van Kampen, describes the asymptotic behavior of multistable systems. To support and illustrate the theory and provide further insight into the complex behavior of multistable systems, we perform a detailed simulation study comparing the various approximation and simulation methods applied to synthetic gene regulatory systems with various qualitative characteristics. The simulation studies show that for large stochastic systems with a single steady-state, deterministic models are quite accurate, since the probability distribution of the solution has a single peak tracking the deterministic trajectory whose variance is inversely proportional to the system size. In multistable stochastic systems, large fluctuations can cause individual trajectories to escape from the domain of attraction of one steady-state and be attracted to another, so the system eventually reaches a multimodal probability distribution in which all stable steady-states are represented proportional to their relative stability. However, since the escape time scales exponentially with system size, this process can take a very long time in large systems. PMID:25632368

  11. Rapid evolution of cis-regulatory sequences via local point mutations

    NASA Technical Reports Server (NTRS)

    Stone, J. R.; Wray, G. A.

    2001-01-01

    Although the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the cis-regulatory regions that control transcription. Yet, changes in gene expression are likely to constitute an important component of phenotypic evolution. We simulated the evolution of new transcription factor binding sites via local point mutations. The results indicate that new binding sites appear and become fixed within populations on microevolutionary timescales under an assumption of neutral evolution. Even combinations of two new binding sites evolve very quickly. We predict that local point mutations continually generate considerable genetic variation that is capable of altering gene expression.

  12. Rapid evolution of cis-regulatory sequences via local point mutations

    NASA Technical Reports Server (NTRS)

    Stone, J. R.; Wray, G. A.

    2001-01-01

    Although the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the cis-regulatory regions that control transcription. Yet, changes in gene expression are likely to constitute an important component of phenotypic evolution. We simulated the evolution of new transcription factor binding sites via local point mutations. The results indicate that new binding sites appear and become fixed within populations on microevolutionary timescales under an assumption of neutral evolution. Even combinations of two new binding sites evolve very quickly. We predict that local point mutations continually generate considerable genetic variation that is capable of altering gene expression.

  13. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    SciTech Connect

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  14. Regulatory Elements of the Floral Homeotic Gene AGAMOUS Identified by Phylogenetic Footprinting and ShadowingW⃞

    PubMed Central

    Hong, Ray L.; Hamaguchi, Lynn; Busch, Maximilian A.; Weigel, Detlef

    2003-01-01

    In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3-kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae species, several other motifs, but not the LFY and WUS binding sites identified previously, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for the activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection but also demonstrate that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites. PMID:12782724

  15. Identification of the regulatory sequence of anaerobically expressed locus aeg-46.5.

    PubMed Central

    Choe, M; Reznikoff, W S

    1993-01-01

    A newly identified anaerobically expressed locus, aeg-46.5, which is located at min 46.5 on Escherichia coli linkage map, was cloned and analyzed. The phenotype of this gene was studied by using a lacZ operon fusion. aeg-46.5 is induced anaerobically in the presence of nitrate in wild-type and narL cells. It is repressed by the narL gene product, as it showed derepressed anaerobic expression in narL mutant cells. We postulate that aeg-46.5 is subject to multiple regulatory systems, activation as a result of anaerobiosis, narL-independent nitrate-dependent activation, and narL-mediated repression. The regulatory region of aeg-46.5 was identified. A 304-bp DNA sequence which includes the regulatory elements was obtained, and the 5' end of aeg-46.5 mRNA was identified. It was verified that the anaerobic regulation of aeg-46.5 expression is controlled on the transcriptional level. Computer analysis predicted possible control sites for the NarL and FNR proteins. The proposed NarL site was found in a perfect-symmetry element. The aeg-46.5 regulatory elements are adjacent to, but divergent from, those of the eco gene. Images PMID:8432709

  16. Evolution of the mammalian embryonic pluripotency gene regulatory network

    PubMed Central

    Fernandez-Tresguerres, Beatriz; Cañon, Susana; Rayon, Teresa; Pernaute, Barbara; Crespo, Miguel; Torroja, Carlos; Manzanares, Miguel

    2010-01-01

    Embryonic pluripotency in the mouse is established and maintained by a gene-regulatory network under the control of a core set of transcription factors that include octamer-binding protein 4 (Oct4; official name POU domain, class 5, transcription factor 1, Pou5f1), sex-determining region Y (SRY)-box containing gene 2 (Sox2), and homeobox protein Nanog. Although this network is largely conserved in eutherian mammals, very little information is available regarding its evolutionary conservation in other vertebrates. We have compared the embryonic pluripotency networks in mouse and chick by means of expression analysis in the pregastrulation chicken embryo, genomic comparisons, and functional assays of pluripotency-related regulatory elements in ES cells and blastocysts. We find that multiple components of the network are either novel to mammals or have acquired novel expression domains in early developmental stages of the mouse. We also find that the downstream action of the mouse core pluripotency factors is mediated largely by genomic sequence elements nonconserved with chick. In the case of Sox2 and Fgf4, we find that elements driving expression in embryonic pluripotent cells have evolved by a small number of nucleotide changes that create novel binding sites for core factors. Our results show that the network in charge of embryonic pluripotency is an evolutionary novelty of mammals that is related to the comparatively extended period during which mammalian embryonic cells need to be maintained in an undetermined state before engaging in early differentiation events. PMID:21048080

  17. Evolution of the mammalian embryonic pluripotency gene regulatory network.

    PubMed

    Fernandez-Tresguerres, Beatriz; Cañon, Susana; Rayon, Teresa; Pernaute, Barbara; Crespo, Miguel; Torroja, Carlos; Manzanares, Miguel

    2010-11-16

    Embryonic pluripotency in the mouse is established and maintained by a gene-regulatory network under the control of a core set of transcription factors that include octamer-binding protein 4 (Oct4; official name POU domain, class 5, transcription factor 1, Pou5f1), sex-determining region Y (SRY)-box containing gene 2 (Sox2), and homeobox protein Nanog. Although this network is largely conserved in eutherian mammals, very little information is available regarding its evolutionary conservation in other vertebrates. We have compared the embryonic pluripotency networks in mouse and chick by means of expression analysis in the pregastrulation chicken embryo, genomic comparisons, and functional assays of pluripotency-related regulatory elements in ES cells and blastocysts. We find that multiple components of the network are either novel to mammals or have acquired novel expression domains in early developmental stages of the mouse. We also find that the downstream action of the mouse core pluripotency factors is mediated largely by genomic sequence elements nonconserved with chick. In the case of Sox2 and Fgf4, we find that elements driving expression in embryonic pluripotent cells have evolved by a small number of nucleotide changes that create novel binding sites for core factors. Our results show that the network in charge of embryonic pluripotency is an evolutionary novelty of mammals that is related to the comparatively extended period during which mammalian embryonic cells need to be maintained in an undetermined state before engaging in early differentiation events.

  18. Caenorhabditis elegans metabolic gene regulatory networks govern the cellular economy.

    PubMed

    Watson, Emma; Walhout, Albertha J M

    2014-10-01

    Diet greatly impacts metabolism in health and disease. In response to the presence or absence of specific nutrients, metabolic gene regulatory networks sense the metabolic state of the cell and regulate metabolic flux accordingly, for instance by the transcriptional control of metabolic enzymes. Here, we discuss recent insights regarding metazoan metabolic regulatory networks using the nematode Caenorhabditis elegans as a model, including the modular organization of metabolic gene regulatory networks, the prominent impact of diet on the transcriptome and metabolome, specialized roles of nuclear hormone receptors (NHRs) in responding to dietary conditions, regulation of metabolic genes and metabolic regulators by miRNAs, and feedback between metabolic genes and their regulators.

  19. Intersecting transcription networks constrain gene regulatory evolution

    PubMed Central

    Sorrells, Trevor R; Booth, Lauren N; Tuch, Brian B; Johnson, Alexander D

    2015-01-01

    Epistasis—the non-additive interactions between different genetic loci—constrains evolutionary pathways, blocking some and permitting others1–8. For biological networks such as transcription circuits, the nature of these constraints and their consequences are largely unknown. Here we describe the evolutionary pathways of a transcription network that controls the response to mating pheromone in yeasts9. A component of this network, the transcription regulator Ste12, has evolved two different modes of binding to a set of its target genes. In one group of species, Ste12 binds to specific DNA binding sites, while in another lineage it occupies DNA indirectly, relying on a second transcription regulator to recognize DNA. We show, through the construction of various possible evolutionary intermediates, that evolution of the direct mode of DNA binding was not directly accessible to the ancestor. Instead, it was contingent on a lineage-specific change to an overlapping transcription network with a different function, the specification of cell type. These results show that analyzing and predicting the evolution of cis-regulatory regions requires an understanding of their positions in overlapping networks, as this placement constrains the available evolutionary pathways. PMID:26153861

  20. Toward an orofacial gene regulatory network.

    PubMed

    Kousa, Youssef A; Schutte, Brian C

    2016-03-01

    Orofacial clefting is a common birth defect with significant morbidity. A panoply of candidate genes have been discovered through synergy of animal models and human genetics. Among these, variants in interferon regulatory factor 6 (IRF6) cause syndromic orofacial clefting and contribute risk toward isolated cleft lip and palate (1/700 live births). Rare variants in IRF6 can lead to Van der Woude syndrome (1/35,000 live births) and popliteal pterygium syndrome (1/300,000 live births). Furthermore, IRF6 regulates GRHL3 and rare variants in this downstream target can also lead to Van der Woude syndrome. In addition, a common variant (rs642961) in the IRF6 locus is found in 30% of the world's population and contributes risk for isolated orofacial clefting. Biochemical studies revealed that rs642961 abrogates one of four AP-2alpha binding sites. Like IRF6 and GRHL3, rare variants in TFAP2A can also lead to syndromic orofacial clefting with lip pits (branchio-oculo-facial syndrome). The literature suggests that AP-2alpha, IRF6 and GRHL3 are part of a pathway that is essential for lip and palate development. In addition to updating the pathways, players and pursuits, this review will highlight some of the current questions in the study of orofacial clefting.

  1. Chaotic Motifs in Gene Regulatory Networks

    PubMed Central

    Zhang, Zhaoyang; Ye, Weiming; Qian, Yu; Zheng, Zhigang; Huang, Xuhui; Hu, Gang

    2012-01-01

    Chaos should occur often in gene regulatory networks (GRNs) which have been widely described by nonlinear coupled ordinary differential equations, if their dimensions are no less than 3. It is therefore puzzling that chaos has never been reported in GRNs in nature and is also extremely rare in models of GRNs. On the other hand, the topic of motifs has attracted great attention in studying biological networks, and network motifs are suggested to be elementary building blocks that carry out some key functions in the network. In this paper, chaotic motifs (subnetworks with chaos) in GRNs are systematically investigated. The conclusion is that: (i) chaos can only appear through competitions between different oscillatory modes with rivaling intensities. Conditions required for chaotic GRNs are found to be very strict, which make chaotic GRNs extremely rare. (ii) Chaotic motifs are explored as the simplest few-node structures capable of producing chaos, and serve as the intrinsic source of chaos of random few-node GRNs. Several optimal motifs causing chaos with atypically high probability are figured out. (iii) Moreover, we discovered that a number of special oscillators can never produce chaos. These structures bring some advantages on rhythmic functions and may help us understand the robustness of diverse biological rhythms. (iv) The methods of dominant phase-advanced driving (DPAD) and DPAD time fraction are proposed to quantitatively identify chaotic motifs and to explain the origin of chaotic behaviors in GRNs. PMID:22792171

  2. Chaotic motifs in gene regulatory networks.

    PubMed

    Zhang, Zhaoyang; Ye, Weiming; Qian, Yu; Zheng, Zhigang; Huang, Xuhui; Hu, Gang

    2012-01-01

    Chaos should occur often in gene regulatory networks (GRNs) which have been widely described by nonlinear coupled ordinary differential equations, if their dimensions are no less than 3. It is therefore puzzling that chaos has never been reported in GRNs in nature and is also extremely rare in models of GRNs. On the other hand, the topic of motifs has attracted great attention in studying biological networks, and network motifs are suggested to be elementary building blocks that carry out some key functions in the network. In this paper, chaotic motifs (subnetworks with chaos) in GRNs are systematically investigated. The conclusion is that: (i) chaos can only appear through competitions between different oscillatory modes with rivaling intensities. Conditions required for chaotic GRNs are found to be very strict, which make chaotic GRNs extremely rare. (ii) Chaotic motifs are explored as the simplest few-node structures capable of producing chaos, and serve as the intrinsic source of chaos of random few-node GRNs. Several optimal motifs causing chaos with atypically high probability are figured out. (iii) Moreover, we discovered that a number of special oscillators can never produce chaos. These structures bring some advantages on rhythmic functions and may help us understand the robustness of diverse biological rhythms. (iv) The methods of dominant phase-advanced driving (DPAD) and DPAD time fraction are proposed to quantitatively identify chaotic motifs and to explain the origin of chaotic behaviors in GRNs.

  3. Deduced products of C4-dicarboxylate transport regulatory genes of Rhizobium leguminosarum are homologous to nitrogen regulatory gene products.

    PubMed Central

    Ronson, C W; Astwood, P M; Nixon, B T; Ausubel, F M

    1987-01-01

    We have sequenced two genes dctB and dctD required for the activation of the C4-dicarboxylate transport structural gene dctA in free-living Rhizobium leguminosarum. The hydropathic profile of the dctB gene product (DctB) suggested that its N-terminal region may be located in the periplasm and its C-terminal region in the cytoplasm. The C-terminal region of DctB was strongly conserved with similar regions of the products of several regulatory genes that may act as environmental sensors, including ntrB, envZ, virA, phoR, cpxA, and phoM. The N-terminal domains of the products of several regulatory genes thought to be transcriptional activators, including ntrC, ompR, virG, phoB and sfrA. In addition, the central and C-terminal regions of DctD were strongly conserved with the products of ntrC and nifA, transcriptional activators that require the alternate sigma factor rpoN (ntrA) as co-activator. The central region of DctD also contained a potential ATP-binding domain. These results are consistent with recent results that show that rpoN product is required for dctA activation, and suggest that DctB plus DctD-mediated transcriptional activation of dctA may be mechanistically similar to NtrB plus NtrC-mediated activation of glnA in E. coli. PMID:3671068

  4. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  5. Amylase and chitinase genes in Streptomyces lividans are regulated by reg1, a pleiotropic regulatory gene.

    PubMed Central

    Nguyen, J; Francou, F; Virolle, M J; Guérineau, M

    1997-01-01

    A regulatory gene, reg1, was identified in Streptomyces lividans. It encodes a 345-amino-acid protein (Reg1) which contains a helix-turn-helix DNA-binding motif in the N-terminal region. Reg1 exhibits similarity with the LacI/GalR family members over the entire sequence. It displays 95% identity with MalR (the repressor of malE in S. coelicolor), 65% identity with ORF-Sl (a putative regulatory gene of alpha-amylase of S. limosus), and 31% identity with CcpA (the carbon catabolite repressor in Bacillus subtilis). In S. lividans, the chromosomal disruption of reg1 affected the expression of several genes. The production of alpha-amylases of S. lividans and that of the alpha-amylase of S. limosus in S. lividans were enhanced in the reg1 mutant strains and relieved of carbon catabolite repression. As a result, the transcription level of the alpha-amylase of S. limosus was noticeably increased in the reg1 mutant strain. Moreover, the induction of chitinase production in S. lividans was relieved of carbon catabolite repression by glucose in the reg1 mutant strain, while the induction by chitin was lost. Therefore, reg1 can be regarded as a pleiotropic regulatory gene in S. lividans. PMID:9335287

  6. Genomic Aberrations Frequently Alter Chromatin Regulatory Genes in Chordoma

    PubMed Central

    Wang, Lu; Zehir, Ahmet; Nafa, Khedoudja; Zhou, Nengyi; Berger, Michael F.; Casanova, Jacklyn; Sadowska, Justyna; Lu, Chao; Allis, C. David; Gounder, Mrinal; Chandhanayingyong, Chandhanarat; Ladanyi, Marc; Boland, Patrick J; Hameed, Meera

    2016-01-01

    Chordoma is a rare primary bone neoplasm that is resistant to standard chemotherapies. Despite aggressive surgical management, local recurrence and metastasis is not uncommon. To identify the specific genetic aberrations that play key roles in chordoma pathogenesis, we utilized a genome-wide high-resolution SNP-array and next generation sequencing (NGS)-based molecular profiling platform to study 24 patient samples with typical histopathologic features of chordoma. Matching normal tissues were available for 16 samples. SNP-array analysis revealed nonrandom copy number losses across the genome, frequently involving 3, 9p, 1p, 14, 10, and 13. In contrast, copy number gain is uncommon in chordomas. Two minimum deleted regions were observed on 3p within a ~8 Mb segment at 3p21.1–p21.31, which overlaps SETD2, BAP1 and PBRM1. The minimum deleted region on 9p was mapped to CDKN2A locus at 9p21.3, and homozygous deletion of CDKN2A was detected in 5/22 chordomas (~23%). NGS-based molecular profiling demonstrated an extremely low level of mutation rate in chordomas, with an average of 0.5 mutations per sample for the 16 cases with matched normal. When the mutated genes were grouped based on molecular functions, many of the mutation events (~40%) were found in chromatin regulatory genes. The combined copy number and mutation profiling revealed that SETD2 is the single gene affected most frequently in chordomas, either by deletion or by mutations. Our study demonstrated that chordoma belongs to the C-class (copy number changes) tumors whose oncogenic signature is non-random multiple copy number losses across the genome and genomic aberrations frequently alter chromatin regulatory genes. PMID:27072194

  7. Integrated analysis of microRNA regulatory network in nasopharyngeal carcinoma with deep sequencing.

    PubMed

    Wang, Fan; Lu, Juan; Peng, Xiaohong; Wang, Jie; Liu, Xiong; Chen, Xiaomei; Jiang, Yiqi; Li, Xiangping; Zhang, Bao

    2016-01-22

    MicroRNAs (miRNAs) have been shown to play a critical role in the development and progression of nasopharyngeal carcinoma (NPC). Although accumulating studies have been performed on the molecular mechanisms of NPC, the miRNA regulatory networks in cancer progression remain largely unknown. Laser capture microdissection (LCM) and deep sequencing are powerful tools that can help us to detect the integrated view of miRNA-target network. Illumina Hiseq2000 deep sequencing was used to screen differentially expressed miRNAs in laser-microdessected biopsies between 12 NPC and 8 chronic nasopharyngitis patients. The result was validated by real-time PCR on 201 NPC and 25 chronic nasopharyngitis patients. The potential candidate target genes of the miRNAs were predicted using published target prediction softwares (RNAhybrid, TargetScan, Miranda, PITA), and the overlay part was analyzed in Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) biological process. The miRNA regulatory network analysis was performed using the Ingenuity Pathway Analysis (IPA) software. Eight differentially expressed miRNAs were identified between NPC and chronic nasopharyngitis patients by deep sequencing. Further qRT-PCR assays confirmed 3 down-regulated miRNAs (miR-34c-5p, miR-375 and miR-449c-5p), 4 up-regulated miRNAs (miR-205-5p, miR-92a-3p, miR-193b-3p and miR-27a-5p). Additionally, the low level of miR-34c-5p (miR-34c) was significantly correlated with advanced TNM stage. GO and KEGG enrichment analyses showed that 914 target genes were involved in cell cycle, cytokine secretion and tumor immunology, and so on. IPA revealed that cancer was the top disease associated with those dysregulated miRNAs, and the genes regulated by miR-34c were in the center of miRNA-mRNA regulatory network, including TP53, CCND1, CDK6, MET and BCL2, and the PI3K/AKT/ mTOR signaling was regarded as a significant function pathway in this network. Our study presents the current knowledge of mi

  8. Preservation of Gene Duplication Increases the Regulatory Spectrum of Ribosomal Protein Genes and Enhances Growth under Stress.

    PubMed

    Parenteau, Julie; Lavoie, Mathieu; Catala, Mathieu; Malik-Ghulam, Mustafa; Gagnon, Jules; Abou Elela, Sherif

    2015-12-22

    In baker's yeast, the majority of ribosomal protein genes (RPGs) are duplicated, and it was recently proposed that such duplications are preserved via the functional specialization of the duplicated genes. However, the origin and nature of duplicated RPGs' (dRPGs) functional specificity remain unclear. In this study, we show that differences in dRPG functions are generated by variations in the modality of gene expression and, to a lesser extent, by protein sequence. Analysis of the sequence and expression patterns of non-intron-containing RPGs indicates that each dRPG is controlled by specific regulatory sequences modulating its expression levels in response to changing growth conditions. Homogenization of dRPG sequences reduces cell tolerance to growth under stress without changing the number of expressed genes. Together, the data reveal a model where duplicated genes provide a means for modulating the expression of ribosomal proteins in response to stress.

  9. Computational inference of gene regulatory networks: Approaches, limitations and opportunities.

    PubMed

    Banf, Michael; Rhee, Seung Y

    2017-01-01

    Gene regulatory networks lie at the core of cell function control. In E. coli and S. cerevisiae, the study of gene regulatory networks has led to the discovery of regulatory mechanisms responsible for the control of cell growth, differentiation and responses to environmental stimuli. In plants, computational rendering of gene regulatory networks is gaining momentum, thanks to the recent availability of high-quality genomes and transcriptomes and development of computational network inference approaches. Here, we review current techniques, challenges and trends in gene regulatory network inference and highlight challenges and opportunities for plant science. We provide plant-specific application examples to guide researchers in selecting methodologies that suit their particular research questions. Given the interdisciplinary nature of gene regulatory network inference, we tried to cater to both biologists and computer scientists to help them engage in a dialogue about concepts and caveats in network inference. Specifically, we discuss problems and opportunities in heterogeneous data integration for eukaryotic organisms and common caveats to be considered during network model evaluation. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.

  10. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.

    1994-07-15

    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  11. A General Approach for Identifying Distant Regulatory Elements Applied to the Gdf6 Gene

    PubMed Central

    Mortlock, Douglas P.; Guenther, Catherine; Kingsley, David M.

    2003-01-01

    Regulatory sequences in higher genomes can map large distances from gene coding regions, and cannot yet be identified by simple inspection of primary DNA sequence information. Here we describe an efficient method of surveying large genomic regions for gene regulatory information, and subdividing complex sets of distant regulatory elements into smaller intervals for detailed study. The mouse Gdf6 gene is expressed in a number of distinct embryonic locations that are involved in the patterning of skeletal and soft tissues. To identify sequences responsible for Gdf6 regulation, we first isolated a series of overlapping bacterial artificial chromosomes (BACs) that extend varying distances upstream and downstream of the gene. A LacZ reporter cassette was integrated into the Gdf6 transcription unit of each BAC using homologous recombination in bacteria. Each modified BAC was injected into fertilized mouse eggs, and founder transgenic embryos were analyzed for LacZ expression mid-gestation. The overlapping segments defined by the BAC clones revealed five separate regulatory regions that drive LacZ expression in 11 distinct anatomical locations. To further localize sequences that control expression in developing skeletal joints, we created a series of BAC constructs with precise deletions across a putative joint-control region. This approach further narrowed the critical control region to an area containing several stretches of sequence that are highly conserved between mice and humans. A distant 2.9-kilobase fragment containing the highly conserved regions is able to direct very specific expression of a minimal promoter/LacZ reporter in proximal limb joints. These results demonstrate that even distant, complex regulatory sequences can be identified using a combination of BAC scanning, BAC deletion, and comparative sequencing approaches. PMID:12915490

  12. Phenotype accessibility and noise in random threshold gene regulatory networks.

    PubMed

    Pinho, Ricardo; Garcia, Victor; Feldman, Marcus W

    2014-01-01

    Evolution requires phenotypic variation in a population of organisms for selection to function. Gene regulatory processes involved in organismal development affect the phenotypic diversity of organisms. Since only a fraction of all possible phenotypes are predicted to be accessed by the end of development, organisms may evolve strategies to use environmental cues and noise-like fluctuations to produce additional phenotypic diversity, and hence to enhance the speed of adaptation. We used a generic model of organismal development --gene regulatory networks-- to investigate how different levels of noise on gene expression states (i.e. phenotypes) may affect access to new, unique phenotypes, thereby affecting phenotypic diversity. We studied additional strategies that organisms might adopt to attain larger phenotypic diversity: either by augmenting their genome or the number of gene expression states. This was done for different types of gene regulatory networks that allow for distinct levels of regulatory influence on gene expression or are more likely to give rise to stable phenotypes. We found that if gene expression is binary, increasing noise levels generally decreases phenotype accessibility for all network types studied. If more gene expression states are considered, noise can moderately enhance the speed of discovery if three or four gene expression states are allowed, and if there are enough distinct regulatory networks in the population. These results were independent of the network types analyzed, and were robust to different implementations of noise. Hence, for noise to increase the number of accessible phenotypes in gene regulatory networks, very specific conditions need to be satisfied. If the number of distinct regulatory networks involved in organismal development is large enough, and the acquisition of more genes or fine tuning of their expression states proves costly to the organism, noise can be useful in allowing access to more unique phenotypes.

  13. Phenotypic plasticity can facilitate adaptive evolution in gene regulatory circuits

    PubMed Central

    2011-01-01

    Background Many important evolutionary adaptations originate in the modification of gene regulatory circuits to produce new gene activity phenotypes. How do evolving populations sift through an astronomical number of circuits to find circuits with new adaptive phenotypes? The answer may often involve phenotypic plasticity. Phenotypic plasticity allows a genotype to produce different - alternative - phenotypes after non-genetic perturbations that include gene expression noise, environmental change, or epigenetic modification. Results We here analyze a well-studied model of gene regulatory circuits. A circuit's genotype encodes the regulatory interactions among circuit genes, and its phenotype corresponds to a stable gene activity pattern the circuit forms. For this model, we study how genotypes are arranged in genotype space, where the distance between two genotypes reflects the number of regulatory mutations that set those genotypes apart. Specifically, we address whether this arrangement favors adaptive evolution mediated by plasticity. We find that plasticity facilitates the origin of genotypes that produce a new phenotype in response to non-genetic perturbations. We also find that selection can then stabilize the new phenotype genetically, allowing it to become a circuit's dominant gene expression phenotype. These are generic properties of the circuits we study here. Conclusions Taken together, our observations suggest that phenotypic plasticity frequently facilitates the evolution of novel beneficial gene activity patterns in gene regulatory circuits. PMID:21211007

  14. Robustness and Accuracy in Sea Urchin Developmental Gene Regulatory Networks.

    PubMed

    Ben-Tabou de-Leon, Smadar

    2016-01-01

    Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.

  15. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

    PubMed

    Winck, Flavia Vischi; Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  16. Regulatory Genes Controlling Anthocyanin Pigmentation Are Functionally Conserved among Plant Species and Have Distinct Sets of Target Genes.

    PubMed Central

    Quattrocchio, F; Wing, JF; Leppen, H; Mol, J; Koes, RE

    1993-01-01

    In this study, we demonstrate that in petunia at least four regulatory genes (anthocyanin-1 [an1], an2, an4, and an11) control transcription of a subset of structural genes from the anthocyanin pathway by using a combination of RNA gel blot analysis, transcription run-on assays, and transient expression assays. an2- and an11- mutants could be transiently complemented by the maize regulatory genes Leaf color (Lc) or Colorless-1 (C1), respectively, whereas an1- mutants only by Lc and C1 together. In addition, the combination of Lc and C1 induces pigment accumulation in young leaves. This indicates that Lc and C1 are both necessary and sufficient to produce pigmentation in leaf cells. Regulatory pigmentation genes in maize and petunia control different sets of structural genes. The maize Lc and C1 genes expressed in petunia differentially activate the promoters of the chalcone synthase genes chsA and chsJ in the same way that the homologous petunia genes do. This suggests that the regulatory proteins in both species are functionally similar and that the choice of target genes is determined by their promoter sequences. We present an evolutionary model that explains the differences in regulation of pigmentation pathways of maize, petunia, and snapdragon. PMID:12271045

  17. Initial deployment of the cardiogenic gene regulatory network in the basal chordate, Ciona intestinalis.

    PubMed

    Woznica, Arielle; Haeussler, Maximilian; Starobinska, Ella; Jemmett, Jessica; Li, Younan; Mount, David; Davidson, Brad

    2012-08-01

    The complex, partially redundant gene regulatory architecture underlying vertebrate heart formation has been difficult to characterize. Here, we dissect the primary cardiac gene regulatory network in the invertebrate chordate, Ciona intestinalis. The Ciona heart progenitor lineage is first specified by Fibroblast Growth Factor/Map Kinase (FGF/MapK) activation of the transcription factor Ets1/2 (Ets). Through microarray analysis of sorted heart progenitor cells, we identified the complete set of primary genes upregulated by FGF/Ets shortly after heart progenitor emergence. Combinatorial sequence analysis of these co-regulated genes generated a hypothetical regulatory code consisting of Ets binding sites associated with a specific co-motif, ATTA. Through extensive reporter analysis, we confirmed the functional importance of the ATTA co-motif in primary heart progenitor gene regulation. We then used the Ets/ATTA combination motif to successfully predict a number of additional heart progenitor gene regulatory elements, including an intronic element driving expression of the core conserved cardiac transcription factor, GATAa. This work significantly advances our understanding of the Ciona heart gene network. Furthermore, this work has begun to elucidate the precise regulatory architecture underlying the conserved, primary role of FGF/Ets in chordate heart lineage specification.

  18. Implications of functional similarity for gene regulatory interactions

    PubMed Central

    Glass, Kimberly; Ott, Edward; Losert, Wolfgang; Girvan, Michelle

    2012-01-01

    If one gene regulates another, those two genes are likely to be involved in many of the same biological functions. Conversely, shared biological function may be suggestive of the existence and nature of a regulatory interaction. With this in mind, we develop a measure of functional similarity between genes based on annotations made to the Gene Ontology in which the magnitude of their functional relationship is also indicative of a regulatory relationship. In contrast to other measures that have previously been used to quantify the functional similarity between genes, our measure scales the strength of any shared functional annotation by the frequency of that function's appearance across the entire set of annotations. We apply our method to both Escherichia coli and Saccharomyces cerevisiae gene annotations and find that the strength of our scaled similarity measure is more predictive of known regulatory interactions than previously published measures of functional similarity. In addition, we observe that the strength of the scaled similarity measure is correlated with the structural importance of links in the known regulatory network. By contrast, other measures of functional similarity are not indicative of any structural importance in the regulatory network. We therefore conclude that adequately adjusting for the frequency of shared biological functions is important in the construction of a functional similarity measure aimed at elucidating the existence and nature of regulatory interactions. We also compare the performance of the scaled similarity with a high-throughput method for determining regulatory interactions from gene expression data and observe that the ontology-based approach identifies a different subset of regulatory interactions compared with the gene expression approach. We show that combining predictions from the scaled similarity with those from the reconstruction algorithm leads to a significant improvement in the accuracy of the reconstructed

  19. Sequence diversity of the Trypanosoma cruzi complement regulatory protein family.

    PubMed

    Beucher, M; Norris, K A

    2008-02-01

    As a central component of innate immunity, complement activation is a critical mechanism of containment and clearance of microbial pathogens in advance of the development of acquired immunity. Several pathogens restrict complement activation through the acquisition of host proteins that regulate complement activation or through the production of their own complement regulatory molecules (M. K. Liszewski, M. K. Leung, R. Hauhart, R. M. Buller, P. Bertram, X. Wang, A. M. Rosengard, G. J. Kotwal, and J. P. Atkinson, J. Immunol. 176:3725-3734, 2006; J. Lubinski, L. Wang, D. Mastellos, A. Sahu, J. D. Lambris, and H. M. Friedman, J. Exp. Med. 190:1637-1646, 1999). The infectious stage of the protozoan parasite Trypanosoma cruzi produces a surface-anchored complement regulatory protein (CRP) that functions to inhibit alternative and classical pathway complement activation (K. A. Norris, B. Bradt, N. R. Cooper, and M. So, J. Immunol. 147:2240-2247, 1991). This study addresses the genomic complexity of the T. cruzi CRP and its relationship to the T. cruzi supergene family comprising active trans-sialidase (TS) and TS-like proteins. The TS superfamily consists of several functionally distinct subfamilies that share a characteristic sialidase domain at their amino termini. These TS families include active TS, adhesions, CRPs, and proteins of unknown functions (G. A. Cross and G. B. Takle, Annu. Rev. Microbiol. 47:385-411, 1993). A sequence comparison search of GenBank using BLASTP revealed several full-length paralogs of CRP. These proteins share significant homology at their amino termini and a strong spatial conservation of cysteine residues. Alternative pathway complement regulation was confirmed for CRP paralogs with 58% (low) and 83% (high) identity to AAB49414. CRPs are functionally similar to the microbial and mammalian proteins that regulate complement activation. Sequence alignment of mammalian complement control proteins to CRP showed that these sequences are

  20. Disease gene identification strategies for exome sequencing

    PubMed Central

    Gilissen, Christian; Hoischen, Alexander; Brunner, Han G; Veltman, Joris A

    2012-01-01

    Next generation sequencing can be used to search for Mendelian disease genes in an unbiased manner by sequencing the entire protein-coding sequence, known as the exome, or even the entire human genome. Identifying the pathogenic mutation amongst thousands to millions of genomic variants is a major challenge, and novel variant prioritization strategies are required. The choice of these strategies depends on the availability of well-phenotyped patients and family members, the mode of inheritance, the severity of the disease and its population frequency. In this review, we discuss the current strategies for Mendelian disease gene identification by exome resequencing. We conclude that exome strategies are successful and identify new Mendelian disease genes in approximately 60% of the projects. Improvements in bioinformatics as well as in sequencing technology will likely increase the success rate even further. Exome sequencing is likely to become the most commonly used tool for Mendelian disease gene identification for the coming years. PMID:22258526

  1. Control of Hoxd gene transcription in the mammary bud by hijacking a preexisting regulatory landscape

    PubMed Central

    Schep, Ruben; Necsulea, Anamaria; Rodríguez-Carballo, Eddie; Guerreiro, Isabel; Andrey, Guillaume; Nguyen Huynh, Thi Hanh; Marcet, Virginie; Zákány, Jozsef; Duboule, Denis; Beccari, Leonardo

    2016-01-01

    Vertebrate Hox genes encode transcription factors operating during the development of multiple organs and structures. However, the evolutionary mechanism underlying this remarkable pleiotropy remains to be fully understood. Here, we show that Hoxd8 and Hoxd9, two genes of the HoxD complex, are transcribed during mammary bud (MB) development. However, unlike in other developmental contexts, their coexpression does not rely on the same regulatory mechanism. Hoxd8 is regulated by the combined activity of closely located sequences and the most distant telomeric gene desert. On the other hand, Hoxd9 is controlled by an enhancer-rich region that is also located within the telomeric gene desert but has no impact on Hoxd8 transcription, thus constituting an exception to the global regulatory logic systematically observed at this locus. The latter DNA region is also involved in Hoxd gene regulation in other contexts and strongly interacts with Hoxd9 in all tissues analyzed thus far, indicating that its regulatory activity was already operational before the appearance of mammary glands. Within this DNA region and neighboring a strong limb enhancer, we identified a short sequence conserved in therian mammals and capable of enhancer activity in the MBs. We propose that Hoxd gene regulation in embryonic MBs evolved by hijacking a preexisting regulatory landscape that was already at work before the emergence of mammals in structures such as the limbs or the intestinal tract. PMID:27856734

  2. Ethanol utilization regulatory protein: profile alignments give no evidence of origin through aldehyde and alcohol dehydrogenase gene fusion.

    PubMed Central

    Nicholas, H. B.; Persson, B.; Jörnvall, H.; Hempel, J.

    1995-01-01

    The suggestion that the ethanol regulatory protein from Aspergillus has its evolutionary origin in a gene fusion between aldehyde and alcohol dehydrogenase genes (Hawkins AR, Lamb HK, Radford A, Moore JD, 1994, Gene 146:145-158) has been tested by profile analysis with aldehyde and alcohol dehydrogenase family profiles. We show that the degree and kind of similarity observed between these profiles and the ethanol regulatory protein sequence is that expected from random sequences of the same composition. This level of similarity fails to support the suggested gene fusion. PMID:8580855

  3. Experimental approaches for gene regulatory network construction: the chick as a model system

    PubMed Central

    Streit, Andrea; Tambalo, Monica; Chen, Jingchen; Grocott, Timothy; Anwar, Maryam; Sosinsky, Alona; Stern, Claudio D.

    2012-01-01

    Setting up the body plan during embryonic development requires the coordinated action of many signals and transcriptional regulators in a precise temporal sequence and spatial pattern. The last decades have seen an explosion of information describing the molecular control of many developmental processes. The next challenge is to integrate this information into logic ‘wiring diagrams’ that visualise gene actions and outputs, have predictive power and point to key control nodes. Here we provide an experimental workflow on how to construct gene regulatory networks using the chick as model system. Keywords: transcription factors, transcriptome analysis, conserved regulatory elements PMID:23174848

  4. Transient and stable GFP expression in germ cells by the vasa regulatory sequences from the red seabream (Pagrus major).

    PubMed

    Lin, Fan; Liu, Qinghua; Li, Mingyou; Li, Zhendong; Hong, Ni; Li, Jun; Hong, Yunhan

    2012-01-01

    Primordial germ cells (PGCs) are the precursors of gametes responsible for genetic transmission to the next generation. They provide an ideal system for cryopreservation and restoration of biodiversity. Recently, considerable attention has been raised to visualize, isolate and transplant PGCs within and between species. In fish, stable PGC visualization in live embryo and individual has been limited to laboratory fish models such as medaka and zebrafish. One exception is the rainbow trout, which represents the only species with aquaculture importance and has GFP-labeled germ cells throughout development. PGCs can be transiently labeled by embryonic injection of mRNA containing green fluorescence protein gene (GFP) and 3'-untranslated region (3'-UTR) of a maternal germ gene such as vasa, nos1, etc. Stable PGC labeling can be achieved through production of transgenic animals by some transcriptional regulatory sequences from germ genes, such as the vasa promoter and 3'-UTR. In this study, we reported the functional analyses of the red seabream vasa (Pmvas) regulatory sequences, using medaka as a model system. It was showed that injection of GFP-Pmvas3'UTR mRNA was able to label medaka PGCs during embryogenesis. Besides, we have constructed pPmvasGFP transgenic vector, and established a stable transgenic medaka line exhibiting GFP expression in germ cells including PGCs, mitotic and meiotic germ cells of both sexes, under control of the Pmvas transcriptional regulatory sequences. It is concluded that the Pmvas regulatory sequences examined in this study are sufficient for germ cell expression and labeling.

  5. Hepatoma cell-specific ganciclovir-mediated toxicity of a lentivirally transduced HSV-TkEGFP fusion protein gene placed under the control of rat alpha-fetoprotein gene regulatory sequences.

    PubMed

    Uch, Rathviro; Gérolami, René; Faivre, Jamila; Hardwigsen, Jean; Mathieu, Sylvie; Mannoni, Patrice; Bagnis, Claude

    2003-09-01

    Suicide gene therapy combining herpes simplex virus thymidine kinase gene transfer and ganciclovir administration can be envisioned as a powerful therapeutical approach in the treatment of hepatocellular carcinoma; however, safety issues regarding transgene expression in parenchyma cells have to be addressed. In this study, we constructed LATKW, a lentiviral vector expressing the HSV-TkEGFP gene placed under the control of the promoter elements that control the expression of the rat alpha-fetoprotein, and assayed its specific expression in vitro in hepatocarcinoma and nonhepatocarcinoma human cell lines, and in epidermal growth factor stimulated human primary hepatocytes. Using LATKW, a strong expression of the transgene was found in transduced hepatocarcinoma cells compared to a very low expression in nonhepatocarcinoma human cell lines, as assessed by Northern blot, RT-PCR, FACS analysis and ganciclovir-mediated toxicity assay, and no expression was found in lentivirally transduced normal human hepatocytes. Altogether, these results demonstrate the possibility to use a lentivirally transduced expression unit containing the rat alpha-fetoprotein promoter to restrict the HSV-TK-mediated induced GCV sensitivity to human hepatocarcinoma cells.

  6. A Novel Regulatory Gene, Tri10, Controls Trichothecene Toxin Production and Gene Expression

    PubMed Central

    Tag, Andrew G.; Garifullina, Gulnara F.; Peplow, Andrew W.; Ake, Charles; Phillips, T. D.; Hohn, Thomas M.; Beremand, Marian N.

    2001-01-01

    We report here the characterization of Tri10, a novel regulatory gene within the trichothecene gene cluster. Comparison of Tri10 genomic and mRNA sequences revealed that removal of a single 77-bp intron provided a 1,260-bp open reading frame, encoding a 420-amino-acid protein. Disruption of Tri10 in Fusarium sporotrichioides abolished T-2 toxin production and dramatically decreased the transcript accumulation for four trichothecene genes (Tri4, Tri5, Tri6, and Tri101) and an apparent farnesyl pyrophosphate synthetase (Fpps) gene. Conversely, homologous integration of a disruption vector by a single upstream crossover event significantly increased T-2 toxin production and elevated the transcript accumulation of the trichothecene genes and Fpps. Further analysis revealed that disruption of Tri10, and to a greater extent the disruption of Tri6, increased sensitivity to T-2 toxin under certain growth conditions. Although Tri10 is conserved in Fusarium graminearum and Fusarium sambucinum and clearly plays a central role in regulating trichothecene gene expression, it does not show any significant matches to proteins of known or predicted function or to motifs except a single transmembrane domain. We suggest a model in which Tri10 acts upstream of the cluster-encoded transcription factor TRI6 and is necessary for full expression of both the other trichothecene genes and the genes for the primary metabolic pathway that precedes the trichothecene biosynthetic pathway, as well as for wild-type levels of trichothecene self-protection. We further suggest the presence of a regulatory loop where Tri6 is not required for the transcription of Tri10 but is required to limit the expression of Tri10. PMID:11679358

  7. Synaptotagmin gene content of the sequenced genomes.

    PubMed

    Craxton, Molly

    2004-07-06

    Synaptotagmins exist as a large gene family in mammals. There is much interest in the function of certain family members which act crucially in the regulated synaptic vesicle exocytosis required for efficient neurotransmission. Knowledge of the functions of other family members is relatively poor and the presence of Synaptotagmin genes in plants indicates a role for the family as a whole which is wider than neurotransmission. Identification of the Synaptotagmin genes within completely sequenced genomes can provide the entire Synaptotagmin gene complement of each sequenced organism. Defining the detailed structures of all the Synaptotagmin genes and their encoded products can provide a useful resource for functional studies and a deeper understanding of the evolution of the gene family. The current rapid increase in the number of sequenced genomes from different branches of the tree of life, together with the public deposition of evolutionarily diverse transcript sequences make such studies worthwhile. I have compiled a detailed list of the Synaptotagmin genes of Caenorhabditis, Anopheles, Drosophila, Ciona, Danio, Fugu, Mus, Homo, Arabidopsis and Oryza by examining genomic and transcript sequences from public sequence databases together with some transcript sequences obtained by cDNA library screening and RT-PCR. I have compared all of the genes and investigated the relationship between plant Synaptotagmins and their non-Synaptotagmin counterparts. I have identified and compared 98 Synaptotagmin genes from 10 sequenced genomes. Detailed comparison of transcript sequences reveals abundant and complex variation in Synaptotagmin gene expression and indicates the presence of Synaptotagmin genes in all animals and land plants. Amino acid sequence comparisons indicate patterns of conservation and diversity in function. Phylogenetic analysis shows the origin of Synaptotagmins in multicellular eukaryotes and their great diversification in animals. Synaptotagmins occur in

  8. The companions: regulatory T cells and gene therapy

    PubMed Central

    Eghtesad, Saman; Morel, Penelope A; Clemens, Paula R

    2009-01-01

    Undesired immunological responses to products of therapeutic gene replacement have been obstacles to successful gene therapy. Understanding such responses of the host immune system to achieve immunological tolerance to a transferred gene product is therefore crucial. In this article, we review relevant studies of immunological responses to gene replacement therapy, the role of immunological tolerance mediated by regulatory T cells in down-regulating the unwanted immune responses, and the interrelationship of the two topics. PMID:19368560

  9. Emerging role of regulatory T cells in gene transfer.

    PubMed

    Cao, Ou; Furlan-Freguia, Christian; Arruda, Valder R; Herzog, Roland W

    2007-10-01

    Induction and maintenance of immune tolerance to therapeutic transgene products are key requirements for successful gene replacement therapies. Gene transfer may also be used to specifically induce immune tolerance and thereby augment other types of therapies. Similarly, gene therapies for treatment of autoimmune diseases are being developed in order to restore tolerance to self-antigens. Regulatory T cells have emerged as key players in many aspects of immune tolerance, and a rapidly increasing body of work documents induction and/or activation of regulatory T cells by gene transfer. Regulatory T cells may suppress antibody formation and cytotoxic T cell responses and may be critical for immune tolerance to therapeutic proteins. In this regard, CD4(+)CD25(+) regulatory T cells have been identified as important components of tolerance in several gene transfer protocols, including hepatic in vivo gene transfer. Augmentation of regulatory T cell responses should be a promising new tool to achieve tolerance and avoid immune-mediated rejection of gene therapy. During the past decade, it has become obvious that immune regulation is an important and integral component of tolerance to self-antigens and of many forms of induced tolerance. Gene therapy can only be successful if the immune system does not reject the therapeutic transgene product. Recent studies provide a rapidly growing body of evidence that regulatory T cells (T(reg)) are involved and often play a crucial role in tolerance to proteins expressed by means of gene transfer. This review seeks to provide an overview of these data and their implications for gene therapy.

  10. The molecular and gene regulatory signature of a neuron

    PubMed Central

    Hobert, Oliver; Carrera, Inés; Stefanakis, Nikolaos

    2010-01-01

    Neuron-type specific gene batteries define the morphological and functional diversity of cell types in the nervous system. Here, we discuss the composition of neuron-type specific gene batteries and illustrate gene regulatory strategies employed by distinct organisms from C.elegans to higher vertebrates, which are instrumental in determining the unique gene expression profile and molecular composition of individual neuronal cell types. Based on principles learned from prokaryotic gene regulation, we argue that neuronal, terminal gene batteries are functionally grouped into parallel acting “regulons”. The theoretical concepts discussed here provide testable hypotheses for future experimental analysis into the exact gene regulatory mechanisms that are employed in the generation of neuronal diversity and identity. PMID:20663572

  11. Enhancer Variants Synergistically Drive Dysfunction of a Gene Regulatory Network In Hirschsprung Disease

    SciTech Connect

    Chatterjee, Sumantra; Kapoor, Ashish; Akiyama, Jennifer A.; Auer, Dallas R.; Lee, Dongwon; Gabriel, Stacey; Berrios, Courtney; Pennacchio, Len A.; Chakravarti, Aravinda

    2016-10-01

    Common sequence variants in cis-regulatory elements (CREs) are suspected etiological causes of complex disorders. We previously identified an intronic enhancer variant in the RET gene disrupting SOX10 binding and increasing Hirschsprung disease (HSCR) risk 4-fold. We now show that two other functionally independent CRE variants, one binding Gata2 and the other binding Rarb, also reduce Ret expression and increase risk 2- and 1.7-fold. By studying human and mouse fetal gut tissues and cell lines, we demonstrate that reduced RET expression propagates throughout its gene regulatory network, exerting effects on both its positive and negative feedback components. We also provide evidence that the presence of a combination of CRE variants synergistically reduces RET expression and its effects throughout the GRN. These studies show how the effects of functionally independent non-coding variants in a coordinated gene regulatory network amplify their individually small effects, providing a model for complex disorders.

  12. Gene regulatory networks modelling using a dynamic evolutionary hybrid

    PubMed Central

    2010-01-01

    Background Inference of gene regulatory networks is a key goal in the quest for understanding fundamental cellular processes and revealing underlying relations among genes. With the availability of gene expression data, computational methods aiming at regulatory networks reconstruction are facing challenges posed by the data's high dimensionality, temporal dynamics or measurement noise. We propose an approach based on a novel multi-layer evolutionary trained neuro-fuzzy recurrent network (ENFRN) that is able to select potential regulators of target genes and describe their regulation type. Results The recurrent, self-organizing structure and evolutionary training of our network yield an optimized pool of regulatory relations, while its fuzzy nature avoids noise-related problems. Furthermore, we are able to assign scores for each regulation, highlighting the confidence in the retrieved relations. The approach was tested by applying it to several benchmark datasets of yeast, managing to acquire biologically validated relations among genes. Conclusions The results demonstrate the effectiveness of the ENFRN in retrieving biologically valid regulatory relations and providing meaningful insights for better understanding the dynamics of gene regulatory networks. The algorithms and methods described in this paper have been implemented in a Matlab toolbox and are available from: http://bioserver-1.bioacademy.gr/DataRepository/Project_ENFRN_GRN/. PMID:20298548

  13. Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data

    PubMed Central

    2013-01-01

    Background High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. Results We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. Conclusions We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments. PMID:24053776

  14. Human diabetes associated with defects in nuclear regulatory proteins for the insulin receptor gene.

    PubMed Central

    Brunetti, A; Brunetti, L; Foti, D; Accili, D; Goldfine, I D

    1996-01-01

    The control of gene transcription is mediated by sequence-specific DNA-binding proteins (trans-acting factors) that bind to upstream regulatory elements (cis elements). We have previously identified two DNA-binding proteins that specifically interact with two unique AT-rich sequences of the 5' regulatory region of the insulin receptor gene which have in vivo promoter activity. Herein we have investigated the expression of these DNA-binding proteins in cells from two unrelated patients with insulin resistance and non-insulin-dependent diabetes mellitus. In these patients, the insulin receptor gene was normal. In EBV-transformed lymphoblasts from both patients, insulin receptor mRNA levels and insulin receptor expression were decreased. The expression of nuclear-binding proteins for the 5' regulatory region of the insulin receptor gene was markedly reduced, and this defect paralleled the decrease in insulin receptor protein expression. These studies indicate that DNA-binding proteins to the regulatory region of the insulin receptor gene are important for expression of the insulin receptor. Further, they suggest that in affected individuals, defects in the expression of these proteins may cause decreased insulin receptor expression and insulin resistance. PMID:8550844

  15. Estimating Gene Regulatory Networks with pandaR.

    PubMed

    Schlauch, Daniel; Paulson, Joseph N; Young, Albert; Glass, Kimberly; Quackenbush, John

    2017-03-11

    PANDA (Passing Attributes betweenNetworks forData Assimilation) is a gene regulatory network inference method that begins with amodel of transcription factor-target gene interactions and usesmessage passing to update the network model given available transcriptomic and protein-protein interaction data. PANDA is used to estimate networks for each experimental group and the network models are then compared between groups to explore transcriptional processes that distinguish the groups. We present pandaR (bioconductor.org/packages/pandaR), a Bioconductor package that implements PANDA and provides a framework for exploratory data analysis on gene regulatory networks.

  16. Time-Delayed Models of Gene Regulatory Networks

    PubMed Central

    Parmar, K.; Blyuss, K. B.; Kyrychko, Y. N.; Hogan, S. J.

    2015-01-01

    We discuss different mathematical models of gene regulatory networks as relevant to the onset and development of cancer. After discussion of alternative modelling approaches, we use a paradigmatic two-gene network to focus on the role played by time delays in the dynamics of gene regulatory networks. We contrast the dynamics of the reduced model arising in the limit of fast mRNA dynamics with that of the full model. The review concludes with the discussion of some open problems. PMID:26576197

  17. Systems Approaches to Identifying Gene Regulatory Networks in Plants

    PubMed Central

    Long, Terri A.; Brady, Siobhan M.; Benfey, Philip N.

    2009-01-01

    Complex gene regulatory networks are composed of genes, noncoding RNAs, proteins, metabolites, and signaling components. The availability of genome-wide mutagenesis libraries; large-scale transcriptome, proteome, and metabalome data sets; and new high-throughput methods that uncover protein interactions underscores the need for mathematical modeling techniques that better enable scientists to synthesize these large amounts of information and to understand the properties of these biological systems. Systems biology approaches can allow researchers to move beyond a reductionist approach and to both integrate and comprehend the interactions of multiple components within these systems. Descriptive and mathematical models for gene regulatory networks can reveal emergent properties of these plant systems. This review highlights methods that researchers are using to obtain large-scale data sets, and examples of gene regulatory networks modeled with these data. Emergent properties revealed by the use of these network models and perspectives on the future of systems biology are discussed. PMID:18616425

  18. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species

  19. GENE SEQUENCE HOMOLOGY OF CHEMOKINES ACROSS SPECIES

    USDA-ARS?s Scientific Manuscript database

    The abundance of expressed gene and protein sequences available in the biological information databases facilitates comparison of protein homologies. A high degree of sequence similarity typically implies homology regarding structure and function and may provide clues to antibody cross-react...

  20. Candidate regulatory sequence elements for cell cycle-dependent transcription in Saccharomyces cerevisiae.

    PubMed

    Wolfsberg, T G; Gabrielian, A E; Campbell, M J; Cho, R J; Spouge, J L; Landsman, D

    1999-08-01

    Recent developments in genome-wide transcript monitoring have led to a rapid accumulation of data from gene expression studies. Such projects highlight the need for methods to predict the molecular basis of transcriptional coregulation. A microarray project identified the 420 yeast transcripts whose synthesis displays cell cycle-dependent periodicity. We present here a statistical technique we developed to identify the sequence elements that may be responsible for this cell cycle regulation. Because most gene regulatory sites contain a short string of highly conserved nucleotides, any such strings that are involved in gene regulation will occur frequently in the upstream regions of the genes that they regulate, and rarely in the upstream regions of other genes. Our strategy therefore utilizes statistical procedures to identify short oligomers, five or six nucleotides in length, that are over-represented in upstream regions of genes whose expression peaks at the same phase of the cell cycle. We report, with a high level of confidence, that 9 hexamers and 12 pentamers are over-represented in the upstream regions of genes whose expression peaks at the early G(1), late G(1), S, G(2), or M phase of the cell cycle. Some of these sequence elements show a preference for a particular orientation, and others, through a separate statistical test, for a particular position upstream of the ATG start codon. The finding that the majority of the statistically significant sequence elements are located in late G(1) upstream regions correlates with other experiments that identified the late G(1)/early S boundary as a vital cell cycle control point. Our results highlight the importance of MCB, an element implicated previously in late G(1)/early S gene regulation, as most of the late G(1) oligomers contain the MCB sequence or variations thereof. It is striking that most MCB-like sequences localize to a specific region upstream of the ATG start codon. Additional sequences that we have

  1. Characterization of the Cis-Regulatory Region of the Drosophila Homeotic Gene Sex Combs Reduced

    PubMed Central

    Gindhart-Jr., J. G.; King, A. N.; Kaufman, T. C.

    1995-01-01

    The Drosophila homeotic gene Sex combs reduced (Scr) controls the segmental identity of the labial and prothoracic segments in the embryo and adult. It encodes a sequence-specific transcription factor that controls, in concert with other gene products, differentiative pathways of tissues in which Scr is expressed. During embryogenesis, Scr accumulation is observed in a discrete spatiotemporal pattern that includes the labial and prothoracic ectoderm, the subesophageal ganglion of the ventral nerve cord and the visceral mesoderm of the anterior and posterior midgut. Previous analyses have demonstrated that breakpoint mutations located in a 75-kb interval, including the Scr transcription unit and 50 kb of upstream DNA, cause Scr misexpression during development, presumably because these mutations remove Scr cis-regulatory sequences from the proximity of the Scr promoter. To gain a better understanding of the regulatory interactions necessary for the control of Scr transcription during embryogenesis, we have begun a molecular analysis of the Scr regulatory interval. DNA fragments from this 75-kb region were subcloned into P-element vectors containing either an Scr-lacZ or hsp70-lacZ fusion gene, and patterns of reporter gene expression were assayed in transgenic embryos. Several fragments appear to contain Scr regulatory sequences, as they direct reporter gene expression in patterns similar to those normally observed for Scr, whereas other DNA fragments direct Scr reporter gene expression in developmentally interesting but non-Scr-like patterns during embryogenesis. Scr expression in some tissues appears to be controlled by multiple regulatory elements that are separated, in some cases, by more than 20 kb of intervening DNA. Interestingly, regulatory sequences that direct reporter gene expression in an Scr-like pattern in the anterior and posterior midgut are imbedded in the regulatory region of the segmentation gene fushi tarazu (ftz), which is normally located

  2. Characterization of the cis-regulatory region of the Drosophila homeotic gene Sex combs reduced

    SciTech Connect

    Gindhart, J.G. Jr.; King, N.A.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) controls the segmental identity of the labial and prothoracic segments in the embryo and adult. It encodes a sequence-specific transcription factor that controls, in concert with other gene products, differentiative pathways of tissues in which Scr is expressed. During embryogenesis, Scr accumulation is observed in a discrete spatiotemporal pattern that includes the labial and prothoracic ectoderm, the subesophageal ganglion of the ventral nerve cord and the visceral mesoderm of the anterior and posterior midgut. Previous analyses have demonstrated that breakpoint mutations located in a 75-kb interval, including the Scr transcription unit and 50 kb of upstream DNA, cause Scr misexpression during development, presumably because these mutations remove Scr cis-regulatory sequences from the proximity of the Scr promoter. To gain a better understanding of the regulatory interactions necessary for the control of Scr transcription during embryogenesis, we have begun a molecular analysis of the Scr regulatory interval. DNA fragments from this 75-kb region were subcloned into P-element vectors containing either an Scr-lacZ or hsp70-lacZ fusion gene, and patterns of reporter gene expression were assayed in transgenic embryos. Several fragments appear to contain Scr regulatory sequences, as they direct reporter gene expression in patterns similar to those normally observed for Scr, whereas other DNA fragments direct Scr reporter gene expression in developmentally interesting but non-Scr-like patterns during embryogenesis. Scr expression in some tissues appears to be controlled by multiple regulatory elements that are separated, in some cases, by more than 20 kb of intervening DNA. This analysis provides an entry point for the study of how Scr transcription is regulated at the molecular level. 60 refs., 7 figs., 1 tab.

  3. High regulatory gene use in sea urchin embryogenesis: Implications for bilaterian development and evolution.

    PubMed

    Howard-Ashby, Meredith; Materna, Stefan C; Brown, C Titus; Tu, Qiang; Oliveri, Paola; Cameron, R Andrew; Davidson, Eric H

    2006-12-01

    A global scan of transcription factor usage in the sea urchin embryo was carried out in the context of the Strongylocentrotus purpuratus genome sequencing project, and results from six individual studies are here considered. Transcript prevalence data were obtained for over 280 regulatory genes encoding sequence-specific transcription factors of every known family, but excluding genes encoding zinc finger proteins. This is a statistically inclusive proxy for the total "regulome" of the sea urchin genome. Close to 80% of the regulome is expressed at significant levels by the late gastrula stage. Most regulatory genes must be used repeatedly for different functions as development progresses. An evolutionary implication is that animal complexity at the stage when the regulome first evolved was far simpler than even the last common bilaterian ancestor, and is thus of deep antiquity.

  4. Genetic validation of whole-transcriptome sequencing for mapping expression affected by cis-regulatory variation

    PubMed Central

    2010-01-01

    Background Identifying associations between genotypes and gene expression levels using microarrays has enabled systematic interrogation of regulatory variation underlying complex phenotypes. This approach has vast potential for functional characterization of disease states, but its prohibitive cost, given hundreds to thousands of individual samples from populations have to be genotyped and expression profiled, has limited its widespread application. Results Here we demonstrate that genomic regions with allele-specific expression (ASE) detected by sequencing cDNA are highly enriched for cis-acting expression quantitative trait loci (cis-eQTL) identified by profiling of 500 animals in parallel, with up to 90% agreement on the allele that is preferentially expressed. We also observed widespread noncoding and antisense ASE and identified several allele-specific alternative splicing variants. Conclusion Monitoring ASE by sequencing cDNA from as little as one sample is a practical alternative to expression genetics for mapping cis-acting variation that regulates RNA transcription and processing. PMID:20707912

  5. Cis-regulatory elements are harbored in Intron5 of the RUNX1 gene

    PubMed Central

    2014-01-01

    Background Human RUNX1 gene is one of the most frequent target for chromosomal translocations associated with acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). The highest prevalence in AML is noted with (8; 21) translocation; which represents 12 to 15% of all AML cases. Interestingly, all the breakpoints mapped to date in t(8;21) are clustered in intron 5 of the RUNX1 gene and intron 1 of the ETO gene. No homologous sequences have been found at the recombination regions; but DNase I hypersensitive sites (DHS) have been mapped to the areas of the genes involved in t(8;21). Presence of DHS sites is commonly associated with regulatory elements such as promoters, enhancers and silencers, among others. Results In this study we used a combination of comparative genomics, cloning and transfection assays to evaluate potential regulatory elements located in intron 5 of the RUNX1 gene. Our genomic analysis identified nine conserved non-coding sequences that are evolutionarily conserved among rat, mouse and human. We cloned two of these regions in pGL-3 Promoter plasmid in order to analyze their transcriptional regulatory activity. Our results demonstrate that the identified regions can indeed regulate transcription of a reporter gene in a distance and position independent manner; moreover, their transcriptional effect is cell type specific. Conclusions We have identified nine conserved non coding sequence that are harbored in intron 5 of the RUNX1 gene. We have also demonstrated that two of these regions can regulate transcriptional activity in vitro. Taken together our results suggest that intron 5 of the RUNX1 gene contains multiple potential cis-regulatory elements. PMID:24655352

  6. Gene regulatory network inference using out of equilibrium statistical mechanics

    PubMed Central

    Benecke, Arndt

    2008-01-01

    Spatiotemporal control of gene expression is fundamental to multicellular life. Despite prodigious efforts, the encoding of gene expression regulation in eukaryotes is not understood. Gene expression analyses nourish the hope to reverse engineer effector-target gene networks using inference techniques. Inference from noisy and circumstantial data relies on using robust models with few parameters for the underlying mechanisms. However, a systematic path to gene regulatory network reverse engineering from functional genomics data is still impeded by fundamental problems. Recently, Johannes Berg from the Theoretical Physics Institute of Cologne University has made two remarkable contributions that significantly advance the gene regulatory network inference problem. Berg, who uses gene expression data from yeast, has demonstrated a nonequilibrium regime for mRNA concentration dynamics and was able to map the gene regulatory process upon simple stochastic systems driven out of equilibrium. The impact of his demonstration is twofold, affecting both the understanding of the operational constraints under which transcription occurs and the capacity to extract relevant information from highly time-resolved expression data. Berg has used his observation to predict target genes of selected transcription factors, and thereby, in principle, demonstrated applicability of his out of equilibrium statistical mechanics approach to the gene network inference problem. PMID:19404429

  7. Gene regulatory network inference using out of equilibrium statistical mechanics.

    PubMed

    Benecke, Arndt

    2008-08-01

    Spatiotemporal control of gene expression is fundamental to multicellular life. Despite prodigious efforts, the encoding of gene expression regulation in eukaryotes is not understood. Gene expression analyses nourish the hope to reverse engineer effector-target gene networks using inference techniques. Inference from noisy and circumstantial data relies on using robust models with few parameters for the underlying mechanisms. However, a systematic path to gene regulatory network reverse engineering from functional genomics data is still impeded by fundamental problems. Recently, Johannes Berg from the Theoretical Physics Institute of Cologne University has made two remarkable contributions that significantly advance the gene regulatory network inference problem. Berg, who uses gene expression data from yeast, has demonstrated a nonequilibrium regime for mRNA concentration dynamics and was able to map the gene regulatory process upon simple stochastic systems driven out of equilibrium. The impact of his demonstration is twofold, affecting both the understanding of the operational constraints under which transcription occurs and the capacity to extract relevant information from highly time-resolved expression data. Berg has used his observation to predict target genes of selected transcription factors, and thereby, in principle, demonstrated applicability of his out of equilibrium statistical mechanics approach to the gene network inference problem.

  8. Selected heterozygosity at cis-regulatory sequences increases the expression homogeneity of a cell population in humans.

    PubMed

    Sung, Min Kyung; Jang, Juneil; Lee, Kang Seon; Ghim, Cheol-Min; Choi, Jung Kyoon

    2016-07-28

    Examples of heterozygote advantage in humans are scarce and limited to protein-coding sequences. Here, we attempt a genome-wide functional inference of advantageous heterozygosity at cis-regulatory regions. The single-nucleotide polymorphisms bearing the signatures of balancing selection are enriched in active cis-regulatory regions of immune cells and epithelial cells, the latter of which provide barrier function and innate immunity. Examples associated with ancient trans-specific balancing selection are also discovered. Allelic imbalance in chromatin accessibility and divergence in transcription factor motif sequences indicate that these balanced polymorphisms cause distinct regulatory variation. However, a majority of these variants show no association with the expression level of the target gene. Instead, single-cell experimental data for gene expression and chromatin accessibility demonstrate that heterozygous sequences can lower cell-to-cell variability in proportion to selection strengths. This negative correlation is more pronounced for highly expressed genes and consistently observed when using different data and methods. Based on mathematical modeling, we hypothesize that extrinsic noise from fluctuations in transcription factor activity may be amplified in homozygotes, whereas it is buffered in heterozygotes. While high expression levels are coupled with intrinsic noise reduction, regulatory heterozygosity can contribute to the suppression of extrinsic noise. This mechanism may confer a selective advantage by increasing cell population homogeneity and thereby enhancing the collective action of the cells, especially of those involved in the defense systems in humans.

  9. Gene Discovery through Expressed Sequence Tag Sequencing in Trypanosoma cruzi

    PubMed Central

    Verdun, Ramiro E.; Di Paolo, Nelson; Urmenyi, Turan P.; Rondinelli, Edson; Frasch, Alberto C. C.; Sanchez, Daniel O.

    1998-01-01

    Analysis of expressed sequence tags (ESTs) constitutes a useful approach for gene identification that, in the case of human pathogens, might result in the identification of new targets for chemotherapy and vaccine development. As part of the Trypanosoma cruzi genome project, we have partially sequenced the 5′ ends of 1,949 clones to generate ESTs. The clones were randomly selected from a normalized CL Brener epimastigote cDNA library. A total of 14.6% of the clones were homologous to previously identified T. cruzi genes, while 18.4% had significant matches to genes from other organisms in the database. A total of 67% of the ESTs had no matches in the database, and thus, some of them might be T. cruzi-specific genes. Functional groups of those sequences with matches in the database were constructed according to their putative biological functions. The two largest categories were protein synthesis (23.3%) and cell surface molecules (10.8%). The information reported in this paper should be useful for researchers in the field to analyze genes and proteins of their own interest. PMID:9784549

  10. Portrait of Candida Species Biofilm Regulatory Network Genes.

    PubMed

    Araújo, Daniela; Henriques, Mariana; Silva, Sónia

    2017-01-01

    Most cases of candidiasis have been attributed to Candida albicans, but Candida glabrata, Candida parapsilosis and Candida tropicalis, designated as non-C. albicans Candida (NCAC), have been identified as frequent human pathogens. Moreover, Candida biofilms are an escalating clinical problem associated with significant rates of mortality. Biofilms have distinct developmental phases, including adhesion/colonisation, maturation and dispersal, controlled by complex regulatory networks. This review discusses recent advances regarding Candida species biofilm regulatory network genes, which are key components for candidiasis.

  11. [Enzymatic regulatory processes in gene recombination].

    PubMed

    Kovarskiĭ, V A; Profir, A V

    1988-01-01

    Recombination bistability in the system of genetic regulation in pro- and eucaryots is analysed on the basis of sigmoid kinetics of regulatory enzymes. It is shown that under an increase of either exogenic factors (temperature) or endogenic factors (concentration of molecules, which activate the enzymes) of crucial values, bistability solutions for recombination frequencies are possible. Histeresic character of the dependence of this value on the external parameters is pointed out. The role of fluctuation processes in distortion of the memory effects is discussed. On the basis of monostable solutions molecular account for the empiric Plau law is given for U-shaped dependence of recombination frequency on temperature.

  12. A Maize Gene Regulatory Network for Phenolic Metabolism.

    PubMed

    Yang, Fan; Li, Wei; Jiang, Nan; Yu, Haidong; Morohashi, Kengo; Ouma, Wilberforce Zachary; Morales-Mantilla, Daniel E; Gomez-Cano, Fabio Andres; Mukundi, Eric; Prada-Salcedo, Luis Daniel; Velazquez, Roberto Alers; Valentin, Jasmin; Mejía-Guerra, Maria Katherine; Gray, John; Doseff, Andrea I; Grotewold, Erich

    2017-03-06

    The translation of the genotype into phenotype, represented for example by the expression of genes encoding enzymes required for the biosynthesis of phytochemicals that are important for interaction of plants with the environment, is largely carried out by transcription factors (TFs) that recognize specific cis-regulatory elements in the genes that they control. TFs and their target genes are organized in gene regulatory networks (GRNs), and thus uncovering GRN architecture presents an important biological challenge necessary to explain gene regulation. Linking TFs to the genes they control, central to understanding GRNs, can be carried out using gene- or TF-centered approaches. In this study, we employed a gene-centered approach utilizing the yeast one-hybrid assay to generate a network of protein-DNA interactions that participate in the transcriptional control of genes involved in the biosynthesis of maize phenolic compounds including general phenylpropanoids, lignins, and flavonoids. We identified 1100 protein-DNA interactions involving 54 phenolic gene promoters and 568 TFs. A set of 11 TFs recognized 10 or more promoters, suggesting a role in coordinating pathway gene expression. The integration of the gene-centered network with information derived from TF-centered approaches provides a foundation for a phenolics GRN characterized by interlaced feed-forward loops that link developmental regulators with biosynthetic genes.

  13. Nucleotide sequence and functional analysis of regulatory region of the lumP and the lux operon from Photobacterium leiognathi.

    PubMed

    Lin, J W; Chao, Y F; Weng, S F

    1995-05-25

    The lumP gene is linked to the lux operon, but runs in the opposite direction in Photobacterium leiognathi PL741. The gene order of the lumP and the lux operon is < -lumP-R & R-luxC-luxD-luxA-luxB-luxN-luxE- > (R & R: regulatory region). The nucleotide sequence of the regulatory region (827-bp) between the lumP and the lux operon was determined. Sequence analysis illustrates that the regulatory region includes two divergent promoter systems, PR-promoter system for the lux operon (R-operon) and PL-promoter system for the lumP or lum operon (L-operon). Functional analysis of the regulatory region shows that the PR- and PL-promoter systems both are able to lead the gene expression. The deletion experiment result elicits that the PR- and PL-promoter are coordinatively and negatively regulated; the PR- and PL-promoter might be competing for recognition by RNA polymerase to initiate transcription. The fact of the LumP responsible for the spectral blue shift in P. leiognathi implied that the lumP gene closedly linked to the lux operon is for coordinative regulation with the lux operon. In addition, the glucose repression on the PR-promoter system shows that the expression of the lux operon is regulated by cAMP-CRP induction in E. coli.

  14. Regulatory region with putA gene of proline dehydrogenase that links to the lum and the lux operons in Photobacterium leiognathi.

    PubMed

    Lin, J W; Yu, K Y; Chen, H Y; Weng, S F

    1996-02-27

    Nucleotide sequence of regulatory region (R & R) with putA gene (EMBL Accession No. U39227) from Photobacterium leiognathi PL741 has been determined, and the putA gene encoded amino acid sequence of proline dehydrogenase is deduced. Alignment and comparison of proline dehydrogenase of P. leiognathi with the proline dehydrogenase domain in the PutA protein of Escherichia coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that regulatory region with the putA gene is linked to the lum and lux operons in genome; the gene order is <--putA--R & R(I)<--ter-lumQ-lumP-R & R-luxC-luxD-luxA-luxB-luxE--> (R & R: regulatory region; ter:transcriptional terminator), whereas the R & R is the regulatory region for the lum and the lux operons, ter is the transcriptional terminator for the lum operon, and R & R(I) apparently is the regulatory region for the putA and related genes. Nucleotide sequence analysis illustrates the specific inverted repeat (SIR), cAMP-CRP consensus sequence, canonical -10/-35 promoter, putative operator and Shine-Dalgarno (SD) sequence on the regulatory region R & R(I) for the putA and related genes; it suggests that the putA and related genes are simply linked to the lum and the lux operons in genome, the regulatory region R & R(I) is independent for the putA and related genes.

  15. 'In silico expression analysis', a novel PathoPlant web tool to identify abiotic and biotic stress conditions associated with specific cis-regulatory sequences.

    PubMed

    Bolívar, Julio C; Machens, Fabian; Brill, Yuri; Romanov, Artyom; Bülow, Lorenz; Hehl, Reinhard

    2014-01-01

    Using bioinformatics, putative cis-regulatory sequences can be easily identified using pattern recognition programs on promoters of specific gene sets. The abundance of predicted cis-sequences is a major challenge to associate these sequences with a possible function in gene expression regulation. To identify a possible function of the predicted cis-sequences, a novel web tool designated 'in silico expression analysis' was developed that correlates submitted cis-sequences with gene expression data from Arabidopsis thaliana. The web tool identifies the A. thaliana genes harbouring the sequence in a defined promoter region and compares the expression of these genes with microarray data. The result is a hierarchy of abiotic and biotic stress conditions to which these genes are most likely responsive. When testing the performance of the web tool, known cis-regulatory sequences were submitted to the 'in silico expression analysis' resulting in the correct identification of the associated stress conditions. When using a recently identified novel elicitor-responsive sequence, a WT-box (CGACTTTT), the 'in silico expression analysis' predicts that genes harbouring this sequence in their promoter are most likely Botrytis cinerea induced. Consistent with this prediction, the strongest induction of a reporter gene harbouring this sequence in the promoter is observed with B. cinerea in transgenic A. thaliana. DATABASE URL: http://www.pathoplant.de/expression_analysis.php.

  16. ‘In silico expression analysis’, a novel PathoPlant web tool to identify abiotic and biotic stress conditions associated with specific cis-regulatory sequences

    PubMed Central

    Machens, Fabian; Brill, Yuri; Romanov, Artyom; Bülow, Lorenz; Hehl, Reinhard

    2014-01-01

    Using bioinformatics, putative cis-regulatory sequences can be easily identified using pattern recognition programs on promoters of specific gene sets. The abundance of predicted cis-sequences is a major challenge to associate these sequences with a possible function in gene expression regulation. To identify a possible function of the predicted cis-sequences, a novel web tool designated ‘in silico expression analysis’ was developed that correlates submitted cis-sequences with gene expression data from Arabidopsis thaliana. The web tool identifies the A. thaliana genes harbouring the sequence in a defined promoter region and compares the expression of these genes with microarray data. The result is a hierarchy of abiotic and biotic stress conditions to which these genes are most likely responsive. When testing the performance of the web tool, known cis-regulatory sequences were submitted to the ‘in silico expression analysis’ resulting in the correct identification of the associated stress conditions. When using a recently identified novel elicitor-responsive sequence, a WT-box (CGACTTTT), the ‘in silico expression analysis’ predicts that genes harbouring this sequence in their promoter are most likely Botrytis cinerea induced. Consistent with this prediction, the strongest induction of a reporter gene harbouring this sequence in the promoter is observed with B. cinerea in transgenic A. thaliana. Database URL: http://www.pathoplant.de/expression_analysis.php. PMID:24727366

  17. Understanding the Role of Housekeeping and Stress-Related Genes in Transcription-Regulatory Networks

    NASA Astrophysics Data System (ADS)

    Heath, Allison; Kavraki, Lydia; Balázsi, Gábor

    2008-03-01

    Despite the increasing number of completely sequenced genomes, much remains to be learned about how living cells process environmental information and respond to changes in their surroundings. Accumulating evidence indicates that eukaryotic and prokaryotic genes can be classified in two distinct categories that we will call class I and class II. Class I genes are housekeeping genes, often characterized by stable, noise resistant expression levels. In contrast, class II genes are stress-related genes and often have noisy, unstable expression levels. In this work we analyze the large scale transcription-regulatory networks (TRN) of E. coli and S. cerevisiae and preliminary data on H. sapien. We find that stable, housekeeping genes (class I) are preferentially utilized as transcriptional inputs while stress related, unstable genes (class II) are utilized as transcriptional integrators. This might be the result of convergent evolution that placed the appropriate genes in the appropriate locations within transcriptional networks according to some fundamental principles that govern cellular information processing.

  18. Regulatory Divergence among Beta-Keratin Genes during Bird Evolution.

    PubMed

    Bhattacharjee, Maloyjo Joyraj; Yu, Chun-Ping; Lin, Jinn-Jy; Ng, Chen Siang; Wang, Tzi-Yuan; Lin, Hsin-Hung; Li, Wen-Hsiung

    2016-11-01

    Feathers, which are mainly composed of α- and β-keratins, are highly diversified, largely owing to duplication and diversification of β-keratin genes during bird evolution. However, little is known about the regulatory changes that contributed to the expressional diversification of β-keratin genes. To address this issue, we studied transcriptomes from five different parts of chicken contour and flight feathers. From these transcriptomes we inferred β-keratin enriched co-expression modules of genes and predicted transcription factors (TFs) of β-keratin genes. In total, we predicted 262 TF-target gene relationships in which 56 TFs regulate 91 β-keratin genes; we validated 14 of them by in vitro tests. A dual criterion of TF enrichment and "TF-target gene" expression correlation identified 26 TFs as the major regulators of β-keratin genes. According to our predictions, the ancestral scale and claw β-keratin genes have common and unique regulators, whereas most feather β-keratin genes show chromosome-wise regulation, distinct from scale and claw β-keratin genes. Thus, after expansion from the β-keratin gene on Chr7 to other chromosomes, which still shares a TF with scale and claw β-keratin genes, most feather β-keratin genes have recruited distinct or chromosome-specific regulators. Moreover, our data showed correlated gene expression profiles, positive or negative, between predicted TFs and their target genes over the five studied feather regions. Therefore, regulatory divergences among feather β-keratin genes have contributed to structural differences among different parts of feathers. Our study sheds light on how feather β-keratin genes have diverged in regulation from scale and claw β-keratin genes and among themselves. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Gene Regulatory Evolution During Speciation in a Songbird

    PubMed Central

    Davidson, John H.; Balakrishnan, Christopher N.

    2016-01-01

    Over the last decade, tremendous progress has been made toward a comparative understanding of gene regulatory evolution. However, we know little about how gene regulation evolves in birds, and how divergent genomes interact in their hybrids. Because of the unique features of birds – female heterogamety, a highly conserved karyotype, and the slow evolution of reproductive incompatibilities – an understanding of regulatory evolution in birds is critical to a comprehensive understanding of regulatory evolution and its implications for speciation. Using a novel complement of analyses of replicated RNA-seq libraries, we demonstrate abundant divergence in brain gene expression between zebra finch (Taeniopygia guttata) subspecies. By comparing parental populations and their F1 hybrids, we also show that gene misexpression is relatively rare among brain-expressed transcripts in male birds. If this pattern is consistent across tissues and sexes, it may partially explain the slow buildup of postzygotic reproductive isolation observed in birds relative to other taxa. Although we expected that the action of genetic drift on the island-dwelling zebra finch subspecies would be manifested in a higher rate of trans regulatory divergence, we found that most divergence was in cis regulation, following a pattern commonly observed in other taxa. Thus, our study highlights both unique and shared features of avian regulatory evolution. PMID:26976438

  20. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin

    2011-01-01

    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  1. Regulatory links between imprinted genes: evolutionary predictions and consequences.

    PubMed

    Patten, Manus M; Cowley, Michael; Oakey, Rebecca J; Feil, Robert

    2016-02-10

    Genomic imprinting is essential for development and growth and plays diverse roles in physiology and behaviour. Imprinted genes have traditionally been studied in isolation or in clusters with respect to cis-acting modes of gene regulation, both from a mechanistic and evolutionary point of view. Recent studies in mammals, however, reveal that imprinted genes are often co-regulated and are part of a gene network involved in the control of cellular proliferation and differentiation. Moreover, a subset of imprinted genes acts in trans on the expression of other imprinted genes. Numerous studies have modulated levels of imprinted gene expression to explore phenotypic and gene regulatory consequences. Increasingly, the applied genome-wide approaches highlight how perturbation of one imprinted gene may affect other maternally or paternally expressed genes. Here, we discuss these novel findings and consider evolutionary theories that offer a rationale for such intricate interactions among imprinted genes. An evolutionary view of these trans-regulatory effects provides a novel interpretation of the logic of gene networks within species and has implications for the origin of reproductive isolation between species.

  2. Regulatory links between imprinted genes: evolutionary predictions and consequences

    PubMed Central

    Patten, Manus M.; Cowley, Michael; Oakey, Rebecca J.; Feil, Robert

    2016-01-01

    Genomic imprinting is essential for development and growth and plays diverse roles in physiology and behaviour. Imprinted genes have traditionally been studied in isolation or in clusters with respect to cis-acting modes of gene regulation, both from a mechanistic and evolutionary point of view. Recent studies in mammals, however, reveal that imprinted genes are often co-regulated and are part of a gene network involved in the control of cellular proliferation and differentiation. Moreover, a subset of imprinted genes acts in trans on the expression of other imprinted genes. Numerous studies have modulated levels of imprinted gene expression to explore phenotypic and gene regulatory consequences. Increasingly, the applied genome-wide approaches highlight how perturbation of one imprinted gene may affect other maternally or paternally expressed genes. Here, we discuss these novel findings and consider evolutionary theories that offer a rationale for such intricate interactions among imprinted genes. An evolutionary view of these trans-regulatory effects provides a novel interpretation of the logic of gene networks within species and has implications for the origin of reproductive isolation between species. PMID:26842569

  3. Dynamics of gene regulatory networks with cell division cycle

    NASA Astrophysics Data System (ADS)

    Chen, Luonan; Wang, Ruiqi; Kobayashi, Tetsuya J.; Aihara, Kazuyuki

    2004-07-01

    This paper focuses on modeling and analyzing the nonlinear dynamics of gene regulatory networks with the consideration of a cell division cycle with duplication process of DNA , in particular for switches and oscillators of synthetic networks. We derive two models that may correspond to the eukaryotic and prokaryotic cells, respectively. A biologically plausible three-gene model ( lac,tetR , and cI ) and a repressilator as switch and oscillator examples are used to illustrate our theoretical results. We show that the cell cycle may play a significant role in gene regulation due to the nonlinear dynamics of a gene regulatory network although gene expressions are usually tightly controlled by transcriptional factors.

  4. Gene regulatory networks elucidating Huanglongbing disease mechanisms

    USDA-ARS?s Scientific Manuscript database

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional...

  5. Dynamic integration of splicing within gene regulatory pathways

    PubMed Central

    Braunschweig, Ulrich; Gueroussov, Serge; Plocik, Alex; Graveley, Brenton R.; Blencowe, Benjamin J.

    2013-01-01

    Precursor mRNA splicing is one of the most highly regulated processes in metazoan species. In addition to generating vast repertoires of RNAs and proteins, splicing has a profound impact on other gene regulatory layers, including mRNA transcription, turnover, transport and translation. Conversely, factors regulating chromatin and transcription complexes impact the splicing process. This extensive cross-talk between gene regulatory layers takes advantage of dynamic spatial, physical and temporal organizational properties of the cell nucleus, and further emphasizes the importance of developing a multidimensional understanding of splicing control. PMID:23498935

  6. Variable neighborhood search for reverse engineering of gene regulatory networks.

    PubMed

    Nicholson, Charles; Goodwin, Leslie; Clark, Corey

    2017-01-01

    A new search heuristic, Divided Neighborhood Exploration Search, designed to be used with inference algorithms such as Bayesian networks to improve on the reverse engineering of gene regulatory networks is presented. The approach systematically moves through the search space to find topologies representative of gene regulatory networks that are more likely to explain microarray data. In empirical testing it is demonstrated that the novel method is superior to the widely employed greedy search techniques in both the quality of the inferred networks and computational time.

  7. Integration of ChIP-seq and machine learning reveals enhancers and a predictive regulatory sequence vocabulary in melanocytes

    PubMed Central

    Gorkin, David U.; Lee, Dongwon; Reed, Xylena; Fletez-Brant, Christopher; Bessling, Seneca L.; Loftus, Stacie K.; Beer, Michael A.; Pavan, William J.; McCallion, Andrew S.

    2012-01-01

    We take a comprehensive approach to the study of regulatory control of gene expression in melanocytes that proceeds from large-scale enhancer discovery facilitated by ChIP-seq; to rigorous validation in silico, in vitro, and in vivo; and finally to the use of machine learning to elucidate a regulatory vocabulary with genome-wide predictive power. We identify 2489 putative melanocyte enhancer loci in the mouse genome by ChIP-seq for EP300 and H3K4me1. We demonstrate that these putative enhancers are evolutionarily constrained, enriched for sequence motifs predicted to bind key melanocyte transcription factors, located near genes relevant to melanocyte biology, and capable of driving reporter gene expression in melanocytes in culture (86%; 43/50) and in transgenic zebrafish (70%; 7/10). Next, using the sequences of these putative enhancers as a training set for a supervised machine learning algorithm, we develop a vocabulary of 6-mers predictive of melanocyte enhancer function. Lastly, we demonstrate that this vocabulary has genome-wide predictive power in both the mouse and human genomes. This study provides deep insight into the regulation of gene expression in melanocytes and demonstrates a powerful approach to the investigation of regulatory sequences that can be applied to other cell types. PMID:23019145

  8. Engineering a regulatory region of jadomycin gene cluster to improve jadomycin B production in Streptomyces venezuelae.

    PubMed

    Zheng, Jian-Ting; Wang, Sheng-Lan; Yang, Ke-Qian

    2007-09-01

    Streptomyces venezuelae ISP5230 produces a group of jadomycin congeners with cytotoxic activities. To improve jadomycin fermentation process, a genetic engineering strategy was designed to replace a 3.4-kb regulatory region of jad gene cluster that contains four regulatory genes (3' end 272 bp of jadW2, jadW3, jadR2, and jadR1) and the native promoter upstream of jadJ (P(J)) with the ermEp* promoter sequence so that ermEp* drives the expression of the jadomycin biosynthetic genes from jadJ in the engineered strain. As expected, the mutant strain produced jadomycin B without ethanol treatment, and the yield increased to about twofold that of the stressed wild-type. These results indicated that manipulation of the regulation of a biosynthetic gene cluster is an effective strategy to increase product yield.

  9. Sequence analysis of porothramycin biosynthetic gene cluster.

    PubMed

    Najmanova, Lucie; Ulanova, Dana; Jelinkova, Marketa; Kamenik, Zdenek; Kettnerova, Eliska; Koberska, Marketa; Gazak, Radek; Radojevic, Bojana; Janata, Jiri

    2014-11-01

    The biosynthetic gene cluster of porothramycin, a sequence-selective DNA alkylating compound, was identified in the genome of producing strain Streptomyces albus subsp. albus (ATCC 39897) and sequentially characterized. A 39.7 kb long DNA region contains 27 putative genes, 18 of them revealing high similarity with homologous genes from biosynthetic gene cluster of closely related pyrrolobenzodiazepine (PBD) compound anthramycin. However, considering the structures of both compounds, the number of differences in the gene composition of compared biosynthetic gene clusters was unexpectedly high, indicating participation of alternative enzymes in biosynthesis of both porothramycin precursors, anthranilate, and branched L-proline derivative. Based on the sequence analysis of putative NRPS modules Por20 and Por21, we suppose that in porothramycin biosynthesis, the methylation of anthranilate unit occurs prior to the condensation reaction, while modifications of branched proline derivative, oxidation, and dimethylation of the side chain occur on already condensed PBD core. Corresponding two specific methyltransferase encoding genes por26 and por25 were identified in the porothramycin gene cluster. Surprisingly, also methyltransferase gene por18 homologous to orf19 from anthramycin biosynthesis was detected in porothramycin gene cluster even though the appropriate biosynthetic step is missing, as suggested by ultra high-performance liquid chromatography-diode array detection-mass spectrometry (UHPLC-DAD-MS) analysis of the product in the S. albus culture broth.

  10. A regulatory gene (ECO-orf4) required for ECO-0501 biosynthesis in Amycolatopsis orientalis.

    PubMed

    Shen, Yang; Huang, He; Zhu, Li; Luo, Minyu; Chen, Daijie

    2014-02-01

    ECO-0501 is a novel linear polyene antibiotic, which was discovered from Amycolatopsis orientalis. Recent study of ECO-0501 biosynthesis pathway revealed the presence of regulatory gene: ECO-orf4. The A. orientalis ECO-orf4 gene from the ECO-0501 biosynthesis cluster was analyzed, and its deduced protein (ECO-orf4) was found to have amino acid sequence homology with large ATP-binding regulators of the LuxR (LAL) family regulators. Database comparison revealed two hypothetical domains, a LuxR-type helix-turn-helix (HTH) DNA binding motif near the C-terminal and an N-terminal nucleotide triphosphate (NTP) binding motif included. Deletion of the corresponding gene (ECO-orf4) resulted in complete loss of ECO-0501 production. Complementation by one copy of intact ECO-orf4 restored the polyene biosynthesis demonstrating that ECO-orf4 is required for ECO-0501 biosynthesis. The results of overexpression ECO-orf4 on ECO-0501 production indicated that it is a positive regulatory gene. Gene expression analysis by reverse transcription PCR of the ECO-0501 gene cluster showed that the transcription of ECO-orf4 correlates with that of genes involved in polyketide biosynthesis. These results demonstrated that ECO-orf4 is a pathway-specific positive regulatory gene that is essential for ECO-0501 biosynthesis. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Sequence diversity in 36 candidate genes for cardiovascular disorders.

    PubMed Central

    Cambien, F; Poirier, O; Nicaud, V; Herrmann, S M; Mallet, C; Ricard, S; Behague, I; Hallet, V; Blanc, H; Loukaci, V; Thillet, J; Evans, A; Ruidavets, J B; Arveiler, D; Luc, G; Tiret, L

    1999-01-01

    Two strategies involving whole-genome association studies have been proposed for the identification of genes involved in complex diseases. The first one seeks to characterize all common variants of human genes and to test their association with disease. The second one seeks to develop dense maps of single-nucleotide polymorphisms (SNPs) and to detect susceptibility genes through linkage disequilibrium. We performed a molecular screening of the coding and/or flanking regions of 36 candidate genes for cardiovascular diseases. All polymorphisms identified by this screening were further genotyped in 750 subjects of European descent. In the whole set of genes, the lengths explored spanned 53.8 kb in the 5' regions, 68.4 kb in exonic regions, and 13 kb in the 3' regions. The strength of linkage disequilibrium within candidate regions suggests that genomewide maps of SNPs might be efficient ways to identify new disease-susceptibility genes, provided that the maps are sufficiently dense. However, the relatively large number of polymorphisms within coding and regulatory regions of candidate genes raises the possibility that several of them might be functional and that the pattern of genotype-phenotype association might be more complex than initially envisaged, as actually has been observed in some well-characterized genes. These results argue in favor of both genomewide association studies and detailed studies of the overall sequence variation of candidate genes, as complementary approaches. PMID:10364531

  12. Extracting regulatory sites from the upstream region of yeast genes by computational analysis of oligonucleotide frequencies.

    PubMed

    van Helden, J; André, B; Collado-Vides, J

    1998-09-04

    We present here a simple and fast method allowing the isolation of DNA binding sites for transcription factors from families of coregulated genes, with results illustrated in Saccharomyces cerevisiae. Although conceptually simple, the algorithm proved efficient for extracting, from most of the yeast regulatory families analyzed, the upstream regulatory sequences which had been previously found by experimental analysis. Furthermore, putative new regulatory sites are predicted within upstream regions of several regulons. The method is based on the detection of over-represented oligonucleotides. A specificity of this approach is to define the statistical significance of a site based on tables of oligonucleotide frequencies observed in all non-coding sequences from the yeast genome. In contrast with heuristic methods, this oligonucleotide analysis is rigorous and exhaustive. Its range of detection is however limited to relatively simple patterns: short motifs with a highly conserved core. These features seem to be shared by a good number of regulatory sites in yeast. This, and similar methods, should be increasingly required to identify unknown regulatory elements within the numerous new coregulated families resulting from measurements of gene expression levels at the genomic scale. All tools described here are available on the web at the site http://copan.cifn.unam.mx/Computational_Biology/ yeast-tools Copyright 1998 Academic Press

  13. Direct interaction of the Polycomb protein with Antennapedia regulatory sequences in polytene chromosomes of Drosophila melanogaster.

    PubMed Central

    Zink, B; Engström, Y; Gehring, W J; Paro, R

    1991-01-01

    The Polycomb (Pc) gene is responsible for the elaboration and maintenance of the expression pattern of the homeotic genes during development of Drosophila. In mutant Pc- embryos, homeotic transcripts are ectopically expressed, leading to abdominal transformations in all segments. From this it was suggested that PC+ acts as a repressor of homeotic gene transcription. We have mapped the cis-acting control sequences of the homeotic Antennapedia (Antp) gene regulated by Pc. Using Antp P1 and P2 promoter fragments linked to the E. coli lacZ reporter gene we show different expression patterns of beta-galactosidase (beta-gal) in transformed Pc+ and Pc- embryos. In addition we are able to visualize by immunocytochemical techniques on polytene chromosomes the direct binding of the Pc protein to the transposed cis-regulatory promoter fragments. However, short Antp P1 promoter constructs which are--due to position effects--ectopically activated in salivary glands, do not reveal a Pc binding signal. Images PMID:1671215

  14. Evolution of DNA specificity in a transcription factor family produced a new gene regulatory module

    PubMed Central

    McKeown, Alesia N.; Bridgham, Jamie T.; Anderson, Dave W.; Murphy, Michael N.; Ortlund, Eric A.; Thornton, Joseph W.

    2015-01-01

    SUMMARY Complex gene regulatory networks require transcription factors (TFs) to bind distinct DNA sequences. To understand how novel TF specificity evolves, we combined phylogenetic, biochemical, and biophysical approaches to interrogate how DNA recognition diversified in the steroid hormone receptor (SR) family. After duplication of the ancestral SR, three mutations in one copy radically weakened binding to the ancestral estrogen response element (ERE) and improved binding to a new set of DNA sequences (steroid response elements, SREs). They did so by establishing unfavorable interactions with ERE and abolishing unfavorable interactions with SRE; also required were numerous permissive substitutions, which nonspecifically improved cooperativity and affinity of DNA binding. Our findings indicate that negative determinants of binding play key roles in TFs’ DNA selectivity and—with our prior work on the evolution of SR ligand specificity during the same interval—show how a specific new gene regulatory module evolved. PMID:25259920

  15. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    SciTech Connect

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  16. [Regulatory functions of Pax gene family in Drosophila development].

    PubMed

    Li, Li; Yang, Yang; Xue, Lei

    2010-02-01

    The Pax gene family encodes a group of important transcription factors that have been evolutionary conserved from Drosophila to human. Pax genes play pivotal roles in regulating diverse signal transduction pathways and organogenesis during embryonic development through modulating cell proliferation and self-renewal, embryonic precursor cell migration, and the coordination of specific differentiation programs. Ten members of the Pax gene family, which perform crucial regulatory functions during embryonic and postembryonic development, have been identified in Drosophila. In this report, we described the protein structures, expression patterns, and main functions of Drosophila Pax genes.

  17. The incorporation of epigenetics in artificial gene regulatory networks.

    PubMed

    Turner, Alexander P; Lones, Michael A; Fuente, Luis A; Stepney, Susan; Caves, Leo S D; Tyrrell, Andy M

    2013-05-01

    Artificial gene regulatory networks are computational models that draw inspiration from biological networks of gene regulation. Since their inception they have been used to infer knowledge about gene regulation and as methods of computation. These computational models have been shown to possess properties typically found in the biological world, such as robustness and self organisation. Recently, it has become apparent that epigenetic mechanisms play an important role in gene regulation. This paper describes a new model, the Artificial Epigenetic Regulatory Network (AERN) which builds upon existing models by adding an epigenetic control layer. Our results demonstrate that AERNs are more adept at controlling multiple opposing trajectories when applied to a chaos control task within a conservative dynamical system, suggesting that AERNs are an interesting area for further investigation.

  18. Charting gene regulatory networks: strategies, challenges and perspectives

    PubMed Central

    2004-01-01

    One of the foremost challenges in the post-genomic era will be to chart the gene regulatory networks of cells, including aspects such as genome annotation, identification of cis-regulatory elements and transcription factors, information on protein–DNA and protein–protein interactions, and data mining and integration. Some of these broad sets of data have already been assembled for building networks of gene regulation. Even though these datasets are still far from comprehensive, and the approach faces many important and difficult challenges, some strategies have begun to make connections between disparate regulatory events and to foster new hypotheses. In this article we review several different genomics and proteomics technologies, and present bioinformatics methods for exploring these data in order to make novel discoveries. PMID:15080794

  19. A gene regulatory network armature for T-lymphocyte specification

    SciTech Connect

    Fung, Elizabeth-sharon

    2008-01-01

    Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.

  20. Angiotensin II-regulated transcription regulatory genes in adrenal steroidogenesis.

    PubMed

    Romero, Damian G; Gomez-Sanchez, Elise P; Gomez-Sanchez, Celso E

    2010-11-29

    Transcription regulatory genes are crucial modulators of cell physiology and metabolism whose intracellular levels are tightly controlled in response to extracellular stimuli. We previously reported a set of 29 transcription regulatory genes modulated by angiotensin II in H295R human adrenocortical cells and their roles in regulating the expression of the last and unique enzymes of the glucocorticoid and mineralocorticoid biosynthetic pathways, 11β-hydroxylase and aldosterone synthase, respectively, using gene expression reporter assays. To study the effect of this set of transcription regulatory genes on adrenal steroidogenesis, H295R cells were transfected by high-efficiency nucleofection and aldosterone and cortisol were measured in cell culture supernatants under basal and angiotensin II-stimulated conditions. BCL11B, BHLHB2, CITED2, ELL2, HMGA1, MAFF, NFIL3, PER1, SERTAD1, and VDR significantly stimulated aldosterone secretion, while EGR1, FOSB, and ZFP295 decreased aldosterone secretion. BTG2, HMGA1, MITF, NR4A1, and ZFP295 significantly increased cortisol secretion, while BCL11B, NFIL3, PER1, and SIX2 decreased cortisol secretion. We also report the effect of some of these regulators on the expression of endogenous aldosterone synthase and 11β-hydroxylase under basal and angiotensin II-stimulated conditions. In summary, this study reports for the first time the effects of a set of angiotensin II-modulated transcription regulatory genes on aldosterone and cortisol secretion and the expression levels of the last and unique enzymes of the mineralocorticoid and glucocorticoid biosynthetic pathways. Abnormal regulation of mineralocorticoid or glucocorticoid secretion is involved in several pathophysiological conditions. These transcription regulatory genes may be involved in adrenal steroidogenesis pathologies; thus they merit additional study as potential candidates for therapeutic intervention.

  1. The immunogenicity of viral haemorragic septicaemia rhabdovirus (VHSV) DNA vaccines can depend on plasmid regulatory sequences.

    PubMed

    Chico, V; Ortega-Villaizan, M; Falco, A; Tafalla, C; Perez, L; Coll, J M; Estepa, A

    2009-03-18

    A plasmid DNA encoding the viral hemorrhagic septicaemia virus (VHSV)-G glycoprotein under the control of 5' sequences (enhancer/promoter sequence plus both non-coding 1st exon and 1st intron sequences) from carp beta-actin gene (pAE6-G(VHSV)) was compared to the vaccine plasmid usually described the gene expression is regulated by the human cytomegalovirus (CMV) immediate-early promoter (pMCV1.4-G(VHSV)). We observed that these two plasmids produced a markedly different profile in the level and time of expression of the encoded-antigen, and this may have a direct effect upon the intensity and suitability of the in vivo immune response. Thus, fish genetic immunisation assays were carried out to study the immune response of both plasmids. A significantly enhanced specific-antibody response against the viral glycoprotein was found in the fish immunised with pAE6-G(VHSV). However, the protective efficacy against VHSV challenge conferred by both plasmids was similar. Later analysis of the transcription profile of a set of representative immune-related genes in the DNA immunized fish suggested that depending on the plasmid-related regulatory sequences controlling its expression, the plasmid might activate distinct patterns of the immune system. All together, the results from this study mainly point out that the selection of a determinate encoded-antigen/vector combination for genetic immunisation is of extraordinary importance in designing optimised DNA vaccines that, when required for inducing protective immune response, could elicit responses biased to antigen-specific antibodies or cytotoxic T cells generation.

  2. Functional Evolution of cis-Regulatory Modules at a Homeotic Gene in Drosophila

    PubMed Central

    Schiller, Benjamin J.; Bae, Esther; Tran, Diana A.; Shur, Andrey S.; Allen, John M.; Rau, Christoph; Bender, Welcome; Fisher, William W.; Celniker, Susan E.; Drewell, Robert A.

    2009-01-01

    It is a long-held belief in evolutionary biology that the rate of molecular evolution for a given DNA sequence is inversely related to the level of functional constraint. This belief holds true for the protein-coding homeotic (Hox) genes originally discovered in Drosophila melanogaster. Expression of the Hox genes in Drosophila embryos is essential for body patterning and is controlled by an extensive array of cis-regulatory modules (CRMs). How the regulatory modules functionally evolve in different species is not clear. A comparison of the CRMs for the Abdominal-B gene from different Drosophila species reveals relatively low levels of overall sequence conservation. However, embryonic enhancer CRMs from other Drosophila species direct transgenic reporter gene expression in the same spatial and temporal patterns during development as their D. melanogaster orthologs. Bioinformatic analysis reveals the presence of short conserved sequences within defined CRMs, representing gap and pair-rule transcription factor binding sites. One predicted binding site for the gap transcription factor KRUPPEL in the IAB5 CRM was found to be altered in Superabdominal (Sab) mutations. In Sab mutant flies, the third abdominal segment is transformed into a copy of the fifth abdominal segment. A model for KRUPPEL-mediated repression at this binding site is presented. These findings challenge our current understanding of the relationship between sequence evolution at the molecular level and functional activity of a CRM. While the overall sequence conservation at Drosophila CRMs is not distinctive from neighboring genomic regions, functionally critical transcription factor binding sites within embryonic enhancer CRMs are highly conserved. These results have implications for understanding mechanisms of gene expression during embryonic development, enhancer function, and the molecular evolution of eukaryotic regulatory modules. PMID:19893611

  3. Cloning and Sequencing the First HLA Gene

    PubMed Central

    Jordan, Bertrand R.

    2010-01-01

    This Perspectives article recounts the isolation and sequencing of the first human histocompatibility gene (HLA) in 1980–1981. At the time, general knowledge of the molecules of the immune system was already fairly extensive, and gene rearrangements in the immunoglobulin complex (discovered in 1976) had generated much excitement: HLA was quite obviously the next frontier. The author was able to use a homologous murine H-2 cDNA to identify putative human HLA genomic clones in a λ-phage library and thus to isolate and sequence the first human histocompatibility gene. This personal account relates the steps that led to this result, describes the highly competitive international environment, and highlights the role of location, connections, and sheer luck in such an achievement. It also puts this work in perspective with a short description of the current knowledge of histocompatibility genes and, finally, presents some reflections on the meaning of “discovery.” PMID:20457890

  4. Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

    PubMed Central

    Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

    2012-01-01

    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to

  5. Gene regulatory networks in the early ascidian embryo.

    PubMed

    Satou, Yutaka; Satoh, Nori; Imai, Kaoru S

    2009-04-01

    Ascidians, or sea squirts, are tunicates that diverged from the vertebrate lineage early in the chordate evolution. The compact and simple organization of the ascidian genome makes this organism an ideal model system for analyzing gene regulatory networks in embryonic development. Embryos contain relatively few cells and gene activities by individual cells have been determined. Here we review and discuss advances in our understanding of the ascidian embryogenesis emerging from genomic expression studies and analyses at the single cell level.

  6. Efficient reverse-engineering of a developmental gene regulatory network.

    PubMed

    Crombach, Anton; Wotton, Karl R; Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

    2012-01-01

    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to

  7. Signal Correlations in Ecological Niches Can Shape the Organization and Evolution of Bacterial Gene Regulatory Networks

    PubMed Central

    Dufour, Yann S.; Donohue, Timothy J.

    2015-01-01

    Transcriptional regulation plays a significant role in the biological response of bacteria to changing environmental conditions. Therefore, mapping transcriptional regulatory networks is an important step not only in understanding how bacteria sense and interpret their environment but also to identify the functions involved in biological responses to specific conditions. Recent experimental and computational developments have facilitated the characterization of regulatory networks on a genome-wide scale in model organisms. In addition, the multiplication of complete genome sequences has encouraged comparative analyses to detect conserved regulatory elements and infer regulatory networks in other less well-studied organisms. However, transcription regulation appears to evolve rapidly, thus, creating challenges for the transfer of knowledge to nonmodel organisms. Nevertheless, the mechanisms and constraints driving the evolution of regulatory networks have been the subjects of numerous analyses, and several models have been proposed. Overall, the contributions of mutations, recombination, and horizontal gene transfer are complex. Finally, the rapid evolution of regulatory networks plays a significant role in the remarkable capacity of bacteria to adapt to new or changing environments. Conversely, the characteristics of environmental niches determine the selective pressures and can shape the structure of regulatory network accordingly. PMID:23046950

  8. Inferring transcription factor collaborations in gene regulatory networks

    PubMed Central

    2014-01-01

    Background Living cells are realized by complex gene expression programs that are moderated by regulatory proteins called transcription factors (TFs). The TFs control the differential expression of target genes in the context of transcriptional regulatory networks (TRNs), either individually or in groups. Deciphering the mechanisms of how the TFs control the expression of target genes is a challenging task, especially when multiple TFs collaboratively participate in the transcriptional regulation. Results We model the underlying regulatory interactions in terms of the directions (activation or repression) and their logical roles (necessary and/or sufficient) with a modified association rule mining approach, called mTRIM. The experiment on Yeast discovered 670 regulatory interactions, in which multiple TFs express their functions on common target genes collaboratively. The evaluation on yeast genetic interactions, TF knockouts and a synthetic dataset shows that our algorithm is significantly better than the existing ones. Conclusions mTRIM is a novel method to infer TF collaborations in transcriptional regulation networks. mTRIM is available at http://www.msu.edu/~jinchen/mTRIM. PMID:24565025

  9. Compartmentalized gene regulatory network of the pathogenic fungus Fusarium graminearum

    USDA-ARS?s Scientific Manuscript database

    Head blight caused by Fusarium graminearum (Fg) is a major limiting factor of wheat production with both yield loss and mycotoxin contamination. Here we report a model for global Fg gene regulatory networks (GRNs) inferred from a large collection of transcriptomic data using a machine-learning appro...

  10. Second order optimization for the inference of gene regulatory pathways.

    PubMed

    Das, Mouli; Murthy, Chivukula A; De, Rajat K

    2014-02-01

    With the increasing availability of experimental data on gene interactions, modeling of gene regulatory pathways has gained special attention. Gradient descent algorithms have been widely used for regression and classification applications. Unfortunately, results obtained after training a model by gradient descent are often highly variable. In this paper, we present a new second order learning rule based on the Newton's method for inferring optimal gene regulatory pathways. Unlike the gradient descent method, the proposed optimization rule is independent of the learning parameter. The flow vectors are estimated based on biomass conservation. A set of constraints is formulated incorporating weighting coefficients. The method calculates the maximal expression of the target gene starting from a given initial gene through these weighting coefficients. Our algorithm has been benchmarked and validated on certain types of functions and on some gene regulatory networks, gathered from literature. The proposed method has been found to perform better than the gradient descent learning. Extensive performance comparison with the extreme pathway analysis method has underlined the effectiveness of our proposed methodology.

  11. Molecular characterization of a maize regulatory gene

    SciTech Connect

    Wessler, S.R.

    1991-12-01

    Based on initial bombardment studies we have previously concluded that promoter diversity was responsible for the diversity of naturally occurring R alleles. During this period we have found that R is controlled at the level of translation initiation and intron 1 is alternatively spliced. The experiments described in Sections 1 and 2 sought to quantify these effects and to determine whether they contribute to the tissue specific expression of select R alleles. This study was done because very little is understood about the post-transcriptional regulation of plant genes. Section 3 and 4 describe experiments designed to identify important structural components of the R protein.

  12. Function does not follow form in gene regulatory circuits

    PubMed Central

    Payne, Joshua L.; Wagner, Andreas

    2015-01-01

    Gene regulatory circuits are to the cell what arithmetic logic units are to the chip: fundamental components of information processing that map an input onto an output. Gene regulatory circuits come in many different forms, distinct structural configurations that determine who regulates whom. Studies that have focused on the gene expression patterns (functions) of circuits with a given structure (form) have examined just a few structures or gene expression patterns. Here, we use a computational model to exhaustively characterize the gene expression patterns of nearly 17 million three-gene circuits in order to systematically explore the relationship between circuit form and function. Three main conclusions emerge. First, function does not follow form. A circuit of any one structure can have between twelve and nearly thirty thousand distinct gene expression patterns. Second, and conversely, form does not follow function. Most gene expression patterns can be realized by more than one circuit structure. And third, multifunctionality severely constrains circuit form. The number of circuit structures able to drive multiple gene expression patterns decreases rapidly with the number of these patterns. These results indicate that it is generally not possible to infer circuit function from circuit form, or vice versa. PMID:26290154

  13. E-cadherin intron 2 contains cis-regulatory elements essential for gene expression.

    PubMed

    Stemmler, Marc P; Hecht, Andreas; Kemler, Rolf

    2005-03-01

    Cadherin-mediated cell-cell adhesion plays important roles in mouse embryonic development, and changes in cadherin expression are often linked to morphogenetic events. For proper embryonic development and organ formation, the expression of E-cadherin must be tightly regulated. Dysregulated expression during tumorigenesis confers invasiveness and metastasis. Except for the E-box motifs in the E-cadherin promoter, little is known about the existence and location of cis-regulatory elements controlling E-cadherin gene expression. We have examined putative cis-regulatory elements in the E-cadherin gene and we show a pivotal role for intron 2 in activating transcription. Upon deleting the genomic intron 2 entirely, the E-cadherin locus becomes completely inactive in embryonic stem cells and during early embryonic development. Later in development, from E11.5 onwards, the locus is activated only weakly in the absence of intron 2 sequences. We demonstrate that in differentiated epithelia, intron 2 sequences are required both to initiate transcriptional activation and additionally to maintain E-cadherin expression. Detailed analysis also revealed that expression in the yolk sac is intron 2 independent, whereas expression in the lens and the salivary glands absolutely relies on cis-regulatory sequences of intron 2. Taken together, our findings reveal a complex mechanism of gene regulation, with a vital role for the large intron 2.

  14. An integrated holo-enhancer unit defines tissue and gene specificity of the Fgf8 regulatory landscape.

    PubMed

    Marinić, Mirna; Aktas, Tugce; Ruf, Sandra; Spitz, François

    2013-03-11

    Fgf8 encodes a key signaling factor, and its precise regulation is essential for embryo patterning. Here, we identified the regulatory modules that control Fgf8 expression during mammalian embryogenesis. These enhancers are interspersed with unrelated genes along a large region of 220 kb; yet they act on Fgf8 only. Intriguingly, this region also contains additional genuine enhancer activities that are not transformed into gene expression. Using genomic engineering strategies, we showed that these multiple and distinct regulatory modules act as a coherent unit and influence genes depending on their position rather than on their promoter sequence. These findings highlight how the structure of a locus regulates the autonomous intrinsic activities of the regulatory elements it contains and contributes to their tissue and target specificities. We discuss the implications of such regulatory systems regarding the evolution of gene expression and the impact of human genomic structural variations. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Inferring slowly-changing dynamic gene-regulatory networks

    PubMed Central

    2015-01-01

    Dynamic gene-regulatory networks are complex since the interaction patterns between their components mean that it is impossible to study parts of the network in separation. This holistic character of gene-regulatory networks poses a real challenge to any type of modelling. Graphical models are a class of models that connect the network with a conditional independence relationships between random variables. By interpreting these random variables as gene activities and the conditional independence relationships as functional non-relatedness, graphical models have been used to describe gene-regulatory networks. Whereas the literature has been focused on static networks, most time-course experiments are designed in order to tease out temporal changes in the underlying network. It is typically reasonable to assume that changes in genomic networks are few, because biological systems tend to be stable. We introduce a new model for estimating slow changes in dynamic gene-regulatory networks, which is suitable for high-dimensional data, e.g. time-course microarray data. Our aim is to estimate a dynamically changing genomic network based on temporal activity measurements of the genes in the network. Our method is based on the penalized likelihood with ℓ1-norm, that penalizes conditional dependencies between genes as well as differences between conditional independence elements across time points. We also present a heuristic search strategy to find optimal tuning parameters. We re-write the penalized maximum likelihood problem into a standard convex optimization problem subject to linear equality constraints. We show that our method performs well in simulation studies. Finally, we apply the proposed model to a time-course T-cell dataset. PMID:25917062

  16. A Genome-Wide Regulatory Framework Identifies Maize Pericarp Color1 Controlled Genes[C][W

    PubMed Central

    Morohashi, Kengo; Casas, María Isabel; Ferreyra, Lorena Falcone; Mejía-Guerra, María Katherine; Pourcel, Lucille; Yilmaz, Alper; Feller, Antje; Carvalho, Bruna; Emiliani, Julia; Rodriguez, Eduardo; Pellegrinet, Silvina; McMullen, Michael; Casati, Paula; Grotewold, Erich

    2012-01-01

    Pericarp Color1 (P1) encodes an R2R3-MYB transcription factor responsible for the accumulation of insecticidal flavones in maize (Zea mays) silks and red phlobaphene pigments in pericarps and other floral tissues, which makes P1 an important visual marker. Using genome-wide expression analyses (RNA sequencing) in pericarps and silks of plants with contrasting P1 alleles combined with chromatin immunoprecipitation coupled with high-throughput sequencing, we show here that the regulatory functions of P1 are much broader than the activation of genes corresponding to enzymes in a branch of flavonoid biosynthesis. P1 modulates the expression of several thousand genes, and ∼1500 of them were identified as putative direct targets of P1. Among them, we identified F2H1, corresponding to a P450 enzyme that converts naringenin into 2-hydroxynaringenin, a key branch point in the P1-controlled pathway and the first step in the formation of insecticidal C-glycosyl flavones. Unexpectedly, the binding of P1 to gene regulatory regions can result in both gene activation and repression. Our results indicate that P1 is the major regulator for a set of genes involved in flavonoid biosynthesis and a minor modulator of the expression of a much larger gene set that includes genes involved in primary metabolism and production of other specialized compounds. PMID:22822204

  17. Isolation and computer analysis of the 5'-regulatory region of the seed storage protein gene from buckwheat (Fagopyrum esculentum Moench).

    PubMed

    Milisavljević, Mira Dj; Konstantinović, Miroslav M; Brkljacić, Jelena M; Maksimović, Vesna R

    2005-03-23

    Using the modified rapid amplification of cDNA ends (5'-RACE) approach, a fragment containing the 955 bp long 5'-regulatory region of the buckwheat storage globulin gene (FeLEG1) has been amplified from the genomic DNA of buckwheat. The entire fragment was sequenced, and the sequence was analyzed by computer prediction of cis-regulatory elements possibly involved in tissue-specific and developmentally controlled seed storage protein gene expression. The promoter obtained might be interesting not only for fundamental research but also as a useful tool for biotechnological application.

  18. Topological origin of global attractors in gene regulatory networks

    NASA Astrophysics Data System (ADS)

    Zhang, YunJun; Ouyang, Qi; Geng, Zhi

    2015-02-01

    Fixed-point attractors with global stability manifest themselves in a number of gene regulatory networks. This property indicates the stability of regulatory networks against small state perturbations and is closely related to other complex dynamics. In this paper, we aim to reveal the core modules in regulatory networks that determine their global attractors and the relationship between these core modules and other motifs. This work has been done via three steps. Firstly, inspired by the signal transmission in the regulation process, we extract the model of chain-like network from regulation networks. We propose a module of "ideal transmission chain (ITC)", which is proved sufficient and necessary (under certain condition) to form a global fixed-point in the context of chain-like network. Secondly, by examining two well-studied regulatory networks (i.e., the cell-cycle regulatory networks of Budding yeast and Fission yeast), we identify the ideal modules in true regulation networks and demonstrate that the modules have a superior contribution to network stability (quantified by the relative size of the biggest attraction basin). Thirdly, in these two regulation networks, we find that the double negative feedback loops, which are the key motifs of forming bistability in regulation, are connected to these core modules with high network stability. These results have shed new light on the connection between the topological feature and the dynamic property of regulatory networks.

  19. Data- and knowledge-based modeling of gene regulatory networks: an update

    PubMed Central

    Linde, Jörg; Schulze, Sylvie; Henkel, Sebastian G.; Guthke, Reinhard

    2015-01-01

    Gene regulatory network inference is a systems biology approach which predicts interactions between genes with the help of high-throughput data. In this review, we present current and updated network inference methods focusing on novel techniques for data acquisition, network inference assessment, network inference for interacting species and the integration of prior knowledge. After the advance of Next-Generation-Sequencing of cDNAs derived from RNA samples (RNA-Seq) we discuss in detail its application to network inference. Furthermore, we present progress for large-scale or even full-genomic network inference as well as for small-scale condensed network inference and review advances in the evaluation of network inference methods by crowdsourcing. Finally, we reflect the current availability of data and prior knowledge sources and give an outlook for the inference of gene regulatory networks that reflect interacting species, in particular pathogen-host interactions. PMID:27047314

  20. Gap Gene Regulatory Dynamics Evolve along a Genotype Network

    PubMed Central

    Crombach, Anton; Wotton, Karl R.; Jiménez-Guri, Eva; Jaeger, Johannes

    2016-01-01

    Developmental gene networks implement the dynamic regulatory mechanisms that pattern and shape the organism. Over evolutionary time, the wiring of these networks changes, yet the patterning outcome is often preserved, a phenomenon known as “system drift.” System drift is illustrated by the gap gene network—involved in segmental patterning—in dipteran insects. In the classic model organism Drosophila melanogaster and the nonmodel scuttle fly Megaselia abdita, early activation and placement of gap gene expression domains show significant quantitative differences, yet the final patterning output of the system is essentially identical in both species. In this detailed modeling analysis of system drift, we use gene circuits which are fit to quantitative gap gene expression data in M. abdita and compare them with an equivalent set of models from D. melanogaster. The results of this comparative analysis show precisely how compensatory regulatory mechanisms achieve equivalent final patterns in both species. We discuss the larger implications of the work in terms of “genotype networks” and the ways in which the structure of regulatory networks can influence patterns of evolutionary change (evolvability). PMID:26796549

  1. Heart morphogenesis gene regulatory networks revealed by temporal expression analysis.

    PubMed

    Hill, Jonathon T; Demarest, Bradley; Gorsi, Bushra; Smith, Megan; Yost, H Joseph

    2017-10-01

    During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks (GRNs) driving this phase of heart development, during which many congenital heart disease malformations likely arise, we conducted an RNA-seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern, identified transcription factor binding motifs enriched in each cluster, and generated a model GRN for the major gene batteries in heart morphogenesis. This approach predicted hundreds of regulatory interactions and found batteries enriched in specific cell and tissue types, indicating that the approach can be used to narrow the search for novel genetic markers and regulatory interactions. Subsequent analyses confirmed the GRN using two mutants, Tbx5 and nkx2-5, and identified sets of duplicated zebrafish genes that do not show temporal subfunctionalization. This dataset provides an essential resource for future studies on the genetic/epigenetic pathways implicated in congenital heart defects and the mechanisms of cardiac transcriptional regulation. © 2017. Published by The Company of Biologists Ltd.

  2. How difficult is inference of mammalian causal gene regulatory networks?

    PubMed

    Djordjevic, Djordje; Yang, Andrian; Zadoorian, Armella; Rungrugeecharoen, Kevin; Ho, Joshua W K

    2014-01-01

    Gene regulatory networks (GRNs) play a central role in systems biology, especially in the study of mammalian organ development. One key question remains largely unanswered: Is it possible to infer mammalian causal GRNs using observable gene co-expression patterns alone? We assembled two mouse GRN datasets (embryonic tooth and heart) and matching microarray gene expression profiles to systematically investigate the difficulties of mammalian causal GRN inference. The GRNs were assembled based on > 2,000 pieces of experimental genetic perturbation evidence from manually reading > 150 primary research articles. Each piece of perturbation evidence records the qualitative change of the expression of one gene following knock-down or over-expression of another gene. Our data have thorough annotation of tissue types and embryonic stages, as well as the type of regulation (activation, inhibition and no effect), which uniquely allows us to estimate both sensitivity and specificity of the inference of tissue specific causal GRN edges. Using these unprecedented datasets, we found that gene co-expression does not reliably distinguish true positive from false positive interactions, making inference of GRN in mammalian development very difficult. Nonetheless, if we have expression profiling data from genetic or molecular perturbation experiments, such as gene knock-out or signalling stimulation, it is possible to use the set of differentially expressed genes to recover causal regulatory relationships with good sensitivity and specificity. Our result supports the importance of using perturbation experimental data in causal network reconstruction. Furthermore, we showed that causal gene regulatory relationship can be highly cell type or developmental stage specific, suggesting the importance of employing expression profiles from homogeneous cell populations. This study provides essential datasets and empirical evidence to guide the development of new GRN inference methods for

  3. Modularity and evolutionary constraints in a baculovirus gene regulatory network

    PubMed Central

    2013-01-01

    Background The structure of regulatory networks remains an open question in our understanding of complex biological systems. Interactions during complete viral life cycles present unique opportunities to understand how host-parasite network take shape and behave. The Anticarsia gemmatalis multiple nucleopolyhedrovirus (AgMNPV) is a large double-stranded DNA virus, whose genome may encode for 152 open reading frames (ORFs). Here we present the analysis of the ordered cascade of the AgMNPV gene expression. Results We observed an earlier onset of the expression than previously reported for other baculoviruses, especially for genes involved in DNA replication. Most ORFs were expressed at higher levels in a more permissive host cell line. Genes with more than one copy in the genome had distinct expression profiles, which could indicate the acquisition of new functionalities. The transcription gene regulatory network (GRN) for 149 ORFs had a modular topology comprising five communities of highly interconnected nodes that separated key genes that are functionally related on different communities, possibly maximizing redundancy and GRN robustness by compartmentalization of important functions. Core conserved functions showed expression synchronicity, distinct GRN features and significantly less genetic diversity, consistent with evolutionary constraints imposed in key elements of biological systems. This reduced genetic diversity also had a positive correlation with the importance of the gene in our estimated GRN, supporting a relationship between phylogenetic data of baculovirus genes and network features inferred from expression data. We also observed that gene arrangement in overlapping transcripts was conserved among related baculoviruses, suggesting a principle of genome organization. Conclusions Albeit with a reduced number of nodes (149), the AgMNPV GRN had a topology and key characteristics similar to those observed in complex cellular organisms, which indicates

  4. Interrogating the topological robustness of gene regulatory circuits by randomization

    PubMed Central

    Levine, Herbert; Onuchic, Jose N.

    2017-01-01

    One of the most important roles of cells is performing their cellular tasks properly for survival. Cells usually achieve robust functionality, for example, cell-fate decision-making and signal transduction, through multiple layers of regulation involving many genes. Despite the combinatorial complexity of gene regulation, its quantitative behavior has been typically studied on the basis of experimentally verified core gene regulatory circuitry, composed of a small set of important elements. It is still unclear how such a core circuit operates in the presence of many other regulatory molecules and in a crowded and noisy cellular environment. Here we report a new computational method, named random circuit perturbation (RACIPE), for interrogating the robust dynamical behavior of a gene regulatory circuit even without accurate measurements of circuit kinetic parameters. RACIPE generates an ensemble of random kinetic models corresponding to a fixed circuit topology, and utilizes statistical tools to identify generic properties of the circuit. By applying RACIPE to simple toggle-switch-like motifs, we observed that the stable states of all models converge to experimentally observed gene state clusters even when the parameters are strongly perturbed. RACIPE was further applied to a proposed 22-gene network of the Epithelial-to-Mesenchymal Transition (EMT), from which we identified four experimentally observed gene states, including the states that are associated with two different types of hybrid Epithelial/Mesenchymal phenotypes. Our results suggest that dynamics of a gene circuit is mainly determined by its topology, not by detailed circuit parameters. Our work provides a theoretical foundation for circuit-based systems biology modeling. We anticipate RACIPE to be a powerful tool to predict and decode circuit design principles in an unbiased manner, and to quantitatively evaluate the robustness and heterogeneity of gene expression. PMID:28362798

  5. The Transcriptional and Gene Regulatory Network of Lactococcus lactis MG1363 during Growth in Milk

    PubMed Central

    de Jong, Anne; Hansen, Morten E.; Kuipers, Oscar P.; Kilstrup, Mogens; Kok, Jan

    2013-01-01

    In the present study we examine the changes in the expression of genes of Lactococcus lactis subspecies cremoris MG1363 during growth in milk. To reveal which specific classes of genes (pathways, operons, regulons, COGs) are important, we performed a transcriptome time series experiment. Global analysis of gene expression over time showed that L. lactis adapted quickly to the environmental changes. Using upstream sequences of genes with correlated gene expression profiles, we uncovered a substantial number of putative DNA binding motifs that may be relevant for L. lactis fermentative growth in milk. All available novel and literature-derived data were integrated into network reconstruction building blocks, which were used to reconstruct and visualize the L. lactis gene regulatory network. This network enables easy mining in the chrono-transcriptomics data. A freely available website at http://milkts.molgenrug.nl gives full access to all transcriptome data, to the reconstructed network and to the individual network building blocks. PMID:23349698

  6. Dynamic Gene Regulatory Networks Drive Hematopoietic Specification and Differentiation

    PubMed Central

    Goode, Debbie K.; Obier, Nadine; Vijayabaskar, M.S.; Lie-A-Ling, Michael; Lilly, Andrew J.; Hannah, Rebecca; Lichtinger, Monika; Batta, Kiran; Florkowska, Magdalena; Patel, Rahima; Challinor, Mairi; Wallace, Kirstie; Gilmour, Jane; Assi, Salam A.; Cauchy, Pierre; Hoogenkamp, Maarten; Westhead, David R.; Lacaud, Georges; Kouskoff, Valerie; Göttgens, Berthold; Bonifer, Constanze

    2016-01-01

    Summary Metazoan development involves the successive activation and silencing of specific gene expression programs and is driven by tissue-specific transcription factors programming the chromatin landscape. To understand how this process executes an entire developmental pathway, we generated global gene expression, chromatin accessibility, histone modification, and transcription factor binding data from purified embryonic stem cell-derived cells representing six sequential stages of hematopoietic specification and differentiation. Our data reveal the nature of regulatory elements driving differential gene expression and inform how transcription factor binding impacts on promoter activity. We present a dynamic core regulatory network model for hematopoietic specification and demonstrate its utility for the design of reprogramming experiments. Functional studies motivated by our genome-wide data uncovered a stage-specific role for TEAD/YAP factors in mammalian hematopoietic specification. Our study presents a powerful resource for studying hematopoiesis and demonstrates how such data advance our understanding of mammalian development. PMID:26923725

  7. Allelic polymorphism in transcriptional regulatory regions of HLA-DQB genes

    PubMed Central

    1991-01-01

    Class II genes of the human major histocompatibility complex (MHC) are highly polymorphic. Allelic variation of structural genes provides diversity in immune cell interactions, contributing to the formation of the T cell repertoire and to susceptibility to certain autoimmune diseases. We now report that allelic polymorphism also exists in the promoter and upstream regulatory regions (URR) of human histocompatibility leukocyte antigen (HLA) class II genes. Nucleotide sequencing of these regulatory regions of seven alleles of the DQB locus reveals a number of allele-specific polymorphisms, some of which lie in functionally critical consensus regions thought to be highly conserved in class II promoters. These sequence differences also correspond to allelic differences in binding of nuclear proteins to the URR. Fragments of the URR of two DQB alleles were analyzed for binding to nuclear proteins extracted from human B lymphoblastoid cell lines (B- LCL). Gel retardation assays showed substantially different banding patterns to the two promoters, including prominent variation in nuclear protein binding to the partially conserved X box regions and a novel upstream polymorphic sequence element. Comparison of these two polymorphic alleles in a transient expression system demonstrated a marked difference in their promoter strengths determined by relative abilities to initiate transcription of the chloramphenicol acetyltransferase reporter gene in human B-LCL. Shuttling of URR sequences between alleles showed that functional variation corresponded to both the X box and upstream sequence polymorphic sites. These findings identify an important source of MHC class II diversity, and suggest the possibility that such regulatory region polymorphisms may confer allelic differences in expression, inducibility, and/or tissue specificity of class II molecules. PMID:1985121

  8. Constraint and Contingency in Multifunctional Gene Regulatory Circuits

    PubMed Central

    Payne, Joshua L.; Wagner, Andreas

    2013-01-01

    Gene regulatory circuits drive the development, physiology, and behavior of organisms from bacteria to humans. The phenotypes or functions of such circuits are embodied in the gene expression patterns they form. Regulatory circuits are typically multifunctional, forming distinct gene expression patterns in different embryonic stages, tissues, or physiological states. Any one circuit with a single function can be realized by many different regulatory genotypes. Multifunctionality presumably constrains this number, but we do not know to what extent. We here exhaustively characterize a genotype space harboring millions of model regulatory circuits and all their possible functions. As a circuit's number of functions increases, the number of genotypes with a given number of functions decreases exponentially but can remain very large for a modest number of functions. However, the sets of circuits that can form any one set of functions becomes increasingly fragmented. As a result, historical contingency becomes widespread in circuits with many functions. Whether a circuit can acquire an additional function in the course of its evolution becomes increasingly dependent on the function it already has. Circuits with many functions also become increasingly brittle and sensitive to mutation. These observations are generic properties of a broad class of circuits and independent of any one circuit genotype or phenotype. PMID:23762020

  9. Constraint and contingency in multifunctional gene regulatory circuits.

    PubMed

    Payne, Joshua L; Wagner, Andreas

    2013-01-01

    Gene regulatory circuits drive the development, physiology, and behavior of organisms from bacteria to humans. The phenotypes or functions of such circuits are embodied in the gene expression patterns they form. Regulatory circuits are typically multifunctional, forming distinct gene expression patterns in different embryonic stages, tissues, or physiological states. Any one circuit with a single function can be realized by many different regulatory genotypes. Multifunctionality presumably constrains this number, but we do not know to what extent. We here exhaustively characterize a genotype space harboring millions of model regulatory circuits and all their possible functions. As a circuit's number of functions increases, the number of genotypes with a given number of functions decreases exponentially but can remain very large for a modest number of functions. However, the sets of circuits that can form any one set of functions becomes increasingly fragmented. As a result, historical contingency becomes widespread in circuits with many functions. Whether a circuit can acquire an additional function in the course of its evolution becomes increasingly dependent on the function it already has. Circuits with many functions also become increasingly brittle and sensitive to mutation. These observations are generic properties of a broad class of circuits and independent of any one circuit genotype or phenotype.

  10. Nemertean toxin genes revealed through transcriptome sequencing.

    PubMed

    Whelan, Nathan V; Kocot, Kevin M; Santos, Scott R; Halanych, Kenneth M

    2014-11-27

    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63-74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Nemertean Toxin Genes Revealed through Transcriptome Sequencing

    PubMed Central

    Whelan, Nathan V.; Kocot, Kevin M.; Santos, Scott R.; Halanych, Kenneth M.

    2014-01-01

    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63–74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. PMID:25432940

  12. PAZAR: a framework for collection and dissemination of cis-regulatory sequence annotation

    PubMed Central

    Portales-Casamar, Elodie; Kirov, Stefan; Lim, Jonathan; Lithwick, Stuart; Swanson, Magdalena I; Ticoll, Amy; Snoddy, Jay; Wasserman, Wyeth W

    2007-01-01

    PAZAR is an open-access and open-source database of transcription factor and regulatory sequence annotation with associated web interface and programming tools for data submission and extraction. Curated boutique data collections can be maintained and disseminated through the unified schema of the mall-like PAZAR repository. The Pleiades Promoter Project collection of brain-linked regulatory sequences is introduced to demonstrate the depth of annotation possible within PAZAR. PAZAR, located at , is open for business. PMID:17916232

  13. Selecting and Weighting Data for Building Consensus Gene Regulatory Networks

    NASA Astrophysics Data System (ADS)

    Steele, Emma; Tucker, Allan

    Microarrays are the major source of data for gene expression activity, allowing the expression of thousands of genes to be measured simultaneously. Gene regulatory networks (GRNs) describe how the expression level of genes affect the expression of the other genes. Modelling GRNs from expression data is a topic of great interest in current bioinformatics research. Previously, we took advantage of publicly available gene expression datasets generated by similar biological studies by drawing together a richer and/or broader collection of data in order to produce GRN models that are more robust, have greater confidence and place less reliance on a single dataset. In this paper a new approach, Weighted Consensus Bayesian Networks, introduces the use of weights in order to place more influence on certain input networks or remove the least reliable networks from the input with encouraging results on both synthetic data and real world yeast microarray datasets.

  14. Genomic imprinting-an epigenetic gene-regulatory model.

    PubMed

    Koerner, Martha V; Barlow, Denise P

    2010-04-01

    Epigenetic mechanisms (Box 1) are considered to play major gene-regulatory roles in development, differentiation and disease. However, the relative importance of epigenetics in defining the mammalian transcriptome in normal and disease states is unknown. The mammalian genome contains only a few model systems where epigenetic gene regulation has been shown to play a major role in transcriptional control. These model systems are important not only to investigate the biological function of known epigenetic modifications but also to identify new and unexpected epigenetic mechanisms in the mammalian genome. Here we review recent progress in understanding how epigenetic mechanisms control imprinted gene expression.

  15. Additive Functions in Boolean Models of Gene Regulatory Network Modules

    PubMed Central

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H.; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in Boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a Boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred Boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  16. Additive functions in boolean models of gene regulatory network modules.

    PubMed

    Darabos, Christian; Di Cunto, Ferdinando; Tomassini, Marco; Moore, Jason H; Provero, Paolo; Giacobini, Mario

    2011-01-01

    Gene-on-gene regulations are key components of every living organism. Dynamical abstract models of genetic regulatory networks help explain the genome's evolvability and robustness. These properties can be attributed to the structural topology of the graph formed by genes, as vertices, and regulatory interactions, as edges. Moreover, the actual gene interaction of each gene is believed to play a key role in the stability of the structure. With advances in biology, some effort was deployed to develop update functions in boolean models that include recent knowledge. We combine real-life gene interaction networks with novel update functions in a boolean model. We use two sub-networks of biological organisms, the yeast cell-cycle and the mouse embryonic stem cell, as topological support for our system. On these structures, we substitute the original random update functions by a novel threshold-based dynamic function in which the promoting and repressing effect of each interaction is considered. We use a third real-life regulatory network, along with its inferred boolean update functions to validate the proposed update function. Results of this validation hint to increased biological plausibility of the threshold-based function. To investigate the dynamical behavior of this new model, we visualized the phase transition between order and chaos into the critical regime using Derrida plots. We complement the qualitative nature of Derrida plots with an alternative measure, the criticality distance, that also allows to discriminate between regimes in a quantitative way. Simulation on both real-life genetic regulatory networks show that there exists a set of parameters that allows the systems to operate in the critical region. This new model includes experimentally derived biological information and recent discoveries, which makes it potentially useful to guide experimental research. The update function confers additional realism to the model, while reducing the complexity

  17. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-01-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  18. Cis-regulatory sequence variation and association with Mycoplasma load in natural populations of the house finch (Carpodacus mexicanus)

    PubMed Central

    Backström, Niclas; Shipilina, Daria; Blom, Mozes P K; Edwards, Scott V

    2013-01-01

    Characterization of the genetic basis of fitness traits in natural populations is important for understanding how organisms adapt to the changing environment and to novel events, such as epizootics. However, candidate fitness-influencing loci, such as regulatory regions, are usually unavailable in nonmodel species. Here, we analyze sequence data from targeted resequencing of the cis-regulatory regions of three candidate genes for disease resistance (CD74, HSP90α, and LCP1) in populations of the house finch (Carpodacus mexicanus) historically exposed (Alabama) and naïve (Arizona) to Mycoplasma gallisepticum. Our study, the first to quantify variation in regulatory regions in wild birds, reveals that the upstream regions of CD74 and HSP90α are GC-rich, with the former exhibiting unusually low sequence variation for this species. We identified two SNPs, located in a GC-rich region immediately upstream of an inferred promoter site in the gene HSP90α, that were significantly associated with Mycoplasma pathogen load in the two populations. The SNPs are closely linked and situated in potential regulatory sequences: one in a binding site for the transcription factor nuclear NFYα and the other in a dinucleotide microsatellite ((GC)6). The genotype associated with pathogen load in the putative NFYα binding site was significantly overrepresented in the Alabama birds. However, we did not see strong effects of selection at this SNP, perhaps because selection has acted on standing genetic variation over an extremely short time in a highly recombining region. Our study is a useful starting point to explore functional relationships between sequence polymorphisms, gene expression, and phenotypic traits, such as pathogen resistance that affect fitness in the wild. PMID:23532859

  19. Regulatory hotspots are associated with plant gene expression under varying soil phosphorus supply in Brassica rapa.

    PubMed

    Hammond, John P; Mayes, Sean; Bowen, Helen C; Graham, Neil S; Hayden, Rory M; Love, Christopher G; Spracklen, William P; Wang, Jun; Welham, Sue J; White, Philip J; King, Graham J; Broadley, Martin R

    2011-07-01

    Gene expression is a quantitative trait that can be mapped genetically in structured populations to identify expression quantitative trait loci (eQTL). Genes and regulatory networks underlying complex traits can subsequently be inferred. Using a recently released genome sequence, we have defined cis- and trans-eQTL and their environmental response to low phosphorus (P) availability within a complex plant genome and found hotspots of trans-eQTL within the genome. Interval mapping, using P supply as a covariate, revealed 18,876 eQTL. trans-eQTL hotspots occurred on chromosomes A06 and A01 within Brassica rapa; these were enriched with P metabolism-related Gene Ontology terms (A06) as well as chloroplast- and photosynthesis-related terms (A01). We have also attributed heritability components to measures of gene expression across environments, allowing the identification of novel gene expression markers and gene expression changes associated with low P availability. Informative gene expression markers were used to map eQTL and P use efficiency-related QTL. Genes responsive to P supply had large environmental and heritable variance components. Regulatory loci and genes associated with P use efficiency identified through eQTL analysis are potential targets for further characterization and may have potential for crop improvement.

  20. Identification of cancer-related genes and motifs in the human gene regulatory network.

    PubMed

    Carson, Matthew B; Gu, Jianlei; Yu, Guangjun; Lu, Hui

    2015-08-01

    The authors investigated the regulatory network motifs and corresponding motif positions of cancer-related genes. First, they mapped disease-related genes to a transcription factor regulatory network. Next, they calculated statistically significant motifs and subsequently identified positions within these motifs that were enriched in cancer-related genes. Potential mechanisms of these motifs and positions are discussed. These results could be used to identify other disease- and cancer-related genes and could also suggest mechanisms for how these genes relate to co-occurring diseases.

  1. Full-Length Minor Ampullate Spidroin Gene Sequence

    PubMed Central

    Chen, Gefei; Liu, Xiangqin; Zhang, Yunlong; Lin, Senzhu; Yang, Zijiang; Johansson, Jan; Rising, Anna; Meng, Qing

    2012-01-01

    Spider silk includes seven protein based fibers and glue-like substances produced by glands in the spider's abdomen. Minor ampullate silk is used to make the auxiliary spiral of the orb-web and also for wrapping prey, has a high tensile strength and does not supercontract in water. So far, only partial cDNA sequences have been obtained for minor ampullate spidroins (MiSps). Here we describe the first MiSp full-length gene sequence from the spider species Araneus ventricosus, using a multidimensional PCR approach. Comparative analysis of the sequence reveals regulatory elements, as well as unique spidroin gene and protein architecture including the presence of an unusually large intron. The spliced full-length transcript of MiSp gene is 5440 bp in size and encodes 1766 amino acid residues organized into conserved nonrepetitive N- and C-terminal domains and a central predominantly repetitive region composed of four units that are iterated in a non regular manner. The repeats are more conserved within A. ventricosus MiSp than compared to repeats from homologous proteins, and are interrupted by two nonrepetitive spacer regions, which have 100% identity even at the nucleotide level. PMID:23251707

  2. Impacts of Neanderthal-Introgressed Sequences on the Landscape of Human Gene Expression.

    PubMed

    McCoy, Rajiv C; Wakefield, Jon; Akey, Joshua M

    2017-02-23

    Regulatory variation influencing gene expression is a key contributor to phenotypic diversity, both within and between species. Unfortunately, RNA degrades too rapidly to be recovered from fossil remains, limiting functional genomic insights about our extinct hominin relatives. Many Neanderthal sequences survive in modern humans due to ancient hybridization, providing an opportunity to assess their contributions to transcriptional variation and to test hypotheses about regulatory evolution. We developed a flexible Bayesian statistical approach to quantify allele-specific expression (ASE) in complex RNA-seq datasets. We identified widespread expression differences between Neanderthal and modern human alleles, indicating pervasive cis-regulatory impacts of introgression. Brain regions and testes exhibited significant downregulation of Neanderthal alleles relative to other tissues, consistent with natural selection influencing the tissue-specific regulatory landscape. Our study demonstrates that Neanderthal-inherited sequences are not silent remnants of ancient interbreeding but have measurable impacts on gene expression that contribute to variation in modern human phenotypes.

  3. Mapping gene regulatory circuitry of Pax6 during neurogenesis

    PubMed Central

    Thakurela, Sudhir; Tiwari, Neha; Schick, Sandra; Garding, Angela; Ivanek, Robert; Berninger, Benedikt; Tiwari, Vijay K

    2016-01-01

    Pax6 is a highly conserved transcription factor among vertebrates and is important in various aspects of the central nervous system development. However, the gene regulatory circuitry of Pax6 underlying these functions remains elusive. We find that Pax6 targets a large number of promoters in neural progenitors cells. Intriguingly, many of these sites are also bound by another progenitor factor, Sox2, which cooperates with Pax6 in gene regulation. A combinatorial analysis of Pax6-binding data set with transcriptome changes in Pax6-deficient neural progenitors reveals a dual role for Pax6, in which it activates the neuronal (ectodermal) genes while concurrently represses the mesodermal and endodermal genes, thereby ensuring the unidirectionality of lineage commitment towards neuronal differentiation. Furthermore, Pax6 is critical for inducing activity of transcription factors that elicit neurogenesis and repress others that promote non-neuronal lineages. In addition to many established downstream effectors, Pax6 directly binds and activates a number of genes that are specifically expressed in neural progenitors but have not been previously implicated in neurogenesis. The in utero knockdown of one such gene, Ift74, during brain development impairs polarity and migration of newborn neurons. These findings demonstrate new aspects of the gene regulatory circuitry of Pax6, revealing how it functions to control neuronal development at multiple levels to ensure unidirectionality and proper execution of the neurogenic program. PMID:27462442

  4. Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

    PubMed Central

    Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  5. Next-generation tag sequencing for cancer gene expression profiling.

    PubMed

    Morrissy, A Sorana; Morin, Ryan D; Delaney, Allen; Zeng, Thomas; McDonald, Helen; Jones, Steven; Zhao, Yongjun; Hirst, Martin; Marra, Marco A

    2009-10-01

    We describe a new method, Tag-seq, which employs ultra high-throughput sequencing of 21 base pair cDNA tags for sensitive and cost-effective gene expression profiling. We compared Tag-seq data to LongSAGE data and observed improved representation of several classes of rare transcripts, including transcription factors, antisense transcripts, and intronic sequences, the latter possibly representing novel exons or genes. We observed increases in the diversity, abundance, and dynamic range of such rare transcripts and took advantage of the greater dynamic range of expression to identify, in cancers and normal libraries, altered expression ratios of alternative transcript isoforms. The strand-specific information of Tag-seq reads further allowed us to detect altered expression ratios of sense and antisense (S-AS) transcripts between cancer and normal libraries. S-AS transcripts were enriched in known cancer genes, while transcript isoforms were enriched in miRNA targeting sites. We found that transcript abundance had a stronger GC-bias in LongSAGE than Tag-seq, such that AT-rich tags were less abundant than GC-rich tags in LongSAGE. Tag-seq also performed better in gene discovery, identifying >98% of genes detected by LongSAGE and profiling a distinct subset of the transcriptome characterized by AT-rich genes, which was expressed at levels below those detectable by LongSAGE. Overall, Tag-seq is sensitive to rare transcripts, has less sequence composition bias relative to LongSAGE, and allows differential expression analysis for a greater range of transcripts, including transcripts encoding important regulatory molecules.

  6. Modeling stochasticity and robustness in gene regulatory networks

    PubMed Central

    Garg, Abhishek; Mohanram, Kartik; Di Cara, Alessandro; De Micheli, Giovanni; Xenarios, Ioannis

    2009-01-01

    Motivation: Understanding gene regulation in biological processes and modeling the robustness of underlying regulatory networks is an important problem that is currently being addressed by computational systems biologists. Lately, there has been a renewed interest in Boolean modeling techniques for gene regulatory networks (GRNs). However, due to their deterministic nature, it is often difficult to identify whether these modeling approaches are robust to the addition of stochastic noise that is widespread in gene regulatory processes. Stochasticity in Boolean models of GRNs has been addressed relatively sparingly in the past, mainly by flipping the expression of genes between different expression levels with a predefined probability. This stochasticity in nodes (SIN) model leads to over representation of noise in GRNs and hence non-correspondence with biological observations. Results: In this article, we introduce the stochasticity in functions (SIF) model for simulating stochasticity in Boolean models of GRNs. By providing biological motivation behind the use of the SIF model and applying it to the T-helper and T-cell activation networks, we show that the SIF model provides more biologically robust results than the existing SIN model of stochasticity in GRNs. Availability: Algorithms are made available under our Boolean modeling toolbox, GenYsis. The software binaries can be downloaded from http://si2.epfl.ch/∼garg/genysis.html. Contact: abhishek.garg@epfl.ch PMID:19477975

  7. Modeling stochasticity and robustness in gene regulatory networks.

    PubMed

    Garg, Abhishek; Mohanram, Kartik; Di Cara, Alessandro; De Micheli, Giovanni; Xenarios, Ioannis

    2009-06-15

    Understanding gene regulation in biological processes and modeling the robustness of underlying regulatory networks is an important problem that is currently being addressed by computational systems biologists. Lately, there has been a renewed interest in Boolean modeling techniques for gene regulatory networks (GRNs). However, due to their deterministic nature, it is often difficult to identify whether these modeling approaches are robust to the addition of stochastic noise that is widespread in gene regulatory processes. Stochasticity in Boolean models of GRNs has been addressed relatively sparingly in the past, mainly by flipping the expression of genes between different expression levels with a predefined probability. This stochasticity in nodes (SIN) model leads to over representation of noise in GRNs and hence non-correspondence with biological observations. In this article, we introduce the stochasticity in functions (SIF) model for simulating stochasticity in Boolean models of GRNs. By providing biological motivation behind the use of the SIF model and applying it to the T-helper and T-cell activation networks, we show that the SIF model provides more biologically robust results than the existing SIN model of stochasticity in GRNs. Algorithms are made available under our Boolean modeling toolbox, GenYsis. The software binaries can be downloaded from http://si2.epfl.ch/ approximately garg/genysis.html.

  8. EXAMINE: a computational approach to reconstructing gene regulatory networks.

    PubMed

    Deng, Xutao; Geng, Huimin; Ali, Hesham

    2005-08-01

    Reverse-engineering of gene networks using linear models often results in an underdetermined system because of excessive unknown parameters. In addition, the practical utility of linear models has remained unclear. We address these problems by developing an improved method, EXpression Array MINing Engine (EXAMINE), to infer gene regulatory networks from time-series gene expression data sets. EXAMINE takes advantage of sparse graph theory to overcome the excessive-parameter problem with an adaptive-connectivity model and fitting algorithm. EXAMINE also guarantees that the most parsimonious network structure will be found with its incremental adaptive fitting process. Compared to previous linear models, where a fully connected model is used, EXAMINE reduces the number of parameters by O(N), thereby increasing the chance of recovering the underlying regulatory network. The fitting algorithm increments the connectivity during the fitting process until a satisfactory fit is obtained. We performed a systematic study to explore the data mining ability of linear models. A guideline for using linear models is provided: If the system is small (3-20 elements), more than 90% of the regulation pathways can be determined correctly. For a large-scale system, either clustering is needed or it is necessary to integrate information in addition to expression profile. Coupled with the clustering method, we applied EXAMINE to rat central nervous system development (CNS) data with 112 genes. We were able to efficiently generate regulatory networks with statistically significant pathways that have been predicted previously.

  9. Expression of regulatory nif genes in Rhodobacter capsulatus.

    PubMed Central

    Hübner, P; Willison, J C; Vignais, P M; Bickle, T A

    1991-01-01

    Translational fusions of the Escherichia coli lacZ gene to Rhodobacter capsulatus nif genes were constructed in order to determine the regulatory circuit of nif gene expression in R. capsulatus, a free-living photosynthetic diazotroph. The expression of nifH, nifA (copies I and II), and nifR4 was measured in different regulatory mutant strains under different physiological conditions. The expression of nifH and nifR4 (the analog of ntrA in Klebsiella pneumoniae) depends on the NIFR1/R2 system (the analog of the ntr system in K. pneumoniae), on NIFA, and on NIFR4. The expression of both copies of nifA is regulated by the NIFR1/R2 system and is modulated by the N source of the medium under anaerobic photosynthetic growth conditions. In the presence of ammonia or oxygen, moderate expression of nifA was detectable, whereas nifH and nifR4 were not expressed under these conditions. The implications for the regulatory circuit of nif gene expression in R. capsulatus are discussed and compared with the situation in K. pneumoniae, another free-living diazotroph. PMID:1902215

  10. Characterization of nif regulatory genes in Rhodopseudomonas capsulata using lac gene fusions.

    PubMed

    Kranz, R G; Haselkorn, R

    1985-01-01

    Translational fusions of the Escherichia coli lacZYA operon to Rhodopseudomonas capsulata nif genes were obtained by using mini-MudII1734 [Castilho et al., J. Bacteriol. 158 (1984) 488-495] inserts into cloned fragments of R. capsulata DNA. A lac fusion to the nifH gene, which encodes dinitrogenase reductase, was used to classify Nif- mutations occurring in regulatory genes. Nine mutations were unable to activate nifHDK transcription. The nine mutations define four nif regulatory genes. Three of these genes are located on the same R. capsulata 8.4-kb EcoRI fragment. Each is transcribed independently. One of these (complementing mutant J61) is partially homologous with the ntrC gene of Escherichia coli, based on Southern hybridization. The fourth nif regulatory gene (complementing mutants LJ1, AH1 and AH3) is unlinked to the others. Lac fusions to all four regulatory genes were constructed. Each regulatory gene is weakly expressed compared to derepressed nifH and partially repressed in the presence of ammonia.

  11. CMGRN: a web server for constructing multilevel gene regulatory networks using ChIP-seq and gene expression data.

    PubMed

    Guan, Daogang; Shao, Jiaofang; Deng, Youping; Wang, Panwen; Zhao, Zhongying; Liang, Yan; Wang, Junwen; Yan, Bin

    2014-04-15

    ChIP-seq technology provides an accurate characterization of transcription or epigenetic factors binding on genomic sequences. With integration of such ChIP-based and other high-throughput information, it would be dedicated to dissecting cross-interactions among multilevel regulators, genes and biological functions. Here, we devised an integrative web server CMGRN (constructing multilevel gene regulatory networks), to unravel hierarchical interactive networks at different regulatory levels. The newly developed method used the Bayesian network modeling to infer causal interrelationships among transcription factors or epigenetic modifications by using ChIP-seq data. Moreover, it used Bayesian hierarchical model with Gibbs sampling to incorporate binding signals of these regulators and gene expression profile together for reconstructing gene regulatory networks. The example applications indicate that CMGRN provides an effective web-based framework that is able to integrate heterogeneous high-throughput data and to reveal hierarchical 'regulome' and the associated gene expression programs. http://bioinfo.icts.hkbu.edu.hk/cmgrn; http://www.byanbioinfo.org/cmgrn CONTACT: yanbinai6017@gmail.com or junwen@hku.hk Supplementary Information: Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  13. Exceptionally high heterologous protein levels in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences.

    PubMed

    De Jaeger, Geert; Angenon, Geert; Depicker, Ann

    2003-01-01

    Seeds are concentrated sources of protein and thus may be ideal 'bioreactors' for the production of heterologous proteins. For this application, strong seed-specific expression signals are required. A set of expression cassettes were designed using 5' and 3' regulatory sequences of the seed storage protein gene arcelin 5-I (arc5-I) from Phaseolus vulgaris, and evaluated for the production of heterologous proteins in dicotyledonous plant species. A murine single-chain variable fragment (scFv) was chosen as model protein because of the current industrial interest to produce antibodies and derived fragments in crops. Because the highest scFv accumulation in seed had previously been achieved in the endoplasmic reticulum (ER), the scFv-encoding sequence was provided with signal sequences for accumulation in the ER. Transgenic Arabidopsis seed stocks, expressing the scFv under control of the 35S promoter, contained scFv accumulation levels in the range of 1% of total soluble protein (TSP). However, the seed storage promoter constructs boosted the scFv to exceptionally high levels. Maximum scFv levels were obtained in homozygous seed stocks, being 12.5% of TSP under control of the arc5-I regulatory sequences and even up to 36.5% of TSP upon replacing the arc5-I promoter by the beta-phaseolin promoter of Phaseolus vulgaris. Even at such very high levels, the scFv proteins retain their full antigen-binding activity. Moreover, the presence of very high scFv levels has only minory effects on seed germination and no effect on seed production. These results demonstrate that the expression levels of arcelin 5-I and beta-phaseolin seed storage protein genes can be transferred to heterologous proteins, giving exceptionally high levels of heterologous proteins, which can be of great value for the molecular farming industry by raising production yield and lowering bio-mass production and purification costs. Finally, the feasibility of heterologous protein production using the

  14. Gene therapy for cancer: regulatory considerations for approval

    PubMed Central

    Husain, S R; Han, J; Au, P; Shannon, K; Puri, R K

    2015-01-01

    The rapidly changing field of gene therapy promises a number of innovative treatments for cancer patients. Advances in genetic modification of cancer and immune cells and the use of oncolytic viruses and bacteria have led to numerous clinical trials for cancer therapy, with several progressing to late-stage product development. At the time of this writing, no gene therapy product has been approved by the United States Food and Drug Administration (FDA). Some of the key scientific and regulatory issues include understanding of gene transfer vector biology, safety of vectors in vitro and in animal models, optimum gene transfer, long-term persistence or integration in the host, shedding of a virus and ability to maintain transgene expression in vivo for a desired period of time. Because of the biological complexity of these products, the FDA encourages a flexible, data-driven approach for preclinical safety testing programs. The clinical trial design should be based on the unique features of gene therapy products, and should ensure the safety of enrolled subjects. This article focuses on regulatory considerations for gene therapy product development and also discusses guidance documents that have been published by the FDA. PMID:26584531

  15. Gene therapy for cancer: regulatory considerations for approval.

    PubMed

    Husain, S R; Han, J; Au, P; Shannon, K; Puri, R K

    2015-12-01

    The rapidly changing field of gene therapy promises a number of innovative treatments for cancer patients. Advances in genetic modification of cancer and immune cells and the use of oncolytic viruses and bacteria have led to numerous clinical trials for cancer therapy, with several progressing to late-stage product development. At the time of this writing, no gene therapy product has been approved by the United States Food and Drug Administration (FDA). Some of the key scientific and regulatory issues include understanding of gene transfer vector biology, safety of vectors in vitro and in animal models, optimum gene transfer, long-term persistence or integration in the host, shedding of a virus and ability to maintain transgene expression in vivo for a desired period of time. Because of the biological complexity of these products, the FDA encourages a flexible, data-driven approach for preclinical safety testing programs. The clinical trial design should be based on the unique features of gene therapy products, and should ensure the safety of enrolled subjects. This article focuses on regulatory considerations for gene therapy product development and also discusses guidance documents that have been published by the FDA.

  16. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library

    PubMed Central

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

    2016-01-01

    Aim Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. Methods After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Results Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. Significance This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes

  17. Establishing neural crest identity: a gene regulatory recipe

    PubMed Central

    Simões-Costa, Marcos; Bronner, Marianne E.

    2015-01-01

    The neural crest is a stem/progenitor cell population that contributes to a wide variety of derivatives, including sensory and autonomic ganglia, cartilage and bone of the face and pigment cells of the skin. Unique to vertebrate embryos, it has served as an excellent model system for the study of cell behavior and identity owing to its multipotency, motility and ability to form a broad array of cell types. Neural crest development is thought to be controlled by a suite of transcriptional and epigenetic inputs arranged hierarchically in a gene regulatory network. Here, we examine neural crest development from a gene regulatory perspective and discuss how the underlying genetic circuitry results in the features that define this unique cell population. PMID:25564621

  18. Statistical ensemble of gene regulatory networks of macrophage differentiation.

    PubMed

    Castiglione, Filippo; Tieri, Paolo; Palma, Alessandro; Jarrah, Abdul Salam

    2016-12-22

    Macrophages cover a major role in the immune system, being the most plastic cell yielding several key immune functions. Here we derived a minimalistic gene regulatory network model for the differentiation of macrophages into the two phenotypes M1 (pro-) and M2 (anti-inflammatory). To test the model, we simulated a large number of such networks as in a statistical ensemble. In other words, to enable the inter-cellular crosstalk required to obtain an immune activation in which the macrophage plays its role, the simulated networks are not taken in isolation but combined with other cellular agents, thus setting up a discrete minimalistic model of the immune system at the microscopic/intracellular (i.e., genetic regulation) and mesoscopic/intercellular scale. We show that within the mesoscopic level description of cellular interaction and cooperation, the gene regulatory logic is coherent and contributes to the overall dynamics of the ensembles that shows, statistically, the expected behaviour.

  19. Gene structure, regulatory control, and evolution of black widow venom latrotoxins

    PubMed Central

    Bhere, Kanaka Varun; Haney, Robert A.; Ayoub, Nadia A.; Garb, Jessica E.

    2014-01-01

    Black widow venom contains α-latrotoxin, infamous for causing intense pain. Combining 33 kb of Latrodectus hesperus genomic DNA with RNA-Seq, we characterized the α-latrotoxin gene and discovered a paralog, 4.5 kb downstream. Both paralogs exhibit venom gland specific transcription, and may be regulated post-transcriptionally via musashi-like proteins. A 4 kb intron interrupts the α-latrotoxin coding sequence, while a 10 kb intron in the 3′ UTR of the paralog may cause nonsense-mediated decay. Phylogenetic analysis confirms these divergent latrotoxins diversified through recent tandem gene duplications. Thus, latrotoxin genes have more complex structures, regulatory controls, and sequence diversity than previously proposed. PMID:25217831

  20. Analyzing stationary states of gene regulatory network using petri nets.

    PubMed

    Gambin, Anna; Lasota, Sławomir; Rutkowski, Michał

    2006-01-01

    We introduce and formally define the notion of a stationary state for Petri nets. We also propose a fully automatic method for finding such states. The procedure makes use of the Presburger arithmetic to describe all the stationary states. Finally we apply this novel approach to find stationary states of a gene regulatory network describing the flower morphogenesis of A. thaliana. This shows that the proposed method can be successfully applied in the study of biological systems.

  1. Analyzing stationary States of gene regulatory network using petri nets.

    PubMed

    Gambin, Anna; Lasota, Sławomir; Rutkowski, Michał

    2011-01-01

    We introduce and formally define the notion of a stationary state for Petri nets. We also propose a fully automatic method for finding such states. The procedure makes use of the Presburger arithmetic to describe all the stationary states. Finally we apply this novel approach to find stationary states of a gene regulatory network describing the flower morphogenesis of A. thaliana. This shows that the proposed method can be successfully applied in the study of biological systems.

  2. Detection of Weakly Conserved Ancestral Mammalian RegulatorySequences by Primate Comparisons

    SciTech Connect

    Wang, Qian-fei; Prabhakar, Shyam; Chanan, Sumita; Cheng,Jan-Fang; Rubin, Edward M.; Boffelli, Dario

    2006-06-01

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detectcryptic functional elements, which are too weakly conserved among mammalsto distinguish from nonfunctional DNA. To address this problem, weexplored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  3. Modeling stochasticity and variability in gene regulatory networks.

    PubMed

    Murrugarra, David; Veliz-Cuba, Alan; Aguilar, Boris; Arat, Seda; Laubenbacher, Reinhard

    2012-06-06

    Modeling stochasticity in gene regulatory networks is an important and complex problem in molecular systems biology. To elucidate intrinsic noise, several modeling strategies such as the Gillespie algorithm have been used successfully. This article contributes an approach as an alternative to these classical settings. Within the discrete paradigm, where genes, proteins, and other molecular components of gene regulatory networks are modeled as discrete variables and are assigned as logical rules describing their regulation through interactions with other components. Stochasticity is modeled at the biological function level under the assumption that even if the expression levels of the input nodes of an update rule guarantee activation or degradation there is a probability that the process will not occur due to stochastic effects. This approach allows a finer analysis of discrete models and provides a natural setup for cell population simulations to study cell-to-cell variability. We applied our methods to two of the most studied regulatory networks, the outcome of lambda phage infection of bacteria and the p53-mdm2 complex.

  4. Modeling stochasticity and variability in gene regulatory networks

    PubMed Central

    2012-01-01

    Modeling stochasticity in gene regulatory networks is an important and complex problem in molecular systems biology. To elucidate intrinsic noise, several modeling strategies such as the Gillespie algorithm have been used successfully. This article contributes an approach as an alternative to these classical settings. Within the discrete paradigm, where genes, proteins, and other molecular components of gene regulatory networks are modeled as discrete variables and are assigned as logical rules describing their regulation through interactions with other components. Stochasticity is modeled at the biological function level under the assumption that even if the expression levels of the input nodes of an update rule guarantee activation or degradation there is a probability that the process will not occur due to stochastic effects. This approach allows a finer analysis of discrete models and provides a natural setup for cell population simulations to study cell-to-cell variability. We applied our methods to two of the most studied regulatory networks, the outcome of lambda phage infection of bacteria and the p53-mdm2 complex. PMID:22673395

  5. Transcriptional Targeting in the Airway Using Novel Gene Regulatory Elements

    PubMed Central

    Burnight, Erin R.; Wang, Guoshun; McCray, Paul B.

    2012-01-01

    The delivery of cystic fibrosis transmembrane conductance regulator (CFTR) to airway epithelia is a goal of many gene therapy strategies to treat cystic fibrosis. Because the native regulatory elements of the CFTR are not well characterized, the development of vectors with heterologous promoters of varying strengths and specificity would aid in our selection of optimal reagents for the appropriate expression of the vector-delivered CFTR gene. Here we contrasted the performance of several novel gene-regulatory elements. Based on airway expression analysis, we selected putative regulatory elements from BPIFA1 and WDR65 to investigate. In addition, we selected a human CFTR promoter region (∼ 2 kb upstream of the human CFTR transcription start site) to study. Using feline immunodeficiency virus vectors containing the candidate elements driving firefly luciferase, we transduced murine nasal epithelia in vivo. Luciferase expression persisted for 30 weeks, which was the duration of the experiment. Furthermore, when the nasal epithelium was ablated using the detergent polidocanol, the mice showed a transient loss of luciferase expression that returned 2 weeks after administration, suggesting that our vectors transduced a progenitor cell population. Importantly, the hWDR65 element drove sufficient CFTR expression to correct the anion transport defect in CFTR-null epithelia. These results will guide the development of optimal vectors for sufficient, sustained CFTR expression in airway epithelia. PMID:22447971

  6. Phase transitions in the evolution of gene regulatory networks

    NASA Astrophysics Data System (ADS)

    Skanata, Antun; Kussell, Edo

    The role of gene regulatory networks is to respond to environmental conditions and optimize growth of the cell. A typical example is found in bacteria, where metabolic genes are activated in response to nutrient availability, and are subsequently turned off to conserve energy when their specific substrates are depleted. However, in fluctuating environmental conditions, regulatory networks could experience strong evolutionary pressures not only to turn the right genes on and off, but also to respond optimally under a wide spectrum of fluctuation timescales. The outcome of evolution is predicted by the long-term growth rate, which differentiates between optimal strategies. Here we present an analytic computation of the long-term growth rate in randomly fluctuating environments, by using mean-field and higher order expansion in the environmental history. We find that optimal strategies correspond to distinct regions in the phase space of fluctuations, separated by first and second order phase transitions. The statistics of environmental randomness are shown to dictate the possible evolutionary modes, which either change the structure of the regulatory network abruptly, or gradually modify and tune the interactions between its components.

  7. Omics approaches to study gene regulatory networks for development in echinoderms.

    PubMed

    Lowe, Elijah K; Cuomo, Claudia; Arnone, Maria I

    2017-09-01

    Gene regulatory networks (GRNs) describe the interactions for a developmental process at a given time and space. Historically, perturbation experiments represent one of the key methods for analyzing and reconstructing a GRN, and the GRN governing early development in the sea urchin embryo stands as one of the more deeply dissected so far. As technology progresses, so do the methods used to address different biological questions. Next-generation sequencing (NGS) has become a standard experimental technique for genome and transcriptome sequencing and studies of protein-DNA interactions and DNA accessibility. While several efforts have been made toward the integration of different omics approaches for the study of the regulatory genome in many animals, in a few cases, these are applied with the purpose of reconstructing and experimentally testing developmental GRNs. Here, we review emerging approaches integrating multiple NGS technologies for the prediction and validation of gene interactions within echinoderm GRNs. These approaches can be applied to both 'model' and 'non-model' organisms. Although a number of issues still need to be addressed, advances in NGS applications, such as assay for transposase-accessible chromatin sequencing, combined with the availability of embryos belonging to different species, all separated by various evolutionary distances and accessible to experimental regulatory biology, place echinoderms in an unprecedented position for the reconstruction and evolutionary comparison of developmental GRNs. We conclude that sequencing technologies and integrated omics approaches allow the examination of GRNs on a genome-wide scale only if biological perturbation and cis-regulatory analyses are experimentally accessible, as in the case of echinoderm embryos. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  8. Enhancer Sequence Variants and Transcription Factor Deregulation Synergize to Construct Pathogenic Regulatory Circuits in B Cell Lymphoma

    PubMed Central

    Koues, Olivia I.; Kowalewski, Rodney A.; Chang, Li-Wei; Pyfrom, Sarah C.; Schmidt, Jennifer A.; Luo, Hong; Sandoval, Luis E.; Hughes, Tyler B.; Bednarski, Jeffrey J.; Cashen, Amanda F.; Payton, Jacqueline E.; Oltz, Eugene M.

    2014-01-01

    Summary Most B cell lymphomas arise in the germinal center (GC), where humoral immune responses evolve from potentially oncogenic cycles of mutation, proliferation, and clonal selection. Although lymphoma gene expression diverges significantly from GC-B cells, underlying mechanisms that alter the activities of corresponding regulatory elements (REs) remain elusive. Here we define the complete pathogenic circuitry of human follicular lymphoma (FL), which activates or decommissions REs from normal GC-B cells and commandeers enhancers from other lineages. Moreover, independent sets of transcription factors, whose expression was deregulated in FL, targeted commandeered versus decommissioned REs. Our approach revealed two distinct subtypes of low-grade FL, whose pathogenic circuitries resembled GC-B or activated B cells. FL-altered enhancers also were enriched for sequence variants, including somatic mutations, which disrupt transcription factor binding and expression of circuit-linked genes. Thus, the pathogenic regulatory circuitry of FL reveals distinct genetic and epigenetic etiologies for GC-B transformation. PMID:25607463

  9. DMRT gene cluster analysis in the platypus: new insights into genomic organization and regulatory regions.

    PubMed

    El-Mogharbel, Nisrine; Wakefield, Matthew; Deakin, Janine E; Tsend-Ayush, Enkhjargal; Grützner, Frank; Alsop, Amber; Ezaz, Tariq; Marshall Graves, Jennifer A

    2007-01-01

    We isolated and characterized a cluster of platypus DMRT genes and compared their arrangement, location, and sequence across vertebrates. The DMRT gene cluster on human 9p24.3 harbors, in order, DMRT1, DMRT3, and DMRT2, which share a DM domain. DMRT1 is highly conserved and involved in sexual development in vertebrates, and deletions in this region cause sex reversal in humans. Sequence comparisons of DMRT genes between species have been valuable in identifying exons, control regions, and conserved nongenic regions (CNGs). The addition of platypus sequences is expected to be particularly valuable, since monotremes fill a gap in the vertebrate genome coverage. We therefore isolated and fully sequenced platypus BAC clones containing DMRT3 and DMRT2 as well as DMRT1 and then generated multispecies alignments and ran prediction programs followed by experimental verification to annotate this gene cluster. We found that the three genes have 58-66% identity to their human orthologues, lie in the same order as in other vertebrates, and colocate on 1 of the 10 platypus sex chromosomes, X5. We also predict that optimal annotation of the newly sequenced platypus genome will be challenging. The analysis of platypus sequence revealed differences in structure and sequence of the DMRT gene cluster. Multispecies comparison was particularly effective for detecting CNGs, revealing several novel potential regulatory regions within DMRT3 and DMRT2 as well as DMRT1. RT-PCR indicated that platypus DMRT1 and DMRT3 are expressed specifically in the adult testis (and not ovary), but DMRT2 has a wider expression profile, as it does for other mammals. The platypus DMRT1 expression pattern, and its location on an X chromosome, suggests an involvement in monotreme sexual development.

  10. Functional studies of regulatory genes in the sea urchin embryo.

    PubMed

    Cavalieri, Vincenzo; Di Bernardo, Maria; Spinelli, Giovanni

    2009-01-01

    Sea urchin embryos are characterized by an extremely simple mode of development, rapid cleavage, high transparency, and well-defined cell lineage. Although they are not suitable for genetic studies, other approaches are successfully used to unravel mechanisms and molecules involved in cell fate specification and morphogenesis. Microinjection is the elective method to study gene function in sea urchin embryos. It is used to deliver precise amounts of DNA, RNA, oligonucleotides, peptides, or antibodies into the eggs or even into blastomeres. Here we describe microinjection as it is currently applied in our laboratory and show how it has been used in gene perturbation analyses and dissection of cis-regulatory DNA elements.

  11. Functional Studies of Regulatory Genes in the Sea Urchin Embryo

    NASA Astrophysics Data System (ADS)

    Cavalieri, Vincenzo; Bernardo, Maria Di; Spinelli, Giovanni

    Sea urchin embryos are characterized by an extremely simple mode of development, rapid cleavage, high transparency, and well-defined cell lineage. Although they are not suitable for genetic studies, other approaches are successfully used to unravel mechanisms and molecules involved in cell fate specification and morphogenesis. Microinjection is the elective method to study gene function in sea urchin embryos. It is used to deliver precise amounts of DNA, RNA, oligonucleotides, peptides, or antibodies into the eggs or even into blastomeres. Here we describe microinjection as it is currently applied in our laboratory and show how it has been used in gene perturbation analyses and dissection of cis-regulatory DNA elements.

  12. Genes associated with the cis-regulatory functions of intragenic LINE-1 elements.

    PubMed

    Wanichnopparat, Wachiraporn; Suwanwongse, Kulachanya; Pin-On, Piyapat; Aporntewan, Chatchawit; Mutirangura, Apiwat

    2013-03-27

    Thousands of intragenic long interspersed element 1 sequences (LINE-1 elements or L1s) reside within genes. These intragenic L1 sequences are conserved and regulate the expression of their host genes. When L1 methylation is decreased, either through chemical induction or in cancer, the intragenic L1 transcription is increased. The resulting L1 mRNAs form RISC complexes with pre-mRNA to degrade the complementary mRNA. In this study, we screened for genes that are involved in intragenic L1 regulation networks. Genes containing L1s were obtained from L1Base (http://l1base.molgen.mpg.de). The expression profiles of 205 genes in 516 gene knockdown experiments were obtained from the Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo). The expression levels of the genes with and without L1s were compared using Pearson's chi-squared test. After a permutation based statistical analysis and a multiple hypothesis testing, 73 genes were found to induce significant regulatory changes (upregulation and/or downregulation) in genes with L1s. In detail, 5 genes were found to induce both the upregulation and downregulation of genes with L1s, whereas 27 and 37 genes induced the downregulation and upregulation, respectively, of genes with L1s. These regulations sometimes differed depending on the cell type and the orientation of the intragenic L1s. Moreover, the siRNA-regulating genes containing L1s possess a variety of molecular functions, are responsible for many cellular phenotypes and are associated with a number of diseases. Cells use intragenic L1s as cis-regulatory elements within gene bodies to modulate gene expression. There may be several mechanisms by which L1s mediate gene expression. Intragenic L1s may be involved in the regulation of several biological processes, including DNA damage and repair, inflammation, immune function, embryogenesis, cell differentiation, cellular response to external stimuli and hormonal responses. Furthermore, in addition to cancer

  13. Roles of lignin biosynthesis and regulatory genes in plant development.

    PubMed

    Yoon, Jinmi; Choi, Heebak; An, Gynheung

    2015-11-01

    Lignin is an important factor affecting agricultural traits, biofuel production, and the pulping industry. Most lignin biosynthesis genes and their regulatory genes are expressed mainly in the vascular bundles of stems and leaves, preferentially in tissues undergoing lignification. Other genes are poorly expressed during normal stages of development, but are strongly induced by abiotic or biotic stresses. Some are expressed in non-lignifying tissues such as the shoot apical meristem. Alterations in lignin levels affect plant development. Suppression of lignin biosynthesis genes causes abnormal phenotypes such as collapsed xylem, bending stems, and growth retardation. The loss of expression by genes that function early in the lignin biosynthesis pathway results in more severe developmental phenotypes when compared with plants that have mutations in later genes. Defective lignin deposition is also associated with phenotypes of seed shattering or brittle culm. MYB and NAC transcriptional factors function as switches, and some homeobox proteins negatively control lignin biosynthesis genes. Ectopic deposition caused by overexpression of lignin biosynthesis genes or master switch genes induces curly leaf formation and dwarfism.

  14. Roles of lignin biosynthesis and regulatory genes in plant development

    PubMed Central

    Yoon, Jinmi; Choi, Heebak

    2015-01-01

    Abstract Lignin is an important factor affecting agricultural traits, biofuel production, and the pulping industry. Most lignin biosynthesis genes and their regulatory genes are expressed mainly in the vascular bundles of stems and leaves, preferentially in tissues undergoing lignification. Other genes are poorly expressed during normal stages of development, but are strongly induced by abiotic or biotic stresses. Some are expressed in non‐lignifying tissues such as the shoot apical meristem. Alterations in lignin levels affect plant development. Suppression of lignin biosynthesis genes causes abnormal phenotypes such as collapsed xylem, bending stems, and growth retardation. The loss of expression by genes that function early in the lignin biosynthesis pathway results in more severe developmental phenotypes when compared with plants that have mutations in later genes. Defective lignin deposition is also associated with phenotypes of seed shattering or brittle culm. MYB and NAC transcriptional factors function as switches, and some homeobox proteins negatively control lignin biosynthesis genes. Ectopic deposition caused by overexpression of lignin biosynthesis genes or master switch genes induces curly leaf formation and dwarfism. PMID:26297385

  15. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    PubMed Central

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre

    2014-01-01

    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression. PMID:25429295

  16. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.

    2005-01-01

    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  17. Using gene expression programming to infer gene regulatory networks from time-series data.

    PubMed

    Zhang, Yongqing; Pu, Yifei; Zhang, Haisen; Su, Yabo; Zhang, Lifang; Zhou, Jiliu

    2013-12-01

    Gene regulatory networks inference is currently a topic under heavy research in the systems biology field. In this paper, gene regulatory networks are inferred via evolutionary model based on time-series microarray data. A non-linear differential equation model is adopted. Gene expression programming (GEP) is applied to identify the structure of the model and least mean square (LMS) is used to optimize the parameters in ordinary differential equations (ODEs). The proposed work has been first verified by synthetic data with noise-free and noisy time-series data, respectively, and then its effectiveness is confirmed by three real time-series expression datasets. Finally, a gene regulatory network was constructed with 12 Yeast genes. Experimental results demonstrate that our model can improve the prediction accuracy of microarray time-series data effectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Comparison of evolutionary algorithms in gene regulatory network model inference

    PubMed Central

    2010-01-01

    Background The evolution of high throughput technologies that measure gene expression levels has created a data base for inferring GRNs (a process also known as reverse engineering of GRNs). However, the nature of these data has made this process very difficult. At the moment, several methods of discovering qualitative causal relationships between genes with high accuracy from microarray data exist, but large scale quantitative analysis on real biological datasets cannot be performed, to date, as existing approaches are not suitable for real microarray data which are noisy and insufficient. Results This paper performs an analysis of several existing evolutionary algorithms for quantitative gene regulatory network modelling. The aim is to present the techniques used and offer a comprehensive comparison of approaches, under a common framework. Algorithms are applied to both synthetic and real gene expression data from DNA microarrays, and ability to reproduce biological behaviour, scalability and robustness to noise are assessed and compared. Conclusions Presented is a comparison framework for assessment of evolutionary algorithms, used to infer gene regulatory networks. Promising methods are identified and a platform for development of appropriate model formalisms is established. PMID:20105328

  19. Comparison of evolutionary algorithms in gene regulatory network model inference.

    PubMed

    Sîrbu, Alina; Ruskin, Heather J; Crane, Martin

    2010-01-27

    The evolution of high throughput technologies that measure gene expression levels has created a data base for inferring GRNs (a process also known as reverse engineering of GRNs). However, the nature of these data has made this process very difficult. At the moment, several methods of discovering qualitative causal relationships between genes with high accuracy from microarray data exist, but large scale quantitative analysis on real biological datasets cannot be performed, to date, as existing approaches are not suitable for real microarray data which are noisy and insufficient. This paper performs an analysis of several existing evolutionary algorithms for quantitative gene regulatory network modelling. The aim is to present the techniques used and offer a comprehensive comparison of approaches, under a common framework. Algorithms are applied to both synthetic and real gene expression data from DNA microarrays, and ability to reproduce biological behaviour, scalability and robustness to noise are assessed and compared. Presented is a comparison framework for assessment of evolutionary algorithms, used to infer gene regulatory networks. Promising methods are identified and a platform for development of appropriate model formalisms is established.

  20. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    PubMed Central

    Chitra, M. Ananda; Jayanthy, C.; Nagarajan, B.

    2015-01-01

    SP contains serine and produce lactone ring structured AIP. Conclusion: Presence of AgrA, B, and D in all SP isolates implies the importance of this regulatory system in the virulence genes expression of the SP bacteria. SP isolates can be typed based on the AgrD auto-inducible protein sequences as it is being carried out for typing of S. aureus isolates. However, further studies are required to elucidate the mechanism of controlling of virulence genes by agr gene locus in the pathogenesis of soft tissue infection by SP. PMID:27047173

  1. An Arabidopsis gene regulatory network for secondary cell wall synthesis

    SciTech Connect

    Taylor-Teeples, M.; Lin, L.; de Lucas, M.; Turco, G.; Toal, T. W.; Gaudinier, A.; Young, N. F.; Trabucco, G. M.; Veling, M. T.; Lamothe, R.; Handakumbura, P. P.; Xiong, G.; Wang, C.; Corwin, J.; Tsoukalas, A.; Zhang, L.; Ware, D.; Pauly, M.; Kliebenstein, D. J.; Dehesh, K.; Tagkopoulos, I.; Breton, G.; Pruneda-Paz, J. L.; Ahnert, S. E.; Kay, S. A.; Hazen, S. P.; Brady, S. M.

    2014-12-24

    The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. In this paper, we present a protein–DNA network between Arabidopsis thaliana transcription factors and secondary cell wall metabolic genes with gene expression regulated by a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. Finally, these interactions will serve as a foundation for understanding the regulation of a complex, integral plant component.

  2. Using shRNA experiments to validate gene regulatory networks.

    PubMed

    Olsen, Catharina; Fleming, Kathleen; Prendergast, Niall; Rubio, Renee; Emmert-Streib, Frank; Bontempi, Gianluca; Quackenbush, John; Haibe-Kains, Benjamin

    2015-06-01

    Quantitative validation of gene regulatory networks (GRNs) inferred from observational expression data is a difficult task usually involving time intensive and costly laboratory experiments. We were able to show that gene knock-down experiments can be used to quantitatively assess the quality of large-scale GRNs via a purely data-driven approach (Olsen et al. 2014). Our new validation framework also enables the statistical comparison of multiple network inference techniques, which was a long-standing challenge in the field. In this Data in Brief we detail the contents and quality controls for the gene expression data (available from NCBI Gene Expression Omnibus repository with accession number GSE53091) associated with our study published in Genomics (Olsen et al. 2014). We also provide R code to access the data and reproduce the analysis presented in this article.

  3. The Metarhizium anisopliae trp1 gene: cloning and regulatory analysis.

    PubMed

    Staats, Charley Christian; Silva, Marcia Suzana Nunes; Pinto, Paulo Marcos; Vainstein, Marilene Henning; Schrank, Augusto

    2004-07-01

    The trp1 gene from the entomopathogenic fungus Metarhizium anisopliae, cloned by heterologous hybridization with the plasmid carrying the trpC gene from Aspergillus nidulans, was sequence characterized. The predicted translation product has the conserved catalytic domains of glutamine amidotransferase (G domain), indoleglycerolphosphate synthase (C domain), and phosphoribosyl anthranilate isomerase (F domain) organized as NH2-G-C-F-COOH. The ORF is interrupted by a single intron of 60 nt that is position conserved in relation to trp genes from Ascomycetes and length conserved in relation to Basidiomycetes species. RT-PCR analysis suggests constitutive expression of trp1 gene in M. anisopliae.

  4. Identification of C4 photosynthesis metabolism and regulatory-associated genes in Eleocharis vivipara by SSH.

    PubMed

    Chen, Taiyu; Ye, Rongjian; Fan, Xiaolei; Li, Xianghua; Lin, Yongjun

    2011-09-01

    This is the first effort to investigate the candidate genes involved in kranz developmental regulation and C(4) metabolic fluxes in Eleocharis vivipara, which is a leafless freshwater amphibious plant and possesses a distinct culms anatomy structure and photosynthetic pattern in contrasting environments. A terrestrial specific SSH library was constructed to investigate the genes involved in kranz anatomy developmental regulation and C(4) metabolic fluxes. A total of 73 ESTs and 56 unigenes in 384 clones were identified by array hybridization and sequencing. In total, 50 unigenes had homologous genes in the databases of rice and Arabidopsis. The real-time quantitative PCR results showed that most of the genes were accumulated in terrestrial culms and ABA-induced culms. The C(4) marker genes were stably accumulated during the culms development process in terrestrial culms. With respect to C(3) culms, C(4) photosynthesis metabolism consumed much more transporters and translocators related to ion metabolism, organic acids and carbohydrate metabolism, phosphate metabolism, amino acids metabolism, and lipids metabolism. Additionally, ten regulatory genes including five transcription factors, four receptor-like proteins, and one BURP protein were identified. These regulatory genes, which co-accumulated with the culms developmental stages, may play important roles in culms structure developmental regulation, bundle sheath chloroplast maturation, and environmental response. These results shed new light on the C(4) metabolic fluxes, environmental response, and anatomy structure developmental regulation in E. vivipara.

  5. Inference of Gene Regulatory Network Based on Local Bayesian Networks.

    PubMed

    Liu, Fei; Zhang, Shao-Wu; Guo, Wei-Feng; Wei, Ze-Gang; Chen, Luonan

    2016-08-01

    The inference of gene regulatory networks (GRNs) from expression data can mine the direct regulations among genes and gain deep insights into biological processes at a network level. During past decades, numerous computational approaches have been introduced for inferring the GRNs. However, many of them still suffer from various problems, e.g., Bayesian network (BN) methods cannot handle large-scale networks due to their high computational complexity, while information theory-based methods cannot identify the directions of regulatory interactions and also suffer from false positive/negative problems. To overcome the limitations, in this work we present a novel algorithm, namely local Bayesian network (LBN), to infer GRNs from gene expression data by using the network decomposition strategy and false-positive edge elimination scheme. Specifically, LBN algorithm first uses conditional mutual information (CMI) to construct an initial network or GRN, which is decomposed into a number of local networks or GRNs. Then, BN method is employed to generate a series of local BNs by selecting the k-nearest neighbors of each gene as its candidate regulatory genes, which significantly reduces the exponential search space from all possible GRN structures. Integrating these local BNs forms a tentative network or GRN by performing CMI, which reduces redundant regulations in the GRN and thus alleviates the false positive problem. The final network or GRN can be obtained by iteratively performing CMI and local BN on the tentative network. In the iterative process, the false or redundant regulations are gradually removed. When tested on the benchmark GRN datasets from DREAM challenge as well as the SOS DNA repair network in E.coli, our results suggest that LBN outperforms other state-of-the-art methods (ARACNE, GENIE3 and NARROMI) significantly, with more accurate and robust performance. In particular, the decomposition strategy with local Bayesian networks not only effectively reduce

  6. Cis-regulatory elements affecting the Nanos gene promoter in the germline stem cells.

    PubMed

    Ali, Ijaz; ur Rehman, Muti; Rashid, Farzana; Khan, Sanaullah; Iqbal, Aqib; Laixin, Xia; ud din Ahmed, Naeem; Swati, A Zahoor

    2010-02-15

    Drosophila Nanos gene plays an important role in stem cell maintenance and body patterning. With the purpose of understanding the cis-regulatory machinery involved in the transcription of the nanos gene in the germline stem cells, we examined its promoter fragment from +97 to -708 relative to the transcription start site and identified enhancer elements located between position -108 and +97. Experiments with transgenic flies revealed that the minimal promoter (from -108 to +20) is sufficient in the germline stem cells for the GFP expression in transgenic Drosophila. Moreover, the flag-tagged nanos protein blotting experiments revealed that a short promoter fragment plus some sequences of the nos 5'UTR spanning -108 to +97 could efficiently drive the expression of the flag-tagged [Nos-mRNA-nos3'UTR] transgene in transgenic flies indicating that the cis-regulatory elements located between positions -108 and +97 of the nanos promoter are sufficient to fully transcribe the nanos mRNA. Deletion of the identified cis-acting sequences from the promoter rendered it non-functional as it could no longer transcribe the nanos mRNA in transgenic flies thus revealing the importance of these sequences for the transcription of the nanos gene. Copyright 2009 Elsevier B.V. All rights reserved.

  7. Transcriptomic sequencing reveals a set of unique genes activated by butyrate-induced histone modification

    USDA-ARS?s Scientific Manuscript database

    Butyrate is a nutritional element with strong epigenetic regulatory activity as an inhibitor of histone deacetylases (HDACs). Based on the analysis of differentially expressed genes induced by butyrate in the bovine epithelial cell using deep RNA-sequencing technology (RNA-seq), a set of unique gen...

  8. Myelin basic protein gene transcription. Identification of proximal and distal cis-acting regulatory elements.

    PubMed

    Devine-Beach, K; Lashgari, M S; Khalili, K

    1990-08-15

    Myelin basic proteins (MBPs) represent a major component of the myelin membrane which are exclusively expressed by glial cells in the nervous system. The cell type-specific expression of MBP is controlled preferentially at the level of RNA synthesis. To investigate the mechanisms by which the MBP gene is regulated, we analyzed transcriptional regulation of this gene in glial and non-glial cells. We have demonstrated that the 320 base pairs upstream of the MBP transcriptional start site contain regulatory elements that preferentially stimulate transcription of MBPs in glial cells. Using a test vector containing the simian virus 40 (SV40) early promoter placed upstream of the bacterial chloramphenicol acetyltransferase gene, we localized three major promoter elements within the 5'-upstream sequence. These elements, designated MB1, MB4, and MB7, spanning proximal (-14 to -50) and distal (-130 to -169 and -249 to -288) positions with respect to the RNA initiation site, activated SV40 promoter transcription more than 40-fold in glial cells. The promoter distal elements, MB4 and MB7, enhanced SV40 promoter activity 2- and 8-fold, respectively, in L cells. Using the gel mobility shift assay, we have demonstrated that the MBP activators (MB1, MB4, and MB7) interact with multiple proteins derived from glial and L cell extract and result in the formation of several complexes. Comparison of band intensity of these complexes implies that these cells contain both unique and ubiquitous DNA binding proteins that recognize the DNA sequences within these activators. These studies suggest that the MBP promoter consists of several regulatory sequences in which the proximal element, MB1, and one of the distal elements, MB4, are selectively more active in glial cells than in L cells. Thus, these novel regulatory elements, in concert with other sequences, appear to stimulate MBP promoter transcription in glial cells.

  9. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.

    PubMed

    Reichenstein, Moshe; German, Tania; Barash, Itamar

    2005-04-11

    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  10. Isolation of Sparus auratus prolactin gene and activity of the cis-acting regulatory elements.

    PubMed

    Astola, Antonio; Ortiz, Manuela; Calduch-Giner, Josep A; Pérez-Sánchez, Jaume; Valdivia, Manuel M

    2003-10-15

    A sea bream prolactin (sbPRL) gene was isolated using a prolactin cDNA fragment, generated by PCR as a probe. The gene analyzed comprises 3.5 kb of DNA containing five exons as described previously for other fish PRL genes. Analysis of 1.0 kb of the proximal promoter sequence reveals a consensus TATAA box, up to seven (A/T)3NCAT consensus motifs for binding of the pituitary-specific factor Pit-1 and putative CREB and GATA binding sites. CHO culture cells co-transfected with a sbPRL promoter sequence and a sea bream Pit-1 cDNA expression plasmid showed expression of a linked luciferase reporter gene. Transient expression experiments with 5'-delection mutants reveals at least three regulatory regions on the sbPRL gene, two with a stimulatory effect on transcription and one with apparent inhibitory effect. From a comparative point of view, this study of PRL gene in Sparus auratus, correlates well with those previously published on tilapia and rainbow trout. The molecular data reported will be useful for comparative analysis of gene regulation in the GH/PRL gene family in teleosts.

  11. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.

    2015-01-01

    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  12. Gene regulatory mechanisms governing energy metabolism during cardiac hypertrophic growth.

    PubMed

    Lehman, John J; Kelly, Daniel P

    2002-04-01

    Studies in a variety of mammalian species, including humans, have demonstrated a reduction in fatty acid oxidation (FAO) and increased glucose utilization in pathologic cardiac hypertrophy, consistent with reinduction of the fetal energy metabolic program. This review describes results of recent molecular studies aimed at delineating the gene regulatory events which facilitate myocardial energy substrate switches during hypertrophic growth of the heart. Studies aimed at the characterization of transcriptional control mechanisms governing FAO enzyme gene expression in the cardiac myocyte have defined a central role for the fatty acid-activated nuclear receptor peroxisome proliferator-activated receptor alpha (PPAR(alpha)). Cardiac FAO enzyme gene expression was shown to be coordinately downregulated in murine models of ventricular pressure overload, consistent with the energy substrate switch away from fatty acid utilization in the hypertrophied heart. Nuclear protein levels of PPAR(alpha) decline in the ventricle in response to pressure overload, while several Sp and nuclear receptor transcription factors are induced to fetal levels, consistent with their binding to DNA as transcriptional repressors of rate-limiting FAO enzyme genes with hypertrophy. Knowledge of key components of this transcriptional regulatory pathway will allow for the development of genetic engineering strategies in mice that will modulate fatty acid oxidative flux and assist in defining whether energy metabolic derangements play a primary role in the development of pathologic cardiac hypertrophy and eventual progression to heart failure.

  13. Fused Regression for Multi-source Gene Regulatory Network Inference

    PubMed Central

    Lam, Kari Y.; Westrick, Zachary M.; Müller, Christian L.; Christiaen, Lionel; Bonneau, Richard

    2016-01-01

    Understanding gene regulatory networks is critical to understanding cellular differentiation and response to external stimuli. Methods for global network inference have been developed and applied to a variety of species. Most approaches consider the problem of network inference independently in each species, despite evidence that gene regulation can be conserved even in distantly related species. Further, network inference is often confined to single data-types (single platforms) and single cell types. We introduce a method for multi-source network inference that allows simultaneous estimation of gene regulatory networks in multiple species or biological processes through the introduction of priors based on known gene relationships such as orthology incorporated using fused regression. This approach improves network inference performance even when orthology mapping and conservation are incomplete. We refine this method by presenting an algorithm that extracts the true conserved subnetwork from a larger set of potentially conserved interactions and demonstrate the utility of our method in cross species network inference. Last, we demonstrate our method’s utility in learning from data collected on different experimental platforms. PMID:27923054

  14. Translating natural genetic variation to gene expression in a computational model of the Drosophila gap gene regulatory network

    PubMed Central

    Kozlov, Konstantin N.; Kulakovskiy, Ivan V.; Zubair, Asif; Marjoram, Paul; Lawrie, David S.; Nuzhdin, Sergey V.; Samsonova, Maria G.

    2017-01-01

    Annotating the genotype-phenotype relationship, and developing a proper quantitative description of the relationship, requires understanding the impact of natural genomic variation on gene expression. We apply a sequence-level model of gap gene expression in the early development of Drosophila to analyze single nucleotide polymorphisms (SNPs) in a panel of natural sequenced D. melanogaster lines. Using a thermodynamic modeling framework, we provide both analytical and computational descriptions of how single-nucleotide variants affect gene expression. The analysis reveals that the sequence variants increase (decrease) gene expression if located within binding sites of repressors (activators). We show that the sign of SNP influence (activation or repression) may change in time and space and elucidate the origin of this change in specific examples. The thermodynamic modeling approach predicts non-local and non-linear effects arising from SNPs, and combinations of SNPs, in individual fly genotypes. Simulation of individual fly genotypes using our model reveals that this non-linearity reduces to almost additive inputs from multiple SNPs. Further, we see signatures of the action of purifying selection in the gap gene regulatory regions. To infer the specific targets of purifying selection, we analyze the patterns of polymorphism in the data at two phenotypic levels: the strengths of binding and expression. We find that combinations of SNPs show evidence of being under selective pressure, while individual SNPs do not. The model predicts that SNPs appear to accumulate in the genotypes of the natural population in a way biased towards small increases in activating action on the expression pattern. Taken together, these results provide a systems-level view of how genetic variation translates to the level of gene regulatory networks via combinatorial SNP effects. PMID:28898266

  15. Genome-wide analysis reveals regulatory role of G4 DNA in gene transcription.

    PubMed

    Du, Zhuo; Zhao, Yiqiang; Li, Ning

    2008-02-01

    G-quadruplex or G4 DNA, a four-stranded DNA structure formed in G-rich sequences, has been hypothesized to be a structural motif involved in gene regulation. In this study, we examined the regulatory role of potential G4 DNA motifs (PG4Ms) located in the putative transcriptional regulatory region (TRR, -500 to +500) of genes across the human genome. We found that PG4Ms in the 500-bp region downstream of the annotated transcription start site (TSS; PG4M(D500)) are associated with gene expression. Generally, PG4M(D500)-positive genes are expressed at higher levels than PG4M(D500)-negative genes, and an increased number of PG4M(D500) provides a cumulative effect. This observation was validated by controlling for attributes, including gene family, function, and promoter similarity. We also observed an asymmetric pattern of PG4M(D500) distribution between strands, whereby the frequency of PG4M(D500) in the coding strand is generally higher than that in the template strand. Further analysis showed that the presence of PG4M(D500) and its strand asymmetry are associated with significant enrichment of RNAP II at the putative TRR. On the basis of these results, we propose a model of G4 DNA-mediated stimulation of transcription with the hypothesis that PG4M(D500) contributes to gene transcription by maintaining the DNA in an open conformation, while the asymmetric distribution of PG4M(D500) considerably reduces the probability of blocking the progression of the RNA polymerase complex on the template strand. Our findings provide a comprehensive view of the regulatory function of G4 DNA in gene transcription.

  16. Regulatory Oversight of Cell and Gene Therapy Products in Canada.

    PubMed

    Ridgway, Anthony; Agbanyo, Francisca; Wang, Jian; Rosu-Myles, Michael

    2015-01-01

    Health Canada regulates gene therapy products and many cell therapy products as biological drugs under the Canadian Food and Drugs Act and its attendant regulations. Cellular products that meet certain criteria, including minimal manipulation and homologous use, may be subjected to a standards-based approach under the Safety of Human Cells, Tissues and Organs for Transplantation Regulations. The manufacture and clinical testing of cell and gene therapy products (CGTPs) presents many challenges beyond those for protein biologics. Cells cannot be subjected to pathogen removal or inactivation procedures and must frequently be administered shortly after final formulation. Viral vector design and manufacturing control are critically important to overall product quality and linked to safety and efficacy in patients through concerns such as replication competence, vector integration, and vector shedding. In addition, for many CGTPs, the value of nonclinical studies is largely limited to providing proof of concept, and the first meaningful data relating to appropriate dosing, safety parameters, and validity of surrogate or true determinants of efficacy must come from carefully designed clinical trials in patients. Addressing these numerous challenges requires application of various risk mitigation strategies and meeting regulatory expectations specifically adapted to the product types. Regulatory cooperation and harmonisation at an international level are essential for progress in the development and commercialisation of these products. However, particularly in the area of cell therapy, new regulatory paradigms may be needed to harness the benefits of clinical progress in situations where the resources and motivation to pursue a typical drug product approval pathway may be lacking.

  17. Resolution of gene regulatory conflicts caused by combinations of antibiotics

    PubMed Central

    Bollenbach, Tobias; Kishony, Roy

    2011-01-01

    SUMMARY Regulatory conflicts occur when two signals which individually trigger opposite cellular responses are present simultaneously. Here, we investigate regulatory conflicts in the bacterial response to antibiotic combinations. We use an Escherichia coli promoter-GFP library to study the transcriptional response of many promoters to either additive or antagonistic drug pairs at fine two-dimensional resolution of drug concentration. Surprisingly, we find that this dataset can be characterized as a linear sum of only two principal components. Component one, accounting for over 70% of the response, represents the response to growth inhibition by the drugs. Component two describes how regulatory conflicts are resolved. For the additive drug pair, conflicts are resolved by linearly interpolating the single drug responses, while for the antagonistic drug pair, the growth-limiting drug dominates the response. Importantly, for a given drug pair, the same conflict resolution strategy applies to almost all genes. These results provide a recipe for predicting gene expression responses to antibiotic combinations. PMID:21596308

  18. Unstable microsatellite repeats facilitate rapid evolution of coding and regulatory sequences.

    PubMed

    Jansen, A; Gemayel, R; Verstrepen, K J

    2012-01-01

    Tandem repeats are intrinsically highly variable sequences since repeat units are often lost or gained during replication or following unequal recombination events. Because of their low complexity and their instability, these repeats, which are also called satellite repeats, are often considered to be useless 'junk' DNA. However, recent findings show that tandem repeats are frequently found within promoters of stress-induced genes and within the coding regions of genes encoding cell-surface and regulatory proteins. Interestingly, frequent changes in these repeats often confer phenotypic variability. Examples include variation in the microbial cell surface, rapid tuning of internal molecular clocks in flies, and enhanced morphological plasticity in mammals. This suggests that instead of being useless junk DNA, some variable tandem repeats are useful functional elements that confer 'evolvability', facilitating swift evolution and rapid adaptation to changing environments. Since changes in repeats are frequent and reversible, repeats provide a unique type of mutation that bridges the gap between rare genetic mutations, such as single nucleotide polymorphisms, and highly unstable but reversible epigenetic inheritance.

  19. iRegulon: from a gene list to a gene regulatory network using large motif and track collections.

    PubMed

    Janky, Rekin's; Verfaillie, Annelien; Imrichová, Hana; Van de Sande, Bram; Standaert, Laura; Christiaens, Valerie; Hulselmans, Gert; Herten, Koen; Naval Sanchez, Marina; Potier, Delphine; Svetlichnyy, Dmitry; Kalender Atak, Zeynep; Fiers, Mark; Marine, Jean-Christophe; Aerts, Stein

    2014-07-01

    Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from http://iregulon.aertslab.org.

  20. iRegulon: From a Gene List to a Gene Regulatory Network Using Large Motif and Track Collections

    PubMed Central

    Imrichová, Hana; Van de Sande, Bram; Standaert, Laura; Christiaens, Valerie; Hulselmans, Gert; Herten, Koen; Naval Sanchez, Marina; Potier, Delphine; Svetlichnyy, Dmitry; Kalender Atak, Zeynep; Fiers, Mark; Marine, Jean-Christophe; Aerts, Stein

    2014-01-01

    Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from http://iregulon.aertslab.org. PMID:25058159

  1. The gene regulatory network for breast cancer: integrated regulatory landscape of cancer hallmarks.

    PubMed

    Emmert-Streib, Frank; de Matos Simoes, Ricardo; Mullan, Paul; Haibe-Kains, Benjamin; Dehmer, Matthias

    2014-01-01

    In this study, we infer the breast cancer gene regulatory network from gene expression data. This network is obtained from the application of the BC3Net inference algorithm to a large-scale gene expression data set consisting of 351 patient samples. In order to elucidate the functional relevance of the inferred network, we are performing a Gene Ontology (GO) analysis for its structural components. Our analysis reveals that most significant GO-terms we find for the breast cancer network represent functional modules of biological processes that are described by known cancer hallmarks, including translation, immune response, cell cycle, organelle fission, mitosis, cell adhesion, RNA processing, RNA splicing and response to wounding. Furthermore, by using a curated list of census cancer genes, we find an enrichment in these functional modules. Finally, we study cooperative effects of chromosomes based on information of interacting genes in the beast cancer network. We find that chromosome 21 is most coactive with other chromosomes. To our knowledge this is the first study investigating the genome-scale breast cancer network.

  2. Regulatory aspects for translating gene therapy research into the clinic.

    PubMed

    Laurencot, Carolyn M; Ruppel, Sheryl

    2009-01-01

    Gene therapy products are highly regulated, therefore moving a promising candidate from the laboratory into the clinic can present unique challenges. Success can only be achieved by proper planning and communication within the clinical development team, as well as consultation with the regulatory scientists who will eventually review the clinical plan. Regulators should not be considered as obstacles but rather as collaborators whose advice can significantly expedite the product development. Sound scientific data is required and reviewed by the regulatory agencies to determine whether the potential benefit to the patient population outweighs the risk. Therefore, compliance with Good Manufacturing Practice (GMP) and Good Laboratory Practice (GLP) principles to ensure quality, safety, purity, and potency of the product, and to establish "proof of concept" for efficacy, and for safety information, respectively, is essential. The design and conduct of the clinical trial must adhere to Good Clinical Practice (GCP) principals. The clinical protocol should contain adequate rationale, supported by nonclinical data, to justify the starting dose and regimen, and adequate safety monitoring based on the patient population and the anticipated toxicities. Proper review and approval of gene therapy clinical studies by numerous committees, and regulatory agencies before and throughout the study allows for ongoing risk assessment of these novel and innovative products. The ethical conduct of clinical trials must be a priority for all clinical investigators and sponsors. As history has shown us, only a few fatal mistakes can dramatically alter the regulation of investigational products for all individuals involved in gene therapy clinical research, and further delay the advancement of gene therapy to licensed medicinal products.

  3. Regulatory Regions of the Homeotic Gene Proboscipedia Are Sensitive to Chromosomal Pairing

    PubMed Central

    Kapoun, A. M.; Kaufman, T. C.

    1995-01-01

    We have identified regulatory regions of the homeotic gene proboscipedia that are capable of repressing a linked white minigene in a manner that is sensitive to chromosomal pairing. Normally, the eye color of transformants containing white in a P-element vector is affected by the number of copies of the transgene; homozygous flies have darker eyes than heterozygotes. However, we found that flies homozygous for select pb DNA-containing transgenes had lighter eyes than heterozygotes. Several pb DNA fragments are capable of causing this pairing sensitive (PS) negative regulation of white. Two fragments in the upstream DNA of pb, 0.58 and 0.98 kb, are PS; additionally, two PS sites are located in the second intron, including a 0.5-kb region and 49-bp sequence. This phenotype is not observed when two PS sites are located at different chromosomal insertion sites (in trans-heterozygous transgenic animals), indicating that the pb-DNA-mediated repression of white is dependent on the pairing or proximity of the PS regions. The observed phenomenon is similar to transvection in which certain alleles of a gene can complement each other, but only when homologous chromosomes are paired. Interestingly, the intronic PS regions contain positive regulatory sequences for pb, whereas the upstream PS sites contain pb negative regulatory elements. PMID:7498743

  4. Polymorphism in the bovine BOLA-DRB3 upstream regulatory regions detected through PCR-SSCP and DNA sequencing.

    PubMed

    Ripoli, M V; Peral-García, P; Dulout, F N; Giovambattista, G

    2004-09-15

    In the present work, we describe through polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing the polymorphism within the URR-BoLA-DRB3 in 15 cattle breeds. In total, seven PCR-SSCP defined alleles were detected. The alignment of studied sequences showed six polymorphic sites (four transitions, one transversion and one deletion) in the interconsensus regions of the BoLA-DRB3 upstream regulatory region (URR), while the consensus boxes were invariant. Five out of six detected polymorphic sites were of one nucleotide substitution in the interconsensus regions. It is expected that these mutations do not affect significantly the level of expression. In contrast, the deletion observed in the sequence between CCAAT and TATA boxes could have some effect on affinity interactions between the promoter region and the transcription factors. The URR-BoLA-DRB3 DNA analyzed sequences showed moderate level of nucleotide diversity, high level of identity among them and were grouped in the same clade in the phylogenetic tree. In addition, the phylogenetic tree, the similarity analysis and the sequence structure confirmed that the fragment analyzed in this study corresponds to the URR-BoLA-DRB3. The functional role of the observed polymorphic sites among the regulatory motifs in bovine needs to be analyzed and confirmed by means of gene expression assays.

  5. Signaling and Gene Regulatory Networks in Mammalian Lens Development.

    PubMed

    Cvekl, Ales; Zhang, Xin

    2017-10-01

    Ocular lens development represents an advantageous system in which to study regulatory mechanisms governing cell fate decisions, extracellular signaling, cell and tissue organization, and the underlying gene regulatory networks. Spatiotemporally regulated domains of BMP, FGF, and other signaling molecules in late gastrula-early neurula stage embryos generate the border region between the neural plate and non-neural ectoderm from which multiple cell types, including lens progenitor cells, emerge and undergo initial tissue formation. Extracellular signaling and DNA-binding transcription factors govern lens and optic cup morphogenesis. Pax6, c-Maf, Hsf4, Prox1, Sox1, and a few additional factors regulate the expression of the lens structural proteins, the crystallins. Extensive crosstalk between a diverse array of signaling pathways controls the complexity and order of lens morphogenetic processes and lens transparency. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Autonomous Boolean modelling of developmental gene regulatory networks

    PubMed Central

    Cheng, Xianrui; Sun, Mengyang; Socolar, Joshua E. S.

    2013-01-01

    During early embryonic development, a network of regulatory interactions among genes dynamically determines a pattern of differentiated tissues. We show that important timing information associated with the interactions can be faithfully represented in autonomous Boolean models in which binary variables representing expression levels are updated in continuous time, and that such models can provide a direct insight into features that are difficult to extract from ordinary differential equation (ODE) models. As an application, we model the experimentally well-studied network controlling fly body segmentation. The Boolean model successfully generates the patterns formed in normal and genetically perturbed fly embryos, permits the derivation of constraints on the time delay parameters, clarifies the logic associated with different ODE parameter sets and provides a platform for studying connectivity and robustness in parameter space. By elucidating the role of regulatory time delays in pattern formation, the results suggest new types of experimental measurements in early embryonic development. PMID:23034351

  7. Optimal finite horizon control in gene regulatory networks

    NASA Astrophysics Data System (ADS)

    Liu, Qiuli

    2013-06-01

    As a paradigm for modeling gene regulatory networks, probabilistic Boolean networks (PBNs) form a subclass of Markov genetic regulatory networks. To date, many different stochastic optimal control approaches have been developed to find therapeutic intervention strategies for PBNs. A PBN is essentially a collection of constituent Boolean networks via a probability structure. Most of the existing works assume that the probability structure for Boolean networks selection is known. Such an assumption cannot be satisfied in practice since the presence of noise prevents the probability structure from being accurately determined. In this paper, we treat a case in which we lack the governing probability structure for Boolean network selection. Specifically, in the framework of PBNs, the theory of finite horizon Markov decision process is employed to find optimal constituent Boolean networks with respect to the defined objective functions. In order to illustrate the validity of our proposed approach, an example is also displayed.

  8. Modelling Human Regulatory Variation in Mouse: Finding the Function in Genome-Wide Association Studies and Whole-Genome Sequencing

    PubMed Central

    Schmouth, Jean-François; Bonaguro, Russell J.; Corso-Diaz, Ximena; Simpson, Elizabeth M.

    2012-01-01

    An increasing body of literature from genome-wide association studies and human whole-genome sequencing highlights the identification of large numbers of candidate regulatory variants of potential therapeutic interest in numerous diseases. Our relatively poor understanding of the functions of non-coding genomic sequence, and the slow and laborious process of experimental validation of the functional significance of human regulatory variants, limits our ability to fully benefit from this information in our efforts to comprehend human disease. Humanized mouse models (HuMMs), in which human genes are introduced into the mouse, suggest an approach to this problem. In the past, HuMMs have been used successfully to study human disease variants; e.g., the complex genetic condition arising from Down syndrome, common monogenic disorders such as Huntington disease and β-thalassemia, and cancer susceptibility genes such as BRCA1. In this commentary, we highlight a novel method for high-throughput single-copy site-specific generation of HuMMs entitled High-throughput Human Genes on the X Chromosome (HuGX). This method can be applied to most human genes for which a bacterial artificial chromosome (BAC) construct can be derived and a mouse-null allele exists. This strategy comprises (1) the use of recombineering technology to create a human variant–harbouring BAC, (2) knock-in of this BAC into the mouse genome using Hprt docking technology, and (3) allele comparison by interspecies complementation. We demonstrate the throughput of the HuGX method by generating a series of seven different alleles for the human NR2E1 gene at Hprt. In future challenges, we consider the current limitations of experimental approaches and call for a concerted effort by the genetics community, for both human and mouse, to solve the challenge of the functional analysis of human regulatory variation. PMID:22396661

  9. Identification of single nucleotide polymorphism in protein phosphatase 1 regulatory subunit 11 gene in Murrah bulls.

    PubMed

    Jain, Varsha; Patel, Brijesh; Umar, Farhat Paul; Ajithakumar, H M; Gurjar, Suraj K; Gupta, I D; Verma, Archana

    2017-02-01

    This study was conducted with the objective to identify single nucleotide polymorphism (SNP) in protein phosphatase 1 regulatory subunit 11 (PPP1R11) gene in Murrah bulls. Genomic DNA was isolated by phenol-chloroform extraction method from the frozen semen samples of 65 Murrah bulls maintained at Artificial Breeding Research Centre, ICAR-National Dairy Research Institute, Karnal. The quality and concentration of DNA was checked by spectrophotometer reading and agarose gel electrophoresis. The target region of PPP1R11 gene was amplified using four sets of primer designed based on Bos taurus reference sequence. The amplified products were sequenced and aligned using Clustal Omega for identification of SNPs. Animals were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using EcoNI restriction enzyme. The sequences in the NCBI accession number NW_005785016.1 for Bubalus bubalis were compared and aligned with the edited sequences of Murrah bulls with Clustal Omega software. A total of 10 SNPs were found, out of which 1 at 5'UTR, 3 at intron 1, and 6 at intron 2 region. PCR-RFLP using restriction enzyme EcoNI revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study. A total of 10 SNPs were found. PCR-RFLP revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study, due to which association analysis with conception rate was not feasible.

  10. Genome-wide analysis of regulatory proteases sequences identified through bioinformatics data mining in Taenia solium.

    PubMed

    Yan, Hong-Bin; Lou, Zhong-Zi; Li, Li; Brindley, Paul J; Zheng, Yadong; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Jia, Wan-Zhong; Cai, Xuepeng

    2014-06-04

    Cysticercosis remains a major neglected tropical disease of humanity in many regions, especially in sub-Saharan Africa, Central America and elsewhere. Owing to the emerging drug resistance and the inability of current drugs to prevent re-infection, identification of novel vaccines and chemotherapeutic agents against Taenia solium and related helminth pathogens is a public health priority. The T. solium genome and the predicted proteome were reported recently, providing a wealth of information from which new interventional targets might be identified. In order to characterize and classify the entire repertoire of protease-encoding genes of T. solium, which act fundamental biological roles in all life processes, we analyzed the predicted proteins of this cestode through a combination of bioinformatics tools. Functional annotation was performed to yield insights into the signaling processes relevant to the complex developmental cycle of this tapeworm and to highlight a suite of the proteases as potential intervention targets. Within the genome of this helminth parasite, we identified 200 open reading frames encoding proteases from five clans, which correspond to 1.68% of the 11,902 protein-encoding genes predicted to be present in its genome. These proteases include calpains, cytosolic, mitochondrial signal peptidases, ubiquitylation related proteins, and others. Many not only show significant similarity to proteases in the Conserved Domain Database but have conserved active sites and catalytic domains. KEGG Automatic Annotation Server (KAAS) analysis indicated that ~60% of these proteases share strong sequence identities with proteins of the KEGG database, which are involved in human disease, metabolic pathways, genetic information processes, cellular processes, environmental information processes and organismal systems. Also, we identified signal peptides and transmembrane helices through comparative analysis with classes of important regulatory proteases

  11. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    PubMed

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  12. Polymorphism in the upstream regulatory region of DQA1 gene in the Italian population.

    PubMed

    Petronzelli, F; Kimura, A; Ferrante, P; Mazzilli, M C

    1995-04-01

    Polymorphism in the 5'-upstream regulatory region of the DQA1 gene has been recently described. Using PCR-SSO method and SSCP analysis we have investigated this polymorphism in a group of 111 Italian blood donors which had been oligotyped for DRB1, DQA1 and DQB1 genes. Eight allelic variants were detected. Looking at the relationships among QAP sequences and DQA1 and DRB1 genes, three alternative situations were found: 1. a one-to-one relation between QAP and DQA1 alleles, independently of the other class II genes; 2. the same QAP allele in association with different DQA1-DRB1 haplotypes; 3. the same DQA1 allele with different QAP sequences according to the DRB1 specificity. No unexpected associations with DQB1 gene were found. These results must be interpreted considering that DQA1 and DRB1 genes are transcribed in opposite directions so that the promoter region of DQA1 gene lies between DQA1 and DRB1, close to the former but several hundreds kb away from the latter.

  13. Core cell cycle regulatory genes in rice and their expression profiles across the growth zone of the leaf.

    PubMed

    Pettkó-Szandtner, A; Cserháti, M; Barrôco, R M; Hariharan, S; Dudits, D; Beemster, G T S

    2015-11-01

    Rice (Oryza sativa L.) as a model and crop plant with a sequenced genome offers an outstanding experimental system for discovering and functionally analyzing the major cell cycle control elements in a cereal species. In this study, we identified the core cell cycle genes in the rice genome through a hidden Markov model search and multiple alignments supported with the use of short protein sequence probes. In total we present 55 rice putative cell cycle genes with locus identity, chromosomal location, approximate chromosome position and EST accession number. These cell cycle genes include nine cyclin dependent-kinase (CDK) genes, 27 cyclin genes, one CKS gene, two RBR genes, nine E2F/DP/DEL genes, six KRP genes, and one WEE gene. We also provide characteristic protein sequence signatures encoded by CDK and cyclin gene variants. Promoter analysis by the FootPrinter program discovered several motifs in the regulatory region of the core cell cycle genes. As a first step towards functional characterization we performed transcript analysis by RT-PCR to determine gene specific variation in transcript levels along the rice leaves. The meristematic zone of the leaves where cells are actively dividing was identified based on kinematic analysis and flow cytometry. As expected, expression of the majority of cell cycle genes was exclusively associated with the meristematic region. However genes such as different D-type cyclins, DEL1, KRP1/3, and RBR2 were also expressed in leaf segments representing the transition zone in which cells start differentiation.

  14. Strong early seed-specific gene regulatory region

    DOEpatents

    Broun, Pierre; Somerville, Chris

    2002-01-01

    Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

  15. Strong early seed-specific gene regulatory region

    DOEpatents

    Broun, Pierre; Somerville, Chris

    1999-01-01

    Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

  16. Isolation and characterization of the 5'-flanking sequence of the human ocular lens MIP gene.

    PubMed

    Wang, X Y; Ohtaka-Maruyama, C; Pisano, M M; Jaworski, C J; Chepelinsky, A B

    1995-12-29

    The MIP (major intrinsic protein) gene, a member of an ancient family of membrane channel genes, encodes the predominant fiber cell membrane protein of the ocular lens. Its specific expression in the lens fibers is temporally and spatially regulated during development. To study the regulation of expression of MIP and delineate the regulatory elements underlying its tissue specificity and ontogenic profile, we have cloned 2840 bp of the human MIP 5'-flanking sequence. The human MIP 5'-flanking sequence contains three complete Alu repetitive elements in tandem at position between nt -1699 and -2684 (nt -1699/-2684). These Alu elements appear to have had a complex evolutionary history with insertions at different times. We have fused DNA fragments containing MIP 5'-flanking sequences to the bacterial cat reporter gene encoding chloramphenicol acetyltransferase and assayed them in primary cultures of chicken lens cells. We have mapped two negative regulatory regions in the human MIP 5'-flanking sequences -1564/-1696 and -948/-1000. We demonstrated that the human MIP 5'-flanking sequence -253/+42 contains a functional promoter in lens cells but is inactive in kidney epithelial cells or mouse fibroblasts, suggesting that this sequence contains regulatory elements responsible for the lens-specific expression of MIP.

  17. Innovation and robustness in complex regulatory gene networks

    PubMed Central

    Ciliberti, S.; Martin, O. C.; Wagner, A.

    2007-01-01

    The history of life involves countless evolutionary innovations, a steady stream of ingenuity that has been flowing for more than 3 billion years. Very little is known about the principles of biological organization that allow such innovation. Here, we examine these principles for evolutionary innovation in gene expression patterns. To this end, we study a model for the transcriptional regulation networks that are at the heart of embryonic development. A genotype corresponds to a regulatory network of a given topology, and a phenotype corresponds to a steady-state gene expression pattern. Networks with the same phenotype form a connected graph in genotype space, where two networks are immediate neighbors if they differ by one regulatory interaction. We show that an evolutionary search on this graph can reach genotypes that are as different from each other as if they were chosen at random in genotype space, allowing evolutionary access to different kinds of innovation while staying close to a viable phenotype. Thus, although robustness to mutations may hinder innovation in the short term, we conclude that long-term innovation in gene expression patterns can only emerge in the presence of the robustness caused by connected genotype graphs. PMID:17690244

  18. Reverse Engineering of Genome-wide Gene Regulatory Networks from Gene Expression Data.

    PubMed

    Liu, Zhi-Ping

    2015-02-01

    Transcriptional regulation plays vital roles in many fundamental biological processes. Reverse engineering of genome-wide regulatory networks from high-throughput transcriptomic data provides a promising way to characterize the global scenario of regulatory relationships between regulators and their targets. In this review, we summarize and categorize the main frameworks and methods currently available for inferring transcriptional regulatory networks from microarray gene expression profiling data. We overview each of strategies and introduce representative methods respectively. Their assumptions, advantages, shortcomings, and possible improvements and extensions are also clarified and commented.

  19. Reverse Engineering of Genome-wide Gene Regulatory Networks from Gene Expression Data

    PubMed Central

    Liu, Zhi-Ping

    2015-01-01

    Transcriptional regulation plays vital roles in many fundamental biological processes. Reverse engineering of genome-wide regulatory networks from high-throughput transcriptomic data provides a promising way to characterize the global scenario of regulatory relationships between regulators and their targets. In this review, we summarize and categorize the main frameworks and methods currently available for inferring transcriptional regulatory networks from microarray gene expression profiling data. We overview each of strategies and introduce representative methods respectively. Their assumptions, advantages, shortcomings, and possible improvements and extensions are also clarified and commented. PMID:25937810

  20. Identifying gene regulatory network rewiring using latent differential graphical models

    PubMed Central

    Tian, Dechao; Gu, Quanquan; Ma, Jian

    2016-01-01

    Gene regulatory networks (GRNs) are highly dynamic among different tissue types. Identifying tissue-specific gene regulation is critically important to understand gene function in a particular cellular context. Graphical models have been used to estimate GRN from gene expression data to distinguish direct interactions from indirect associations. However, most existing methods estimate GRN for a specific cell/tissue type or in a tissue-naive way, or do not specifically focus on network rewiring between different tissues. Here, we describe a new method called Latent Differential Graphical Model (LDGM). The motivation of our method is to estimate the differential network between two tissue types directly without inferring the network for individual tissues, which has the advantage of utilizing much smaller sample size to achieve reliable differential network estimation. Our simulation results demonstrated that LDGM consistently outperforms other Gaussian graphical model based methods. We further evaluated LDGM by applying to the brain and blood gene expression data from the GTEx consortium. We also applied LDGM to identify network rewiring between cancer subtypes using the TCGA breast cancer samples. Our results suggest that LDGM is an effective method to infer differential network using high-throughput gene expression data to identify GRN dynamics among different cellular conditions. PMID:27378774

  1. High-throughput PCR screening of genes for three-component regulatory system putatively involved in quorum sensing from low-G + C gram-positive bacteria.

    PubMed

    Nakayama, Jiro; Akkermans, Antoon D L; De Vos, Willem M

    2003-03-01

    Quorum sensing of gram-positive bacteria is often regulated by three-component regulatory system composed of autoinducing peptide, sensor kinase and response regulator. We used PCR to study a gene cassette encoding this three-component regulatory system. Degenerate primers were designed from consensus amino acid sequences in the HPK10 subfamily, mostly involved in quorum sensing. Products amplified from genomic DNA of Lactobacillus, Enterococcus, and Clostridium species were cloned and sequenced; their deduced amino acid sequences were similar to those of members of the HPK10 subfamily. Complete genes for the putative gene cassette were cloned by inverse PCR from L. paracasei E93490 and L. plantarum WCFS6. Phylogenetic analysis grouped the cloned putative HPKs into the HPK10 subfamily. These results indicated the usefulness of this high-throughput gene screening and suggested that the three-component regulatory gene cassette are widely present.

  2. Enhancer Variants Synergistically Drive Dysfunction of a Gene Regulatory Network In Hirschsprung Disease

    DOE PAGES

    Chatterjee, Sumantra; Kapoor, Ashish; Akiyama, Jennifer A.; ...

    2016-09-29

    Common sequence variants in cis-regulatory elements (CREs) are suspected etiological causes of complex disorders. We previously identified an intronic enhancer variant in the RET gene disrupting SOX10 binding and increasing Hirschsprung disease (HSCR) risk 4-fold. We now show that two other functionally independent CRE variants, one binding Gata2 and the other binding Rarb, also reduce Ret expression and increase risk 2- and 1.7-fold. By studying human and mouse fetal gut tissues and cell lines, we demonstrate that reduced RET expression propagates throughout its gene regulatory network, exerting effects on both its positive and negative feedback components. We also provide evidencemore » that the presence of a combination of CRE variants synergistically reduces RET expression and its effects throughout the GRN. These studies show how the effects of functionally independent non-coding variants in a coordinated gene regulatory network amplify their individually small effects, providing a model for complex disorders.« less

  3. Cloning and characterization of nif structural and regulatory genes in the purple sulfur bacterium, Halorhodospira halophila.

    PubMed

    Tsuihiji, Hisayoshi; Yamazaki, Yoichi; Kamikubo, Hironari; Imamoto, Yasushi; Kataoka, Mikio

    2006-03-01

    Halorhodospira halophila is a halophilic photosynthetic bacterium classified as a purple sulfur bacterium. We found that H. halophila generates hydrogen gas during photoautotrophic growth as a byproduct of a nitrogenase reaction. In order to consider the applied possibilities of this photobiological hydrogen generation, we cloned and characterized the structural and regulatory genes encoding the nitrogenase, nifH, nifD and nifA, from H. halophila. This is the first description of the nif genes for a purple sulfur bacterium. The amino-acid sequences of NifH and NifD indicated that these proteins are an Fe protein and a part of a MoFe protein, respectively. The important residues are conserved completely. The sequence upstream from the nifH region and sequence similarities of nifH and nifD with those of the other organisms suggest that the regulatory system might be a NifL-NifA system; however, H. halophila lacks nifL. The amino-acid sequence of H. halophila NifA is closer to that of the NifA of the NifL-NifA system than to that of NifA without NifL. H. halophila NifA does not conserve either the residue that interacts with NifL or the important residues involved in NifL-independent regulation. These results suggest the existence of yet another regulatory system, and that the development of functional systems and their molecular counterparts are not necessarily correlated throughout evolution. All of these Nif proteins of H. halophila possess an excess of acidic residues, which acts as a salt-resistant mechanism.

  4. Engineering nucleases for gene targeting: safety and regulatory considerations.

    PubMed

    Pauwels, Katia; Podevin, Nancy; Breyer, Didier; Carroll, Dana; Herman, Philippe

    2014-01-25

    Nuclease-based gene targeting (NBGT) represents a significant breakthrough in targeted genome editing since it is applicable from single-celled protozoa to human, including several species of economic importance. Along with the fast progress in NBGT and the increasing availability of customized nucleases, more data are available about off-target effects associated with the use of this approach. We discuss how NBGT may offer a new perspective for genetic modification, we address some aspects crucial for a safety improvement of the corresponding techniques and we also briefly relate the use of NBGT applications and products to the regulatory oversight.

  5. The first determination of DNA sequence of a specific gene.

    PubMed

    Inouye, Masayori

    2016-05-10

    How and when the first DNA sequence of a gene was determined? In 1977, F. Sanger came up with an innovative technology to sequence DNA by using chain terminators, and determined the entire DNA sequence of the 5375-base genome of bacteriophage φX 174 (Sanger et al., 1977). While this Sanger's achievement has been recognized as the first DNA sequencing of genes, we had determined DNA sequence of a gene, albeit a partial sequence, 11 years before the Sanger's DNA sequence (Okada et al., 1966).

  6. Molecular analysis of the transcriptional regulatory region of an early baculovirus gene.

    PubMed Central

    Nissen, M S; Friesen, P D

    1989-01-01

    Transcription of the gene encoding a 35,000-molecular-weight protein (35K protein) from the EcoRI-S region (86.8 to 87.8 map units) of Autographa california nuclear polyhedrosis virus (AcMNPV) occurs early in infection and declines later. The region promoting the gene for the 35K protein, extending from 426 base pairs (bp) upstream to 12 bp downstream from the RNA start site, was linked to the bacterial chloramphenicol acetyltransferase gene (CAT) for analysis. CAT expression was monitored in cells that were transfected with plasmids containing the promoter-CAT fusion as well as cells infected with recombinant viruses containing the chimeric gene inserted into the AcMNPV genome. Mapping of the 5' ends of CAT-specific RNAs indicated that transcription initiated from the proper sites in both assays; moreover, the promoter fragment retained its early activity, despite an alternate location in the viral genome. The 5' boundary of upstream regulatory sequences was determined by constructing deletions of the promoter fragment extending toward the early RNA start site (position +1). In transient assays, a gradual reduction in CAT expression occurred as sequences from positions -426 to -31 were removed. In contrast, promoter deletions from positions -426 to -155 in recombinant viruses exhibited no effect on CAT expression, whereas deletions to position -55 abolished early expression but had no effect on late expression. Late CAT expression was eliminated when deletions to position -4 removed part of the late RNA start site. DNA signals potentiating early transcription were therefore located upstream (between positions -155 and -55) from those involved in late transcription of the gene encoding the 35K protein. Potential consensus sequences for early and late regulatory elements were identified. Images PMID:2642976

  7. Regulatory Architecture of Gene Expression Variation in the Threespine Stickleback Gasterosteus aculeatus

    PubMed Central

    Pritchard, Victoria L.; Viitaniemi, Heidi M.; McCairns, R. J. Scott; Merilä, Juha; Nikinmaa, Mikko; Primmer, Craig R.; Leder, Erica H.

    2016-01-01

    Much adaptive evolutionary change is underlain by mutational variation in regions of the genome that regulate gene expression rather than in the coding regions of the genes themselves. An understanding of the role of gene expression variation in facilitating local adaptation will be aided by an understanding of underlying regulatory networks. Here, we characterize the genetic architecture of gene expression variation in the threespine stickleback (Gasterosteus aculeatus), an important model in the study of adaptive evolution. We collected transcriptomic and genomic data from 60 half-sib families using an expression microarray and genotyping-by-sequencing, and located expression quantitative trait loci (eQTL) underlying the variation in gene expression in liver tissue using an interval mapping approach. We identified eQTL for several thousand expression traits. Expression was influenced by polymorphism in both cis- and trans-regulatory regions. Trans-eQTL clustered into hotspots. We did not identify master transcriptional regulators in hotspot locations: rather, the presence of hotspots may be driven by complex interactions between multiple transcription factors. One observed hotspot colocated with a QTL recently found to underlie salinity tolerance in the threespine stickleback. However, most other observed hotspots did not colocate with regions of the genome known to be involved in adaptive divergence between marine and freshwater habitats. PMID:27836907

  8. Gene regulatory networks governing haematopoietic stem cell development and identity.

    PubMed

    Pimanda, John E; Göttgens, Berthold

    2010-01-01

    Development can be viewed as a dynamic progression through regulatory states which characterise the various cell types within a given differentiation cascade. To understand the progression of regulatory states that define the origin and subsequent development of haematopoietic stem cells, the first imperative is to understand the ontogeny of haematopoiesis. We are fortunate that the ontogeny of blood development is one of the best characterized mammalian developmental systems. However, the field is still in its infancy with regard to the reconstruction of gene regulatory networks and their interactions with cell signalling cascades that drive a mesodermal progenitor to adopt the identity of a haematopoietic stem cell and beyond. Nevertheless, a framework to dissect these networks and comprehend the logic of its circuitry does exist and although they may not as yet be available, a sense for the tools that will be required to achieve this aim is also emerging. In this review we cover the fundamentals of network architecture, methods used to reconstruct networks, current knowledge of haematopoietic and related transcriptional networks, current challenges and future outlook.

  9. Nucleotide Sequence of the Akv env Gene

    PubMed Central

    Lenz, Jack; Crowther, Robert; Straceski, Anthony; Haseltine, William

    1982-01-01

    The sequence of 2,191 nucleotides encoding the env gene of murine retrovirus Akv was determined by using a molecular clone of the Akv provirus. Deduction of the encoded amino acid sequence showed that a single open reading frame encodes a 638-amino acid precursor to gp70 and p15E. In addition, there is a typical leader sequence preceding the amino terminus of gp70. The locations of potential glycosylation sites and other structural features indicate that the entire gp70 molecule and most of p15E are located on the outer side of the membrane. Internal cleavage of the env precursor to generate gp70 and p15E occurs immediately adjacent to several basic amino acids at the carboxyl terminus of gp70. This cleavage generates a region of 42 uncharged, relatively hydrophobic amino acids at the amino terminus of p15E, which is located in a position analogous to the hydrophobic membrane fusion sequence of influenza virus hemagglutinin. The mature polypeptides are predicted to associate with the membrane via a region of 30 uncharged, mostly hydrophobic amino acids located near the carboxyl terminus of p15E. Distal to this membrane association region is a sequence of 35 amino acids at the carboxyl terminus of the env precursor, which is predicted to be located on the inner side of the membrane. By analogy to Moloney murine leukemia virus, a proteolytic cleavage in this region removes the terminal 19 amino acids, thus generating the carboxyl terminus of p15E. This leaves 15 amino acids at the carboxyl terminus of p15E on the inner side of the membrane in a position to interact with virion cores during budding. The precise location and order of the large RNase T1-resistant oligonucleotides in the env region were determined and compared with those from several leukemogenic viruses of AKR origin. This permitted a determination of how the differences in the leukemogenic viruses affect the primary structure of the env gene products. PMID:6283170

  10. Sequence and gene expression evolution of paralogous genes in willows

    PubMed Central

    Harikrishnan, Srilakshmy L.; Pucholt, Pascal; Berlin, Sofia

    2015-01-01

    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows. PMID:26689951

  11. Sequence and gene expression evolution of paralogous genes in willows.

    PubMed

    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia

    2015-12-22

    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows.

  12. Redeployment of a conserved gene regulatory network during Aedes aegypti development.

    PubMed

    Suryamohan, Kushal; Hanson, Casey; Andrews, Emily; Sinha, Saurabh; Scheel, Molly Duman; Halfon, Marc S

    2016-08-15

    Changes in gene regulatory networks (GRNs) underlie the evolution of morphological novelty and developmental system drift. The fruitfly Drosophila melanogaster and the dengue and Zika vector mosquito Aedes aegypti have substantially similar nervous system morphology. Nevertheless, they show significant divergence in a set of genes co-expressed in the midline of the Drosophila central nervous system, including the master regulator single minded and downstream genes including short gastrulation, Star, and NetrinA. In contrast to Drosophila, we find that midline expression of these genes is either absent or severely diminished in A. aegypti. Instead, they are co-expressed in the lateral nervous system. This suggests that in A. aegypti this "midline GRN" has been redeployed to a new location while lost from its previous site of activity. In order to characterize the relevant GRNs, we employed the SCRMshaw method we previously developed to identify transcriptional cis-regulatory modules in both species. Analysis of these regulatory sequences in transgenic Drosophila suggests that the altered gene expression observed in A. aegypti is the result of trans-dependent redeployment of the GRN, potentially stemming from cis-mediated changes in the expression of sim and other as-yet unidentified regulators. Our results illustrate a novel "repeal, replace, and redeploy" mode of evolution in which a conserved GRN acquires a different function at a new site while its original function is co-opted by a different GRN. This represents a striking example of developmental system drift in which the dramatic shift in gene expression does not result in gross morphological changes, but in more subtle differences in development and function of the late embryonic nervous system. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Redeployment of a conserved gene regulatory network during Aedes aegypti development

    PubMed Central

    Suryamohan, Kushal; Hanson, Casey; Andrews, Emily; Sinha, Saurabh; Scheel, Molly Duman; Halfon, Marc S.

    2016-01-01

    Changes in gene regulatory networks (GRNs) underlie the evolution of morphological novelty and developmental system drift. The fruitfly Drosophila melanogaster and the dengue and Zika vector mosquito Aedes aegypti have substantially similar nervous system morphology. Nevertheless, they show significant divergence in a set of genes co-expressed in the midline of the Drosophila central nervous system, including the master regulator single minded and downstream genes including short gastrulation, Star, and NetrinA. In contrast to Drosophila, we find that midline expression of these genes is either absent or severely diminished in A. aegypti. Instead, they are co-expressed in the lateral nervous system. This suggests that in A. aegypti this “midline GRN” has been redeployed to a new location while lost from its previous site of activity. In order to characterize the relevant GRNs, we employed the SCRMshaw method we previously developed to identify transcriptional cis-regulatory modules in both species. Analysis of these regulatory sequences in transgenic Drosophila suggests that the altered gene expression observed in A. aegypti is the result of trans-dependent redeployment of the GRN, potentially stemming from cis-mediated changes in the expression of sim and other as-yet unidentified regulators. Our results illustrate a novel “repeal, replace, and redeploy” mode of evolution in which a conserved GRN acquires a different function at a new site while its original function is co-opted by a different GRN. This represents a striking example of developmental system drift in which the dramatic shift in gene expression does not result in gross morphological changes, but in more subtle differences in development and function of the late embryonic nervous system. PMID:27341759

  14. Selection for distinct gene expression properties favours the evolution of mutational robustness in gene regulatory networks.

    PubMed

    Espinosa-Soto, C

    2016-11-01

    Mutational robustness is a genotype's tendency to keep a phenotypic trait with little and few changes in the face of mutations. Mutational robustness is both ubiquitous and evolutionarily important as it affects in different ways the probability that new phenotypic variation arises. Understanding the origins of robustness is specially relevant for systems of development that are phylogenetically widespread and that construct phenotypic traits with a strong impact on fitness. Gene regulatory networks are examples of this class of systems. They comprise sets of genes that, through cross-regulation, build the gene activity patterns that define cellular responses, different tissues or distinct cell types. Several empirical observations, such as a greater robustness of wild-type phenotypes, suggest that stabilizing selection underlies the evolution of mutational robustness. However, the role of selection in the evolution of robustness is still under debate. Computer simulations of the dynamics and evolution of gene regulatory networks have shown that selection for any gene activity pattern that is steady and self-sustaining is sufficient to promote the evolution of mutational robustness. Here, I generalize this scenario using a computational model to show that selection for different aspects of a gene activity phenotype increases mutational robustness. Mutational robustness evolves even when selection favours properties that conflict with the stationarity of a gene activity pattern. The results that I present support an important role for stabilizing selection in the evolution of robustness in gene regulatory networks.

  15. Identification of a conserved sequence in the non-coding regions of many human genes.

    PubMed Central

    Donehower, L A; Slagle, B L; Wilde, M; Darlington, G; Butel, J S

    1989-01-01

    We have analyzed a sequence of approximately 70 base pairs (bp) that shows a high degree of similarity to sequences present in the non-coding regions of a number of human and other mammalian genes. The sequence was discovered in a fragment of human genomic DNA adjacent to an integrated hepatitis B virus genome in cells derived from human hepatocellular carcinoma tissue. When one of the viral flanking sequences was compared to nucleotide sequences in GenBank, more than thirty human genes were identified that contained a similar sequence in their non-coding regions. The sequence element was usually found once or twice in a gene, either in an intron or in the 5' or 3' flanking regions. It did not share any similarities with known short interspersed nucleotide elements (SINEs) or presently known gene regulatory elements. This element was highly conserved at the same position within the corresponding human and mouse genes for myoglobin and N-myc, indicating evolutionary conservation and possible functional importance. Preliminary DNase I footprinting data suggested that the element or its adjacent sequences may bind nuclear factors to generate specific DNase I hypersensitive sites. The size, structure, and evolutionary conservation of this sequence indicates that it is distinct from other types of short interspersed repetitive elements. It is possible that the element may have a cis-acting functional role in the genome. Images PMID:2536922

  16. Regulatory dynamics of synthetic gene networks with positive feedback.

    PubMed

    Maeda, Yusuke T; Sano, Masaki

    2006-06-16

    Biological processes are governed by complex networks ranging from gene regulation to signal transduction. Positive feedback is a key element in such networks. The regulation enables cells to adopt multiple internal expression states in response to a single external input signal. However, past works lacked a dynamical aspect of this system. To address the dynamical property of the positive feedback system, we employ synthetic gene circuits in Escherichia coli to measure the rise-time of both the no-feedback system and the positive feedback system. We show that the kinetics of gene expression is slowed down if the gene regulatory system includes positive feedback. We also report that the transition of gene switching behaviors from the hysteretic one to the graded one occurs. A mathematical model based on the chemical reactions shows that the response delay is an inherited property of the positive feedback system. Furthermore, with the aid of the phase diagram, we demonstrate the decline of the feedback activation causes the transition of switching behaviors. Our findings provide a further understanding of a positive feedback system in a living cell from a dynamical point of view.

  17. Genomic organization and sequences of immunoglobulin light chain genes in a primitive vertebrate suggest coevolution of immunoglobulin gene organization.

    PubMed Central

    Shamblott, M J; Litman, G W

    1989-01-01

    The genomic organization and sequence of immunoglobulin light chain genes in Heterodontus francisci (horned shark), a phylogenetically primitive vertebrate, have been characterized. Light chain variable (VL) and joining (JI) segments are separated by 380 nucleotides and together with the single constant region exon (CI), occupy less than 2.7 kb, the closest linkage described thus far for a rearranging gene system. The VL segment is flanked by a characteristic recombination signal sequence possessing a 12 nucleotide spacer; the recombination signal sequence flanking the JL segment is 23 nucleotides. The VL genes, unlike heavy chain genes, possess a typical upstream regulatory octamer as well as conserved enhancer core sequences in the intervening sequence separating JL and CL. Restriction mapping and genomic Southern blotting are consistent with the presence of multiple light chain gene clusters. There appear to be considerably fewer light than heavy chain genes. Heavy and light chain clusters show no evidence of genomic linkage using field inversion gel electrophoresis. The findings of major differences in the organization and functional rearrangement properties of immunoglobulin genes in species representing different levels of vertebrate evolution, but consistent similarity in the organization of heavy and light chain genes within a species, suggests that these systems may be coevolving. Images PMID:2511000

  18. GeneMachine: gene prediction and sequence annotation.

    PubMed

    Makalowska, I; Ryan, J F; Baxevanis, A D

    2001-09-01

    A number of free-standing programs have been developed in order to help researchers find potential coding regions and deduce gene structure for long stretches of what is essentially 'anonymous DNA'. As these programs apply inherently different criteria to the question of what is and is not a coding region, multiple algorithms should be used in the course of positional cloning and positional candidate projects to assure that all potential coding regions within a previously-identified critical region are identified. We have developed a gene identification tool called GeneMachine which allows users to query multiple exon and gene prediction programs in an automated fashion. BLAST searches are also performed in order to see whether a previously-characterized coding region corresponds to a region in the query sequence. A suite of Perl programs and modules are used to run MZEF, GENSCAN, GRAIL 2, FGENES, RepeatMasker, Sputnik, and BLAST. The results of these runs are then parsed and written into ASN.1 format. Output files can be opened using NCBI Sequin, in essence using Sequin as both a workbench and as a graphical viewer. The main feature of GeneMachine is that the process is fully automated; the user is only required to launch GeneMachine and then open the resulting file with Sequin. Annotations can then be made to these results prior to submission to GenBank, thereby increasing the intrinsic value of these data. GeneMachine is freely-available for download at http://genome.nhgri.nih.gov/genemachine. A public Web interface to the GeneMachine server for academic and not-for-profit users is available at http://genemachine.nhgri.nih.gov. The Web supplement to this paper may be found at http://genome.nhgri.nih.gov/genemachine/supplement/.

  19. Using synthetic biology to study gene regulatory evolution.

    PubMed

    Crocker, Justin; Ilsley, Garth R

    2017-09-29

    Transcriptional enhancers specify the precise time, level, and location of gene expression. Disentangling and characterizing the components of enhancer activity in multicellular eukaryotic development has proven challenging because enhancers contain activator and repressor binding sites for multiple factors that each exert nuanced, context-dependent control of enhancer activity. Recent advances in synthetic biology provide an almost unlimited ability to create and modify regulatory elements and networks, offering unprecedented power to study gene regulation. Here we review several studies demonstrating the utility of synthetic biology for studying enhancer function during development and evolution. These studies clearly show that synthetic biology can provide a way to reverse-engineer and reengineer transcriptional regulation in animal genomes with enormous potential for understanding evolution. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Reverse engineering of gene regulatory networks: a comparative study.

    PubMed

    Hache, Hendrik; Lehrach, Hans; Herwig, Ralf

    2009-01-01

    Reverse engineering of gene regulatory networks has been an intensively studied topic in bioinformatics since it constitutes an intermediate step from explorative to causative gene expression analysis. Many methods have been proposed through recent years leading to a wide range of mathematical approaches. In practice, different mathematical approaches will generate different resulting network structures, thus, it is very important for users to assess the performance of these algorithms. We have conducted a comparative study with six different reverse engineering methods, including relevance networks, neural networks, and Bayesian networks. Our approach consists of the generation of defined benchmark data, the analysis of these data with the different methods, and the assessment of algorithmic performances by statistical analyses. Performance was judged by network size and noise levels. The results of the comparative study highlight the neural network approach as best performing method among those under study.

  1. Discovering transcription factor regulatory targets using gene expression and binding data.

    PubMed

    Maienschein-Cline, Mark; Zhou, Jie; White, Kevin P; Sciammas, Roger; Dinner, Aaron R

    2012-01-15

    Identifying the target genes regulated by transcription factors (TFs) is the most basic step in understanding gene regulation. Recent advances in high-throughput sequencing technology, together with chromatin immunoprecipitation (ChIP), enable mapping TF binding sites genome wide, but it is not possible to infer function from binding alone. This is especially true in mammalian systems, where regulation often occurs through long-range enhancers in gene-rich neighborhoods, rather than proximal promoters, preventing straightforward assignment of a binding site to a target gene. We present EMBER (Expectation Maximization of Binding and Expression pRofiles), a method that integrates high-throughput binding data (e.g. ChIP-chip or ChIP-seq) with gene expression data (e.g. DNA microarray) via an unsupervised machine learning algorithm for inferring the gene targets of sets of TF binding sites. Genes selected are those that match overrepresented expression patterns, which can be used to provide information about multiple TF regulatory modes. We apply the method to genome-wide human breast cancer data and demonstrate that EMBER confirms a role for the TFs estrogen receptor alpha, retinoic acid receptors alpha and gamma in breast cancer development, whereas the conventional approach of assigning regulatory targets based on proximity does not. Additionally, we compare several predicted target genes from EMBER to interactions inferred previously, examine combinatorial effects of TFs on gene regulation and illustrate the ability of EMBER to discover multiple modes of regulation. All code used for this work is available at http://dinner-group.uchicago.edu/downloads.html.

  2. Diverse Gene Expression in Human Regulatory T Cell Subsets Uncovers Connection between Regulatory T Cell Genes and Suppressive Function.

    PubMed

    Hua, Jing; Davis, Scott P; Hill, Jonathan A; Yamagata, Tetsuya

    2015-10-15

    Regulatory T (Treg) cells have a critical role in the control of immunity, and their diverse subpopulations may allow adaptation to different types of immune responses. In this study, we analyzed human Treg cell subpopulations in the peripheral blood by performing genome-wide expression profiling of 40 Treg cell subsets from healthy donors. We found that the human peripheral blood Treg cell population is comprised of five major genomic subgroups, represented by 16 tractable subsets with a particular cell surface phenotype. These subsets possess a range of suppressive function and cytokine secretion and can exert a genomic footprint on target effector T (Teff) cells. Correlation analysis of variability in gene expression in the subsets identified several cell surface molecules associated with Treg suppressive function, and pharmacological interrogation revealed a set of genes having causative effect. The five genomic subgroups of Treg cells imposed a preserved pattern of gene expression on Teff cells, with a varying degree of genes being suppressed or induced. Notably, there was a cluster of genes induced by Treg cells that bolstered an autoinhibitory effect in Teff cells, and this induction appears to be governed by a different set of genes than ones involved in counteracting Teff activation. Our work shows an example of exploiting the diversity within human Treg cell subpopulations to dissect Treg cell biology.

  3. Detection and Visualization of Compositionally Similar cis-Regulatory Element Clusters in Orthologous and Coordinately Controlled Genes

    PubMed Central

    Jegga, Anil G.; Sherwood, Shawn P.; Carman, James W.; Pinski, Andrew T.; Phillips, Jerry L.; Pestian, John P.; Aronow, Bruce J.

    2002-01-01

    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) (http://trafac.chmcc.org). We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions. PMID:12213778

  4. Detection and visualization of compositionally similar cis-regulatory element clusters in orthologous and coordinately controlled genes.

    PubMed

    Jegga, Anil G; Sherwood, Shawn P; Carman, James W; Pinski, Andrew T; Phillips, Jerry L; Pestian, John P; Aronow, Bruce J

    2002-09-01

    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) (http://trafac.chmcc.org). We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions.

  5. Mouse Vk gene classification by nucleic acid sequence similarity.

    PubMed

    Strohal, R; Helmberg, A; Kroemer, G; Kofler, R

    1989-01-01

    Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.

  6. Maps of open chromatin highlight cell type-restricted patterns of regulatory sequence variation at hematological trait loci.

    PubMed

    Paul, Dirk S; Albers, Cornelis A; Rendon, Augusto; Voss, Katrin; Stephens, Jonathan; van der Harst, Pim; Chambers, John C; Soranzo, Nicole; Ouwehand, Willem H; Deloukas, Panos

    2013-07-01

    Nearly three-quarters of the 143 genetic signals associated with platelet and erythrocyte phenotypes identified by meta-analyses of genome-wide association (GWA) studies are located at non-protein-coding regions. Here, we assessed the role of candidate regulatory variants associated with cell type-restricted, closely related hematological quantitative traits in biologically relevant hematopoietic cell types. We used formaldehyde-assisted isolation of regulatory elements followed by next-generation sequencing (FAIRE-seq) to map regions of open chromatin in three primary human blood cells of the myeloid lineage. In the precursors of platelets and erythrocytes, as well as in monocytes, we found that open chromatin signatures reflect the corresponding hematopoietic lineages of the studied cell types and associate with the cell type-specific gene expression patterns. Dependent on their signal strength, open chromatin regions showed correlation with promoter and enhancer histone marks, distance to the transcription start site, and ontology classes of nearby genes. Cell type-restricted regions of open chromatin were enriched in sequence variants associated with hematological indices. The majority (63.6%) of such candidate functional variants at platelet quantitative trait loci (QTLs) coincided with binding sites of five transcription factors key in regulating megakaryopoiesis. We experimentally tested 13 candidate regulatory variants at 10 platelet QTLs and found that 10 (76.9%) affected protein binding, suggesting that this is a frequent mechanism by which regulatory variants influence quantitative trait levels. Our findings demonstrate that combining large-scale GWA data with open chromatin profiles of relevant cell types can be a powerful means of dissecting the genetic architecture of closely related quantitative traits.

  7. Toxin-mediated gene regulatory mechanism in Staphylococcus aureus

    PubMed Central

    Joo, Hwang-Soo; Otto, Michael

    2016-01-01

    The dangerous human pathogen Staphylococcus aureus relies heavily on toxins to cause disease, but toxin production can put a strong burden on the bacteria’s energy balance. Thus, controlling the synthesis of proteins solely needed in times of toxin production represents a way for the bacteria to avoid wasting energy. One hypothetical manner to accomplish this sort of regulation is by gene regulatory functions of the toxins themselves. There have been several reports about gene regulation by toxins in S. aureus, but these were never verified on the molecular level. In our study published in MBio [Joo et al., 7(5). pii: e01579-16], we show that phenol-soluble modulins (PSMs), important peptide toxins of S. aureus, release a repressor from the promoter of the operon encoding the toxin export system, thereby enabling toxin secretion. This study describes the first molecular regulatory mechanism exerted by an S. aureus toxin, setting a paradigmatic example of how S. aureus toxins may influence cell functions to adjust them to times of toxin production.

  8. Neurogenic gene regulatory pathways in the sea urchin embryo

    PubMed Central

    Wei, Zheng; Angerer, Lynne M.; Angerer, Robert C.

    2016-01-01

    During embryogenesis the sea urchin early pluteus larva differentiates 40-50 neurons marked by expression of the pan-neural marker synaptotagmin B (SynB) that are distributed along the ciliary band, in the apical plate and pharyngeal endoderm, and 4-6 serotonergic neurons that are confined to the apical plate. Development of all neurons has been shown to depend on the function of Six3. Using a combination of molecular screens and tests of gene function by morpholino-mediated knockdown, we identified SoxC and Brn1/2/4, which function sequentially in the neurogenic regulatory pathway and are also required for the differentiation of all neurons. Misexpression of Brn1/2/4 at low dose caused an increase in the number of serotonin-expressing cells and at higher dose converted most of the embryo to a neurogenic epithelial sphere expressing the Hnf6 ciliary band marker. A third factor, Z167, was shown to work downstream of the Six3 and SoxC core factors and to define a branch specific for the differentiation of serotonergic neurons. These results provide a framework for building a gene regulatory network for neurogenesis in the sea urchin embryo. PMID:26657764

  9. Gene Regulatory Networks in Cardiac Conduction System Development

    PubMed Central

    Munshi, Nikhil V.

    2014-01-01

    The cardiac conduction system is a specialized tract of myocardial cells responsible for maintaining normal cardiac rhythm. Given its critical role in coordinating cardiac performance, a detailed analysis of the molecular mechanisms underlying conduction system formation should inform our understanding of arrhythmia pathophysiology and affect the development of novel therapeutic strategies. Historically, the ability to distinguish cells of the conduction system from neighboring working myocytes presented a major technical challenge for performing comprehensive mechanistic studies. Early lineage tracing experiments suggested that conduction cells derive from cardiomyocyte precursors, and these claims have been substantiated by using more contemporary approaches. However, regional specialization of conduction cells adds an additional layer of complexity to this system, and it appears that different components of the conduction system utilize unique modes of developmental formation. The identification of numerous transcription factors and their downstream target genes involved in regional differentiation of the conduction system has provided insight into how lineage commitment is achieved. Furthermore, by adopting cutting-edge genetic techniques in combination with sophisticated phenotyping capabilities, investigators have made substantial progress in delineating the regulatory networks that orchestrate conduction system formation and their role in cardiac rhythm and physiology. This review describes the connectivity of these gene regulatory networks in cardiac conduction system development and discusses how they provide a foundation for understanding normal and pathological human cardiac rhythms. PMID:22628576

  10. Neurogenic gene regulatory pathways in the sea urchin embryo.

    PubMed

    Wei, Zheng; Angerer, Lynne M; Angerer, Robert C

    2016-01-15

    During embryogenesis the sea urchin early pluteus larva differentiates 40-50 neurons marked by expression of the pan-neural marker synaptotagmin B (SynB) that are distributed along the ciliary band, in the apical plate and pharyngeal endoderm, and 4-6 serotonergic neurons that are confined to the apical plate. Development of all neurons has been shown to depend on the function of Six3. Using a combination of molecular screens and tests of gene function by morpholino-mediated knockdown, we identified SoxC and Brn1/2/4, which function sequentially in the neurogenic regulatory pathway and are also required for the differentiation of all neurons. Misexpression of Brn1/2/4 at low dose caused an increase in the number of serotonin-expressing cells and at higher dose converted most of the embryo to a neurogenic epithelial sphere expressing the Hnf6 ciliary band marker. A third factor, Z167, was shown to work downstream of the Six3 and SoxC core factors and to define a branch specific for the differentiation of serotonergic neurons. These results provide a framework for building a gene regulatory network for neurogenesis in the sea urchin embryo. © 2016. Published by The Company of Biologists Ltd.

  11. Evaluation of whole exome sequencing by targeted gene sequencing and Sanger sequencing.

    PubMed

    Chang, Ya-Sian; Huang, Hsien-Da; Yeh, Kun-Tu; Chang, Jan-Gowth

    2017-08-01

    Targeted gene sequencing (TGS) and whole exome sequencing (WES) are being used in clinical testing in laboratories. We compared the performances of TGS and WES using the same DNA samples. DNA was extracted from 10 endometrial tumor tissue specimens. Sequencing were performed with an Illumina HiSeq 2000. We randomly selected variants to confirm through Sanger sequencing or mutant-enriched PCR with Sanger sequencing. We found that the variants identified in both TGS and WES were true positives (47/47), regardless of the sequencing depth. Most variants found in TGS only were true positives (34/40), and most of the variants found by WES only were false positives (8/18). From these results, we suggest that the sequencing depth may not play important role in the accuracy of NGS-based methods. After analysis, we found that WES had a sensitivity of 72.70%, specificity of 96.27%, precision of 99.44%, and accuracy of 75.03%. The results of NGS-based methods must currently be validated, especially for important reported variants regardless of the methods used, and for the use of WES in cancers a higher false negative rate must be considered. More sensitive methods should be used to confirm the NGS results in uneven cancer tissues. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. A Trans-Acting Regulatory Gene That Inversely Affects the Expression of the White, Brown and Scarlet Loci in Drosophila

    PubMed Central

    Rabinow, L.; Nguyen-Huynh, A. T.; Birchler, J. A.

    1991-01-01

    A trans-acting regulatory gene, Inr-a, that alters the level of expression of the white eye color locus as an inverse function of the number of its functional copies is described. Several independent lines of evidence demonstrate that this regulatory gene interacts with white via the promoter sequences. Among these are the observations that the inverse regulatory effect is conferred to the Adh gene when fused to the white promoter and that cis-regulatory mutants of white fail to respond. The phenotypic response to Inr-a is found in all tissues in which white is expressed, and mutants of the regulator exhibit a recessive lethality during larval periods. Increased white messenger RNA levels in pupal stages are found in Inr-a/+ individuals versus +/+ and a coordinate response is observed for mRNA levels from the brown and scarlet loci. All are structurally related and participate in pigment deposition. These experiments demonstrate that a single regulatory gene can exert an inverse effect on a target structural locus, a situation postulated from segmental aneuploid studies of gene expression and dosage compensation. PMID:1743487

  13. Inheritance of gene expression level and selective constraints on trans- and cis-regulatory changes in yeast.

    PubMed

    Schaefke, Bernhard; Emerson, J J; Wang, Tzi-Yuan; Lu, Mei-Yeh Jade; Hsieh, Li-Ching; Li, Wen-Hsiung

    2013-09-01

    Gene expression evolution can be caused by changes in cis- or trans-regulatory elements or both. As cis and trans regulation operate through different molecular mechanisms, cis and trans mutations may show different inheritance patterns and may be subjected to different selective constraints. To investigate these issues, we obtained and analyzed gene expression data from two Saccharomyces cerevisiae strains and their hybrid, using high-throughput sequencing. Our data indicate that compared with other types of genes, those with antagonistic cis-trans interactions are more likely to exhibit over- or underdominant inheritance of expression level. Moreover, in accordance with previous studies, genes with trans variants tend to have a dominant inheritance pattern, whereas cis variants are enriched for additive inheritance. In addition, cis regulatory differences contribute more to expression differences between species than within species, whereas trans regulatory differences show a stronger association between divergence and polymorphism. Our data indicate that in the trans component of gene expression differences genes subjected to weaker selective constraints tend to have an excess of polymorphism over divergence compared with those subjected to stronger selective constraints. In contrast, in the cis component, this difference between genes under stronger and weaker selective constraint is mostly absent. To explain these observations, we propose that purifying selection more strongly shapes trans changes than cis changes and that positive selection may have significantly contributed to cis regulatory divergence.

  14. Deep sequencing-based identification of small regulatory RNAs in Synechocystis sp. PCC 6803.

    PubMed

    Xu, Wen; Chen, Hui; He, Chen-Liu; Wang, Qiang

    2014-01-01

    Synechocystis sp. PCC 6803 is a genetically tractable model organism for photosynthesis research. The genome of Synechocystis sp. PCC 6803 consists of a circular chromosome and seven plasmids. The importance of small regulatory RNAs (sRNAs) as mediators of a number of cellular processes in bacteria has begun to be recognized. However, little is known regarding sRNAs in Synechocystis sp. PCC 6803. To provide a comprehensive overview of sRNAs in this model organism, the sRNAs of Synechocystis sp. PCC 6803 were analyzed using deep sequencing, and 7,951,189 reads were obtained. High quality mapping reads (6,127,890) were mapped onto the genome and assembled into 16,192 transcribed regions (clusters) based on read overlap. A total number of 5211 putative sRNAs were revealed from the genome and the 4 megaplasmids, and 27 of these molecules, including four from plasmids, were confirmed by RT-PCR. In addition, possible target genes regulated by all of the putative sRNAs identified in this study were predicted by IntaRNA and analyzed for functional categorization and biological pathways, which provided evidence that sRNAs are indeed involved in many different metabolic pathways, including basic metabolic pathways, such as glycolysis/gluconeogenesis, the citrate cycle, fatty acid metabolism and adaptations to environmentally stress-induced changes. The information from this study provides a valuable reservoir for understanding the sRNA-mediated regulation of the complex physiology and metabolic processes of cyanobacteria.

  15. A global view of gene expression in lithium and zinc treated sea urchin embryos: new components of gene regulatory networks

    PubMed Central

    Poustka, Albert J; Kühn, Alexander; Groth, Detlef; Weise, Vesna; Yaguchi, Shunsuke; Burke, Robert D; Herwig, Ralf; Lehrach, Hans; Panopoulou, Georgia

    2007-01-01

    Background The genome of the sea urchin Strongylocentrotus purpuratus has recently been sequenced because it is a major model system for the study of gene regulatory networks. Embryonic expression patterns for most genes are unknown, however. Results Using large-scale screens on arrays carrying 50% to 70% of all genes, we identified novel territory-specific markers. Our strategy was based on computational selection of genes that are differentially expressed in lithium-treated embryos, which form excess endomesoderm, and in zinc-treated embryos, in which endomesoderm specification is blocked. Whole-mount in situ hybridization (WISH) analysis of 700 genes indicates that the apical organ region is eliminated in lithium-treated embryos. Conversely, apical and specifically neural markers are expressed more broadly in zinc-treated embryos, whereas endomesoderm signaling is severely reduced. Strikingly, the number of serotonergic neurons is amplified by at least tenfold in zinc-treated embryos. WISH analysis further indicates that there is crosstalk between the Wnt (wingless int), Notch, and fibroblast growth factor signaling pathways in secondary mesoderm cell specification and differentiation, similar to signaling cascades that function during development of presomitic mesoderm in mouse embryogenesis. We provide differential expression data for more than 4,000 genes and WISH patterns of more than 250 genes, and more than 2,400 annotated WISH images. Conclusion Our work provides tissue-specific expression patterns for a large fraction of the sea urchin genes that have not yet been included in existing regulatory networks and await functional integration. Furthermore, we noted neuron-inducing activity of zinc on embryonic development; this is the first observation of such activity in any organism. PMID:17506889

  16. Screening in silico predicted remotely acting NF1 gene regulatory elements for mutations in patients with neurofibromatosis type 1.

    PubMed

    Hamby, Stephen E; Reviriego, Pablo; Cooper, David N; Upadhyaya, Meena; Chuzhanova, Nadia

    2013-08-15

    Neurofibromatosis type 1 (NF1), a neuroectodermal disorder, is caused by germline mutations in the NF1 gene. NF1 affects approximately 1/3,000 individuals worldwide, with about 50% of cases representing de novo mutations. Although the NF1 gene was identified in 1990, the underlying gene mutations still remain undetected in a small but obdurate minority of NF1 patients. We postulated that in these patients, hitherto undetected pathogenic mutations might occur in regulatory elements far upstream of the NF1 gene. In an attempt to identify such remotely acting regulatory elements, we reasoned that some of them might reside within DNA sequences that (1) have the potential to interact at distance with the NF1 gene and (2) lie within a histone H3K27ac-enriched region, a characteristic of active enhancers. Combining Hi-C data, obtained by means of the chromosome conformation capture technique, with data on the location and level of histone H3K27ac enrichment upstream of the NF1 gene, we predicted in silico the presence of two remotely acting regulatory regions, located, respectively, approximately 600 kb and approximately 42 kb upstream of the NF1 gene. These regions were then sequenced in 47 NF1 patients in whom no mutations had been found in either the NF1 or SPRED1 gene regions. Five patients were found to harbour DNA sequence variants in the distal H3K27ac-enriched region. Although these variants are of uncertain pathological significance and still remain to be functionally characterized, this approach promises to be of general utility for the detection of mutations underlying other inherited disorders that may be caused by mutations in remotely acting regulatory elements.

  17. Graphlet Based Metrics for the Comparison of Gene Regulatory Networks

    PubMed Central

    Martin, Alberto J. M.; Dominguez, Calixto; Contreras-Riquelme, Sebastián; Holmes, David S.; Perez-Acle, Tomas

    2016-01-01

    Understanding the control of gene expression remains one of the main challenges in the post-genomic era. Accordingly, a plethora of methods exists to identify variations in gene expression levels. These variations underlay almost all relevant biological phenomena, including disease and adaptation to environmental conditions. However, computational tools to identify how regulation changes are scarce. Regulation of gene expression is usually depicted in the form of a gene regulatory network (GRN). Structural changes in a GRN over time and conditions represent variations in the regulation of gene expression. Like other biological networks, GRNs are composed of basic building blocks called graphlets. As a consequence, two new metrics based on graphlets are proposed in this work: REConstruction Rate (REC) and REC Graphlet Degree (RGD). REC determines the rate of graphlet similarity between different states of a network and RGD identifies the subset of nodes with the highest topological variation. In other words, RGD discerns how th GRN was rewired. REC and RGD were used to compare the local structure of nodes in condition-specific GRNs obtained from gene expression data of Escherichia coli, forming biofilms and cultured in suspension. According to our results, most of the network local structure remains unaltered in the two compared conditions. Nevertheless, changes reported by RGD necessarily imply that a different cohort of regulators (i.e. transcription factors (TFs)) appear on the scene, shedding light on how the regulation of gene expression occurs when E. coli transits from suspension to biofilm. Consequently, we propose that both metrics REC and RGD should be adopted as a quantitative approach to conduct differential analyses of GRNs. A tool that implements both metrics is available as an on-line web server (http://dlab.cl/loto). PMID:27695050

  18. Graphlet Based Metrics for the Comparison of Gene Regulatory Networks.

    PubMed

    Martin, Alberto J M; Dominguez, Calixto; Contreras-Riquelme, Sebastián; Holmes, David S; Perez-Acle, Tomas

    2016-01-01

    Understanding the control of gene expression remains one of the main challenges in the post-genomic era. Accordingly, a plethora of methods exists to identify variations in gene expression levels. These variations underlay almost all relevant biological phenomena, including disease and adaptation to environmental conditions. However, computational tools to identify how regulation changes are scarce. Regulation of gene expression is usually depicted in the form of a gene regulatory network (GRN). Structural changes in a GRN over time and conditions represent variations in the regulation of gene expression. Like other biological networks, GRNs are composed of basic building blocks called graphlets. As a consequence, two new metrics based on graphlets are proposed in this work: REConstruction Rate (REC) and REC Graphlet Degree (RGD). REC determines the rate of graphlet similarity between different states of a network and RGD identifies the subset of nodes with the highest topological variation. In other words, RGD discerns how th GRN was rewired. REC and RGD were used to compare the local structure of nodes in condition-specific GRNs obtained from gene expression data of Escherichia coli, forming biofilms and cultured in suspension. According to our results, most of the network local structure remains unaltered in the two compared conditions. Nevertheless, changes reported by RGD necessarily imply that a different cohort of regulators (i.e. transcription factors (TFs)) appear on the scene, shedding light on how the regulation of gene expression occurs when E. coli transits from suspension to biofilm. Consequently, we propose that both metrics REC and RGD should be adopted as a quantitative approach to conduct differential analyses of GRNs. A tool that implements both metrics is available as an on-line web server (http://dlab.cl/loto).

  19. Evolutionary and Topological Properties of Genes and Community Structures in Human Gene Regulatory Networks.

    PubMed

    Szedlak, Anthony; Smith, Nicholas; Liu, Li; Paternostro, Giovanni; Piermarocchi, Carlo

    2016-06-01

    The diverse, specialized genes present in today's lifeforms evolved from a common core of ancient, elementary genes. However, these genes did not evolve individually: gene expression is controlled by a complex network of interactions, and alterations in one gene may drive reciprocal changes in its proteins' binding partners. Like many complex networks, these gene regulatory networks (GRNs) are composed of communities, or clusters of genes with relatively high connectivity. A deep understanding of the relationship between the evolutionary history of single genes and the topological properties of the underlying GRN is integral to evolutionary genetics. Here, we show that the topological properties of an acute myeloid leukemia GRN and a general human GRN are strongly coupled with its genes' evolutionary properties. Slowly evolving ("cold"), old genes tend to interact with each other, as do rapidly evolving ("hot"), young genes. This naturally causes genes to segregate into community structures with relatively homogeneous evolutionary histories. We argue that gene duplication placed old, cold genes and communities at the center of the networks, and young, hot genes and communities at the periphery. We demonstrate this with single-node centrality measures and two new measures of efficiency, the set efficiency and the interset efficiency. We conclude that these methods for studying the relationships between a GRN's community structures and its genes' evolutionary properties provide new perspectives for understanding evolutionary genetics.

  20. Molecular structural and functional characterization of STAT1 gene regulatory region in teleost Channa argus.

    PubMed

    Jia, Weizhang; Zhou, Xiuxia

    2010-05-15

    The transcription factor STAT1 is involved in signal transduction of type I and II interferons (IFNs). However, the molecular characteristics of the STAT1 regulatory region still remain to be elucidated in teleosts. In the present study, the complete cDNA and the regulatory region of the STAT1 gene were isolated from snakehead (Channa argus). More than 2.4kb 5'-flanking region of STAT1 shares the regulatory elements of IFN-stimulated response element (ISRE) and IFN-gamma activation site (GAS). Consensus ISRE and GAS were located from -373 to -361 and -716 to -724 in the promoter region, respectively. Moreover, it is noticeable that the crucial elements of ISRE (+698 to +710) and GAS (+294 and +301) are present in the first intron of snakehead STAT1. Comparisons of six vertebrate STAT1 5'-flanking regions all present the common sequence characteristics of IFN-induced gene promoter, which include ISRE, GAS and Sp1 sites. In order to further characterize the snakehead STAT1 regulatory region, six reporter constructs of snakehead STAT1 promoter and first intron were generated to examine the specificity to human interferon-gamma (hIFN-gamma). Only those constructs containing the ISRE element showed notable reporter activity after stimulation of Hela cells with hIFN-gamma. However, sequential deletions of putative transcription factor binding sites indicated that GAS elements have little effect on the promoter and intronic activity in response to hIFN-gamma. Taken together, these results suggest that the regulatory mechanisms of IFN-signalling appear to be mediated in a similar manner in fish and mammals. Copyright 2009 Elsevier B.V. All rights reserved.

  1. LOESS correction for length variation in gene set-based genomic sequence analysis

    PubMed Central

    Aboukhalil, Anton; Bulyk, Martha L.

    2012-01-01

    Motivation: Sequence analysis algorithms are often applied to sets of DNA, RNA or protein sequences to identify common or distinguishing features. Controlling for sequence length variation is critical to properly score sequence features and identify true biological signals rather than length-dependent artifacts. Results: Several cis-regulatory module discovery algorithms exhibit a substantial dependence between DNA sequence score and sequence length. Our newly developed LOESS method is flexible in capturing diverse score-length relationships and is more effective in correcting DNA sequence scores for length-dependent artifacts, compared with four other approaches. Application of this method to genes co-expressed during Drosophila melanogaster embryonic mesoderm development or neural development scored by the Lever motif analysis algorithm resulted in successful recovery of their biologically validated cis-regulatory codes. The LOESS length-correction method is broadly applicable, and may be useful not only for more accurate inference of cis-regulatory codes, but also for detection of other types of patterns in biological sequences. Availability: Source code and compiled code are available from http://thebrain.bwh.harvard.edu/LM_LOESS/ Contact: mlbulyk@receptor.med.harvard.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22492312

  2. Gene regulatory effects of disease-associated variation in the NRF2 network.

    PubMed

    Lacher, Sarah E; Slattery, Matthew

    2016-12-01

    Reactive oxygen species (ROS), which are both a natural byproduct of oxidative metabolism and an undesirable byproduct of many environmental stressors, can damage all classes of cellular macromolecules and promote diseases from cancer to neurodegeneration. The actions of ROS are mitigated by the transcription factor NRF2, which regulates expression of antioxidant genes via its interaction with cis-regulatory antioxidant response elements (AREs). However, despite the seemingly straightforward relationship between the opposing forces of ROS and NRF2, regulatory precision in the NRF2 network is essential. Genetic variants that alter NRF2 stability or alter ARE sequences have been linked to a range of diseases. NRF2 hyperactivating mutations are associated with tumorigenesis. On the subtler end of the spectrum, single nucleotide variants (SNVs) that alter individual ARE sequences have been linked to neurodegenerative disorders including progressive supranuclear palsy and Parkinson's disease, as well as other diseases. Although the human health implications of NRF2 dysregulation have been recognized for some time, a systems level view of this regulatory network is beginning to highlight key NRF2-targeted AREs consistently associated with disease.

  3. Evolution of gene regulatory network architectures: examples of subcircuit conservation and plasticity between classes of echinoderms.

    PubMed

    Hinman, Veronica F; Yankura, Kristen A; McCauley, Brenna S

    2009-04-01

    Developmental gene regulatory networks (GRNs) explain how regulatory states are established in particular cells during development and how these states then determine the final form of the embryo. Evolutionary changes to the sequence of the genome will direct reorganization of GRN architectures, which in turn will lead to the alteration of developmental programs. A comparison of GRN architectures must consequently reveal the molecular basis for the evolution of developmental programs among different organisms. This review highlights some of the important findings that have emerged from the most extensive direct comparison of GRN architectures to date. Comparison of the orthologous GRNs for endomesodermal specification in the sea urchin and sea star, provides examples of several discrete, functional GRN subcircuits and shows that they are subject to diverse selective pressures. This demonstrates that different regulatory linkages may be more or less amenable to evolutionary change. One of the more surprising findings from this comparison is that GRN-level functions may be maintained while the factors performing the functions have changed, suggesting that GRNs have a high capacity for compensatory changes involving transcription factor binding to cis regulatory modules.

  4. Coupled enhancer and coding sequence evolution of a homeobox gene shaped leaf diversity

    PubMed Central

    Vuolo, Francesco; Mentink, Remco A.; Hajheidari, Mohsen; Bailey, C. Donovan; Filatov, Dmitry A.; Tsiantis, Miltos

    2016-01-01

    Here we investigate mechanisms underlying the diversification of biological forms using crucifer leaf shape as an example. We show that evolution of an enhancer element in the homeobox gene REDUCED COMPLEXITY (RCO) altered leaf shape by changing gene expression from the distal leaf blade to its base. A single amino acid substitution evolved together with this regulatory change, which reduced RCO protein stability, preventing pleiotropic effects caused by its altered gene expression. We detected hallmarks of positive selection in these evolved regulatory and coding sequence variants and showed that modulating RCO activity can improve plant physiological performance. Therefore, interplay between enhancer and coding sequence evolution created a potentially adaptive path for morphological evolution. PMID:27852629

  5. Implications of Developmental Gene Regulatory Networks Inside and Outside Developmental Biology.

    PubMed

    Peter, Isabelle S; Davidson, Eric H

    2016-01-01

    The insight that the genomic control of developmental process is encoded in the form of gene regulatory networks has profound impacts on many areas of modern bioscience. Most importantly, it affects developmental biology itself, as it means that a causal understanding of development requires knowledge of the architecture of regulatory network interactions. Furthermore, it follows that functional changes in developmental gene regulatory networks have to be considered as a primary mechanism for evolutionary process. We here discuss some of the recent advances in gene regulatory network biology and how they have affected our current understanding of development, evolution, and regulatory genomics.

  6. Enhancing gene regulatory network inference through data integration with markov random fields

    DOE PAGES

    Banf, Michael; Rhee, Seung Y.

    2017-02-01

    Here, a gene regulatory network links transcription factors to their target genes and represents a map of transcriptional regulation. Much progress has been made in deciphering gene regulatory networks computationally. However, gene regulatory network inference for most eukaryotic organisms remain challenging. To improve the accuracy of gene regulatory network inference and facilitate candidate selection for experimentation, we developed an algorithm called GRACE (Gene Regulatory network inference ACcuracy Enhancement). GRACE exploits biological a priori and heterogeneous data integration to generate high- confidence network predictions for eukaryotic organisms using Markov Random Fields in a semi-supervised fashion. GRACE uses a novel optimization schememore » to integrate regulatory evidence and biological relevance. It is particularly suited for model learning with sparse regulatory gold standard data. We show GRACE’s potential to produce high confidence regulatory networks compared to state of the art approaches using Drosophila melanogaster and Arabidopsis thaliana data. In an A. thaliana developmental gene regulatory network, GRACE recovers cell cycle related regulatory mechanisms and