Networking Senescence-Regulating Pathways by Using Arabidopsis Enhancer Trap Lines1

PubMed Central

He, Yuehui; Tang, Weining; Swain, Johnnie D.; Green, Anthony L.; Jack, Thomas P.; Gan, Susheng

2001-01-01

The last phase of leaf development, generally referred to as leaf senescence, is an integral part of plant development that involves massive programmed cell death. Due to a sharp decline of photosynthetic capacity in a leaf, senescence limits crop yield and forest plant biomass production. However, the biochemical components and regulatory mechanisms underlying leaf senescence are poorly characterized. Although several approaches such as differential cDNA screening, differential display, and cDNA subtraction have been employed to isolate senescence-associated genes (SAGs), only a limited number of SAGs have been identified, and information regarding the regulation of these genes is fragmentary. Here we report on the utilization of enhancer trap approach toward the identification and analysis of SAGs. We have developed a sensitive large-scale screening method and have screened 1,300 Arabidopsis enhancer trap lines and have identified 147 lines in which the reporter gene GUS (β-glucuronidase) is expressed in senescing leaves but not in non-senescing ones. We have systematically analyzed the regulation of β-glucuronidase expression in 125 lines (genetically, each contains single T-DNA insertion) by six senescence-promoting factors, namely abscisic acid, ethylene, jasmonic acid, brassinosteroid, darkness, and dehydration. This analysis not only reveals the complexity of the regulatory circuitry but also allows us to postulate the existence of a network of senescence-promoting pathways. We have also cloned three SAGs from randomly selected enhancer trap lines, demonstrating that reporter expression pattern reflects the expression pattern of the endogenous gene. PMID:11402199

Insertional Mutagenesis for Genes involved in Otic/Vestibular Development and Function in Xenopus Tropicalis

NASA Technical Reports Server (NTRS)

Torrejon, Marcela; Li, Erica; Nguyen, Minh; Winfree, Seth; Wang, Esther; Reinsch, Sigrid; Dalton, Bonnie (Technical Monitor)

2002-01-01

Sensitivity to gravity is essential for spatial orientation. Consequently, the gravity receptor system is one of the phylogenetically oldest sensory systems, and the special adaptations that enhance sensitivity to gravity are highly conserved. The main goal of this project is to use Xenopus (frog) to identify genes expressed during vestibular and auditory development. These studies will lead a better understanding of the molecular mechanisms involved in vestibular and auditory development and function. We are using a gene-trap approach in Xenopus tropicalis with the green fluorescent protein (GFP) gene as the transgene reporter. GFP expression occurs only when the GFP gene is correctly integrated in actively transcribed genes. Using the GFP as a tag we can easily identify and clone the mutated gene. In addition, we can study the function of the mutated gene by analyzing the defects generated by insertion of the GFP transgene. To date we have tissue specific GFP expression in X. tropicalis including expression in ear, neural tube, kidney, muscle, eyes and nose. Our transgenic animals will soon reach maturity so that we can outcross them and analyze their progeny. Our next goal is to isolate RNA from our transgenics and clone the tagged genes using RACE-PCR. Currently we are optimizing the RACE-PCR method using transgenics with crystallin GFP expression.

A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research

PubMed Central

Kockel, Lutz; Huq, Lutfi M.; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E. S.; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M.; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E.; Chisholm, Townley W.; Kim, Seung K.

2016-01-01

Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila. However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. PMID:27527793

A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research.

PubMed

Kockel, Lutz; Huq, Lutfi M; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E S; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E; Chisholm, Townley W; Kim, Seung K

2016-10-13

Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. Copyright © 2016 Kockel et al.

Genetic resources offer efficient tools for rice functional genomics research.

PubMed

Lo, Shuen-Fang; Fan, Ming-Jen; Hsing, Yue-Ie; Chen, Liang-Jwu; Chen, Shu; Wen, Ien-Chie; Liu, Yi-Lun; Chen, Ku-Ting; Jiang, Mirng-Jier; Lin, Ming-Kuang; Rao, Meng-Yen; Yu, Lin-Chih; Ho, Tuan-Hua David; Yu, Su-May

2016-05-01

Rice is an important crop and major model plant for monocot functional genomics studies. With the establishment of various genetic resources for rice genomics, the next challenge is to systematically assign functions to predicted genes in the rice genome. Compared with the robustness of genome sequencing and bioinformatics techniques, progress in understanding the function of rice genes has lagged, hampering the utilization of rice genes for cereal crop improvement. The use of transfer DNA (T-DNA) insertional mutagenesis offers the advantage of uniform distribution throughout the rice genome, but preferentially in gene-rich regions, resulting in direct gene knockout or activation of genes within 20-30 kb up- and downstream of the T-DNA insertion site and high gene tagging efficiency. Here, we summarize the recent progress in functional genomics using the T-DNA-tagged rice mutant population. We also discuss important features of T-DNA activation- and knockout-tagging and promoter-trapping of the rice genome in relation to mutant and candidate gene characterizations and how to more efficiently utilize rice mutant populations and datasets for high-throughput functional genomics and phenomics studies by forward and reverse genetics approaches. These studies may facilitate the translation of rice functional genomics research to improvements of rice and other cereal crops. © 2015 John Wiley & Sons Ltd.

Genome-based insights into the resistome and mobilome of multidrug-resistant Aeromonas sp. ARM81 isolated from wastewater.

PubMed

Adamczuk, Marcin; Dziewit, Lukasz

2017-01-01

The draft genome of multidrug-resistant Aeromonas sp. ARM81 isolated from a wastewater treatment plant in Warsaw (Poland) was obtained. Sequence analysis revealed multiple genes conferring resistance to aminoglycosides, β-lactams or tetracycline. Three different β-lactamase genes were identified, including an extended-spectrum β-lactamase gene bla PER-1 . The antibiotic susceptibility was experimentally tested. Genome sequencing also allowed us to investigate the plasmidome and transposable mobilome of ARM81. Four plasmids, of which two carry phenotypic modules (i.e., genes encoding a zinc transporter ZitB and a putative glucosyltransferase), and 28 putative transposase genes were identified. The mobility of three insertion sequences (isoforms of previously identified elements ISAs12, ISKpn9 and ISAs26) was confirmed using trap plasmids.

Endogenous Retroviruses: With Us and Against Us

NASA Astrophysics Data System (ADS)

Meyer, Thomas J.; Rosenkrantz, Jimi L.; Carbone, Lucia; Chavez, Shawn L.

2017-04-01

Mammalian genomes are scattered with thousands of copies of endogenous retroviruses (ERVs), mobile genetic elements that are relics of ancient retroviral infections. After inserting copies into the germ line of a host, most ERVs accumulate mutations that prevent the normal assembly of infectious viral particles, becoming trapped in host genomes and unable to leave to infect other cells. While most copies of ERVs are inactive, some are transcribed and encode the proteins needed to generate new insertions at novel loci. In some cases, old copies are removed via recombination and other mechanisms. This creates a shifting landscape of ERV copies within host genomes. New insertions can disrupt normal expression of nearby genes via directly inserting into key regulatory elements or by containing regulatory motifs within their sequences. Further, the transcriptional silencing of ERVs via epigenetic modification may result in changes to the epigenetic regulation of adjacent genes. In these ways, ERVs can be potent sources of regulatory disruption as well as genetic innovation. Here, we provide a brief review of the association between ERVs and gene expression, especially as observed in pre-implantation development and placentation. Moreover, we will describe the roles ERVs may play in somatic tissues, mostly in the context of human disease, including cancer, neurodegenerative disorders, and schizophrenia. Lastly, we discuss the recent discovery that some ERVs may have been pressed into the service of their host genomes to aid in the innate immune response to exogenous viral infections.

The expanding universe of transposon technologies for gene and cell engineering.

PubMed

Ivics, Zoltán; Izsvák, Zsuzsanna

2010-12-07

Transposable elements can be viewed as natural DNA transfer vehicles that, similar to integrating viruses, are capable of efficient genomic insertion. The mobility of class II transposable elements (DNA transposons) can be controlled by conditionally providing the transposase component of the transposition reaction. Thus, a DNA of interest (be it a fluorescent marker, a small hairpin (sh)RNA expression cassette, a mutagenic gene trap or a therapeutic gene construct) cloned between the inverted repeat sequences of a transposon-based vector can be used for stable genomic insertion in a regulated and highly efficient manner. This methodological paradigm opened up a number of avenues for genome manipulations in vertebrates, including transgenesis for the generation of transgenic cells in tissue culture, the production of germline transgenic animals for basic and applied research, forward genetic screens for functional gene annotation in model species, and therapy of genetic disorders in humans. Sleeping Beauty (SB) was the first transposon shown to be capable of gene transfer in vertebrate cells, and recent results confirm that SB supports a full spectrum of genetic engineering including transgenesis, insertional mutagenesis, and therapeutic somatic gene transfer both ex vivo and in vivo. The first clinical application of the SB system will help to validate both the safety and efficacy of this approach. In this review, we describe the major transposon systems currently available (with special emphasis on SB), discuss the various parameters and considerations pertinent to their experimental use, and highlight the state of the art in transposon technology in diverse genetic applications.

Controlled insertional mutagenesis using a LINE-1 (ORFeus) gene-trap mouse model.

PubMed

O'Donnell, Kathryn A; An, Wenfeng; Schrum, Christina T; Wheelan, Sarah J; Boeke, Jef D

2013-07-16

A codon-optimized mouse LINE-1 element, ORFeus, exhibits dramatically higher retrotransposition frequencies compared with its native long interspersed element 1 counterpart. To establish a retrotransposon-mediated mouse model with regulatable and potent mutagenic capabilities, we generated a tetracycline (tet)-regulated ORFeus element harboring a gene-trap cassette. Here, we show that mice expressing tet-ORFeus broadly exhibit robust retrotransposition in somatic tissues when treated with doxycycline. Consistent with a significant mutagenic burden, we observed a reduced number of double transgenic animals when treated with high-level doxycycline during embryogenesis. Transgene induction in skin resulted in a white spotting phenotype due to somatic ORFeus-mediated mutations that likely disrupt melanocyte development. The data suggest a high level of transposition in melanocyte precursors and consequent mutation of genes important for melanoblast proliferation, differentiation, or migration. These findings reveal the utility of a retrotransposon-based mutagenesis system as an alternative to existing DNA transposon systems. Moreover, breeding these mice to different tet-transactivator/reversible tet-transactivator lines supports broad functionality of tet-ORFeus because of the potential for dose-dependent, tissue-specific, and temporal-specific mutagenesis.

Trap seal for open circuit liquid cooled turbines

DOEpatents

Grondahl, Clayton M.; Germain, Malcolm R.

1980-01-01

An improved trap seal for open circuit liquid cooled turbines is disclosed. The trap seal of the present invention includes an annular recess formed in the supply conduit of cooling channels formed in the airfoil of the turbine buckets. A cylindrical insert is located in the annular recesses and has a plurality of axial grooves formed along the outer periphery thereof and a central recess formed in one end thereof. The axial grooves and central recess formed in the cylindrical insert cooperate with the annular recess to define a plurality of S-shaped trap seals which permit the passage of liquid coolant but prohibit passage of gaseous coolant.

Insulation of Enhancer-Promoter Communication by a Gypsy Transposon Insert in the Drosophila cut Gene: Cooperation between Suppressor of Hairy-wing and Modifier of mdg4 Proteins

PubMed Central

Gause, Maria; Morcillo, Patrick; Dorsett, Dale

2001-01-01

The Drosophila mod(mdg4) gene products counteract heterochromatin-mediated silencing of the white gene and help activate genes of the bithorax complex. They also regulate the insulator activity of the gypsy transposon when gypsy inserts between an enhancer and promoter. The Su(Hw) protein is required for gypsy-mediated insulation, and the Mod(mdg4)-67.2 protein binds to Su(Hw). The aim of this study was to determine whether Mod(mdg4)-67.2 is a coinsulator that helps Su(Hw) block enhancers or a facilitator of activation that is inhibited by Su(Hw). Here we provide evidence that Mod(mdg4)-67.2 acts as a coinsulator by showing that some loss-of-function mod(mdg4) mutations decrease enhancer blocking by a gypsy insert in the cut gene. We find that the C terminus of Mod(mdg4)-67.2 binds in vitro to a region of Su(Hw) that is required for insulation, while the N terminus mediates self-association. The N terminus of Mod(mdg4)-67.2 also interacts with the Chip protein, which facilitates activation of cut. Mod(mdg4)-67.2 truncated in the C terminus interferes in a dominant-negative fashion with insulation in cut but does not significantly affect heterochromatin-mediated silencing of white. We infer that multiple contacts between Su(Hw) and a Mod(mdg4)-67.2 multimer are required for insulation. We theorize that Mod(mdg4)-67.2 usually aids gene activation but can also act as a coinsulator by helping Su(Hw) trap facilitators of activation, such as the Chip protein. PMID:11416154

Single-cell optoporation and transfection using femtosecond laser and optical tweezers.

PubMed

Waleed, Muhammad; Hwang, Sun-Uk; Kim, Jung-Dae; Shabbir, Irfan; Shin, Sang-Mo; Lee, Yong-Gu

2013-01-01

In this paper, we demonstrate a new single-cell optoporation and transfection technique using a femtosecond Gaussian laser beam and optical tweezers. Tightly focused near-infrared (NIR) femtosecond laser pulse was employed to transiently perforate the cellular membrane at a single point in MCF-7 cancer cells. A distinct technique was developed by trapping the microparticle using optical tweezers to focus the femtosecond laser precisely on the cell membrane to puncture it. Subsequently, an external gene was introduced in the cell by trapping and inserting the same plasmid-coated microparticle into the optoporated cell using optical tweezers. Various experimental parameters such as femtosecond laser exposure power, exposure time, puncture hole size, exact focusing of the femtosecond laser on the cell membrane, and cell healing time were closely analyzed to create the optimal conditions for cell viability. Following the insertion of plasmid-coated microparticles in the cell, the targeted cells exhibited green fluorescent protein (GFP) under the fluorescent microscope, hence confirming successful transfection into the cell. This new optoporation and transfection technique maximizes the level of selectivity and control over the targeted cell, and this may be a breakthrough method through which to induce controllable genetic changes in the cell.

A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gong, Y.; Li, X.M.; Shapiro, L.J.

1994-09-01

Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand,more » and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.« less

Transposon tagging and the study of root development in Arabidopsis

NASA Technical Reports Server (NTRS)

Tsugeki, R.; Olson, M. L.; Fedoroff, N. V.

1998-01-01

The maize Ac-Ds transposable element family has been used as the basis of transposon mutagenesis systems that function in a variety of plants, including Arabidopsis. We have developed modified transposons and methods which simplify the detection, cloning and analysis of insertion mutations. We have identified and are analyzing two plant lines in which genes expressed either in the root cap cells or in the quiescent cells, cortex/endodermal initial cells and columella cells of the root cap have been tagged with a transposon carrying a reporter gene. A gene expressed in root cap cells tagged with an enhancer-trap Ds was isolated and its corresponding EST cDNA was identified. Nucleotide and deduced amino acid sequences of the gene show no significant similarity to other genes in the database. Genetic ablation experiments have been done by fusing a root cap-specific promoter to the diphtheria toxin A-chain gene and introducing the fusion construct into Arabidopsis plants. We find that in addition to eliminating gravitropism, root cap ablation inhibits elongation of roots by lowering root meristematic activities.

Formation of the spinal network in zebrafish determined by domain-specific Pax genes

PubMed Central

Ikenaga, Takanori; Urban, Jason M.; Gebhart, Nichole; Hatta, Kohei; Kawakami, Koichi; Ono, Fumihito

2012-01-01

In the formation of the spinal network, various transcription factors interact to develop specific cell types. Using a gene trap technique, we established a stable line of zebrafish in which the red fluorescent protein (RFP) was inserted in the pax8 gene. RFP insertion marked putative pax8-lineage cells with fluorescence and inhibited pax8 expression in homozygous embryos. Pax8 homozygous embryos displayed defects in the otic vesicle, as previously reported in studies using morpholinos. The pax8 homozygous embryos survived to adulthood in contrast to mammalian counterparts that die prematurely. RFP is expressed in the dorsal spinal cord. Examination of the axon morphology revealed that RFP (+) neurons include Commissural Bifurcating Longitudinal (CoBL) interneurons, but other inhibitory neurons such as Commissural Local (CoLo) interneurons and Circumferential Ascending (CiA) interneurons do not express RFP. We examined the effect of inhibiting pax2a/pax8 expression on interneuron development. In pax8 homozygous fish, the RFP (+) cells undergo differentiation similar to that of pax8 heterozygous fish, and the swimming behavior remained intact. In contrast, the RFP (+) cells of pax2a/pax8 double mutants displayed altered cell fates. CoBLs were not observed. Instead, RFP (+) cells exhibited axons descending ipsilaterally: a morphology resembling that of V2a/V2b interneurons. PMID:21452218

Formation of the spinal network in zebrafish determined by domain-specific pax genes.

PubMed

Ikenaga, Takanori; Urban, Jason M; Gebhart, Nichole; Hatta, Kohei; Kawakami, Koichi; Ono, Fumihito

2011-06-01

In the formation of the spinal network, various transcription factors interact to develop specific cell types. By using a gene trap technique, we established a stable line of zebrafish in which the red fluorescent protein (RFP) was inserted into the pax8 gene. RFP insertion marked putative pax8-lineage cells with fluorescence and inhibited pax8 expression in homozygous embryos. Pax8 homozygous embryos displayed defects in the otic vesicle, as previously reported in studies with morpholinos. The pax8 homozygous embryos survived to adulthood, in contrast to mammalian counterparts that die prematurely. RFP is expressed in the dorsal spinal cord. Examination of the axon morphology revealed that RFP(+) neurons include commissural bifurcating longitudinal (CoBL) interneurons, but other inhibitory neurons such as commissural local (CoLo) interneurons and circumferential ascending (CiA) interneurons do not express RFP. We examined the effect of inhibiting pax2a/pax8 expression on interneuron development. In pax8 homozygous fish, the RFP(+) cells underwent differentiation similar to that of pax8 heterozygous fish, and the swimming behavior remained intact. In contrast, the RFP(+) cells of pax2a/pax8 double mutants displayed altered cell fates. CoBLs were not observed. Instead, RFP(+) cells exhibited axons descending ipsilaterally, a morphology resembling that of V2a/V2b interneurons. Copyright © 2010 Wiley-Liss, Inc.

Identifying transposon insertions and their effects from RNA-sequencing data.

PubMed

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Identification of Cellular Proteins Required for Replication of Human Immunodeficiency Virus Type 1

PubMed Central

Dziuba, Natallia; Ferguson, Monique R.; O'Brien, William A.; Sanchez, Anthony; Prussia, Andrew J.; McDonald, Natalie J.; Friedrich, Brian M.; Li, Guangyu; Shaw, Michael W.; Sheng, Jinsong; Hodge, Thomas W.; Rubin, Donald H.

2012-01-01

Abstract Cellular proteins are essential for human immunodeficiency virus type 1 (HIV-1) replication and may serve as viable new targets for treating infection. Using gene trap insertional mutagenesis, a high-throughput approach based on random inactivation of cellular genes, candidate genes were found that limit virus replication when mutated. Disrupted genes (N=87) conferring resistance to lytic infection with several viruses were queried for an affect on HIV-1 replication by utilizing small interfering RNA (siRNA) screens in TZM-bl cells. Several genes regulating diverse pathways were found to be required for HIV-1 replication, including DHX8, DNAJA1, GTF2E1, GTF2E2, HAP1, KALRN, UBA3, UBE2E3, and VMP1. Candidate genes were independently tested in primary human macrophages, toxicity assays, and/or Tat-dependent β-galactosidase reporter assays. Bioinformatics analyses indicated that several host factors present in this study participate in canonical pathways and functional processes implicated in prior genome-wide studies. However, the genes presented in this study did not share identity with those found previously. Novel antiviral targets identified in this study should open new avenues for mechanistic investigation. PMID:22404213

Identification of cellular proteins required for replication of human immunodeficiency virus type 1.

PubMed

Dziuba, Natallia; Ferguson, Monique R; O'Brien, William A; Sanchez, Anthony; Prussia, Andrew J; McDonald, Natalie J; Friedrich, Brian M; Li, Guangyu; Shaw, Michael W; Sheng, Jinsong; Hodge, Thomas W; Rubin, Donald H; Murray, James L

2012-10-01

Cellular proteins are essential for human immunodeficiency virus type 1 (HIV-1) replication and may serve as viable new targets for treating infection. Using gene trap insertional mutagenesis, a high-throughput approach based on random inactivation of cellular genes, candidate genes were found that limit virus replication when mutated. Disrupted genes (N=87) conferring resistance to lytic infection with several viruses were queried for an affect on HIV-1 replication by utilizing small interfering RNA (siRNA) screens in TZM-bl cells. Several genes regulating diverse pathways were found to be required for HIV-1 replication, including DHX8, DNAJA1, GTF2E1, GTF2E2, HAP1, KALRN, UBA3, UBE2E3, and VMP1. Candidate genes were independently tested in primary human macrophages, toxicity assays, and/or Tat-dependent β-galactosidase reporter assays. Bioinformatics analyses indicated that several host factors present in this study participate in canonical pathways and functional processes implicated in prior genome-wide studies. However, the genes presented in this study did not share identity with those found previously. Novel antiviral targets identified in this study should open new avenues for mechanistic investigation.

The role of inserted polymers in polymeric insulation materials: insights from QM/MD simulations.

PubMed

Li, Chunyang; Zhao, Hong; Zhang, Hui; Wang, Ying; Wu, Zhijian; Han, Baozhong

2018-02-28

In this study, we performed a quantum chemical molecular dynamics (QM/MD) simulation to investigate the space charge accumulation process in copolymers of polyethylene (PE) with ethylene acrylic acid (EAA), ethylene vinyl acetate (EVA), styrene-ethylene-butadiene-styrene (SEBS), and black carbon (BC). We predicted that BC, especially branched BC, would possess the highest electron affinity and is identified as the most promising filler in power cable insulation. Following incorporations of 0-4 high-energy electrons into the composites, branched BC exhibited the highest stability and almost all electrons were trapped by it. Therefore, PE was protected efficiently and BC can be considered as an efficient filler for high voltage cables and an inhibitor of tree formation. On the contrary, although EAA, EVA, and SEBS can trap high-energy electrons, the latter can be supersaturated in composites of EAA, EVA, and SEBS with PE. The inserted polymers was unavoidably destroyed following C-H and C-O bond cleavage, which results from the interactions and charge transfer between PE and inserted polymers. The content effects of -COOH, benzene, and -OCOCH 3 groups on the electron trapping, mobility and stability of PE were also investigated systematically. We hope this knowledge gained from this work will be helpful in understanding the role of inserted polymers and the growth mechanisms of electrical treeing in high voltage cable insulation.

viking: identification and characterization of a second type IV collagen in Drosophila.

PubMed

Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

1997-10-01

We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

Motility and Flagellar Glycosylation in Clostridium difficile▿ †

PubMed Central

Twine, Susan M.; Reid, Christopher W.; Aubry, Annie; McMullin, David R.; Fulton, Kelly M.; Austin, John; Logan, Susan M.

2009-01-01

In this study, intact flagellin proteins were purified from strains of Clostridium difficile and analyzed using quadrupole time of flight and linear ion trap mass spectrometers. Top-down studies showed the flagellin proteins to have a mass greater than that predicted from the corresponding gene sequence. These top-down studies revealed marker ions characteristic of glycan modifications. Additionally, diversity in the observed masses of glycan modifications was seen between strains. Electron transfer dissociation mass spectrometry was used to demonstrate that the glycan was attached to the flagellin protein backbone in O linkage via a HexNAc residue in all strains examined. Bioinformatic analysis of C. difficile genomes revealed diversity with respect to glycan biosynthesis gene content within the flagellar biosynthesis locus, likely reflected by the observed flagellar glycan diversity. In C. difficile strain 630, insertional inactivation of a glycosyltransferase gene (CD0240) present in all sequenced genomes resulted in an inability to produce flagellar filaments at the cell surface and only minor amounts of unmodified flagellin protein. PMID:19749038

Mutagenesis of diploid mammalian genes by gene entrapment

PubMed Central

Lin, Qing; Donahue, Sarah L.; Moore-Jarrett, Tracy; Cao, Shang; Osipovich, Anna B.; Ruley, H. Earl

2006-01-01

The present study describes a genome-wide method for biallelic mutagenesis in mammalian cells. Novel poly(A) gene trap vectors, which contain features for direct cloning vector–cell fusion transcripts and for post-entrapment genome engineering, were used to generate a library of 979 mutant ES cells. The entrapment mutations generally disrupted gene expression and were readily transmitted through the germline, establishing the library as a resource for constructing mutant mice. Cells homozygous for most entrapment loci could be isolated by selecting for enhanced expression of an inserted neomycin-resistance gene that resulted from losses of heterozygosity (LOH). The frequencies of LOH measured at 37 sites in the genome ranged from 1.3 × 10−5 to 1.2 × 10−4 per cell and increased with increasing distance from the centromere, implicating mitotic recombination in the process. The ease and efficiency of obtaining homozygous mutations will (i) facilitate genetic studies of gene function in cultured cells, (ii) permit genome-wide studies of recombination events that result in LOH and mediate a type of chromosomal instability important in carcinogenesis, and (iii) provide new strategies for phenotype-driven mutagenesis screens in mammalian cells. PMID:17062627

Analysis of metal tolerance in Rhizobium leguminosarum strains isolated from an ultramafic soil.

PubMed

Rubio-Sanz, Laura; Brito, Belén; Palacios, Jose

2018-02-01

Natural habitats containing high amounts of heavy metals provide a valuable source of bacteria adapted to deal with metal toxicity. A functional analysis of the population of legume endosymbiotic bacteria in an ultramafic soil was undertaken by studying a collection of Rhizobium leguminosarum bv viciae (Rlv) isolates obtained using pea as trap plant. One of the isolates, Rlv UPM1137, was selected on the basis of its higher tolerance to nickel and cobalt and presence of inducible mechanisms for such tolerance. A random transposon mutagenesis of Rlv UPM1137 allowed the generation of 14 transposant derivatives with increased nickel sensitivity; five of these transposants were also more sensitive to cobalt. Sequencing of the insertion sites revealed that one of the transposants (D2250) was affected in a gene homologous to the cation diffusion facilitator gene dmeF first identified in the metal-resistant bacterium Cupriavidus metallidurans CH34. The symbiotic performance of D2250 and two other transposants bearing single transposon insertions was unaffected under high-metal conditions, suggesting that, in contrast to previous observations in other Rlv strain, metal tolerance in UPM1137 under symbiotic conditions might be supported by functional redundancy between several mechanisms. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

PubMed

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Characterization of the hrpZ gene from Pseudomonas syringae pv. maculicola M2.

PubMed

Álvarez-Mejía, César; Rodríguez-Ríos, Dalia; Hernández-Guzmán, Gustavo; López-Ramírez, Varinia; Valenzuela-Soto, Humberto; Marsch, Rodolfo

2015-01-01

Pseudomonas syringae pv. maculicola is a natural pathogen of members of the Brassicaceae plant family. Using a transposon-based mutagenesis strategy in Pseudomonas syringaepv. maculicola M2 (PsmM2), we conducted a genetic screen to identify mutants that were capable of growing in M9 medium supplemented with a crude extract from the leaves of Arabidopsis thaliana. A mutant containing a transposon insertion in the hrpZ gene (PsmMut8) was unable to infect adult plants from Arabidopsis thaliana or Brassica oleracea, suggesting a loss of pathogenicity. The promotorless cat reporter present in the gene trap was expressed if PsmMut8 was grown in minimal medium (M9) supplemented with the leaf extract but not if grown in normal rich medium (KB). We conducted phylogenetic analysis using hrpAZB genes, showing the classical 5-clade distribution, and nucleotide diversity analysis, showing the putative position for selective pressure in this operon. Our results indicate that the hrpAZB operon from Pseudomonas syringaepv. maculicola M2 is necessary for its pathogenicity and that its diversity would be under host-mediated diversifying selection.

Characterization of the hrpZ gene from Pseudomonas syringae pv. maculicolaM2

PubMed Central

Álvarez-Mejía, César; Rodríguez-Ríos, Dalia; Hernández-Guzmán, Gustavo; López-Ramírez, Varinia; Valenzuela-Soto, Humberto; Marsch, Rodolfo

2015-01-01

Pseudomonas syringae pv. maculicola is a natural pathogen of members of the Brassicaceae plant family. Using a transposon-based mutagenesis strategy in Pseudomonas syringaepv. maculicola M2 (PsmM2), we conducted a genetic screen to identify mutants that were capable of growing in M9 medium supplemented with a crude extract from the leaves of Arabidopsis thaliana. A mutant containing a transposon insertion in the hrpZ gene (PsmMut8) was unable to infect adult plants from Arabidopsis thaliana or Brassica oleracea, suggesting a loss of pathogenicity. The promotorless cat reporter present in the gene trap was expressed if PsmMut8 was grown in minimal medium (M9) supplemented with the leaf extract but not if grown in normal rich medium (KB). We conducted phylogenetic analysis using hrpAZB genes, showing the classical 5-clade distribution, and nucleotide diversity analysis, showing the putative position for selective pressure in this operon. Our results indicate that the hrpAZB operon from Pseudomonas syringaepv. maculicola M2 is necessary for its pathogenicity and that its diversity would be under host-mediated diversifying selection. PMID:26413080

Interactions of a Charged Nanoparticle with a Lipid Membrane: Implications for Gene Delivery

PubMed Central

Ting, Christina L.; Wang, Zhen-Gang

2011-01-01

We employ self-consistent field theory to study the thermodynamics of membrane-particle interactions in the context of gene delivery systems, with the aim to guide the design of dendrimers that can overcome the endosomal escape barrier by inserting into membranes and creating pores. We consider the interaction between a model polyamidoamine dendrimer and a membrane under controlled tension as a function of the separation between the dendrimer and the membrane. In all the cases we have studied, the lowest free energy state corresponds to the membrane partially wrapping the dendrimer. However, with moderate tension, we find that a G5 (or larger) generation dendrimer, through thermal fluctuation, can induce the formation of metastable pores. These metastable pores are subsequently shown to significantly lower the critical tension necessary for membrane rupture, thus possibly enhancing the release of the trapped genetic material from the endosome. PMID:21354402

Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ε-Toxin

PubMed Central

Ivie, Susan E.; Fennessey, Christine M.; Sheng, Jinsong; Rubin, Donald H.; McClain, Mark S.

2011-01-01

The Clostridium perfringens ε-toxin is an extremely potent toxin associated with lethal toxemias in domesticated ruminants and may be toxic to humans. Intoxication results in fluid accumulation in various tissues, most notably in the brain and kidneys. Previous studies suggest that the toxin is a pore-forming toxin, leading to dysregulated ion homeostasis and ultimately cell death. However, mammalian host factors that likely contribute to ε-toxin-induced cytotoxicity are poorly understood. A library of insertional mutant Madin Darby canine kidney (MDCK) cells, which are highly susceptible to the lethal affects of ε-toxin, was used to select clones of cells resistant to ε-toxin-induced cytotoxicity. The genes mutated in 9 surviving resistant cell clones were identified. We focused additional experiments on one of the identified genes as a means of validating the experimental approach. Gene expression microarray analysis revealed that one of the identified genes, hepatitis A virus cellular receptor 1 (HAVCR1, KIM-1, TIM1), is more abundantly expressed in human kidney cell lines than it is expressed in human cells known to be resistant to ε-toxin. One human kidney cell line, ACHN, was found to be sensitive to the toxin and expresses a larger isoform of the HAVCR1 protein than the HAVCR1 protein expressed by other, toxin-resistant human kidney cell lines. RNA interference studies in MDCK and in ACHN cells confirmed that HAVCR1 contributes to ε-toxin-induced cytotoxicity. Additionally, ε-toxin was shown to bind to HAVCR1 in vitro. The results of this study indicate that HAVCR1 and the other genes identified through the use of gene-trap mutagenesis and RNA interference strategies represent important targets for investigation of the process by which ε-toxin induces cell death and new targets for potential therapeutic intervention. PMID:21412435

Gene-trap mutagenesis identifies mammalian genes contributing to intoxication by Clostridium perfringens ε-toxin.

PubMed

Ivie, Susan E; Fennessey, Christine M; Sheng, Jinsong; Rubin, Donald H; McClain, Mark S

2011-03-11

The Clostridium perfringens ε-toxin is an extremely potent toxin associated with lethal toxemias in domesticated ruminants and may be toxic to humans. Intoxication results in fluid accumulation in various tissues, most notably in the brain and kidneys. Previous studies suggest that the toxin is a pore-forming toxin, leading to dysregulated ion homeostasis and ultimately cell death. However, mammalian host factors that likely contribute to ε-toxin-induced cytotoxicity are poorly understood. A library of insertional mutant Madin Darby canine kidney (MDCK) cells, which are highly susceptible to the lethal affects of ε-toxin, was used to select clones of cells resistant to ε-toxin-induced cytotoxicity. The genes mutated in 9 surviving resistant cell clones were identified. We focused additional experiments on one of the identified genes as a means of validating the experimental approach. Gene expression microarray analysis revealed that one of the identified genes, hepatitis A virus cellular receptor 1 (HAVCR1, KIM-1, TIM1), is more abundantly expressed in human kidney cell lines than it is expressed in human cells known to be resistant to ε-toxin. One human kidney cell line, ACHN, was found to be sensitive to the toxin and expresses a larger isoform of the HAVCR1 protein than the HAVCR1 protein expressed by other, toxin-resistant human kidney cell lines. RNA interference studies in MDCK and in ACHN cells confirmed that HAVCR1 contributes to ε-toxin-induced cytotoxicity. Additionally, ε-toxin was shown to bind to HAVCR1 in vitro. The results of this study indicate that HAVCR1 and the other genes identified through the use of gene-trap mutagenesis and RNA interference strategies represent important targets for investigation of the process by which ε-toxin induces cell death and new targets for potential therapeutic intervention.

Crosstalk elimination in the detection of dual-beam optical tweezers by spatial filtering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ott, Dino; Oddershede, Lene B., E-mail: oddershede@nbi.dk; Reihani, S. Nader S.

2014-05-15

In dual-beam optical tweezers, the accuracy of position and force measurements is often compromised by crosstalk between the two detected signals, this crosstalk leading to systematic and significant errors on the measured forces and distances. This is true both for dual-beam optical traps where the splitting of the two traps is done by polarization optics and for dual optical traps constructed by other methods, e.g., holographic tweezers. If the two traps are orthogonally polarized, most often crosstalk is minimized by inserting polarization optics in front of the detector; however, this method is not perfect because of the de-polarization of themore » trapping beam introduced by the required high numerical aperture optics. Here we present a simple and easy-to-implement method to efficiently eliminate crosstalk. The method is based on spatial filtering by simply inserting a pinhole at the correct position and is highly compatible with standard back focal plane photodiode based detection of position and force. Our spatial filtering method reduces crosstalk up to five times better than polarization filtering alone. The effectiveness is dependent on pinhole size and distance between the traps and is here quantified experimentally and reproduced by theoretical modeling. The method here proposed will improve the accuracy of force-distance measurements, e.g., of single molecules, performed by dual-beam optical traps and hence give much more scientific value for the experimental efforts.« less

A versatile strategy for gene trapping and trap conversion in emerging model organisms.

PubMed

Kontarakis, Zacharias; Pavlopoulos, Anastasios; Kiupakis, Alexandros; Konstantinides, Nikolaos; Douris, Vassilis; Averof, Michalis

2011-06-01

Genetic model organisms such as Drosophila, C. elegans and the mouse provide formidable tools for studying mechanisms of development, physiology and behaviour. Established models alone, however, allow us to survey only a tiny fraction of the morphological and functional diversity present in the animal kingdom. Here, we present iTRAC, a versatile gene-trapping approach that combines the implementation of unbiased genetic screens with the generation of sophisticated genetic tools both in established and emerging model organisms. The approach utilises an exon-trapping transposon vector that carries an integrase docking site, allowing the targeted integration of new constructs into trapped loci. We provide proof of principle for iTRAC in the emerging model crustacean Parhyale hawaiensis: we generate traps that allow specific developmental and physiological processes to be visualised in unparalleled detail, we show that trapped genes can be easily cloned from an unsequenced genome, and we demonstrate targeting of new constructs into a trapped locus. Using this approach, gene traps can serve as platforms for generating diverse reporters, drivers for tissue-specific expression, gene knockdown and other genetic tools not yet imagined.

Single-step generation of gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9.

PubMed

Matsunaga, Taichi; Yamashita, Jun K

2014-02-07

Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.

Conditional transgenic mouse models: from the basics to genome-wide sets of knockouts and current studies of tissue regeneration.

PubMed

Bockamp, Ernesto; Sprengel, Rolf; Eshkind, Leonid; Lehmann, Thomas; Braun, Jan M; Emmrich, Frank; Hengstler, Jan G

2008-03-01

Many mouse models are currently available, providing avenues to elucidate gene function and to recapitulate specific pathological conditions. To a large extent, successful translation of clinical evidence or analytical data into appropriate mouse models is possible through progress in transgenic or gene-targeting technology. Beginning with a review of standard mouse transgenics and conventional gene targeting, this article will move on to discussing the basics of conditional gene expression: the tetracycline (tet)-off and tet-on systems based on the transactivators tet-controlled transactivator (Tta) and reverse tet-on transactivator (rtTA) that allow downregulation or induction of gene expression; Cre or Flp recombinase-mediated modifications, including excision, inversion, insertion and interchromosomal translocation; combination of the tet and Cre systems, permitting inducible knockout, reporter gene activation or activation of point mutations; the avian retroviral system based on delivery of rtTA specifically into cells expressing the avian retroviral receptor, which enables cell type-specific, inducible gene expression; the tamoxifen system, one of the most frequently applied steroid receptor-based systems, allows rapid activation of a fusion protein between the gene of interest and a mutant domain of the estrogen receptor, whereby activation does not depend on transcription; and techniques for cell type-specific ablation. The diphtheria toxin receptor system offers the advantage that it can be combined with the 'zoo' of Cre recombinase driver mice. Having described the basics we move on to the cutting edge: generation of genome-wide sets of conditional knockout mice. To this end, large ongoing projects apply two strategies: gene trapping based on random integration of trapping vectors into introns leading to truncation of the transcript, and gene targeting, representing the directed approach using homologous recombination. It can be expected that in the near future genome-wide sets of such mice will be available. Finally, the possibilities of conditional expression systems for investigating gene function in tissue regeneration will be illustrated by examples for neurodegenerative disease, liver regeneration and wound healing of the skin.

P and M gene junction is the optimal insertion site in Newcastle disease virus vaccine vector for foreign gene expression

USDA-ARS?s Scientific Manuscript database

Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...

Identification of multiple sites suitable for insertion of foreign genes in herpes simplex virus genomes.

PubMed

Morimoto, Tomomi; Arii, Jun; Akashi, Hiroomi; Kawaguchi, Yasushi

2009-03-01

Information on sites in HSV genomes at which foreign gene(s) can be inserted without disrupting viral genes or affecting properties of the parental virus are important for basic research on HSV and development of HSV-based vectors for human therapy. The intergenic region between HSV-1 UL3 and UL4 genes has been reported to satisfy the requirements for such an insertion site. The UL3 and UL4 genes are oriented toward the intergenic region and, therefore, insertion of a foreign gene(s) into the region between the UL3 and UL4 polyadenylation signals should not disrupt any viral genes or transcriptional units. HSV-1 and HSV-2 each have more than 10 additional regions structurally similar to the intergenic region between UL3 and UL4. In the studies reported here, it has been demonstrated that insertion of a reporter gene expression cassette into several of the HSV-1 and HSV-2 intergenic regions has no effect on viral growth in cell culture or virulence in mice, suggesting that these multiple intergenic regions may be suitable HSV sites for insertion of foreign genes.

Assembly of microparticles by optical trapping with a photonic crystal nanocavity

NASA Astrophysics Data System (ADS)

Renaut, C.; Dellinger, J.; Cluzel, B.; Honegger, T.; Peyrade, D.; Picard, E.; de Fornel, F.; Hadji, E.

2012-03-01

In this work, we report the auto-assembly experiments of micrometer sized particles by optical trapping in the evanescent field of a photonic crystal nanocavity. The nanocavity is inserted inside an optofluidic cell designed to enable the real time control of the nanoresonator transmittance as well as the real time visualization of the particles motion in the vicinity of the nanocavity. It is demonstrated that the optical trap above the cavity enables the assembly of multiple particles in respect of different stable conformations.

Eliminating degradation and uncovering ion-trapping dynamics in electrochromic WO3 thin films

PubMed Central

Wen, Rui-Tao; Granqvist, Claes G.; Niklasson, Gunnar A.

2015-01-01

Amorphous WO3 thin films are of keen interest as cathodic electrodes in transmittance-modulating electrochromic devices. However, these films suffer from ion-trapping-induced degradation of optical modulation and reversibility upon extended Li+-ion exchange. Here, we demonstrate that ion-trapping-induced degradation, which is commonly believed to be irreversible, can be successfully eliminated by constant-current-driven de-trapping, i.e., WO3 films can be rejuvenated and regain their initial highly reversible electrochromic performance. Pronounced ion-trapping occurs when x exceeds ~0.65 in LixWO3 during ion insertion. We find two main kinds of Li+-ion trapping sites (intermediate and deep) in WO3, where the intermediate ones are most prevalent. Li+-ions can be completely removed from intermediate traps but are irreversibly bound in deep traps. Our results provide a general framework for developing and designing superior electrochromic materials and devices. PMID:26259104

Nonoverlapping functions for Notch1 and Notch3 during murine steady-state thymic lymphopoiesis

PubMed Central

Shi, Jianjun; Fallahi, Mohammad; Luo, Jun-Li

2011-01-01

Notch1 signaling is absolutely essential for steady-state thymic lymphopoiesis, but the role of other Notch receptors, and their potential overlap with the function of Notch1, remains unclear. Here we show that like Notch1, Notch3 is differentially expressed by progenitor thymocytes, peaking at the DN3 progenitor stage. Using mice carrying a gene-trapped allele, we show that thymic cellularity is slightly reduced in the absence of Notch3, although progression through the defined sequence of TCR-αβ development is normal, as are NKT and TCRγδ cell production. The absence of a profound effect from Notch3 deletion is not explained by residual function of the gene-trapped allele because insertion mapping suggests that the targeted allele would not encode functional signaling domains. We also show that although Notch1 and Notch3 are coexpressed on some early intrathymic progenitors, the relatively mild phenotype seen after Notch3 deletion does not result from the compensatory function of Notch1, nor does Notch3 function explain the likewise mild phenotype seen after conditional (intrathymic) deletion of Notch1. Our studies indicate that Notch1 and Notch3 carry out nonoverlapping functions during thymocyte differentiation, and that while Notch1 is absolutely required early in the lymphopoietic process, neither receptor is essential at later stages. PMID:21768299

Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection.

PubMed

Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka

2015-06-30

Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

PubMed

Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

2016-09-12

Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

Vertically aligned gas-insulated transmission line having particle traps at the inner conductor

DOEpatents

Dale, Steinar J.

1984-01-01

Gas insulated electrical apparatus having first and second conductors separated by an insulating support within an insulating gas environment, and particle traps disposed along the surface of the high potential conductor for trapping and inactivating foreign particles which may be present within the insulating gas medium. Several embodiments of the invention were developed which are particularly suited for vertically aligned gas insulated transmission lines. The particle traps are grooves or cavities formed into the walls of the tubular inner conductor, without extending into the hollow portion of the conductor. In other embodiments, the traps are appendages or insert flanges extending from the inner conductor, with the insulator supports contacting the appendages instead of the inner conductor.

Genomic mechanisms accounting for the adaptation to parasitism in nematode-trapping fungi.

PubMed

Meerupati, Tejashwari; Andersson, Karl-Magnus; Friman, Eva; Kumar, Dharmendra; Tunlid, Anders; Ahrén, Dag

2013-11-01

Orbiliomycetes is one of the earliest diverging branches of the filamentous ascomycetes. The class contains nematode-trapping fungi that form unique infection structures, called traps, to capture and kill free-living nematodes. The traps have evolved differently along several lineages and include adhesive traps (knobs, nets or branches) and constricting rings. We show, by genome sequencing of the knob-forming species Monacrosporium haptotylum and comparison with the net-forming species Arthrobotrys oligospora, that two genomic mechanisms are likely to have been important for the adaptation to parasitism in these fungi. Firstly, the expansion of protein domain families and the large number of species-specific genes indicated that gene duplication followed by functional diversification had a major role in the evolution of the nematode-trapping fungi. Gene expression indicated that many of these genes are important for pathogenicity. Secondly, gene expression of orthologs between the two fungi during infection indicated that differential regulation was an important mechanism for the evolution of parasitism in nematode-trapping fungi. Many of the highly expressed and highly upregulated M. haptotylum transcripts during the early stages of nematode infection were species-specific and encoded small secreted proteins (SSPs) that were affected by repeat-induced point mutations (RIP). An active RIP mechanism was revealed by lack of repeats, dinucleotide bias in repeats and genes, low proportion of recent gene duplicates, and reduction of recent gene family expansions. The high expression and rapid divergence of SSPs indicate a striking similarity in the infection mechanisms of nematode-trapping fungi and plant and insect pathogens from the crown groups of the filamentous ascomycetes (Pezizomycotina). The patterns of gene family expansions in the nematode-trapping fungi were more similar to plant pathogens than to insect and animal pathogens. The observation of RIP activity in the Orbiliomycetes suggested that this mechanism was present early in the evolution of the filamentous ascomycetes.

Genomic Mechanisms Accounting for the Adaptation to Parasitism in Nematode-Trapping Fungi

PubMed Central

Meerupati, Tejashwari; Andersson, Karl-Magnus; Friman, Eva; Kumar, Dharmendra; Tunlid, Anders; Ahrén, Dag

2013-01-01

Orbiliomycetes is one of the earliest diverging branches of the filamentous ascomycetes. The class contains nematode-trapping fungi that form unique infection structures, called traps, to capture and kill free-living nematodes. The traps have evolved differently along several lineages and include adhesive traps (knobs, nets or branches) and constricting rings. We show, by genome sequencing of the knob-forming species Monacrosporium haptotylum and comparison with the net-forming species Arthrobotrys oligospora, that two genomic mechanisms are likely to have been important for the adaptation to parasitism in these fungi. Firstly, the expansion of protein domain families and the large number of species-specific genes indicated that gene duplication followed by functional diversification had a major role in the evolution of the nematode-trapping fungi. Gene expression indicated that many of these genes are important for pathogenicity. Secondly, gene expression of orthologs between the two fungi during infection indicated that differential regulation was an important mechanism for the evolution of parasitism in nematode-trapping fungi. Many of the highly expressed and highly upregulated M. haptotylum transcripts during the early stages of nematode infection were species-specific and encoded small secreted proteins (SSPs) that were affected by repeat-induced point mutations (RIP). An active RIP mechanism was revealed by lack of repeats, dinucleotide bias in repeats and genes, low proportion of recent gene duplicates, and reduction of recent gene family expansions. The high expression and rapid divergence of SSPs indicate a striking similarity in the infection mechanisms of nematode-trapping fungi and plant and insect pathogens from the crown groups of the filamentous ascomycetes (Pezizomycotina). The patterns of gene family expansions in the nematode-trapping fungi were more similar to plant pathogens than to insect and animal pathogens. The observation of RIP activity in the Orbiliomycetes suggested that this mechanism was present early in the evolution of the filamentous ascomycetes. PMID:24244185

A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

PubMed

White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

2018-03-28

A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

RNA-Seq reveals the molecular mechanism of trapping and killing of root-knot nematodes by nematode-trapping fungi.

PubMed

Pandit, Ramesh; Patel, Reena; Patel, Namrata; Bhatt, Vaibhav; Joshi, Chaitanya; Singh, Pawan Kumar; Kunjadia, Anju

2017-04-01

Nematode-trapping fungi are well known for their inherent potential to trap and kill nematodes using specialized trapping devices. However, the molecular mechanisms underlying the trapping and subsequent processes are still unclear. Therefore, in this study, we examined differential genes expression in two nematode-trapping fungi after baiting with nematode extracts. In Arthrobotrys conoides, 809 transcripts associated with diverse functions such as signal transduction, morphogenesis, stress response and peroxisomal proteins, proteases, chitinases and genes involved in the host-pathogen interaction showed differential expression with fold change (>±1.5 fold) in the presence of nematode extract with FDR (p-value < 0.001). G-proteins and mitogen activated protein kinases are considered crucial for signal transduction mechanism. Results of qRT-PCR of 20 genes further validated the sequencing data. Further, variations in gene expression among Duddingtonia flagrans and A. conoides showed septicity of nematode-trapping fungi for its host. The findings illustrate the molecular mechanism of fungal parasitism in A. conoides which may be helpful in developing a potential biocontrol agent against parasitic nematodes.

Filter vapor trap

DOEpatents

Guon, Jerold

1976-04-13

A sintered filter trap is adapted for insertion in a gas stream of sodium vapor to condense and deposit sodium thereon. The filter is heated and operated above the melting temperature of sodium, resulting in a more efficient means to remove sodium particulates from the effluent inert gas emanating from the surface of a liquid sodium pool. Preferably the filter leaves are precoated with a natrophobic coating such as tetracosane.

Ty1-copia elements reveal diverse insertion sites linked to polymorphisms among flax (Linum usitatissimum L.) accessions.

PubMed

Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K

2016-12-07

Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.

The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

PubMed

Fleckenstein, E C; Dirks, W G; Drexler, H G

2000-02-01

The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

Evaluation of the efficacy of ChAd63-MVA vectored vaccines expressing circumsporozoite protein and ME-TRAP against controlled human malaria infection in malaria-naive individuals.

PubMed

Hodgson, Susanne H; Ewer, Katie J; Bliss, Carly M; Edwards, Nick J; Rampling, Thomas; Anagnostou, Nicholas A; de Barra, Eoghan; Havelock, Tom; Bowyer, Georgina; Poulton, Ian D; de Cassan, Simone; Longley, Rhea; Illingworth, Joseph J; Douglas, Alexander D; Mange, Pooja B; Collins, Katharine A; Roberts, Rachel; Gerry, Stephen; Berrie, Eleanor; Moyle, Sarah; Colloca, Stefano; Cortese, Riccardo; Sinden, Robert E; Gilbert, Sarah C; Bejon, Philip; Lawrie, Alison M; Nicosia, Alfredo; Faust, Saul N; Hill, Adrian V S

2015-04-01

Circumsporozoite protein (CS) is the antigenic target for RTS,S, the most advanced malaria vaccine to date. Heterologous prime-boost with the viral vectors simian adenovirus 63 (ChAd63)-modified vaccinia virus Ankara (MVA) is the most potent inducer of T-cells in humans, demonstrating significant efficacy when expressing the preerythrocytic antigen insert multiple epitope-thrombospondin-related adhesion protein (ME-TRAP). We hypothesized that ChAd63-MVA containing CS may result in a significant clinical protective efficacy. We conducted an open-label, 2-site, partially randomized Plasmodium falciparum sporozoite controlled human malaria infection (CHMI) study to compare the clinical efficacy of ChAd63-MVA CS with ChAd63-MVA ME-TRAP. One of 15 vaccinees (7%) receiving ChAd63-MVA CS and 2 of 15 (13%) receiving ChAd63-MVA ME-TRAP achieved sterile protection after CHMI. Three of 15 vaccinees (20%) receiving ChAd63-MVA CS and 5 of 15 (33%) receiving ChAd63-MVA ME-TRAP demonstrated a delay in time to treatment, compared with unvaccinated controls. In quantitative polymerase chain reaction analyses, ChAd63-MVA CS was estimated to reduce the liver parasite burden by 69%-79%, compared with 79%-84% for ChAd63-MVA ME-TRAP. ChAd63-MVA CS does reduce the liver parasite burden, but ChAd63-MVA ME-TRAP remains the most promising antigenic insert for a vectored liver-stage vaccine. Detailed analyses of parasite kinetics may allow detection of smaller but biologically important differences in vaccine efficacy that can influence future vaccine development. NCT01623557. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Cloning, expression, and purification of a new antimicrobial peptide gene from Musca domestica larva.

PubMed

Pei, Zhihua; Sun, Xiaoning; Tang, Yan; Wang, Kai; Gao, Yunhang; Ma, Hongxia

2014-10-01

Musca domestica (Diptera: Muscidae), the housefly, exhibits unique immune defences and can produce antimicrobial peptides upon stimulation with bacteria. Based on the cDNA library constructed using the suppression subtractive hybridization (SSH) method, a 198-bp antimicrobial peptide gene, which we named MDAP-2, was amplified by rapid amplification of cDNA ends (RACE) from M. domestica larvae stimulated with Salmonella pullorum (Enterobacteriaceae: Salmonella). In the present study, the full-length MDAP-2 gene was cloned and inserted into a His-tagged Escherichia coli prokaryotic expression system to enable production of the recombinant peptide. The recombinant MDAP-2 peptide was purified using Ni-NTA HisTrap FF crude column chromatography. The bacteriostatic activity of the recombinant purified MDAP-2 protein was assessed. The results indicated that MDAP-2 had in vitro antibacterial activity against all of the tested Gram- bacteria from clinical isolates, including E. coli (Enterobacteriaceae: Escherichia), one strain of S. pullorum (Enterobacteriaceae: Salmonella), and one strain of Pasteurella multocida. DNA sequencing and BLAST analysis showed that the MDAP-2 antimicrobial peptide gene was not homologous to any other antimicrobial peptide genes in GenBank. The antibacterial mechanisms of the newly discovered MDAP-2 peptide warrant further study. Copyright © 2014 Elsevier B.V. All rights reserved.

Isolation and expression of scabrous, a gene regulating neurogenesis in Drosophila.

PubMed

Mlodzik, M; Baker, N E; Rubin, G M

1990-11-01

Mutations in the Drosophila scabrous (sca) gene affect eye and bristle development, leading to irregular spacing of ommatidia and bristle duplications in the adult fly. We have cloned the sca gene by P-element tagging. The sca transcription unit is 12 kb and consists of four exons that are joined in a 3.2-kb mRNA. In an enhancer trap screen we have isolated several P[lacZ] insertions close to the sca transcription start site. We have examined the expression pattern of sca by in situ hybridization to sca transcripts, by beta-galactosidase localization in the P[lacZ] lines, and by immunocytochemistry with an anti-sca antiserum. During embryogenesis, sca is expressed in a dynamic pattern associated with neural development. During imaginal development, sca is mainly expressed in the R8 photoreceptor precursor cells in the eye imaginal disc and in sensory organ precursor cells in other discs. In the wing disc, sca expression is coextensive with the anlagen for bristles and is controlled by genes of the achaete-scute complex. Based on its loss-of-function phenotype, expression pattern, and the predicted structure of its product, a secreted peptide with homology to the fibrinogen gene family, we propose that sca encodes a signal involved in lateral inhibition within individual domains of the developing nervous system.

Cancer gene discovery: exploiting insertional mutagenesis

PubMed Central

Ranzani, Marco; Annunziato, Stefano; Adams, David J.; Montini, Eugenio

2013-01-01

Insertional mutagenesis has been utilized as a functional forward genetics screen for the identification of novel genes involved in the pathogenesis of human cancers. Different insertional mutagens have been successfully used to reveal new cancer genes. For example, retroviruses (RVs) are integrating viruses with the capacity to induce the deregulation of genes in the neighborhood of the insertion site. RVs have been employed for more than 30 years to identify cancer genes in the hematopoietic system and mammary gland. Similarly, another tool that has revolutionized cancer gene discovery is the cut-and-paste transposons. These DNA elements have been engineered to contain strong promoters and stop cassettes that may function to perturb gene expression upon integration proximal to genes. In addition, complex mouse models characterized by tissue-restricted activity of transposons have been developed to identify oncogenes and tumor suppressor genes that control the development of a wide range of solid tumor types, extending beyond those tissues accessible using RV-based approaches. Most recently, lentiviral vectors (LVs) have appeared on the scene for use in cancer gene screens. LVs are replication defective integrating vectors that have the advantage of being able to infect non-dividing cells, in a wide range of cell types and tissues. In this review, we describe the various insertional mutagens focusing on their advantages/limitations and we discuss the new and promising tools that will improve the insertional mutagenesis screens of the future. PMID:23928056

Genomic and Proteomic Analyses of the Fungus Arthrobotrys oligospora Provide Insights into Nematode-Trap Formation

PubMed Central

Feng, Yun; Li, Xiaomin; Zou, Chenggang; Xu, Jianping; Ren, Yan; Mi, Qili; Wu, Junli; Liu, Shuqun; Liu, Yu; Huang, Xiaowei; Wang, Haiyan; Niu, Xuemei; Li, Juan; Liang, Lianming; Luo, Yanlu; Ji, Kaifang; Zhou, Wei; Yu, Zefen; Li, Guohong; Liu, Yajun; Li, Lei; Qiao, Min; Feng, Lu; Zhang, Ke-Qin

2011-01-01

Nematode-trapping fungi are “carnivorous” and attack their hosts using specialized trapping devices. The morphological development of these traps is the key indicator of their switch from saprophytic to predacious lifestyles. Here, the genome of the nematode-trapping fungus Arthrobotrys oligospora Fres. (ATCC24927) was reported. The genome contains 40.07 Mb assembled sequence with 11,479 predicted genes. Comparative analysis showed that A. oligospora shared many more genes with pathogenic fungi than with non-pathogenic fungi. Specifically, compared to several sequenced ascomycete fungi, the A. oligospora genome has a larger number of pathogenicity-related genes in the subtilisin, cellulase, cellobiohydrolase, and pectinesterase gene families. Searching against the pathogen-host interaction gene database identified 398 homologous genes involved in pathogenicity in other fungi. The analysis of repetitive sequences provided evidence for repeat-induced point mutations in A. oligospora. Proteomic and quantitative PCR (qPCR) analyses revealed that 90 genes were significantly up-regulated at the early stage of trap-formation by nematode extracts and most of these genes were involved in translation, amino acid metabolism, carbohydrate metabolism, cell wall and membrane biogenesis. Based on the combined genomic, proteomic and qPCR data, a model for the formation of nematode trapping device in this fungus was proposed. In this model, multiple fungal signal transduction pathways are activated by its nematode prey to further regulate downstream genes associated with diverse cellular processes such as energy metabolism, biosynthesis of the cell wall and adhesive proteins, cell division, glycerol accumulation and peroxisome biogenesis. This study will facilitate the identification of pathogenicity-related genes and provide a broad foundation for understanding the molecular and evolutionary mechanisms underlying fungi-nematodes interactions. PMID:21909256

Genomic and proteomic analyses of the fungus Arthrobotrys oligospora provide insights into nematode-trap formation.

PubMed

Yang, Jinkui; Wang, Lei; Ji, Xinglai; Feng, Yun; Li, Xiaomin; Zou, Chenggang; Xu, Jianping; Ren, Yan; Mi, Qili; Wu, Junli; Liu, Shuqun; Liu, Yu; Huang, Xiaowei; Wang, Haiyan; Niu, Xuemei; Li, Juan; Liang, Lianming; Luo, Yanlu; Ji, Kaifang; Zhou, Wei; Yu, Zefen; Li, Guohong; Liu, Yajun; Li, Lei; Qiao, Min; Feng, Lu; Zhang, Ke-Qin

2011-09-01

Nematode-trapping fungi are "carnivorous" and attack their hosts using specialized trapping devices. The morphological development of these traps is the key indicator of their switch from saprophytic to predacious lifestyles. Here, the genome of the nematode-trapping fungus Arthrobotrys oligospora Fres. (ATCC24927) was reported. The genome contains 40.07 Mb assembled sequence with 11,479 predicted genes. Comparative analysis showed that A. oligospora shared many more genes with pathogenic fungi than with non-pathogenic fungi. Specifically, compared to several sequenced ascomycete fungi, the A. oligospora genome has a larger number of pathogenicity-related genes in the subtilisin, cellulase, cellobiohydrolase, and pectinesterase gene families. Searching against the pathogen-host interaction gene database identified 398 homologous genes involved in pathogenicity in other fungi. The analysis of repetitive sequences provided evidence for repeat-induced point mutations in A. oligospora. Proteomic and quantitative PCR (qPCR) analyses revealed that 90 genes were significantly up-regulated at the early stage of trap-formation by nematode extracts and most of these genes were involved in translation, amino acid metabolism, carbohydrate metabolism, cell wall and membrane biogenesis. Based on the combined genomic, proteomic and qPCR data, a model for the formation of nematode trapping device in this fungus was proposed. In this model, multiple fungal signal transduction pathways are activated by its nematode prey to further regulate downstream genes associated with diverse cellular processes such as energy metabolism, biosynthesis of the cell wall and adhesive proteins, cell division, glycerol accumulation and peroxisome biogenesis. This study will facilitate the identification of pathogenicity-related genes and provide a broad foundation for understanding the molecular and evolutionary mechanisms underlying fungi-nematodes interactions.

A Comprehensive Analysis of In Vitro and In Vivo Genetic Fitness of Pseudomonas aeruginosa Using High-Throughput Sequencing of Transposon Libraries

PubMed Central

Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.

2013-01-01

High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572

Dynamics of plasma−dust structures formed in a trap created in the narrowing of a current channel in a magnetic field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dzlieva, E. S., E-mail: plasmadust@yandex.ru; Karasev, V. Yu., E-mail: v.karasev@spbu.ru; Pavlov, S. I.

The geometry and dynamics of plasma−dust structures in a longitudinal magnetic field is studied experimentally. The structures are formed in a glow-discharge trap created in the double electric layer produced as a result of discharge narrowing by means of a dielectric insert introduced in the discharge tube. Studies of structures formed in the new type of glow-discharge trap are of interest from the standpoint of future experiments with complex plasmas in superstrong magnetic fields in which the dust component is magnetized. Different types of dielectric inserts were used: conical and plane ones with symmetric and asymmetric apertures. Conditions for themore » existence of stable dust structures are determined for dust grains of different density and different dispersity. According to the experimental results, the angular velocity of dust rotation is ≥10 s{sup –1}, which is the fastest type of dust motion for all types of discharges in a magnetic field. The rotation is interpreted by analyzing the dynamics of individual dust grains.« less

Distinguishing triplet energy transfer and trap-assisted recombination in multi-color organic light-emitting diode with an ultrathin phosphorescent emissive layer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xue, Qin, E-mail: xueqin19851202@163.com; Liu, Shouyin; Xie, Guohua

2014-03-21

An ultrathin layer of deep-red phosphorescent emitter tris(1-phenylisoquinoline) iridium (III) (Ir(piq){sub 3}) is inserted within different positions of the electron blocking layer fac-tris (1-phenylpyrazolato-N,C{sup 2′})-iridium(III) (Ir(ppz){sub 3}) to distinguish the contribution of the emission from the triplet exciton energy transfer/diffusion from the adjacent blue phosphorescent emitter and the trap-assisted recombination from the narrow band-gap emitter itself. The charge trapping effect of the narrow band-gap deep-red emitter which forms a quantum-well-like structure also plays a role in shaping the electroluminescent characteristics of multi-color organic light-emitting diodes. By accurately controlling the position of the ultrathin sensing layer, it is considerably easy tomore » balance the white emission which is quite challenging for full-color devices with multiple emission zones. There is nearly no energy transfer detectable if 7 nm thick Ir(ppz){sub 3} is inserted between the blue phosphorescent emitter and the ultrathin red emitter.« less

cea-kil operon of the ColE1 plasmid.

PubMed Central

Sabik, J F; Suit, J L; Luria, S E

1983-01-01

We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187

A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

PubMed

Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

2009-03-13

Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.

PubMed

Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui

2009-04-01

Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.

Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster

PubMed Central

Lin, Chun-Chieh; Potter, Christopher J.

2016-01-01

Gene conversions occur when genomic double-strand DNA breaks (DSBs) trigger unidirectional transfer of genetic material from a homologous template sequence. Exogenous or mutated sequence can be introduced through this homology-directed repair (HDR). We leveraged gene conversion to develop a method for genomic editing of existing transgenic insertions in Drosophila melanogaster. The clustered regularly-interspaced palindromic repeats (CRISPR)/Cas9 system is used in the homology assisted CRISPR knock-in (HACK) method to induce DSBs in a GAL4 transgene, which is repaired by a single-genomic transgenic construct containing GAL4 homologous sequences flanking a T2A-QF2 cassette. With two crosses, this technique converts existing GAL4 lines, including enhancer traps, into functional QF2 expressing lines. We used HACK to convert the most commonly-used GAL4 lines (labeling tissues such as neurons, fat, glia, muscle, and hemocytes) to QF2 lines. We also identified regions of the genome that exhibited differential efficiencies of HDR. The HACK technique is robust and readily adaptable for targeting and replacement of other genomic sequences, and could be a useful approach to repurpose existing transgenes as new genetic reagents become available. PMID:27334272

Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

PubMed Central

Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

2017-01-01

Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011

The Hairless Stem Phenotype of Cotton (Gossypium barbadense) Is Linked to a Copia-Like Retrotransposon Insertion in a Homeodomain-Leucine Zipper Gene (HD1)

PubMed Central

Ding, Mingquan; Ye, Wuwei; Lin, Lifeng; He, Shae; Du, Xiongming; Chen, Aiqun; Cao, Yuefen; Qin, Yuan; Yang, Fen; Jiang, Yurong; Zhang, Hua; Wang, Xiyin; Paterson, Andrew H.; Rong, Junkang

2015-01-01

Cotton (Gossypium) stem trichomes are mostly single cells that arise from stem epidermal cells. In this study, a homeodomain-leucine zipper gene (HD1) was found to cosegregate with the dominant trichome locus previously designated as T1 and mapped to chromosome 6. Characterization of HD1 orthologs revealed that the absence of stem trichomes in modern Gossypium barbadense varieties is linked to a large retrotransposon insertion in the ninth exon, 2565 bp downstream from the initial codon in the At subgenome HD1 gene (At-GbHD1). In both the At and Dt subgenomes, reduced transcription of GbHD1 genes is caused by this insertion. The disruption of At-HD1 further affects the expression of downstream GbMYB25 and GbHOX3 genes. Analyses of primitive cultivated accessions identified another retrotransposon insertion event in the sixth exon of At-GbHD1 that might predate the previously identified retrotransposon in modern varieties. Although both retrotransposon insertions results in similar phenotypic changes, the timing of these two retrotransposon insertion events fits well with our current understanding of the history of cotton speciation and dispersal. Taken together, the results of genetics mapping, gene expression and association analyses suggest that GbHD1 is an important component that controls stem trichome development and is a promising candidate gene for the T1 locus. The interspecific phenotypic difference in stem trichome traits also may be attributable to HD1 inactivation associated with retrotransposon insertion. PMID:26133897

De novo insertion of an intron into the mammalian sex determining gene, SRY

PubMed Central

O’Neill, Rachel J. Waugh; Brennan, Francine E.; Delbridge, Margaret L.; Crozier, Ross H.; Graves, Jennifer A. Marshall

1998-01-01

Two theories have been proposed to explain the evolution of introns within eukaryotic genes. The introns early theory, or “exon theory of genes,” proposes that introns are ancient and that recombination within introns provided new exon structure, and thus new genes. The introns late theory, or “insertional theory of introns,” proposes that ancient genes existed as uninterrupted exons and that introns have been introduced during the course of evolution. There is still controversy as to how intron–exon structure evolved and whether the majority of introns are ancient or novel. Although there is extensive evidence in support of the introns early theory, phylogenetic comparisons of several genes indicate recent gain and loss of introns within these genes. However, no example has been shown of a protein coding gene, intronless in its ancestral form, which has acquired an intron in a derived form. The mammalian sex determining gene, SRY, is intronless in all mammals studied to date, as is the gene from which it recently evolved. However, we report here comparisons of genomic and cDNA sequences that now provide evidence of a de novo insertion of an intron into the SRY gene of dasyurid marsupials. This recently (approximately 45 million years ago) inserted sequence is not homologous with known transposable elements. Our data demonstrate that introns may be inserted as spliced units within a developmentally crucial gene without disrupting its function. PMID:9465071

Insights into the transposable mobilome of Paracoccus spp. (Alphaproteobacteria).

PubMed

Dziewit, Lukasz; Baj, Jadwiga; Szuplewska, Magdalena; Maj, Anna; Tabin, Mateusz; Czyzkowska, Anna; Skrzypczyk, Grazyna; Adamczuk, Marcin; Sitarek, Tomasz; Stawinski, Piotr; Tudek, Agnieszka; Wanasz, Katarzyna; Wardal, Ewa; Piechucka, Ewa; Bartosik, Dariusz

2012-01-01

Several trap plasmids (enabling positive selection of transposition events) were used to identify a pool of functional transposable elements (TEs) residing in bacteria of the genus Paracoccus (Alphaproteobacteria). Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i) 37 insertion sequences (ISs) representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634), (ii) a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family) containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii) 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv) a transposable genomic island TnPpa1 (45 kb). Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family) were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i) the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1) and (ii) structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family). We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value) by horizontal gene transfer, which is considered the driving force of bacterial evolution.

Insights into the Transposable Mobilome of Paracoccus spp. (Alphaproteobacteria)

PubMed Central

Dziewit, Lukasz; Baj, Jadwiga; Szuplewska, Magdalena; Maj, Anna; Tabin, Mateusz; Czyzkowska, Anna; Skrzypczyk, Grazyna; Adamczuk, Marcin; Sitarek, Tomasz; Stawinski, Piotr; Tudek, Agnieszka; Wanasz, Katarzyna; Wardal, Ewa; Piechucka, Ewa; Bartosik, Dariusz

2012-01-01

Several trap plasmids (enabling positive selection of transposition events) were used to identify a pool of functional transposable elements (TEs) residing in bacteria of the genus Paracoccus (Alphaproteobacteria). Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i) 37 insertion sequences (ISs) representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634), (ii) a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family) containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii) 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv) a transposable genomic island TnPpa1 (45 kb). Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family) were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i) the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1) and (ii) structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family). We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value) by horizontal gene transfer, which is considered the driving force of bacterial evolution. PMID:22359677

Development of the piggyBac transposable system for Plasmodium berghei and its application for random mutagenesis in malaria parasites

PubMed Central

2011-01-01

Background The genome of a number of species of malaria parasites (Plasmodium spp.) has been sequenced in the hope of identifying new drug and vaccine targets. However, almost one-half of predicted Plasmodium genes are annotated as hypothetical and are difficult to analyse in bulk due to the inefficiency of current reverse genetic methodologies for Plasmodium. Recently, it has been shown that the transposase piggyBac integrates at random into the genome of the human malaria parasite P. falciparum offering the possibility to develop forward genetic screens to analyse Plasmodium gene function. This study reports the development and application of the piggyBac transposition system for the rodent malaria parasite P. berghei and the evaluation of its potential as a tool in forward genetic studies. P. berghei is the most frequently used malaria parasite model in gene function analysis since phenotype screens throughout the complete Plasmodium life cycle are possible both in vitro and in vivo. Results We demonstrate that piggyBac based gene inactivation and promoter-trapping is both easier and more efficient in P. berghei than in the human malaria parasite, P. falciparum. Random piggyBac-mediated insertion into genes was achieved after parasites were transfected with the piggyBac donor plasmid either when transposase was expressed either from a helper plasmid or a stably integrated gene in the genome. Characterization of more than 120 insertion sites demonstrated that more than 70 most likely affect gene expression classifying their protein products as non-essential for asexual blood stage development. The non-essential nature of two of these genes was confirmed by targeted gene deletion one of which encodes P41, an ortholog of a human malaria vaccine candidate. Importantly for future development of whole genome phenotypic screens the remobilization of the piggyBac element in parasites that stably express transposase was demonstrated. Conclusion These data demonstrate that piggyBac behaved as an efficient and random transposon in P. berghei. Remobilization of piggyBac element shows that with further development the piggyBac system can be an effective tool to generate random genome-wide mutation parasite libraries, for use in large-scale phenotype screens in vitro and in vivo. PMID:21418605

Reshaping and linking of molecules in ion-pair traps

NASA Astrophysics Data System (ADS)

Cochrane, Bryce; Naumkin, Fedor Y.

2016-01-01

A series of insertion complexes of small molecules trapped between alkali-halide counter-ions are investigated ab initio. The molecular shape is altered inside the complexes and varies in corresponding anions. Stabilities and charge distributions are investigated. Strong charge-transfer in the alkali-halide component effectively through the almost neutral molecule results in very large dipole moments. The most stable species is used to construct a dimer significantly bound via dipole-dipole interaction. Another complex with two alkali-halide diatoms trapping the molecule represents a unit of corresponding longer oligomer. This completes the array of systems with the molecule effectively in ion-pair, ion-dipole, dipole-pair electric fields.

Selection of genes of Mycobacterium tuberculosis upregulated during residence in lungs of infected mice.

PubMed

Srivastava, Vikas; Jain, Anamika; Srivastava, Brahm S; Srivastava, Ranjana

2008-05-01

In sequel to previous report [Srivastava V, Rouanet C, Srivastava R, Ramalingam B, Locht C, Srivastava BS. Macrophage-specific Mycobacterium tuberculosis genes: identification by green fluorescent protein and kanamycin resistance selection. Microbiology 2007;153:659-66], the genes of Mycobacterium tuberculosis upregulated during residence in lungs of infected mice were identified in an in vivo expression system based on kanamycin resistance. A promoter library of M. tuberculosis was constructed in a promoter trap shuttle vector pLL192 containing an artificial bicistronic operon composed of promoterless green fluorescent protein gene followed by kanamycin resistance gene. The library was introduced in M. bovis BCG and then infected in mice by intravenous route. Mice were treated twice daily with 40 mg/kg dose of kanamycin by intramuscular route for 21 days. Recombinant BCG recovered from the lungs were reinfected in mice to enrich clones surviving kanamycin treatment in the lung but sensitive to killing by kanamycin in vitro. After nucleotide sequencing of inserts from these clones, 20 genes belonging to fatty acids metabolism, membrane transport, nitric oxide defence and PE_PGRS/PPE family were identified. Real-time PCR analysis using RNA isolated from M. tuberculosis grown in vitro and from the lungs, confirmed upregulation of genes from 2 to 20-fold in vivo compared to growth in vitro. Several of these select 20 genes were also found upregulated ex vivo in macrophage-like cell line J774A.1, thus, suggesting a correlation in mycobacterial gene expression between ex vivo and in vivo conditions.

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

PubMed

Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

2015-02-01

To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

MMTV insertional mutagenesis identifies genes, gene families and pathways involved in mammary cancer.

PubMed

Theodorou, Vassiliki; Kimm, Melanie A; Boer, Mandy; Wessels, Lodewyk; Theelen, Wendy; Jonkers, Jos; Hilkens, John

2007-06-01

We performed a high-throughput retroviral insertional mutagenesis screen in mouse mammary tumor virus (MMTV)-induced mammary tumors and identified 33 common insertion sites, of which 17 genes were previously not known to be associated with mammary cancer and 13 had not previously been linked to cancer in general. Although members of the Wnt and fibroblast growth factors (Fgf) families were frequently tagged, our exhaustive screening for MMTV insertion sites uncovered a new repertoire of candidate breast cancer oncogenes. We validated one of these genes, Rspo3, as an oncogene by overexpression in a p53-deficient mammary epithelial cell line. The human orthologs of the candidate oncogenes were frequently deregulated in human breast cancers and associated with several tumor parameters. Computational analysis of all MMTV-tagged genes uncovered specific gene families not previously associated with cancer and showed a significant overrepresentation of protein domains and signaling pathways mainly associated with development and growth factor signaling. Comparison of all tagged genes in MMTV and Moloney murine leukemia virus-induced malignancies showed that both viruses target mostly different genes that act predominantly in distinct pathways.

Expression of a putative dioxygenase gene adjacent to an insertion mutation is involved in the short internodes of columnar apples (Malus × domestica).

PubMed

Okada, Kazuma; Wada, Masato; Moriya, Shigeki; Katayose, Yuichi; Fujisawa, Hiroko; Wu, Jianzhong; Kanamori, Hiroyuki; Kurita, Kanako; Sasaki, Harumi; Fujii, Hiroshi; Terakami, Shingo; Iwanami, Hiroshi; Yamamoto, Toshiya; Abe, Kazuyuki

2016-11-01

Determining the molecular mechanism of fruit tree architecture is important for tree management and fruit production. An apple mutant 'McIntosh Wijcik', which was discovered as a bud mutation from 'McIntosh', exhibits a columnar growth phenotype that is controlled by a single dominant gene, Co. In this study, the mutation and the Co gene were analyzed. Fine mapping narrowed the Co region to a 101 kb region. Sequence analysis of the Co region and the original wild-type co region identified an insertion mutation of an 8202 bp long terminal repeat (LTR) retroposon in the Co region. Segregation analysis using a DNA marker based on the insertion polymorphism showed that the LTR retroposon was closely associated with the columnar growth phenotype. RNA-seq and RT-PCR analysis identified a promising Co candidate gene (91071-gene) within the Co region that is specifically expressed in 'McIntosh Wijcik' but not in 'McIntosh'. The 91071-gene was located approximately 16 kb downstream of the insertion mutation and is predicted to encode a 2-oxoglutarate-dependent dioxygenase involved in an unknown reaction. Overexpression of the 91071-gene in transgenic tobaccos and apples resulted in phenotypes with short internodes, like columnar apples. These data suggested that the 8202 bp retroposon insertion in 'McIntosh Wijcik' is associated with the short internodes of the columnar growth phenotype via upregulated expression of the adjacent 91071-gene. Furthermore, the DNA marker based on the insertion polymorphism could be useful for the marker-assisted selection of columnar apples.

Enhanced electrical properties of oxide semiconductor thin-film transistors with high conductivity thin layer insertion for the channel region

NASA Astrophysics Data System (ADS)

Nguyen, Cam Phu Thi; Raja, Jayapal; Kim, Sunbo; Jang, Kyungsoo; Le, Anh Huy Tuan; Lee, Youn-Jung; Yi, Junsin

2017-02-01

This study examined the performance and the stability of indium tin zinc oxide (ITZO) thin film transistors (TFTs) by inserting an ultra-thin indium tin oxide (ITO) layer at the active/insulator interface. The electrical properties of the double channel device (ITO thickness of 5 nm) were improved in comparison with the single channel ITZO or ITO devices. The TFT characteristics of the device with an ITO thickness of less than 5 nm were degraded due to the formation of an island-like morphology and the carriers scattering at the active/insulator interface. The 5 nm-thick ITO inserted ITZO TFTs (optimal condition) exhibited a superior field effect mobility (∼95 cm2/V·s) compared with the ITZO-only TFTs (∼34 cm2/V·s). The best characteristics of the TFT devices with double channel layer are due to the lowest surface roughness (0.14 nm) and contact angle (50.1°) that result in the highest hydrophicility, and the most effective adhesion at the surface. Furthermore, the threshold voltage shifts for the ITO/ITZO double layer device decreased to 0.80 and -2.39 V compared with 6.10 and -6.79 V (for the ITZO only device) under positive and negative bias stress, respectively. The falling rates of EA were 0.38 eV/V and 0.54 eV/V for the ITZO and ITO/ITZO bi-layer devices, respectively. The faster falling rate of the double channel devices suggests that the trap density, including interface trap and semiconductor bulk trap, can be decreased by the ion insertion of a very thin ITO film into the ITZO/SiO2 reference device. These results demonstrate that the double active layer TFT can potentially be applied to the flat panel display.

Sorting genomes by reciprocal translocations, insertions, and deletions.

PubMed

Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

2010-01-01

The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

Establishment of an Arbitrary PCR for Rapid Identification of Tn917 Insertion Sites in Staphylococcus epidermidis: Characterization of Biofilm-Negative and Nonmucoid Mutants

PubMed Central

Knobloch, Johannes K.-M.; Nedelmann, Max; Kiel, Kathrin; Bartscht, Katrin; Horstkotte, Matthias A.; Dobinsky, Sabine; Rohde, Holger; Mack, Dietrich

2003-01-01

Transposon mutagenesis with the Enterococcus faecalis transposon Tn917 is a genetic approach frequently used to identify genes related with specific phenotypes in gram-positive bacteria. We established an arbitrary PCR for the rapid and easy identification of Tn917 insertion sites in Staphylococcus epidermidis with six independent, well-characterized biofilm-negative Tn917 transposon mutants, which were clustered in the icaADBC gene locus or harbor Tn917 in the regulatory gene rsbU. For all six of these mutants, short chromosomal DNA fragments flanking both transposon ends could be amplified. All fragments were sufficient to correctly identify the Tn917 insertion sites in the published S. epidermidis genomes. By using this technique, the Tn917 insertion sites of three not-yet-characterized biofilm-negative or nonmucoid mutants were identified. In the biofilm-negative and nonmucoid mutant M12, Tn917 is inserted into a gene homologous to the regulatory gene purR of Bacillus subtilis and Staphylococcus aureus. The Tn917 insertions of the nonmucoid but biofilm-positive mutants M16 and M20 are located in genes homologous to components of the phosphoenolpyruvate-sugar phosphotransferase system (PTS) of B. subtilis, S. aureus, and Staphylococcus carnosus, indicating an influence of the PTS on the mucoid phenotype in S. epidermidis. PMID:14532029

FLUX-TRAP REACTOR WITH ABSORBER IN THE CENTER

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ergen, W.K.

1958-03-01

An idealized flux-trap reactor is modified by the insertion of absorber. It is shown that, for appreciable absorption, a flux depression results, and the remaining flux is proportional to the diffusion constant D times the center flux in the nonabsorption case. This factor D just cancels the factor 1/D in the expression for this center flux so that the flux in the case with absorber is independent of D. In the case with absorber the advantage of Be and BeO largely disappears. (auth)

[The Russian gene pool: gene geography of Alu-insertions (ACE, APOA1, B65, PV92 TPA25)].

PubMed

Solov'eva, D S; Balanovskaia, E V; Kuznetsova, M A; Vasinskaia, O A; Frolova, S A; Pocheshkhova, E A; Evseeva, I V; Boldyreva, M N; Balanovskiĭ, O P

2010-01-01

The analysis of five Alu insertion loci (ACE, AP4OA1, B65, PV92, TPA25) has been carried out for the first time in 10 Russian populations (1088 individuals), covered all parts of historical area of the Russian ethnos. Depending on locus, Russian populations exhibit similarity with their western (European populations) or with the eastern (populations of the Ural region) neighbors. Considering frequencies of the studied Alu-insertions, Russian gene pool exhibits low variation: average difference between populations is d = 0.007, whereas on classical markers, mtDNA and Y chromosome heterogeneity of Russian gene pool is essentially higher (0.013, 0.033 and 0.142 respectively). Therefore, this set of five Alu insertions has lower variability on the intra-ethnic level. However in inter-ethnic comparisons the clear pattern was obtained: 13 Eastern European ethnic groups formed three clusters, according with their historical and geographical position--East Slavic, Caucasian and South Ural clusters. The obtained data confirms efficiency of using Alu insertions for studying genetic differentiation and history of a gene pool of the Eastern European populations.

Zinc-finger nuclease-mediated targeted insertion of reporter genes for quantitative imaging of gene expression in sea urchin embryos

PubMed Central

Ochiai, Hiroshi; Sakamoto, Naoaki; Fujita, Kazumasa; Nishikawa, Masatoshi; Suzuki, Ken-ichi; Matsuura, Shinya; Miyamoto, Tatsuo; Sakuma, Tetsushi; Shibata, Tatsuo; Yamamoto, Takashi

2012-01-01

To understand complex biological systems, such as the development of multicellular organisms, it is important to characterize the gene expression dynamics. However, there is currently no universal technique for targeted insertion of reporter genes and quantitative imaging in multicellular model systems. Recently, genome editing using zinc-finger nucleases (ZFNs) has been reported in several models. ZFNs consist of a zinc-finger DNA-binding array with the nuclease domain of the restriction enzyme FokI and facilitate targeted transgene insertion. In this study, we successfully inserted a GFP reporter cassette into the HpEts1 gene locus of the sea urchin, Hemicentrotus pulcherrimus. We achieved this insertion by injecting eggs with a pair of ZFNs for HpEts1 with a targeting donor construct that contained ∼1-kb homology arms and a 2A-histone H2B–GFP cassette. We increased the efficiency of the ZFN-mediated targeted transgene insertion by in situ linearization of the targeting donor construct and cointroduction of an mRNA for a dominant-negative form of HpLig4, which encodes the H. pulcherrimus homolog of DNA ligase IV required for error-prone nonhomologous end joining. We measured the fluorescence intensity of GFP at the single-cell level in living embryos during development and found that there was variation in HpEts1 expression among the primary mesenchyme cells. These findings demonstrate the feasibility of ZFN-mediated targeted transgene insertion to enable quantification of the expression levels of endogenous genes during development in living sea urchin embryos. PMID:22711830

Minos-insertion mutant of the Drosophila GBA gene homologue showed abnormal phenotypes of climbing ability, sleep and life span with accumulation of hydroxy-glucocerebroside.

PubMed

Kawasaki, Haruhisa; Suzuki, Takahiro; Ito, Kumpei; Takahara, Tsubasa; Goto-Inoue, Naoko; Setou, Mitsutoshi; Sakata, Kazuki; Ishida, Norio

2017-05-30

Gaucher's disease in humans is considered a deficiency of glucocerebrosidase (GlcCerase) that result in the accumulation of its substrate, glucocerebroside (GlcCer). Although mouse models of Gaucher's disease have been reported from several laboratories, these models are limited due to the perinatal lethality of GlcCerase gene. Here, we examined phenotypes of Drosophila melanogaster homologues genes of the human Gaucher's disease gene by using Minos insertion. One of two Minos insertion mutants to unknown function gene (CG31414) accumulates the hydroxy-GlcCer in whole body of Drosophila melanogaster. This mutant showed abnormal phenotypes of climbing ability and sleep, and short lifespan. These abnormal phenotypes are very similar to that of Gaucher's disease in human. In contrast, another Minos insertion mutant (CG31148) and its RNAi line did not show such severe phenotype as observed in CG31414 gene mutation. The data suggests that Drosophila CG31414 gene mutation might be useful for unraveling the molecular mechanism of Gaucher's disease. Copyright © 2017 Elsevier B.V. All rights reserved.

Improvement in trapped fields by stacking bulk superconductors

NASA Astrophysics Data System (ADS)

Suzuki, A.; Wongsatanawarid, A.; Seki, H.; Murakami, M.

2009-10-01

We studied the effects of stacking several bulk superconductor blocks on the field trapping properties. In order to avoid the detrimental effects of the bottom deteriorated parts, bulk Dy-Ba-Cu-O superconductors 45 mm in diameter and 10 mm in thickness were cut from the top parts of as-grown bulk blocks of 25 mm diameter. We stacked the superconductors and measured the field distribution as a function of the gap. The trapped field measurements were performed by field-cooling the samples inserted in between two permanent magnets with liquid nitrogen. It was found that the trapped field values are almost doubled when the number of stacked bulk superconductors increased from two to three. The present results clearly show that one can expect beneficial effects of increasing the ratio of the height to the diameter even in bulk high temperature superconductors.

Recurrence, submicroscopic complexity, and potential clinical relevance of copy gains detected by array CGH that are shown to be unbalanced insertions by FISH.

PubMed

Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G

2011-04-01

Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.

Effects of insertion sites in a Newcastle disease virus vector on foreign gene expression through an internal ribosomal entry site

USDA-ARS?s Scientific Manuscript database

Newcastle disease virus (NDV), avian paramyxovirus type 1, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU), which potentially a...

Stable zymomonas mobilis xylose and arabinose fermenting strains

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

2008-04-08

The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

PubMed Central

Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

2007-01-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

PubMed

Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

2007-10-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

PubMed

Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

2014-01-01

Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

PubMed

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡

PubMed Central

Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu

2009-01-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402

Genome-wide transposon mutagenesis in pathogenic Leptospira species.

PubMed

Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu

2009-02-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.

Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco

PubMed Central

Mazier, Marianne; Botton, Emmanuel; Flamain, Fabrice; Bouchet, Jean-Paul; Courtial, Béatrice; Chupeau, Marie-Christine; Chupeau, Yves; Maisonneuve, Brigitte; Lucas, Hélène

2007-01-01

The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3β-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome. PMID:17351058

Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

PubMed

Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

2014-01-01

The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

Isolation of Novel CreERT2-Driver Lines in Zebrafish Using an Unbiased Gene Trap Approach

PubMed Central

Jungke, Peggy; Hammer, Juliane; Hans, Stefan; Brand, Michael

2015-01-01

Gene manipulation using the Cre/loxP-recombinase system has been successfully employed in zebrafish to study gene functions and lineage relationships. Recently, gene trapping approaches have been applied to produce large collections of transgenic fish expressing conditional alleles in various tissues. However, the limited number of available cell- and tissue-specific Cre/CreERT2-driver lines still constrains widespread application in this model organism. To enlarge the pool of existing CreERT2-driver lines, we performed a genome-wide gene trap screen using a Tol2-based mCherry-T2a-CreERT2 (mCT2aC) gene trap vector. This cassette consists of a splice acceptor and a mCherry-tagged variant of CreERT2 which enables simultaneous labeling of the trapping event, as well as CreERT2 expression from the endogenous promoter. Using this strategy, we generated 27 novel functional CreERT2-driver lines expressing in a cell- and tissue-specific manner during development and adulthood. This study summarizes the analysis of the generated CreERT2-driver lines with respect to functionality, expression, integration, as well as associated phenotypes. Our results significantly enlarge the existing pool of CreERT2-driver lines in zebrafish and combined with Cre–dependent effector lines, the new CreERT2-driver lines will be important tools to manipulate the zebrafish genome. PMID:26083735

Time-series RNA-seq analysis package (TRAP) and its application to the analysis of rice, Oryza sativa L. ssp. Japonica, upon drought stress.

PubMed

Jo, Kyuri; Kwon, Hawk-Bin; Kim, Sun

2014-06-01

Measuring expression levels of genes at the whole genome level can be useful for many purposes, especially for revealing biological pathways underlying specific phenotype conditions. When gene expression is measured over a time period, we have opportunities to understand how organisms react to stress conditions over time. Thus many biologists routinely measure whole genome level gene expressions at multiple time points. However, there are several technical difficulties for analyzing such whole genome expression data. In addition, these days gene expression data is often measured by using RNA-sequencing rather than microarray technologies and then analysis of expression data is much more complicated since the analysis process should start with mapping short reads and produce differentially activated pathways and also possibly interactions among pathways. In addition, many useful tools for analyzing microarray gene expression data are not applicable for the RNA-seq data. Thus a comprehensive package for analyzing time series transcriptome data is much needed. In this article, we present a comprehensive package, Time-series RNA-seq Analysis Package (TRAP), integrating all necessary tasks such as mapping short reads, measuring gene expression levels, finding differentially expressed genes (DEGs), clustering and pathway analysis for time-series data in a single environment. In addition to implementing useful algorithms that are not available for RNA-seq data, we extended existing pathway analysis methods, ORA and SPIA, for time series analysis and estimates statistical values for combined dataset by an advanced metric. TRAP also produces visual summary of pathway interactions. Gene expression change labeling, a practical clustering method used in TRAP, enables more accurate interpretation of the data when combined with pathway analysis. We applied our methods on a real dataset for the analysis of rice (Oryza sativa L. Japonica nipponbare) upon drought stress. The result showed that TRAP was able to detect pathways more accurately than several existing methods. TRAP is available at http://biohealth.snu.ac.kr/software/TRAP/. Copyright © 2014 Elsevier Inc. All rights reserved.

Antimicrobial resistance in generic Escherichia coli isolates from wild small mammals living in swine farm, residential, landfill, and natural environments in southern Ontario, Canada.

PubMed

Allen, Samantha E; Boerlin, Patrick; Janecko, Nicol; Lumsden, John S; Barker, Ian K; Pearl, David L; Reid-Smith, Richard J; Jardine, Claire

2011-02-01

To assess the impacts of different types of human activity on the development of resistant bacteria in the feces of wild small mammals, we compared the prevalences and patterns of antimicrobial resistance and resistance genes in generic Escherichia coli and Salmonella enterica isolates from fecal samples collected from wild small mammals living in four environments: swine farms, residential areas, landfills, and natural habitats. Resistance to antimicrobials was observed in E. coli isolates from animals in all environments: 25/52 (48%) animals trapped at swine farms, 6/69 (9%) animals trapped in residential areas, 3/20 (15%) animals trapped at landfills, and 1/22 (5%) animals trapped in natural habitats. Animals trapped on farms were significantly more likely to carry E. coli isolates with resistance to tetracycline, ampicillin, sulfisoxazole, and streptomycin than animals trapped in residential areas. The resistance genes sul2, aadA, and tet(A) were significantly more likely to be detected in E. coli isolates from animals trapped on farms than from those trapped in residential areas. Three S. enterica serotypes (Give, Typhimurium, and Newport) were recovered from the feces of 4/302 (1%) wild small mammals. All Salmonella isolates were pansusceptible. Our results show that swine farm origin is significantly associated with the presence of resistant bacteria and resistance genes in wild small mammals in southern Ontario, Canada. However, resistant fecal bacteria were found in small mammals living in all environments studied, indicating that environmental exposure to antimicrobials, antimicrobial residues, resistant bacteria, or resistance genes is widespread.

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

PubMed Central

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

Influence of insertion site of the avian influenza virus haemagglutinin (HA) gene within the Newcastle disease virus genome on HA expression.

PubMed

Ramp, Kristina; Skiba, Martin; Karger, Axel; Mettenleiter, Thomas C; Römer-Oberdörfer, Angela

2011-02-01

Members of the order Mononegavirales express their genes in a transcription gradient from 3' to 5'. To assess how this impacts on expression of a foreign transgene, the haemagglutinin (HA) of highly pathogenic avian influenza virus (HPAIV) A/chicken/Vietnam/P41/05 (subtype H5N1) was inserted between the phosphoprotein (P) and matrix protein (M), M and fusion protein (F), or F and haemagglutinin-neuraminidase protein (HN) genes of attenuated Newcastle disease virus (NDV) Clone 30. In addition, the gene encoding the neuraminidase of HPAIV A/duck/Vietnam/TG24-01/05 (subtype H5N1) was inserted into the NDV genome either alone or in combination with the HA gene. All recombinants replicated well in embryonated chicken eggs. The expression levels of HA-specific mRNA and protein were quantified by Northern blot analysis and mass spectrometry, with good correlation. HA expression levels differed only moderately and were highest in the recombinant carrying the HA insertion between the F and HN genes of NDV.

Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer

PubMed Central

Ranzani, Marco; Cesana, Daniela; Bartholomae, Cynthia C.; Sanvito, Francesca; Pala, Mauro; Benedicenti, Fabrizio; Gallina, Pierangela; Sergi, Lucia Sergi; Merella, Stefania; Bulfone, Alessandro; Doglioni, Claudio; von Kalle, Christof; Kim, Yoon Jun; Schmidt, Manfred; Tonon, Giovanni; Naldini, Luigi; Montini, Eugenio

2013-01-01

Transposons and γ-retroviruses have been efficiently used as insertional mutagens in different tissues to identify molecular culprits of cancer. However, these systems are characterized by recurring integrations that accumulate in tumor cells, hampering the identification of early cancer-driving events amongst bystander and progression-related events. We developed an insertional mutagenesis platform based on lentiviral vectors (LVV) by which we could efficiently induce hepatocellular carcinoma (HCC) in 3 different mouse models. By virtue of LVV’s replication-deficient nature and broad genome-wide integration pattern, LVV-based insertional mutagenesis allowed identification of 4 new liver cancer genes from a limited number of integrations. We validated the oncogenic potential of all the identified genes in vivo, with different levels of penetrance. Our newly identified cancer genes are likely to play a role in human disease, since they are upregulated and/or amplified/deleted in human HCCs and can predict clinical outcome of patients. PMID:23314173

Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

PubMed

Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

2015-07-22

Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

Inserting Thienyl Linkers into Conjugated Molecules for Efficient Multilevel Electronic Memory: A New Understanding of Charge-Trapping in Organic Materials.

PubMed

Li, Yang; Li, Hua; He, Jinghui; Xu, Qingfeng; Li, Najun; Chen, Dongyun; Lu, Jianmei

2016-03-18

The practical application of organic memory devices requires low power consumption and reliable device quality. Herein, we report that inserting thienyl units into D-π-A molecules can improve these parameters by tuning the texture of the film. Theoretical calculations revealed that introducing thienyl π bridges increased the planarity of the molecular backbone and extended the D-A conjugation. Thus, molecules with more thienyl spacers showed improved stacking and orientation in the film state relative to the substrates. The corresponding sandwiched memory devices showed enhanced ternary memory behavior, with lower threshold voltages and better repeatability. The conductive switching and variation in the performance of the memory devices were interpreted by using an extended-charge-trapping mechanism. Our study suggests that judicious molecular engineering can facilitate control of the orientation of the crystallite in the solid state to achieve superior multilevel memory performance. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quantitative analysis of bristle number in Drosophila mutants identifies genes involved in neural development

NASA Technical Reports Server (NTRS)

Norga, Koenraad K.; Gurganus, Marjorie C.; Dilda, Christy L.; Yamamoto, Akihiko; Lyman, Richard F.; Patel, Prajal H.; Rubin, Gerald M.; Hoskins, Roger A.; Mackay, Trudy F.; Bellen, Hugo J.

2003-01-01

BACKGROUND: The identification of the function of all genes that contribute to specific biological processes and complex traits is one of the major challenges in the postgenomic era. One approach is to employ forward genetic screens in genetically tractable model organisms. In Drosophila melanogaster, P element-mediated insertional mutagenesis is a versatile tool for the dissection of molecular pathways, and there is an ongoing effort to tag every gene with a P element insertion. However, the vast majority of P element insertion lines are viable and fertile as homozygotes and do not exhibit obvious phenotypic defects, perhaps because of the tendency for P elements to insert 5' of transcription units. Quantitative genetic analysis of subtle effects of P element mutations that have been induced in an isogenic background may be a highly efficient method for functional genome annotation. RESULTS: Here, we have tested the efficacy of this strategy by assessing the extent to which screening for quantitative effects of P elements on sensory bristle number can identify genes affecting neural development. We find that such quantitative screens uncover an unusually large number of genes that are known to function in neural development, as well as genes with yet uncharacterized effects on neural development, and novel loci. CONCLUSIONS: Our findings establish the use of quantitative trait analysis for functional genome annotation through forward genetics. Similar analyses of quantitative effects of P element insertions will facilitate our understanding of the genes affecting many other complex traits in Drosophila.

Insertion sequence 1515 in the ply gene of a type 1 clinical isolate of Streptococcus pneumoniae abolishes pneumolysin expression.

PubMed

Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile

2007-07-01

A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.

Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

PubMed Central

Youderian, Philip; Hartzell, Patricia L.

2006-01-01

Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid

PubMed Central

Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad

2015-01-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

PubMed

Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

2014-11-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.

Transposable elements contribute to activation of maize genes in response to abiotic stress.

PubMed

Makarevitch, Irina; Waters, Amanda J; West, Patrick T; Stitzer, Michelle; Hirsch, Candice N; Ross-Ibarra, Jeffrey; Springer, Nathan M

2015-01-01

Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.

The Tc1/mariner transposable element family shapes genetic variation and gene expression in the protist Trichomonas vaginalis

PubMed Central

2014-01-01

Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be expected, we identified two Tvmar1 insertion loci that are fixed across global populations. This observation indicates that Tvmar1 insertion may have differing impacts and fitness costs in the host genome and may play varying roles in the adaptive evolution of T. vaginalis. PMID:24834134

A Genetic Interaction Screen for Breast Cancer Progression Driver Genes

DTIC Science & Technology

2013-06-01

analysis of genetic alterations in human breast cancers has revealed that individual tumors accumulate mutations in approximately ninety different genes ...cancer. We performed a screen to test the roles of seventy breast cancer mutated genes in mouse mammary tumorigenesis using the MMTV-PyVT mouse breast...cancer model and piggyBac insertional mutation strains. We found that insertional mutations in 23 genes altered the onset of tumor formation and four

Tn5099, a xylE promoter probe transposon for Streptomyces spp.

PubMed Central

Hahn, D R; Solenberg, P J; Baltz, R H

1991-01-01

Tn5099, a promoter probe transposon for Streptomyces spp., was constructed by inserting a promoterless xylE gene and a hygromycin resistance gene into IS493. Tn5099 transposed into different sites in the Streptomyces griseofuscus genome, and the xylE reporter gene was expressed in some of the transposition mutants. Strains containing Tn5099 insertions that gave regulated expression of the xylE gene were identified. Images PMID:1653213

Cloning and expression in Escherichia coli of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A

1987-01-15

The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.

Proteinuria and Perinatal Lethality in Mice Lacking NEPH1, a Novel Protein with Homology to NEPHRIN

PubMed Central

Donoviel, Dorit B.; Freed, Deon D.; Vogel, Hannes; Potter, David G.; Hawkins, Edith; Barrish, James P.; Mathur, Brian N.; Turner, C. Alexander; Geske, Robert; Montgomery, Charles A.; Starbuck, Michael; Brandt, Mary; Gupta, Anupma; Ramirez-Solis, Ramiro; Zambrowicz, Brian P.; Powell, David R.

2001-01-01

A high-throughput, retrovirus-mediated mutagenesis method based on gene trapping in embryonic stem cells was used to identify a novel mouse gene. The human ortholog encodes a transmembrane protein containing five extracellular immunoglobulin-like domains that is structurally related to human NEPHRIN, a protein associated with congenital nephrotic syndrome. Northern analysis revealed wide expression in humans and mice, with highest expression in kidney. Based on similarity to NEPHRIN and abundant expression in kidney, this protein was designated NEPH1 and embryonic stem cells containing the retroviral insertion in the Neph1 locus were used to generate mutant mice. Analysis of kidney RNA from Neph1−/− mice showed that the retroviral insertion disrupted expression of Neph1 transcripts. Neph1−/− pups were represented at the expected normal Mendelian ratios at 1 to 3 days of age but at only 10% of the expected frequency at 10 to 12 days after birth, suggesting an early postnatal lethality. The Neph1−/− animals that survived beyond the first week of life were sickly and small but without edema, and all died between 3 and 8 weeks of age. Proteinuria ranging from 300 to 2,000 mg/dl was present in all Neph1−/− mice. Electron microscopy demonstrated NEPH1 expression in glomerular podocytes and revealed effacement of podocyte foot processes in Neph1−/− mice. These findings suggest that NEPH1, like NEPHRIN, may play an important role in maintaining the structure of the filtration barrier that prevents proteins from freely entering the glomerular urinary space. PMID:11416156

Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

PubMed

Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

2006-12-01

An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

[Prokaryotic expression of Nanog gene and preparation of anti-Nanog antibody].

PubMed

Li, Jun; Wang, Xiao-min; Dou, Zhong-ying; Li, Yong

2012-07-01

To express Nanog fusion protein in Escherichia coli ( E.coli), and to prepare rabbit anti-mouse polyclonal antibodies to the Nanog fusion protein. Mouse Nanog gene was amplified from the pNA992 recombinant plasmid and inserted into pET-32a vector to construct a recombinant expression vector pET-32a-Nanog. The recombinant vector was transfected into E.coli BL21 and induced by IPTG to express in them. The acquired Nanog fusion protein was purified with HisTrap affinity column and injected as an antigen into rabbits for preparing polyclonal antibodies. At last, the titer and specificity of the polyclonal antibodies were analyzed with indirect ELISA, Western blotting and immunocytochemical staining, respectively. The recombinant expression vector pET-32a-Nanog was successfully prepared, transfected and induced to obtain the high expression of the Nanog fusion protein in a form of inclusion bodies in E.coli. After purification, its purity was up to 97%. The titer of anti-Nanog antibodies was 1:32 000 in the immunized rabbit serum, and exhibited a high specificity to Nanog protein. The rabbit anti-mouse polyclonal antibodies have been prepared successfully with a high titer and specificity to the Nanog fusion protein.

Fibulin-1 is required for morphogenesis of neural crest-derived structures

PubMed Central

Cooley, Marion A.; Kern, Christine B.; Fresco, Victor M.; Wessels, Andy; Thompson, Robert P.; McQuinn, Tim C.; Twal, Waleed O.; Mjaatvedt, Corey H.; Drake, Christopher J.; Argraves, W. Scott

2008-01-01

Here we report that mouse embryos homozygous for a gene trap insertion in the fibulin-1 (Fbln1) gene are deficient in Fbln1 and exhibit cardiac ventricular wall thinning and ventricular septal defects with double outlet right ventricle or overriding aorta. Fbln1 nulls also display anomalies of aortic arch arteries, hypoplasia of the thymus and thyroid, underdeveloped skull bones, malformations of cranial nerves and hemorrhagic blood vessels in the head and neck. The spectrum of malformations is consistent with Fbln1 influencing neural crest cell (NCC)-dependent development of these tissues. This is supported by evidence that Fbln1 expression is associated with streams of cranial NCCs migrating adjacent to rhombomeres 2–7 and that Fbln1-deficient embryos display patterning anomalies of NCCs forming cranial nerves IX and X, which derive from rhombomeres 6 and 7. Additionally, Fbln1-deficient embryos show increased apoptosis in areas populated by NCCs derived from rhombomeres 4, 6 and 7. Based on these findings, it is concluded that Fbln1 is required for the directed migration and survival of cranial NCCs contributing to the development of pharyngeal glands, craniofacial skeleton, cranial nerves, aortic arch arteries, cardiac outflow tract and cephalic blood vessels. PMID:18538758

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

PubMed

Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

2017-10-27

Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.

Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

PubMed

Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

2018-03-01

Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

PubMed Central

Dunn, R. C.; Laurie, C. C.

1995-01-01

Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Rotifer rDNA-specific R9 retrotransposable elements generate an exceptionally long target site duplication upon insertion.

PubMed

Gladyshev, Eugene A; Arkhipova, Irina R

2009-12-15

Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

PubMed

Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

2012-05-03

Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

Recurrent abdominal pain as the presentation of tumor necrosis factor receptor-associated periodic syndrome (TRAPS) in an Asian girl: a case report and review of the literature.

PubMed

Chen, Yun-Ju; Yu, Hsin-Hui; Yang, Yao-Hsu; Lau, Yu-Lung; Lee, Wen-I; Chiang, Bor-Luen

2014-12-01

Tumor necrosis factor receptor-associated periodic syndrome (TRAPS) is characterized by periodic fever, cutaneous rash, conjunctivitis, lymphadenopathy, abdominal pain, myalgia, and arthralgia. It is a rare autosomal dominant disease and strongly associated with heterozygous mutations in the tumor necrosis factor (TNF) receptor super family 1A (TNFRSF1A) gene. It is believed to be more common in Western countries than in Asian countries. Here, we present the case of a 14-year-old girl with periodic fever and abdominal pain with elevation of inflammatory markers for 2 years. After extensive work-up of infectious etiology with negative results, the diagnosis of TRAPS was made although no gene mutations were identified in the TNFRSF1A gene, MVK gene, and NALP3/CIAS1 gene. She had partial clinical response to corticosteroids and immunomodulatory agents. However, the treatment response to TNF-α inhibitor etanercept was dramatic. She has remained symptom free under regular weekly to biweekly etanercept treatment for 2 years. We also reviewed the related literature and summarized the data of 10 Asian cases of TRAPS. Copyright © 2012. Published by Elsevier B.V.

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

PubMed Central

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs

PubMed Central

Sinha, Rahul; Goyal, Pankaj; Grapputo, Alessandro

2011-01-01

Background Insertions of spliceosomal introns are very rare events during evolution of vertebrates and the mechanisms governing creation of novel intron(s) remain obscure. Largely, gene structures of melanocortin (MC) receptors are characterized by intron-less architecture. However, recently a few exceptions have been reported in some fishes. This warrants a systematic survey of MC receptors for understanding intron insertion events during vertebrate evolution. Methodology/Principal Findings We have compiled an extended list of MC receptors from different vertebrate genomes with variations in fishes. Notably, the closely linked MC2Rs and MC5Rs from a group of ray-finned fishes have three and one intron insertion(s), respectively, with conserved positions and intron phase. In both genes, one novel insertion was in the highly conserved DRY motif at the end of helix TM3. Further, the proto-splice site MAG↑R is maintained at intron insertion sites in these two genes. However, the orthologs of these receptors from zebrafish and tetrapods are intron-less, suggesting these introns are simultaneously created in selected fishes. Surprisingly, these novel introns are traceable only in four fish genomes. We found that these fish genomes are severely compacted after the separation from zebrafish. Furthermore, we also report novel intron insertions in P2Y receptors and in CHRM3. Finally, we report ultrasmall introns in MC2R genes from selected fishes. Conclusions/Significance The current repository of MC receptors illustrates that fishes have no MC3R ortholog. MC2R, MC5R, P2Y receptors and CHRM3 have novel intron insertions only in ray-finned fishes that underwent genome compaction. These receptors share one intron at an identical position suggestive of being inserted contemporaneously. In addition to repetitive elements, genome compaction is now believed to be a new hallmark that promotes intron insertions, as it requires rapid DNA breakage and subsequent repair processes to gain back normal functionality. PMID:21850219

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Evidence for a Retroviral Insertion in TRPM1 as the Cause of Congenital Stationary Night Blindness and Leopard Complex Spotting in the Horse

PubMed Central

Bellone, Rebecca R.; Holl, Heather; Setaluri, Vijayasaradhi; Devi, Sulochana; Maddodi, Nityanand; Archer, Sheila; Sandmeyer, Lynne; Ludwig, Arne; Foerster, Daniel; Pruvost, Melanie; Reissmann, Monika; Bortfeldt, Ralf; Adelson, David L.; Lim, Sim Lin; Nelson, Janelle; Haase, Bianca; Engensteiner, Martina; Leeb, Tosso; Forsyth, George; Mienaltowski, Michael J.; Mahadevan, Padmanabhan; Hofreiter, Michael; Paijmans, Johanna L. A.; Gonzalez-Fortes, Gloria; Grahn, Bruce; Brooks, Samantha A.

2013-01-01

Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ2=1022.00, p<<0.0005), and CSNB, testing 43 horses (χ2=43, p<<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder. PMID:24167615

Evidence for a retroviral insertion in TRPM1 as the cause of congenital stationary night blindness and leopard complex spotting in the horse.

PubMed

Bellone, Rebecca R; Holl, Heather; Setaluri, Vijayasaradhi; Devi, Sulochana; Maddodi, Nityanand; Archer, Sheila; Sandmeyer, Lynne; Ludwig, Arne; Foerster, Daniel; Pruvost, Melanie; Reissmann, Monika; Bortfeldt, Ralf; Adelson, David L; Lim, Sim Lin; Nelson, Janelle; Haase, Bianca; Engensteiner, Martina; Leeb, Tosso; Forsyth, George; Mienaltowski, Michael J; Mahadevan, Padmanabhan; Hofreiter, Michael; Paijmans, Johanna L A; Gonzalez-Fortes, Gloria; Grahn, Bruce; Brooks, Samantha A

2013-01-01

Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ(2)=1022.00, p<0.0005), and CSNB, testing 43 horses (χ(2)=43, p<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder.

Novel insertion in exon 5 of the TCOF1 gene in twin sisters with Treacher Collins syndrome.

PubMed

Marszałek-Kruk, Bożena Anna; Wójcicki, Piotr; Smigiel, Robert; Trzeciak, Wiesław H

2012-08-01

Treacher Collins syndrome (TCS) is associated with an abnormal differentiation of the first and second pharyngeal arches during fetal development. This causes mostly craniofacial deformities, which require numerous corrective surgeries. TCS is an autosomal dominant disorder and it occurs in the general population at a frequency of 1 in 50,000 live births. The syndrome is caused by mutations in the TCOF1 gene, which encodes the serine/alanine-rich protein named Treacle. Over 120 mutations of the TCOF1 gene responsible for TCS have been described. About 70% of recognized mutations are deletions, which lead to a frame shift, formation of a termination codon, and shortening of the protein product of the gene. Herewith, a new heterozygotic insertion, c.484_668ins185bp, was described in two monozygotic twin sisters suffering from TCS. This mutation was absent in their father, brother, and uncle, indicating a de novo origin. The insertion causes a shift in the reading frame and premature termination of translation at 167 aa. The novel insertion is the longest ever found in the TCOF1 gene and the only one found among monozygotic twin sisters.

IS1598 (IsPg4) distributed to abscess-forming strains of Porphyromonas gingivalis may enhance virulence through upregulation of nrdD-like gene expression.

PubMed

Sonoi, Norihiro; Maeda, Hiroshi; Murauchi, Toshimitsu; Yamamoto, Tadashi; Omori, Kazuhiro; Kokeguchi, Susumu; Naruishi, Koji; Takashiba, Shogo

2018-01-01

An insertion sequence, IS1598 (IsPg4) has been found in virulent strains of Porphyromonas gingivalis in a murine abscess model. The present study was performed to investigate the effects of genetic rearrangements by IS1598 on the phenotypic characteristics of the virulent strains. For this purpose, we searched for a common insertion site of IS1598 among the virulent strains. Through cloning and database search, a common insertion site was identified beside an nrdD-like gene in the virulent FDC 381, W83 and W50 strains. In this region, predicted promoters of the nrdD-like gene and IS1598 are located in tandem, and accumulation of nrdD-like gene mRNA was 5-fold higher in virulent strains (W83, W50, FDC 381) than avirulent strains (ATCC33277, SU63, SUNY1021, ESO59 without IS1598). The role of the nrdD-like gene in virulence of P. gingivalis was investigated by constructing a nrdD-deficient mutant. In the murine abscess model, the parental W83 strain produced necrotic abscesses, while the nrdD-deficient mutant had almost lost this ability. Insertion of IS1598 into the nrdD-like gene promoter region may be related to the phenotypic differences in virulence among P. gingivalis strains through upregulation of the expression of this gene.

Highly efficient CRISPR/HDR-mediated knock-in for mouse embryonic stem cells and zygotes.

PubMed

Wang, Bangmei; Li, Kunyu; Wang, Amy; Reiser, Michelle; Saunders, Thom; Lockey, Richard F; Wang, Jia-Wang

2015-10-01

The clustered regularly interspaced short palindromic repeat (CRISPR) gene editing technique, based on the non-homologous end-joining (NHEJ) repair pathway, has been used to generate gene knock-outs with variable sizes of small insertion/deletions with high efficiency. More precise genome editing, either the insertion or deletion of a desired fragment, can be done by combining the homology-directed-repair (HDR) pathway with CRISPR cleavage. However, HDR-mediated gene knock-in experiments are typically inefficient, and there have been no reports of successful gene knock-in with DNA fragments larger than 4 kb. Here, we describe the targeted insertion of large DNA fragments (7.4 and 5.8 kb) into the genomes of mouse embryonic stem (ES) cells and zygotes, respectively, using the CRISPR/HDR technique without NHEJ inhibitors. Our data show that CRISPR/HDR without NHEJ inhibitors can result in highly efficient gene knock-in, equivalent to CRISPR/HDR with NHEJ inhibitors. Although NHEJ is the dominant repair pathway associated with CRISPR-mediated double-strand breaks (DSBs), and biallelic gene knock-ins are common, NHEJ and biallelic gene knock-ins were not detected. Our results demonstrate that efficient targeted insertion of large DNA fragments without NHEJ inhibitors is possible, a result that should stimulate interest in understanding the mechanisms of high efficiency CRISPR targeting in general.

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage

PubMed Central

Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage.

PubMed

Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene

PubMed Central

Yoshida, Asuka; Samal, Siba K.

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3′-to-5′ attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV. PMID:28473820

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene.

PubMed

Yoshida, Asuka; Samal, Siba K

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.

A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2010-12-01

We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.

Construction of Poxviruses as Cloning Vectors: Insertion of the Thymidine Kinase Gene from Herpes Simplex Virus into the DNA of Infectious Vaccinia Virus

NASA Astrophysics Data System (ADS)

Panicali, Dennis; Paoletti, Enzo

1982-08-01

We have constructed recombinant vaccinia viruses containing the thymidine kinase gene from herpes simplex virus. The gene was inserted into the genome of a variant of vaccinia virus that had undergone spontaneous deletion as well as into the 120-megadalton genome of the large prototypic vaccinia variant. This was accomplished via in vivo recombination by contransfection of eukaryotic tissue culture cells with cloned BamHI-digested thymidine kinase gene from herpes simplex virus containing flanking vaccinia virus DNA sequences and infectious rescuing vaccinia virus. Pure populations of the recombinant viruses were obtained by replica filter techniques or by growth of the recombinant virus in biochemically selective medium. The herpes simplex virus thymidine kinase gene, as an insert in vaccinia virus, is transcribed in vivo and in vitro, and the fidelity of in vivo transcription into a functional gene product was detected by the phosphorylation of 5-[125I]iodo-2'-deoxycytidine.

Microbial community structure and function on sinking particles in the North Pacific Subtropical Gyre

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fontanez, Kristina M.; Eppley, John M.; Samo, Ty J.

Sinking particles mediate the transport of carbon and energy to the deep-sea, yet the specific microbes associated with sedimenting particles in the ocean's interior remain largely uncharacterized. In this study, we used particle interceptor traps (PITs) to assess the nature of particle-associated microbial communities collected at a variety of depths in the North Pacific Subtropical Gyre. Comparative metagenomics was used to assess differences in microbial taxa and functional gene repertoires in PITs containing a preservative (poisoned traps) compared to preservative-free traps where growth was allowed to continue in situ (live traps). Live trap microbial communities shared taxonomic and functional similaritiesmore » with bacteria previously reported to be enriched in dissolved organic matter (DOM) microcosms (e.g., Alteromonas and Methylophaga), in addition to other particle and eukaryote-associated bacteria (e.g., Flavobacteriales and Pseudoalteromonas). Poisoned trap microbial assemblages were enriched in Vibrio and Campylobacterales likely associated with eukaryotic surfaces and intestinal tracts as symbionts, pathogens, or saprophytes. The functional gene content of microbial assemblages in poisoned traps included a variety of genes involved in virulence, anaerobic metabolism, attachment to chitinaceaous surfaces, and chitin degradation. The presence of chitinaceaous surfaces was also accompanied by the co-existence of bacteria which encoded the capacity to attach to, transport and metabolize chitin and its derivatives. Distinctly different microbial assemblages predominated in live traps, which were largely represented by copiotrophs and eukaryote-associated bacterial communities. Predominant sediment trap-assocaited eukaryotic phyla included Dinoflagellata, Metazoa (mostly copepods), Protalveolata, Retaria, and Stramenopiles. In conclusion, these data indicate the central role of eukaryotic taxa in structuring sinking particle microbial assemblages, as well as the rapid responses of indigenous microbial species in the degradation of marine particulate organic matter (POM) in situ in the ocean's interior.« less

Microbial community structure and function on sinking particles in the North Pacific Subtropical Gyre

DOE PAGES

Fontanez, Kristina M.; Eppley, John M.; Samo, Ty J.; ...

2015-05-19

Sinking particles mediate the transport of carbon and energy to the deep-sea, yet the specific microbes associated with sedimenting particles in the ocean's interior remain largely uncharacterized. In this study, we used particle interceptor traps (PITs) to assess the nature of particle-associated microbial communities collected at a variety of depths in the North Pacific Subtropical Gyre. Comparative metagenomics was used to assess differences in microbial taxa and functional gene repertoires in PITs containing a preservative (poisoned traps) compared to preservative-free traps where growth was allowed to continue in situ (live traps). Live trap microbial communities shared taxonomic and functional similaritiesmore » with bacteria previously reported to be enriched in dissolved organic matter (DOM) microcosms (e.g., Alteromonas and Methylophaga), in addition to other particle and eukaryote-associated bacteria (e.g., Flavobacteriales and Pseudoalteromonas). Poisoned trap microbial assemblages were enriched in Vibrio and Campylobacterales likely associated with eukaryotic surfaces and intestinal tracts as symbionts, pathogens, or saprophytes. The functional gene content of microbial assemblages in poisoned traps included a variety of genes involved in virulence, anaerobic metabolism, attachment to chitinaceaous surfaces, and chitin degradation. The presence of chitinaceaous surfaces was also accompanied by the co-existence of bacteria which encoded the capacity to attach to, transport and metabolize chitin and its derivatives. Distinctly different microbial assemblages predominated in live traps, which were largely represented by copiotrophs and eukaryote-associated bacterial communities. Predominant sediment trap-assocaited eukaryotic phyla included Dinoflagellata, Metazoa (mostly copepods), Protalveolata, Retaria, and Stramenopiles. In conclusion, these data indicate the central role of eukaryotic taxa in structuring sinking particle microbial assemblages, as well as the rapid responses of indigenous microbial species in the degradation of marine particulate organic matter (POM) in situ in the ocean's interior.« less

Response to crizotinib in a non-small-cell lung cancer patient harboring an EML4-ALK fusion with an atypical LTBP1 insertion.

PubMed

Aguado, Cristina; Gil, Maria-de-Los-Llanos; Yeste, Zaira; Giménez-Capitán, Ana; Teixidó, Cristina; Karachaliou, Niki; Viteri, Santiago; Rosell, Rafael; Molina-Vila, Miguel A

2018-01-01

Fusion of the anaplastic lymphoma receptor tyrosine kinase gene ( ALK ) with the echinoderm microtubule-associated protein 4 gene ( EML4 ) is the second most common actionable alteration in non-small-cell lung cancer, with a frequency of 5%. Here, we present a case of an EML4-ALK-positive patient with an atypical in-frame insertion from the LTBP1 gene in the canonical junction of variant 1 . The patient was a 39-year-old never-smoker female diagnosed with Stage IV lung adenocarcinoma. A core biopsy was negative for EGFR and KRAS mutations but positive for ALK immunohistochemistry and fluorescence in situ hybridization. When submitted to nCounter, the sample showed a 3'/5' imbalance indicative of an ALK rearrangement, but failed to give a positive signal for any of the variants tested. Finally, a band with a molecular weight higher than expected appeared after reverse transcriptase-polymerase chain reaction analysis. When Sanger sequencing was performed, the band revealed an atypical EML4-ALK fusion gene with an in-frame 129 bp insertion. A 115 bp segment of the insertion corresponded to an intronic region of LTBP1 , a gene located in the short arm of chromosome 2, between ALK and EML4 . The patient received crizotinib and showed a good therapeutic response that is still ongoing after 12 months. Our result suggests that short in-frame insertions of other genes in the EML4-ALK junction do not affect the sensitivity of the EML4-ALK fusion protein to crizotinib.

Activity of genes with functions in human Williams-Beuren Syndrome are impacted by mobile element insertions in the gray wolf genome.

PubMed

vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S

2018-06-01

In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.

Identification and characterization of a new multigene family in the human MHC: A candidate autoimmune disease susceptibility element (3.8-1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, J.M.; Venditti, C.P.; Chorney, M.J.

1994-09-01

An association between idiopathic hemochromatosis (HFE) and the HLA-A3 locus has been previously well-established. In an attempt to identify potential HFE candidate genes, a genomic DNA fragment distal to the HLA-A9 breakpoint was used to screen a B cell cDNA library; a member (3.8-1) of a new multigene family, composed of five distinct genomic cross-reactive fragments, was identified. Clone 3.8-1 represents the 3{prime} end of 9.6 kb transcript which is expressed in multiple tissues including the spleen, thymus, lung and kidney. Sequencing and genome database analysis indicate that 3.8-1 is unique, with no homology to any known entries. The genomicmore » residence of 3-8.1, defined by polymorphism analysis and physical mapping using YAC clones, appears to be absent from the genomes of higher primates, although four other cross-reactivities are maintained. The absence of this gene as well as other probes which map in the TNF to HLA-B interval, suggest that this portion of the human HMC, located between the Class I and Class III regions, arose in humans as the result of a post-speciation insertional event. The large size of the 3.8-1 gene and the possible categorization of 3.8-1 as a human-specific gene are significant given the genetic data that place an autoimmune susceptibility element for IDDM and myasthenia gravis in the precise region where this gene resides. In an attempt to isolate the 5{prime} end of this large transcript, we have constructed a cosmid contig which encompasses the genomic locus of this gene and are progressively isolating coding sequences by exon trapping.« less

Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

PubMed

Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

2016-11-04

Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types, duplication ages and co-expression consequences.

Sidewall penetrator for oil wells

NASA Technical Reports Server (NTRS)

Collins, E. R., Jr.

1981-01-01

Penetrator bores horizontal holes in well casing to increase trapped oil drainage. Several penetrators operated by common drive are inserted into well at once. Shaft, made from spiraling cable, rotates and thrusts simultaneously through rigid curvilinear guide tube forcing bit through casing into strata. Device pierces more deeply than armor-piercing bullets and shaped explosive charges.

The loss-of-allele assay for ES cell screening and mouse genotyping.

PubMed

Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

2010-01-01

Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.

A high-current electron gun for the electron beam ion trap at the National Superconducting Cyclotron Laboratory.

PubMed

Schwarz, S; Baumann, T M; Kittimanapun, K; Lapierre, A; Snyder, A

2014-02-01

The Electron Beam Ion Trap (EBIT) in NSCL's reaccelerator ReA uses continuous ion injection and accumulation. In order to maximize capture efficiency and minimize breeding time into high charge states, the EBIT requires a high-current/high current-density electron beam. A new electron gun insert based on a concave Ba-dispenser cathode has been designed and built to increase the current transmitted through the EBIT's superconducting magnet. With the new insert, stable EBIT operating conditions with 0.8 A of electron beam have been established. The design of the electron gun is presented together with calculated and measured perveance data. In order to assess the experimental compression of the electron beam, a pinhole CCD camera has been set up to measure the electron beam radius. The camera observes X-rays emitted from highly charged ions, excited by the electron beam. Initial tests with this camera setup will be presented. They indicate that a current density of 640 A/cm(2) has been reached when the EBIT magnet was operated at 4 T.

A high-current electron gun for the electron beam ion trap at the National Superconducting Cyclotron Laboratory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwarz, S., E-mail: schwarz@nscl.msu.edu; Baumann, T. M.; Kittimanapun, K.

The Electron Beam Ion Trap (EBIT) in NSCL’s reaccelerator ReA uses continuous ion injection and accumulation. In order to maximize capture efficiency and minimize breeding time into high charge states, the EBIT requires a high-current/high current-density electron beam. A new electron gun insert based on a concave Ba-dispenser cathode has been designed and built to increase the current transmitted through the EBIT’s superconducting magnet. With the new insert, stable EBIT operating conditions with 0.8 A of electron beam have been established. The design of the electron gun is presented together with calculated and measured perveance data. In order to assessmore » the experimental compression of the electron beam, a pinhole CCD camera has been set up to measure the electron beam radius. The camera observes X-rays emitted from highly charged ions, excited by the electron beam. Initial tests with this camera setup will be presented. They indicate that a current density of 640 A/cm{sup 2} has been reached when the EBIT magnet was operated at 4 T.« less

Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system.

PubMed

Peng, Feng; Wang, Xinyue; Sun, Yang; Dong, Guibin; Yang, Yankun; Liu, Xiuxia; Bai, Zhonghu

2017-11-14

Corynebacterium glutamicum (C. glutamicum) has traditionally been used as a microbial cell factory for the industrial production of many amino acids and other industrially important commodities. C. glutamicum has recently been established as a host for recombinant protein expression; however, some intrinsic disadvantages could be improved by genetic modification. Gene editing techniques, such as deletion, insertion, or replacement, are important tools for modifying chromosomes. In this research, we report a CRISPR/Cas9 system in C. glutamicum for rapid and efficient genome editing, including gene deletion and insertion. The system consists of two plasmids: one containing a target-specific guide RNA and a homologous sequence to a target gene, the other expressing Cas9 protein. With high efficiency (up to 100%), this system was used to disrupt the porB, mepA, clpX and Ncgl0911 genes, which affect the ability to express proteins. The porB- and mepA-deletion strains had enhanced expression of green fluorescent protein, compared with the wild-type stain. This system can also be used to engineer point mutations and gene insertions. In this study, we adapted the CRISPR/Cas9 system from S. pyogens to gene deletion, point mutations and insertion in C. glutamicum. Compared with published genome modification methods, methods based on the CRISPR/Cas9 system can rapidly and efficiently achieve genome editing. Our research provides a powerful tool for facilitating the study of gene function, metabolic pathways, and enhanced productivity in C. glutamicum.

A Novel Intergenic ETnII-β Insertion Mutation Causes Multiple Malformations in Polypodia Mice

PubMed Central

Lehoczky, Jessica A.; Thomas, Peedikayil E.; Patrie, Kevin M.; Owens, Kailey M.; Villarreal, Lisa M.; Galbraith, Kenneth; Washburn, Joe; Johnson, Craig N.; Gavino, Bryant; Borowsky, Alexander D.; Millen, Kathleen J.; Wakenight, Paul; Law, William; Van Keuren, Margaret L.; Gavrilina, Galina; Hughes, Elizabeth D.; Saunders, Thomas L.; Brihn, Lesil; Nadeau, Joseph H.; Innis, Jeffrey W.

2013-01-01

Mouse early transposon insertions are responsible for ∼10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd), a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5′ LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development. PMID:24339789

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

PubMed

Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

PubMed

Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

2014-05-01

To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

Contribution of transposable elements in the plant's genome.

PubMed

Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Rice, David; Rafii, M Y; Azizi, Parisa; Osman, Mohamad; Taheri, Sima; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat; Noor, Yusuf Muhammad

2018-07-30

Plants maintain extensive growth flexibility under different environmental conditions, allowing them to continuously and rapidly adapt to alterations in their environment. A large portion of many plant genomes consists of transposable elements (TEs) that create new genetic variations within plant species. Different types of mutations may be created by TEs in plants. Many TEs can avoid the host's defense mechanisms and survive alterations in transposition activity, internal sequence and target site. Thus, plant genomes are expected to utilize a variety of mechanisms to tolerate TEs that are near or within genes. TEs affect the expression of not only nearby genes but also unlinked inserted genes. TEs can create new promoters, leading to novel expression patterns or alternative coding regions to generate alternate transcripts in plant species. TEs can also provide novel cis-acting regulatory elements that act as enhancers or inserts within original enhancers that are required for transcription. Thus, the regulation of plant gene expression is strongly managed by the insertion of TEs into nearby genes. TEs can also lead to chromatin modifications and thereby affect gene expression in plants. TEs are able to generate new genes and modify existing gene structures by duplicating, mobilizing and recombining gene fragments. They can also facilitate cellular functions by sharing their transposase-coding regions. Hence, TE insertions can not only act as simple mutagens but can also alter the elementary functions of the plant genome. Here, we review recent discoveries concerning the contribution of TEs to gene expression in plant genomes and discuss the different mechanisms by which TEs can affect plant gene expression and reduce host defense mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.

Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

PubMed Central

Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2016-01-01

The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

Targeted gene insertion for molecular medicine.

PubMed

Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

2008-11-01

Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

The development of a cisgenic apple plant.

PubMed

Vanblaere, Thalia; Szankowski, Iris; Schaart, Jan; Schouten, Henk; Flachowsky, Henryk; Broggini, Giovanni A L; Gessler, Cesare

2011-07-20

Cisgenesis represents a step toward a new generation of GM crops. The lack of selectable genes (e.g. antibiotic or herbicide resistance) in the final product and the fact that the inserted gene(s) derive from organisms sexually compatible with the target crop should rise less environmental concerns and increase consumer's acceptance. Here we report the generation of a cisgenic apple plant by inserting the endogenous apple scab resistance gene HcrVf2 under the control of its own regulatory sequences into the scab susceptible apple cultivar Gala. A previously developed method based on Agrobacterium-mediated transformation combined with a positive and negative selection system and a chemically inducible recombination machinery allowed the generation of apple cv. Gala carrying the scab resistance gene HcrVf2 under its native regulatory sequences and no foreign genes. Three cisgenic lines were chosen for detailed investigation and were shown to carry a single T-DNA insertion and express the target gene HcrVf2. This is the first report of the generation of a true cisgenic plant. Copyright © 2011 Elsevier B.V. All rights reserved.

Genes and Gene Therapy

MedlinePlus

... a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

Impact of the excision of an ancient repeat insertion on Rickettsia conorii guanylate kinase activity.

PubMed

Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel

2006-11-01

The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.

Gene Expression Analysis of Mouse Embryonic Stem Cells Following Levitation in an Ultrasound Standing Wave Trap

PubMed Central

Bazou, Despina; Kearney, Roisin; Mansergh, Fiona; Bourdon, Celine; Farrar, Jane; Wride, Michael

2011-01-01

In the present paper, gene expression analysis of mouse embryonic stem (ES) cells levitated in a novel ultrasound standing wave trap (USWT) (Bazou et al. 2005a) at variable acoustic pressures (0.08–0.85 MPa) and times (5–60 min) was performed. Our results showed that levitation of ES cells at the highest employed acoustic pressure for 60 min does not modify gene expression and cells maintain their pluripotency. Embryoid bodies (EBs) also expressed the early and late neural differentiation markers, which were also unaffected by the acoustic field. Our results suggest that the ultrasound trap microenvironment is minimally invasive as the biologic consequences of ES cell replication and EB differentiation proceed without significantly affecting gene expression. The technique holds great promise in safe cell manipulation techniques for a variety of applications including tissue engineering and regenerative medicine. (E-mail: Bazoud@tcd.ie) PMID:21208732

Uncapped mRNA introduced into tobacco protoplasts can be imported into the nucleus and is trapped by leptomycin B.

PubMed

Stuger, Rogier; Forreiter, Christoph

2004-08-01

The mechanism of nuclear export of RNAs in yeast and animal cells is rapidly being uncovered, but RNA export in plants has received little attention. We introduced capped and uncapped fluorescent mRNAs into tobacco (Nicotiana plumbaginifolia) protoplasts and studied their cellular localization. Following insertion, capped transcripts were found in the cytoplasm, while uncapped messengers transiently appeared in the nucleus in about one-quarter to one-third of the cells. These mRNAs were trapped by the nuclear export-inhibiting drug leptomycin B, pointing to an export mechanism in plants similar to Rev-NES-mediated RNP export in other organisms.

Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky.

PubMed

Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel

2008-10-01

Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

PubMed Central

2012-01-01

Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

Coil spring venting arrangement

DOEpatents

McCugh, R.M.

1975-10-21

A simple venting device for trapped gas pockets in hydraulic systems is inserted through a small access passages, operated remotely, and removed completely. The device comprises a small diameter, closely wound coil spring which is pushed through a guide temporarily inserted in the access passage. The guide has a central passageway which directs the coil spring radially upward into the pocket, so that, with the guide properly positioned for depth and properly oriented, the coil spring can be pushed up into the top of the pocket to vent it. By positioning a seal around the free end of the guide, the spring and guide are removed and the passage is sealed.

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

PubMed

Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

2018-06-01

Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

PubMed

Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

2007-07-01

Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

A High-Throughput Arabidopsis Reverse Genetics System

PubMed Central

Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

2002-01-01

A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

Recombining overlapping BACs into a single larger BAC.

PubMed

Kotzamanis, George; Huxley, Clare

2004-01-06

BAC clones containing entire mammalian genes including all the transcribed region and long range controlling elements are very useful for functional analysis. Sequenced BACs are available for most of the human and mouse genomes and in many cases these contain intact genes. However, large genes often span more than one BAC, and single BACs covering the entire region of interest are not available. Here we describe a system for linking two or more overlapping BACs into a single clone by homologous recombination. The method was used to link a 61-kb insert carrying the final 5 exons of the human CFTR gene onto a 160-kb BAC carrying the first 22 exons. Two rounds of homologous recombination were carried out in the EL350 strain of bacteria which can be induced for the Red genes. In the first round, the inserts of the two overlapping BACs were subcloned into modified BAC vectors using homologous recombination. In the second round, the BAC to be added was linearised with the very rare-cutting enzyme I-PpoI and electroporated into recombination efficient EL350 bacteria carrying the other BAC. Recombined BACs were identified by antibiotic selection and PCR screening and 10% of clones contained the correctly recombined 220-kb BAC. The system can be used to link the inserts from any overlapping BAC or PAC clones. The original orientation of the inserts is not important and desired regions of the inserts can be selected. The size limit for the fragments recombined may be larger than the 61 kb used here and multiple BACs in a contig could be combined by alternating use of the two pBACLink vectors. This system should be of use to many investigators wishing to carry out functional analysis on large mammalian genes which are not available in single BAC clones.

Negative regulatory loci coupling flagellin synthesis to flagellar assembly in Salmonella typhimurium.

PubMed Central

Gillen, K L; Hughes, K T

1991-01-01

The complex regulation of flagellin gene expression in Salmonella typhimurium was characterized in vivo by using lac transcriptional fusions to the two flagellin structural genes (fliC [H1] and fljB [H2]). Phase variation was measured as the rate of switching of flagellin gene expression. Switching frequencies varied from 1/500 per cell per generation to 1/10,000 per cell per generation depending on the particular insertion and the direction of switching. There is a 4- to 20-fold bias in favor of switching from the fljB(On) to the fljB(Off) orientation. Random Tn10dTc insertions were isolated which failed to express flagellin. While most of these insertions mapped to loci known to be required for flagellin expression, several new loci were identified. The presence of functional copies of all of the genes responsible for complete flagellar assembly, except the hook-associated proteins (flgK, flgL, and fliD gene products), were required for expression of the fliC or fljB flagellin genes. Two novel loci involved in negative regulation of fliC and fljB in fla mutant backgrounds were identified. One of these loci, designated the flgR locus, mapped to the flg operon at 23 min on the Salmonella linkage map. An flgR insertion mutation resulted in relief of repression of the fliC and fljB genes in all fla mutant backgrounds except for mutants in the positive regulatory loci (flhC, flhD, and fliA genes). PMID:1848842

Drechslerella stenobrocha genome illustrates the mechanism of constricting rings and the origin of nematode predation in fungi

PubMed Central

2014-01-01

Background Nematode-trapping fungi are a unique group of organisms that can capture nematodes using sophisticated trapping structures. The genome of Drechslerella stenobrocha, a constricting-ring-forming fungus, has been sequenced and reported, and provided new insights into the evolutionary origins of nematode predation in fungi, the trapping mechanisms, and the dual lifestyles of saprophagy and predation. Results The genome of the fungus Drechslerella stenobrocha, which mechanically traps nematodes using a constricting ring, was sequenced. The genome was 29.02 Mb in size and was found rare instances of transposons and repeat induced point mutations, than that of Arthrobotrys oligospora. The functional proteins involved in nematode-infection, such as chitinases, subtilisins, and adhesive proteins, underwent a significant expansion in the A. oligospora genome, while there were fewer lectin genes that mediate fungus-nematode recognition in the D. stenobrocha genome. The carbohydrate-degrading enzyme catalogs in both species were similar to those of efficient cellulolytic fungi, suggesting a saprophytic origin of nematode-trapping fungi. In D. stenobrocha, the down-regulation of saprophytic enzyme genes and the up-regulation of infection-related genes during the capture of nematodes indicated a transition between dual life strategies of saprophagy and predation. The transcriptional profiles also indicated that trap formation was related to the protein kinase C (PKC) signal pathway and regulated by Zn(2)–C6 type transcription factors. Conclusions The genome of D. stenobrocha provides support for the hypothesis that nematode trapping fungi evolved from saprophytic fungi in a high carbon and low nitrogen environment. It reveals the transition between saprophagy and predation of these fungi and also proves new insights into the mechanisms of mechanical trapping. PMID:24507587

A single gene mutation that increases maize seed weight

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giroux, M.J.; Shaw, J.; Hannah, L.C.

1996-06-11

The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less

Identification of a two-component signal transduction system involved in fimbriation of Porphyromonas gingivalis.

PubMed

Hayashi, J; Nishikawa, K; Hirano, R; Noguchi, T; Yoshimura, F

2000-01-01

Porphyromonas gingivalis, a periodontopathogen, is an oral anaerobic gram-negative bacterium with numerous fimbriae on the cell surface. Fimbriae have been considered to be an important virulence factor in this organism. We analyzed the genomic DNA of transposon-induced, fimbria-deficient mutants derived from ATCC 33277 and found that seven independent mutants had transposon insertions within the same restriction fragment. Cloning and sequencing of the disrupted region from one of the mutants revealed two adjacent open reading frames (ORFs) which seemed to encode a two-component signal transduction system. We also found that six of the mutants had insertions in a gene, fimS, a homologue of the genes encoding sensor kinase, and that the insertion in the remaining one disrupted the gene immediately downstream, fimR, a homologue of the response regulator genes in other bacteria. These findings suggest that this two-component regulatory system is involved in fimbriation of P. gingivalis.

Evaluating Risks of Insertional Mutagenesis by DNA Transposons in Gene Therapy

PubMed Central

Hackett, Perry B.; Largaespada, David A.; Switzer, Kirsten C.; Cooper, Laurence J.N.

2013-01-01

Investigational therapy can be successfully undertaken using viral- and non-viral-mediated ex vivo gene transfer. Indeed, recent clinical trials have established the potential for genetically modified T cells to improve and restore health. Recently the Sleeping Beauty (SB) transposon/transposase system has been applied in clinical trials to stably insert a chimeric antigen receptor (CAR) to redirect T-cell specificity. We discuss the context in which the SB system can be harnessed for gene therapy and describe the human application of SB-modified CAR+ T cells. We have focused on theoretical issues relating to insertional mutagenesis in the context of human genomes that are naturally subjected to remobilization of transposons and the experimental evidence over the last decade of employing SB transposons for defining genes that induce cancer. These findings are put into the context of the use of SB transposons in the treatment of human disease. PMID:23313630

The P gene of bovine parainfluenza virus 3 expresses all three reading frames from a single mRNA editing site.

PubMed Central

Pelet, T; Curran, J; Kolakofsky, D

1991-01-01

The P gene of bovine parainfluenza virus 3 (bPIV3) contains two downstream overlapping ORFs, called V and D. By comparison with the mRNA editing sites of other paramyxoviruses, two editing sites were predicted for bPIV3; site a to express the D protein, and site b to express the V protein. Examination of the bPIV3 mRNAs, however, indicates that site b is non-functional whereas site a operates frequently. Insertions at site a give rise to both V and D protein mRNAs, because a very broad distribution of Gs is added when insertions occur. This broad distribution is very different from the editing sites of Sendai virus or SV5, where predominantly one form of edited mRNA containing either a one or two G insertion respectively is created, to access the single overlapping ORF of these viruses. A model is proposed to explain how paramyxoviruses control the range of G insertions on that fraction of the mRNAs where insertions occur. The bPIV3 P gene is unique as far as we know, in that a sizeable portion of the gene expresses all 3 reading frames as protein. bPIV3 apparently does this from a single editing site by removing the constraints which control the number of slippage rounds which take place. Images PMID:1846805

An investigation into the association between HLA-G 14 bp insertion/deletion polymorphism and multiple sclerosis susceptibility.

PubMed

Mohammadi, Nabiallah; Adib, Minoo; Alsahebfosoul, Fereshteh; Kazemi, Mohammad; Etemadifar, Masoud

2016-01-15

Human Leukocyte Antigen G (HLA-G) gene polymorphism and expression rate have recently been suggested to have a potential role in susceptibility to Multiple Sclerosis (MS), a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system with unknown etiology. The aim of this study was to investigate the association of the frequency of HLA-G gene 14 bp insertion/deletion polymorphism and its plasma level with MS susceptibility. In this study, the HLA-G gene from 212 patients and 210 healthy individuals was amplified using real time PCR and screened for the 14 bp insertion/deletion polymorphism. In addition, HLA-G plasma levels of the patients were measured and compared to normal controls by ELISA method. Our results revealed that 14 bp insertion in HLA-G could result in lower plasma HLA-G level of the subjects, regardless of their health status and vice versa. Additionally, significant correlation of HLA-G genotype and its plasma level with MS susceptibility was observed. In conclusion, not only HLA-G 14 bp insertion/deletion polymorphism could be associated with expression rate of the HLA-G gene and its plasma level, but also could be considered as a risk factor for susceptibility to MS in our study population. Copyright © 2015 Elsevier B.V. All rights reserved.

Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.

PubMed Central

Kalos, M; Zissler, J

1990-01-01

The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982

Expression of homing endonuclease gene and insertion-like element in sea anemone mitochondrial genomes: Lesson learned from Anemonia viridis.

PubMed

Chi, Sylvia Ighem; Urbarova, Ilona; Johansen, Steinar D

2018-04-30

The mitochondrial genomes of sea anemones are dynamic in structure. Invasion by genetic elements, such as self-catalytic group I introns or insertion-like sequences, contribute to sea anemone mitochondrial genome expansion and complexity. By using next generation sequencing we investigated the complete mtDNAs and corresponding transcriptomes of the temperate sea anemone Anemonia viridis and its closer tropical relative Anemonia majano. Two versions of fused homing endonuclease gene (HEG) organization were observed among the Actiniidae sea anemones; in-frame gene fusion and pseudo-gene fusion. We provided support for the pseudo-gene fusion organization in Anemonia species, resulting in a repressed HEG from the COI-884 group I intron. orfA, a putative protein-coding gene with insertion-like features, was present in both Anemonia species. Interestingly, orfA and COI expression were significantly up-regulated upon long-term environmental stress corresponding to low seawater pH conditions. This study provides new insights to the dynamics of sea anemone mitochondrial genome structure and function. Copyright © 2018 Elsevier B.V. All rights reserved.

Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.

PubMed

Wang, Limei; Beer, Steven V

2006-12-01

To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.

Effects of Hematopoietic Lineage and Precursor Age on CML Disease Progression

DTIC Science & Technology

2007-03-01

ABL gene was inserted is bi-cistronic and contains the gene encoding green fluorescence protein (GFP) in addition to BCR-ABL, we were able to assess...ribosome entry site (IRES) enhanced green fluorescent protein (EGFP) or 5’ LTR-driven IRES EGFP for 24-36 hours; We received the BCR-ABL construct...from our collaborator, Dr. Owen Witte. This gene was then inserted into a murine retrovirus. We then prepared stocks of retrovirus to be used for

Transposon integration enhances expression of stress response genes.

PubMed

Feng, Gang; Leem, Young-Eun; Levin, Henry L

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.

Transposon integration enhances expression of stress response genes

PubMed Central

Feng, Gang; Leem, Young-Eun; Levin, Henry L.

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295

Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

PubMed Central

Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

2006-01-01

Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

Interspecific and host-related gene expression patterns in nematode-trapping fungi.

PubMed

Andersson, Karl-Magnus; Kumar, Dharmendra; Bentzer, Johan; Friman, Eva; Ahrén, Dag; Tunlid, Anders

2014-11-11

Nematode-trapping fungi are soil-living fungi that capture and kill nematodes using special hyphal structures called traps. They display a large diversity of trapping mechanisms and differ in their host preferences. To provide insights into the genetic basis for this variation, we compared the transcriptome expressed by three species of nematode-trapping fungi (Arthrobotrys oligospora, Monacrosporium cionopagum and Arthrobotrys dactyloides, which use adhesive nets, adhesive branches or constricting rings, respectively, to trap nematodes) during infection of two different plant-pathogenic nematode hosts (the root knot nematode Meloidogyne hapla and the sugar beet cyst nematode Heterodera schachtii). The divergence in gene expression between the fungi was significantly larger than that related to the nematode species being infected. Transcripts predicted to encode secreted proteins and proteins with unknown function (orphans) were overrepresented among the highly expressed transcripts in all fungi. Genes that were highly expressed in all fungi encoded endopeptidases, such as subtilisins and aspartic proteases; cell-surface proteins containing the carbohydrate-binding domain WSC; stress response proteins; membrane transporters; transcription factors; and transcripts containing the Ricin-B lectin domain. Differentially expressed transcripts among the fungal species encoded various lectins, such as the fungal fruit-body lectin and the D-mannose binding lectin; transcription factors; cell-signaling components; proteins containing a WSC domain; and proteins containing a DUF3129 domain. A small set of transcripts were differentially expressed in infections of different host nematodes, including peptidases, WSC domain proteins, tyrosinases, and small secreted proteins with unknown function. This is the first study on the variation of infection-related gene expression patterns in nematode-trapping fungi infecting different host species. A better understanding of these patterns will facilitate the improvements of these fungi in biological control programs, by providing molecular markers for screening programs and candidates for genetic manipulations of virulence and host preferences.

Utilization of next generation sequencing for analyzing transgenic insertions in plum

USDA-ARS?s Scientific Manuscript database

When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...

Casting of weldable graphite/magnesium metal matrix composites with built-in metallic inserts

NASA Technical Reports Server (NTRS)

Lee, Jonathan A.; Kashalikar, Uday; Majkowski, Patricia

1994-01-01

Technology innovations directed at the advanced development of a potentially low cost and weldable graphite/magnesium metal matrix composites (MMC) through near net shape pressure casting are described. These MMC components uniquely have built-in metallic inserts to provide an innovative approach for joining or connecting other MMC components through conventional joining techniques such as welding, brazing, mechanical fasteners, etc. Moreover, the metallic inserts trapped within the MMC components can be made to transfer the imposed load efficiently to the continuous graphite fiber reinforcement thus producing stronger, stiffer, and more reliable MMC components. The use of low pressure near net shape casting is economical compared to other MMC fabrication processes. These castable and potentially weldable MMC components can provide great payoffs in terms of high strength, high stiffness, low thermal expansion, lightweight, and easily joinable MMC components for several future NASA space structural, industrial, and commercial applications.

Subcellular localisations of the CPTI collection of YFP-tagged proteins in Drosophila embryos

PubMed Central

Lye, Claire M.; Naylor, Huw W.; Sanson, Bénédicte

2014-01-01

A key challenge in the post-genomic area is to identify the function of the genes discovered, with many still uncharacterised in all metazoans. A first step is transcription pattern characterisation, for which we now have near whole-genome coverage in Drosophila. However, we have much more limited information about the expression and subcellular localisation of the corresponding proteins. The Cambridge Protein Trap Consortium generated, via piggyBac transposition, over 600 novel YFP-trap proteins tagging just under 400 Drosophila loci. Here, we characterise the subcellular localisations and expression patterns of these insertions, called the CPTI lines, in Drosophila embryos. We have systematically analysed subcellular localisations at cellularisation (stage 5) and recorded expression patterns at stage 5, at mid-embryogenesis (stage 11) and at late embryogenesis (stages 15-17). At stage 5, 31% of the nuclear lines (41) and 26% of the cytoplasmic lines (67) show discrete localisations that provide clues on the function of the protein and markers for organelles or regions, including nucleoli, the nuclear envelope, nuclear speckles, centrosomes, mitochondria, the endoplasmic reticulum, Golgi, lysosomes and peroxisomes. We characterised the membranous/cortical lines (102) throughout stage 5 to 10 during epithelial morphogenesis, documenting their apico-basal position and identifying those secreted in the extracellular space. We identified the tricellular vertices as a specialized membrane domain marked by the integral membrane protein Sidekick. Finally, we categorised the localisation of the membranous/cortical proteins during cytokinesis. PMID:25294944

A natural allele of Nxf1/TAP supresses retrovirus insertional mutations

PubMed Central

Floyd, Jennifer A.; Gold, David A.; Concepcion, Dorothy; Poon, Tiffany H.; Wang, Xiaobo; Keithley, Elizabeth; Chen, Dan; Ward, Erica J.; Chinn, Steven B.; Friedman, Rick A.; Yu, Hon-Tsen; Moriwaki, Kazuo; Shiroishi, Toshihiko; Hamilton, Bruce A.

2009-01-01

Endogenous retroviruses have shaped the evolution of mammalian genomes. Host genes that control the effects of retrovirus insertions are therefore of great interest. The Modifier-of-vibrator-1 locus controls level of correctly processed mRNA from genes mutated by endogenous retrovirus insertions into introns, including the pitpnvb tremor mutation and the Eya1BOR model of human branchiootorenal syndrome. Positional complementation cloning identifies Mvb1 as the nuclear export factor Nxf1, providing an unexpected link between mRNA export receptor and pre-mRNA processing. Population structure of the suppressing allele in wild M. m. castaneus suggests selective advantage. A congenic Mvb1CAST allele is a useful tool for modifying gene expression from existing mutations and could be used to manipulate engineered mutations containing retroviral elements. PMID:14517553

Insertion of a solo LTR retrotransposon associates with spur mutations in 'Red Delicious' apple (Malus × domestica).

PubMed

Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun

2017-09-01

Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.

An EAV-HP Insertion in 5′ Flanking Region of SLCO1B3 Causes Blue Eggshell in the Chicken

PubMed Central

Yang, Xiaolin; Li, Guangqi; Zhang, Yuanyuan; Li, Junying; Wang, Xiaotong; Bai, Jirong; Xu, Guiyun; Deng, Xuemei; Yang, Ning; Wu, Changxin

2013-01-01

The genetic determination of eggshell coloration has not been determined in birds. Here we report that the blue eggshell is caused by an EAV-HP insertion that promotes the expression of SLCO1B3 gene in the uterus (shell gland) of the oviduct in chicken. In this study, the genetic map location of the blue eggshell gene was refined by linkage analysis in an F2 chicken population, and four candidate genes within the refined interval were subsequently tested for their expression levels in the shell gland of the uterus from blue-shelled and non-blue-shelled hens. SLCO1B3 gene was found to be the only one expressed in the uterus of blue-shelled hens but not in that of non-blue-shelled hens. Results from a pyrosequencing analysis showed that only the allele of SLCO1B3 from blue-shelled chickens was expressed in the uterus of heterozygous hens (O*LC/O*N). SLCO1B3 gene belongs to the organic anion transporting polypeptide (OATP) family; and the OATPs, functioning as membrane transporters, have been reported for the transportation of amphipathic organic compounds, including bile salt in mammals. We subsequently resequenced the whole genomic region of SLCO1B3 and discovered an EAV-HP insertion in the 5′ flanking region of SLCO1B3. The EAV-HP insertion was found closely associated with blue eggshell phenotype following complete Mendelian segregation. In situ hybridization also demonstrated that the blue eggshell is associated with ectopic expression of SLCO1B3 in shell glands of uterus. Our finding strongly suggests that the EAV-HP insertion is the causative mutation for the blue eggshell phenotype. The insertion was also found in another Chinese blue-shelled breed and an American blue-shelled breed. In addition, we found that the insertion site in the blue-shelled chickens from Araucana is different from that in Chinese breeds, which implied independent integration events in the blue-shelled chickens from the two continents, providing a parallel evolutionary example at the molecular level. PMID:23359636

A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers.

PubMed

Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng

2015-12-01

The ornamental peach cultivar 'Hongbaihuatao (HBH)' can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene-regulator involved in anthocyanin transport (Riant)-which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Dictyostelium mobile elements: strategies to amplify in a compact genome.

PubMed

Winckler, T; Dingermann, T; Glöckner, G

2002-12-01

Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.

Volatilization of Arsenic from Polluted Soil by Pseudomonas putida Engineered for Expression of the arsM Arsenic(III) S-Adenosine Methyltransferase Gene

PubMed Central

2015-01-01

Even though arsenic is one of the most widespread environmental carcinogens, methods of remediation are still limited. In this report we demonstrate that a strain of Pseudomonas putida KT2440 endowed with chromosomal expression of the arsM gene encoding the As(III) S-adenosylmethionine (SAM) methyltransfase from Rhodopseudomonas palustris to remove arsenic from contaminated soil. We genetically engineered the P. putida KT2440 with stable expression of an arsM-gfp fusion gene (GE P. putida), which was inserted into the bacterial chromosome. GE P. putida showed high arsenic methylation and volatilization activity. When exposed to 25 μM arsenite or arsenate overnight, most inorganic arsenic was methylated to the less toxic methylated arsenicals methylarsenate (MAs(V)), dimethylarsenate (DMAs(V)) and trimethylarsine oxide (TMAs(V)O). Of total added arsenic, the species were about 62 ± 2.2% DMAs(V), 25 ± 1.4% MAs(V) and 10 ± 1.2% TMAs(V)O. Volatilized arsenicals were trapped, and the predominant species were dimethylarsine (Me2AsH) (21 ± 1.0%) and trimethylarsine (TMAs(III)) (10 ± 1.2%). At later times, more DMAs(V) and volatile species were produced. Volatilization of Me2AsH and TMAs(III) from contaminated soil is thus possible with this genetically engineered bacterium and could be instrumental as an agent for reducing the inorganic arsenic content of soil and agricultural products. PMID:25122054

Volatilization of arsenic from polluted soil by Pseudomonas putida engineered for expression of the arsM Arsenic(III) S-adenosine methyltransferase gene.

PubMed

Chen, Jian; Sun, Guo-Xin; Wang, Xiao-Xue; Lorenzo, Víctor de; Rosen, Barry P; Zhu, Yong-Guan

2014-09-02

Even though arsenic is one of the most widespread environmental carcinogens, methods of remediation are still limited. In this report we demonstrate that a strain of Pseudomonas putida KT2440 endowed with chromosomal expression of the arsM gene encoding the As(III) S-adenosylmethionine (SAM) methyltransfase from Rhodopseudomonas palustris to remove arsenic from contaminated soil. We genetically engineered the P. putida KT2440 with stable expression of an arsM-gfp fusion gene (GE P. putida), which was inserted into the bacterial chromosome. GE P. putida showed high arsenic methylation and volatilization activity. When exposed to 25 μM arsenite or arsenate overnight, most inorganic arsenic was methylated to the less toxic methylated arsenicals methylarsenate (MAs(V)), dimethylarsenate (DMAs(V)) and trimethylarsine oxide (TMAs(V)O). Of total added arsenic, the species were about 62 ± 2.2% DMAs(V), 25 ± 1.4% MAs(V) and 10 ± 1.2% TMAs(V)O. Volatilized arsenicals were trapped, and the predominant species were dimethylarsine (Me2AsH) (21 ± 1.0%) and trimethylarsine (TMAs(III)) (10 ± 1.2%). At later times, more DMAs(V) and volatile species were produced. Volatilization of Me2AsH and TMAs(III) from contaminated soil is thus possible with this genetically engineered bacterium and could be instrumental as an agent for reducing the inorganic arsenic content of soil and agricultural products.

Gene expression analysis of mouse embryonic stem cells following levitation in an ultrasound standing wave trap.

PubMed

Bazou, Despina; Kearney, Roisin; Mansergh, Fiona; Bourdon, Celine; Farrar, Jane; Wride, Michael

2011-02-01

In the present paper, gene expression analysis of mouse embryonic stem (ES) cells levitated in a novel ultrasound standing wave trap (USWT) (Bazou et al. 2005a) at variable acoustic pressures (0.08-0.85 MPa) and times (5-60 min) was performed. Our results showed that levitation of ES cells at the highest employed acoustic pressure for 60 min does not modify gene expression and cells maintain their pluripotency. Embryoid bodies (EBs) also expressed the early and late neural differentiation markers, which were also unaffected by the acoustic field. Our results suggest that the ultrasound trap microenvironment is minimally invasive as the biologic consequences of ES cell replication and EB differentiation proceed without significantly affecting gene expression. The technique holds great promise in safe cell manipulation techniques for a variety of applications including tissue engineering and regenerative medicine. Copyright © 2011 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Biallelic insertion of a transcriptional terminator via the CRISPR/Cas9 system efficiently silences expression of protein-coding and non-coding RNA genes.

PubMed

Liu, Yangyang; Han, Xiao; Yuan, Junting; Geng, Tuoyu; Chen, Shihao; Hu, Xuming; Cui, Isabelle H; Cui, Hengmi

2017-04-07

The type II bacterial CRISPR/Cas9 system is a simple, convenient, and powerful tool for targeted gene editing. Here, we describe a CRISPR/Cas9-based approach for inserting a poly(A) transcriptional terminator into both alleles of a targeted gene to silence protein-coding and non-protein-coding genes, which often play key roles in gene regulation but are difficult to silence via insertion or deletion of short DNA fragments. The integration of 225 bp of bovine growth hormone poly(A) signals into either the first intron or the first exon or behind the promoter of target genes caused efficient termination of expression of PPP1R12C , NSUN2 (protein-coding genes), and MALAT1 (non-protein-coding gene). Both NeoR and PuroR were used as markers in the selection of clonal cell lines with biallelic integration of a poly(A) signal. Genotyping analysis indicated that the cell lines displayed the desired biallelic silencing after a brief selection period. These combined results indicate that this CRISPR/Cas9-based approach offers an easy, convenient, and efficient novel technique for gene silencing in cell lines, especially for those in which gene integration is difficult because of a low efficiency of homology-directed repair. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A recombinant rabies virus carrying GFP between N and P affects viral transcription in vitro.

PubMed

Luo, Jun; Zhao, Jing; Tian, Qin; Mo, Weiyu; Wang, Yifei; Chen, Hao; Guo, Xiaofeng

2016-06-01

Several studies have demonstrated the rabies virus to be a perfect potential vaccine vector to insert foreign genes into the target genome. For this study, a green fluorescent protein (GFP) gene was cloned into the rabies virus (RABV) genome between the N and P gene. CT dinucleotide was inserted as intergenic region. The recombinant high egg passage Flury strain (HEP-Flury) of RABV, carrying GFP (rHEP-NP-GFP), was generated in BHK-21 cells using reverse genetics. According to the viral growth kinetics assay, the addition of GFP between N and P gene has little effect on the viral growth compared to the parental strain HEP-Flury. Quantitative real-time PCR (qPCR) indicated that rHEP-NP-GFP showed different viral gene transcription, especially for G gene, compared to HEP-Flury. The same is true for one other recombinant RABV carrying GFP between G and L gene in NA cells. In addition, parent HEP-Flury showed more expression of innate immune-related molecules in NA cells. Compared to HEP-Flury, Western blotting (WB) indicated that insertion of a foreign gene following N gene enhanced the expression of M and G proteins. According to the qPCR and WB, GFP expression levels of rHEP-NP-GFP were significantly higher than rHEP-GFP. This study indicates HEP-Flury as valid vector to express exogenous genes between N and P.

Unusual Properties of Regulatory DNA from the Drosophila Engrailed Gene: Three ``pairing-Sensitive'' Sites within a 1.6-Kb Region

PubMed Central

Kassis, J. A.

1994-01-01

We have previously shown that a 2-kb fragment of engrailed DNA can suppress expression of a linked marker gene, white, in the P element vector CaSpeR. This suppression is dependent on the presence of two copies of engrailed DNA-containing P elements (P[en]) in proximity in the Drosophila genome (either in cis or in trans). In this study, the 2-kb fragment was dissected and found to contain three fragments of DNA which could mediate white suppression [called ``pairing-sensitive sites'' (PS)]. A PS site was also identified in regulatory DNA from the Drosophila escargot gene. The eye colors of six different P[en] insertions in the escargot gene suggest an interaction between P[en]-encoded and genome-encoded PS sites. I hypothesize that white gene expression from P[en] is repressed by the formation of a protein complex which is initiated at the engrailed PS sites and also requires interactions with flanking genomic DNA. Genes were sought which influence the function of PS sites. Mutations in some Polycomb and trithorax group genes were found to affect the eye color from some P[en] insertion sites. However, different mutations affected expression from different P[en] insertion sites and no one mutation was found to affect expression from all P[en] insertion sites examined. These results suggest that white expression from P[en] is not directly regulated by members of the Polycomb and trithorax group genes, but in some cases can be influenced by them. I propose that engrailed PS sites normally act to promote interactions between distantly located engrailed regulatory sites and the engrailed promoter. PMID:8005412

Gene conversion as a mechanism for divergence of a chloroplast tRNA gene inserted in the mitochondrial genome of Brassica oleracea.

PubMed Central

Dron, M; Hartmann, C; Rode, A; Sevignac, M

1985-01-01

We have characterized a 1.7 kb sequence, containing a tRNA Leu2 gene shared by the ct and mt genomes of Brassica oleracea. The two sequences are completely homologous except in two short regions where two distinct gene conversion events have occurred between two sets of direct repeats leading to the insertion of 5 bp in the T loop of the mt copy of the ct gene. This is the first evidence that gene conversion represents the initial evolutionary step in inactivation of transferred ct genes in the mt genome. We also indicate that organelle DNA transfer by organelle fusion is an ongoing process which could be useful in genetic engineering. PMID:4080548

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

A Look to Future Directions in Gene Therapy Research for Monogenic Diseases

PubMed Central

Porteus, Matthew H; Connelly, Jon P; Pruett, Shondra M

2006-01-01

The concept of gene therapy has long appealed to biomedical researchers and clinicians because it promised to treat certain diseases at their origins. In the last several years, there have been several trials in which patients have benefited from gene therapy protocols. This progress, however, has revealed important problems, including the problem of insertional oncogenesis. In this review, which focuses on monogenic diseases, we discuss the problem of insertional oncogenesis and identify areas for future research, such as developing more quantitative assays for risk and efficacy, and ways of minimizing the genotoxic effects of gene therapy protocols, which will be important if gene therapy is to fulfill its conceptual promise. PMID:17009872

Identification of the novel lincosamide resistance gene lnu(E) truncated by ISEnfa5-cfr-ISEnfa5 insertion in Streptococcus suis: de novo synthesis and confirmation of functional activity in Staphylococcus aureus.

PubMed

Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong; Schwarz, Stefan; Wang, Yang

2014-01-01

The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin.

Identification of the Novel Lincosamide Resistance Gene lnu(E) Truncated by ISEnfa5-cfr-ISEnfa5 Insertion in Streptococcus suis: De Novo Synthesis and Confirmation of Functional Activity in Staphylococcus aureus

PubMed Central

Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong

2014-01-01

The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin. PMID:24366733

Analysis of the K1 capsule biosynthesis genes of Escherichia coli: definition of three functional regions for capsule production.

PubMed

Boulnois, G J; Roberts, I S; Hodge, R; Hardy, K R; Jann, K B; Timmis, K N

1987-06-01

Transposon and deletion analysis of the cloned K1 capsule biosynthesis genes of Escherichia coli revealed that approximately 17 kb of DNA, split into three functional regions, is required for capsule production. One block (region 1) is required for translocation of polysaccharide to the cell surface and mutations in this region result in the intracellular appearance of polymer indistinguishable on immunoelectrophoresis to that found on the surface of K1 encapsulated bacteria. This material was released from the cell by osmotic shock indicating that the polysaccharide was probably present in the periplasmic space. Insertions in a second block (region 2) completely abolished polymer production and this second region is believed to encode the enzymes for the biosynthesis and polymerisation of the K1 antigen. Addition of exogenous N-acetylneuraminic acid to one insertion mutant in this region restored its ability to express surface polymer as judged by K1 phage sensitivity. This insertion probably defines genes involved in biosynthesis of N-acetylneuraminic acid. Insertions in a third block (region 3) result in the intracellular appearance of polysaccharide with a very low electrophoretic mobility. The presence of the cloned K1 capsule biosynthesis genes on a multicopy plasmid in an E. coli K-12 strain did not increase the yields of capsular polysaccharide produced compared to the K1+ isolate from which the genes were cloned.

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

PubMed Central

Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

2008-01-01

Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

Identification of a monofunctional aspartate kinase gene of Arabidopsis thaliana with spatially and temporally regulated expression.

PubMed

Yoshioka, Y; Kurei, S; Machida, Y

2001-06-01

We screened a gene trap library of Arabidopsis thaliana and isolated a line in which a gene encoding a homologue of monofunctional aspartate kinase was trapped by the reporter gene. Aspartate kinase (AK) is a key enzyme in the biosynthsis of aspartate family amino acids such as lysine, threonine, isoleucine, and methionine. In plants, two types of AK are known: one is AK which is sensitive to feedback inhibition by threonine and carries both AK and homoserine dehydrogenase (HSD) activities. The other one is monofunctional, sensitive to lysine and synergistically S-adenosylmethionine, and has only AK activity. We concluded that the trapped gene encoded a monofunctional aspartate kinase and designated as AK-lys3, because it lacked the HSD domain and had an amino acid sequence highly similar to those of the monofunctional aspartate kinases ofA. thaliana. AK-lys3 was highly expressed in xylem of leaves and hypocotyls and stele of roots. Significant expression of this gene was also observed in trichomes after bolting. Slight expression of AK-lys3 was detected in vascular bundles and mesophyll cells of cauline leaves, inflorescence stems, sepals, petals, and stigmas. These results indicated that this aspartate kinase gene was not expressed uniformly but in a spatially specific manner.

An integrated laser trap/flow control video microscope for the study of single biomolecules.

PubMed Central

Wuite, G J; Davenport, R J; Rappaport, A; Bustamante, C

2000-01-01

We have developed an integrated laser trap/flow control video microscope for mechanical manipulation of single biopolymers. The instrument is automated to maximize experimental throughput. A single-beam optical trap capable of trapping micron-scale polystyrene beads in the middle of a 200-microm-deep microchamber is used, making it possible to insert a micropipette inside this chamber to hold a second bead by suction. Together, these beads function as easily exchangeable surfaces between which macromolecules of interest can be attached. A computer-controlled flow system is used to exchange the liquid in the chamber and to establish a flow rate with high precision. The flow and the optical trap can be used to exert forces on the beads, the displacements of which can be measured either by video microscopy or by laser deflection. To test the performance of this instrument, individual biotinylated DNA molecules were assembled between two streptavidin beads, and the DNA elasticity was characterized using both laser trap and flow forces. DNA extension under varying forces was measured by video microscopy. The combination of the flow system and video microscopy is a versatile design that is particularly useful for the study of systems susceptible to laser-induced damage. This capability was demonstrated by following the translocation of transcribing RNA polymerase up to 650 s. PMID:10920045

Trapping two types of particles using a double-ring-shaped radially polarized beam

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Yaoju; Ding Biaofeng; Suyama, Taikei

An optical-trap method based on the illumination of a double-ring-shaped radially polarized beam (R-TEM{sub 11}*) is proposed. The numerical results based on the vector diffraction theory show that a highly focused R-TEM{sub 11}* beam not only can produce a bright spot but also can form an optical cage in the focal region by changing the truncation parameter {beta}, defined as the ratio of the radius of the aperture to the waist of the beam. The radiation forces acting on Rayleigh particles are calculated by using the Rayleigh scattering theory. The bright spot generated by the R-TEM{sub 11}* beam with amore » {beta} value close to 2 can three-dimensionally trap a particle with a refractive index larger than that of the ambient. An optical cage or three-dimensional dark spot generated by the R-TEM{sub 11}* beam with a {beta} value close to 1.3 can three-dimensionally trap a particle with refractive index smaller than that of the ambient. Because the adjustment of the truncation parameter can be actualized by simply changing the radius of a circular aperture inserted in the front of the lens, only one optical-trap system in the present method can be used to three-dimensionally trap two types of particles with different refractive indices.« less

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Structure and expression of the attacin genes in Hyalophora cecropia.

PubMed

Sun, S C; Lindström, I; Lee, J Y; Faye, I

1991-02-26

To study the regulation of the immune genes in insects, we have cloned and sequenced the attacin gene locus of the giant silk moth Hyalophora cecropia. The locus contains one acidic and one basic attacin gene as well as two pseudogenes, which are remnants of basic attacin genes. A small insertion element was found within the locus. The two functional attacin genes are transcribed in opposite directions and have two introns inserted at homologous positions. A common sequence, GGGGATTCCT, is found at nucleotide position -48 in the acidic gene and at nucleotide position -58 in the basic gene. Interestingly, this decanucleotide is similar to the consensus of the NF-k B-binding site. Expression studies revealed that both attacins are strongly induced by phorbol 12-myristate 13-acetate, lipopolysaccharide and bacteria. However, only the acidic attacin gene showed a clear response to injury.

[Observation on gene polymorphism of Rh blood group in Chinese Han nationality].

PubMed

Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong

2003-12-01

To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.

Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

PubMed

Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

2017-10-01

A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

Construction of Signature-tagged Mutant Library in Mesorhizobium loti as a Powerful Tool for Functional Genomics

PubMed Central

Shimoda, Yoshikazu; Mitsui, Hisayuki; Kamimatsuse, Hiroko; Minamisawa, Kiwamu; Nishiyama, Eri; Ohtsubo, Yoshiyuki; Nagata, Yuji; Tsuda, Masataka; Shinpo, Sayaka; Watanabe, Akiko; Kohara, Mitsuyo; Yamada, Manabu; Nakamura, Yasukazu; Tabata, Satoshi; Sato, Shusei

2008-01-01

Rhizobia are nitrogen-fixing soil bacteria that establish endosymbiosis with some leguminous plants. The completion of several rhizobial genome sequences provides opportunities for genome-wide functional studies of the physiological roles of many rhizobial genes. In order to carry out genome-wide phenotypic screenings, we have constructed a large mutant library of the nitrogen-fixing symbiotic bacterium, Mesorhizobium loti, by transposon mutagenesis. Transposon insertion mutants were generated using the signature-tagged mutagenesis (STM) technique and a total of 29 330 independent mutants were obtained. Along with the collection of transposon mutants, we have determined the transposon insertion sites for 7892 clones, and confirmed insertions in 3680 non-redundant M. loti genes (50.5% of the total number of M. loti genes). Transposon insertions were randomly distributed throughout the M. loti genome without any bias toward G+C contents of insertion target sites and transposon plasmids used for the mutagenesis. We also show the utility of STM mutants by examining the specificity of signature tags and test screenings for growth- and nodulation-deficient mutants. This defined mutant library allows for genome-wide forward- and reverse-genetic functional studies of M. loti and will serve as an invaluable resource for researchers to further our understanding of rhizobial biology. PMID:18658183

Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

PubMed

Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

2016-05-01

Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

[Mutants of bacterium Azospirillum brasilense Sp245 with Omegon insertion in mmsB or fabG genes of lipid metabolism are defective in motility and flagellation].

PubMed

Kovtunov, E A; Shelud'ko, A V; Chernyshova, M P; Petrova, L P; Katsy, E I

2013-11-01

Bacteria Azospirillum brasilense have mixed flagellation: in addition to the polar flagellum, numerous lateral flagella are formed in their cells on medium with increased density. Flagella determine the active swimming and swarming capacities of azospirilla. Using A. brasilense Sp245 as an example, we showed that the Omegon-Km artificial transposon insertion into the chromosomal gene for 3-hydroxyisobutyrate dehydrogenase (mmsB) was concurrent with the appearance of significant defects in the formation of polar flagella and with the paralysis of lateral flagella. The Sp245 mutant with the Omegon insertion into the plasmid AZOBR_p1-borne gene for 3-oxoacyl-[acyl-carrier protein]-reductase (fabG) showed the complete loss of flagella and the swarming capacity, as well as significant defects in polar flagellar assembly (though some cells are still motile in liquid medium). The viability of the A. brasilense Sp245 mutants with the Omegon insertion into the mmsB or fabG gene was not reduced. No considerable differences in the fatty acid composition of whole cell lipid extracts were found for the A. brasilense Sp245 strain and its mmsB and fabG mutants.

Construction and characterization of a recombinant invertebrate iridovirus.

PubMed

Ozgen, Arzu; Muratoglu, Hacer; Demirbag, Zihni; Vlak, Just M; van Oers, Monique M; Nalcacioglu, Remziye

2014-08-30

Chilo iridescent virus (CIV), officially named Insect iridescent virus 6 (IIV6), is the type species of the genus Iridovirus (family Iridoviridae). In this paper we constructed a recombinant CIV, encoding the green fluorescent protein (GFP). This recombinant can be used to investigate viral replication dynamics. We showed that homologous recombination is a valid method to make CIV gene knockouts and to insert foreign genes. The CIV 157L gene, putatively encoding a non-functional inhibitor of apoptosis (IAP), was chosen as target for foreign gene insertion. The gfp open reading frame preceded by the viral mcp promoter was inserted into the 157L locus by homologous recombination in Anthonomus grandis BRL-AG-3A cells. Recombinant virus (rCIV-Δ157L-gfp) was purified by successive rounds of plaque purification. All plaques produced by the purified recombinant virus emitted green fluorescence due to the presence of GFP. One-step growth curves for recombinant and wild-type CIV were similar and the recombinant was fully infectious in vivo. Hence, CIV157L can be inactivated without altering the replication kinetics of the virus. Consequently, the CIV 157L locus can be used as a site for insertion of foreign DNA, e.g. to modify viral properties for insect biocontrol. Copyright © 2014 Elsevier B.V. All rights reserved.

[Analysis of Alu-insertion polymorphism in three subethnic groups of Kalmyks].

PubMed

Khusainova, R I; Balinova, N V; Kutuev, I A; Spitsina, N Kh; Akhmetova, V L; Valiev, R R; Spitsyn, V A; Khusnutdinova, E K

2009-03-01

Eight Alu insertions at the NBC27, TPA25, NBC148, NBC123, ACE, APOA1, NBC51, and PV92 locus were examined in three subethnic groups of Kalmyks (Torgouds, Derbets, and Buzava). In general, the pattern of allele frequencies in Kalmyks was consistent with that in Asian populations of the world, and was similar to the Alu insertion frequencies pattern in Turkic populations of the Volga--Ural region and Central Asia. Pairwise comparisons of three subpopulations of Kalmyks with respect to the frequency distributions of eight Alu insertions revealed the differences between the groups examined. The coefficient of gene differentiation, F(st), constituted 1.37%, pointing to the common origin of the groups of interest, as well as to the uniformity of the gene pools of subethnic groups of Kalmyks examined.

Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene.

PubMed Central

Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G

1995-01-01

A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070

Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9

PubMed Central

Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu

2015-01-01

ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037

Identification of Novel Virulence Determinants in Mycobacterium paratuberculosis by Screening a Library of Insertional Mutants†

PubMed Central

Shin, Sung Jae; Wu, Chia-wei; Steinberg, Howard; Talaat, Adel M.

2006-01-01

Johne's disease, caused by Mycobacterium paratuberculosis infection, is a worldwide problem for the dairy industry and has a possible involvement in Crohn's disease in humans. To identify virulence determinants of this economically important pathogen, a library of 5,060 transposon mutants was constructed using Tn5367 insertion mutagenesis, followed by large-scale sequencing to identify disrupted genes. In this report, 1,150 mutants were analyzed and 970 unique insertion sites were identified. Sequence analysis of the disrupted genes indicated that the insertion of Tn5367 was more prevalent in genomic regions with G+C content (50.5 to 60.5%) lower than the average G+C content (69.3%) of the rest of the genome. Phenotypic screening of the library identified disruptions of genes involved in iron, tryptophan, or mycolic acid metabolic pathways that displayed unique growth characteristics. Bioinformatic analysis of disrupted genes identified a list of potential virulence determinants for further testing with animals. Mouse infection studies showed a significant decrease in tissue colonization by mutants with a disruption in the gcpE, pstA, kdpC, papA2, impA, umaA1, or fabG2_2 gene. Attenuation phenotypes were tissue specific (e.g., for the umaA1 mutant) as well as time specific (e.g., for the impA mutant), suggesting that those genes may be involved in different virulence mechanisms. The identified potential virulence determinants represent novel functional classes that could be necessary for mycobacterial survival during infection and could provide suitable targets for vaccine and drug development against Johne's and Crohn's diseases. PMID:16790754

A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers

PubMed Central

Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng

2015-01-01

The ornamental peach cultivar ‘Hongbaihuatao (HBH)’ can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene—regulator involved in anthocyanin transport (Riant)—which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. PMID:26357885

Characterization of Novel Hepatitis B Virus PreS/S-Gene Mutations in a Patient with Occult Hepatitis B Virus Infection

PubMed Central

Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping

2016-01-01

Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID:27182775

Transcriptome-wide effects of inverted SINEs on gene expression and their impact on RNA polymerase II activity.

PubMed

Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F

2016-10-25

Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Analysis of the role of tripeptidyl peptidase II in MHC class I antigen presentation in vivo1

PubMed Central

Kawahara, Masahiro; York, Ian A.; Hearn, Arron; Farfan, Diego; Rock, Kenneth L.

2015-01-01

Previous experiments using enzyme inhibitors and RNAi in cell lysates and cultured cells have suggested that tripeptidyl peptidase II (TPPII) plays a role in creating and destroying MHC class I-presented peptides. However, its precise contribution to these processes has been controversial. To elucidate the importance of TPPII in MHC class I antigen presentation, we analyzed TPPII-deficient gene-trapped mice and cell lines from these animals. In these mice, the expression level of TPPII was reduced by >90% compared to wild-type mice. Thymocytes from TPPII gene-trapped mice displayed more MHC class I on the cell surface, suggesting that TPPII normally limits antigen presentation by destroying peptides overall. TPPII gene-trapped mice responded as well as did wild-type mice to four epitopes from lymphocytic choriomeningitis virus (LCMV). The processing and presentation of peptide precursors with long N-terminal extensions in TPPII gene-trapped embryonic fibroblasts was modestly reduced, but in vivo immunization with recombinant lentiviral or vaccinia virus vectors revealed that such peptide precursors induced an equivalent CD8 T cell response in wild type and TPPII-deficient mice. These data indicate while TPPII contributes to the trimming of peptides with very long N-terminal extensions, TPPII is not essential for generating most MHC class I-presented peptides or for stimulating CTL responses to several antigens in vivo. PMID:19841172

Gene leopard nuclei (len P103) participating in control of disjunction and coiling of chromosomes in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omel`yanchuk, L.V.

1995-12-01

A lethal insertion of an element P[lArB], which caused nondisjunction and structural abnormalities in chromosomes in the neuroblasts of homozygous larvae, was found. The insertion was mapped to region 57B1-12 of the polytene map of chromosome 2 of Drosophila. The expression of the corresponding gene was found in testes, ovaries, and neural ganglia. 8 refs., 6 figs.

The pht4;1-3 mutant line contains a loss of function allele in the Fatty Acid Desaturase 7 gene caused by a remnant inactivated selection marker-a cautionary tale.

PubMed

Nilsson, Anders K; Andersson, Mats X

2017-01-01

A striking and unexpected biochemical phenotype was found in an insertion mutant line in the model plant Arabidopsis thaliana . One of two investigated insertion mutant lines in the gene encoding the phosphate transporter PHT4;1 demonstrated a prominent loss of trienoic fatty acids, whereas the other insertion line was indistinguishable from wild type in this aspect. We demonstrate that the loss of trienoic fatty acids was due to a remnant inactive negative selection marker gene in this particular transposon tagged line, pht4;1-3 . This constitutes a cautionary tale that warns of the importance to confirm the loss of this type of selection markers and the importance of verifying the relationship between a phenotype and genotype by more than one independent mutant line or alternatively genetic complementation.

Distribution of Classical and Nonclassical Virulence Genes in Enterotoxigenic Escherichia coli Isolates from Chilean Children and tRNA Gene Screening for Putative Insertion Sites for Genomic Islands▿†

PubMed Central

Del Canto, Felipe; Valenzuela, Patricio; Cantero, Lidia; Bronstein, Jonathan; Blanco, Jesús E.; Blanco, Jorge; Prado, Valeria; Levine, Myron; Nataro, James; Sommerfelt, Halvor; Vidal, Roberto

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrhea. Three adhesins (Tia, TibA, EtpA), an iron acquisition system (Irp1, Irp2, and FyuA), a GTPase (LeoA), and an autotransporter (EatA) are ETEC virulence-related proteins that, in contrast to the classical virulence factors (enterotoxins and fimbrial colonization factors) have not heretofore been targets in characterizing isolates from epidemiological studies. Here, we determined the occurrence of these nonclassical virulence genes in 103 ETEC isolates from Chilean children with diarrhea and described their association with O serogroups and classical virulence determinants. Because tia, leoA, irp2, and fyuA are harbored by pathogenicity islands inserted into the selC and asnT tRNA genes (tDNAs), we analyzed the regions flanking these loci. Ten additional tDNAs were also screened to identify hot spots for genetic insertions. Associations between the most frequent serogroups and classical colonization factor (CF)-toxin profiles included O6/LT-STh/CS1-CS3-CS21 (i.e., O6 serogroup, heat-labile [LT] and human heat-stable [STh] enterotoxins, and CFs CS1, -3 and -21), O6/LT-STh/CS2-CS3-CS21, and O104-O127/STh/CFAI-CS21. The eatA and etpA genes were detected in more than 70% of the collection, including diverse serogroups and virulence profiles. Sixteen percent of the ETEC strains were negative for classical and nonclassical adhesins, suggesting the presence of unknown determinants of adhesion. The leuX, thrW, and asnT tDNAs were disrupted in more than 65% of strains, suggesting they are hot spots for the insertion of mobile elements. Sequences similar to integrase genes were identified next to the thrW, asnT, pheV, and selC tDNAs. We propose that the eatA and etpA genes should be included in characterizations of ETEC isolates in future epidemiological studies to determine their prevalence in other geographical regions. Sequencing of tDNA-associated genetic insertions might identify new ETEC virulence determinants. PMID:21775541

Potent Nematicidal Activity and New Hybrid Metabolite Production by Disruption of a Cytochrome P450 Gene Involved in the Biosynthesis of Morphological Regulatory Arthrosporols in Nematode-Trapping Fungus Arthrobotrys oligospora.

PubMed

Song, Tian-Yang; Xu, Zi-Fei; Chen, Yong-Hong; Ding, Qiu-Yan; Sun, Yu-Rong; Miao, Yang; Zhang, Ke-Qin; Niu, Xue-Mei

2017-05-24

Types of polyketide synthase-terpenoid synthase (PKS-TPS) hybrid metabolites, including arthrosporols with significant morphological regulatory activity, have been elucidated from nematode-trapping fungus Arthrobotrys oligospora. A previous study suggested that the gene cluster AOL_s00215 in A. oligospora was involved in the production of arthrosporols. Here, we report that disruption of one cytochrome P450 monooxygenase gene AOL_s00215g280 in the cluster resulted in significant phenotypic difference and much aerial hyphae. A further bioassay indicated that the mutant showed a dramatic decrease in the conidial formation but developed numerous traps and killed 85% nematodes within 6 h in contact with prey, in sharp contrast to the wild-type strain with no obvious response. Chemical investigation revealed huge accumulation of three new PKS-TPS epoxycyclohexone derivatives with different oxygenated patterns around the epoxycyclohexone moiety and the absence of arthrosporols in the cultural broth of the mutant ΔAOL_s00215g280. These findings suggested that a study on the biosynthetic pathway for morphological regulatory metabolites in nematode-trapping fungus would provide an efficient way to develop new fungal biocontrol agents.

The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

PubMed

Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A

1998-06-01

We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.

DOE final report 100608.doc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Golden, Susan S

2008-10-16

The aim of this project was to inactivate each locus of the genome of the cyanobacterium Synechococcus elongatus PCC 7942 and screen resulting mutants for altered circadian phenotypes. The immediate goal was to identify all open reading frames (ORFs) that contribute to circadian timing. An additional result was to create a complete archived set of mutagenesis templates, of great utility for the wider research community, that will allow inactivation of any given locus in the genome of S. elongatus. Clones that carry segments of the S. elongatus genome were saturated with transposon insertions in vitro. We completed saturation mutagenesis ofmore » the chromosome (~2800 ORFs). The positions of insertions were sequenced for 17,767 mutagenized clones. Each individual insertion into the S. elongatus DNA in a cosmid or plasmid is a substrate for mutagenesis of the genome via homologous recombination. Because the complete insertion mutation clone set is 5-7 fold redundant, we produced a streamlined set of clones that contains one insertion mutation per locus in the genome, a unigene set. All clones are archived as Escherichia coli stocks frozen in glycerol in 96-well plates at -85ºC and as replicas of these plates on Whatman CloneSaver cards. Each of the mutagenesis substrates from the unigene set has been recombined into the chromosome of wild-type S. elongatus and these cyanobacterial mutants have been archived at -85ºC as well. S. elongatus insertion mutants defective for than 1400 independent genes have screened in luciferase reporter gene backgrounds to evaluate the effect of each mutation on circadian rhythms of gene expression. For the first 700 genes tested, mutagenesis of 71 different ORFs resulted in circadian phenotypes. The mutagenesis project also created insertion mutations in the endogenous large plasmid of S. elongatus, pANL. The sequence of pANL revealed two potential addiction cassettes that appear to account for selection for plasmid persistence. Genetic experiments confirmed that these regions are present on all sub-sets of the plasmid that can replace wild-type pANL. Analysis of mutants defective in each of the remaining ~1400 genes for defects in circadian rhythms will be completed with support from another agency as part of a larger project on circadian rhythms in this cyanobacterium.« less

Clostridium perfringens type A–E toxin plasmids

PubMed Central

Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

2014-01-01

Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

Optical manipulation of microparticles and biological structures

NASA Astrophysics Data System (ADS)

Gahagan, Kevin Thomas

1998-06-01

We report experimental and theoretical investigations of the trapping of microparticles and biological objects using radiation pressure. Part I of this thesis presents a technique for trapping both low and high index microparticles using a single, stationary focused laser beam containing an optical vortex. Advantages of this vortex trap include the ease of implementation, a lower exposure level for high-index particles compared to a standard Gaussian beam trap, and the ability to isolate individual low-index particles in concentrated dispersions. The vortex trap is modeled using ray-tracing methods and a more precise electromagnetic model, which is accurate for particles less than 10 μm in diameter. We have measured the stable equilibrium position for two low-index particle systems (e.g., hollow glass spheres (HGS) in water, and water droplets in acetophenone (W/A)). The strength of the trap was measured for the HGS system along the longitudinal and transverse directions. We also demonstrate simultaneous trapping of a low and high index particle with a vortex beam. The stability of this dual-particle trap is found to depend on the relative particle size, the divergence angle of the beam, and the depth of the particles within the trapping chamber. Part II presents results from an interdisciplinary and collaborative investigation of an all-optical genetic engineering technique whereby Agrobacterium rhizogenes were inserted through a laser-ablated hole in the cell wall of the plant, Gingko biloba. We describe a protocol which includes the control of osmotic conditions, culturing procedures, viability assays and laser microsurgery. We succeeded in placing up to twelve viable bacteria into a single plant cell using this technique. The bacteria are believed to be slightly heated by the Gaussian beam trap. A numerical model is presented predicting a temperature rise of just a few degrees. Whereas G. biloba and A. rhitogenes were chosen for this study because of Ginkgo's pharmaceutical importance, only slight modification of the protocol is needed for other plant species.

A virus vector based on Canine Herpesvirus for vaccine applications in canids.

PubMed

Strive, T; Hardy, C M; Wright, J; Reubel, G H

2007-01-31

Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.

Prioritizing biological pathways by recognizing context in time-series gene expression data.

PubMed

Lee, Jusang; Jo, Kyuri; Lee, Sunwon; Kang, Jaewoo; Kim, Sun

2016-12-23

The primary goal of pathway analysis using transcriptome data is to find significantly perturbed pathways. However, pathway analysis is not always successful in identifying pathways that are truly relevant to the context under study. A major reason for this difficulty is that a single gene is involved in multiple pathways. In the KEGG pathway database, there are 146 genes, each of which is involved in more than 20 pathways. Thus activation of even a single gene will result in activation of many pathways. This complex relationship often makes the pathway analysis very difficult. While we need much more powerful pathway analysis methods, a readily available alternative way is to incorporate the literature information. In this study, we propose a novel approach for prioritizing pathways by combining results from both pathway analysis tools and literature information. The basic idea is as follows. Whenever there are enough articles that provide evidence on which pathways are relevant to the context, we can be assured that the pathways are indeed related to the context, which is termed as relevance in this paper. However, if there are few or no articles reported, then we should rely on the results from the pathway analysis tools, which is termed as significance in this paper. We realized this concept as an algorithm by introducing Context Score and Impact Score and then combining the two into a single score. Our method ranked truly relevant pathways significantly higher than existing pathway analysis tools in experiments with two data sets. Our novel framework was implemented as ContextTRAP by utilizing two existing tools, TRAP and BEST. ContextTRAP will be a useful tool for the pathway based analysis of gene expression data since the user can specify the context of the biological experiment in a set of keywords. The web version of ContextTRAP is available at http://biohealth.snu.ac.kr/software/contextTRAP .

Reconstitutional Mutagenesis of the Maize P Gene by Short-Range Ac Transpositions

PubMed Central

Moreno, M. A.; Chen, J.; Greenblatt, I.; Dellaporta, S. L.

1992-01-01

The tendency for Ac to transpose over short intervals has been utilized to develop insertional mutagenesis and fine structure genetic mapping strategies in maize. We recovered excisions of Ac from the P gene and insertions into nearby chromosomal sites. These closely linked Ac elements reinserted into the P gene, reconstituting over 250 unstable variegated alleles. Reconstituted alleles condition a variety of variegation patterns that reflect the position and orientation of Ac within the P gene. Molecular mapping and DNA sequence analyses have shown that reinsertion sites are dispersed throughout a 12.3-kb chromosomal region in the promoter, exons and introns of the P gene, but in some regions insertions sites were clustered in a nonrandom fashion. Transposition profiles and target site sequence data obtained from these studies have revealed several features of Ac transposition including its preference for certain target sites. These results clearly demonstrate the tendency of Ac to transpose to nearby sites in both proximal and distal directions from the donor site. With minor modifications, reconstitutional mutagenesis should be applicable to many Ac-induced mutations in maize and in other plant species and can possibly be extended to other eukaryotic transposon systems as well. PMID:1325389

Molecular outcomes, clinical consequences, and genetic diagnosis of Oculocutaneous Albinism in Pakistani population.

PubMed

Shahzad, Mohsin; Yousaf, Sairah; Waryah, Yar M; Gul, Hadia; Kausar, Tasleem; Tariq, Nabeela; Mahmood, Umair; Ali, Muhammad; Khan, Muzammil A; Waryah, Ali M; Shaikh, Rehan S; Riazuddin, Saima; Ahmed, Zubair M

2017-03-07

Nonsyndromic oculocutaneous Albinism (nsOCA) is clinically characterized by the loss of pigmentation in the skin, hair, and iris. OCA is amongst the most common causes of vision impairment in children. To date, pathogenic variants in six genes have been identified in individuals with nsOCA. Here, we determined the identities, frequencies, and clinical consequences of OCA alleles in 94 previously unreported Pakistani families. Combination of Sanger and Exome sequencing revealed 38 alleles, including 22 novel variants, segregating with nsOCA phenotype in 80 families. Variants of TYR and OCA2 genes were the most common cause of nsOCA, occurring in 43 and 30 families, respectively. Twenty-two novel variants include nine missense, four splice site, two non-sense, one insertion and six gross deletions. In vitro studies revealed retention of OCA proteins harboring novel missense alleles in the endoplasmic reticulum (ER) of transfected cells. Exon-trapping assays with constructs containing splice site alleles revealed errors in splicing. As eight alleles account for approximately 56% (95% CI: 46.52-65.24%) of nsOCA cases, primarily enrolled from Punjab province of Pakistan, hierarchical strategies for variant detection would be feasible and cost-efficient genetic tests for OCA in families with similar origin. Thus, we developed Tetra-primer ARMS assays for rapid, reliable, reproducible and economical screening of most of these common alleles.

Problems associated with gene transfer and opportunities for microgravity environments

NASA Astrophysics Data System (ADS)

Tennessen, Daniel J.

1997-01-01

The method of crop improvement by gene transfer is becoming increasingly routine with transgenic foods and ornamental crops now being marketed to consumers. However, biological processes of plants, and the physical barriers of current protocols continue to limit the application of gene transfer in many commercial crops. The goal of this paper is to outline the current limitations of gene transfer and to hypothesize possible opportunities for use of microgravity to overcome such limitations. The limitations detailed in this paper include host-range specificity of Agrobacterium mediated transformation, probability of gene insertion, position effects of the inserted genes, gene copy number, stability of foreign gene expression in host plants, and regeneration of recalcitrant plant species. Microgravity offers an opportunity for gene transfer where cell growth kinetics, DNA synthesis, and genetic recombination rates can be altered. Such biological conditions may enhance the ability for recombination of reporter genes and other genes of interest to agriculture. Proposed studies would be useful for understanding instability of foreign gene expression and may lead to stable transformed plants. Other aspects of gene transfer in microgravity are discussed.

Stepwise visualization of membrane pore formation by suilysin, a bacterial cholesterol-dependent cytolysin.

PubMed

Leung, Carl; Dudkina, Natalya V; Lukoyanova, Natalya; Hodel, Adrian W; Farabella, Irene; Pandurangan, Arun P; Jahan, Nasrin; Pires Damaso, Mafalda; Osmanović, Dino; Reboul, Cyril F; Dunstone, Michelle A; Andrew, Peter W; Lonnen, Rana; Topf, Maya; Saibil, Helen R; Hoogenboom, Bart W

2014-12-02

Membrane attack complex/perforin/cholesterol-dependent cytolysin (MACPF/CDC) proteins constitute a major superfamily of pore-forming proteins that act as bacterial virulence factors and effectors in immune defence. Upon binding to the membrane, they convert from the soluble monomeric form to oligomeric, membrane-inserted pores. Using real-time atomic force microscopy (AFM), electron microscopy (EM), and atomic structure fitting, we have mapped the structure and assembly pathways of a bacterial CDC in unprecedented detail and accuracy, focussing on suilysin from Streptococcus suis. We show that suilysin assembly is a noncooperative process that is terminated before the protein inserts into the membrane. The resulting ring-shaped pores and kinetically trapped arc-shaped assemblies are all seen to perforate the membrane, as also visible by the ejection of its lipids. Membrane insertion requires a concerted conformational change of the monomeric subunits, with a marked expansion in pore diameter due to large changes in subunit structure and packing.

Stepwise visualization of membrane pore formation by suilysin, a bacterial cholesterol-dependent cytolysin

PubMed Central

Lukoyanova, Natalya; Hodel, Adrian W; Farabella, Irene; Pandurangan, Arun P; Jahan, Nasrin; Pires Damaso, Mafalda; Osmanović, Dino; Reboul, Cyril F; Dunstone, Michelle A; Andrew, Peter W; Lonnen, Rana; Topf, Maya

2014-01-01

Membrane attack complex/perforin/cholesterol-dependent cytolysin (MACPF/CDC) proteins constitute a major superfamily of pore-forming proteins that act as bacterial virulence factors and effectors in immune defence. Upon binding to the membrane, they convert from the soluble monomeric form to oligomeric, membrane-inserted pores. Using real-time atomic force microscopy (AFM), electron microscopy (EM), and atomic structure fitting, we have mapped the structure and assembly pathways of a bacterial CDC in unprecedented detail and accuracy, focussing on suilysin from Streptococcus suis. We show that suilysin assembly is a noncooperative process that is terminated before the protein inserts into the membrane. The resulting ring-shaped pores and kinetically trapped arc-shaped assemblies are all seen to perforate the membrane, as also visible by the ejection of its lipids. Membrane insertion requires a concerted conformational change of the monomeric subunits, with a marked expansion in pore diameter due to large changes in subunit structure and packing. DOI: http://dx.doi.org/10.7554/eLife.04247.001 PMID:25457051

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vishal C.; Gopalakrishnan, Ganesh; Krishnamoorthy, Sriram

The systems resilience research community has developed methods to manually insert additional source-program level assertions to trap errors, and also devised tools to conduct fault injection studies for scalar program codes. In this work, we contribute the first vector oriented LLVM-level fault injector VULFI to help study the effects of faults in vector architectures that are of growing importance, especially for vectorizing loops. Using VULFI, we conduct a resiliency study of nine real-world vector benchmarks using Intel’s AVX and SSE extensions as the target vector instruction sets, and offer the first reported understanding of how faults affect vector instruction sets.more » We take this work further toward automating the insertion of resilience assertions during compilation. This is based on our observation that during intermediate (e.g., LLVM-level) code generation to handle full and partial vectorization, modern compilers exploit (and explicate in their code-documentation) critical invariants. These invariants are turned into error-checking code. We confirm the efficacy of these automatically inserted low-overhead error detectors for vectorized for-loops.« less

Irreversible xenon insertion into a small-pore zeolite at moderate pressures and temperatures

DOE PAGES

Seoung, Donghoon; Cynn, Hyunchae; Park, Changyong; ...

2014-09-01

Pressure drastically alters the chemical and physical properties of materials and allows structural phase transitions and chemical reactions to occur that defy much of our understanding gained under ambient conditions. Particularly exciting is the high-pressure chemistry of xenon, which is known to react with hydrogen and ice at high pressures and form stable compounds. Here, we show that Ag 16Al 16Si 24O 8·16H 2O (Ag-natrolite) irreversibly inserts xenon into its micropores at 1.7 GPa and 250 °C, while Ag + is reduced to metallic Ag and possibly oxidized to Ag 2+. In contrast to krypton, xenon is retained within themore » pores of this zeolite after pressure release and requires heat to desorb. This irreversible insertion and trapping of xenon in Ag-natrolite under moderate conditions sheds new light on chemical reactions that could account for the xenon deficiency relative to argon observed in terrestrial and Martian atmospheres.« less

Effect of oxide insertion layer on resistance switching properties of copper phthalocyanine

NASA Astrophysics Data System (ADS)

Joshi, Nikhil G.; Pandya, Nirav C.; Joshi, U. S.

2013-02-01

Organic memory device showing resistance switching properties is a next-generation of the electrical memory unit. We have investigated the bistable resistance switching in current-voltage (I-V) characteristics of organic diode based on copper phthalocyanine (CuPc) film sandwiched between aluminum (Al) electrodes. Pronounced hysteresis in the I-V curves revealed a resistance switching with on-off ratio of the order of 85%. In order to control the charge injection in the CuPc, nanoscale indium oxide buffer layer was inserted to form Al/CuPc/In2O3/Al device. Analysis of I-V measurements revealed space charge limited switching conduction at the Al/CuPc interface. The traps in the organic layer and charge blocking by oxide insertion layer have been used to explain the absence of resistance switching in the oxide buffer layered memory device cell. Present study offer potential applications for CuPc organic semiconductor in low power non volatile resistive switching memory and logic circuits.

Retrotransposons of the Tnt1B family are mobile in Nicotiana plumbaginifolia and can induce alternative splicing of the host gene upon insertion.

PubMed

Leprinc, A S; Grandbastien, M A; Christian, M

2001-11-01

Active retrotransposons have been identified in Nicotiana plumbaginifolia by their ability to disrupt the nitrate reductase gene in chlorate-resistant mutants selected from protoplast-derived cultures. In mutants E23 and F97, two independent insertions of Tnp2, a new retrotransposon closely related to the tobacco Tnt1 elements, were detected in the nitrate reductase gene. These two Tnp2 elements are members of the Tnt1B subfamily which shows that Tnt1B elements can be active and mutagenic in the N. plumbaginifolia genome. Furthermore, these results suggest that Tnt1B is the most active family of Tntl elements in N. plumbaginifolia, whereas in tobacco only members of the Tnt1A subfamily were found inserted in the nitrate reductase gene. The transcriptional regulations of Tnp2 and Tnt1A elements are most probably different due to non-conserved U3 regions. Our results thus support the hypothesis that different Nicotiana species contain different active Tntl subfamilies and that only one active Tntl subfamily might be maintained in each of these species. The Tnp2 insertion found in the F97 mutant was found to be spliced out of the nitrate reductase mRNA by activation of cryptic donor and acceptor sites in the nitrate reductase and the Tnp2 sequences respectively.

Characterization of three active transposable elements recently inserted in three independent DFR-A alleles and one high-copy DNA transposon isolated from the Pink allele of the ANS gene in onion (Allium cepa L.).

PubMed

Kim, Sunggil; Park, Jee Young; Yang, Tae-Jin

2015-06-01

Intact retrotransposon and DNA transposons inserted in a single gene were characterized in onions (Allium cepa) and their transcription and copy numbers were estimated in this study. While analyzing diverse onion germplasm, large insertions in the DFR-A gene encoding dihydroflavonol 4-reductase (DFR) involved in the anthocyanin biosynthesis pathway were found in two accessions. A 5,070-bp long terminal repeat (LTR) retrotransposon inserted in the active DFR-A (R4) allele was identified from one of the large insertions and designated AcCOPIA1. An intact ORF encoded typical domains of copia-like LTR retrotransposons. However, AcCOPIA1 contained atypical 'TG' and 'TA' dinucleotides at the ends of the LTRs. A 4,615-bp DNA transposon was identified in the other large insertion. This DNA transposon, designated AcCACTA1, contained an ORF coding for a transposase showing homology with the CACTA superfamily transposable elements (TEs). Another 5,073-bp DNA transposon was identified from the DFR-A (TRN) allele. This DNA transposon, designated AchAT1, belonged to the hAT superfamily with short 4-bp terminal inverted repeats (TIRs). Finally, a 6,258-bp non-autonomous DNA transposon, designated AcPINK, was identified in the ANS-p allele encoding anthocyanidin synthase, the next downstream enzyme to DFR in the anthocyanin biosynthesis pathway. AcPINK also possessed very short 3-bp TIRs. Active transcription of AcCOPIA1, AcCACTA1, and AchAT1 was observed through RNA-Seq analysis and RT-PCR. The copy numbers of AcPINK estimated by mapping the genomic DNA reads produced by NextSeq 500 were predominantly high compared with the other TEs. A series of evidence indicated that these TEs might have transposed in these onion genes very recently, providing a stepping stone for elucidation of enormously large-sized onion genome structure.

Evolutionary genomics: transdomain gene transfers.

PubMed

Bordenstein, Seth R

2007-11-06

Biologists have until now conceded that bacterial gene transfer to multicellular animals is relatively uncommon in Nature. A new study showing promiscuous insertions of bacterial endosymbiont genes into invertebrate genomes ushers in a shift in this paradigm.

Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum.

PubMed

McCarthy, Alex J; Stabler, Richard A; Taylor, Peter W

2018-04-01

Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn 5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. Copyright © 2018 McCarthy et al.

Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum

PubMed Central

McCarthy, Alex J.

2018-01-01

ABSTRACT Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. PMID:29339415

Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome

PubMed Central

2013-01-01

Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in gene-rich regions, and it is assumed that they may contribute to the evolution of duplicated genes in the highly duplicated Brassica genome. The resulting MIPs can serve as a good source of DNA markers for Brassica crops because the insertions are highly dispersed in the gene-rich euchromatin region and are polymorphic between or within species. PMID:23547712

Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

PubMed

Proels, Reinhard K; Roitsch, Thomas

2006-03-01

Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

Tnt1 Retrotransposon Mutagenesis: A Tool for Soybean Functional Genomics1[W][OA

PubMed Central

Cui, Yaya; Barampuram, Shyam; Stacey, Minviluz G.; Hancock, C. Nathan; Findley, Seth; Mathieu, Melanie; Zhang, Zhanyuan; Parrott, Wayne A.; Stacey, Gary

2013-01-01

Insertional mutagenesis is a powerful tool for determining gene function in both model and crop plant species. Tnt1, the transposable element of tobacco (Nicotiana tabacum) cell type 1, is a retrotransposon that replicates via an RNA copy that is reverse transcribed and integrated elsewhere in the plant genome. Based on studies in a variety of plants, Tnt1 appears to be inactive in normal plant tissue but can be reactivated by tissue culture. Our goal was to evaluate the utility of the Tnt1 retrotransposon as a mutagenesis strategy in soybean (Glycine max). Experiments showed that the Tnt1 element was stably transformed into soybean plants by Agrobacterium tumefaciens-mediated transformation. Twenty-seven independent transgenic lines carrying Tnt1 insertions were generated. Southern-blot analysis revealed that the copy number of transposed Tnt1 elements ranged from four to 19 insertions, with an average of approximately eight copies per line. These insertions showed Mendelian segregation and did not transpose under normal growth conditions. Analysis of 99 Tnt1 flanking sequences revealed insertions into 62 (62%) annotated genes, indicating that the element preferentially inserts into protein-coding regions. Tnt1 insertions were found in all 20 soybean chromosomes, indicating that Tnt1 transposed throughout the soybean genome. Furthermore, fluorescence in situ hybridization experiments validated that Tnt1 inserted into multiple chromosomes. Passage of transgenic lines through two different tissue culture treatments resulted in Tnt1 transposition, significantly increasing the number of insertions per line. Thus, our data demonstrate the Tnt1 retrotransposon to be a powerful system that can be used for effective large-scale insertional mutagenesis in soybean. PMID:23124322

Mitochondrial Enzyme Plays Critical Role in Chemotherapy-Induced Heart Damage | Center for Cancer Research

Cancer.gov

Doxorubicin (DOX) is an effective drug for treating cancers ranging from leukemia and lymphoma to solid tumors, such as breast cancer. DOX kills dividing cells in two ways: inserting between the base pairs of DNA and trapping a complex of DNA and an enzyme that cuts DNA, topoisomerase 2α, preventing DNA repair. However, DOX also causes congestive heart failure in about 30

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otani, Sanae; Department of Pediatrics, Graduate School of Medicine, Osaka City University, Osaka; Ayata, Minoru, E-mail: maverick@med.osaka-cu.ac.jp

Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader andmore » the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. - Highlights: • Wild-type MV can cause persistent infections in nude mice. • Biased hypermutation occurred in the M gene. • Biased hypermutation occurred in an inessential gene inserted between the leader and the N gene.« less

Do Variants in GSTs Modify the Association between Traffic Air Pollution and Asthma in Adolescence?

PubMed Central

Bowatte, Gayan; Lodge, Caroline J.; Lowe, Adrian J.; Erbas, Bircan; Dennekamp, Martine; Marks, Guy B.; Perret, Jennifer; Hui, Jennie; Wjst, Matthias; Gurrin, Lyle C.; Allen, Katrina J.; Abramson, Michael J.; Matheson, Melanie C.; Dharmage, Shyamali C.

2016-01-01

Polymorphisms in genes involved in the oxidative stress response may partially explain the documented heterogeneous associations between traffic-related air pollution (TRAP) exposure and asthma and allergies in children. We investigated whether the GSTT1, GSTM1 and GSTP1 gene polymorphisms modified the associations between TRAP exposure during the first year of life and asthma, wheeze and hay fever in adolescence. We used a birth cohort of 620 high risk infants from the Melbourne Atopy Cohort Study. TRAP exposure during the first year of life was defined as the cumulative length of major roads within 150 m of each participant’s residence during the first year of life. Wheeze, asthma and hay fever were measured at ages 12 (n = 370) and 18 (n = 434) years. The associations and interactions with glutathione S-transferases (GST s) were investigated using regression models. Overall, there was no relationship between TRAP exposure during the first year of life and current asthma, wheeze and hay fever at ages 12 or 18 years. However, in GSTT1 null carriers, every 100 m increase in cumulative lengths of major road exposure during the first year of life was associated with a 2.31-fold increased risk of wheeze and a 2.15-fold increased risk of asthma at 12 years. TRAP is associated with some respiratory outcomes in carriers of genetic polymorphisms in oxidative stress metabolism genes. PMID:27043549

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach.

PubMed

Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders

2017-09-11

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

A Versatile Transposon-Based Activation Tag Vector System for Functional Genomics in Cereals and Other Monocot Plants1[OA

PubMed Central

Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan

2008-01-01

Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541

Comparison of Insertional RNA Editing in Myxomycetes

PubMed Central

Chen, Cai; Frankhouser, David; Bundschuh, Ralf

2012-01-01

RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments) is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails. PMID:22383871

A Genetic Screen for Pathogenicity Genes in the Hemibiotrophic Fungus Colletotrichum higginsianum Identifies the Plasma Membrane Proton Pump Pma2 Required for Host Penetration

PubMed Central

Dahl, Marlis; Müller, Susanne; Voll, Lars M.; Koch, Christian

2015-01-01

We used insertional mutagenesis by Agrobacterium tumefaciens mediated transformation (ATMT) to isolate pathogenicity mutants of Colletotrichum higginsianum. From a collection of 7200 insertion mutants we isolated 75 mutants with reduced symptoms. 19 of these were affected in host penetration, while 17 were affected in later stages of infection, like switching to necrotrophic growth. For 16 mutants the location of T-DNA insertions could be identified by PCR. A potential plasma membrane H+-ATPase Pma2 was targeted in five independent insertion mutants. We genetically inactivated the Ku80 component of the non-homologous end-joining pathway in C. higginsianum to establish an efficient gene knockout protocol. Chpma2 deletion mutants generated by homologous recombination in the ΔChku80 background form fully melanized appressoria but entirely fail to penetrate the host tissue and are non-pathogenic. The ChPMA2 gene is induced upon appressoria formation and infection of A. thaliana. Pma2 activity is not important for vegetative growth of saprophytically growing mycelium, since the mutant shows no growth penalty under these conditions. Colletotrichum higginsianum codes for a closely related gene (ChPMA1), which is highly expressed under most growth conditions. ChPMA1 is more similar to the homologous yeast genes for plasma membrane pumps. We propose that expression of a specific proton pump early during infection may be common to many appressoria forming fungal pathogens as we found ChPMA2 orthologs in several plant pathogenic fungi. PMID:25992547

Transcript map of the Ovum mutant (Om) locus: isolation by exon trapping of new candidate genes for the DDK syndrome.

PubMed

Le Bras, Stéphanie; Cohen-Tannoudji, Michel; Guyot, Valérie; Vandormael-Pournin, Sandrine; Coumailleau, Franck; Babinet, Charles; Baldacci, Patricia

2002-08-21

The DDK syndrome is defined as the embryonic lethality of F1 mouse embryos from crosses between DDK females and males from other strains (named hereafter as non-DDK strains). Genetically controlled by the Ovum mutant (Om) locus, it is due to a deleterious interaction between a maternal factor present in DDK oocytes and the non-DDK paternal pronucleus. Therefore, the DDK syndrome constitutes a unique genetic tool to study the crucial interactions that take place between the parental genomes and the egg cytoplasm during mammalian development. In this paper, we present an extensive analysis performed by exon trapping on the Om region. Twenty-seven trapped sequences were from genes in the databases: beta-adaptin, CCT zeta2, DNA LigaseIII, Notchless, Rad51l3 and Scya1. Twenty-eight other sequences presented similarities with expressed sequence tags and genomic sequences whereas 57 did not. The pattern of expression of 37 of these markers was established. Importantly, five of them are expressed in DDK oocytes and are candidate genes for the maternal factor, and 20 are candidate genes for the paternal factor since they are expressed in testis. This data is an important step towards identifying the genes responsible for the DDK syndrome.

Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation.

PubMed

Toyama, H; Anthony, C; Lidstrom, M E

1998-09-01

Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.

Molecular Characteristics of the Mycobacterium tuberculosis LAM-RUS Family Prevalent in Central Russia▿ †

PubMed Central

Dubiley, Svetlana; Kirillov, Eugene; Ignatova, Anna; Stepanshina, Valentina; Shemyakin, Igor

2007-01-01

We analyzed IS6110-associated polymorphisms in the phospholipase C genes of 107 isolates of Mycobacterium tuberculosis selected to be representative of isolates circulating in central Russia. We found that the majority of Latin American-Mediterranean family strains contained an insertion in a unique position in the plcA gene, suggesting a common ancestor. This insertion can serve as a specific genetic marker for this group, which we designate the LAM-RUS family. PMID:17942651

A general insert label for peptide display on chimeric filamentous bacteriophages.

PubMed

Kaplan, Gilad; Gershoni, Jonathan M

2012-01-01

The foreign insert intended to be displayed via recombinant phage proteins can have a negative effect on protein expression and phage assembly. A typical example is the case of display of peptides longer than 6 amino acid residues on the major coat protein, protein VIII of the filamentous bacteriophages M13 and fd. A solution to this problem has been the use of "two-gene systems" generating chimeric phages that concomitantly express wild-type protein VIII along with recombinant protein VIII. Although the two-gene systems are much more permissive in regard to insert length and composition, some cases can still adversely affect phage assembly. Although these phages genotypically contain the desired DNA of the insert, they appear to be phenotypically wild type. To avoid false-negative results when using chimeric phages in binding studies, it is necessary to confirm that the observed lack of phage recognition is not due to faulty assembly and display of the intended insert. Here we describe a strategy for generating antibodies that specifically recognize recombinant protein VIII regardless of the nature of its foreign insert. These antibodies can be used as a general monitor of the display of recombinant protein VIII into phage particles. Copyright © 2011 Elsevier Inc. All rights reserved.

Integrated genome-wide Alu methylation and transcriptome profiling analyses reveal novel epigenetic regulatory networks associated with autism spectrum disorder.

PubMed

Saeliw, Thanit; Tangsuwansri, Chayanin; Thongkorn, Surangrat; Chonchaiya, Weerasak; Suphapeetiporn, Kanya; Mutirangura, Apiwat; Tencomnao, Tewin; Hu, Valerie W; Sarachana, Tewarit

2018-01-01

Alu elements are a group of repetitive elements that can influence gene expression through CpG residues and transcription factor binding. Altered gene expression and methylation profiles have been reported in various tissues and cell lines from individuals with autism spectrum disorder (ASD). However, the role of Alu elements in ASD remains unclear. We thus investigated whether Alu elements are associated with altered gene expression profiles in ASD. We obtained five blood-based gene expression profiles from the Gene Expression Omnibus database and human Alu-inserted gene lists from the TranspoGene database. Differentially expressed genes (DEGs) in ASD were identified from each study and overlapped with the human Alu-inserted genes. The biological functions and networks of Alu-inserted DEGs were then predicted by Ingenuity Pathway Analysis (IPA). A combined bisulfite restriction analysis of lymphoblastoid cell lines (LCLs) derived from 36 ASD and 20 sex- and age-matched unaffected individuals was performed to assess the global DNA methylation levels within Alu elements, and the Alu expression levels were determined by quantitative RT-PCR. In ASD blood or blood-derived cells, 320 Alu-inserted genes were reproducibly differentially expressed. Biological function and pathway analysis showed that these genes were significantly associated with neurodevelopmental disorders and neurological functions involved in ASD etiology. Interestingly, estrogen receptor and androgen signaling pathways implicated in the sex bias of ASD, as well as IL-6 signaling and neuroinflammation signaling pathways, were also highlighted. Alu methylation was not significantly different between the ASD and sex- and age-matched control groups. However, significantly altered Alu methylation patterns were observed in ASD cases sub-grouped based on Autism Diagnostic Interview-Revised scores compared with matched controls. Quantitative RT-PCR analysis of Alu expression also showed significant differences between ASD subgroups. Interestingly, Alu expression was correlated with methylation status in one phenotypic ASD subgroup. Alu methylation and expression were altered in LCLs from ASD subgroups. Our findings highlight the association of Alu elements with gene dysregulation in ASD blood samples and warrant further investigation. Moreover, the classification of ASD individuals into subgroups based on phenotypes may be beneficial and could provide insights into the still unknown etiology and the underlying mechanisms of ASD.

Biased hypermutation occurred frequently in a gene inserted into the IC323 recombinant measles virus during its persistence in the brains of nude mice.

PubMed

Otani, Sanae; Ayata, Minoru; Takeuchi, Kaoru; Takeda, Makoto; Shintaku, Haruo; Ogura, Hisashi

2014-08-01

Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader and the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. Copyright © 2014 Elsevier Inc. All rights reserved.

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

PubMed

Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

PubMed Central

Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran.

PubMed

Shariati, A; Azimi, T; Ardebili, A; Chirani, A S; Bahramian, A; Pormohammad, A; Sadredinamin, M; Erfanimanesh, S; Bostanghadiri, N; Shams, S; Hashemi, A

2018-01-01

In this study, we report the insertion sequence IS Ppu 21 in the opr D porin gene of carbapenem-resistant Pseudomonas aeruginosa isolates from burn patients in Tehran, Iran. Antibiotic susceptibility tests for P. aeruginosa isolates were determined. Production of metallo-β-lactamases (MBLs) and carbapenemase was evaluated and the β-lactamase-encoding and aminoglycoside-modifying enzyme genes were investigated by PCR and sequencing methods. The mRNA transcription level of oprD and mex efflux pump genes were evaluated by real-time PCR. The outer membrane protein profile was determined by SDS-PAGE. The genetic relationship between the P. aeruginosa isolates was assessed by random amplified polymorphic DNA PCR. In all, 10.52% (10/95) of clinical isolates of P. aeruginosa harboured the IS Ppu 21 insertion element in the opr D gene. The extended-spectrum β-lactamase-encoding gene in IS Ppu 21-carrying isolates was bla TEM . PCR assays targeting MBL and carbapenemase-encoding genes were also negative in all ten isolates. The rmt A, aad A, aad B and arm A genes were positive in all IS Ppu 21 harbouring isolates. The relative expression levels of the mex X, mex B, mex T and mex D genes in ten isolates ranged from 0.1- to 1.4-fold, 1.1- to 3.68-fold, 0.3- to 8.22-fold and 1.7- to 35.17-fold, respectively. The relative expression levels of the oprD in ten isolates ranged from 0.57- to 35.01-fold, which was much higher than those in the control strain P. aeruginosa PAO1. Evaluation of the outer membrane protein by SDS-PAGE suggested that opr D was produced at very low levels by all isolates. Using random amplified polymorphic DNA PCR genotyping, eight of the ten isolates containing IS Ppu 21 were shown to be clonally related. The present study describes a novel molecular mechanism, IS Ppu 21 insertion of the opr D gene, associated with carbapenem resistance in clinical P. aeruginosa isolates.

The development of the conditionally replication-competent adenovirus: replacement of E4 orf1-4 region by exogenous gene.

PubMed

Nam, Jae-Kook; Lee, Mi-Hyang; Seo, Hae-Hyun; Kim, Seok-Ki; Lee, Kang-Huyn; Kim, In-Hoo; Lee, Sang-Jin

2010-05-01

Tumor or tissue specific replicative adenovirus armed with a therapeutic gene has shown a promising anti-cancer therapeutic modality. However, because the genomic packaging capacity is constrained, only a few places inside it are available for transgene insertion. In the present study, we introduce a novel strategy utilizing the early E4 region for the insertion of therapeutic gene(s). We constructed the conditionally replication-competent adenovirus (CRAd), Ad5E4(mRFP) by: (i) replacing the E4/E1a promoter by the prostate-specific enhancer element; (ii) inserting mRFP inside the E4orf1-4 deletion region; and (iii) sub-cloning enhanced green fluorescent protein controlled by cytomegalovirus promoter in the left end of the viral genome. Subsequently, we evaluated its replication abilities and killing activities in vitro, as well as its in vivo anti-tumor efficacy in CWR22rv xenografts. When infected with Ad5E4(mRFP), the number and intensity of the mRFP gene products increased in a prostate cancer cell-specific manner as designed, suggesting that the mRFP gene and E4orfs other than E4orf1-4 were well synthesized from one transcript via alternative splicing as the recombinant adenovirus replicated. As expected from the confirmed virus replication capability, Ad5E4(mRFP) induced cell lysis as potent as the wild-type adenovirus and effectively suppressed tumor growth when tested in the CWR22rv xenografts in nude mice. Furthermore, Ad5E4(endo/angio) harboring an endostatin-angiostatin gene in E4orf1-4 was able to enhance CRAd by replacing mRFP with a therapeutic gene. The approach employed in the present study for the insertion of a therapeutic transgene in CRAd should facilitate the construction of CRAd containing multiple therapeutic genes in the viral genome that may have the potential to serve as highly potent cancer therapeutic reagents. Copyright (c) 2010 John Wiley & Sons, Ltd.

The Wnt-1 (int-1) oncogene promoter and its mechanism of activation by insertion of proviral DNA of the mouse mammary tumor virus.

PubMed Central

Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A

1990-01-01

Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322

A transposable element in a NAC gene is associated with drought tolerance in maize seedlings

PubMed Central

Mao, Hude; Wang, Hongwei; Liu, Shengxue; Li, Zhigang; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Qin, Feng

2015-01-01

Drought represents a major constraint on maize production worldwide. Understanding the genetic basis for natural variation in drought tolerance of maize may facilitate efforts to improve this trait in cultivated germplasm. Here, using a genome-wide association study, we show that a miniature inverted-repeat transposable element (MITE) inserted in the promoter of a NAC gene (ZmNAC111) is significantly associated with natural variation in maize drought tolerance. The 82-bp MITE represses ZmNAC111 expression via RNA-directed DNA methylation and H3K9 dimethylation when heterologously expressed in Arabidopsis. Increasing ZmNAC111 expression in transgenic maize enhances drought tolerance at the seedling stage, improves water-use efficiency and induces upregulation of drought-responsive genes under water stress. The MITE insertion in the ZmNAC111 promoter appears to have occurred after maize domestication and spread among temperate germplasm. The identification of this MITE insertion provides insight into the genetic basis for natural variation in maize drought tolerance. PMID:26387805

Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors.

PubMed

Miura, Hiromi; Quadros, Rolen M; Gurumurthy, Channabasavaiah B; Ohtsuka, Masato

2018-01-01

CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement of genomic segments is very poor. The majority of mouse models used in research involve knock-in (reporters or recombinases) or gene replacement (e.g., conditional knockout alleles containing exons flanked by LoxP sites). A few methods for creating such models have been reported that use double-stranded DNA as donors, but their efficiency is typically 1-10% and therefore not suitable for routine use. We recently demonstrated that long single-stranded DNAs (ssDNAs) serve as very efficient donors, both for insertion and for gene replacement. We call this method efficient additions with ssDNA inserts-CRISPR (Easi-CRISPR) because it is a highly efficient technology (efficiency is typically 30-60% and reaches as high as 100% in some cases). The protocol takes ∼2 months to generate the founder mice.

Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

PubMed

Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

2006-04-01

We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

PubMed

Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

2015-04-01

In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.

PubMed

Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G

2008-12-01

With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

PubMed

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

PubMed Central

Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

2012-01-01

Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

A functional 12T-insertion polymorphism in the ATP1A1 promoter confers decreased susceptibility to hypertension in a male Sardinian population.

PubMed

Herrera, Victoria L; Pasion, Khristine A; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson

2015-01-01

Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5'-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28-0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/- male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/- mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population.

A Functional 12T-Insertion Polymorphism in the ATP1A1 Promoter Confers Decreased Susceptibility to Hypertension in a Male Sardinian Population

PubMed Central

Herrera, Victoria L.; Pasion, Khristine A.; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson

2015-01-01

Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5’-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28–0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/− male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/− mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population. PMID:25615575

Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages

PubMed Central

Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie

2015-01-01

Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955

Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

PubMed Central

Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

2002-01-01

Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

Transposon based functional characterization of soybean genes

USDA-ARS?s Scientific Manuscript database

Type II transposable elements that use cut and paste mechanism for jumping from one genomic region to another is ideal in tagging and cloning genes. Precise excision from an insertion site in a mutant gene leads to regaining the wild-type function. Thus, function of a gene can be established based o...

Liver-Directed Lentiviral Gene Therapy in a Dog Model of Hemophilia B

PubMed Central

Bartholomae, Cynthia C.; Volpin, Monica; Della Valle, Patrizia; Sanvito, Francesca; Sergi Sergi, Lucia; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D’Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K.; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi

2017-01-01

We investigated the safety and efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B, and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We show that gene therapy using lentiviral vectors targeting expression of a canine factor IX transgene to hepatocytes was well-tolerated and provided stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we show that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be useful for the treatment of hemophilia. PMID:25739762

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

Comprehensive identification of Vibrio vulnificus genes required for growth in human serum.

PubMed

Carda-Diéguez, M; Silva-Hernández, F X; Hubbard, T P; Chao, M C; Waldor, M K; Amaro, C

2018-12-31

Vibrio vulnificus can be a highly invasive pathogen capable of spreading from an infection site to the bloodstream, causing sepsis and death. To survive and proliferate in blood, the pathogen requires mechanisms to overcome the innate immune defenses and metabolic limitations of this host niche. We created a high-density transposon mutant library in YJ016, a strain representative of the most virulent V. vulnificus lineage (or phylogroup) and used transposon insertion sequencing (TIS) screens to identify loci that enable the pathogen to survive and proliferate in human serum. Initially, genes underrepresented for insertions were used to estimate the V. vulnificus essential gene set; comparisons of these genes with similar TIS-based classification of underrepresented genes in other vibrios enabled the compilation of a common Vibrio essential gene set. Analysis of the relative abundance of insertion mutants in the library after exposure to serum suggested that genes involved in capsule biogenesis are critical for YJ016 complement resistance. Notably, homologues of two genes required for YJ016 serum-resistance and capsule biogenesis were not previously linked to capsule biogenesis and are largely absent from other V. vulnificus strains. The relative abundance of mutants after exposure to heat inactivated serum was compared with the findings from the serum screen. These comparisons suggest that in both conditions the pathogen relies on its Na + transporting NADH-ubiquinone reductase (NQR) complex and type II secretion system to survive/proliferate within the metabolic constraints of serum. Collectively, our findings reveal the potency of comparative TIS screens to provide knowledge of how a pathogen overcomes the diverse limitations to growth imposed by serum.

The Major Cold Shock Gene, cspA, Is Involved in the Susceptibility of Staphylococcus aureus to an Antimicrobial Peptide of Human Cathepsin G

PubMed Central

Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T.; Shafer, William M.

2003-01-01

A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system. PMID:12874306

The major cold shock gene, cspA, is involved in the susceptibility of Staphylococcus aureus to an antimicrobial peptide of human cathepsin G.

PubMed

Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T; Shafer, William M

2003-08-01

A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system.

[Influence of antisense RNA and sequences of viral transactivators traps on RNA synthesis of HTLV-1 virus].

PubMed

Borisenko, A S; Kotus, E V; Kaloshin, A A

2008-01-01

Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.

Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.

PubMed Central

Condemine, G; Hugouvieux-Cotte-Pattat, N; Robert-Baudouy, J

1986-01-01

Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis. PMID:3949717

Perturbation of nuclear architecture by long-distance chromosome interactions.

PubMed

Dernburg, A F; Broman, K W; Fung, J C; Marshall, W F; Philips, J; Agard, D A; Sedat, J W

1996-05-31

Position-effect variegation (PEV) describes the stochastic transcriptional silencing of a gene positioned adjacent to heterochromatin. Using FISH, we have tested whether variegated expression of the eye-color gene brown in Drosophila is influenced by its nuclear localization. In embryonic nuclei, a heterochromatic insertion at the brown locus is always spatially isolated from other heterochromatin. However, during larval development this insertion physically associates with other heterochromatic regions on the same chromosome in a stochastic manner. These observations indicate that the brown gene is silenced by specific contact with centromeric heterochromatin. Moreover, they provide direct evidence for long-range chromosome interactions and their impact on three-dimensional nuclear architecture, while providing a cohesive explanation for the phenomenon of PEV.

Evaluations of sampling methods for darkling beetles (Alphitobius diaperinus) in the litter of turkey and broiler houses.

PubMed

Safrit, R D; Axtell, R C

1984-12-01

Materials placed on the litter in turkey and broiler houses were evaluated as sampling devices for the larvae and adults of Alphitobius diaperinus (lesser mealworm or darkling beetle). Insects harbored in, on, and between pieces of the materials were counted after 1-week exposure. Pan traps consisting of two stacked pieces of 1.3-cm thick foil-covered polyisocyanurate insulation (Celotex) placed under a protective metal pan staked to the litter surface was a more effective sampling device than pan traps using thicker (5 cm) Celotex, 3.8 cm thick polystyrene (Styrofoam), or two stacked pieces of wood. A tube trap consisting of rolled fluted corrugated cardboard inserted in a section of polyvinyl chloride pipe was as effective a sampling device as the two pieces of Celotex in a pan trap and was more convenient to use. Six pieces of corrugated cardboard stacked under a pan caught larger numbers of beetle larvae and adults but was awkward to handle and impractical. Placement of sampling devices in the major subhabitats (open center, near walls, near feeders, and near waterers) in turkey and broiler houses affected catches of beetle larvae and adults. The open center area was satisfactory and most convenient.

Characterization of Chicken Spleen Transcriptome after Infection with Salmonella enterica Serovar Enteritidis

PubMed Central

Matulova, Marta; Rajova, Jana; Vlasatikova, Lenka; Volf, Jiri; Stepanova, Hana; Havlickova, Hana; Sisak, Frantisek; Rychlik, Ivan

2012-01-01

In this study we were interested in identification of new markers of chicken response to Salmonella Enteritidis infection. To reach this aim, gene expression in the spleens of naive chickens and those intravenously infected with S. Enteritidis with or without previous oral vaccination was determined by 454 pyrosequencing of splenic mRNA/cDNA. Forty genes with increased expression at the level of transcription were identified. The most inducible genes encoded avidin (AVD), extracellular fatty acid binding protein (EXFABP), immune responsive gene 1 (IRG1), chemokine ah221 (AH221), trappin-6-like protein (TRAP6) and serum amyloid A (SAA). Using cDNA from sorted splenic B-lymphocytes, macrophages, CD4, CD8 and γδ T-lymphocytes, we found that the above mentioned genes were preferentially expressed in macrophages. AVD, EXFABP, IRG1, AH221, TRAP6 and SAA were induced also in the cecum of chickens orally infected with S. Enteritidis on day 1 of life or day 42 of life. Unusual results were obtained for the immunoglobulin encoding transcripts. Prior to the infection, transcripts coding for the constant parts of IgM, IgY, IgA and Ig light chain were detected in B-lymphocytes. However, after the infection, immunoglobulin encoding transcripts were expressed also by T-lymphocytes and macrophages. Expression of AVD, EXFABP, IRG1, AH221, TRAP6, SAA and all immunoglobulin genes can be therefore used for the characterization of the course of S. Enteritidis infection in chickens. PMID:23094107

Fluorescence spectroscopy of trapped molecular ions

NASA Astrophysics Data System (ADS)

Wright, Kenneth Charles

This thesis describes the development of a unique instrument capable of detecting fluorescence emission from large gas phase molecular ions trapped in a three-dimensional quadrupole ion trap. The hypothesis that has formed the basis of this work is the belief that fluorescence spectroscopy can be combined with ion trap mass spectrometry to probe the structure of gas phase molecular ions. The ion trap provides a rarefied environment where fluorescence experiments can be conducted without interference from solvent molecules or impurities. Although fluorescence was not detected during preliminary experiments, two significant experimental challenges associated with detecting the gas phase fluorescence of ions were discovered. First, gas phase ions were vulnerable to photodissociation and low laser powers were necessary to avoid photodissociation. Since fluorescence emission is directly proportional to laser intensity, a lower laser power limits the fluorescence signal. Second, the fluorescence emission was not significantly Stokes shifted from the excitation. The lack of Stokes shift meant the small fluorescence signal must be detected in the presence of a large amount of background scatter generated by the excitation. Initially, this background was seven orders of magnitude higher than the analytical signal ultimately detected. A specially designed fiber optic probe was inserted between the electrodes of the ion trap to stop light scattered off the outside surfaces of the trap from reaching the detector. The inside surfaces of the ion trap were coated black to further reduce the amount of scattered light collected. These innovations helped reduced the background by six orders of magnitude and fluorescence emission from rhodamine-6G was detected. Pulse counting experiments were used to optimize fluorescence detection. The effects of trapping level, laser power, and irradiation time were investigated and optimized. The instrument developed in this work not only allows for the detection of fluorescent photons, but the sensitivity is high enough for the light to be dispersed and an emission spectrum recorded. The emission spectra of rhodamine-6G and 5-carboxyrhodamine-6G ions reported in this thesis represent the first spectra recorded from large molecular ions confined in a quadrupole ion trap. Finally, anti-Stokes fluorescence from rhodamine-6G was also detected.

Genome Engineering in Bacillus anthracis Using Cre Recombinase

PubMed Central

Pomerantsev, Andrei P.; Sitaraman, Ramakrishnan; Galloway, Craig R.; Kivovich, Violetta; Leppla, Stephen H.

2006-01-01

Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis, it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A, and mcrB and mrr. Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth. PMID:16369025

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.

PubMed

Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

2015-06-19

Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.

Germline transformation of the western corn rootworm, Diabrotica virgifera virgifera.

PubMed

Chu, F; Klobasa, W; Wu, P; Pinzi, S; Grubbs, N; Gorski, S; Cardoza, Y; Lorenzen, M D

2017-08-01

The western corn rootworm (WCR), a major pest of maize, is notorious for rapidly adapting biochemically, behaviourally and developmentally to a variety of control methods. Despite much effort, the genetic basis of WCR adaptation remains a mystery. Since transformation-based applications such as transposon tagging and enhancer trapping have facilitated genetic dissection of model species such as Drosophila melanogaster, we developed a germline-transformation system for WCR in an effort to gain a greater understanding of the basic biology of this economically important insect. Here we report the use of a fluorescent-marked Minos element to create transgenic WCR. We demonstrate that the transgenic strains express both an eye-specific fluorescent marker and piggyBac transposase. We identified insertion-site junction sequences via inverse PCR and assessed insertion copy number using digital droplet PCR (ddPCR). Interestingly, most WCR identified as transgenic via visual screening for DsRed fluorescence proved to carry multiple Minos insertions when tested via ddPCR. A total of eight unique insertion strains were created by outcrossing the initial transgenic strains to nontransgenic WCR mates. Establishing transgenic technologies for this beetle is the first step towards bringing a wide range of transformation-based tools to bear on understanding WCR biology. © 2017 The Royal Entomological Society.

Angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism is not a risk factor for hypertension in SLE nephritis.

PubMed

Negi, Vir S; Devaraju, Panneer; Gulati, Reena

2015-09-01

SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian Tamils.

What makes up plant genomes: The vanishing line between transposable elements and genes.

PubMed

Zhao, Dongyan; Ferguson, Ann A; Jiang, Ning

2016-02-01

The ultimate source of evolution is mutation. As the largest component in plant genomes, transposable elements (TEs) create numerous types of mutations that cannot be mimicked by other genetic mechanisms. When TEs insert into genomic sequences, they influence the expression of nearby genes as well as genes unlinked to the insertion. TEs can duplicate, mobilize, and recombine normal genes or gene fragments, with the potential to generate new genes or modify the structure of existing genes. TEs also donate their transposase coding regions for cellular functions in a process called TE domestication. Despite the host defense against TE activity, a subset of TEs survived and thrived through discreet selection of transposition activity, target site, element size, and the internal sequence. Finally, TEs have established strategies to reduce the efficacy of host defense system by increasing the cost of silencing TEs. This review discusses the recent progress in the area of plant TEs with a focus on the interaction between TEs and genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Cell-free protein synthesis and assembly on a biochip

NASA Astrophysics Data System (ADS)

Heyman, Yael; Buxboim, Amnon; Wolf, Sharon G.; Daube, Shirley S.; Bar-Ziv, Roy H.

2012-06-01

Biologically active complexes such as ribosomes and bacteriophages are formed through the self-assembly of proteins and nucleic acids. Recapitulating these biological self-assembly processes in a cell-free environment offers a way to develop synthetic biodevices. To visualize and understand the assembly process, a platform is required that enables simultaneous synthesis, assembly and imaging at the nanoscale. Here, we show that a silicon dioxide grid, used to support samples in transmission electron microscopy, can be modified into a biochip to combine in situ protein synthesis, assembly and imaging. Light is used to pattern the biochip surface with genes that encode specific proteins, and antibody traps that bind and assemble the nascent proteins. Using transmission electron microscopy imaging we show that protein nanotubes synthesized on the biochip surface in the presence of antibody traps efficiently assembled on these traps, but pre-assembled nanotubes were not effectively captured. Moreover, synthesis of green fluorescent protein from its immobilized gene generated a gradient of captured proteins decreasing in concentration away from the gene source. This biochip could be used to create spatial patterns of proteins assembled on surfaces.

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coradetti, Samuel T.; Pinel, Dominic; Geiselman, Gina M.

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted functionmore » in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. Lastly, these results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi.« less

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

PubMed Central

Geiselman, Gina M; Ito, Masakazu; Mondo, Stephen J; Reilly, Morgann C; Cheng, Ya-Fang; Bauer, Stefan; Grigoriev, Igor V; Gladden, John M; Simmons, Blake A; Brem, Rachel B

2018-01-01

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted function in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. These results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi. PMID:29521624

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

DOE PAGES

Coradetti, Samuel T.; Pinel, Dominic; Geiselman, Gina M.; ...

2018-03-09

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted functionmore » in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. Lastly, these results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi.« less

Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat

PubMed Central

Cui, Yang; Yan, Hailong; Wang, Ke; Xu, Han; Zhang, Xuelian; Zhu, Haijing; Liu, Jinwang; Qu, Lei; Lan, Xianyong; Pan, Chuanying

2018-01-01

A previous whole-genome association analysis identified lysine demethylase 6A (KDM6A), which encodes a type of histone demethylase, as a candidate gene associated to goat fecundity. KDM6A gene knockout mouse disrupts gametophyte development, suggesting that it has a critical role in reproduction. In this study, goat KDM6A mRNA expression profiles were determined, insertion/deletion (indel) variants in the gene identified, indel variants effect on KDM6A gene expression assessed, and their association with first-born litter size analyzed in 2326 healthy female Shaanbei white cashmere goats. KDM6A mRNA was expressed in all tissues tested (heart, liver, spleen, lung, kidney, muscle, brain, skin and testis); the expression levels in testes at different developmental stages [1-week-old (wk), 2, 3 wk, 1-month-old (mo), 1.5 and 2 mo] indicated a potential association with the mitosis-to-meiosis transition, implying that KDM6A may have an essential role in goat fertility. Meanwhile, two novel intronic indels of 16 bp and 5 bp were identified. Statistical analysis revealed that only the 16 bp indel was associated with first-born litter size (P < 0.01), and the average first-born litter size of individuals with an insertion/insertion genotype higher than that of those with the deletion/deletion genotype (P < 0.05). There was also a significant difference in genotype distributions of the 16 bp indel between mothers of single-lamb and multi-lamb litters in the studied goat population (P = 0.001). Consistently, the 16 bp indel also had a significant effect on KDM6A gene expression. Additionally, there was no significant linkage disequilibrium (LD) between these two indel loci, consistent with the association analysis results. Together, these findings suggest that the 16 bp indel in KDM6A may be useful for marker-assisted selection (MAS) of goats. PMID:29616081

Transposable elements are enriched within or in close proximity to xenobiotic-metabolizing cytochrome P450 genes

PubMed Central

Chen, Song; Li, Xianchun

2007-01-01

Background Transposons, i.e. transposable elements (TEs), are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements), MITEs (miniature inverted-repeat transposable elements), one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1) implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1) involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes. PMID:17381843

A "White" Anthocyanin-less Pomegranate (Punica granatum L.) Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS) Gene.

PubMed

Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2015-01-01

Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation.

A "White" Anthocyanin-less Pomegranate (Punica granatum L.) Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS) Gene

PubMed Central

Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2015-01-01

Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation. PMID:26581077

Capturing novel mouse genes encoding chromosomal and other nuclear proteins.

PubMed

Tate, P; Lee, M; Tweedie, S; Skarnes, W C; Bickmore, W A

1998-09-01

The burgeoning wealth of gene sequences contrasts with our ignorance of gene function. One route to assigning function is by determining the sub-cellular location of proteins. We describe the identification of mouse genes encoding proteins that are confined to nuclear compartments by splicing endogeneous gene sequences to a promoterless betageo reporter, using a gene trap approach. Mouse ES (embryonic stem) cell lines were identified that express betageo fusions located within sub-nuclear compartments, including chromosomes, the nucleolus and foci containing splicing factors. The sequences of 11 trapped genes were ascertained, and characterisation of endogenous protein distribution in two cases confirmed the validity of the approach. Three novel proteins concentrated within distinct chromosomal domains were identified, one of which appears to be a serine/threonine kinase. The sequence of a gene whose product co-localises with splicesome components suggests that this protein may be an E3 ubiquitin-protein ligase. The majority of the other genes isolated represent novel genes. This approach is shown to be a powerful tool for identifying genes encoding novel proteins with specific sub-nuclear localisations and exposes our ignorance of the protein composition of the nucleus. Motifs in two of the isolated genes suggest new links between cellular regulatory mechanisms (ubiquitination and phosphorylation) and mRNA splicing and chromosome structure/function.

Periodic molybdenum disc array for light trapping in amorphous silicon layer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Jiwei; Deng, Changkai; Shanghai Advanced Research Institute, Chinese Academy of Sciences, 99 Haike Road, Shanghai, 201210 China

2016-05-15

We demonstrate the light trapping effect in amorphous silicon (a-Si:H) layer by inserting a layer of periodic molybdenum disc array (MDA) between the a-Si:H layer and the quartz substrate, which forms a three-layer structure of Si/MDA/SiO{sub 2}. The MDA layer was fabricated by a new cost-effective method based on nano-imprint technology. Further light absorption enhancement was realized through altering the topography of MDA by annealing it at 700°C. The mechanism of light absorption enhancement in a-Si:H interfaced with MDA was analyzed, and the electric field distribution and light absorption curve of the different layers in the Si/MDA structure under lightmore » illumination of different wavelengths were simulated by employing numerical finite difference time domain (FDTD) solutions.« less

Conformational trapping of mismatch recognition complex MSH2/MSH3 on repair-resistant DNA loops.

PubMed

Lang, Walter H; Coats, Julie E; Majka, Jerzy; Hura, Greg L; Lin, Yuyen; Rasnik, Ivan; McMurray, Cynthia T

2011-10-18

Insertion and deletion of small heteroduplex loops are common mutations in DNA, but why some loops are prone to mutation and others are efficiently repaired is unknown. Here we report that the mismatch recognition complex, MSH2/MSH3, discriminates between a repair-competent and a repair-resistant loop by sensing the conformational dynamics of their junctions. MSH2/MSH3 binds, bends, and dissociates from repair-competent loops to signal downstream repair. Repair-resistant Cytosine-Adenine-Guanine (CAG) loops adopt a unique DNA junction that traps nucleotide-bound MSH2/MSH3, and inhibits its dissociation from the DNA. We envision that junction dynamics is an active participant and a conformational regulator of repair signaling, and governs whether a loop is removed by MSH2/MSH3 or escapes to become a precursor for mutation.

Mobility and generation of mosaic non-autonomous transposons by Tn3-derived inverted-repeat miniature elements (TIMEs).

PubMed

Szuplewska, Magdalena; Ludwiczak, Marta; Lyzwa, Katarzyna; Czarnecki, Jakub; Bartosik, Dariusz

2014-01-01

Functional transposable elements (TEs) of several Pseudomonas spp. strains isolated from black shale ore of Lubin mine and from post-flotation tailings of Zelazny Most in Poland, were identified using a positive selection trap plasmid strategy. This approach led to the capture and characterization of (i) 13 insertion sequences from 5 IS families (IS3, IS5, ISL3, IS30 and IS1380), (ii) isoforms of two Tn3-family transposons--Tn5563a and Tn4662a (the latter contains a toxin-antitoxin system), as well as (iii) non-autonomous TEs of diverse structure, ranging in size from 262 to 3892 bp. The non-autonomous elements transposed into AT-rich DNA regions and generated 5- or 6-bp sequence duplications at the target site of transposition. Although these TEs lack a transposase gene, they contain homologous 38-bp-long terminal inverted repeat sequences (IRs), highly conserved in Tn5563a and many other Tn3-family transposons. The simplest elements of this type, designated TIMEs (Tn3 family-derived Inverted-repeat Miniature Elements) (262 bp), were identified within two natural plasmids (pZM1P1 and pLM8P2) of Pseudomonas spp. It was demonstrated that TIMEs are able to mobilize segments of plasmid DNA for transposition, which results in the generation of more complex non-autonomous elements, resembling IS-driven composite transposons in structure. Such transposon-like elements may contain different functional genetic modules in their core regions, including plasmid replication systems. Another non-autonomous element "captured" with a trap plasmid was a TIME derivative containing a predicted resolvase gene and a res site typical for many Tn3-family transposons. The identification of a portable site-specific recombination system is another intriguing example confirming the important role of non-autonomous TEs of the TIME family in shuffling genetic information in bacterial genomes. Transposition of such mosaic elements may have a significant impact on diversity and evolution, not only of transposons and plasmids, but also of other types of mobile genetic elements.

The Essential Genome of Escherichia coli K-12

PubMed Central

2018-01-01

ABSTRACT Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. PMID:29463657

Liver-directed lentiviral gene therapy in a dog model of hemophilia B.

PubMed

Cantore, Alessio; Ranzani, Marco; Bartholomae, Cynthia C; Volpin, Monica; Valle, Patrizia Della; Sanvito, Francesca; Sergi, Lucia Sergi; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D'Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi

2015-03-04

We investigated the efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We showed that gene therapy using lentiviral vectors targeting the expression of a canine factor IX transgene in hepatocytes was well tolerated and provided a stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we showed that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be potentially useful for the treatment of hemophilia. Copyright © 2015, American Association for the Advancement of Science.

Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.

PubMed

Byrne, Susan M; Church, George M

2015-01-01

CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.

Unstable transpositions of his4 in yeast.

PubMed Central

Greer, H; Fink, G R

1979-01-01

Unstable transpositions in yeast have been selected in which the his4C gene from chromosome III is inserted into chromosome XII. This event is associated with the generation of a recessive lethal mutation, resulting from the integration of his4C into an essential gene. Strains with these transpositions are viable as diploids or aneuploids for chromosome XII. The event that generates the transpositions does not lead reciprocally to a deletion on chromosome III, implying that synthesis of a new copy of his4C and subsequent transposition may have occurred. The his4C transpositions are unstable and give rise to C- segregants at a high frequency, as a result of either precise excision of the his4C gene (restoring function of the gene into which insertion had occurred) or chromosome loss. PMID:386353

High Inter-Individual Diversity of Point Mutations, Insertions, and Deletions in Human Influenza Virus Nucleoprotein-Specific Memory B Cells

PubMed Central

Bussmann, Bianca M.; Horn, Susanne; Sieg, Michael; Jassoy, Christian

2015-01-01

The diversity of virus-specific antibodies and of B cells among different individuals is unknown. Using single-cell cloning of antibody genes, we generated recombinant human monoclonal antibodies from influenza nucleoprotein-specific memory B cells in four adult humans with and without preceding influenza vaccination. We examined the diversity of the antibody repertoires and found that NP-specific B cells used numerous immunoglobulin genes. The heavy chains (HCs) originated from 26 and the kappa light chains (LCs) from 19 different germ line genes. Matching HC and LC chains gave rise to 43 genetically distinct antibodies that bound influenza NP. The median lengths of the CDR3 of the HC, kappa and lambda LC were 14, 9 and 11 amino acids, respectively. We identified changes at 13.6% of the amino acid positions in the V gene of the antibody heavy chain, at 8.4 % in the kappa and at 10.6 % in the lambda V gene. We identified somatic insertions or deletions in 8.1% of the variable genes. We also found several small groups of clonal relatives that were highly diversified. Our findings demonstrate broadly diverse memory B cell repertoires for the influenza nucleoprotein. We found extensive variation within individuals with a high number of point mutations, insertions, and deletions, and extensive clonal diversification. Thus, structurally conserved proteins can elicit broadly diverse and highly mutated B-cell responses. PMID:26086076

Construction of a recombinant duck enteritis virus vaccine expressing hemagglutinin of H9N2 avian influenza virus and evaluation of its efficacy in ducks.

PubMed

Sun, Ying; Yang, Chenghuai; Li, Junping; Li, Ling; Cao, Minghui; Li, Qihong; Li, Huijiao

2017-01-01

H9 subtype avian influenza viruses (AIVs) remain a significant burden in the poultry industry and are considered to be one of the most likely causes of any new influenza pandemic in humans. As ducks play an important role in the maintenance of H9 viruses in nature, successful control of the spread of H9 AIVs in ducks will have significant beneficial effects on public health. Duck enteritis virus (DEV) may be a promising candidate viral vector for aquatic poultry vaccination. In this study, we constructed a recombinant DEV, rDEV-∆UL2-HA, inserting the hemagglutinin (HA) gene from duck-origin H9N2 AIV into the UL2 gene by homologous recombination. One-step growth analyses showed that the HA gene insertion had no effect on viral replication and suggested that the UL2 gene was nonessential for virus growth in vitro. In vivo tests further showed that the insertion of the HA gene in place of the UL2 gene did not affect the immunogenicity of the virus. Moreover, a single dose of 10 3 TCID 50 of rDEV-∆UL2-HA induced solid protection against lethal DEV challenge and completely prevented H9N2 AIV viral shedding. To our knowledge, this is the first report of a DEV-vectored vaccine providing robust protection against both DEV and H9N2 AIV virus infections in ducks.

Comparative Genomics and Transcriptomics Analyses Reveal Divergent Lifestyle Features of Nematode Endoparasitic Fungus Hirsutella minnesotensis

PubMed Central

Lai, Yiling; Liu, Keke; Zhang, Xinyu; Zhang, Xiaoling; Li, Kuan; Wang, Niuniu; Shu, Chi; Wu, Yunpeng; Wang, Chengshu; Bushley, Kathryn E.; Xiang, Meichun; Liu, Xingzhong

2014-01-01

Hirsutella minnesotensis [Ophiocordycipitaceae (Hypocreales, Ascomycota)] is a dominant endoparasitic fungus by using conidia that adhere to and penetrate the secondary stage juveniles of soybean cyst nematode. Its genome was de novo sequenced and compared with five entomopathogenic fungi in the Hypocreales and three nematode-trapping fungi in the Orbiliales (Ascomycota). The genome of H. minnesotensis is 51.4 Mb and encodes 12,702 genes enriched with transposable elements up to 32%. Phylogenomic analysis revealed that H. minnesotensis was diverged from entomopathogenic fungi in Hypocreales. Genome of H. minnesotensis is similar to those of entomopathogenic fungi to have fewer genes encoding lectins for adhesion and glycoside hydrolases for cellulose degradation, but is different from those of nematode-trapping fungi to possess more genes for protein degradation, signal transduction, and secondary metabolism. Those results indicate that H. minnesotensis has evolved different mechanism for nematode endoparasitism compared with nematode-trapping fungi. Transcriptomics analyses for the time-scale parasitism revealed the upregulations of lectins, secreted proteases and the genes for biosynthesis of secondary metabolites that could be putatively involved in host surface adhesion, cuticle degradation, and host manipulation. Genome and transcriptome analyses provided comprehensive understanding of the evolution and lifestyle of nematode endoparasitism. PMID:25359922

Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution

PubMed Central

Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.

2005-01-01

The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818

Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

PubMed

Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

2013-02-01

To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

Lentiviral-Mediated Gene Therapy in Fanconi Anemia-A Mice Reveals Long-Term Engraftment and Continuous Turnover of Corrected HSCs.

PubMed

Molina-Estevez, F Javier; Nowrouzi, Ali; Lozano, M Luz; Galy, Anne; Charrier, Sabine; von Kalle, Christof; Guenechea, Guillermo; Bueren, Juan A; Schmidt, Manfred

2015-01-01

Fanconi anemia is a DNA repair-deficiency syndrome mainly characterized by cancer predisposition and bone marrow failure. Trying to restore the hematopoietic function in these patients, lentiviral vector-mediated gene therapy trials have recently been proposed. However, because no insertional oncogenesis studies have been conducted so far in DNA repair-deficiency syndromes such as Fanconi anemia, we have carried out a genome-wide screening of lentiviral insertion sites after the gene correction of Fanca(-/-) hematopoietic stem cells (HSCs), using LAM-PCR and 454-pyrosequencing. Our studies first demonstrated that transduction of Fanca(-/-) HSCs with a lentiviral vector designed for clinical application efficiently corrects the phenotype of Fanconi anemia repopulating cells without any sign of toxicity. The identification of more than 6,500 insertion sites in primary and secondary recipients showed a polyclonal pattern of reconstitution, as well as a continuous turnover of corrected Fanca(-/-) HSC clones, without evidences of selection towards specific common integration sites. Taken together our data show, for the first time in a DNA repair-deficiency syndrome, that lentiviral vector-mediated gene therapy efficiently corrects the phenotype of affected HSCs and promotes a healthy pattern of clonal turnover in vivo. These studies will have a particular impact in the development of new gene therapy trials in patients affected by DNA repair syndromes, particularly in Fanconi anemia.

Identification of Salmonella typhimurium Genes Required for Colonization of the Chicken Alimentary Tract and for Virulence in Newly Hatched Chicks

PubMed Central

Turner, Arthur K.; Lovell, Margaret A.; Hulme, Scott D.; Zhang-Barber, Li; Barrow, Paul A.

1998-01-01

From a collection of 2,800 Tn5-TC1 transposon mutants of Salmonella typhimurium F98, 18 that showed reduced intestinal colonization of 3-week-old chicks were identified. The sites of transposon insertion were determined for most of the mutants and included insertions in the lipopolysaccharide biosynthesis genes rfaK, rfaY, rfbK, and rfbB and the genes dksA, clpB, hupA, and sipC. In addition, identification was made of an insertion into a novel gene that encodes a protein showing similarity to the IIC component of the mannose class of phosphoenolpyruvate-carbohydrate phosphotransferase systems, which we putatively called ptsC. Transduction of most of the transposon mutations to a fresh S. typhimurium F98 genetic background and construction of defined mutations in the rfbK, dksA, hupA, sipC, and ptsC genes of S. typhimurium F98 supported the role in colonization of all but the pts locus. The virulence of the rfbK, dksA, hupA, sipC, and ptsC defined mutants and clpB and rfaY transductants in 1-day-old chicks was tested. All but the ptsC and rfaY mutants were attenuated for virulence. A number of other phenotypes associated with some of the mutations are described. PMID:9573095

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Structural, Bioinformatic, and In Vivo Analyses of Two Treponema pallidum Lipoproteins Reveal a Unique TRAP Transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deka, Ranjit K.; Brautigam, Chad A.; Goldberg, Martin

2012-05-25

Treponema pallidum, the bacterial agent of syphilis, is predicted to encode one tripartite ATP-independent periplasmic transporter (TRAP-T). TRAP-Ts typically employ a periplasmic substrate-binding protein (SBP) to deliver the cognate ligand to the transmembrane symporter. Herein, we demonstrate that the genes encoding the putative TRAP-T components from T. pallidum, tp0957 (the SBP), and tp0958 (the symporter), are in an operon with an uncharacterized third gene, tp0956. We determined the crystal structure of recombinant Tp0956; the protein is trimeric and perforated by a pore. Part of Tp0956 forms an assembly similar to those of 'tetratricopeptide repeat' (TPR) motifs. The crystal structure ofmore » recombinant Tp0957 was also determined; like the SBPs of other TRAP-Ts, there are two lobes separated by a cleft. In these other SBPs, the cleft binds a negatively charged ligand. However, the cleft of Tp0957 has a strikingly hydrophobic chemical composition, indicating that its ligand may be substantially different and likely hydrophobic. Analytical ultracentrifugation of the recombinant versions of Tp0956 and Tp0957 established that these proteins associate avidly. This unprecedented interaction was confirmed for the native molecules using in vivo cross-linking experiments. Finally, bioinformatic analyses suggested that this transporter exemplifies a new subfamily of TPATs (TPR-protein-associated TRAP-Ts) that require the action of a TPR-containing accessory protein for the periplasmic transport of a potentially hydrophobic ligand(s).« less

Evolutionary transgenomics: prospects and challenges.

PubMed

Correa, Raul; Baum, David A

2015-01-01

Many advances in our understanding of the genetic basis of species differences have arisen from transformation experiments, which allow us to study the effect of genes from one species (the donor) when placed in the genetic background of another species (the recipient). Such interspecies transformation experiments are usually focused on candidate genes - genes that, based on work in model systems, are suspected to be responsible for certain phenotypic differences between the donor and recipient species. We suggest that the high efficiency of transformation in a few plant species, most notably Arabidopsis thaliana, combined with the small size of typical plant genes and their cis-regulatory regions allow implementation of a screening strategy that does not depend upon a priori candidate gene identification. This approach, transgenomics, entails moving many large genomic inserts of a donor species into the wild type background of a recipient species and then screening for dominant phenotypic effects. As a proof of concept, we recently conducted a transgenomic screen that analyzed more than 1100 random, large genomic inserts of the Alabama gladecress Leavenworthia alabamica for dominant phenotypic effects in the A. thaliana background. This screen identified one insert that shortens fruit and decreases A. thaliana fertility. In this paper we discuss the principles of transgenomic screens and suggest methods to help minimize the frequencies of false positive and false negative results. We argue that, because transgenomics avoids committing in advance to candidate genes it has the potential to help us identify truly novel genes or cryptic functions of known genes. Given the valuable knowledge that is likely to be gained, we believe the time is ripe for the plant evolutionary community to invest in transgenomic screens, at least in the mustard family Brassicaceae where many species are amenable to efficient transformation.

Study of Gene Trafficking between Acanthamoeba and Giant Viruses Suggests an Undiscovered Family of Amoeba-Infecting Viruses.

PubMed

Maumus, Florian; Blanc, Guillaume

2016-12-14

The nucleocytoplasmic large DNA viruses (NCLDV) are a group of extremely complex double-stranded DNA viruses, which are major parasites of a variety of eukaryotes. Recent studies showed that certain unicellular eukaryotes contain fragments of NCLDV DNA integrated in their genome, when surprisingly many of these organisms were not previously shown to be infected by NCLDVs. These findings prompted us to search the genome of Acanthamoeba castellanii strain Neff (Neff), one of the most prolific hosts in the discovery of giant NCLDVs, for possible DNA inserts of viral origin. We report the identification of 267 markers of lateral gene transfer with viruses, approximately half of which are clustered in Neff genome regions of viral origins, transcriptionally inactive or exhibit nucleotide-composition signatures suggestive of a foreign origin. The integrated viral genes had diverse origin among relatives of viruses that infect Neff, including Mollivirus, Pandoravirus, Marseillevirus, Pithovirus, and Mimivirus However, phylogenetic analysis suggests the existence of a yet-undiscovered family of amoeba-infecting NCLDV in addition to the five already characterized. The active transcription of some apparently anciently integrated virus-like genes suggests that some viral genes might have been domesticated during the amoeba evolution. These insights confirm that genomic insertion of NCLDV DNA is a common theme in eukaryotes. This gene flow contributed fertilizing the eukaryotic gene repertoire and participated in the occurrence of orphan genes, a long standing issue in genomics. Search for viral inserts in eukaryotic genomes followed by environmental screening of the original viruses should be used to isolate radically new NCLDVs. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Insertional engineering of chromosomes with Sleeping Beauty transposition: an overview.

PubMed

Grabundzija, Ivana; Izsvák, Zsuzsanna; Ivics, Zoltán

2011-01-01

Novel genetic tools and mutagenesis strategies based on the Sleeping Beauty (SB) transposable element are currently under development with a vision to link primary DNA sequence information to gene functions in vertebrate models. By virtue of its inherent capacity to insert into DNA, the SB transposon can be developed into powerful tools for chromosomal manipulations. Mutagenesis screens based on SB have numerous advantages including high throughput and easy identification of mutated alleles. Forward genetic approaches based on insertional mutagenesis by engineered SB transposons have the advantage of providing insight into genetic networks and pathways based on phenotype. Indeed, the SB transposon has become a highly instrumental tool to induce tumors in experimental animals in a tissue-specific -manner with the aim of uncovering the genetic basis of diverse cancers. Here, we describe a battery of mutagenic cassettes that can be applied in conjunction with SB transposon vectors to mutagenize genes, and highlight versatile experimental strategies for the generation of engineered chromosomes for loss-of-function as well as gain-of-function mutagenesis for functional gene annotation in vertebrate models.

Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

PubMed Central

Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

1993-01-01

Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana

2015-03-01

We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Prevalence of Ambler class A β-lactamases and ampC expression in cephalosporin-resistant isolates of Acinetobacter baumannii.

PubMed

Rezaee, Mohammad Ahangarzadeh; Pajand, Omid; Nahaei, Mohammad Reza; Mahdian, Reza; Aghazadeh, Mohammad; Ghojazadeh, Morteza; Hojabri, Zoya

2013-07-01

We examined the prevalence of various cephalosporins' resistance mechanisms in Acinetobacter baumannii clinical isolates. Phenotypic and molecular detection of Ambler classes A, B and D β-lactamases was performed on 75 isolates. Clonal relatedness was defined using Repetitive Extragenic Palindromic PCR. PCR mapping was used to examine the linkage of insertion sequences and the ampC gene, and ampC expression was analyzed by TaqMan reverse transcriptase-PCR. Twenty-six (37%) isolates carried at least one of the blaPER-1 or blaTEM-1. Sixty-nine (98.5%) out of 70 cephalosporin-resistant isolates had insertions upstream of the ampC gene, of which 48 (69%) and 6 (8%) were identified as ISAba1and ISAba125, respectively. Higher level of expression was obtained in resistant isolates lacking ISAba1/ampC combination in comparison with that in positive ones. The ability to up-regulate the expression of ampC gene in association with different insertion elements has become an important factor in A. baumannii resistance to cephalosporins. Copyright © 2013 Elsevier Inc. All rights reserved.

An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease.

PubMed Central

Urban, M; Bhargava, T; Hamer, J E

1999-01-01

Cells tolerate exposure to cytotoxic compounds through the action of ATP-driven efflux pumps belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. Phytopathogenic fungi encounter toxic environments during plant invasion as a result of the plant defense response. Here we demonstrate the requirement for an ABC transporter during host infection by the fungal plant pathogen Magnaporthe grisea. The ABC1 gene was identified in an insertional mutagenesis screen for pathogenicity mutants. The ABC1 insertional mutant and a gene-replacement mutant arrest growth and die shortly after penetrating either rice or barley epidermal cells. The ABC1-encoded protein is similar to yeast ABC transporters implicated in multidrug resistance, and ABC1 gene transcripts are inducible by toxic drugs and a rice phytoalexin. However, abc1 mutants are not hypersensitive to antifungal compounds. The non-pathogenic, insertional mutation in ABC1 occurs in the promoter region and dramatically reduces transcript induction by metabolic poisons. These data strongly suggest that M.grisea requires the up-regulation of specific ABC transporters for pathogenesis; most likely to protect itself against plant defense mechanisms. PMID:9927411

In vivo modification of a maize engineered minichromosome.

PubMed

Gaeta, Robert T; Masonbrink, Rick E; Zhao, Changzeng; Sanyal, Abhijit; Krishnaswamy, Lakshminarasimhan; Birchler, James A

2013-06-01

Engineered minichromosomes provide efficient platforms for stacking transgenes in crop plants. Methods for modifying these chromosomes in vivo are essential for the development of customizable systems for the removal of selection genes or other sequences and for the addition of new genes. Previous studies have demonstrated that Cre, a site-specific recombinase, could be used to modify lox sites on transgenes on maize minichromosomes; however, these studies demonstrated somatic recombination only, and modified minichromosomes could not be recovered. We describe the recovery of an engineered chromosome composed of little more than a centromere plus transgene that was derived by telomere-mediated truncation. We used the fiber fluorescence in situ hybridization technique and detected a transgene on the minichromosome inserted among stretches of CentC centromere repeats, and this insertion was large enough to suggest a tandem insertion. By crossing the minichromosome to a plant expressing Cre-recombinase, the Bar selection gene was removed, leaving behind a single loxP site. This study demonstrates that engineered chromosomes can be modified in vivo using site-specific recombinases, a demonstration essential to the development of amendable chromosome platforms in plants.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

Single gene insertion drives bioalcohol production by a thermophilic archaeon

PubMed Central

Basen, Mirko; Schut, Gerrit J.; Nguyen, Diep M.; Lipscomb, Gina L.; Benn, Robert A.; Prybol, Cameron J.; Vaccaro, Brian J.; Poole, Farris L.; Kelly, Robert M.; Adams, Michael W. W.

2014-01-01

Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 °C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways. PMID:25368184

Single gene insertion drives bioalcohol production by a thermophilic archaeon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basen, M; Schut, GJ; Nguyen, DM

2014-12-09

Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. Bymore » heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.« less

Papaya (Carica papaya L.).

PubMed

Zhu, Yun J; Fitch, Maureen M M; Moore, Paul H

2006-01-01

Transgenic papaya plants were initially obtained using particle bombardment, a method having poor efficiency in producing intact, single-copy insertion of transgenes. Single-copy gene insertion was improved using Agrobacterium tumefaciens. With progress being made in genome sequencing and gene discovery, there is a need for more efficient methods of transformation in order to study the function of these genes. We describe a protocol for Agrobacterium-mediated transformation using carborundum-wounded papaya embryogenic calli. This method should lead to high-throughput transformation, which on average produced at least one plant that was positive in polymerase chain reaction (PCR), histochemical staining, or by Southern blot hybridization from 10 to 20% of the callus clusters that had been co-cultivated with Agrobacterium. Plants regenerated from the callus clusters in 9 to 13 mo.

Transposon Mutagenesis Identified Chromosomal and Plasmid Genes Essential for Adaptation of the Marine Bacterium Dinoroseobacter shibae to Anaerobic Conditions

PubMed Central

Ebert, Matthias; Laaß, Sebastian; Burghartz, Melanie; Petersen, Jörn; Koßmehl, Sebastian; Wöhlbrand, Lars; Rabus, Ralf; Wittmann, Christoph; Jahn, Dieter

2013-01-01

Anaerobic growth and survival are integral parts of the life cycle of many marine bacteria. To identify genes essential for the anoxic life of Dinoroseobacter shibae, a transposon library was screened for strains impaired in anaerobic denitrifying growth. Transposon insertions in 35 chromosomal and 18 plasmid genes were detected. The essential contribution of plasmid genes to anaerobic growth was confirmed with plasmid-cured D. shibae strains. A combined transcriptome and proteome approach identified oxygen tension-regulated genes. Transposon insertion sites of a total of 1,527 mutants without an anaerobic growth phenotype were determined to identify anaerobically induced but not essential genes. A surprisingly small overlap of only three genes (napA, phaA, and the Na+/Pi antiporter gene Dshi_0543) between anaerobically essential and induced genes was found. Interestingly, transposon mutations in genes involved in dissimilatory and assimilatory nitrate reduction (napA, nasA) and corresponding cofactor biosynthesis (genomic moaB, moeB, and dsbC and plasmid-carried dsbD and ccmH) were found to cause anaerobic growth defects. In contrast, mutation of anaerobically induced genes encoding proteins required for the later denitrification steps (nirS, nirJ, nosD), dimethyl sulfoxide reduction (dmsA1), and fermentation (pdhB1, arcA, aceE, pta, acs) did not result in decreased anaerobic growth under the conditions tested. Additional essential components (ferredoxin, cccA) of the anaerobic electron transfer chain and central metabolism (pdhB) were identified. Another surprise was the importance of sodium gradient-dependent membrane processes and genomic rearrangements via viruses, transposons, and insertion sequence elements for anaerobic growth. These processes and the observed contributions of cell envelope restructuring (lysM, mipA, fadK), C4-dicarboxylate transport (dctM1, dctM3), and protease functions to anaerobic growth require further investigation to unravel the novel underlying adaptation strategies. PMID:23974024

Expressing genes do not forget their LINEs: transposable elements and gene expression

PubMed Central

Kines, Kristine J.; Belancio, Victoria P.

2012-01-01

1. ABSTRACT Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue-or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored. PMID:22201807

Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism.

PubMed

Zhang, Zhenyu; Zhao, Wei; Li, Deshan; Yang, Jinlong; Zsak, Laszlo; Yu, Qingzhong

2015-08-01

In the present study, we developed a novel approach for foreign gene expression by Newcastle disease virus (NDV) from a second ORF through an internal ribosomal entry site (IRES). Six NDV LaSota strain-based recombinant viruses vectoring the IRES and a red fluorescence protein (RFP) gene behind the nucleocapsid (NP), phosphoprotein (P), matrix (M), fusion (F), haemagglutinin-neuraminidase (HN) or large polymerase (L) gene ORF were generated using reverse genetics technology. The insertion of the second ORF slightly attenuated virus pathogenicity, but did not affect ability of the virus to grow. Quantitative measurements of RFP expression in virus-infected DF-1 cells revealed that the abundance of viral mRNAs and red fluorescence intensity were positively correlated with the gene order of NDV, 3'-NP-P-M-F-HN-L-5', proving the sequential transcription mechanism for NDV. The results herein suggest that the level of foreign gene expression could be regulated by selecting the second ORF insertion site to maximize the efficacy of vaccine and gene therapy.

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

The Tgm9-induced indexed insertional mutant collection to conduct community-based reverse genetics studies in soybean

USDA-ARS?s Scientific Manuscript database

Until now, functional analyses of soybean genes have been very arduous because of the lack of a rapid transformation procedure. Recently identified the active endogenous type II transposable element, Tgm9, excises from insertion sites and restores wild-type phenotypes. Thus, this element provides a ...

Facial asymmetry and clinical manifestations in patients with novel insertion of the TCOF1 gene.

PubMed

Su, P-H; Liu, Y-F; Yu, J-S; Chen, J-Y; Chen, S-J; Lai, Y-J

2012-11-01

This study explored the role of TCOF1 insertion mutations in Taiwanese patients with craniofacial anomalies. Twelve patients with single or multiple, asymmetrical congenital craniofacial anomalies were enrolled. Genomic DNA was prepared from leukocytes; the coding regions of TCOF1 were analyzed by polymerase chain reaction and direct sequencing. Clinical manifestations were correlated to the TCOF1 mutation. Six of 12 patients diagnosed with hemifacial microsomia exhibited a novel insertion mutation 4127 ins G (frameshift) in exon 24 in the TCOF1 gene. All six patients were diagnosed with anomalies on the left side. In addition, four of these six patients had hearing impairment; three had other major anomalies; and two had developmental delay. The insertion caused a frameshift, an early truncation, the loss of two putative nuclear localization signals (residues 1404-1420 and 1424-1440), and the loss of coiled coil domain (1406-1426) in treacle protein. These findings support the existence of two regulators of growth of the mandibular condyles. © 2011 John Wiley & Sons A/S.

Nicotinamide dependence of uropathogenic Escherichia coli UTI89 and application of nadB as a neutral insertion site.

PubMed

Li, Zhaoli; Bouckaert, Julie; Deboeck, Francine; De Greve, Henri; Hernalsteens, Jean-Pierre

2012-03-01

NAD and NADP are ubiquitous in the metabolism of Escherichia coli K-12. NAD auxotrophy can be rendered by mutation in any of the three genes nadB, nadA and nadC. The nadB and nadA genes were defined as antivirulence loci in Shigella spp., as a mutation (mainly in nadB) disrupting the synthesis of quinolinate is required for virulence. Uropathogenic E. coli (UPEC) isolates from acute cystitis patients, exhibiting nicotinamide auxotrophy, were of serotype O18 : K1 : H7. E. coli UTI89, the model uropathogenic and O18 : K1 : H7 strain, requires nicotinamide or quinolinate for growth. A mutation in the nadB gene, encoding L-aspartate oxidase, was shown to be responsible for the nicotinamide requirement of UTI89. This was further confirmed by complementation of UTI89 with a recombinant plasmid harbouring the nadB gene of E. coli K-12. An Ala28Val point mutant of the recombinant plasmid failed to support the growth of UTI89 in minimal medium. This proves that the Ala28Val mutation in the NadB gene of UTI89 completely impedes de novo synthesis of nicotinamide. In spontaneous prototrophic revertants of UTI89, the nadB gene has a Val28Ala mutation. Both analyses implicate that the nicotinamide auxotrophy of UTI89 is caused by a single Ala28Val mutation in NadB. We showed that the same mutation is also present in other NAD auxotrophic E. coli O18 strains. No significant differences were observed between the virulence of isogenic NAD auxotrophic and prototrophic strains in the murine ascending urinary tract infection model. Considering these data, we applied the nadB locus as a neutral site for DNA insertions in the bacterial chromosome. We successfully restored the parental phenotype of a fimH mutant by inserting fimH, with a synthetic em7 promoter, into the nadB gene. This neutral insertion site is of significance for further research on the pathogenicity of UPEC.

A Truncated AdeS Kinase Protein Generated by ISAba1 Insertion Correlates with Tigecycline Resistance in Acinetobacter baumannii

PubMed Central

Sun, Jun-Ren; Perng, Cherng-Lih; Chan, Ming-Chin; Morita, Yuji; Lin, Jung-Chung; Su, Chih-Mao; Wang, Wei-Yao; Chang, Tein-Yao; Chiueh, Tzong-Shi

2012-01-01

Over-expression of AdeABC efflux pump stimulated continuously by the mutated AdeRS two component system has been found to result in antimicrobial resistance, even tigecycline (TGC) resistance, in multidrug-resistant Acinetobacter baumannii (MRAB). Although the insertion sequence, ISAba1, contributes to one of the AdeRS mutations, the detail mechanism remains unclear. In the present study we collected 130 TGC-resistant isolates from 317 carbapenem resistant MRAB (MRAB-C) isolates, and 38 of them were characterized with ISAba1 insertion in the adeS gene. The relationship between the expression of AdeABC efflux pump and TGC resistant was verified indirectly by successfully reducing TGC resistance with NMP, an efflux pump inhibitor. Further analysis showed that the remaining gene following the ISAba1 insertion was still transcribed to generate a truncated AdeS protein by the Pout promoter on ISAba1 instead of frame shift or pre-termination. Through introducing a series of recombinant adeRS constructs into a adeRS knockout strain, we demonstrated the truncated AdeS protein was constitutively produced and stimulating the expression of AdeABC efflux pump via interaction with AdeR. Our findings suggest a mechanism of antimicrobial resistance induced by an aberrant cytoplasmic sensor derived from an insertion element. PMID:23166700

Generation of mariner-based transposon insertion mutant library of Bacillus sphaericus 2297 and investigation of genes involved in sporulation and mosquito-larvicidal crystal protein synthesis.

PubMed

Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming

2012-05-01

Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

A potyvirus-based gene vector allows producing active human S-COMT and animal GFP, but not human sorcin, in vector-infected plants.

PubMed

Kelloniemi, Jani; Mäkinen, Kristiina; Valkonen, Jari P T

2006-05-01

Potato virus A (PVA), a potyvirus with a (+)ssRNA genome translated to a large polyprotein, was engineered and used as a gene vector for expression of heterologous proteins in plants. Foreign genes including jellyfish GFP (Aequorea victoria) encoding the green fluorescent protein (GFP, 27 kDa) and the genes of human origin (Homo sapiens) encoding a soluble resistance-related calcium-binding protein (sorcin, 22 kDa) and the catechol-O-methyltransferase (S-COMT; 25 kDa) were cloned between the cistrons for the viral replicase and coat protein (CP). The inserts caused no adverse effects on viral infectivity and virulence, and the inserted sequences remained intact in progeny viruses in the systemically infected leaves. The heterologous proteins were released from the viral polyprotein following cleavage by the main viral proteinase, NIa, at engineered proteolytic processing sites flanking the insert. Active GFP, as indicated by green fluorescence, and S-COMT with high levels of enzymatic activity were produced. In contrast, no sorcin was detected despite the expected equimolar amounts of the foreign and viral proteins being expressed as a polyprotein. These data reveal inherent differences between heterologous proteins in their suitability for production in plants.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

[Genetic diversity and relationships of northern eurasia populations for polymorphic Alu-insertions].

PubMed

Khitrinskaia, I Iu; Khar'kov, V N; Voevoda, M I; Stepanova, V A

2014-01-01

We for the first time have examined the autosomal gene pool of the Siberia, Central Asian and the Far East populations (27 populations of 12 ethnic groups) using a set of polymorphic Alu insertions in the human genome. The results of the analysis testify (i) to a significant level of genetic diversity in the Northern Eurasian populations and (ii) to a considerable differentiation of gene pool in the population of this region. It has been shown that at the CD4 locus, the frequency of Alu (-) is inversely related to the Mongoloid component of the population, the lowest and highest frequencies of the Alu deletion at locus CD4 were recorded respectively in Eskimo (0.012) and Russian and Ukrainian (0.35). The analysis of gene flow proved Caucasoid populations (Russian, Tajik and Uzbek), as well as those of Turkic ethnic groups from the Southern Siberia (Altaians and Tuvinians) and Khanty and Mansy populations to be the recipients of a considerable gene flow from the outside of the concerned population system, as compared with the East Siberian and the Far East ethnic groups. The results of the correlation analysis received with use polymorphic Alu insertion testify to the greatest correlation of genetic distances with anthropological characteristics of populations.

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

Disruption of tetR type regulator adeN by mobile genetic element confers elevated virulence in Acinetobacter baumannii.

PubMed

Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K

2017-10-03

Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.

Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

PubMed Central

Bii, Victor M.; Trobridge, Grant D.

2016-01-01

Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127

Transcriptomics and molecular evolutionary rate analysis of the bladderwort (Utricularia), a carnivorous plant with a minimal genome

PubMed Central

2011-01-01

Background The carnivorous plant Utricularia gibba (bladderwort) is remarkable in having a minute genome, which at ca. 80 megabases is approximately half that of Arabidopsis. Bladderworts show an incredible diversity of forms surrounding a defined theme: tiny, bladder-like suction traps on terrestrial, epiphytic, or aquatic plants with a diversity of unusual vegetative forms. Utricularia plants, which are rootless, are also anomalous in physiological features (respiration and carbon distribution), and highly enhanced molecular evolutionary rates in chloroplast, mitochondrial and nuclear ribosomal sequences. Despite great interest in the genus, no genomic resources exist for Utricularia, and the substitution rate increase has received limited study. Results Here we describe the sequencing and analysis of the Utricularia gibba transcriptome. Three different organs were surveyed, the traps, the vegetative shoot bodies, and the inflorescence stems. We also examined the bladderwort transcriptome under diverse stress conditions. We detail aspects of functional classification, tissue similarity, nitrogen and phosphorus metabolism, respiration, DNA repair, and detoxification of reactive oxygen species (ROS). Long contigs of plastid and mitochondrial genomes, as well as sequences for 100 individual nuclear genes, were compared with those of other plants to better establish information on molecular evolutionary rates. Conclusion The Utricularia transcriptome provides a detailed genomic window into processes occurring in a carnivorous plant. It contains a deep representation of the complex metabolic pathways that characterize a putative minimal plant genome, permitting its use as a source of genomic information to explore the structural, functional, and evolutionary diversity of the genus. Vegetative shoots and traps are the most similar organs by functional classification of their transcriptome, the traps expressing hydrolytic enzymes for prey digestion that were previously thought to be encoded by bacteria. Supporting physiological data, global gene expression analysis shows that traps significantly over-express genes involved in respiration and that phosphate uptake might occur mainly in traps, whereas nitrogen uptake could in part take place in vegetative parts. Expression of DNA repair and ROS detoxification enzymes may be indicative of a response to increased respiration. Finally, evidence from the bladderwort transcriptome, direct measurement of ROS in situ, and cross-species comparisons of organellar genomes and multiple nuclear genes supports the hypothesis that increased nucleotide substitution rates throughout the plant may be due to the mutagenic action of amplified ROS production. PMID:21639913

Molecular detection and genetic diversity of Babesia gibsoni in dogs in Bangladesh.

PubMed

Terao, Masashi; Akter, Shirin; Yasin, Md Golam; Nakao, Ryo; Kato, Hirotomo; Alam, Mohammad Zahangir; Katakura, Ken

2015-04-01

Babesia gibsoni is a tick-borne hemoprotozoan parasite of dogs that often causes fever and hemolytic illness. Detection of B. gibsoni has been predominantly reported in Asian countries, including Japan, Korea, Taiwan, Malaysia, Bangladesh and India. The present study shows the first molecular characterization of B. gibsoni detected from dogs in Bangladesh. Blood samples were collected on FTA® Elute cards from 50 stray dogs in Mymensingh District in Bangladesh. DNA eluted from the cards was subjected to nested PCR for the 18S rRNA gene of Babesia species. Approximately 800bp PCR products were detected in 15 of 50 dogs (30%). Based on restriction fragment length polymorphism (RFLP) and direct sequencing of the PCR products, all parasite isolates were identified as B. gibsoni. Furthermore, the BgTRAP (B. gibsoni thrombospondin-related adhesive protein) gene fragments were detected in 13 of 15 18S rRNA gene PCR positive blood samples. Phylogenetic analysis of the BgTRAP gene revealed that B. gibsoni parasites in Bangladesh formed a cluster, which was genetically different from other Asian B. gibsoni isolates. In addition, tandem repeat analysis of the BgTRAP gene clearly showed considerable genetic variation among Bangladeshi isolates. These results suggested that B. gibsoni parasites in a different genetic clade are endemic in dogs in Bangladesh. Further studies are required to elucidate the origin, distribution, vector and pathogenesis of B. gibsoni parasites circulating in dogs in Bangladesh. Copyright © 2015 Elsevier B.V. All rights reserved.

The dam replacing gene product enhances Neisseria gonorrhoeae FA1090 viability and biofilm formation

PubMed Central

Kwiatek, Agnieszka; Bacal, Pawel; Wasiluk, Adrian; Trybunko, Anastasiya; Adamczyk-Poplawska, Monika

2014-01-01

Many Neisseriaceae do not exhibit Dam methyltransferase activity and, instead of the dam gene, possess drg (dam replacing gene) inserted in the leuS/dam locus. The drg locus in Neisseria gonorrhoeae FA1090 has a lower GC-pairs content (40.5%) compared to the whole genome of N. gonorrhoeae FA1090 (52%). The gonococcal drg gene encodes a DNA endonuclease Drg, with GmeATC specificity. Disruption of drg or insertion of the dam gene in gonococcal genome changes the level of expression of genes as shown by transcriptome analysis. For the drg-deficient N. gonorrhoeae mutant, a total of 195 (8.94% of the total gene pool) genes exhibited an altered expression compared to the wt strain by at least 1.5 fold. In dam-expressing N. gonorrhoeae mutant, the expression of 240 genes (11% of total genes) was deregulated. Most of these deregulated genes were involved in translation, DNA repair, membrane biogenesis and energy production as shown by cluster of orthologous group analysis. In vivo, the inactivation of drg gene causes the decrease of the number of live neisserial cells and long lag phase of growth. The insertion of dam gene instead of drg locus restores cell viability. We have also shown that presence of the drg gene product is important for N. gonorrhoeae FA1090 in adhesion, including human epithelial cells, and biofilm formation. Biofilm produced by drg-deficient strain is formed by more dispersed cells, compared to this one formed by parental strain as shown by scanning electron and confocal microscopy. Also adherence assays show a significantly smaller biomass of formed biofilm (OD570 = 0.242 ± 0.038) for drg-deficient strain, compared to wild-type strain (OD570 = 0.378 ± 0.057). Dam-expressing gonococcal cells produce slightly weaker biofilm with cells embedded in an extracellular matrix. This strain has also a five times reduced ability for adhesion to human epithelial cells. In this context, the presence of Drg is more advantageous for N. gonorrhoeae biology than Dam presence. PMID:25566225

A Novel Retrotransposon Inserted in the Dominant Vrn-B1 Allele Confers Spring Growth Habit in Tetraploid Wheat (Triticum turgidum L.).

PubMed

Chu, C-G; Tan, C T; Yu, G-T; Zhong, S; Xu, S S; Yan, L

2011-12-01

Vernalization genes determine winter/spring growth habit in temperate cereals and play important roles in plant development and environmental adaptation. In wheat (Triticum L. sp.), it was previously shown that allelic variation in the vernalization gene VRN1 was due to deletions or insertions either in the promoter or in the first intron. Here, we report a novel Vrn-B1 allele that has a retrotransposon in its promoter conferring spring growth habit. The VRN-B1 gene was mapped in a doubled haploid population that segregated for winter-spring growth habit but was derived from two spring tetraploid wheat genotypes, the durum wheat (T. turgidum subsp. durum) variety 'Lebsock' and T. turgidum subsp. carthlicum accession PI 94749. Genetic analysis revealed that Lebsock carried the dominant Vrn-A1 and recessive vrn-B1 alleles, whereas PI 94749 had the recessive vrn-A1 and dominant Vrn-B1 alleles. The Vrn-A1 allele in Lebsock was the same as the Vrn-A1c allele previously reported in hexaploid wheat. No differences existed between the vrn-B1 and Vrn-B1 alleles, except that a 5463-bp insertion was detected in the 5'-UTR region of the Vrn-B1 allele. This insertion was a novel retrotransposon (designated as retrotrans_VRN), which was flanked by a 5-bp target site duplication and contained primer binding site and polypurine tract motifs, a 325-bp long terminal repeat, and an open reading frame encoding 1231 amino acids. The insertion of retrotrans_VRN resulted in expression of Vrn-B1 without vernalization. Retrotrans_VRN is prevalent among T. turgidum subsp. carthlicum accessions, less prevalent among T. turgidum subsp. dicoccum accessions, and rarely found in other tetraploid wheat subspecies.

Phenotypic characterization of xpr, a global regulator of extracellular virulence factors in Staphylococcus aureus

NASA Technical Reports Server (NTRS)

Smeltzer, M. S.; Hart, M. E.; Iandolo, J. J.; Spooner, B. S. (Principal Investigator)

1993-01-01

We recently described a Tn551 insertion in the chromosome of Staphylococcus aureus S6C that resulted in drastically reduced expression of extracellular lipase (M. S. Smeltzer, S. R. Gill, and J. J. Iandolo, J. Bacteriol. 174:4000-4006, 1992). The insertion was localized to a chromosomal site (designated omega 1058) distinct from the lipase structural gene (geh) and the accessory gene regulator (agr), both of which were structurally intact in the lipase-negative (Lip-) mutants. In this report, we describe a phenotypic comparison between strains S6C, a hyperproducer of enterotoxin B; KSI9051, a derivative of S6C carrying the Tn551 insertion at omega 1058; ISP546, an 8325-4 strain that carries a Tn551 insertion in the agr locus; and ISP479C, the parent strain of ISP546 cured of the Tn551 delivery plasmid pI258repA36. Compared with their respective parent strains, ISP546 and KSI9051 produced greatly reduced amounts of lipase, alpha-toxin, delta-toxin, protease, and nuclease. KSI9051 also produced reduced amounts of staphylococcal enterotoxin B. Coagulase production was increased in ISP546 but not in KSI9051. Using a mouse model, we also demonstrated that ISP546 and KSI9051 were far less virulent than ISP479C and S6C. We have designated the genetic element defined by the Tn551 insertion at omega 1058 xpr to denote its role as a regulator of extracellular protein synthesis. We conclude that xpr and agr are similar and possibly interactive regulatory genes that play an important role in pathogenesis of staphylococcal disease.

A putative regulatory genetic locus modulates virulence in the pathogen Leptospira interrogans.

PubMed

Eshghi, Azad; Becam, Jérôme; Lambert, Ambroise; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Wunder, Elsio A; Ko, Albert I; Coppee, Jean-Yves; Goarant, Cyrille; Picardeau, Mathieu

2014-06-01

Limited research has been conducted on the role of transcriptional regulators in relation to virulence in Leptospira interrogans, the etiological agent of leptospirosis. Here, we identify an L. interrogans locus that encodes a sensor protein, an anti-sigma factor antagonist, and two genes encoding proteins of unknown function. Transposon insertion into the gene encoding the sensor protein led to dampened transcription of the other 3 genes in this locus. This lb139 insertion mutant (the lb139(-) mutant) displayed attenuated virulence in the hamster model of infection and reduced motility in vitro. Whole-transcriptome analyses using RNA sequencing revealed the downregulation of 115 genes and the upregulation of 28 genes, with an overrepresentation of gene products functioning in motility and signal transduction and numerous gene products with unknown functions, predicted to be localized to the extracellular space. Another significant finding encompassed suppressed expression of the majority of the genes previously demonstrated to be upregulated at physiological osmolarity, including the sphingomyelinase C precursor Sph2 and LigB. We provide insight into a possible requirement for transcriptional regulation as it relates to leptospiral virulence and suggest various biological processes that are affected due to the loss of native expression of this genetic locus.

TrapEase inferior vena cava filter placement: use of the subclavian vein.

PubMed

Stone, Patrick A; Aburahma, Ali F; Hass, Stephen M; Hofeldt, Matthew J; Zimmerman, William B; Deel, John T; Deluca, John A

2004-01-01

The purpose of this paper was to evaluate the safety and technical success of TrapEase inferior vena cava filter placement via the subclavian vein. As of yet, no reports in the literature have specifically investigated the use of the subclavian vein as a route for deploying TrapEase vena cava filters. Retrospective chart review was conducted of 135 patients with attempted TrapEase inferior vena cava filter placement over a 2-year period. In a majority of cases, the choice of subclavian vein approach was based primarily on surgeon preference. Other circumstances for subclavian vein deployment included cervical immobilization secondary to trauma, desire for concomitant placement of a subclavian long-term central venous access catheter, and patient body habitus limiting exposure to the internal jugular vein. One hundred and thirty-five filters were placed over this 2-year period. The internal jugular vein approach was used in 56 patients, the femoral vein approach in 39 patients, and the subclavian vein approach in 40 patients. Thirty-nine of the 40 TrapEase filter placements using the subclavian vein were successful. Twenty-six were deployed through the right subclavian vein and 14 through the left subclavian vein. The single failed subclavian deployment was due to the inability to pass the guidewire adequately into the inferior vena cava after successful cannulation of the right subclavian vein. The average deployment time for subclavian vein placement was 26 minutes when TrapEase filter placement was the only procedure performed. No insertional complications were encountered, specifically no pneumothoraces confirmed by chest radiography or fluoroscopy. The subclavian vein provides an alternative site of access for the TrapEase inferior vena cava filter. This route is comparable to other alternative methods evaluated both in average deployment time and complication occurrence. Furthermore, the subclavian vein route is valuable in patients with limited central access and where combined long-term central venous catheter placement using the subclavian vein is desirable.

Paucity and preferential suppression of transgenes in late replication domains of the D. melanogaster genome.

PubMed

Babenko, Vladimir N; Makunin, Igor V; Brusentsova, Irina V; Belyaeva, Elena S; Maksimov, Daniil A; Belyakin, Stepan N; Maroy, Peter; Vasil'eva, Lyubov A; Zhimulev, Igor F

2010-05-21

Eukaryotic genomes are organized in extended domains with distinct features intimately linking genome structure, replication pattern and chromatin state. Recently we identified a set of long late replicating euchromatic regions that are underreplicated in salivary gland polytene chromosomes of D. melanogaster. Here we demonstrate that these underreplicated regions (URs) have a low density of P-element and piggyBac insertions compared to the genome average or neighboring regions. In contrast, Minos-based transposons show no paucity in URs but have a strong bias to testis-specific genes. We estimated the suppression level in 2,852 stocks carrying a single P-element by analysis of eye color determined by the mini-white marker gene and demonstrate that the proportion of suppressed transgenes in URs is more than three times higher than in the flanking regions or the genomic average. The suppressed transgenes reside in intergenic, genic or promoter regions of the annotated genes. We speculate that the low insertion frequency of P-elements and piggyBacs in URs partially results from suppression of transgenes that potentially could prevent identification of transgenes due to complete suppression of the marker gene. In a similar manner, the proportion of suppressed transgenes is higher in loci replicating late or very late in Kc cells and these loci have a lower density of P-elements and piggyBac insertions. In transgenes with two marker genes suppression of mini-white gene in eye coincides with suppression of yellow gene in bristles. Our results suggest that the late replication domains have a high inactivation potential apparently linked to the silenced or closed chromatin state in these regions, and that such inactivation potential is largely maintained in different tissues.

Biodegradation of the Organic Disulfide 4,4′-Dithiodibutyric Acid by Rhodococcus spp.

PubMed Central

Khairy, Heba; Wübbeler, Jan Hendrik

2015-01-01

Four Rhodococcus spp. exhibited the ability to use 4,4′-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). PMID:26407888

Mining secreted proteins that function in pepper fruit development and ripening using a yeast secretion trap (YST)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Je Min, E-mail: jemin@knu.ac.kr; Department of Horticultural Science, Kyungpook National University, Daegu; Lee, Sang-Jik

Highlights: • Yeast secretion trap (YST) is a valuable tool for mining secretome. • A total of 80 secreted proteins are newly identified via YST in pepper fruits. • The secreted proteins are differentially regulated during pepper development and ripening. • Transient GFP-fusion assay and in planta secretion trap can effectively validate the secretion of proteins. - Abstract: Plant cells secrete diverse sets of constitutively- and conditionally-expressed proteins under various environmental and developmental states. Secreted protein populations, or secretomes have multiple functions, including defense responses, signaling, metabolic processes, and developmental regulation. To identify genes encoding secreted proteins that function inmore » fruit development and ripening, a yeast secretion trap (YST) screen was employed using pepper (Capsicum annuum) fruit cDNAs. The YST screen revealed 80 pepper fruit-related genes (CaPFRs) encoding secreted proteins including cell wall proteins, several of which have not been previously described. Transient GFP-fusion assay and an in planta secretion trap were used to validate the secretion of proteins encoded by selected YST clones. In addition, RNA gel blot analyses provided further insights into their expression and regulation during fruit development and ripening. Integrating our data, we conclude that the YST provides a valuable functional genomics tool for the identification of substantial numbers of novel secreted plant proteins that are associated with biological processes, including fruit development and ripening.« less

Expression of immune response genes in the stifle joint of dogs with oligoarthritis and degenerative cranial cruciate ligament rupture.

PubMed

Muir, P; Schaefer, S L; Manley, P A; Svaren, J P; Oldenhoff, W E; Hao, Z

2007-10-15

Dysregulation of immune responses within joints plays an important role in development of inflammatory arthritis. We determined expression of a panel of immune response and matrix turnover genes in synovial fluid collected from a group of dogs with stifle oligoarthritis and associated degenerative cranial cruciate ligament (CCL) rupture (n=27). We also studied synovial fluid gene expression in dogs affected with other forms of degenerative arthritis (n=9) and in the stifle joint of healthy dogs with intact CCL (n=14). After collection, synovial cells were pelleted and RNA was isolated. Relative expression of cathepsin K, cathepsin S, tartrate-resistant acid phosphatase (TRAP), matrix metalloproteinase-9 (MMP-9), invariant chain (li), toll-like receptor-2 (TLR-2), and TLR-9 was determined using real-time quantitative RT-PCR. Data were normalized to peripheral blood mononuclear cells (PBMC) as an internal control. Relative expression of cathepsin K, MMP-9, TRAP, and li was increased in the stifle synovial fluid of dogs with oligoarthritis, when compared with the stifles of healthy dogs (P<0.05). In contrast, relative expression of all of the genes-of-interest in synovial fluid from joints affected with other forms of arthritis was not significantly different from the stifles of healthy dogs. TRAP expression was also significantly increased in the stifle joints of dogs with oligoarthritis, when compared to joint expression of TRAP in dogs with other forms of degenerative arthritis (P<0.05). In the dogs with stifle oligoarthritis, expression of both matrix turnover and immune response genes was increased in stifle synovial fluid, when compared with the internal PBMC control, whereas in healthy dogs and dogs with other forms of arthritis, only expression of matrix turnover genes was increased in synovial fluid, when compared with the internal PBMC control (P<0.05). Taken together, these findings suggest that antigen-specific immune responses within the stifle joint may be involved in the pathogenesis of persistent synovitis and associated joint degradation in dogs with oligoarthritis and degenerative CCL rupture.

Catalysts as sensors--a promising novel approach in automotive exhaust gas aftertreatment.

PubMed

Moos, Ralf

2010-01-01

Sensors that detect directly and in situ the status of automotive exhaust gas catalysts by monitoring the electrical properties of the catalyst coating itself are overviewed. Examples included in this review are the in-situ determination of the electrical impedance of three-way catalysts based on ceria-zirconia solutions and of lean NO(x) traps of earth-alkaline based coatings, as well as approaches to determine the ammonia loading in Fe-SCR-zeolites with electrical ac measurements. Even more sophisticated approaches based on interactions with electromagnetic waves are also reviewed. For that purpose, metallic stick-like antennas are inserted into the exhaust pipe. The catalyst properties are measured in a contactless manner, directly indicating the catalyst status. The radio frequency probes gauge the oxygen loading degree of three-way catalysts, the NO(x)-loading of lean NO(x) traps, and the soot loading of Diesel particulate filters.

Catalysts as Sensors—A Promising Novel Approach in Automotive Exhaust Gas Aftertreatment

PubMed Central

Moos, Ralf

2010-01-01

Sensors that detect directly and in situ the status of automotive exhaust gas catalysts by monitoring the electrical properties of the catalyst coating itself are overviewed. Examples included in this review are the in-situ determination of the electrical impedance of three-way catalysts based on ceria-zirconia solutions and of lean NOx traps of earth-alkaline based coatings, as well as approaches to determine the ammonia loading in Fe-SCR-zeolites with electrical ac measurements. Even more sophisticated approaches based on interactions with electromagnetic waves are also reviewed. For that purpose, metallic stick-like antennas are inserted into the exhaust pipe. The catalyst properties are measured in a contactless manner, directly indicating the catalyst status. The radio frequency probes gauge the oxygen loading degree of three-way catalysts, the NOx-loading of lean NOx traps, and the soot loading of Diesel particulate filters. PMID:22163575

Methods and compositions for controlling gene expression by RNA processing

DOEpatents

Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

2017-08-29

The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

Displacement damage dose and implantation temperature effects on the trapping and release of deuterium implanted into SiC

NASA Astrophysics Data System (ADS)

Muñoz, P.; García-Cortés, I.; Sánchez, F. J.; Moroño, A.; Malo, M.; Hodgson, E. R.

2017-09-01

Radiation damage to flow channel insert (FCI) materials is an important issue for the concept of dual-coolant blanket development in future fusion devices. Silicon Carbide (SiC) is one of the most suitable materials for FCI. Because of the severe radiation environment and exposure to tritium during operation it is of fundamental importance to study hydrogen isotope trapping and release in these materials. Here the trapping, detrapping, and diffusion of deuterium implanted into SiC is studied in correlation with pre- and post-damage induced under different conditions. For this, SiC samples are pre-damaged with 50 keV Ne+ ions at different temperatures (20, 200, 450, 700 °C) to different damage doses (1, 3.6, 7 dpa). Next, deuterium is introduced into the samples at 450 °C by ion implantation at 7 keV. The implanted deuterium retained in the sample is analysed using secondary ion mass spectrometry (SIMS) and thermo-stimulated desorption (TSD) measurements. The results indicate that with increasing neon damage dose, the maximum deuterium desorption occurs at higher temperatures. In contrast, when increasing neon implantation temperature for a fixed dose, the maximum deuterium desorption release temperature decreases. It is interpreted that the neon bombardment produces thermally stable traps for hydrogen isotopes and the stability of this damage increases with neon pre-implantation dose. A decrease of the trapping of implanted deuterium is also observed to occur due to damage recovery by thermal annealing during pre-implantation at the higher temperatures. Finally, direct particle bombardment induced deuterium release is also observed.

Biochemical and genetic analyses of acetoin catabolism in Alcaligenes eutrophus.

PubMed Central

Fründ, C; Priefert, H; Steinbüchel, A; Schlegel, H G

1989-01-01

In genetic studies on the catabolism of acetoin in Alcaligenes eutrophus, we used Tn5::mob-induced mutants which were impaired in the utilization of acetoin as the sole carbon source for growth. The transposon-harboring EcoRI restriction fragments from 17 acetoin-negative and slow-growing mutants (class 2a) and from six pleiotropic mutants of A. eutorphus, which were acetoin-negative and did not grow chemolithoautotrophically (class 2b), were cloned from pHC79 gene banks. The insertions of Tn5 were mapped on four different chromosomal EcoRI restriction fragments (A, C, D, and E) in class 2a mutants. The native DNA fragments were cloned from a lambda L47 or from a cosmid gene bank. Evidence is provided that fragments A (21 kilobase pairs [kb]) and C (7.7 kb) are closely linked in the genome; the insertions of Tn5 covered a region of approximately 5 kb. Physiological experiments revealed that this region encodes for acetoin:dichlorophenol-indophenol oxidoreductase, a fast-migrating protein, and probably for one additional protein that is as yet unknown. In mutants which were not completely impaired in growth on acetoin but which grew much slower and after a prolonged lag phase, fragments D (7.2 kb) and E (8.1 kb) were inactivated by insertion of Tn5::mob. No structural gene could be assigned to the D or E fragments. In class 2b mutants, insertions of Tn5 were mapped on fragment B (11.3 kb). This fragment complemented pleiotropic hno mutants in trans; these mutants were impaired in the formation of a rpoN-like protein. The expression of the gene cluster on fragments A and C seemed to be rpoN dependent. PMID:2556366

A novel (A)γδβ(0)-thalassemia caused by DNA deletion-inversion-insertion of the β-globin gene cluster and five olfactory receptor genes: Genetic interactions, hematological phenotypes and molecular characterization.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Hama, Abdulloh; Fucharoen, Supan

2015-07-01

To report the phenotypes and genetic basis of a novel (A)γδβ(0)-thalassemia found in Thai individuals with several forms of thalassemia. An initial study was done in an adult Thai woman who had hypochromic microcytic red cells with unusually 100% Hb F. Extended study was carried out on her parents and another 17 unrelated individuals with elevated Hb F. Hb analysis was performed by capillary electrophoresis and DNA analysis was done using PCR. A novel diagnostic method based on multiplex PCR assays was developed. DNA analysis of the proband revealed the homozygosity for a novel deletion of 118.3 kb, removing the entire (A)γ, ψβ, δ-, β-globin and five olfactory receptor (OR) genes with an insertion of a 179 bp inverted DNA sequence located behind the OR52A5 gene located downstream and an insertion of 7 orphan nucleotides. Her parents were both carriers of this mutation. Further screening in suspected cases in our series unexpectedly led to identification of an additional 17 cases with this mutation in different genotypes including plain heterozygote, homozygote, compound heterozygote with Hb E, and double heterozygote with several forms of α-thalassemia. Hematological features associated with these genetic interactions are presented. Haplotype analysis indicated a single origin of this novel deletion-inversion-insertion (A)γδβ(0)-thalassemia in the Thai population. Differentiation of this mutation and other high Hb F determinants documented previously could be done by using a developed multiplex PCR assay. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

[Analysis of ethnogeographic groups of Kazakhs based on nuclear genome DNA polymorphism].

PubMed

Salimova, A Z; Kutuev, I A; Khusainova, R I; Akhmetova, V L; Sviatova, G S; Berezina, G M; Khusnutdinova, E K

2005-07-01

Eight nuclear DNA loci, including six Alu insertions (ACE, APOA1, PV92, TPA25, Ya5NBC27, and Ya5NBC148), 32-bp deletion in the CCR5 gene, and VNTR locus at the eNOS gene, were examined in three ethnogeographic groups of Kazakhs (342 individuals). The individuals examined lived in southeastern, central, and southwestern regions of Kazakhstan, and according to their tribal attribution, belonged to the Senior, Middle, and Junior Zhuzes. The Alu insertions appeared to be polymorphic in all populations examined: the insertion frequency varied from 0.264 in the populations of the Senior and Middle Zhuzes at the Ya5NBC27 and Ya5NBC148 loci, to 0.827 in Kazakhs of the Middle Zhuz at the APOA1 locus. In Kazakh groups examined only two alleles of the eNOS VNTR locus were detected with the number of repeats constituting four (A) and five (B) copies. The highest frequency of A allele was found in Kazakhs from the Junior Zhuz (0.113), while the highest frequency of B allele was detected in population of the Senior Zhuz (0.893). The frequency of the 32-bp deletion in the chemokine receptor CCR5 gene varied from 0.027 in the Junior Zhuz to 0.045 in the Senior Zhuz. Kazakhs showed high genetic diversity (Hex = 0.376). In general, in three ethnogeographic groups of Kazakhs, the coefficient of gene differentiation (G(ST)) over eight diallelic markers of nuclear genome constituted 1.1%. The differences in the Alu insertions made the highest contribution to the among-population diversity (G(ST) = 1.2%).

The insertion of the non-heme FeB cofactor into nitric oxide reductase from P. denitrificans depends on NorQ and NorD accessory proteins.

PubMed

Kahle, Maximilian; Ter Beek, Josy; Hosler, Jonathan P; Ädelroth, Pia

2018-06-03

Bacterial NO reductases (NOR) catalyze the reduction of NO into N 2 O, either as a step in denitrification or as a detoxification mechanism. cNOR from Paracoccus (P.) denitrificans is expressed from the norCBQDEF operon, but only the NorB and NorC proteins are found in the purified NOR complex. Here, we established a new purification method for the P. denitrificans cNOR via a His-tag using heterologous expression in E. coli. The His-tagged enzyme is both structurally and functionally very similar to non-tagged cNOR. We were also able to express and purify cNOR from the structural genes norCB only, in absence of the accessory genes norQDEF. The produced protein is a stable NorCB complex containing all hemes and it can bind gaseous ligands (CO) to heme b 3 , but it is catalytically inactive. We show that this deficient cNOR lacks the non-heme iron cofactor Fe B . Mutational analysis of the nor gene cluster revealed that it is the norQ and norD genes that are essential to form functional cNOR. NorQ belongs to the family of MoxR P-loop AAA+ ATPases, which are in general considered to facilitate enzyme activation processes often involving metal insertion. Our data indicates that NorQ and NorD work together in order to facilitate non-heme Fe insertion. This is noteworthy since in many cases Fe cofactor binding occurs spontaneously. We further suggest a model for NorQ/D-facilitated metal insertion into cNOR. Copyright © 2018 Elsevier B.V. All rights reserved.

Reverse genetics of Newcastle disease virus

USDA-ARS?s Scientific Manuscript database

Reverse genetics allows the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique allows genetic manipulation and cloning of viral genomes, mutation through site-directed mutagenesis, and gene insertion or deletion, among othe...

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

Physiological impact of transposable elements encoding DDE transposases in the environmental adaptation of Streptococcus agalactiae.

PubMed

Fléchard, Maud; Gilot, Philippe

2014-07-01

We have referenced and described Streptococcus agalactiae transposable elements encoding DDE transposases. These elements belonged to nine families of insertion sequences (ISs) and to a family of conjugative transposons (TnGBSs). An overview of the physiological impact of the insertion of all these elements is provided. DDE-transposable elements affect S. agalactiae in a number of aspects of its capability to adapt to various environments and modulate the expression of several virulence genes, the scpB-lmB genomic region and the genes involved in capsule expression and haemolysin transport being the targets of several different mobile elements. The referenced mobile elements modify S. agalactiae behaviour by transferring new gene(s) to its genome, by modifying the expression of neighbouring genes at the integration site or by promoting genomic rearrangements. Transposition of some of these elements occurs in vivo, suggesting that by dynamically regulating some adaptation and/or virulence genes, they improve the ability of S. agalactiae to reach different niches within its host and ensure the 'success' of the infectious process. © 2014 The Authors.

Effect of the Molecular Nature of Mutation on the Efficiency of Intrachromosomal Gene Conversion in Mouse Cells

PubMed Central

Letsou, Anthea; Liskay, R. Michael

1987-01-01

With the intent of further exploring the nature of gene conversion in mammalian cells, we systematically addressed the effects of the molecular nature of mutation on the efficiency of intrachromosomal gene conversion in cultured mouse cells. Comparison of conversion rates revealed that all mutations studied were suitable substrates for gene conversion; however, we observed that the rates at which different mutations converted to wild-type could differ by two orders of magnitude. Differences in conversion rates were correlated with the molecular nature of the mutations. In general, rates of conversion decreased with increasing size of the molecular lesions. In comparisons of conversion rates for single base pair insertions and deletions we detected a genotype-directed path for conversion, by which an insertion was converted to wild-type three to four times more efficiently than was a deletion which maps to the same site. The data are discussed in relation to current theories of gene conversion, and are consistent with the idea that gene conversion in mammalian cells can result from repair of heteroduplex DNA (hDNA) intermediates. PMID:2828159

Angiotensin-converting enzyme gene insertion/deletion polymorphism studies in Asian Indian pregnant women biochemically identifies gestational diabetes mellitus.

PubMed

Khan, Imran A; Jahan, Parveen; Hasan, Qurratulain; Rao, Pragna

2014-12-01

Gestational diabetes mellitus (GDM) is defined as glucose intolerance first recognized during pregnancy. Insertion/deletion (I/D) polymorphism of a 287 bp Alu repetitive sequence in intron 16 of the angiotensin-converting enzyme (ACE) gene has been widely investigated in Asian Indian populations with different ethnic origins. The present study examined possible association between I/D polymorphism of the ACE gene and GDM in Asian Indian pregnant women. A total of 200 pregnant women (100 GDM and 100 non-GDM) were recruited in this study and I/D polymorphism of a 287 bp Alu1 element inside intron 16 of the ACE gene was examined by polymerase chain reaction (PCR)-based gel electrophoresis. The distribution of the variants like II, ID, and DD genotypes of ACE gene showed differences between normal GDM versus non-GDM subjects, and the frequency of the ID+ DD Vs II genotype was significant (p=0.0002) in the GDM group. ACE gene polymorphism was associated with GDM in Asian Indian pregnant women. © The Author(s) 2013.

Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

PubMed

Kline, E L; Chiang, S J; Lattora, D; Chaung, W

1992-02-01

We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

Recombinant Parainfluenza Virus 5 Expressing Hemagglutinin of Influenza A Virus H5N1 Protected Mice against Lethal Highly Pathogenic Avian Influenza Virus H5N1 Challenge

PubMed Central

Li, Zhuo; Mooney, Alaina J.; Gabbard, Jon D.; Gao, Xiudan; Xu, Pei; Place, Ryan J.; Hogan, Robert J.; Tompkins, S. Mark

2013-01-01

A safe and effective vaccine is the best way to prevent large-scale highly pathogenic avian influenza virus (HPAI) H5N1 outbreaks in the human population. The current FDA-approved H5N1 vaccine has serious limitations. A more efficacious H5N1 vaccine is urgently needed. Parainfluenza virus 5 (PIV5), a paramyxovirus, is not known to cause any illness in humans. PIV5 is an attractive vaccine vector. In our studies, a single dose of a live recombinant PIV5 expressing a hemagglutinin (HA) gene of H5N1 (rPIV5-H5) from the H5N1 subtype provided sterilizing immunity against lethal doses of HPAI H5N1 infection in mice. Furthermore, we have examined the effect of insertion of H5N1 HA at different locations within the PIV5 genome on the efficacy of a PIV5-based vaccine. Interestingly, insertion of H5N1 HA between the leader sequence, the de facto promoter of PIV5, and the first viral gene, nucleoprotein (NP), did not lead to a viable virus. Insertion of H5N1 HA between NP and the next gene, V/phosphorprotein (V/P), led to a virus that was defective in growth. We have found that insertion of H5N1 HA at the junction between the small hydrophobic (SH) gene and the hemagglutinin-neuraminidase (HN) gene gave the best immunity against HPAI H5N1 challenge: a dose as low as 1,000 PFU was sufficient to protect against lethal HPAI H5N1 challenge in mice. The work suggests that recombinant PIV5 expressing H5N1 HA has great potential as an HPAI H5N1 vaccine. PMID:23077314

Genome-wide analysis of Tol2 transposon reintegration in zebrafish.

PubMed

Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir

2009-09-08

Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.

The role of the proline-rich domain of Ssdp1 in the modular architecture of the vertebrate head organizer

PubMed Central

Enkhmandakh, Badam; Makeyev, Alexandr V.; Bayarsaihan, Dashzeveg

2006-01-01

Lim1, Ssdp1, and Ldb1 proteins are components of the Ldb1-associated transcriptional complex, which is important in the head-organizing activity during early mouse development. Depletion of each individual protein alone causes a headless phenotype. To explore in more detail the modular architecture of the complex, we have generated two different gene-trapped mouse lines that express truncated forms of Ssdp1. Embryos derived from the gene-trapped line that encodes a truncated Ssdp1 lacking the proline-rich sequence exhibit a lethal abnormal head-development phenotype, resembling mouse embryos deficient for Lim1, Ssdp1, or Otx2 genes. Embryos derived from the second gene-trapped line, in which most of the proline-rich domain of Ssdp1 is retained, did not show abnormalities in head development. Our data demonstrate that components of the Ldb1-dependent module can be subdivided further into discrete functional domains and that the proline-rich stretch of Ssdp1 is critical for embryonic head development. Furthermore, phylogenetic comparisons revealed that in Caenorhabditis elegans, a similar proline-rich sequence is absent in Ssdp but present in Ldb1. We conclude that although the overall architecture of the Ldb1-dependent module has been preserved, the genetic specification of its individual components has diversified during evolution, without compromising the function of the module. PMID:16864769

The role of the proline-rich domain of Ssdp1 in the modular architecture of the vertebrate head organizer.

PubMed

Enkhmandakh, Badam; Makeyev, Alexandr V; Bayarsaihan, Dashzeveg

2006-08-01

Lim1, Ssdp1, and Ldb1 proteins are components of the Ldb1-associated transcriptional complex, which is important in the head-organizing activity during early mouse development. Depletion of each individual protein alone causes a headless phenotype. To explore in more detail the modular architecture of the complex, we have generated two different gene-trapped mouse lines that express truncated forms of Ssdp1. Embryos derived from the gene-trapped line that encodes a truncated Ssdp1 lacking the proline-rich sequence exhibit a lethal abnormal head-development phenotype, resembling mouse embryos deficient for Lim1, Ssdp1, or Otx2 genes. Embryos derived from the second gene-trapped line, in which most of the proline-rich domain of Ssdp1 is retained, did not show abnormalities in head development. Our data demonstrate that components of the Ldb1-dependent module can be subdivided further into discrete functional domains and that the proline-rich stretch of Ssdp1 is critical for embryonic head development. Furthermore, phylogenetic comparisons revealed that in Caenorhabditis elegans, a similar proline-rich sequence is absent in Ssdp but present in Ldb1. We conclude that although the overall architecture of the Ldb1-dependent module has been preserved, the genetic specification of its individual components has diversified during evolution, without compromising the function of the module.

A Forward Genetic Screening for Prostate Cancer Progression Genes

DTIC Science & Technology

2012-10-01

sequence  reads. For verifying  the  prevalence of insertions in tumors, PCR was  performed on  genomic  DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science

Genome Enabled Discovery of Carbon Sequestration Genes in Poplar

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filichkin, Sergei; Etherington, Elizabeth; Ma, Caiping

2007-02-22

The goals of the S.H. Strauss laboratory portion of 'Genome-enabled discovery of carbon sequestration genes in poplar' are (1) to explore the functions of candidate genes using Populus transformation by inserting genes provided by Oakridge National Laboratory (ORNL) and the University of Florida (UF) into poplar; (2) to expand the poplar transformation toolkit by developing transformation methods for important genotypes; and (3) to allow induced expression, and efficient gene suppression, in roots and other tissues. As part of the transformation improvement effort, OSU developed transformation protocols for Populus trichocarpa 'Nisqually-1' clone and an early flowering P. alba clone, 6K10. Completemore » descriptions of the transformation systems were published (Ma et. al. 2004, Meilan et. al 2004). Twenty-one 'Nisqually-1' and 622 6K10 transgenic plants were generated. To identify root predominant promoters, a set of three promoters were tested for their tissue-specific expression patterns in poplar and in Arabidopsis as a model system. A novel gene, ET304, was identified by analyzing a collection of poplar enhancer trap lines generated at OSU (Filichkin et. al 2006a, 2006b). Other promoters include the pGgMT1 root-predominant promoter from Casuarina glauca and the pAtPIN2 promoter from Arabidopsis root specific PIN2 gene. OSU tested two induction systems, alcohol- and estrogen-inducible, in multiple poplar transgenics. Ethanol proved to be the more efficient when tested in tissue culture and greenhouse conditions. Two estrogen-inducible systems were evaluated in transgenic Populus, neither of which functioned reliably in tissue culture conditions. GATEWAY-compatible plant binary vectors were designed to compare the silencing efficiency of homologous (direct) RNAi vs. heterologous (transitive) RNAi inverted repeats. A set of genes was targeted for post transcriptional silencing in the model Arabidopsis system; these include the floral meristem identity gene (APETALA1 or AP1), auxin response factor gene (ETTIN), the gene encoding transcriptional factor of WD40 family (TRANSPARENTTESTAGLABRA1 or TTG1), and the auxin efflux carrier (PIN-FORMED2 or PIN2) gene. More than 220 transgenic lines of the 1st, 2nd and 3rd generations were analyzed for RNAi suppression phenotypes (Filichkin et. al., manuscript submitted). A total of 108 constructs were supplied by ORNL, UF and OSU and used to generate over 1,881 PCR verified transgenic Populus and over 300 PCR verified transgenic Arabidopsis events. The Populus transgenics alone required Agrobacterium co-cultivations of 124.406 explants.« less

Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

PubMed

Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

2016-07-01

Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Genetic diversity of three surface protein genes in Plasmodium malariae from three Asian countries.

PubMed

Srisutham, Suttipat; Saralamba, Naowarat; Sriprawat, Kanlaya; Mayxay, Mayfong; Smithuis, Frank; Nosten, Francois; Pukrittayakamee, Sasithon; Day, Nicholas P J; Dondorp, Arjen M; Imwong, Mallika

2018-01-11

Genetic diversity of the three important antigenic proteins, namely thrombospondin-related anonymous protein (TRAP), apical membrane antigen 1 (AMA1), and 6-cysteine protein (P48/45), all of which are found in various developmental stages of Plasmodium parasites is crucial for targeted vaccine development. While studies related to the genetic diversity of these proteins are available for Plasmodium falciparum and Plasmodium vivax, barely enough information exists regarding Plasmodium malariae. The present study aims to demonstrate the genetic variations existing among these three genes in P. malariae by analysing their diversity at nucleotide and protein levels. Three surface protein genes were isolated from 45 samples collected in Thailand (N = 33), Myanmar (N = 8), and Lao PDR (N = 4), using conventional polymerase chain reaction (PCR) assay. Then, the PCR products were sequenced and analysed using BioEdit, MEGA6, and DnaSP programs. The average pairwise nucleotide diversities (π) of P. malariae trap, ama1, and p48/45 were 0.00169, 0.00413, and 0.00029, respectively. The haplotype diversities (Hd) of P. malariae trap, ama1, and p48/45 were 0.919, 0.946, and 0.130, respectively. Most of the nucleotide substitutions were non-synonymous, which indicated that the genetic variations of these genes were maintained by positive diversifying selection, thus, suggesting their role as a potential target of protective immune response. Amino acid substitutions of P. malariae TRAP, AMA1, and P48/45 could be categorized to 17, 20, and 2 unique amino-acid variants, respectively. For further vaccine development, carboxyl terminal of P48/45 would be a good candidate according to conserved amino acid at low genetic diversity (π = 0.2-0.3). High mutational diversity was observed in P. malariae trap and ama1 as compared to p48/45 in P. malariae samples isolated from Thailand, Myanmar, and Lao PDR. Taken together, these results suggest that P48/45 might be a good vaccine candidate against P. malariae infection because of its sufficiently low genetic diversity and highly conserved amino acids especially on the carboxyl end.

Trapped Energetic Electrons in the Magnetosphere of Ganymede

NASA Technical Reports Server (NTRS)

Eviatar, Aharon; Williams, Donald J.; Paranicas, Chris; McEntire, Richard W.; Mauk, Barry H.; Kivelson, Margaret G.

2000-01-01

On May 7, 1997, the Galileo orbiter flew through the magnetosphere of Ganymede and crossed flux tubes connected at both ends to the satellite. Energetic electrons, observed during this encounter by means of the Energetic Particle Detector on board Galileo, showed double loss cones and "butterfly" type pitch angle distributions, as has been noted in past publications. In addition, as the spacecraft flew toward Ganymede, both the shape and magnitude of the spectrum changed. The intensities decreased, with the greatest depletion observed at the lowest energies, and the monotonic slope characteristic of the Jovian environment was replaced by a rollover of the spectrum at the low-energy end. The spectra lead us to infer a strongly energy-dependent injection efficiency into the trapping region. As on previous encounters, the pitch angle distributions confirmed the position of the magnetopause as indicated by the magnetometer measurements, but the spectra remained Jovian until the trapping region was reached. Various physical mechanisms capable of generating the observed spectra and pitch angle distributions, including downstream reconnection insertion followed by magnetic gradient drift and absorption of the lowest-energy electrons by Ganymede and injection from Jovian flux tubes upstream are assessed.

Induction of trap formation in nematode-trapping fungi by bacteria-released ammonia.

PubMed

Su, H N; Xu, Y Y; Wang, X; Zhang, K Q; Li, G H

2016-04-01

A total of 11 bacterial strains were assayed for bacteria-induced trap formation in the nematode-trapping fungus Arthrobotrys oligospora YMF1·01883 with two-compartmented Petri dish. These strains were identified on the basis of their 16S rRNA gene sequences. Volatile organic compounds (VOCs) of eight isolates were extracted using solid-phase micro-extraction (SPME) and their structures were identified based on gas chromatography-mass spectrometry (GC-MS). At the same time, all isolates were used for quantitative measurement of ammonia by the indophenol blue method. The effects of pure commercial compounds on inducement of trap formation in A. oligospora were tested. Taken together, results demonstrated that the predominant bacterial volatile compound inducing trap formation was ammonia. Meanwhile, ammonia also played a role in other nematode-trapping fungi, including Arthrobotrys guizhouensis YMF1·00014, producing adhesive nets; Dactylellina phymatopaga YMF1·01474, producing adhesive knobs; Dactylellina cionopaga YMF1·01472, producing adhesive columns and Drechslerella brochopaga YMF1·01829, producing constricting rings. © 2016 The Society for Applied Microbiology.

The thyroid hormone receptor-associated protein TRAP220 is required at distinct embryonic stages in placental, cardiac, and hepatic development.

PubMed

Landles, Christian; Chalk, Sara; Steel, Jennifer H; Rosewell, Ian; Spencer-Dene, Bradley; Lalani, El-Nasir; Parker, Malcolm G

2003-12-01

Recent work indicates that thyroid hormone receptor-associated protein 220 (TRAP220), a subunit of the multiprotein TRAP coactivator complex, is essential for embryonic survival. We have generated TRAP220 conditional null mice that are hypomorphic and express the gene at reduced levels. In contrast to TRAP220 null mice, which die at embryonic d 11.5 (E11.5), hypomorphic mice survive until E13.5. The reduced expression in hypomorphs results in hepatic necrosis, defects in hematopoiesis, and hypoplasia of the ventricular myocardium, similar to that observed in TRAP220 null embryos at an earlier stage. The embryonic lethality of null embryos at E11.5 is due to placental insufficiency. Tetraploid aggregation assays partially rescues embryonic development until E13.5, when embryonic loss occurs due to hepatic necrosis coupled with poor myocardial development as observed in hypomorphs. These findings demonstrate that, for normal placental function, there is an absolute requirement for TRAP220 in extraembryonic tissues at E11.5, with an additional requirement in embryonic tissues for hepatic and cardiovascular development thereafter.

Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism

USDA-ARS?s Scientific Manuscript database

Objectives: Newcastle disease virus (NDV), a member of the Paramxoviridae family, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU...

Mechanism for DNA transposons to generate introns on genomic scales

PubMed Central

Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.

2017-01-01

Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032.

PubMed

Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping

2018-01-01

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.

Cell Cycle Status of CD34+ Hemopoietic Stem Cells Determines Lentiviral Integration in Actively Transcribed and Development-related Genes

PubMed Central

Papanikolaou, Eleni; Paruzynski, Anna; Kasampalidis, Ioannis; Deichmann, Annette; Stamateris, Evangelos; Schmidt, Manfred; von Kalle, Christof; Anagnou, Nicholas P

2015-01-01

Gene therapy utilizing lentiviral-vectors (LVs) is postulated as a dynamic therapeutic alternative for monogenic diseases. However, retroviral gene transfer may cause insertional mutagenesis. Although, such risks had been originally estimated as extremely low, several reports of leukemias or clonal dominance, have led to a re-evaluation of the mechanisms operating in insertional mutagenesis. Therefore, unraveling the mechanism of retroviral integration is mandatory toward safer gene therapy applications. In the present study, we undertook an experimental approach which enabled direct correlation of the cell cycle stage of the target cell with the integration profile of LVs. CD34+ cells arrested at different stages of cell cycle, were transduced with a GFP-LV. LAM-PCR was employed for integration site detection, followed by microarray analysis to correlate transcribed genes with integration sites. The results indicate that ~10% of integration events occurred in actively transcribed genes and that the cell cycle stage of target cells affects integration pattern. Specifically, use of thymine promoted a safer profile, since it significantly reduced integration within cell cycle-related genes, while we observed increased possibility for integration into genes related to development, and decreased possibility for integration within cell cycle and cancer-related genes, when transduction occurs during mitosis. PMID:25523760

Establishment of a Mouse Model with Misregulated Chromosome Condensation due to Defective Mcph1 Function

PubMed Central

Walther, Diego J.; Dopatka, Monika; Dutrannoy, Véronique; Busche, Andreas; Meyer, Franziska; Nowak, Stefanie; Nowak, Jean; Zabel, Claus; Klose, Joachim; Esquitino, Veronica; Garshasbi, Masoud; Kuss, Andreas W.; Ropers, Hans-Hilger; Mueller, Susanne; Poehlmann, Charlotte; Gavvovidis, Ioannis; Schindler, Detlev; Sperling, Karl; Neitzel, Heidemarie

2010-01-01

Mutations in the human gene MCPH1 cause primary microcephaly associated with a unique cellular phenotype with premature chromosome condensation (PCC) in early G2 phase and delayed decondensation post-mitosis (PCC syndrome). The gene encodes the BRCT-domain containing protein microcephalin/BRIT1. Apart from its role in the regulation of chromosome condensation, the protein is involved in the cellular response to DNA damage. We report here on the first mouse model of impaired Mcph1-function. The model was established based on an embryonic stem cell line from BayGenomics (RR0608) containing a gene trap in intron 12 of the Mcph1 gene deleting the C-terminal BRCT-domain of the protein. Although residual wild type allele can be detected by quantitative real-time PCR cell cultures generated from mouse tissues bearing the homozygous gene trap mutation display the cellular phenotype of misregulated chromosome condensation that is characteristic for the human disorder, confirming defective Mcph1 function due to the gene trap mutation. While surprisingly the DNA damage response (formation of repair foci, chromosomal breakage, and G2/M checkpoint function after irradiation) appears to be largely normal in cell cultures derived from Mcph1gt/gt mice, the overall survival rates of the Mcph1gt/gt animals are significantly reduced compared to wild type and heterozygous mice. However, we could not detect clear signs of premature malignant disease development due to the perturbed Mcph1 function. Moreover, the animals show no obvious physical phenotype and no reduced fertility. Body and brain size are within the range of wild type controls. Gene expression on RNA and protein level did not reveal any specific pattern of differentially regulated genes. To the best of our knowledge this represents the first mammalian transgenic model displaying a defect in mitotic chromosome condensation and is also the first mouse model for impaired Mcph1-function. PMID:20169082

Establishment of a mouse model with misregulated chromosome condensation due to defective Mcph1 function.

PubMed

Trimborn, Marc; Ghani, Mahdi; Walther, Diego J; Dopatka, Monika; Dutrannoy, Véronique; Busche, Andreas; Meyer, Franziska; Nowak, Stefanie; Nowak, Jean; Zabel, Claus; Klose, Joachim; Esquitino, Veronica; Garshasbi, Masoud; Kuss, Andreas W; Ropers, Hans-Hilger; Mueller, Susanne; Poehlmann, Charlotte; Gavvovidis, Ioannis; Schindler, Detlev; Sperling, Karl; Neitzel, Heidemarie

2010-02-16

Mutations in the human gene MCPH1 cause primary microcephaly associated with a unique cellular phenotype with premature chromosome condensation (PCC) in early G2 phase and delayed decondensation post-mitosis (PCC syndrome). The gene encodes the BRCT-domain containing protein microcephalin/BRIT1. Apart from its role in the regulation of chromosome condensation, the protein is involved in the cellular response to DNA damage. We report here on the first mouse model of impaired Mcph1-function. The model was established based on an embryonic stem cell line from BayGenomics (RR0608) containing a gene trap in intron 12 of the Mcph1 gene deleting the C-terminal BRCT-domain of the protein. Although residual wild type allele can be detected by quantitative real-time PCR cell cultures generated from mouse tissues bearing the homozygous gene trap mutation display the cellular phenotype of misregulated chromosome condensation that is characteristic for the human disorder, confirming defective Mcph1 function due to the gene trap mutation. While surprisingly the DNA damage response (formation of repair foci, chromosomal breakage, and G2/M checkpoint function after irradiation) appears to be largely normal in cell cultures derived from Mcph1(gt/gt) mice, the overall survival rates of the Mcph1(gt/gt) animals are significantly reduced compared to wild type and heterozygous mice. However, we could not detect clear signs of premature malignant disease development due to the perturbed Mcph1 function. Moreover, the animals show no obvious physical phenotype and no reduced fertility. Body and brain size are within the range of wild type controls. Gene expression on RNA and protein level did not reveal any specific pattern of differentially regulated genes. To the best of our knowledge this represents the first mammalian transgenic model displaying a defect in mitotic chromosome condensation and is also the first mouse model for impaired Mcph1-function.

Efficient transformation and expression of gfp gene in Valsa mali var. mali.

PubMed

Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai

2015-01-01

Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.

The Identification and Differentiation between Burkholderia mallei and Burkholderia pseudomallei Using One Gene Pyrosequencing.

PubMed

Gilling, Damian H; Luna, Vicki Ann; Pflugradt, Cori

2014-01-01

The etiologic agents for melioidosis and glanders, Burkholderia mallei and Burkholderia pseudomallei respectively, are genetically similar making identification and differentiation from other Burkholderia species and each other challenging. We used pyrosequencing to determine the presence or absence of an insertion sequence IS407A within the flagellin P (fliP) gene and to exploit the difference in orientation of this gene in the two species. Oligonucleotide primers were designed to selectively target the IS407A-fliP interface in B. mallei and the fliP gene specifically at the insertion point in B. pseudomallei. We then examined DNA from ten B. mallei, ten B. pseudomallei, 14 B. cepacia, eight other Burkholderia spp., and 17 other bacteria. Resultant pyrograms encompassed the target sequence that contained either the fliP gene with the IS407A interruption or the fully intact fliP gene with 100% sensitivity and 100% specificity. These pyrosequencing assays based upon a single gene enable investigators to reliably identify the two species. The information obtained by these assays provides more knowledge of the genomic reduction that created the new species B. mallei from B. pseudomallei and may point to new targets that can be exploited in the future.

PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

PubMed Central

Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

2016-01-01

The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

Evaluation of Measles Vaccine Virus as a Vector to Deliver Respiratory Syncytial Virus Fusion Protein or Epstein-Barr Virus Glycoprotein gp350

PubMed Central

Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C. Kathy; Jin, Hong

2012-01-01

Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1st or the 3rd position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3rd position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation. PMID:22383906

Applications of optical manipulation in plant biology

NASA Astrophysics Data System (ADS)

Buer, Charles S.

Measuring small forces in biology is important for determining basic physiological parameters of a cell. The plant cell wall provides a primary defense and presents a barrier to research. Magnitudes of small forces are impossible to measure with mechanical transducers, glass needles, atomic force microscopy, or micropipet-based force transduction due to the cell wall. Therefore, a noninvasive method of breaching the plant cell wall to access the symplastic region of the cell is required. Laser light provides sub-micrometer positioning, particle manipulation without mechanical contact, and piconewton force determination. Consequently, the extension of laser microsurgery to expand an experimental tool for plant biology encompassed the overall objective. A protocol was developed for precisely inserting microscopic objects into the periplasmic region of plant callus cells using laser microsurgery. Ginkgo biloba and Agrobacterium rhizogenes were used as the model system for developing the optical tweezers and scalpel techniques. Better than 95% survival was achieved after plasmolyzing G. biloba cells, ablating a 2-4 μm hole through the cell wall using a pulsed UV laser beam, trapping and manipulating bacteria into the periplasmic region, and deplasmolyzing the cells. Optical trapping experiments implied a difference existed between the bacteria models. Determining the optical trapping efficiency of Agrobacterium rhizogenes and A. tumefaciens strains indicated the A. rhizogenes strain, ATCC 11325, was significantly less efficiently trapped than strains A4 and ATCC 15834 and the A. tumefaciens strain LBA4404. Differences were also found in capsule generation, growth media viscosity, and transmission electron microscopy negative staining implying that a difference in surface structure exists. Calcofluor fluorescence suggests the difference involves an exopolysaccharide. Callus cell plasmolysis revealed Hechtian strands interconnecting the plasma membrane and the cell wall. The spring tension of these strands was measured in normal and cold-hardened G. biloba and N. tabacum callus cells. There was little change in flexibility between the groups of cultured cells in either species studied. Microspheres were attached to Hechtian strands in normal cultured Nicotiana tabacum and the cells were deplasmolyzed and replasmolyzed to determine the fate of Hechtian strands. The microspheres either moved to the plasma membrane and adhered or moved to the cell wall and adhered. The attached microspheres occasionally moved independently on the same strand. Inserted microspheres provided a visual probe to follow physiological events within a plant cell.

Structure and transcriptional impact of divergent repetitive elements inserted within Phanerochaete chrysosporium strain RP-78 genes

Treesearch

Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen

2007-01-01

We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...

Stx1 prophage excision in Escherichia coli strain PA20 confers strong curli and biofilm formation by restoring native mlrA

USDA-ARS?s Scientific Manuscript database

Prophage insertions in Escherichia coli O157:H7 mlrA contribute to the low expression of curli fimbriae and biofilm observed in many clinical isolates. Varying levels of CsgD-dependent curli/biofilm expression are restored to strains bearing prophage insertions in mlrA by mutation of regulatory gene...

Origin of mitochondria by intracellular enslavement of a photosynthetic purple bacterium

PubMed Central

Cavalier-Smith, Thomas

2006-01-01

Mitochondria originated by permanent enslavement of purple non-sulphur bacteria. These endosymbionts became organelles through the origin of complex protein-import machinery and insertion into their inner membranes of protein carriers for extracting energy for the host. A chicken-and-egg problem exists: selective advantages for evolving import machinery were absent until inner membrane carriers were present, but this very machinery is now required for carrier insertion. I argue here that this problem was probably circumvented by conversion of the symbiont protein-export machinery into protein-import machinery, in three phases. I suggest that the first carrier entered the periplasmic space via pre-existing β-barrel proteins in the bacterial outer membrane that later became Tom40, and inserted into the inner membrane probably helped by a pre-existing inner membrane protein, thereby immediately providing the protoeukaryote host with photosynthesate. This would have created a powerful selective advantage for evolving more efficient carrier import by inserting Tom70 receptors. Massive gene transfer to the nucleus inevitably occurred by mutation pressure. Finally, pressure from harmful, non-selected gene transfer to the nucleus probably caused evolution of the presequence mechanism, and photosynthesis was lost. PMID:16822756

Transposable elements and insecticide resistance.

PubMed

Rostant, Wayne G; Wedell, Nina; Hosken, David J

2012-01-01

Transposable elements (TEs) are mobile DNA sequences that are able to copy themselves within a host genome. They were initially characterized as selfish genes because of documented or presumed costs to host fitness, but it has become increasingly clear that not all TEs reduce host fitness. A good example of TEs benefiting hosts is seen with insecticide resistance, where in a number of cases, TE insertions near specific genes confer resistance to these man-made products. This is particularly true of Accord and associated TEs in Drosophila melanogaster and Doc insertions in Drosophila simulans. The first of these insertions also has sexually antagonistic fitness effects in the absence of insecticides, and although the magnitude of this effect depends on the genetic background in which Accord finds itself, this represents an excellent example of intralocus sexual conflict where the precise allele involved is well characterized. We discuss this finding and the role of TEs in insecticide resistance. We also highlight areas for further research, including the need for surveys of the prevalence and fitness consequences of the Doc insertion and how Drosophila can be used as models to investigate resistance in pest species. Copyright © 2012 Elsevier Inc. All rights reserved.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

A Genome-Wide Functional Investigation into the Roles of Receptor-Like Proteins in Arabidopsis1[W][OA

PubMed Central

Wang, Guodong; Ellendorff, Ursula; Kemp, Ben; Mansfield, John W.; Forsyth, Alec; Mitchell, Kathy; Bastas, Kubilay; Liu, Chun-Ming; Woods-Tör, Alison; Zipfel, Cyril; de Wit, Pierre J.G.M.; Jones, Jonathan D.G.; Tör, Mahmut; Thomma, Bart P.H.J.

2008-01-01

Receptor-like proteins (RLPs) are cell surface receptors that typically consist of an extracellular leucine-rich repeat domain, a transmembrane domain, and a short cytoplasmatic tail. In several plant species, RLPs have been found to play a role in disease resistance, such as the tomato (Solanum lycopersicum) Cf and Ve proteins and the apple (Malus domestica) HcrVf2 protein that mediate resistance against the fungal pathogens Cladosporium fulvum, Verticillium spp., and Venturia inaequalis, respectively. In addition, RLPs play a role in plant development; Arabidopsis (Arabidopsis thaliana) TOO MANY MOUTHS (TMM) regulates stomatal distribution, while Arabidopsis CLAVATA2 (CLV2) and its functional maize (Zea mays) ortholog FASCINATED EAR2 regulate meristem maintenance. In total, 57 RLP genes have been identified in the Arabidopsis genome and a genome-wide collection of T-DNA insertion lines was assembled. This collection was functionally analyzed with respect to plant growth and development and sensitivity to various stress responses, including susceptibility toward pathogens. A number of novel developmental phenotypes were revealed for our CLV2 and TMM insertion mutants. In addition, one AtRLP gene was found to mediate abscisic acid sensitivity and another AtRLP gene was found to influence nonhost resistance toward Pseudomonas syringae pv phaseolicola. This genome-wide collection of Arabidopsis RLP gene T-DNA insertion mutants provides a tool for future investigations into the biological roles of RLPs. PMID:18434605

A Pseudomonas putida double mutant deficient in butanol assimilation: a promising step for engineering a biological biofuel production platform.

PubMed

Cuenca, María Del Sol; Molina-Santiago, Carlos; Gómez-García, María R; Ramos, Juan L

2016-03-01

Biological production in heterologous hosts is of interest for the production of the C4 alcohol (butanol) and other chemicals. However, some hurdles need to be overcome in order to achieve an economically viable process; these include avoiding the consumption of butanol and maintaining tolerance to this solvent during production. Pseudomonas putida is a potential host for solvent production; in order to further adapt P. putida to this role, we generated mini-Tn5 mutant libraries in strain BIRD-1 that do not consume butanol. We analyzed the insertion site of the mini-Tn5 in a mutant that was deficient in assimilation of butanol using arbitrary PCR followed by Sanger sequencing and found that the transposon was inserted in the malate synthase B gene. Here, we show that in a second round of mutagenesis a double mutant unable to take up butanol had an insertion in a gene coding for a multisensor hybrid histidine kinase. The genetic context of the histidine kinase sensor revealed the presence of a set of genes potentially involved in butanol assimilation; qRT-PCR analysis showed induction of this set of genes in the wild type and the malate synthase mutant but not in the double mutant. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

PubMed Central

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

2013-01-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Complete genome analysis of three Acinetobacter baumannii clinical isolates in China for insight into the diversification of drug resistance elements.

PubMed

Zhu, Lingxiang; Yan, Zhongqiang; Zhang, Zhaojun; Zhou, Qiming; Zhou, Jinchun; Wakeland, Edward K; Fang, Xiangdong; Xuan, Zhenyu; Shen, Dingxia; Li, Quan-Zhen

2013-01-01

The emergence and rapid spreading of multidrug-resistant Acinetobacter baumannii strains has become a major health threat worldwide. To better understand the genetic recombination related with the acquisition of drug-resistant elements during bacterial infection, we performed complete genome analysis on three newly isolated multidrug-resistant A. baumannii strains from Beijing using next-generation sequencing technology. Whole genome comparison revealed that all 3 strains share some common drug resistant elements including carbapenem-resistant bla OXA-23 and tetracycline (tet) resistance islands, but the genome structures are diversified among strains. Various genomic islands intersperse on the genome with transposons and insertions, reflecting the recombination flexibility during the acquisition of the resistant elements. The blood-isolated BJAB07104 and ascites-isolated BJAB0868 exhibit high similarity on their genome structure with most of the global clone II strains, suggesting these two strains belong to the dominant outbreak strains prevalent worldwide. A large resistance island (RI) of about 121-kb, carrying a cluster of resistance-related genes, was inserted into the ATPase gene on BJAB07104 and BJAB0868 genomes. A 78-kb insertion element carrying tra-locus and bla OXA-23 island, can be either inserted into one of the tniB gene in the 121-kb RI on the chromosome, or transformed to conjugative plasmid in the two BJAB strains. The third strains of this study, BJAB0715, which was isolated from spinal fluid, exhibit much more divergence compared with above two strains. It harbors multiple drug-resistance elements including a truncated AbaR-22-like RI on its genome. One of the unique features of this strain is that it carries both bla OXA-23 and bla OXA-58 genes on its genome. Besides, an Acinetobacter lwoffii adeABC efflux element was found inserted into the ATPase position in BJAB0715. Our comparative analysis on currently completed Acinetobacter baumannii genomes revealed extensive and dynamic genome organizations, which may facilitate the bacteria to acquire drug-resistance elements into their genomes.

Molecular biology. Mothers setting boundaries.

PubMed

Thorvaldsen, J L; Bartolomei, M S

2000-06-23

Certain genes are only expressed at one allele, a phenomenon called imprinting. Although it is well established that one allele of certain imprinted genes is silenced through methylation, this does not appear to be the case for all imprinted genes. In a thoughtful Perspective, Thorvaldsen and Bartolomei discuss new findings showing that insertion of insulator elements (boundary regions) between the promoter of a gene and its enhancer (a sequence that boosts gene expression) may be another way in which genes are silenced during imprinting.

hisT is part of a multigene operon in Escherichia coli K-12.

PubMed Central

Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E

1985-01-01

The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810

Short and long-term genome stability analysis of prokaryotic genomes.

PubMed

Brilli, Matteo; Liò, Pietro; Lacroix, Vincent; Sagot, Marie-France

2013-05-08

Gene organization dynamics is actively studied because it provides useful evolutionary information, makes functional annotation easier and often enables to characterize pathogens. There is therefore a strong interest in understanding the variability of this trait and the possible correlations with life-style. Two kinds of events affect genome organization: on one hand translocations and recombinations change the relative position of genes shared by two genomes (i.e. the backbone gene order); on the other, insertions and deletions leave the backbone gene order unchanged but they alter the gene neighborhoods by breaking the syntenic regions. A complete picture about genome organization evolution therefore requires to account for both kinds of events. We developed an approach where we model chromosomes as graphs on which we compute different stability estimators; we consider genome rearrangements as well as the effect of gene insertions and deletions. In a first part of the paper, we fit a measure of backbone gene order conservation (hereinafter called backbone stability) against phylogenetic distance for over 3000 genome comparisons, improving existing models for the divergence in time of backbone stability. Intra- and inter-specific comparisons were treated separately to focus on different time-scales. The use of multiple genomes of a same species allowed to identify genomes with diverging gene order with respect to their conspecific. The inter-species analysis indicates that pathogens are more often unstable with respect to non-pathogens. In a second part of the text, we show that in pathogens, gene content dynamics (insertions and deletions) have a much more dramatic effect on genome organization stability than backbone rearrangements. In this work, we studied genome organization divergence taking into account the contribution of both genome order rearrangements and genome content dynamics. By studying species with multiple sequenced genomes available, we were able to explore genome organization stability at different time-scales and to find significant differences for pathogen and non-pathogen species. The output of our framework also allows to identify the conserved gene clusters and/or partial occurrences thereof, making possible to explore how gene clusters assembled during evolution.

Novel mutants of Erwinia carotovora subsp. carotovora defective in the production of plant cell wall degrading enzymes generated by Mu transpososome-mediated insertion mutagenesis.

PubMed

Laasik, Eve; Ojarand, Merli; Pajunen, Maria; Savilahti, Harri; Mäe, Andres

2005-02-01

As in Erwinia carotovora subsp. carotovora the regulation details of the main virulence factors, encoding extracellular enzymes that degrade the plant cell wall, is only rudimentally understood, we performed a genetic screen to identify novel candidate genes involved in the process. Initially, we used Mu transpososome-mediated mutagenesis approach to generate a comprehensive transposon insertion mutant library of ca. 10000 clones and screened the clones for the loss of extracellular enzyme production. Extracellular enzymes production was abolished by mutations in the chromosomal helEcc, trkAEcc yheLEcc, glsEcc, igaAEcc and cysQEcc genes. The findings reported here demonstrate that we have isolated six new representatives that belong to the pool of genes modulating the production of virulence factors in E. carotovora.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Optimizing and benchmarking de novo transcriptome sequencing: from library preparation to assembly evaluation.

PubMed

Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro

2015-11-18

RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.

Identification of genes associated with asexual reproduction in Phyllosticta citricarpa mutants obtained through Agrobacterium tumefaciens transformation.

PubMed

Goulin, Eduardo Henrique; Savi, Daiani Cristina; Petters, Desirrê Alexia Lourenço; Kava, Vanessa; Galli-Terasawa, Lygia; Silva, Geraldo José; Glienke, Chirlei

2016-11-01

Phyllosticta citricarpa is the epidemiological agent of Citrus Black Spot (CBS) disease, which is responsible for large economic losses worldwide. CBS is characterized by the presence of spores (pycnidiospores) in dark lesions of fruit, which are also responsible for short distance dispersal of the disease. The identification of genes involved in asexual reproduction of P. citricarpa can be an alternative for directional disease control. We analyzed a library of mutants obtained through Agrobacterium tumefaciens transformation system, looking for alterations in growth and reproductive structure formation. Two mutant strains were found to have lost the ability to form pycnidia. The flanking T-DNA insertion regions were identified on P. citricarpa genome by using blast analysis and further gene prediction. The predicted genes containing the T-DNA insertions were identified as Spindle Poison Sensitivity Scp3, Ion Transport protein, and Cullin Binding proteins. The Ion Transport and Cullin Binding proteins are known to be correlated with sexual and asexual reproduction in fungi; however, the exact mechanism by which these proteins act on spore formation in P. citricarpa needs to be better characterized. The Scp3 proteins are suggested here for the first time as being associated with asexual reproduction in fungus. This protein is associated with microtubule formation, and as microtubules play an essential role as spindle machinery for chromosome segregation and cytokinesis, insertions in this gene can lead to abnormal formations, such as that observed here in P. citricarpa. We suggest these genes as new targets for fungicide development and CBS disease control, by iRNA. Copyright © 2016 Elsevier GmbH. All rights reserved.

Simple Monitoring of Gene Targeting Efficiency in Human Somatic Cell Lines Using the PIGA Gene

PubMed Central

Karnan, Sivasundaram; Konishi, Yuko; Ota, Akinobu; Takahashi, Miyuki; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2012-01-01

Gene targeting in most of human somatic cell lines has been labor-intensive because of low homologous recombination efficiency. The development of an experimental system that permits a facile evaluation of gene targeting efficiency in human somatic cell lines is the first step towards the improvement of this technology and its application to a broad range of cell lines. In this study, we utilized phosphatidylinositol glycan anchor biosynthesis class A (PIGA), a gene essential for the synthesis of glycosylphosphatidyl inositol (GPI) anchors, as a reporter of gene targeting events in human somatic cell lines. Targeted disruption of PIGA was quantitatively detected with FLAER, a reagent that specifically binds to GPI anchors. Using this PIGA-based reporter system, we successfully detected adeno-associated virus (AAV)-mediated gene targeting events both with and without promoter-trap enrichment of gene-targeted cell population. The PIGA-based reporter system was also capable of reproducing previous findings that an AAV-mediated gene targeting achieves a remarkably higher ratio of homologous versus random integration (H/R ratio) of targeting vectors than a plasmid-mediated gene targeting. The PIGA-based system also detected an approximately 2-fold increase in the H/R ratio achieved by a small negative selection cassette introduced at the end of the AAV-based targeting vector with a promoter-trap system. Thus, our PIGA-based system is useful for monitoring AAV-mediated gene targeting and will assist in improving gene targeting technology in human somatic cell lines. PMID:23056640

Expression of sall4 in taste buds of zebrafish.

PubMed

Jackson, Robyn; Braubach, Oliver R; Bilkey, Jessica; Zhang, Jing; Akimenko, Marie-Andrée; Fine, Alan; Croll, Roger P; Jonz, Michael G

2013-07-01

We characterized the expression of sall4, a gene encoding a zinc finger transcription factor involved in the maintenance of embryonic stem cells, in taste buds of zebrafish (Danio rerio). Using an enhancer trap line (ET5), we detected enhanced green fluorescent protein (EGFP) in developing and adult transgenic zebrafish in regions containing taste buds: the lips, branchial arches, and the nasal and maxillary barbels. Localization of EGFP to taste cells of the branchial arches and lips was confirmed by co-immunolabeling with antibodies against calretinin and serotonin, and a zebrafish-derived neuronal marker (zn-12). Transgenic insertion of the ET construct into the zebrafish genome was evaluated and mapped to chromosome 23 in proximity (i.e. 23 kb) to the sall4 gene. In situ hybridization and expression analysis between 24 and 96 h post-fertilization (hpf) demonstrated that transgenic egfp expression in ET5 zebrafish was correlated with the spatial and temporal pattern of expression of sall4 in the wild-type. Expression was first observed in the central nervous system and branchial arches at 24 hpf. At 48 hpf, sall4 and egfp expression was observed in taste bud primordia surrounding the mouth and branchial arches. At 72 and 96 hpf, expression was detected in the upper and lower lips and branchial arches. Double fluorescence in situ hybridization at 3 and 10 dpf confirmed colocalization of sall4 and egfp in the lips and branchial arches. These studies reveal sall4 expression in chemosensory cells and implicate this transcription factor in the development and renewal of taste epithelia in zebrafish. Copyright © 2013 Wiley Periodicals, Inc.

Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing

PubMed Central

Rosconi, Federico; de Vries, Stefan P. W.; Baig, Abiyad; Fabiano, Elena

2016-01-01

ABSTRACT The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. IMPORTANCE A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. PMID:27590816

Human Alu insertion polymorphisms in North African populations.

PubMed

Cherni, Loth; Frigi, Sabeh; Ennafaa, Hajer; Mtiraoui, Nabil; Mahjoub, Touhami; Benammar-Elgaaied, Amel

2011-10-01

Several features make Alu insertions a powerful tool used in population genetic studies: the polymorphic nature of many Alu insertions, the stability of an Alu insertion event and, furthermore, the ancestral state of an Alu insertion is known to be the absence of the Alu element at a particular locus and the presence of an Alu insertion at the site that forward mutational change. This study analyses seven Alu insertion polymorphisms in a sample of 297 individuals from the autochthonous population of Tunisia (Thala, Smar, Zarzis, and Bou Salem) and Libya with the aim of studying their genetic structure with respect to the populations of North Africa, Western, Eastern and Central Europe. The comparative analyses carried out using the MDS and AMOVA methods reveal the existence of spatial heterogeneity, and identify four population groups. Study populations (Libya, Smar, Zarzis, and Bou Salem) are closest to North African populations whereas Thala is isolated and is closest to Western European populations. In conclusion, Results of the present study support the important role that migratory movements have played in the North African gene pool, at least since the Neolithic period.

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

PubMed

van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

2012-07-01

Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

Resources for Biological Annotation of the Drosophila Genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gerald M. Rubin

2005-08-08

This project supported seed money for the development of cDNA and genetic resources to support studies of the Drosophila melanogaster genome. Key publications supported by this work that provide additional detail: (1) ''The Drosophila gene collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes''; and (2) ''The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes''.

Phylogenetic Evidence for Lateral Gene Transfer in the Intestine of Marine Iguanas

PubMed Central

Nelson, David M.; Cann, Isaac K. O.; Altermann, Eric; Mackie, Roderick I.

2010-01-01

Background Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. Methodology/Principal Findings We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Conclusion Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas. PMID:20520734

Trapping of oxidized LDL in lysosomes of Kupffer cells is a trigger for hepatic inflammation.

PubMed

Bieghs, Veerle; Walenbergh, Sofie M A; Hendrikx, Tim; van Gorp, Patrick J; Verheyen, Fons; Olde Damink, Steven W; Masclee, Ad A; Koek, Ger H; Hofker, Marten H; Binder, Christoph J; Shiri-Sverdlov, Ronit

2013-08-01

Non-alcoholic steatohepatitis (NASH) is characterized by steatosis and inflammation. The transition from steatosis towards NASH represents a key step in pathogenesis, as it will set the stage for further severe liver damage. Under normal conditions, lipoproteins that are endocytosed by Kupffer cells (KCs) are easily transferred from the lysosomes into the cytoplasm. Oxidized LDL (oxLDL) that is taken up by the macrophages in vitro is trapped within the lysosomes, while acetylated LDL (acLDL) is leading to normal lysosomal hydrolysis, resulting in cytoplasmic storage. We have recently demonstrated that hepatic inflammation is correlated with lysosomal trapping of lipids. So far, a link between lysosomal trapping of oxLDL and inflammation was not established. We hypothesized that lysosomal trapping of oxLDL in KCs will lead to hepatic inflammation. Ldlr(-/-) mice were injected with LDL, acLDL and oxLDL and sacrificed after 2, 6 and 24 h. Electron microscopy of KCs demonstrated that after oxLDL injection, small lipid inclusions were present inside the lysosomes after all time points and were mostly pronounced after 6 and 24 h. In contrast, no lipid inclusions were present inside KCs after LDL or acLDL injection. Hepatic expression of several inflammatory genes and scavenger receptors was higher after oxLDL injections compared with LDL or acLDL. These data suggest that trapping of oxLDL inside lysosomes of KCs in vivo is causally linked to increased hepatic inflammatory gene expression. Our novel observations provide new bases for prevention and treatment of NASH. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Tn-Seq Analysis of Vibrio cholerae Intestinal Colonization Reveals a Role for T6SS-Mediated Antibacterial Activity in the Host

PubMed Central

Fu, Yang; Waldor, Matthew K.; Mekalanos, John J.

2014-01-01

SUMMARY Analysis of genes required for host infection will provide clues to the drivers of evolutionary fitness of pathogens like Vibrio cholerae, a mounting threat to global heath. We used transposon insertion site sequencing (Tn-seq) to comprehensively assess the contribution of nearly all V. cholerae genes toward growth in the infant rabbit intestine. Four hundred genes were identified as critical to V. cholerae in vivo fitness. These included most known colonization factors and several new genes affecting the bacterium's metabolic properties, resistance to bile, and ability to synthesize cyclic AMP-GMP. Notably, a mutant carrying an insertion in tsiV3, encoding immunity to a bacteriocidal type VI secretion system (T6SS) effector VgrG3, exhibited a colonization defect. The reduced in vivo fitness of tsiV3 mutants depends on their cocolonization with bacterial cells carrying an intact T6SS locus and VgrG3 gene, suggesting that the V. cholerae T6SS is functional and mediates antagonistic interbacterial interactions during infection. PMID:24331463

A baculovirus dual expression vector derived from the Autographa californica nuclear polyhedrosis virus polyhedrin and p10 promoters: co-expression of two influenza virus genes in insect cells.

PubMed

Weyer, U; Possee, R D

1991-12-01

A baculovirus transfer vector, pAcUW3, was developed to facilitate the insertion of two influenza virus genes, those encoding the haemagglutinin (HA) and neuraminidase (NA) membrane glycoproteins, into the Autographa californica nuclear polyhedrosis virus genome in a single cotransfection experiment. The NA gene was inserted in place of the polyhedrin coding sequences under the control of the polyhedrin promoter, whereas the HA gene was placed under the control of a copy of the p10 promoter at a site upstream of and in opposite orientation to the polyhedrin promoter. After infection of Spodoptera frugiperda cells with the recombinant virus, AcUW3HANA, both HA and NA were expressed in the very late phase of infection and were shown to be functional in appropriate assays. Immunofluorescence assays demonstrated their localization at the surface of infected insect cells. The expression of both foreign genes in the recombinant virus was found to be stable for at least 12 passages in cell culture.

Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

PubMed

Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

2001-06-01

A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

Type 3 fimbriae and biofilm formation are regulated by the transcriptional regulators MrkHI in Klebsiella pneumoniae.

PubMed

Johnson, Jeremiah G; Murphy, Caitlin N; Sippy, Jean; Johnson, Tylor J; Clegg, Steven

2011-07-01

Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression.

Type 3 Fimbriae and Biofilm Formation Are Regulated by the Transcriptional Regulators MrkHI in Klebsiella pneumoniae▿

PubMed Central

Johnson, Jeremiah G.; Murphy, Caitlin N.; Sippy, Jean; Johnson, Tylor J.; Clegg, Steven

2011-01-01

Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression. PMID:21571997

A mixed group II/group III twintron in the Euglena gracilis chloroplast ribosomal protein S3 gene: evidence for intron insertion during gene evolution.

PubMed Central

Copertino, D W; Christopher, D A; Hallick, R B

1991-01-01

The splicing of a 409 nucleotide intron from the Euglena gracilis chloroplast ribosomal protein S3 gene (rps3) was examined by cDNA cloning and sequencing, and northern hybridization. Based on the characterization of a partially spliced pre-mRNA, the intron was characterized as a 'mixed' twintron, composed of a 311 nucleotide group II intron internal to a 98 nucleotide group III intron. Twintron excision is via a 2-step sequential splicing pathway, with removal of the internal group II intron preceding excision of the external group III intron. Based on secondary structural analysis of the twintron, we propose that group III introns may represent highly degenerate versions of group II introns. The existence of twintrons is interpreted as evidence that group II introns were inserted during the evolution of Euglena chloroplast genes from a common ancestor with eubacteria, archaebacteria, cyanobacteria, and other chloroplasts. Images PMID:1721702

Heme and menaquinone induced electron transport in lactic acid bacteria.

PubMed

Brooijmans, Rob; Smit, Bart; Santos, Filipe; van Riel, Jan; de Vos, Willem M; Hugenholtz, Jeroen

2009-05-29

For some lactic acid bacteria higher biomass production as a result of aerobic respiration has been reported upon supplementation with heme and menaquinone. In this report, we have studied a large number of species among lactic acid bacteria for the existence of this trait. Heme- (and menaquinone) stimulated aerobic growth was observed for several species and genera of lactic acid bacteria. These include Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacilllus brevis, Lactobacillus paralimentarius, Streptococcus entericus and Lactococcus garviae. The increased biomass production without further acidification, which are respiration associated traits, are suitable for high-throughput screening as demonstrated by the screening of 8000 Lactococcus lactis insertion mutants. Respiration-negative insertion-mutants were found with noxA, bd-type cytochrome and menaquinol biosynthesis gene-disruptions. Phenotypic screening and in silico genome analysis suggest that respiration can be considered characteristic for certain species. We propose that the cyd-genes were present in the common ancestor of lactic acid bacteria, and that multiple gene-loss events best explains the observed distribution of these genes among the species.

Cytokine-independent growth and clonal expansion of a primary human CD8+ T-cell clone following retroviral transduction with the IL-15 gene

PubMed Central

Hsu, Cary; Jones, Stephanie A.; Cohen, Cyrille J.; Zheng, Zhili; Kerstann, Keith; Zhou, Juhua; Robbins, Paul F.; Peng, Peter D.; Shen, Xinglei; Gomes, Theotonius J.; Dunbar, Cynthia E.; Munroe, David J.; Stewart, Claudia; Cornetta, Kenneth; Wangsa, Danny; Ried, Thomas; Rosenberg, Steven A.

2007-01-01

Malignancies arising from retrovirally transduced hematopoietic stem cells have been reported in animal models and human gene therapy trials. Whether mature lymphocytes are susceptible to insertional mutagenesis is unknown. We have characterized a primary human CD8+ T-cell clone, which exhibited logarithmic ex vivo growth in the absence of exogenous cytokine support for more than 1 year after transduction with a murine leukemia virus–based vector encoding the T-cell growth factor IL-15. Phenotypically, the clone was CD28−, CD45RA−, CD45RO+, and CD62L−, a profile consistent with effector memory T lymphocytes. After gene transfer with tumor-antigen–specific T-cell receptors, the clone secreted IFN-γ upon encountering tumor targets, providing further evidence that they derived from mature lymphocytes. Gene-expression analyses revealed no evidence of insertional activation of genes flanking the retroviral insertion sites. The clone exhibited constitutive telomerase activity, and the presence of autocrine loop was suggested by impaired cell proliferation following knockdown of IL-15Rα expression. The generation of this cell line suggests that nonphysiologic expression of IL-15 can result in the long-term in vitro growth of mature human T lymphocytes. The cytokine-independent growth of this line was a rare event that has not been observed in other IL-15 vector transduction experiments or with any other integrating vector system. It does not appear that the retroviral vector integration sites played a role in the continuous growth of this cell clone, but this remains under investigation. PMID:17353346

Gene relocations within chloroplast genomes of Jasminum and Menodora (Oleaceae) are due to multiple, overlapping inversions.

PubMed

Lee, Hae-Lim; Jansen, Robert K; Chumley, Timothy W; Kim, Ki-Joong

2007-05-01

The chloroplast (cp) DNA sequence of Jasminum nudiflorum (Oleaceae-Jasmineae) is completed and compared with the large single-copy region sequences from 6 related species. The cp genomes of the tribe Jasmineae (Jasminum and Menodora) show several distinctive rearrangements, including inversions, gene duplications, insertions, inverted repeat expansions, and gene and intron losses. The ycf4-psaI region in Jasminum section Primulina was relocated as a result of 2 overlapping inversions of 21,169 and 18,414 bp. The 1st, larger inversion is shared by all members of the Jasmineae indicating that it occurred in the common ancestor of the tribe. Similar rearrangements were also identified in the cp genome of Menodora. In this case, 2 fragments including ycf4 and rps4-trnS-ycf3 genes were moved by 2 additional inversions of 14 and 59 kb that are unique to Menodora. Other rearrangements in the Oleaceae are confined to certain regions of the Jasminum and Menodora cp genomes, including the presence of highly repeated sequences and duplications of coding and noncoding sequences that are inserted into clpP and between rbcL and psaI. These insertions are correlated with the loss of 2 introns in clpP and a serial loss of segments of accD. The loss of the accD gene and clpP introns in both the monocot family Poaceae and the eudicot family Oleaceae are clearly independent evolutionary events. However, their genome organization is surprisingly similar despite the distant relationship of these 2 angiosperm families.

ACE/DD genotype is associated with hemostasis balance disturbances reflecting hypercoagulability and endothelial dysfunction in patients with untreated hypertension.

PubMed

Makris, T K; Stavroulakis, G A; Dafni, U G; Gialeraki, A E; Krespi, P G; Hatzizacharias, A N; Tsoukala, C G; Vythoulkas, J S; Kyriakidis, M K

2000-11-01

Angiotensin-converting enzyme (ACE) gene polymorphism has been associated with an increased incidence of myocardial infarction. Recent studies have investigated a potential influence of ACE gene polymorphism on fibrinolysis or endothelial function. It has been previously established that essential hypertension is accompanied by endothelial dysfunction and fibrinolytic balance disorders. The aim of our study was to study the relation between ACE gene polymorphism and fibrinolytic/hemostatic factors as well as endothelial cell damage markers in patients with hypertension. The following parameters were evaluated in 104 patients with previously untreated hypertension: plasminogen activator inhibitor-1 (PAI-1), tissue plasminogen activator (tPA) antigen, fibrinogen, D-dimer, and von Willebrand factor (vWF). The genotype of the ACE gene was also determined (by the polymerase chain reaction method), and patients were characterized according to the observed alleles as deletion/deletion (DD), insertion/insertion (II), or insertion/deletion (ID). Those with DD genotype (n = 42) had significantly higher plasma levels of PAI-1 antigen (P =. 012), tPA antigen (P =.0001), fibrinogen (P =.0002), D-dimer (P =. 0001) and vWF (P =.0004) compared with ID (n = 30) or II (n = 32) genotypes. The ACE gene genotypes appeared to be significant predictors for plasma PAI-1 antigen, tPA antigen, fibrinogen, D -dimer, and vWF even after adjustment for age, sex, body mass index, triglyceride and cholesterol levels, and blood pressure. Our findings suggest that the ACE/DD genotype is associated with hemostasis balance disturbances reflecting hypercoagulability and endothelial damage in patients with untreated hypertension.

Enhancer trap expression patterns provide a novel teaching resource.

PubMed

Geisler, Matt; Jablonska, Barbara; Springer, Patricia S

2002-12-01

A collection of Arabidopsis enhancer trap transposants has been identified for use as a teaching tool. This collection serves to assist students in understanding the patterning and organization of plant tissues and cells, and will be useful in plant anatomy, morphology, and developmental biology courses. Each transposant exhibits reporter gene expression in a specific tissue, cell type, or domain, and these lines collectively offer a glimpse of compartments of gene expression. Some compartments correspond to classical definitions of botanical anatomy and can assist in anatomical identification. Other patterns of reporter gene expression are more complex and do not necessarily correspond to known anatomical features. The sensitivity of the beta-glucuronidase histochemical stain provides the student with a colorful and direct way to visualize difficult aspects of plant development and anatomy, and provides the teacher with an invaluable tool for a practical laboratory session.

Going, going, gone: predicting the fate of genomic insertions in plant RNA viruses.

PubMed

Willemsen, Anouk; Carrasco, José L; Elena, Santiago F; Zwart, Mark P

2018-05-10

Horizontal gene transfer is common among viruses, while they also have highly compact genomes and tend to lose artificial genomic insertions rapidly. Understanding the stability of genomic insertions in viral genomes is therefore relevant for explaining and predicting their evolutionary patterns. Here, we revisit a large body of experimental research on a plant RNA virus, tobacco etch potyvirus (TEV), to identify the patterns underlying the stability of a range of homologous and heterologous insertions in the viral genome. We obtained a wide range of estimates for the recombination rate-the rate at which deletions removing the insertion occur-and these appeared to be independent of the type of insertion and its location. Of the factors we considered, recombination rate was the best predictor of insertion stability, although we could not identify the specific sequence characteristics that would help predict insertion instability. We also considered experimentally the possibility that functional insertions lead to higher mutational robustness through increased redundancy. However, our observations suggest that both functional and non-functional increases in genome size decreased the mutational robustness. Our results therefore demonstrate the importance of recombination rates for predicting the long-term stability and evolution of viral RNA genomes and suggest that there are unexpected drawbacks to increases in genome size for mutational robustness.

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

PubMed

Traverse, Charles C; Ochman, Howard

2017-08-29

Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

Design Optimization of Vena Cava Filters: An application to dual filtration devices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, M A; Wang, S L; Diachin, D P

Pulmonary embolism (PE) is a significant medical problem that results in over 300,000 fatalities per year. A common preventative treatment for PE is the insertion of a metallic filter into the inferior vena cava that traps thrombi before they reach the lungs. The goal of this work is to use methods of mathematical modeling and design optimization to determine the configuration of trapped thrombi that minimizes the hemodynamic disruption. The resulting configuration has implications for constructing an optimally designed vena cava filter. Computational fluid dynamics is coupled with a nonlinear optimization algorithm to determine the optimal configuration of trapped modelmore » thrombus in the inferior vena cava. The location and shape of the thrombus are parameterized, and an objective function, based on wall shear stresses, determines the worthiness of a given configuration. The methods are fully automated and demonstrate the capabilities of a design optimization framework that is broadly applicable. Changes to thrombus location and shape alter the velocity contours and wall shear stress profiles significantly. For vena cava filters that trap two thrombi simultaneously, the undesirable flow dynamics past one thrombus can be mitigated by leveraging the flow past the other thrombus. Streamlining the shape of thrombus trapped along the cava wall reduces the disruption to the flow, but increases the area exposed to abnormal wall shear stress. Computer-based design optimization is a useful tool for developing vena cava filters. Characterizing and parameterizing the design requirements and constraints is essential for constructing devices that address clinical complications. In addition, formulating a well-defined objective function that quantifies clinical risks and benefits is needed for designing devices that are clinically viable.« less

Antigenic Diversity of the Plasmodium vivax Circumsporozoite Protein in Parasite Isolates of Western Colombia

PubMed Central

Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878

Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl

PubMed Central

Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950

Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.

PubMed

Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.

Mechanism and Regulation of Gene Expression by Androgen Receptor in Prostate Cancer

DTIC Science & Technology

2004-07-01

the nature, regulation and mechanism of action of these factors can facilitate the development of anti-prostatic cancer therapy. The general objective...response to other signal transduction pathways) during prostate cancer development . This approach might provide new drug development insights into...G. Roeder. 2000. Involvement of the TRAP220 component of the TRAP/SMCC coactivator complex in embryonic development and thyroid hormone action. Mol

Cas9-Guide RNA Directed Genome Editing in Soybean[OPEN

PubMed Central

Li, Zhongsen; Liu, Zhan-Bin; Xing, Aiqiu; Moon, Bryan P.; Koellhoffer, Jessica P.; Huang, Lingxia; Ward, R. Timothy; Clifton, Elizabeth; Falco, S. Carl; Cigan, A. Mark

2015-01-01

Recently discovered bacteria and archaea adaptive immune system consisting of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) endonuclease has been explored in targeted genome editing in different species. Streptococcus pyogenes Cas9-guide RNA (gRNA) was successfully applied to generate targeted mutagenesis, gene integration, and gene editing in soybean (Glycine max). Two genomic sites, DD20 and DD43 on chromosome 4, were mutagenized with frequencies of 59% and 76%, respectively. Sequencing randomly selected transgenic events confirmed that the genome modifications were specific to the Cas9-gRNA cleavage sites and consisted of small deletions or insertions. Targeted gene integrations through homology-directed recombination were detected by border-specific polymerase chain reaction analysis for both sites at callus stage, and one DD43 homology-directed recombination event was transmitted to T1 generation. T1 progenies of the integration event segregated according to Mendelian laws and clean homozygous T1 plants with the donor gene precisely inserted at the DD43 target site were obtained. The Cas9-gRNA system was also successfully applied to make a directed P178S mutation of acetolactate synthase1 gene through in planta gene editing. PMID:26294043

A Novel ‘Gene Insertion/Marker Out’ (GIMO) Method for Transgene Expression and Gene Complementation in Rodent Malaria Parasites

PubMed Central

Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.

2011-01-01

Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235

Rapid synthesis and decoration of reduced graphene oxide with gold nanoparticles by thermostable peptides for memory device and photothermal applications.

PubMed

Otari, Sachin V; Kumar, Manoj; Anwar, Muhammad Zahid; Thorat, Nanasaheb D; Patel, Sanjay K S; Lee, Dongjin; Lee, Jai Hyo; Lee, Jung-Kul; Kang, Yun Chan; Zhang, Liaoyuan

2017-09-08

This article presents novel, rapid, and environmentally benign synthesis method for one-step reduction and decoration of graphene oxide with gold nanoparticles (NAuNPs) by using thermostable antimicrobial nisin peptides to form a gold-nanoparticles-reduced graphene oxide (NAu-rGO) nanocomposite. The formed composite material was characterized by UV/Vis spectroscopy, X-ray diffraction, Raman spectroscopy, X-ray photoelectron spectroscopy, field emission scanning electron microscopy, and high-resolution transmission electron microscopy (HR-TEM). HR-TEM analysis revealed the formation of spherical AuNPs of 5-30 nm in size on reduced graphene oxide (rGO) nanosheets. A non-volatile-memory device was prepared based on a solution-processed ZnO thin-film transistor fabricated by inserting the NAu-rGO nanocomposite in the gate dielectric stack as a charge trapping medium. The transfer characteristic of the ZnO thin-film transistor memory device showed large clockwise hysteresis behaviour because of charge carrier trapping in the NAu-rGO nanocomposite. Under positive and negative bias conditions, clear positive and negative threshold voltage shifts occurred, which were attributed to charge carrier trapping and de-trapping in the ZnO/NAu-rGO/SiO 2 structure. Also, the photothermal effect of the NAu-rGO nanocomposites on MCF7 breast cancer cells caused inhibition of ~80% cells after irradiation with infrared light (0.5 W cm -2 ) for 5 min.

A mechanism study of sound wave-trapping barriers.

PubMed

Yang, Cheng; Pan, Jie; Cheng, Li

2013-09-01

The performance of a sound barrier is usually degraded if a large reflecting surface is placed on the source side. A wave-trapping barrier (WTB), with its inner surface covered by wedge-shaped structures, has been proposed to confine waves within the area between the barrier and the reflecting surface, and thus improve the performance. In this paper, the deterioration in performance of a conventional sound barrier due to the reflecting surface is first explained in terms of the resonance effect of the trapped modes. At each resonance frequency, a strong and mode-controlled sound field is generated by the noise source both within and in the vicinity outside the region bounded by the sound barrier and the reflecting surface. It is found that the peak sound pressures in the barrier's shadow zone, which correspond to the minimum values in the barrier's insertion loss, are largely determined by the resonance frequencies and by the shapes and losses of the trapped modes. These peak pressures usually result in high sound intensity component impinging normal to the barrier surface near the top. The WTB can alter the sound wave diffraction at the top of the barrier if the wavelengths of the sound wave are comparable or smaller than the dimensions of the wedge. In this case, the modified barrier profile is capable of re-organizing the pressure distribution within the bounded domain and altering the acoustic properties near the top of the sound barrier.

Novel genes associated with enhanced motility of Escherichia coli ST131

PubMed Central

Kakkanat, Asha; Phan, Minh-Duy; Lo, Alvin W.; Beatson, Scott A.

2017-01-01

Uropathogenic Escherichia coli (UPEC) is the cause of ~75% of all urinary tract infections (UTIs) and is increasingly associated with multidrug resistance. This includes UPEC strains from the recently emerged and globally disseminated sequence type 131 (ST131), which is now the dominant fluoroquinolone-resistant UPEC clone worldwide. Most ST131 strains are motile and produce H4-type flagella. Here, we applied a combination of saturated Tn5 mutagenesis and transposon directed insertion site sequencing (TraDIS) as a high throughput genetic screen and identified 30 genes associated with enhanced motility of the reference ST131 strain EC958. This included 12 genes that repress motility of E. coli K-12, four of which (lrhA, ihfA, ydiV, lrp) were confirmed in EC958. Other genes represented novel factors that impact motility, and we focused our investigation on characterisation of the mprA, hemK and yjeA genes. Mutation of each of these genes in EC958 led to increased transcription of flagellar genes (flhD and fliC), increased expression of the FliC flagellin, enhanced flagella synthesis and a hyper-motile phenotype. Complementation restored all of these properties to wild-type level. We also identified Tn5 insertions in several intergenic regions (IGRs) on the EC958 chromosome that were associated with enhanced motility; this included flhDC and EC958_1546. In both of these cases, the Tn5 insertions were associated with increased transcription of the downstream gene(s), which resulted in enhanced motility. The EC958_1546 gene encodes a phage protein with similarity to esterase/deacetylase enzymes involved in the hydrolysis of sialic acid derivatives found in human mucus. We showed that over-expression of EC958_1546 led to enhanced motility of EC958 as well as the UPEC strains CFT073 and UTI89, demonstrating its activity affects the motility of different UPEC strains. Overall, this study has identified and characterised a number of novel factors associated with enhanced UPEC motility. PMID:28489862

Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

PubMed

Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

2015-08-01

Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at frequencies of ca. 25-67 % and those with negative Phr were broadly found in Europe and Asia. The stop codon type was found in 285 accessions and was broadly distributed in Europe and Asia, whereas the TE-1 insertion type was found in 99 accessions from Europe and Asia but was not found in India. The 6-bp duplication type was found in only 8 accessions from Nansei Islands (Okinawa Prefecture) of Japan. We also analyzed Phr in the wild ancestor and concluded that the negative Phr type was likely to have originated after domestication of foxtail millet. It was also implied that negative Phr of foxtail millet arose by multiple independent loss of function of PPO gene through dispersal because of some advantages under some environmental conditions and human selection as in rice and barley.

Cloning of Pf3, a filamentous bacteriophage of Pseudomonas aeruginosa, into the pBD214 vector of Bacillus subtilis.

PubMed Central

Putterman, D G; Gryczan, T J; Dubnau, D; Day, L A

1983-01-01

The genome of Pf3, a filamentous single-stranded DNA bacteriophage of Pseudomonas aeruginosa (a gram-negative organism) was cloned into pBD214, a plasmid cloning vector of Bacillus subtilis (a gram-positive organism). Cloning in the gram-positive organism was done to avoid anticipated lethal effects. The entire Pf3 genome was inserted in each orientation at a unique Bc/I site within a thymidylate synthetase gene (from B. subtilis phage beta 22) on the plasmid. Additional clones were made by inserting EcoRI fragments of Pf3 DNA into a unique EcoRI site within this gene. Images PMID:6306273

MERE1, a low-copy-number copia-type retroelement in Medicago truncatula active during tissue culture.

PubMed

Rakocevic, Alexandra; Mondy, Samuel; Tirichine, Leïla; Cosson, Viviane; Brocard, Lysiane; Iantcheva, Anelia; Cayrel, Anne; Devier, Benjamin; Abu El-Heba, Ghada Ahmed; Ratet, Pascal

2009-11-01

We have identified an active Medicago truncatula copia-like retroelement called Medicago RetroElement1-1 (MERE1-1) as an insertion in the symbiotic NSP2 gene. MERE1-1 belongs to a low-copy-number family in the sequenced Medicago genome. These copies are highly related, but only three of them have a complete coding region and polymorphism exists between the long terminal repeats of these different copies. This retroelement family is present in all M. truncatula ecotypes tested but also in other legume species like Lotus japonicus. It is active only during tissue culture in both R108 and Jemalong Medicago accessions and inserts preferentially in genes.

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?

PubMed

Rodić, Nemanja; Burns, Kathleen H

2013-03-01

LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.

Characterization of T-DNA insertion mutants with decreased virulence in the entomopathogenic fungus Beauveria bassiana JEF-007.

PubMed

Kim, Sihyeon; Lee, Se Jin; Nai, Yu-Shin; Yu, Jeong Seon; Lee, Mi Rong; Yang, Yi-Ting; Kim, Jae Su

2016-10-01

The bean bug, Riptortus pedestris, is a major agricultural pest that reduces crop quality and value. Chemical pesticides have contributed to pest management, but resistance to these chemicals has significantly limited their use. Alternative strategies with different modes of action, such as entomopathogenic fungi, are therefore of great interest. Herein, we explored how entomopathogenic fungi can potentially be used to control the bean bug and focused on identifying virulence-related genes. Beauveria bassiana (JEF isolates) were assayed against bean bugs under laboratory conditions. One isolate, JEF-007, showed >80 % virulence by both spray and contact exposure methods. Agrobacterium tumefaciens-mediated transformation (AtMT) of JEF-007 generated 249 random transformants, two of which (B1-06 and C1-49) showed significantly reduced virulence against Tenebrio molitor and R. pedestris immatures. Both species were used for rapid screening of virulence-reduced mutants. The two transformants had different morphologies, conidial production, and thermotolerance than the wild type. To determine the localization of the randomly inserted T-DNA, thermal asymmetric interlaced (TAIL) PCR was conducted and analysis of the two clones found multiple T-DNA insertions (two in B1-06 and three in C1-49). Genes encoding complex I intermediate-associated protein 30 (CIA30) and the autophagy protein (Atg22) were possibly disrupted by the T-DNA insertion and might be involved in the virulence. This work provides a strong platform for future functional genetic studies of bean bug-pathogenic B. bassiana. The genes putatively involved in fungal virulence should be experimentally validated by knockdown in future studies.

Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

PubMed

Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

2017-11-01

In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

Detection and characterization of miniature inverted-repeat transposable elements in “Candidatus Liberibacter asiaticus”

USDA-ARS?s Scientific Manuscript database

Miniature inverted-repeat transposable elements (MITEs) are non-autonomous transposons (devoid a transposase gene, tps) involving insertion/deletion of genomic DNA in bacterial genomes influencing gene functions. No transposon has yet been reported in “Candidatus Liberibacter asiaticus”, an alpha-pr...

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

PubMed

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.

PubMed

Rurek, M; Oczkowski, M; Augustyniak, H

1998-01-01

A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

Improving Prompt Temperature Feedback by Stimulating Doppler Broadening in Heterogeneous Composite Nuclear Fuel Forms

NASA Astrophysics Data System (ADS)

Morrison, Christopher

Nuclear fuels with similar aggregate material composition, but with different millimeter and micrometer spatial configurations of the component materials can have very different safety and performance characteristics. This research focuses on modeling and attempting to engineer heterogeneous combinations of nuclear fuels to improve negative prompt temperature feedback in response to reactivity insertion accidents. Improvements in negative prompt temperature feedback are proposed by developing a tailored thermal resistance in the nuclear fuel. In the event of a large reactivity insertion, the thermal resistance allows for a faster negative Doppler feedback by temporarily trapping heat in material zones with strong absorption resonances. A multi-physics simulation framework was created that could model large reactivity insertions. The framework was then used to model a comparison of a heterogeneous fuel with a tailored thermal resistance and a homogeneous fuel without the tailored thermal resistance. The results from the analysis confirmed the fundamental premise of prompt temperature feedback and provide insights into the neutron spectrum dynamics throughout the transient process. A trade study was conducted on infinite lattice fuels to help map a design space to study and improve prompt temperature feedback with many results. A multi-scale fuel pin analysis was also completed to study more realistic geometries. The results of this research could someday allow for novel nuclear fuels that would behave differently than current fuels. The idea of having a thermal barrier coating in the fuel is contrary to most current thinking. Inherent resistance to reactivity insertion accidents could enable certain reactor types once considered vulnerable to reactivity insertion accidents to be reevaluated in light of improved negative prompt temperature feedback.

Role of the 2 adenine (g.11293_11294insAA) insertion polymorphism in the 3' untranslated region of the factor VII (FVII) gene: molecular characterization of a patient with severe FVII deficiency.

PubMed

Peyvandi, F; Garagiola, I; Palla, R; Marziliano, N; Mannucci, P M

2005-11-01

Polymorphic variants in the gene encoding factor VII (F7) affect the plasma levels of this coagulation protein and modify the clinical phenotype of FVII deficiency in some patients. In this study we report the in vitro functional analysis of a novel polymorphic variant located in the 3' untranslated region of F7: g.11293_11294insAA. To determine whether this variant regulates FVII expression, we initially compared an expression vector containing FVII cDNA with g.11293_11294insAA with the FVII wild-type (WT) construct. The kinetics of mRNA production showed that the insertion decreases the steady-state FVII mRNA levels. To assess whether the insertion influences the phenotype of FVII-deficient patients, we evaluated its effect on the expression of FVII in a patient with severe FVII deficiency (undetectable FVII activity and antigen) carrying two additional homozygous missense variations (p.Arg277Cys and p.Arg353Gln). The two substitutions alone reduced the expression of FVII activity and antigen in vitro, but with the insertion polymorphism in our expression vector the patient's phenotype of undetectable plasma FVII was recapitulated. The insertion polymorphism in the 3' untranslated region of F7 is another modifier of FVII expression that might explain the poor genotype-phenotype correlation in some FVII-deficient patients. Copyright 2005 Wiley-Liss, Inc.

A novel helper phage enabling construction of genome-scale ORF-enriched phage display libraries.

PubMed

Gupta, Amita; Shrivastava, Nimisha; Grover, Payal; Singh, Ajay; Mathur, Kapil; Verma, Vaishali; Kaur, Charanpreet; Chaudhary, Vijay K

2013-01-01

Phagemid-based expression of cloned genes fused to the gIIIP coding sequence and rescue using helper phages, such as VCSM13, has been used extensively for constructing large antibody phage display libraries. However, for randomly primed cDNA and gene fragment libraries, this system encounters reading frame problems wherein only one of 18 phages display the translated foreign peptide/protein fused to phagemid-encoded gIIIP. The elimination of phages carrying out-of-frame inserts is vital in order to improve the quality of phage display libraries. In this study, we designed a novel helper phage, AGM13, which carries trypsin-sensitive sites within the linker regions of gIIIP. This renders the phage highly sensitive to trypsin digestion, which abolishes its infectivity. For open reading frame (ORF) selection, the phagemid-borne phages are rescued using AGM13, so that clones with in-frame inserts express fusion proteins with phagemid-encoded trypsin-resistant gIIIP, which becomes incorporated into the phages along with a few copies of AGM13-encoded trypsin-sensitive gIIIP. In contrast, clones with out-of-frame inserts produce phages carrying only AGM13-encoded trypsin-sensitive gIIIP. Trypsin treatment of the phage population renders the phages with out-of-frame inserts non-infectious, whereas phages carrying in-frame inserts remain fully infectious and can hence be enriched by infection. This strategy was applied efficiently at a genome scale to generate an ORF-enriched whole genome fragment library from Mycobacterium tuberculosis, in which nearly 100% of the clones carried in-frame inserts after selection. The ORF-enriched libraries were successfully used for identification of linear and conformational epitopes for monoclonal antibodies specific to mycobacterial proteins.

Whole genome analyses of marine fish pathogenic isolate, Mycobacterium sp. 012931.

PubMed

Kurokawa, Satoru; Kabayama, Jun; Hwang, Seong Don; Nho, Seong Won; Hikima, Jun-ichi; Jung, Tae Sung; Kondo, Hidehiro; Hirono, Ikuo; Takeyama, Haruko; Mori, Tetsushi; Aoki, Takashi

2014-10-01

Mycobacterium is a genus within the order Actinomycetales that comprises of a large number of well-characterized species, several of which includes pathogens known to cause serious disease in human and animal. Here, we report the whole genome sequence of Mycobacterium sp. strain 012931 isolated from the marine fish, yellowtail (Seriola quinqueradiata). Mycobacterium sp. 012931 is a fish pathogen causing serious damage to aquaculture farms in Japan. DNA dot plot analysis showed that Mycobacterium sp. 012931 was more closely related to Mycobacterium marinum when compared across several Mycobacterium species. However, little conservation of the gene order was observed between Mycobacterium sp. 012931 and M. marinum genome. The annotated 5,464 genes of Mycobacterium sp. 012931 was classified into 26 subsystems. The insertion/deletion gene analysis shows Mycobacterium sp. 012931 had 643 unique genes that were not found in the M. marinum strains. In the virulence, disease, and defense subsystem, both insertion and deletion genes of Mycobacterium sp. 012931 were associated with the PPE gene cluster of Mycobacteria. Of seven plcB genes in Mycobacterium sp. 012931, plcB_2 and plcB_3 showed low identities with those of M. marinum strains. Therefore, Mycobacterium sp. 012931 has differences on genetic and virulence from M. marinum and may induce different interaction mechanisms between host and pathogen.

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

PubMed

Luo, Ming; Gilbert, Brian; Ayliffe, Michael

2016-07-01

Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described.

Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

PubMed Central

Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

2016-01-01

The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.

PubMed

Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K

2011-10-01

A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

The Identification and Differentiation between Burkholderia mallei and Burkholderia pseudomallei Using One Gene Pyrosequencing

PubMed Central

Gilling, Damian H.; Luna, Vicki Ann; Pflugradt, Cori

2014-01-01

The etiologic agents for melioidosis and glanders, Burkholderia mallei and Burkholderia pseudomallei respectively, are genetically similar making identification and differentiation from other Burkholderia species and each other challenging. We used pyrosequencing to determine the presence or absence of an insertion sequence IS407A within the flagellin P (fliP) gene and to exploit the difference in orientation of this gene in the two species. Oligonucleotide primers were designed to selectively target the IS407A-fliP interface in B. mallei and the fliP gene specifically at the insertion point in B. pseudomallei. We then examined DNA from ten B. mallei, ten B. pseudomallei, 14 B. cepacia, eight other Burkholderia spp., and 17 other bacteria. Resultant pyrograms encompassed the target sequence that contained either the fliP gene with the IS407A interruption or the fully intact fliP gene with 100% sensitivity and 100% specificity. These pyrosequencing assays based upon a single gene enable investigators to reliably identify the two species. The information obtained by these assays provides more knowledge of the genomic reduction that created the new species B. mallei from B. pseudomallei and may point to new targets that can be exploited in the future. PMID:27350960

The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon.

PubMed

Lorenzen, Marcé D; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W

2008-07-22

Maternal-Effect Dominant Embryonic Arrest ("Medea") factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea(1) activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea(1) reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations.

The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon

PubMed Central

Lorenzen, Marcé D.; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J.; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W.

2008-01-01

Maternal-Effect Dominant Embryonic Arrest (“Medea”) factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea1 activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea1 reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations. PMID:18621706

A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

DOE PAGES

Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E.; ...

2015-03-31

Here, we document a collection of ~7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstratemore » reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates.« less

Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ionasescu, V.; Ionasescu, R.; Searby, C.

1996-06-14

We studied the relationship between the genotype and clinical phenotype in 27 families with dominant X-linked Charcot-Marie-Tooth (CMTX1) neuropathy. Twenty-two families showed mutations in the coding region of the connexin32 (cx32) gene. The mutations include four nonsense mutations, eight missense mutations, two medium size deletions, and one insertion. Most missense mutations showed a mild clinical phenotype (five out of eight), whereas all nonsense mutations, the larger of the two deletions, and the insertion that produced frameshifts showed severe phenotypes. Five CMTX1 families with mild clinical phenotype showed no point mutations of the cx32 gene coding region. Three of these familiesmore » showed positive genetic linkage with the markers of the Xq13.1 region. The genetic linkage of the remaining two families could not be evaluated because of their small size. 25 refs., 1 fig., 1 tab.« less

The B73 maize genome: complexity, diversity, and dynamics.

PubMed

Schnable, Patrick S; Ware, Doreen; Fulton, Robert S; Stein, Joshua C; Wei, Fusheng; Pasternak, Shiran; Liang, Chengzhi; Zhang, Jianwei; Fulton, Lucinda; Graves, Tina A; Minx, Patrick; Reily, Amy Denise; Courtney, Laura; Kruchowski, Scott S; Tomlinson, Chad; Strong, Cindy; Delehaunty, Kim; Fronick, Catrina; Courtney, Bill; Rock, Susan M; Belter, Eddie; Du, Feiyu; Kim, Kyung; Abbott, Rachel M; Cotton, Marc; Levy, Andy; Marchetto, Pamela; Ochoa, Kerri; Jackson, Stephanie M; Gillam, Barbara; Chen, Weizu; Yan, Le; Higginbotham, Jamey; Cardenas, Marco; Waligorski, Jason; Applebaum, Elizabeth; Phelps, Lindsey; Falcone, Jason; Kanchi, Krishna; Thane, Thynn; Scimone, Adam; Thane, Nay; Henke, Jessica; Wang, Tom; Ruppert, Jessica; Shah, Neha; Rotter, Kelsi; Hodges, Jennifer; Ingenthron, Elizabeth; Cordes, Matt; Kohlberg, Sara; Sgro, Jennifer; Delgado, Brandon; Mead, Kelly; Chinwalla, Asif; Leonard, Shawn; Crouse, Kevin; Collura, Kristi; Kudrna, Dave; Currie, Jennifer; He, Ruifeng; Angelova, Angelina; Rajasekar, Shanmugam; Mueller, Teri; Lomeli, Rene; Scara, Gabriel; Ko, Ara; Delaney, Krista; Wissotski, Marina; Lopez, Georgina; Campos, David; Braidotti, Michele; Ashley, Elizabeth; Golser, Wolfgang; Kim, HyeRan; Lee, Seunghee; Lin, Jinke; Dujmic, Zeljko; Kim, Woojin; Talag, Jayson; Zuccolo, Andrea; Fan, Chuanzhu; Sebastian, Aswathy; Kramer, Melissa; Spiegel, Lori; Nascimento, Lidia; Zutavern, Theresa; Miller, Beth; Ambroise, Claude; Muller, Stephanie; Spooner, Will; Narechania, Apurva; Ren, Liya; Wei, Sharon; Kumari, Sunita; Faga, Ben; Levy, Michael J; McMahan, Linda; Van Buren, Peter; Vaughn, Matthew W; Ying, Kai; Yeh, Cheng-Ting; Emrich, Scott J; Jia, Yi; Kalyanaraman, Ananth; Hsia, An-Ping; Barbazuk, W Brad; Baucom, Regina S; Brutnell, Thomas P; Carpita, Nicholas C; Chaparro, Cristian; Chia, Jer-Ming; Deragon, Jean-Marc; Estill, James C; Fu, Yan; Jeddeloh, Jeffrey A; Han, Yujun; Lee, Hyeran; Li, Pinghua; Lisch, Damon R; Liu, Sanzhen; Liu, Zhijie; Nagel, Dawn Holligan; McCann, Maureen C; SanMiguel, Phillip; Myers, Alan M; Nettleton, Dan; Nguyen, John; Penning, Bryan W; Ponnala, Lalit; Schneider, Kevin L; Schwartz, David C; Sharma, Anupma; Soderlund, Carol; Springer, Nathan M; Sun, Qi; Wang, Hao; Waterman, Michael; Westerman, Richard; Wolfgruber, Thomas K; Yang, Lixing; Yu, Yeisoo; Zhang, Lifang; Zhou, Shiguo; Zhu, Qihui; Bennetzen, Jeffrey L; Dawe, R Kelly; Jiang, Jiming; Jiang, Ning; Presting, Gernot G; Wessler, Susan R; Aluru, Srinivas; Martienssen, Robert A; Clifton, Sandra W; McCombie, W Richard; Wing, Rod A; Wilson, Richard K

2009-11-20

We report an improved draft nucleotide sequence of the 2.3-gigabase genome of maize, an important crop plant and model for biological research. Over 32,000 genes were predicted, of which 99.8% were placed on reference chromosomes. Nearly 85% of the genome is composed of hundreds of families of transposable elements, dispersed nonuniformly across the genome. These were responsible for the capture and amplification of numerous gene fragments and affect the composition, sizes, and positions of centromeres. We also report on the correlation of methylation-poor regions with Mu transposon insertions and recombination, and copy number variants with insertions and/or deletions, as well as how uneven gene losses between duplicated regions were involved in returning an ancient allotetraploid to a genetically diploid state. These analyses inform and set the stage for further investigations to improve our understanding of the domestication and agricultural improvements of maize.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes.

PubMed

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard

2012-04-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Sialic acid catabolism and transport gene clusters are lineage specific in Vibrio vulnificus.

PubMed

Lubin, Jean-Bernard; Kingston, Joseph J; Chowdhury, Nityananda; Boyd, E Fidelma

2012-05-01

Sialic or nonulosonic acids are nine-carbon alpha ketosugars that are present in all vertebrate mucous membranes. Among bacteria, the ability to catabolize sialic acid as a carbon source is present mainly in pathogenic and commensal species of animals. Previously, it was shown that several Vibrio species carry homologues of the genes required for sialic acid transport and catabolism, which are genetically linked. In Vibrio cholerae on chromosome I, these genes are carried on the Vibrio pathogenicity island-2 region, which is confined to pathogenic isolates. We found that among the three sequenced Vibrio vulnificus clinical strains, these genes are present on chromosome II and are not associated with a pathogenicity island. To determine whether the sialic acid transport (SAT) and catabolism (SAC) region is universally present within V. vulnificus, we examined 67 natural isolates whose phylogenetic relationships are known. We found that the region was present predominantly among lineage I of V. vulnificus, which is comprised mainly of clinical isolates. We demonstrate that the isolates that contain this region can catabolize sialic acid as a sole carbon source. Two putative transporters are genetically linked to the region in V. vulnificus, the tripartite ATP-independent periplasmic (TRAP) transporter SiaPQM and a component of an ATP-binding cassette (ABC) transporter. We constructed an in-frame deletion mutation in siaM, a component of the TRAP transporter, and demonstrate that this transporter is essential for sialic acid uptake in this species. Expression analysis of the SAT and SAC genes indicates that sialic acid is an inducer of expression. Overall, our study demonstrates that the ability to catabolize and transport sialic acid is predominately lineage specific in V. vulnificus and that the TRAP transporter is essential for sialic acid uptake.

Biodegradation of the organic disulfide 4,4'-dithiodibutyric acid by Rhodococcus spp.

PubMed

Khairy, Heba; Wübbeler, Jan Hendrik; Steinbüchel, Alexander

2015-12-01

Four Rhodococcus spp. exhibited the ability to use 4,4'-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Lentiviral Vector Induced Insertional Haploinsufficiency of Ebf1 Causes Murine Leukemia

PubMed Central

Heckl, Dirk; Schwarzer, Adrian; Haemmerle, Reinhard; Steinemann, Doris; Rudolph, Cornelia; Skawran, Britta; Knoess, Sabine; Krause, Johanna; Li, Zhixiong; Schlegelberger, Brigitte; Baum, Christopher; Modlich, Ute

2012-01-01

Integrating vectors developed on the basis of various retroviruses have demonstrated therapeutic potential following genetic modification of long-lived hematopoietic stem and progenitor cells. Lentiviral vectors (LV) are assumed to circumvent genotoxic events previously observed with γ-retroviral vectors, due to their integration bias to transcription units in comparison to the γ-retroviral preference for promoter regions and CpG islands. However, recently several studies have revealed the potential for gene activation by LV insertions. Here, we report a murine acute B-lymphoblastic leukemia (B-ALL) triggered by insertional gene inactivation. LV integration occurred into the 8th intron of Ebf1, a major regulator of B-lymphopoiesis. Various aberrant splice variants could be detected that involved splice donor and acceptor sites of the lentiviral construct, inducing downregulation of Ebf1 full-length message. The transcriptome signature was compatible with loss of this major determinant of B-cell differentiation, with partial acquisition of myeloid markers, including Csf1r (macrophage colony-stimulating factor (M-CSF) receptor). This was accompanied by receptor phosphorylation and STAT5 activation, both most likely contributing to leukemic progression. Our results highlight the risk of intragenic vector integration to initiate leukemia by inducing haploinsufficiency of a tumor suppressor gene. We propose to address this risk in future vector design. PMID:22472950

Cryptic insertion of 3'FOXO1 into inverted chromosome arm 2q in the presence of two normal chromosome 13s and 13 small interstitial duplications in a patient with alveolar rhabdomyosarcoma.

PubMed

Hackman, Sarah; Calvey, Laura; Bernreuter, Kristen; Mark, Mengya Wang; Starnes, Sarah; Batanian, Jacqueline R

2015-09-01

Alveolar rhabdomyosarcoma (ARMS) is a pediatric soft tissue neoplasm with a characteristic translocation, t(2;13)(q35;q14), which is detected in 70-80% of cases. This well-described translocation produces the gene fusion product PAX3-FOXO1. Cryptic rearrangements of this fusion have never before been reported in ARMS. Here we describe a patient with ARMS that showed, by fluorescence in situ hybridization and G-banded chromosomes, a cryptic insertion of 3'FOXO1 into inverted chromosome 2q. The inversion breakpoints were depicted by array comparative genomic hybridization as two small interstitial duplications, one of which involved the PAX3 gene. In addition, the array comparative genomic hybridization results revealed 1q gain, 16q loss, and 11 more small duplications, with one of them involving the FOXO1 gene. Although the pathogenesis in classic ARMS cases is thought to be driven by the 5'PAX3-3'FOXO1 fusion on derivative chromosome 13, here we report a novel cryptic insertion of 3'FOXO1 resulting in a pathogenic fusion with 5'PAX3 on inverted chromosome 2q. Copyright © 2015 Elsevier Inc. All rights reserved.