Science.gov

Sample records for gene-related peptide gene

  1. Calcitonin Gene-Related Peptide: Physiology and Pathophysiology

    PubMed Central

    Russell, F. A.; King, R.; Smillie, S.-J.; Kodji, X.; Brain, S. D.

    2014-01-01

    Calcitonin gene-related peptide (CGRP) is a 37-amino acid neuropeptide. Discovered 30 years ago, it is produced as a consequence of alternative RNA processing of the calcitonin gene. CGRP has two major forms (α and β). It belongs to a group of peptides that all act on an unusual receptor family. These receptors consist of calcitonin receptor-like receptor (CLR) linked to an essential receptor activity modifying protein (RAMP) that is necessary for full functionality. CGRP is a highly potent vasodilator and, partly as a consequence, possesses protective mechanisms that are important for physiological and pathological conditions involving the cardiovascular system and wound healing. CGRP is primarily released from sensory nerves and thus is implicated in pain pathways. The proven ability of CGRP antagonists to alleviate migraine has been of most interest in terms of drug development, and knowledge to date concerning this potential therapeutic area is discussed. Other areas covered, where there is less information known on CGRP, include arthritis, skin conditions, diabetes, and obesity. It is concluded that CGRP is an important peptide in mammalian biology, but it is too early at present to know if new medicines for disease treatment will emerge from our knowledge concerning this molecule. PMID:25287861

  2. Calcitonin gene-related peptide as inflammatory mediator.

    PubMed

    Springer, Jochen; Geppetti, Pierangelo; Fischer, Axel; Groneberg, David A

    2003-01-01

    Sensory neuropeptides have been proposed to play a key role in the pathogenesis of a number of respiratory diseases such as asthma, chronic obstructive pulmonary disease or chronic cough. Next to prominent neuropeptides such as tachykinins or vasoactive intestinal polypeptide (VIP), calcitonin gene-related peptide (CGRP) has long been suggested to participate in airway physiology and pathophysiology. CGRP is a 37 amino-acid peptide which is expressed by nerve fibers projecting to the airways and by pulmonary neuroendocrine cells. The most prominent effects of CGRP in the airways are vasodilatation and in a few instances bronchoconstriction. A further pulmonary effect of CGRP is the induction of eosinophil migration and the stimulation of beta-integrin-mediated T cell adhesion to fibronectin at the site of inflammation. By contrast, CGRP inhibits macrophage secretion and the capacity of macrophages to activate T-cells, indicating a potential anti-inflammatory effect. Due to the complex pulmonary effects of CGRP with bronchoconstriction and vasodilatation and diverse immunomodulatory actions, potential anti-asthma drugs based on this peptide have not been established so far. However, targeting the effects of CGRP may be of value for future strategies in nerve modulation.

  3. Calcitonin gene related peptide as inhibitory neurotransmitter in the ureter.

    PubMed

    Maggi, C A; Giuliani, S; Meini, S; Santicioli, P

    1995-07-01

    A dense plexus of calcitonin gene related peptide (CGRP) containing nerve fibres is present in the mammalian ureter, from which CGRP is released by depolarizing stimuli, including chemical normally present in the urine. CGRP exerts a profound, receptor-mediated, inhibitory effect on the evoked motility of the ureter by suppressing latent pacemakers in the smooth muscle. This effect is largely glibenclamide sensitive, indicating the activation of potassium (K) channels in its genesis. Electrical stimulation of intramural nerves in the guinea-pig ureter produces a transient membrane hyperpolarization, which is blocked by glibenclamide or by capsaicin pretreatment, enhanced in a low-K medium, and inhibited by a CGRP receptor antagonist. Thus endogenous CGRP acts as a neurotransmitter K channel opener in the ureter. The refractory period of the guinea-pig ureter is markedly and similarly reduced by capsaicin pretreatment or administration of a CGRP receptor antagonist, indicating that endogenous CGRP can modulate the maximal frequency of ureteral peristalsis. Using a three-chamber organ bath that enabled the separate perfusion of the renal, middle, and bladder regions of the organ, evidence was obtained that CGRP blocks propagation of impulses along the ureter through a glibenclamide-sensitive mechanism. These findings indicate a role of CGRP in the local regulation of ureteral motility and peristalsis.

  4. Quantitative structure-activity relationships and docking studies of calcitonin gene-related peptide antagonists.

    PubMed

    Kyani, Anahita; Mehrabian, Mohadeseh; Jenssen, Håvard

    2012-02-01

    Defining the role of calcitonin gene-related peptide in migraine pathogenesis could lead to the application of calcitonin gene-related peptide antagonists as novel migraine therapeutics. In this work, quantitative structure-activity relationship modeling of biological activities of a large range of calcitonin gene-related peptide antagonists was performed using a panel of physicochemical descriptors. The computational studies evaluated different variable selection techniques and demonstrated shuffling stepwise multiple linear regression to be superior over genetic algorithm-multiple linear regression. The linear quantitative structure-activity relationship model revealed better statistical parameters of cross-validation in comparison with the non-linear support vector regression technique. Implementing only five peptide descriptors into this linear quantitative structure-activity relationship model resulted in an extremely robust and highly predictive model with calibration, leave-one-out and leave-20-out validation R(2) of 0.9194, 0.9103, and 0.9214, respectively. We performed docking of the most potent calcitonin gene-related peptide antagonists with the calcitonin gene-related peptide receptor and demonstrated that peptide antagonists act by blocking access to the peptide-binding cleft. We also demonstrated the direct contact of residues 28-37 of the calcitonin gene-related peptide antagonists with the receptor. These results are in agreement with the conclusions drawn from the quantitative structure-activity relationship model, indicating that both electrostatic and steric factors should be taken into account when designing novel calcitonin gene-related peptide antagonists.

  5. Calcitonin Gene-Related Peptide: Key Regulator of Cutaneous Immunity

    PubMed Central

    Granstein, Richard D.; Wagner, John A.; Stohl, Lori L.; Ding, Wanhong

    2014-01-01

    Calcitonin gene-related peptide (CGRP) has been viewed as a neuropeptide and vasodilator. However, CGRP is more appropriately thought of as a pleiotropic signaling molecule. Indeed, CGRP has key regulatory functions on immune and inflammatory processes within the skin. CGRP-containing nerves are intimately associated with epidermal LCs and CGRP has profound regulatory effects on Langerhans cell antigen-presenting capability. When LCs are exposed to CGRP in vitro, their ability to present antigen for in vivo priming of naïve mice or elicitation of delayed-type hypersensitivity is inhibited in at least some situations. Administration of CGRP intradermally inhibits acquisition of immunity to Th1-dominant haptens applied to the injected site while augmenting immunity to Th2-dominant haptens, although the cellular targets of activity in these experiments remains unclear. Although CGRP can be a pro-inflammatory agent, several studies have demonstrated that administration of CGRP can inhibit the elicitation of inflammation by inflammatory stimuli in vivo. In this regard, CGRP inhibits the release of certain chemokines by stimulated endothelial cells. This is likely to be physiologically relevant since cutaneous blood vessels are innervated by sensory nerves. Exciting new studies suggest a significant role for CGRP in the pathogenesis of psoriasis and, most strikingly, that CGRP inhibit the ability of LCs to transmit the human immunodeficiency virus 1 to T lymphocytes. A more complete understanding of the role of CGRP in the skin immune system may lead to new and novel approaches for the therapy of immune mediated skin disorders. PMID:25534428

  6. Role of calcitonin gene-related peptide in hypertension-induced renal damage.

    PubMed

    Bowers, Mark C; Katki, Khurshed A; Rao, Arundhati; Koehler, Michael; Patel, Parag; Spiekerman, Alvin; DiPette, Donald J; Supowit, Scott C

    2005-07-01

    Calcitonin gene-related peptide, a potent vasodilator neuropeptide, is localized in perivascular sensory nerves. We have reported that alpha-calcitonin gene-related peptide knockout mice have elevated baseline blood pressure and enhanced hypertension-induced renal damage compared with wild-type controls. Thus, the aim of this study was to determine the mechanism and functional significance of this increased hypertension-induced renal damage. We previously demonstrated by telemetric recording that the deoxycorticosterone-salt protocol produces a 35% increase in mean arterial pressure in both alpha-calcitonin gene-related peptide knockout and wild-type mice. Both strains of mice were studied at 0, 14, and 21 days after deoxycorticosterone-salt hypertension. Renal sections from hypertensive wild-type mice showed no pathological changes at any time point studied. However, on days 14 and 21, hypertensive knockout mice displayed progressive increases in glomerular proliferation, crescent formation, and tubular protein casts, as well as the inflammatory markers intercellular adhesion molecule-1, vascular adhesion molecule-1, and monocyte chemoattractant protein-1. There was a significant increase in 24-hour urinary isoprostane, a marker of oxidative stress-induced lipid peroxidation, levels at days 14 and 21 in the hypertensive knockout compared with hypertensive wild-type mice. Urinary microalbumin was significantly higher (2-fold) at day 21 and creatinine clearance was significantly decreased 4-fold in the hypertensive knockout compared with hypertensive wild-type mice. Therefore, in the absence of alpha-calcitonin gene-related peptide, deoxycorticosterone-salt hypertension induces enhanced oxidative stress, inflammation, and renal histopathologic damage, resulting in reduced renal function. Thus, sensory nerves, via alpha-calcitonin gene-related peptide, appear to be renoprotective against hypertension-induced damage.

  7. The role of calcitonin gene-related peptide in peripheral and central pain mechanisms including migraine.

    PubMed

    Iyengar, Smriti; Ossipov, Michael H; Johnson, Kirk W

    2017-04-01

    Calcitonin gene-related peptide (CGRP) is a 37-amino acid peptide found primarily in the C and Aδ sensory fibers arising from the dorsal root and trigeminal ganglia, as well as the central nervous system. Calcitonin gene-related peptide was found to play important roles in cardiovascular, digestive, and sensory functions. Although the vasodilatory properties of CGRP are well documented, its somatosensory function regarding modulation of neuronal sensitization and of enhanced pain has received considerable attention recently. Growing evidence indicates that CGRP plays a key role in the development of peripheral sensitization and the associated enhanced pain. Calcitonin gene-related peptide is implicated in the development of neurogenic inflammation and it is upregulated in conditions of inflammatory and neuropathic pain. It is most likely that CGRP facilitates nociceptive transmission and contributes to the development and maintenance of a sensitized, hyperresponsive state not only of the primary afferent sensory neurons but also of the second-order pain transmission neurons within the central nervous system, thus contributing to central sensitization as well. The maintenance of a sensitized neuronal condition is believed to be an important factor underlying migraine. Recent successful clinical studies have shown that blocking the function of CGRP can alleviate migraine. However, the mechanisms through which CGRP may contribute to migraine are still not fully understood. We reviewed the role of CGRP in primary afferents, the dorsal root ganglion, and in the trigeminal system as well as its role in peripheral and central sensitization and its potential contribution to pain processing and to migraine.

  8. Calcitonin gene-related peptide induced migraine attacks in patients with and without familial aggregation of migraine.

    PubMed

    Guo, Song; Christensen, Anne Francke; Liu, Marie Louise; Janjooa, Benjamin Naveed; Olesen, Jes; Ashina, Messoud

    2017-02-01

    Background Calcitonin gene-related peptide provokes migraine attacks in 65% of patients with migraine without aura. Whether aggregation of migraine in first-degree relatives (family load) or a high number of risk-conferring single nucleotide polymorphisms contributes to migraine susceptibility to calcitonin gene-related peptide infusion in migraine patients is unknown. We hypothesized that genetic enrichment plays a role in triggering of migraine and, therefore, migraine without aura patients with high family load would report more migraine attacks after calcitonin gene-related peptide infusion than patients with low family load. Methods We allocated 40 previously genotyped migraine without aura patients to receive intravenous infusion of 1.5 µg/min calcitonin gene-related peptide and recorded migraine attacks including headache characteristics and associated symptoms. Information of familial aggregation was obtained by telephone interview of first-degree relatives using a validated semi-structured questionnaire. Results Calcitonin gene-related peptide infusion induced a migraine-like attack in 75% (12 out of 16) of patients with high family load compared to 52% (12 out of 23) with low family load ( P = 0.150). In addition, we found that the migraine response after calcitonin gene-related peptide was not associated with specific or a high number of risk-conferring single nucleotide polymorphisms of migraine without aura. Conclusion We found no statistical association between familial aggregation of migraine and hypersensitivity to calcitonin gene-related peptide infusion in migraine without aura patients. We also demonstrated that the currently known single nucleotide polymorphisms conferring risk of migraine without aura have no additive effect on calcitonin gene-related peptide induced migraine-like attacks.

  9. Calcitonin gene-related peptide targeted immunotherapy for migraine: progress and challenges in treating headache.

    PubMed

    Peroutka, Stephen J

    2014-06-01

    A role for calcitonin gene-related peptide (CGRP) in the pathophysiology of migraine has been established over the past 25 years. There have now been at least five different small-molecule CGRP antagonists that have demonstrated statistical proof of efficacy in the acute treatment of migraine. At present, multiple clinical trials are underway that are assessing the ability of long-acting antibodies against CGRP to prevent frequent migraine attacks. This review summarizes the existing data concerning the role of CGRP in migraine and attempts to highlight some possible outcomes from the ongoing anti-CGRP antibody trials.

  10. Heat hyperalgesia and mechanical hypersensitivity induced by calcitonin gene-related peptide in a mouse model of neurofibromatosis.

    PubMed

    White, Stephanie; Marquez de Prado, Blanca; Russo, Andrew F; Hammond, Donna L

    2014-01-01

    This study examined whether mice with a deficiency of neurofibromin, a Ras GTPase activating protein, exhibit a nociceptive phenotype and probed a possible contribution by calcitonin gene-related peptide. In the absence of inflammation, Nf1+/- mice (B6.129S6 Nf1/J) and wild type littermates responded comparably to heat or mechanical stimuli, except for a subtle enhanced mechanical sensitivity in female Nf1+/- mice. Nociceptive phenotype was also examined after inflammation induced by capsaicin and formalin, which release endogenous calcitonin gene-related peptide. Intraplantar injection of capsaicin evoked comparable heat hyperalgesia and mechanical hypersensitivity in Nf1+/- and wild type mice of both genders. Formalin injection caused a similar duration of licking in male Nf1+/- and wild type mice. Female Nf1+/- mice licked less than wild type mice, but displayed other nociceptive behaviors. In contrast, intraplantar injection of CGRP caused greater heat hyperalgesia in Nf1+/- mice of both genders compared to wild type mice. Male Nf1+/- mice also exhibited greater mechanical hypersensitivity; however, female Nf1+/- mice exhibited less mechanical hypersensitivity than their wild type littermates. Transcripts for calcitonin gene-related peptide were similar in the dorsal root ganglia of both genotypes and genders. Transcripts for receptor activity-modifying protein-1, which is rate-limiting for the calcitonin gene-related peptide receptor, in the spinal cord were comparable for both genotypes and genders. The increased responsiveness to intraplantar calcitonin gene-related peptide suggests that the peripheral actions of calcitonin gene-related peptide are enhanced as a result of the neurofibromin deficit. The analgesic efficacy of calcitonin gene-related peptide receptor antagonists may therefore merit investigation in neurofibromatosis patients.

  11. [Calcitonin gene-related peptide: a key player neuropeptide in migraine].

    PubMed

    Ramos-Romero, M L; Sobrino-Mejia, F E

    2016-11-16

    Calcitonin gene-related peptide (CGRP) is a multifunctional neuropeptide produced as a consequence of alternative RNA processing of the calcitonin gene. CGRP is widely distributed in the nervous system, particularly at anatomical areas thought to be involved with migraine pathophysiology, including the trigeminovascular nociceptive system. Over the past two decades, a convergence of basic and clinical evidence has established the CGRP as a key player in migraine. CGRP enhances sensitivity to sensory input at multiple levels in both the periphery and central nervous system. Within the brain, the wide distribution of CGRP and CGRP receptors provides numerous possible targets for CGRP to act as a neuromodulator. Now, CGRP has emerged as a promising therapeutic target for a number of novel treatments for migraine. This review discusses the evidence behind the role of CGRP in migraine and the state of CGRP-based mechanism treatment development.

  12. Spatiotemporal Changes of Calcitonin Gene-Related Peptide Innervation in Spinal Fusion

    PubMed Central

    Zhou, Xiao-Yi; Xu, Xi-Ming; Wu, Sui-Yi; Wang, Fei; Yang, Yi-Lin; Li, Ming

    2016-01-01

    Few studies have investigated the role calcitonin gene-related peptide (CGRP) plays in the process of spinal fusion. The aim of the present study is to observe the temporal and spatial changes of CGRP induced by experimental fusion surgery in rats and elucidate the role of CGRP in spinal fusion. Male Sprague-Dawley rats were used in the study and the specimens were collected on the 7th, 14th, 21st, and 28th day, respectively. Then, histological and immunohistochemical analysis were applied to evaluate the fusion mass and spatiotemporal changes of CGRP chronologically. The results demonstrated that density of CGRP reached peak on the 21st day after surgery and most of the CGRP expression located surrounding the interface of allograft and fibrous tissue where the cells differentiate into osteoblasts, indicating that CGRP might be involved in the process of bone formation and absorption. PMID:27990431

  13. Calcitonin gene-related peptide (CGRP): a molecular link between obesity and migraine?

    PubMed Central

    Recober, Ana; Goadsby, Peter J

    2010-01-01

    Epidemiological studies have begun to suggest obesity is a risk factor for chronic migraine, although no causal relationship has been established, and risk factors for progression from episodic to chronic migraine remain unknown. The neuropeptide calcitonin gene-related peptide (CGRP) plays a important role in the pathophysiology of migraine. Here the potential role of CGRP as a molecular link between obesity and migraine is reviewed. A mechanistic association is supported by several lines of evidence: a) common markers are elevated in obesity and migraine, b) adipose tissue secretes pro-inflammatory cytokines and adipocytokines that have been implicated in migraine pathophysiology and c) elevated plasma levels of CGRP have been found in obese individuals. We propose that CGRP released from trigeminal neurons may represent a biological link between obesity and migraine. Enhanced trigeminal CGRP production in obese susceptible individuals may lower the threshold necessary to trigger migraine attacks, leading to more frequent episodes and eventually to chronic migraine. PMID:20369076

  14. Inhibition of calcitonin gene-related peptide function: a promising strategy for treating migraine.

    PubMed

    Durham, Paul L

    2008-09-01

    The neuropeptide calcitonin gene-related peptide (CGRP) is implicated in the underlying pathology of migraine. Serum levels of CGRP, which are elevated during a migraine attack, have been reported to return to normal with alleviation of pain. In addition, CGRP administration has been shown to cause a migraine-like headache in susceptible individuals. Importantly, CGRP receptors are found on many cell types within the trigeminovascular system that are thought to play important roles in controlling inflammatory and nociceptive processes. Based on these findings, it was proposed that blockage of CGRP receptor function and, hence, the physiological effects of CGRP would be effective in aborting a migraine attack. This review will summarize key preclinical data that support the therapeutic potential of using CGRP receptor antagonists or molecules that bind CGRP within the context of current neurovascular theories on migraine pathology.

  15. Calcitonin gene-related peptide (CGRP) stimulates purkinje cell dendrite growth in culture.

    PubMed

    D'Antoni, Simona; Zambusi, Laura; Codazzi, Franca; Zacchetti, Daniele; Grohovaz, Fabio; Provini, Luciano; Catania, Maria Vincenza; Morara, Stefano

    2010-12-01

    Previous reports described the transient expression during development of Calcitonin Gene-Related Peptide (CGRP) in rodent cerebellar climbing fibers and CGRP receptor in astrocytes. Here, mixed cerebellar cultures were used to analyze the effects of CGRP on Purkinje cells growth. Our results show that CGRP stimulated Purkinje cell dendrite growth under cell culture conditions mimicking Purkinje cell development in vivo. The stimulation was not blocked by CGRP8-37, a specific antagonist, suggesting the activation of other related receptors. CGRP did not affect survival of Purkinje cells, granule cells or astrocytes. The selective expression of Receptor Component Protein (RCP) (a component of CGRP receptor family) in astrocytes points to a role of these cells as mediators of CGRP effect. Finally, in pure cerebellar astrocyte cultures CGRP induced a transient morphological differentiation from flat, polygonal to stellate form. It is concluded that CGRP influences Purkinje cell dendrite growth in vitro, most likely through the involvement of astrocytes.

  16. Adrenomedullin and calcitonin gene-related peptide receptors in endocrine-related cancers: opportunities and challenges.

    PubMed

    Hay, Debbie L; Walker, Christopher S; Poyner, David R

    2011-02-01

    Adrenomedullin (AM), adrenomedullin 2 (AM2/intermedin) and calcitonin gene-related peptide (CGRP) are members of the calcitonin family of peptides. They can act as growth or survival factors for a number of tumours, including those that are endocrine-related. One mechanism through which this occurs is stimulating angiogenesis and lymphangiogenesis. AM is expressed by numerous tumour types and for some cancers, plasma AM levels can be correlated with the severity of the disease. In cancer models, lowering AM content or blocking AM receptors can reduce tumour mass. AM receptors are complexes formed between a seven transmembrane protein, calcitonin receptor-like receptor and one of the two accessory proteins, receptor activity-modifying proteins (RAMPs) 2 or 3 to give the AM1 and AM2 receptors respectively. AM also has affinity at the CGRP receptor, which uses RAMP1. Unfortunately, due to a lack of selective pharmacological tools or antibodies to distinguish AM and CGRP receptors, the precise receptors and signal transduction pathways used by the peptides are often uncertain. Two other membrane proteins, RDC1 and L1/G10D (the 'ADMR'), are not currently considered to be genuine CGRP or AM receptors. In order to properly evaluate whether AM or CGRP receptor inhibition has a role in cancer therapy, it is important to identify which receptors mediate the effects of these peptides. To effectively distinguish AM1 and AM2 receptors, selective receptor antagonists need to be developed. The development of specific CGRP receptor antagonists suggests that this is now feasible.

  17. Peripheral amplification of sweating – a role for calcitonin gene-related peptide

    PubMed Central

    Schlereth, Tanja; Dittmar, Jan Oliver; Seewald, Bianca; Birklein, Frank

    2006-01-01

    Neuropeptides are the mediators of neurogenic inflammation. Some pain disorders, e.g. complex regional pain syndromes, are characterized by increased neurogenic inflammation and by exaggerated sudomotor function. The aim of this study was to explore whether neuropeptides have a peripheral effect on human sweating. We investigated the effects of different concentrations of calcitonin gene-related peptide (CGRP), vasoactive intestinal peptide (VIP) and substance P (SP) on acetylcholine-induced axon reflex sweating in healthy subjects (total n = 18). All substances were applied via dermal microdialysis. The experiments were done in a parallel setting: ACh alone and ACh combined with CGRP, VIP or SP in various concentrations were applied. Acetylcholine (10−2m) always elicited a sweating response, neuropeptides alone did not. However, CGRP significantly enhanced ACh-induced sweating (P < 0.01). Post hoc tests revealed that CGRP in physiological concentrations of 10−7–10−9m was most effective. VIP at any concentration had no significant effect on axon reflex sweating. The duration of the sweating response (P < 0.01), but not the amount of sweat, was reduced by SP. ACh-induced skin blood flow was significantly increased by CGRP (P < 0.01), but unaltered by VIP and SP. The results indicate that CGRP amplifies axon reflex sweating in human skin. PMID:16931551

  18. Calcitonin gene-related peptide inhibits local acute inflammation and protects mice against lethal endotoxemia.

    PubMed

    Gomes, Rachel Novaes; Castro-Faria-Neto, Hugo C; Bozza, Patricia T; Soares, Milena B P; Shoemaker, Charles B; David, John R; Bozza, Marcelo T

    2005-12-01

    Calcitonin gene-related peptide (CGRP), a potent vasodilatory peptide present in central and peripheral neurons, is released at inflammatory sites and inhibits several macrophage, dendritic cell, and lymphocyte functions. In the present study, we investigated the role of CGRP in models of local and systemic acute inflammation and on macrophage activation induced by lipopolysaccharide (LPS). Intraperitoneal pretreatment with synthetic CGRP reduces in approximately 50% the number of neutrophils in the blood and into the peritoneal cavity 4 h after LPS injection. CGRP failed to inhibit neutrophil recruitment induced by the direct chemoattractant platelet-activating factor, whereas it significantly inhibited LPS-induced KC generation, suggesting that the effect of CGRP on neutrophil recruitment is indirect, acting on chemokine production by resident cells. Pretreatment of mice with 1 mug of CGRP protects against a lethal dose of LPS. The CGRP-induced protection is receptor mediated because it is completely reverted by the CGRP receptor antagonist, CGRP 8-37. The protective effect of CGRP correlates with an inhibition of TNF-alpha and an induction of IL-6 and IL-10 in mice sera 90 min after LPS challenge. Finally, CGRP significantly inhibits LPS-induced TNF-alpha released from mouse peritoneal macrophages. These results suggest that activation of the CGRP receptor on macrophages during acute inflammation could be part of the negative feedback mechanism controlling the extension of acute inflammatory responses.

  19. Peripheral amplification of sweating--a role for calcitonin gene-related peptide.

    PubMed

    Schlereth, Tanja; Dittmar, Jan Oliver; Seewald, Bianca; Birklein, Frank

    2006-11-01

    Neuropeptides are the mediators of neurogenic inflammation. Some pain disorders, e.g. complex regional pain syndromes, are characterized by increased neurogenic inflammation and by exaggerated sudomotor function. The aim of this study was to explore whether neuropeptides have a peripheral effect on human sweating. We investigated the effects of different concentrations of calcitonin gene-related peptide (CGRP), vasoactive intestinal peptide (VIP) and substance P (SP) on acetylcholine-induced axon reflex sweating in healthy subjects (total n = 18). All substances were applied via dermal microdialysis. The experiments were done in a parallel setting: ACh alone and ACh combined with CGRP, VIP or SP in various concentrations were applied. Acetylcholine (10(-2) m) always elicited a sweating response, neuropeptides alone did not. However, CGRP significantly enhanced ACh-induced sweating (P < 0.01). Post hoc tests revealed that CGRP in physiological concentrations of 10(-7)-10(-9) m was most effective. VIP at any concentration had no significant effect on axon reflex sweating. The duration of the sweating response (P < 0.01), but not the amount of sweat, was reduced by SP. ACh-induced skin blood flow was significantly increased by CGRP (P < 0.01), but unaltered by VIP and SP. The results indicate that CGRP amplifies axon reflex sweating in human skin.

  20. Calcitonin gene-related peptide in migraine: intersection of peripheral inflammation and central modulation

    PubMed Central

    Raddant, Ann C.; Russo, Andrew F.

    2012-01-01

    Over the past two decades, a convergence of basic and clinical evidence has established the neuropeptide calcitonin-gene-related peptide (CGRP) as a key player in migraine. Although CGRP is a recognised neuromodulator of nociception, its mechanism of action in migraine remains elusive. In this review, we present evidence that led us to propose that CGRP is well poised to enhance neurotransmission in migraine by both peripheral and central mechanisms. In the periphery, it is thought that local release of CGRP from the nerve endings of meningeal nociceptors following their initial activation by cortical spreading depression is critical for the induction of vasodilation, plasma protein extravasation, neurogenic inflammation and the consequential sensitisation of meningeal nociceptors. Mechanistically, we propose that CGRP release can give rise to a positive-feedback loop involved in localised increased synthesis and release of CGRP from neurons and a CGRP-like peptide called procalcitonin from trigeminal ganglion glia. Within the brain, the wide distribution of CGRP and CGRP receptors provides numerous possible targets for CGRP to act as a neuromodulator. PMID:22123247

  1. Superior Cervical Ganglia Neurons Induce Foxp3+ Regulatory T Cells via Calcitonin Gene-Related Peptide.

    PubMed

    Szklany, Kirsten; Ruiter, Evelyn; Mian, Firoz; Kunze, Wolfgang; Bienenstock, John; Forsythe, Paul; Karimi, Khalil

    2016-01-01

    The nervous and immune systems communicate bidirectionally, utilizing diverse molecular signals including cytokines and neurotransmitters to provide an integrated response to changes in the body's internal and external environment. Although, neuro-immune interactions are becoming better understood under inflammatory circumstances and it has been evidenced that interaction between neurons and T cells results in the conversion of encephalitogenic T cells to T regulatory cells, relatively little is known about the communication between neurons and naïve T cells. Here, we demonstrate that following co-culture of naïve CD4+ T cells with superior cervical ganglion neurons, the percentage of Foxp3 expressing CD4+CD25+ cells significantly increased. This was mediated in part by immune-regulatory cytokines TGF-β and IL-10, as well as the neuropeptide calcitonin gene-related peptide while vasoactive intestinal peptide was shown to play no role in generation of T regulatory cells. Additionally, T cells co-cultured with neurons showed a decrease in the levels of pro-inflammatory cytokine IFN-γ released upon in vitro stimulation. These findings suggest that the generation of Tregs may be promoted by naïve CD4+ T cell: neuron interaction through the release of neuropeptide CGRP.

  2. Involvement of calcitonin gene-related peptide and receptor component protein in experimental autoimmune encephalomyelitis

    PubMed Central

    Sardi, Claudia; Zambusi, Laura; Finardi, Annamaria; Ruffini, Francesca; Tolun, Adviye A.; Dickerson, Ian M.; Righi, Marco; Zacchetti, Daniele; Grohovaz, Fabio; Provini, Luciano; Furlan, Roberto; Morara, Stefano

    2015-01-01

    Calcitonin Gene-Related Peptide (CGRP) inhibits microglia inflammatory activation in vitro. We here analyzed the involvement of CGRP and Receptor Component Protein (RCP) in experimental autoimmune encephalomyelitis (EAE). Alpha-CGRP deficiency increased EAE scores which followed the scale alpha-CGRP null > heterozygote > wild type. In wild type mice, CGRP delivery into the cerebrospinal fluid (CSF) 1) reduced chronic EAE (C-EAE) signs, 2) inhibited microglia activation (revealed by quantitative shape analysis), and 3) did not alter GFAP expression, cell density, lymphocyte infiltration, and peripheral lymphocyte production of IFN-gamma, TNF-alpha, IL-17, IL-2, and IL-4. RCP (probe for receptor involvement) was expressed in white matter microglia, astrocytes, oligodendrocytes, and vascular-endothelial cells: in EAE, also in infiltrating lymphocytes. In relapsing–remitting EAE (R-EAE) RCP increased during relapse, without correlation with lymphocyte density. RCP nuclear localization (stimulated by CGRP in vitro) was I) increased in microglia and decreased in astrocytes (R-EAE), and II) increased in microglia by CGRP CSF delivery (C-EAE). Calcitonin like receptor was rarely localized in nuclei of control and relapse mice. CGRP increased in motoneurons. In conclusion, CGRP can inhibit microglia activation in vivo in EAE. CGRP and its receptor may represent novel protective factors in EAE, apparently acting through the differential cell-specific intracellular translocationof RCP. PMID:24746422

  3. Calcitonin gene-related peptide (CGRP) in autonomic cardiovascular regulation and vascular structure.

    PubMed

    Mai, Tu H; Wu, Jing; Diedrich, André; Garland, Emily M; Robertson, David

    2014-05-01

    Calcitonin gene-related peptide (CGRP) is reported to play important roles in cardiovascular regulation in human and animal models. In spite of this, its role remains controversial. We aim to clarify this by studying the autonomic cardiovascular function and vascular structure in CGRP knockout (CGRP(-/-)) mice. Blood pressure (BP) and heart rate (HR) were assessed by telemeters. Urine (24-hour) and blood were collected for catecholamines measurements. Baroreflex sensitivity was assessed using phenylephrine and sodium nitroprusside administered in an acute study. Daytime mean arterial pressure (MAP; 12-hour period) was significantly higher in the CGRP(-/-) mice than in the wild type (WT) mice (114.5 vs. 104.5 mm Hg; P = .04). Norepinephrine was elevated in plasma and 24-hour urine in the knockouts (Urine, 956 vs. 618 pg/mL; P = .004; Plasma, 2505 vs. 1168 pg/mL; P = .04). Paradoxically, cardiovagal baroreflex sensitivity was higher in CGRP(-/-) mice (3.2 vs. 1.4 ms/mm Hg; P = .03). To increase insight, we studied aortic stiffness in CGRP(-/-) mice and found it increased compared with age-matched WT mice, as evidenced by the depression of the compliance curve (P < .05). CGRP(-/-) mice have higher BP due to elevated sympathetic signals and abnormalities in blood vessel structure. Moreover, our data also showed that CGRP plays an important role in the regulation of the cardio-vagal tone.

  4. Calcitonin gene-related peptide receptor expression in alternatively activated monocytes/macrophages during irreversible pulpitis.

    PubMed

    Caviedes-Bucheli, Javier; Moreno, Gloria Cristina; López, María Paula; Bermeo-Noguera, Ana Milena; Pacheco-Rodríguez, Gloriana; Cuellar, Adriana; Muñoz, Hugo Roberto

    2008-08-01

    The purpose of this study was to quantify the percentage and the mean fluorescence intensity of viable alternatively activated monocytes/macrophages (AAMø) CD163+ positive for calcitonin gene-related peptide receptor (CGRPr) within the total AAMø population in human dental pulp. Pulp tissue samples were collected from teeth with a clinical diagnosis of irreversible pulpitis (n = 13), pulps with induced inflammation (n = 13), and normal pulps (n = 13). All samples were labeled to identify positive cells for CGRPr and CD163 using a flow cytometry assay. Results demonstrated that a high percentage of total viable AAMø CD163+ expressed CGRPr on their membranes (72.12% in healthy pulp, 62.20% in irreversible pulpitis, and 58.01% in induced pulpitis). Significant differences were found between mean AAMø CD163+ fluorescence for CGRPr according to pulp condition, being greater in irreversible pulpitis. It can be concluded that AAMø CD163+ are expressed during normal and inflammatory processes, supporting the hypothesis that they could exercise an anti-inflammatory action that could be controlled by CGRP signaling after its binding.

  5. Anti-insulin effects of amylin and calcitonin-gene-related peptide on hepatic glycogen metabolism.

    PubMed Central

    Gómez-Foix, A M; Rodriguez-Gil, J E; Guinovart, J J

    1991-01-01

    To evaluate the effects of amylin and calcitonin-gene-related peptide (CGRP) as anti-insulin agents in hepatic tissue, we have studied whether these two agents counteracted the action of insulin on glycogen metabolism in isolated rat hepatocytes. In this system insulin stimulates [14C]glucose incorporation into glycogen and activates glycogen synthase. Incubation of the cells with insulin in the presence of amylin or CGRP markedly blocked the insulin stimulation of these two parameters, whereas amylin or CGRP acting alone did not induce any effect. We also examined the ability of amylin and CGRP to modify the anti-glucagon effects of insulin. In the presence of 100 nM-amylin or -CGRP, 10 nM-insulin was almost unable to counteract the inactivation of glycogen synthase and the activation of phosphorylase induced by glucagon. In contrast, neither amylin nor CGRP modified the effect of glucagon on these two enzymes. Our results indicate that amylin and CGRP are able to impair the action of insulin on hepatic glycogen metabolism. PMID:1905922

  6. Substance P and Calcitonin Gene-Related Peptide: Key Regulators of Cutaneous Microbiota Homeostasis

    PubMed Central

    N’Diaye, Awa; Gannesen, Andrei; Borrel, Valérie; Maillot, Olivier; Enault, Jeremy; Racine, Pierre-Jean; Plakunov, Vladimir; Chevalier, Sylvie; Lesouhaitier, Olivier; Feuilloley, Marc G. J.

    2017-01-01

    Neurohormones diffuse in sweat and epidermis leading skin bacterial microflora to be largely exposed to these host factors. Bacteria can sense a multitude of neurohormones, but their role in skin homeostasis was only investigated recently. The first study focused on substance P (SP), a neuropeptide produced in abundance by skin nerve terminals. SP is without effect on the growth of Gram-positive (Bacillus cereus, Staphylococcus aureus, and Staphylococcus epidermidis) and Gram-negative (Pseudomonas fluorescens) bacteria. However, SP is stimulating the virulence of Bacillus and Staphylococci. The action of SP is highly specific with a threshold below the nanomolar level. Mechanisms involved in the response to SP are different between bacteria although they are all leading to increased adhesion and/or virulence. The moonlighting protein EfTu was identified as the SP-binding site in B. cereus and Staphylococci. In skin nerve terminals, SP is co-secreted with the calcitonin gene-related peptide (CGRP), which was shown to modulate the virulence of S. epidermidis. This effect is antagonized by SP. Identification of the CGRP sensor, DnaK, allowed understanding this phenomenon as EfTu and DnaK are apparently exported from the bacterium through a common system before acting as SP and CGRP sensors. Many other neuropeptides are expressed in skin, and their potential effects on skin bacteria remain to be investigated. Integration of these host signals by the cutaneous microbiota now appears as a key parameter in skin homeostasis. PMID:28194136

  7. Acupuncture as Treatment of Hot Flashes and the Possible Role of Calcitonin Gene-Related Peptide

    PubMed Central

    Spetz Holm, Anna-Clara E.; Frisk, Jessica; Hammar, Mats L.

    2012-01-01

    The mechanisms behind hot flashes in menopausal women are not fully understood. The flashes in women are probably preceded by and actually initiated by a sudden downward shift in the set point for the core body temperature in the thermoregulatory center that is affected by sex steroids, β-endorphins, and other central neurotransmitters. Treatments that influence these factors may be expected to reduce hot flashes. Since therapy with sex steroids for hot flashes has appeared to cause a number of side effects and risks and women with hot flashes and breast cancer as well as men with prostate cancer and hot flashes are prevented from sex steroid therapy there is a great need for alternative therapies. Acupuncture affecting the opioid system has been suggested as an alternative treatment option for hot flashes in menopausal women and castrated men. The heat loss during hot flashes may be mediated by the potent vasodilator and sweat gland activator calcitonin gene-related peptide (CGRP) the concentration of which increases in plasma during flashes in menopausal women and, according to one study, in castrated men with flushes. There is also evidence for connections between the opioid system and the release of CGRP. In this paper we discuss acupuncture as a treatment alternative for hot flashes and the role of CGRP in this context. PMID:22110545

  8. Calcitonin gene-related peptide pre-administration acts as a novel antidepressant in stressed mice.

    PubMed

    Hashikawa-Hobara, Narumi; Ogawa, Takumi; Sakamoto, Yusuke; Matsuo, Yumi; Ogawa, Mami; Zamami, Yoshito; Hashikawa, Naoya

    2015-08-07

    Calcitonin gene-related peptide (CGRP) is a neuropeptide that has potent vasodilator properties and is involved in various behavioral disorders. The relationship between CGRP and depression-like behavior is unclear. In this study, we used chronically stressed mice to investigate whether CGRP is involved in depression-like behavior. Each mouse was exposed to restraint and water immersion stress for 15 days. After stress exposure, mice were assessed using behavioral tests: open field test, forced swim test and sucrose preference test. Serum corticosterone levels, hippocampal proliferation and mRNA expression of neurotrophins were measured. After stress exposure, mice exhibited depression-like behavior and decreased CGRP mRNA levels in the hippocampus. Although intracerebroventricular CGRP administration (0.5 nmol) did not alter depression-like behavior after 15-day stress exposure, a single CGRP administration into the brain, before the beginning of the 15-day stress exposure, normalized the behavioral dysfunctions and increased nerve growth factor (Ngf) mRNA levels in stressed mice. Furthermore, in the mouse E14 hippocampal cell line, CGRP treatment induced increased expression of Ngf mRNA. The NGF receptor inhibitor K252a inhibited CGRP's antidepressant-like effects in stressed mice. These results suggest that CGRP expression in the mouse hippocampus is associated with depression-like behavior and changes in Ngf mRNA levels.

  9. Calcitonin gene-related peptide in the joint: contributions to pain and inflammation.

    PubMed

    Walsh, David A; Mapp, Paul I; Kelly, Sara

    2015-11-01

    Arthritis is the commonest cause of disabling chronic pain, and both osteoarthritis (OA) and rheumatoid arthritis (RA) remain major burdens on both individuals and society. Peripheral release of calcitonin gene-related peptide (CGRP) contributes to the vasodilation of acute neurogenic inflammation. Contributions of CGRP to the pain and inflammation of chronic arthritis, however, are only recently being elucidated. Animal models of arthritis are revealing the molecular and pathophysiological events that accompany and lead to progression of both arthritis and pain. Peripheral actions of CGRP in the joint might contribute to both inflammation and joint afferent sensitization. CGRP and its specific receptors are expressed in joint afferents and up-regulated following arthritis induction. Peripheral CGRP release results in activation of synovial vascular cells, through which acute vasodilatation is followed by endothelial cell proliferation and angiogenesis, key features of chronic inflammation. Local administration of CGRP to the knee also increases mechanosensitivity of joint afferents, mimicking peripheral sensitization seen in arthritic joints. Increased mechanosensitivity in OA knees and pain behaviour can be reduced by peripherally acting CGRP receptor antagonists. Effects of CGRP pathway blockade on arthritic joint afferents, but not in normal joints, suggest contributions to sensitization rather than normal joint nociception. CGRP therefore might make key contributions to the transition from normal to persistent synovitis, and the progression from nociception to sensitization. Targeting CGRP or its receptors within joint tissues to prevent these undesirable transitions during early arthritis, or suppress them in established disease, might prevent persistent inflammation and relieve arthritis pain.

  10. Modulation of voltage-activated channels by calcitonin gene-related peptide in cultured rat neurones.

    PubMed Central

    Zona, C; Farini, D; Palma, E; Eusebi, F

    1991-01-01

    1. Whole-cell currents were recorded from cultures of dissociated neocortical neurones of the rat. Rat alpha-calcitonin gene-related peptide (CGRP; 1 nM-1 microM) caused significant dose-dependent decreases in the voltage-activated transient (A-current) and delayed rectifier K+ currents. Forskolin (10 nM-20 microM) mimicked this effect. Peak K+ currents were gradually decreased after loading neurones with cyclic AMP (100 microM) through patch pipettes. CGRP was ineffective in neurones loaded with cyclic AMP. 2. CGRP (0.5-2 microM) increased cytosolic cyclic AMP concentration and this effect was mimicked by forskolin (5-40 microM). 3. CGRP (0.1-1 microM) reduced high-threshold Ca2+ currents; as did forskolin (5-20 microM) and cyclic AMP loaded into the neurones. In contrast, low-threshold Ca2+ currents were not affected by any of these agents. 4. Voltage-activated Na+ currents were significantly reduced by both CGRP (0.1-1 microM) and forskolin (5-20 microM). A similar effect was observed when cells were loaded with cyclic AMP. 5. We conclude that, in neocortical neurones, CGRP attenuates voltage-activated currents by stimulating the intracellular cyclic AMP signalling system. PMID:1726796

  11. Acupuncture as treatment of hot flashes and the possible role of calcitonin gene-related Peptide.

    PubMed

    Spetz Holm, Anna-Clara E; Frisk, Jessica; Hammar, Mats L

    2012-01-01

    The mechanisms behind hot flashes in menopausal women are not fully understood. The flashes in women are probably preceded by and actually initiated by a sudden downward shift in the set point for the core body temperature in the thermoregulatory center that is affected by sex steroids, β-endorphins, and other central neurotransmitters. Treatments that influence these factors may be expected to reduce hot flashes. Since therapy with sex steroids for hot flashes has appeared to cause a number of side effects and risks and women with hot flashes and breast cancer as well as men with prostate cancer and hot flashes are prevented from sex steroid therapy there is a great need for alternative therapies. Acupuncture affecting the opioid system has been suggested as an alternative treatment option for hot flashes in menopausal women and castrated men. The heat loss during hot flashes may be mediated by the potent vasodilator and sweat gland activator calcitonin gene-related peptide (CGRP) the concentration of which increases in plasma during flashes in menopausal women and, according to one study, in castrated men with flushes. There is also evidence for connections between the opioid system and the release of CGRP. In this paper we discuss acupuncture as a treatment alternative for hot flashes and the role of CGRP in this context.

  12. Critical role of calcitonin gene-related peptide receptors in cortical spreading depression

    PubMed Central

    Tozzi, Alessandro; de Iure, Antonio; Di Filippo, Massimiliano; Costa, Cinzia; Caproni, Stefano; Pisani, Antonio; Bonsi, Paola; Picconi, Barbara; Cupini, Letizia M.; Materazzi, Serena; Geppetti, Pierangelo; Sarchielli, Paola; Calabresi, Paolo

    2012-01-01

    Cortical spreading depression (CSD) is a key pathogenetic step in migraine with aura. Dysfunctions of voltage-dependent and receptor-operated channels have been implicated in the generation of CSD and in the pathophysiology of migraine. Although a known correlation exists between migraine and release of the calcitonin gene-related peptide (CGRP), the possibility that CGRP is involved in CSD has not been examined in detail. We analyzed the pharmacological mechanisms underlying CSD and investigated the possibility that endogenous CGRP contributes to this phenomenon. CSD was analyzed in rat neocortical slices by imaging of the intrinsic optical signal. CSD was measured as the percentage of the maximal surface of a cortical slice covered by the propagation of intrinsic optical signal changes during an induction episode. Reproducible CSD episodes were induced through repetitive elevations of extracellular potassium concentration. AMPA glutamate receptor antagonism did not inhibit CSD, whereas NMDA receptor antagonism did inhibit CSD. Blockade of voltage-dependent sodium channels by TTX also reduced CSD. CSD was also decreased by the antiepileptic drug topiramate, but not by carbamazepine. Interestingly, endogenous CGRP was released in the cortical tissue in a calcium-dependent manner during CSD, and three different CGRP receptor antagonists had a dose-dependent inhibitory effect on CSD, suggesting a critical role of CGRP in this phenomenon. Our findings show that both glutamate NMDA receptors and voltage-dependent sodium channels play roles in CSD. They also demonstrate that CGRP antagonism reduces CSD, supporting the possible use of drugs targeting central CGRP receptors as antimigraine agents. PMID:23112192

  13. The modulation of inflammatory oedema by calcitonin gene-related peptide.

    PubMed Central

    Newbold, P.; Brain, S. D.

    1993-01-01

    1. The effect of calcitonin gene-related peptide (CGRP) when given with or as a pretreatment to oedema inducing agents was investigated in the skin and paws of male Wistar and Sprague Dawley rats. 2. Oedema formation at intradermally-injected sites in the skin was measured by a 125I-labelled human serum albumin accumulation technique and paw oedema was measured by a weight displacement technique. 3. CGRP (30 pmol) when given with, or as a 20 min pretreatment, markedly potentiated oedema formation induced by substance P (100 pmol) in rat skin. In comparison, CGRP had little effect on 5-hydroxytryptamine (5-HT, 0.1-3 nmol)-induced oedema when given as a co-injection but significantly potentiated 5-HT-induced oedema when given as a 20 min pretreatment in the skin. Similar results were obtained in both Wistar and Sprague Dawley rats. 4. Pretreatment with CGRP (30 pmol) had little modulatory effect on oedema induced by substance P (100 pmol) in the presence of the vasodilator prostanoid, prostaglandin E1 (PGE1, 850 pmol) in the skin of Wistar rats. 5. Pretreatment with CGRP (30 pmol) caused a non-significant increase in carrageenin (300 micrograms)-induced oedema in the hind paw of Wistar rats. Capsaicin (100 nmol) given as a pretreatment had little effect on carrageenin-induced oedema. 6. CGRP (30 pmol), given as a pretreatment, had little modulatory effect on 5-HT (3 nmol)-induced oedema in the paw of Wistar rats but a non-significant decrease in paw oedema was observed in Sprague Dawley rats.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7682134

  14. Calcitonin gene-related peptide down-regulates bleomycin-induced pulmonary fibrosis.

    PubMed

    Li, Xian-Wei; Li, Xiao-Hui; Du, Jie; Li, Dai; Li, Yuan-Jian; Hu, Chang-Ping

    2016-12-01

    We have found that eIF3a plays an important role in bleomycin-induced pulmonary fibrosis, and up-regulation of eIF3a induced by TGF-β1 is mediated via the ERK1/2 pathway. Whether ERK1/2 - eIF3a signal pathway is involved in calcitonin gene-related peptide (CGRP)-mediated pathogenesis of bleomycin-induced pulmonary fibrosis remains unknown. Pulmonary fibrosis was induced by intratracheal instillation of bleomycin (5 mg/kg) in rats. Primary pulmonary fibroblasts were cultured to investigate the proliferation by BrdU incorporation method and flow cytometry. Sensory CGRP depletion by capsaicin exacerbated bleomycin-induced pulmonary fibrosis in rats, as shown by a significant disturbed alveolar structure, marked thickening of the interalveolar septa and dense interstitial infiltration by inflammatory cells and fibroblasts, accompanied with increased expression of TGF-β1, eIF3a, phosphorylated ERK1/2, α-SMA, collagen I, and collagen III. Exogenous application of CGRP significantly inhibited TGF-β1-induced proliferation and differentiation of pulmonary fibroblasts concomitantly with decreased expression of eIF3a, phosphorylated ERK1/2, α-SMA, collagen I, and collagen III. These effects of CGRP were abolished in the presence of CGRP8-37. These results suggest that endogenous CGRP is related to the development of pulmonary fibrosis induced by bleomycin, and the inhibitory effect of CGRP on proliferation of lung fibroblasts involves the ERK1/2 - eIF3a signaling pathway.

  15. Role of Calcitonin Gene-Related Peptide in Functional Adaptation of the Skeleton

    PubMed Central

    Sample, Susannah J.; Heaton, Caitlin M.; Behan, Mary; Bleedorn, Jason A.; Racette, Molly A.; Hao, Zhengling; Muir, Peter

    2014-01-01

    Peptidergic sensory nerve fibers innervating bone and periosteum are rich in calcitonin gene-related peptide (CGRP), an osteoanabolic neurotransmitter. There are two CGRP isoforms, CGRPα and CGRPβ. Sensory fibers are a potential means by which the nervous system may detect and respond to loading events within the skeleton. However, the functional role of the nervous system in the response of bone to mechanical loading is unclear. We used the ulna end-loading model to induce an adaptive modeling response in CGRPα and CGRPβ knockout mouse lines and their respective wildtype controls. For each knockout mouse line, groups of mice were treated with cyclic loading or sham-loading of the right ulna. A third group of mice received brachial plexus anesthesia (BPA) of the loaded limb before mechanical loading. Fluorochrome labels were administered at the time of loading and 7 days later. Ten days after loading, bone responses were quantified morphometrically. We hypothesized that CGRP signaling is required for normal mechanosensing and associated load-induced bone formation. We found that mechanically-induced activation of periosteal mineralizing surface in mice and associated blocking with BPA were eliminated by knockout of CGRPα signaling. This effect was not evident in CGRPβ knockout mice. We also found that mineral apposition responses to mechanical loading and associated BPA blocking were retained with CGRPα deletion. We conclude that activation of periosteal mineralizing surfaces in response to mechanical loading of bone is CGRPα-dependent in vivo. This suggests that release of CGRP from sensory peptidergic fibers in periosteum and bone has a functional role in load-induced bone formation. PMID:25536054

  16. Calcitonin gene-related peptide (CGRP) regulates excitability and refractory period of the guinea pig ureter.

    PubMed

    Maggi, C A; Giuliani, S

    1994-08-01

    Previous studies have indicated that calcitonin gene-related peptide (CGRP), released from the peripheral endings of capsaicin-sensitive primary afferent neurons, may play a role as an inhibitory transmitter in the guinea pig ureter. The aim of this study was to compare the effect of capsaicin desensitization and administration of a CGRP receptor antagonist on the excitability and refractory period of the guinea pig ureter to electrical field stimulation. Electrical field stimulation using a long (5 msec.) pulse width produced phasic contractions of the ureter which were unaffected by tetrodotoxin, that is, were produced through direct excitation of ureteral smooth muscle. Human alpha CGRP (1 to 10 nM.) produced a concentration-dependent transient suppression of the evoked contractions, and its effect was prevented by the CGRP receptor antagonist human alpha CGRP(8-37) (1 microM.). In vitro capsaicin pretreatment (10 microM. for 15 minutes) to block neuropeptide release from peripheral endings of sensory nerves or administration of the CGRP receptor antagonist enhanced the responsiveness of the guinea pig ureter to electrical stimulation. In control ureters, the application of two trains of electrical stimuli failed to produce a second contraction at intertrain intervals greater than 20 seconds. The intertrain interval required to obtain a second contraction averaging 50% of the amplitude of the first response (ITI50) of control ureters was about 50 seconds. In vitro capsaicin pretreatment or administration of the CGRP receptor antagonist reduced the refractory period of the ureter to electrical field stimulation: ITI50 averaged 8.8 and 9.1 seconds after capsaicin or CGRP antagonist pretreatment, respectively. These findings demonstrate that capsaicin pretreatment or blockade of CGRP receptors produced qualitatively and quantitatively similar excitatory effects on ureteral excitability and refractory period and are in general agreement with the idea that CGRP is a

  17. Effects of Voluntary Locomotion and Calcitonin Gene-Related Peptide on the Dynamics of Single Dural Vessels in Awake Mice

    PubMed Central

    Gao, Yu-Rong

    2016-01-01

    The dura mater is a vascularized membrane surrounding the brain and is heavily innervated by sensory nerves. Our knowledge of the dural vasculature has been limited to pathological conditions, such as headaches, but little is known about the dural blood flow regulation during behavior. To better understand the dynamics of dural vessels during behavior, we used two-photon laser scanning microscopy (2PLSM) to measure the diameter changes of single dural and pial vessels in the awake mouse during voluntary locomotion. Surprisingly, we found that voluntary locomotion drove the constriction of dural vessels, and the dynamics of these constrictions could be captured with a linear convolution model. Dural vessel constrictions did not mirror the large increases in intracranial pressure (ICP) during locomotion, indicating that dural vessel constriction was not caused passively by compression. To study how behaviorally driven dynamics of dural vessels might be altered in pathological states, we injected the vasodilator calcitonin gene-related peptide (CGRP), which induces headache in humans. CGRP dilated dural, but not pial, vessels and significantly reduced spontaneous locomotion but did not block locomotion-induced constrictions in dural vessels. Sumatriptan, a drug commonly used to treat headaches, blocked the vascular and behavioral the effects of CGRP. These findings suggest that, in the awake animal, the diameters of dural vessels are regulated dynamically during behavior and during drug-induced pathological states. SIGNIFICANT STATEMENT The vasculature of the dura has been implicated in the pathophysiology of headaches, but how individual dural vessels respond during behavior, both under normal conditions and after treatment with the headache-inducing peptide calcitonin gene-related peptide (CGRP), is poorly understood. To address these issues, we imaged individual dural vessels in awake mice and found that dural vessels constricted during voluntary locomotion, and

  18. Local neurogenic regulation of rat hindlimb circulation: CO2-induced release of calcitonin gene-related peptide from sensory nerves

    PubMed Central

    Yamada, Masami; Ishikawa, Tomohisa; Yamanaka, Akihiro; Fujimori, Akira; Goto, Katsutoshi

    1997-01-01

    The mechanism of release of calcitonin gene-related peptide (CGRP) from sensory nerves in response to skeletal muscle contraction was investigated in the rat hindlimb in vivo and in vitro. In the anaesthetized rat, sciatic nerve stimulation at 10 Hz for 1 min caused a hyperaemic response in the hindlimb. During the response, partial pressure of CO2 in the venous blood effluent from the hindlimb significantly increased from 43±3 to 73±8 mmHg, whereas a small decrease in pH and no appreciable change in partial pressure of O2 were observed. An intra-arterial bolus injection of NaHCO3 (titrated to pH 7.2 with HCl), which elevated PCO2 of the venous blood, caused a sustained increase in regional blood flow of the iliac artery. Capsaicin (0.33 μmol kg−1, i.a.) and a specific calcitonin gene-related peptide (CGRP) receptor antagonist, CGRP(8–37), (100 nmol kg−1 min−1, i.v.) significantly suppressed the hyperaemic response to NaHCO3. Neither NDΩ-nitro-L-arginine methyl ester (1 μmol kg−1 min−1, i.v.) nor indomethacin (5 mg kg−1, i.v.) affected the response. The serum level of CGRP-like immunoreactivity in the venous blood was significantly increased by a bolus injection of NaHCO3 (pH=7.2) from 50±4 to 196±16 fmol ml−1. In the isolated hindlimb perfused with Krebs-Ringer solution, a bolus injection of NaHCO3 (pH=7.2) caused a decrease in perfusion pressure which was composed of two responses, i.e., an initial transient response and a slowly-developing long-lasting one. CGRP(8–37) significantly inhibited the latter response by 73%. These results suggest that CO2 liberated from exercising skeletal muscle activates capsaicin-sensitive perivascular sensory nerves locally, which results in the release of CGRP from their peripheral endings, and then the released peptide causes local vasodilatation. PMID:9375968

  19. C-terminal calcitonin gene-related peptide fragments and vasopressin but not somatostatin-28 induce miosis in monkeys.

    PubMed

    Almegård, B; Bill, A

    1993-11-30

    The miotic effects of C-terminal calcitonin gene-related peptide (CGRP) fragments, somatostatin-28 and vasopressin have been evaluated with special attention being paid to possible interactions with cholecystokinin (CCK)A receptors. The peptides were injected intracamerally to anesthetized monkeys pretreated with indomethacin and atropine. CGRP-(32-37) induced a miosis with a potency 1000 times lower than that previously found with sulphated CCK-8. Two other fragments, CGRP-(30-37) and CGRP-(31-37), also had miotic properties. The CGRP-(32-37)-induced miosis was antagonized by the CCKA receptor antagonist loxiglumide. No contractile effect was elicited by 67 pmol-7.4 nmol somatostatin-28. Vasopressin (360 pmol) caused a small reduction in pupil size. Loxiglumide pretreatment did not affect the reduction in pupil size but a vasopressin receptor antagonist partly inhibited the response. The results indicate that CGRP-(32-37) is a miotic with low potency but high efficacy in the monkey eye, probably interacting with CCKA receptors, and that vasopressin is a mitotic with low potency and efficacy, probably acting via vasopressin receptors.

  20. Calcitonin Gene-Related Peptide Modulates Heat Nociception in the Human Brain - An fMRI Study in Healthy Volunteers

    PubMed Central

    Asghar, Mohammad Sohail; Becerra, Lino; Larsson, Henrik B. W.; Borsook, David; Ashina, Messoud

    2016-01-01

    Background Intravenous infusion of calcitonin-gene-related-peptide (CGRP) provokes headache and migraine in humans. Mechanisms underlying CGRP-induced headache are not fully clarified and it is unknown to what extent CGRP modulates nociceptive processing in the brain. To elucidate this we recorded blood-oxygenation-level-dependent (BOLD) signals in the brain by functional MRI after infusion of CGRP in a double-blind placebo-controlled crossover study of 27 healthy volunteers. BOLD-signals were recorded in response to noxious heat stimuli in the V1-area of the trigeminal nerve. In addition, we measured BOLD-signals after injection of sumatriptan (5-HT1B/1D antagonist). Results Brain activation to noxious heat stimuli following CGRP infusion compared to baseline resulted in increased BOLD-signal in insula and brainstem, and decreased BOLD-signal in the caudate nuclei, thalamus and cingulate cortex. Sumatriptan injection reversed these changes. Conclusion The changes in BOLD-signals in the brain after CGRP infusion suggests that systemic CGRP modulates nociceptive transmission in the trigeminal pain pathways in response to noxious heat stimuli. PMID:26990646

  1. Statins decrease expression of the proinflammatory neuropeptides calcitonin gene-related peptide and substance P in sensory neurons.

    PubMed

    Bucelli, Robert C; Gonsiorek, Eugene A; Kim, Woo-Yang; Bruun, Donald; Rabin, Richard A; Higgins, Dennis; Lein, Pamela J

    2008-03-01

    Clinical and experimental observations suggest that statins may be useful for treating diseases presenting with predominant neurogenic inflammation, but the mechanism(s) mediating this potential therapeutic effect are poorly understood. In this study, we tested the hypothesis that statins act directly on sensory neurons to decrease expression of proinflammatory neuropeptides that trigger neurogenic inflammation, specifically calcitonin gene-related peptide (CGRP) and substance P. Reverse transcriptase-polymerase chain reaction, radioimmunoassay, and immunocytochemistry were used to quantify CGRP and substance P expression in dorsal root ganglia (DRG) harvested from adult male rats and in primary cultures of sensory neurons derived from embryonic rat DRG. Systemic administration of statins at pharmacologically relevant doses significantly reduced CGRP and substance P levels in DRG in vivo. In cultured sensory neurons, statins blocked bone morphogenetic protein (BMP)-induced CGRP and substance P expression and decreased expression of these neuropeptides in sensory neurons pretreated with BMPs. These effects were concentration-dependent and occurred independent of effects on cell survival or axon growth. Statin inhibition of neuropeptide expression was reversed by supplementation with mevalonate and cholesterol, but not isoprenoid precursors. BMPs signal via Smad activation, and cholesterol depletion by statins inhibited Smad1 phosphorylation and nuclear translocation. These findings identify a novel action of statins involving down-regulation of proinflammatory neuropeptide expression in sensory ganglia via cholesterol depletion and decreased Smad1 activation and suggest that statins may be effective in attenuating neurogenic inflammation.

  2. Skin-bacteria communication: Involvement of the neurohormone Calcitonin Gene Related Peptide (CGRP) in the regulation of Staphylococcus epidermidis virulence.

    PubMed

    N'Diaye, Awa R; Leclerc, Camille; Kentache, Takfarinas; Hardouin, Julie; Poc, Cecile Duclairoir; Konto-Ghiorghi, Yoan; Chevalier, Sylvie; Lesouhaitier, Olivier; Feuilloley, Marc G J

    2016-10-14

    Staphylococci can sense Substance P (SP) in skin, but this molecule is generally released by nerve terminals along with another neuropeptide, Calcitonin Gene Related Peptide (CGRP). In this study, we investigated the effects of αCGRP on Staphylococci. CGRP induced a strong stimulation of Staphylococcus epidermidis virulence with a low threshold (<10(-12 )M) whereas Staphylococcus aureus was insensitive to CGRP. We observed that CGRP-treated S. epidermidis induced interleukin 8 release by keratinocytes. This effect was associated with an increase in cathelicidin LL37 secretion. S. epidermidis displayed no change in virulence factors secretion but showed marked differences in surface properties. After exposure to CGRP, the adherence of S. epidermidis to keratinocytes increased, whereas its internalization and biofilm formation activity were reduced. These effects were correlated with an increase in surface hydrophobicity. The DnaK chaperone was identified as the S. epidermidis CGRP-binding protein. We further showed that the effects of CGRP were blocked by gadolinium chloride (GdCl3), an inhibitor of MscL mechanosensitive channels. In addition, GdCl3 inhibited the membrane translocation of EfTu, the Substance P sensor. This work reveals that through interaction with specific sensors S. epidermidis integrates different skin signals and consequently adapts its virulence.

  3. Skin-bacteria communication: Involvement of the neurohormone Calcitonin Gene Related Peptide (CGRP) in the regulation of Staphylococcus epidermidis virulence

    PubMed Central

    N’Diaye, Awa R.; Leclerc, Camille; Kentache, Takfarinas; Hardouin, Julie; Poc, Cecile Duclairoir; Konto-Ghiorghi, Yoan; Chevalier, Sylvie; Lesouhaitier, Olivier; Feuilloley, Marc G. J.

    2016-01-01

    Staphylococci can sense Substance P (SP) in skin, but this molecule is generally released by nerve terminals along with another neuropeptide, Calcitonin Gene Related Peptide (CGRP). In this study, we investigated the effects of αCGRP on Staphylococci. CGRP induced a strong stimulation of Staphylococcus epidermidis virulence with a low threshold (<10−12 M) whereas Staphylococcus aureus was insensitive to CGRP. We observed that CGRP-treated S. epidermidis induced interleukin 8 release by keratinocytes. This effect was associated with an increase in cathelicidin LL37 secretion. S. epidermidis displayed no change in virulence factors secretion but showed marked differences in surface properties. After exposure to CGRP, the adherence of S. epidermidis to keratinocytes increased, whereas its internalization and biofilm formation activity were reduced. These effects were correlated with an increase in surface hydrophobicity. The DnaK chaperone was identified as the S. epidermidis CGRP-binding protein. We further showed that the effects of CGRP were blocked by gadolinium chloride (GdCl3), an inhibitor of MscL mechanosensitive channels. In addition, GdCl3 inhibited the membrane translocation of EfTu, the Substance P sensor. This work reveals that through interaction with specific sensors S. epidermidis integrates different skin signals and consequently adapts its virulence. PMID:27739485

  4. Activin Acts with Nerve Growth Factor to Regulate Calcitonin Gene-Related Peptide mRNA in Sensory Neurons

    PubMed Central

    Xu, Pin; Hall, Alison K.

    2009-01-01

    Calcitonin Gene-Related Peptide (CGRP) increases in sensory neurons after inflammation and plays an important role in abnormal pain responses, but how this neuropeptide is regulated is not well understood. Both activin A and Nerve Growth Factor (NGF) increase in skin after inflammation and induce CGRP in neurons in vivo and in vitro. This study was designed to understand how neurons integrate these two signals to regulate the neuropeptide important for inflammatory pain. In adult dorsal root ganglion neurons, NGF but not activin alone produced a dose-dependent increase in CGRP mRNA. When added together with NGF, activin synergistically increased CGRP mRNA, indicating that sensory neurons combine these signals. Studies were then designed to learn if that combination occurred at a common receptor or shared intracellular signals. Studies with Activin IB receptor or trkA inhibitors suggested that each ligand required its cognate receptor to stimulate the neuropeptide. Further, activin did not augment NGF-initiated intracellular MAPK signals but instead stimulated Smad phosphorylation, suggesting these ligands initiated parallel signals in the cytoplasm. Activin synergy required several NGF intracellular signals to be present. Because activin did not further stimulate, but did require NGF intracellular signals, it appears that activin and NGF converge not in receptor or cytoplasmic signals, but in transcriptional mechanisms to regulate CGRP in sensory neurons after inflammation. PMID:17964731

  5. Expression pattern of sonic hedgehog signaling and calcitonin gene-related peptide in the socket healing process after tooth extraction.

    PubMed

    Pang, Pai; Shimo, Tsuyoshi; Takada, Hiroyuki; Matsumoto, Kenichi; Yoshioka, Norie; Ibaragi, Soichiro; Sasaki, Akira

    2015-11-06

    Sonic Hedgehog (SHH), a neural development inducer, plays a significant role in the bone healing process. Calcitonin gene-related peptide (CGRP), a neuropeptide marker of sensory nerves, has been demonstrated to affect bone formation. The roles of SHH signaling and CGRP-positive sensory nerves in the alveolar bone formation process have been unknown. Here we examined the expression patterns of SHH signaling and CGRP in mouse socket by immunohistochemistry and immunofluorescence analysis. We found that the expression level of SHH peaked at day 3 and was then decreased at 5 days after tooth extraction. CGRP, PTCH1 and GLI2 were each expressed in a similar pattern with their highest expression levels at day 5 and day 7 after tooth extraction. CGRP and GLI2 were co-expressed in some inflammatory cells and bone forming cells. In some areas, CGRP-positive neurons expressed GLI2. In conclusion, SHH may affect alveolar bone healing by interacting with CGRP-positive sensory neurons and thus regulate the socket's healing process after tooth extraction.

  6. Cells showing immunoreactivity for calcitonin or calcitonin gene-related peptide (CGRP) in the central nervous system of some invertebrates.

    PubMed

    Sasayama, Y; Katoh, A; Oguro, C; Kambegawa, A; Yoshizawa, H

    1991-09-01

    In the central nervous system of some species of several invertebrate phyla, including land planarians (Platyhelminthes), ribbon worms (Nemertina), slugs (Mollusca), polychaetes, earthworms and leeches (Annelida), pill bugs (Arthropoda), and beard worms (Pogonophora), salmon calcitonin-immunoreactive cells and rat calcitonin gene-related peptide (CGRP)-immunoreactive cells were found by immunohistochemistry. These immunoreactive cells were located in the region surrounding the neuropile, although the sizes of the cells varied according to species. Some of them were round or polygonal and regarded as apolar nerve cells because of their lack of cytoplasmic processes, whereas others were spindle-shaped or elongated, being comparable with unipolar nerve cells because of extension of their cytoplasmic processes in the direction of the neuropile. In some cases, it was noted that the cytoplasmic processes had complicated branches or formed loop-like structures at their ends. These observations suggest that a calcitonin-like or CGRP-like substance is extensively present in invertebrates as well as vertebrates.

  7. Calcitonin gene-related peptide immunoreactive sensory neurons in the vagal and glossopharyngeal ganglia innervating the larynx of the rat.

    PubMed

    Hayakawa, Tetsu; Kuwahara-Otani, Sachi; Maeda, Seishi; Tanaka, Koichi; Seki, Makoto

    2014-01-01

    We have examined whether calcitonin gene-related peptide-immunoreactive (CGRP-ir) neurons in the vagal and glossopharyngeal ganglia innervate the larynx. Many CGRP-ir neurons were located mostly in the superior glossopharyngeal-jugular ganglion complex that was fused the superior glossopharyngeal ganglion and the jugular ganglion in the cranial cavity. When Fluorogold was applied to the cut end of the superior laryngeal nerve (SLN) or the recurrent laryngeal nerve (RLN), many Fluorogold-labeled neurons were found in the superior glossopharyngeal-jugular ganglion complex and the nodose ganglion. Double-labeling for CGRP and Fluorogold showed that about 80% of Fluorogold-labeled neurons in the superior glossopharyngeal-jugular ganglion complex expressed CGRP-like immunoreactivity in the case of application to the SLN, and about 50% of Fluorogold-labeled neurons expressed CGRP-like immunoreactivity in the case of the RLN. Only a few double-labeled neurons were found in the nodose ganglion. The number of the Fluorogold-labeled neurons and double-labeled neurons in the superior glossopharyngeal-jugular ganglion complex in the case of the SLN was larger than that in the case of the RLN. These results indicate that sensory information from the larynx might be conveyed by many CGRP-ir neurons located in the superior glossopharyngeal-jugular ganglion complex by way of the SLN and the RLN.

  8. Immature osteoblastic MG63 cells possess two calcitonin gene-related peptide receptor subtypes that respond differently to [Cys(Acm)(2,7)] calcitonin gene-related peptide and CGRP(8-37).

    PubMed

    Kawase, Tomoyuki; Okuda, Kazuhiro; Burns, Douglas M

    2005-10-01

    Calcitonin gene-related peptide (CGRP) is clearly an anabolic factor in skeletal tissue, but the distribution of CGRP receptor (CGRPR) subtypes in osteoblastic cells is poorly understood. We previously demonstrated that the CGRPR expressed in osteoblastic MG63 cells does not match exactly the known characteristics of the classic subtype 1 receptor (CGRPR1). The aim of the present study was to further characterize the MG63 CGRPR using a selective agonist of the putative CGRPR2, [Cys(Acm)(2,7)]CGRP, and a relatively specific antagonist of CGRPR1, CGRP(8-37). [Cys(Acm)(2,7)]CGRP acted as a significant agonist only upon ERK dephosphorylation, whereas this analog effectively antagonized CGRP-induced cAMP production and phosphorylation of cAMP response element-binding protein (CREB) and p38 MAPK. Although it had no agonistic action when used alone, CGRP(8-37) potently blocked CGRP actions on cAMP, CREB, and p38 MAPK but had less of an effect on ERK. Schild plot analysis of the latter data revealed that the apparent pA2 value for ERK is clearly distinguishable from those of the other three plots as judged using the 95% confidence intervals. Additional assays using 3-isobutyl-1-methylxanthine or the PKA inhibitor N-(2-[p-bromocinnamylamino]ethyl)-5-isoquinolinesulfonamide hydrochloride (H-89) indicated that the cAMP-dependent pathway was predominantly responsible for CREB phosphorylation, partially involved in ERK dephosphorylation, and not involved in p38 MAPK phosphorylation. Considering previous data from Scatchard analysis of [125I]CGRP binding in connection with these results, these findings suggest that MG63 cells possess two functionally distinct CGRPR subtypes that show almost identical affinity for CGRP but different sensitivity to CGRP analogs: one is best characterized as a variation of CGRPR1, and the second may be a novel variant of CGRPR2.

  9. Distribution and fine structure of calcitonin gene-related peptide-like immunoreactive nerve fibers in the rat skin.

    PubMed

    Ishida-Yamamoto, A; Senba, E; Tohyama, M

    1989-07-03

    Distribution of calcitonin gene-related peptide-like immunoreactive (CGRPI) nerve fibers and their fine structure were examined in the skin of rat foot pads using immunocytochemistry. The CGRPI fibers formed bundles in the dermis and subcutaneous tissue. Two types of single-stranded CGRPI fibers were seen to leave the fiber bundles: one was located along the blood vessels or around the eccrine sweat glands, while the other entered the epidermis directly or through the Meissner's corpuscles in the dermal papillae. CGRPI fibers in the epidermis were distributed widely and were occasionally associated with Merkel cells. Immunoelectron microscopic study revealed that CGRPI fibers located around blood vessels, sweat glands, epidermal keratinocytes and Merkel cells, or in the Meissner's corpuscles did not form typical synaptic contacts with underlying cells, despite being varicose and filled with vesicles resembling synaptic ones. These findings suggested that the CGRP is released non-synaptically from these terminals to influence diffusely the organs surrounding the terminals. These cutaneous fibers seemed to originate from CGRPI neurons (both small type B cells and large type A cells) in the dorsal root ganglia (DRG), because injection of fast blue dye into the cutaneous nerve resulted in labeling of these CGRPI cells in the DRG and excision of the L3-L6 DRG resulted in the non-detection of cutaneous CGRPI fibers in the foot pads. Analysis of the composition of CGRPI fibers found in the rat skin has revealed that these are mostly unmyelinated. C-type fibers with some of them being thin myelinated fibers. This was true even of CGRPI fibers at the proximal end of peripheral neurites of the DRG.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Elevated levels of calcitonin gene-related peptide in upper spinal cord promotes sensitization of primary trigeminal nociceptive neurons.

    PubMed

    Cornelison, Lauren E; Hawkins, Jordan L; Durham, Paul L

    2016-12-17

    Orofacial pain conditions including temporomandibular disorder (TMD) and migraine are characterized by peripheral and central sensitization of trigeminal nociceptive neurons. The goal of this study was to investigate the role of calcitonin gene-related peptide (CGRP) in promoting bidirectional signaling within the trigeminal system to mediate sensitization of primary nociceptive neurons. Adult male Sprague-Dawley rats were injected intercisternally with CGRP or co-injected with the receptor antagonist CGRP8-37 or KT 5720, a protein kinase A (PKA) inhibitor. Nocifensive head withdrawal response to mechanical stimulation was investigated using von Frey filaments. Expression of PKA, glial fibrillary acidic protein (GFAP), and ionized calcium-binding adapter molecule 1 (Iba1) in the spinal cord and phosphorylated extracellular signal-regulated kinase (P-ERK) in the ganglion was studied using immunohistochemistry. Some animals were co-injected with CGRP and Fast Blue dye and the ganglion was imaged using fluorescent microscopy. CGRP increased nocifensive responses to mechanical stimulation when compared to control. Co-injection of CGRP8-37 or KT 5720 with CGRP inhibited the nocifensive response. CGRP stimulated PKA and GFAP expression in the spinal cord, and P-ERK in ganglion neurons. Seven days post injection, Fast Blue was observed in ganglion neurons and satellite glial cells. Our results demonstrate that elevated levels of CGRP in the upper spinal cord promote sensitization of primary nociceptive neurons via a mechanism that involves activation of PKA centrally and P-ERK in ganglion neurons. Our findings provide evidence of bidirectional signaling within the trigeminal system that facilitate increased neuron-glia communication within the ganglion associated with trigeminal sensitization.

  11. The paradoxical vascular interactions between endothelin-1 and calcitonin gene-related peptide in the rat gastric mucosal microcirculation.

    PubMed Central

    Lopez-Belmonte, J.; Whittle, B. J.

    1993-01-01

    1. The interactions between local intra-arterial infusion of endothelin-1 (ET-1) and rat alpha-calcitonin gene-related peptide (alpha-CGRP) on gastric mucosal damage and blood flow have been investigated in the pentobarbitone-anaesthetized rat. 2. Close-arterial infusion of ET-1 (2-200 pmol kg-1 min-1) induced a significant and dose-dependent increase in gastric mucosal haemorrhagic injury. 3. Close-arterial infusion of the higher doses of ET-1 (100 and 200 pmol kg-1 min-1) resulted in a biphasic effect on mucosal blood flow, as determined by laser Doppler flowmetry (LDF). This consisted of an initial transient increase followed by a pronounced and sustained fall in LDF. 4. Local microvascular constriction may thus contribute to the mechanisms underlying the gastric injury induced by these higher doses of ET-1. 5. However, close-arterial infusion of lower doses of ET-1 (2-50 pmol kg-1 min-1), that also provoked substantial mucosal damage, induced only a sustained and significant mucosal hyperaemia, which may be secondary to microvascular injury. 6. Concurrent dose-arterial administration of rat alpha-CGRP (50 pmol kg-1 min-1) significantly inhibited the extent of gastric mucosal injury induced by ET-1 (5 pmol kg-1 min-1). 7. Furthermore, concurrent close-arterial infusion of this dose of alpha-CGRP, which itself increased mucosal LDF, significantly inhibited the hyperaemic response induced by close-arterial infusion of ET-1 (5 pmol kg-1 min-1).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8220913

  12. Crossed and uncrossed projections to the cat sacrocaudal spinal cord: III. Axons expressing calcitonin gene-related peptide immunoreactivity.

    PubMed

    Ritz, L A; Murray, C R; Foli, K

    2001-10-01

    We have investigated the projection patterns of peptidergic small-diameter primary afferent fibers to the cat sacrocaudal spinal cord, a region associated with midline structures of the lower urogenital system and of the tail. Calcitonin gene-related peptide (CGRP)-immunoreactive (CGRP-IR) primary afferent fibers were observed within the superficial laminae, rostrally as the typical inverted U-shaped band that capped the separate dorsal horns (S1 to rostral S2) and caudally as a broad band that spanned the entire mediolateral extent of the fused dorsal horns (caudal S2 and caudal). Within the dorsal gray commissure, labeling was seen as a periodic vertical, midline band. CGRP-IR labeling was prevalent in an extensive mediolateral distribution at the base of the dorsal horn, originating from both lateral and medial collateral bundles that extend from the superficial dorsal horn. Some bundles, in part traveling within the dorsal commissure, conspicuously crossed the midline. In addition to the robust projection to the superficial dorsal horn, there was a more extensive distribution of CGRP-IR fibers within the deeper portions of the cat sacrocaudal dorsal horn than has been reported for other regions of the cat spinal cord. Presumably, these deep projections convey visceral information to projection or segmental neurons at the neck of the dorsal horn and in the region of the central canal. This deep distribution overlaps the reported projections of the pelvic and pudendal nerves. In addition, the contralateral projections of CGRP-IR fibers may form an anatomical substrate of the bilateral receptive fields for selective dorsal horn neurons. The density and variety of CGRP-IR projection patterns is a reflection of the functional attributes of the innervated structures.

  13. CGRP-RCP, a novel protein required for signal transduction at calcitonin gene-related peptide and adrenomedullin receptors.

    PubMed

    Evans, B N; Rosenblatt, M I; Mnayer, L O; Oliver, K R; Dickerson, I M

    2000-10-06

    It is becoming clear that receptors that initiate signal transduction by interacting with G-proteins do not function as monomers, but often require accessory proteins for function. Some of these accessory proteins are chaperones, required for correct transport of the receptor to the cell surface, but the function of many accessory proteins remains unknown. We determined the role of an accessory protein for the receptor for calcitonin gene-related peptide (CGRP), a potent vasodilator neuropeptide. We have previously shown that this accessory protein, the CGRP-receptor component protein (RCP), is expressed in CGRP responsive tissues and that RCP protein expression correlates with the biological efficacy of CGRP in vivo. However, the function of RCP has remained elusive. In this study stable cell lines were made that express antisense RCP RNA, and CGRP- and adrenomedullin-mediated signal transduction were greatly reduced. However, the loss of RCP did not effect CGRP binding or receptor density, indicating that RCP did not behave as a chaperone but was instead coupling the CGRP receptor to downstream effectors. A candidate CGRP receptor named calcitonin receptor-like receptor (CRLR) has been identified, and in this study RCP co-immunoprecipitated with CRLR indicating that these two proteins interact directly. Since CGRP and adrenomedullin can both signal through CRLR, which has been previously shown to require a chaperone protein for function, we now propose that a functional CGRP or adrenomedullin receptor consists of at least three proteins: the receptor (CRLR), the chaperone protein (RAMP), and RCP that couples the receptor to the cellular signal transduction pathway.

  14. Non-excitatory electrical stimulation attenuates myocardial infarction via homeostasis of calcitonin gene-related peptide in myocardium.

    PubMed

    Guo, Zhi-Jia; Guo, Zheng

    2015-03-01

    Electrical stimulation has been shown protection of brain, retina, optic nerves and pancreatic β-cells but the effect on cardio-protection is still unknown. Calcitonin gene-related peptide (CGRP) participates in the pathology of injury and protection of myocardium but whether or not electrical stimulation modulates endogenous CGRP is not clear. Male Sprague-Dawley rats were divided into 4 groups: (1) control group, without any treatment. (2) I/R group, animals were subjected to 30 min of myocardial ischemia followed by 60 min reperfusion. (3) NES+I/R group, non-excitatory electrical stimulation (NES) was commenced from 15 min before coronary artery occlusion till the end of reperfusion. (4) I/R+CGRP8-37 group, animals were given with CGRP8-37 (an antagonist of CGRP receptor, 10(-7) mol/L, 0.3 ml, i.v.) at 5 min before reperfusion without any electrical stimulation. The hemodynamics and electrocardiogram were monitored and recorded. Infarct size and troponin I were examined and CGRP expression in the myocardium and serum was analyzed. It was found that the infarct size and TnI were significantly reduced in NES+I/R group, by 45% and 58% respectively, accompanied by an obvious fall back of CGRP in myocardium, compared to I/R group (all p<0.05). Treatment with CGRP8-37 resulted in the same protection on myocardium as NES did. No significant difference in hemodynamics or ventricular tachycardia was detected among the groups (all p>0.05). It can be concluded that NES reduced the infarction size after acute myocardial ischemia and reperfusion, for which the underlying mechanism may be associated with modulation of endogenous CGRP in myocardium.

  15. Calcitonin gene-related peptide inhibits autophagic-lysosomal proteolysis through cAMP/PKA signaling in rat skeletal muscles.

    PubMed

    Machado, Juliano; Manfredi, Leandro H; Silveira, Wilian A; Gonçalves, Dawit A P; Lustrino, Danilo; Zanon, Neusa M; Kettelhut, Isis C; Navegantes, Luiz C

    2016-03-01

    Calcitonin gene-related peptide (CGRP) is a neuropeptide released by motor neuron in skeletal muscle and modulates the neuromuscular transmission by induction of synthesis and insertion of acetylcholine receptor on postsynaptic muscle membrane; however, its role in skeletal muscle protein metabolism remains unclear. We examined the in vitro and in vivo effects of CGRP on protein breakdown and signaling pathways in control skeletal muscles and muscles following denervation (DEN) in rats. In isolated muscles, CGRP (10(-10) to 10(-6)M) reduced basal and DEN-induced activation of overall proteolysis in a concentration-dependent manner. The in vitro anti-proteolytic effect of CGRP was completely abolished by CGRP8-37, a CGRP receptor antagonist. CGRP down-regulated the lysosomal proteolysis, the mRNA levels of LC3b, Gabarapl1 and cathepsin L and the protein content of LC3-II in control and denervated muscles. In parallel, CGRP elevated cAMP levels, stimulated PKA/CREB signaling and increased Foxo1 phosphorylation in both conditions. In denervated muscles and starved C2C12 cells, Rp-8-Br-cAMPs or PKI, two PKA inhibitors, completely abolished the inhibitory effect of CGRP on Foxo1, 3 and 4 and LC3 lipidation. A single injection of CGRP (100 μg kg(-1)) in denervated rats increased the phosphorylation levels of CREB and Akt, inhibited Foxo transcriptional activity, the LC3 lipidation as well as the mRNA levels of LC3b and cathepsin L, two bona fide targets of Foxo. This study shows for the first time that CGRP exerts a direct inhibitory action on autophagic-lysosomal proteolysis in control and denervated skeletal muscle by recruiting cAMP/PKA signaling, effects that are related to inhibition of Foxo activity and LC3 lipidation.

  16. Changes in the Expression of Calcitonin Gene-Related Peptide After Exposure to Injurious Stretch-Shortening Contractions

    PubMed Central

    Johnson, C.; Miller, G.R.; Baker, B.A.; Hollander, M.; Kashon, M.L.; Waugh, S; Krajnak, K.

    2016-01-01

    One of the factors that can result in musculoskeletal injuries, and time off work, is exposure to repetitive motion. The goal of this study was to determine if skeletal muscle injury induced by exposure to injurious stretch-shortening cycles (iSSCs), resulted in hyperalgesia in the hind limb and changes in calcitonin-gene related peptide (CGRP) immunolabeling in the dorsal root ganglia (DRG) in young and old male rats. Methods Young (3 mo) and old (30 mo) male Fisher 344 × BN F1 rats were anesthetized with isoflurane and the left hind limbs were exposed to 15 sets of 10 SSCs. Control animals were exposed to a single bout of SSCs of equal intensity. Sensitivity to mechanical stimulation was assessed using von Frey filaments prior to beginning the experiment, and on days 2 and 9 following exposure to iSSCs. Rats were euthanized one, 3 or 10 days after the exposure. The ipsilateral DRG were dissected from the L4-5 region of the spine, along with the left tibialis anterior (LTA) muscle. Results Rats exposed to iSSCs were more sensitive to mechanical stimulation than control rats 2 days after the exposure, and showed a reduction in peak force 3 days after exposure. Changes in sensitivity to pressure were not associated with increases in CGRP labeling in the DRG at 3 days. However, 9 days after exposure to iSSCs, old rats still displayed an increased sensitivity to mechanical stimulation, and this hyperalgesia was associated with an increase in CGRP immunolabeling in the DRG. Young rats exposed to iSSC did not display a change in CGRP immunolabeling and sensitivity to mechanical stimulation returned to control levels at 10 days. Conclusions These findings suggest that hyperalgesia seen shortly after exposure to iSSC is not influenced by CGRP levels. However, in cases where recovery from injury may be slower, as it is in older rats, CGRP may contribute to the maintenance of hyperalgesia. PMID:26972633

  17. The peptide semax affects the expression of genes related to the immune and vascular systems in rat brain focal ischemia: genome-wide transcriptional analysis

    PubMed Central

    2014-01-01

    Background The nootropic neuroprotective peptide Semax (Met-Glu-His-Phe-Pro-Gly-Pro) has proved efficient in the therapy of brain stroke; however, the molecular mechanisms underlying its action remain obscure. Our genome-wide study was designed to investigate the response of the transcriptome of ischemized rat brain cortex tissues to the action of Semax in vivo. Results The gene-expression alteration caused by the action of the peptide Semax was compared with the gene expression of the “ischemia” group animals at 3 and 24 h after permanent middle cerebral artery occlusion (pMCAO). The peptide predominantly enhanced the expression of genes related to the immune system. Three hours after pMCAO, Semax influenced the expression of some genes that affect the activity of immune cells, and, 24 h after pMCAO, the action of Semax on the immune response increased considerably. The genes implicated in this response represented over 50% of the total number of genes that exhibited Semax-induced altered expression. Among the immune-response genes, the expression of which was modulated by Semax, genes that encode immunoglobulins and chemokines formed the most notable groups. In response to Semax administration, 24 genes related to the vascular system exhibited altered expression 3 h after pMCAO, whereas 12 genes were changed 24 h after pMCAO. These genes are associated with such processes as the development and migration of endothelial tissue, the migration of smooth muscle cells, hematopoiesis, and vasculogenesis. Conclusions Semax affects several biological processes involved in the function of various systems. The immune response is the process most markedly affected by the drug. Semax altered the expression of genes that modulate the amount and mobility of immune cells and enhanced the expression of genes that encode chemokines and immunoglobulins. In conditions of rat brain focal ischemia, Semax influenced the expression of genes that promote the formation and

  18. RT97- and calcitonin gene-related peptide-like immunoreactivity in lumbar intervertebral discs and adjacent tissue from the rat.

    PubMed Central

    McCarthy, P W; Petts, P; Hamilton, A

    1992-01-01

    The innervation of rat intervertebral disc and adjacent ligamentous tissue has been investigated using 2 antibodies, RT97 and anti-calcitonin gene-related peptide. Immunoreactivity to the peptide was found in many fibres throughout the long ligaments around the intervertebral discs and in the periosteum, especially associated with vascular channels entering the vertebral bodies. Few of the immunoreactive fibres entered the annular lamellae of the disc tissue. Most of those which terminated did so as fine fibres which lay close to, or in, the interlamellar spaces of the outer annulus fibrosus. Calcitonin gene-related peptide-like immunoreactivity was also found in more complex endings in the longitudinal ligaments and rarely within the annulus fibrosus. RT97-immunoreactivity was also present in the complex endings and associated fibres. Conversely, RT97-immunoreactivity was apparent only in a few fine filamentous fibre endings. This suggested that the majority of fine filamentous, or free, nerve endings were of an unmyelinated sensory origin. Alternatively, those endings of a more complex nature, which were RT97-immunoreactive, were of a myelinated sensory origin. No immunoreactivity to either antibody was seen in the inner annular or nuclear tissue. It was therefore concluded that the sensory innervation of the rat intervertebral disc has both myelinated and unmyelinated components, the latter being more extensive. Both types of innervation appear to be restricted to the outermost rings of the annulus fibrosus. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:1452470

  19. Glial cell line-derived neurotrophic factor family ligands enhance capsaicin-stimulated release of calcitonin gene-related peptide from sensory neurons.

    PubMed

    Schmutzler, B S; Roy, S; Hingtgen, C M

    2009-06-16

    The glial cell line-derived neurotrophic factor (GDNF) family ligands (GFLs) are a group of peptides that have been implicated as important factors in inflammation, since they are released in increased amounts during inflammation and induce thermal hyperalgesia upon injection. Mouse isolated sensory neurons in culture and freshly dissociated spinal cord slices were used to examine the enhancement in stimulated-release of the neuropeptide, calcitonin gene-related peptide (CGRP), as a measure of sensitization. Exposure of isolated sensory neurons in culture to GDNF, neurturin, and artemin enhanced the capsaicin-stimulated release of immunoreactive calcitonin gene-related peptide (iCGRP) two- to threefold, but did not increase potassium-stimulated release of iCGRP. A similar profile of sensitization was observed in freshly dissociated spinal cord slices. Persephin, another member of the GFL family thought to be important in development, was unable to induce an enhancement in the release of iCGRP. These results demonstrate that specific GFLs are important mediators affecting sensory neuronal sensitivity, likely through modulation of the capsaicin receptor. The sensitization of sensory neurons during inflammation, and the pain and neurogenic inflammation resulting from this sensitization, may be due in part to the effects of these selected GFLs.

  20. Structural studies on the [Bu(t)-Cys18](19-37)-fragment of human beta-calcitonin-gene-related peptide.

    PubMed Central

    Sagoo, J K; Bose, C; Beeley, N R; Tendler, S J

    1991-01-01

    High-field n.m.r. studies were undertaken upon a peptide fragment of the C-terminal region of human beta-calcitonin-gene-related peptide (beta-hCGRP). Studies on the antigenic [Bu(t)-Cys18]beta-hCGRP-(19-37)-fragment revealed that several elements of secondary structure were present when the peptide was dissolved in [2H6]dimethyl sulphoxide. In particular an unspecified turn in the region of Ser19-Gly20 and a type I beta-turn in the region of Asn31-Val32-Gly33 were identified. Through-space connections between the terminal Phe37 amide group and the beta-protons of Thr50 suggest that the peptide may be folded into a loop-type conformation. These structural elements appear to overlap with the epitopes of a number of monoclonal antibodies and provide a molecular basis for understanding the role of the terminal Phe37 amide residue in the immune recognition of beta-hCGRP. Images Fig. 3. PMID:1741742

  1. Diverse Physiological Roles of Calcitonin Gene-Related Peptide in Migraine Pathology: Modulation of Neuronal-Glial-Immune Cells to Promote Peripheral and Central Sensitization.

    PubMed

    Durham, Paul L

    2016-08-01

    The neuropeptide calcitonin gene-related peptide (CGRP) is implicated in the underlying pathology of migraine by promoting the development of a sensitized state of primary and secondary nociceptive neurons. The ability of CGRP to initiate and maintain peripheral and central sensitization is mediated by modulation of neuronal, glial, and immune cells in the trigeminal nociceptive signaling pathway. There is accumulating evidence to support a key role of CGRP in promoting cross excitation within the trigeminal ganglion that may help to explain the high co-morbidity of migraine with rhinosinusitis and temporomandibular joint disorder. In addition, there is emerging evidence that CGRP facilitates and sustains a hyperresponsive neuronal state in migraineurs mediated by reported risk factors such as stress and anxiety. In this review, the significant role of CGRP as a modulator of the trigeminal system will be discussed to provide a better understanding of the underlying pathology associated with the migraine phenotype.

  2. Expression of calcitonin gene-related peptide-receptor component protein (CGRP-RCP) in human myometrium in differing physiological states and following misoprostol administration.

    PubMed

    Goharkhay, Nina; Lu, Jing; Felix, Juan C; Wing, Deborah A

    2007-09-01

    Our objective was to assess relative expression levels of mRNA for calcitonin gene-related peptide-receptor component protein (CGRP-RCP) in human myometrium in various physiological states. Using semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR), we analyzed myometrial samples from 46 women (10 menopausal, 10 nongravid premenopausal, 19 gravidae, and 7 premenopausal misoprostol-treated nongravid women) for the specific expression of CGRP-RCP mRNA. The expression of CGRP-RCP was significantly increased in gravid compared with nongravid myometrium ( P < 0.002). No significant differences in CGRP-RCP expression were found among the other study groups. We concluded that the increased mRNA expression CGRP-RCP in gravid myometrium supports the possibility of involvement of CGRP in the control of myometrial contractility. Additional studies are necessary to evaluate the exact mechanism of action of CGRP and CGRP-RCP in human myometrium.

  3. Anti-nociceptive effects of calcitonin gene-related peptide in nucleus raphe magnus of rats: an effect attenuated by naloxone.

    PubMed

    Huang, Y; Brodda-Jansen, G; Lundeberg, T; Yu, L C

    2000-08-04

    The present study investigated the role of calcitonin gene-related peptide (CGRP) on nociception in nucleus raphe magnus (NRM) and the interaction between CGRP and opioid peptides in NRM of rats. CGRP-like immunoreactivity was found at a concentration of 6.0+/-0. 77 pmol/g in NRM tissue of ten samples of rats, suggesting that it may contribute to physiological responses orchestrated by the NRM. The hindpaw withdrawal latency (HWL) to thermal and mechanical stimulation increased significantly after intra-NRM administration of 0.5 or 1 nmol of CGRP in rats, but not 0.25 nmol. The anti-nociceptive effect induced by CGRP was antagonized by following intra-NRM injection of 1 nmol of the CGRP receptor antagonist CGRP8-37. Furthermore, the CGRP-induced anti-nociceptive effect was attenuated by following intra-NRM administration of 6 nmol of naloxone. The results indicate that CGRP and its receptors play an important role in anti-nociception, and there is a possible interaction between CGRP and opioid peptides in NRM of rats.

  4. Effects of rizatriptan on the expression of calcitonin gene-related peptide and cholecystokinin in the periaqueductal gray of a rat migraine model.

    PubMed

    Yao, Gang; Han, Ximei; Hao, Tingting; Huang, Qian; Yu, Tingmin

    2015-02-05

    Triptans are serotonin 5-hydroxytryptamine receptor 1B/D agonists that are highly effective in the treatment of migraine. We previously found that rizatriptan can reduce the expression of proenkephalin and P substance in the rat midbrain, suggesting that rizatriptan may exert its analgesic effects by influencing the endogenous pain modulatory system. Calcitonin gene-related peptide (CGRP) and cholecystokinin (CCK) are mainly responsible for antagonizing the analgesic effects of opioid peptides in the endogenous pain modulatory system. In this study, we investigated the effects of rizatriptan on the expression of CGRP and CCK in the periaqueductal gray (PAG), a key structure of the endogenous pain modulatory system, in a rat migraine model induced by nitroglycerin. We found that the mRNA and protein levels of CGRP and CCK in the PAG of migraine rats were significantly increased compared to those in control rats, and these levels were significantly reduced upon treatment with rizatriptan in migraine rats (P<0.05). Our results suggest that the expression of CGRP and CCK in the endogenous pain modulatory system may be increased during migraine attacks, which further antagonizes the analgesic effects of endogenous opioid peptides and induces sustained migraine. Rizatriptan, however, significantly reduces the levels of CGRP and CCK to enhance the inhibition of pain signals via the endogenous pain modulatory system, resulting in effective treatment of migraine.

  5. Effect of a calcitonin gene-related peptide antagonist (CGRP8-37) on skin vasodilatation and oedema induced by stimulation of the rat saphenous nerve.

    PubMed Central

    Escott, K. J.; Brain, S. D.

    1993-01-01

    1. The effect of the calcitonin gene-related peptide antagonist (CGRP8-37, 400 nmol kg-1, i.v.) on the increased blood flow induced by calcitonin gene related peptide (CGRP), vasodilator prostaglandins, and topical capsaicin was measured with a laser Doppler blood flow meter in rat abdominal skin. 2. The saphenous nerve was electrically stimulated and the effect of CGRP8-37 (400 nmol kg-1, i.v.) on the increased blood flow (measured by laser Doppler flowmetry) and oedema formation (measured by the extravascular accumulation of [125I]-albumin) was investigated in the rat hind paw. 3. CGRP8-37 (400 nmol kg-1, i.v.) had no effect on basal cutaneous blood flow at uninjected sites and sites injected with Tyrode buffer, but acted selectively to inhibit the increased blood flow induced by intradermal CGRP (10 pmol/site, P < 0.05), but not that induced by prostaglandin E2 (PGE2, 300 pmol/site) or carba-prostacyclin (cPGI2, 100 pmol/site). 4. Capsaicin (0.1-33 mM), applied topically, acted in a dose-related manner to increase blood flow. CGRP8-37 (400 nmol kg-1, i.v.) almost totally inhibited blood flow induced by capsaicin (10 mM; P < 0.05) but did not significantly inhibit blood flow induced by a higher dose of capsaicin (33 mM). 5. The increased blood flow induced by short stimulation of the saphenous nerve (10 V, 1 ms, 2 Hz for 30 s) was inhibited by 76%, 5 min after i.v. CGRP8-37 (400 nmol kg-1, i.v., P < 0.05). 6. A longer (5 min) electrical stimulation of the saphenous nerve caused oedema formation, in addition to increased blood flow.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8242250

  6. Calcitonin gene-related peptide elevates cyclic AMP levels in chick skeletal muscle: possible neurotrophic role for a coexisting neuronal messenger.

    PubMed Central

    Laufer, R; Changeux, J P

    1987-01-01

    Recent immunocytochemical studies have shown that calcitonin gene-related peptide (CGRP) coexists with the neurotransmitter acetylcholine in spinal motoneurons of the chick. Moreover, CGRP causes an increase in the number of acetylcholine receptors on the surface of cultured chick myotubes. CGRP might thus serve as one of the signals by which motoneurons regulate endplate development. In a search for the second messengers involved, we now demonstrate that CGRP stimulates accumulation of cyclic AMP (cAMP) in cultured chick myotubes. This effect is, at least in part, mediated by an increase in cAMP synthesis, as the peptide also activates adenylate cyclase in chick muscle membranes. Nanomolar concentrations of CGRP elicit significant increases in both cellular cAMP levels and acetylcholine receptor numbers. The present findings suggest that cAMP is one of the second messengers which mediate the increase in acetylcholine receptor number elicited by CGRP. Furthermore, CGRP might be implicated in other trophic actions mediated by cAMP in skeletal muscle cells. PMID:3036493

  7. Receptor Activity-modifying Protein-directed G Protein Signaling Specificity for the Calcitonin Gene-related Peptide Family of Receptors*

    PubMed Central

    Weston, Cathryn; Winfield, Ian; Harris, Matthew; Hodgson, Rose; Shah, Archna; Dowell, Simon J.; Mobarec, Juan Carlos; Woodlock, David A.; Reynolds, Christopher A.; Poyner, David R.; Watkins, Harriet A.; Ladds, Graham

    2016-01-01

    The calcitonin gene-related peptide (CGRP) family of G protein-coupled receptors (GPCRs) is formed through the association of the calcitonin receptor-like receptor (CLR) and one of three receptor activity-modifying proteins (RAMPs). Binding of one of the three peptide ligands, CGRP, adrenomedullin (AM), and intermedin/adrenomedullin 2 (AM2), is well known to result in a Gαs-mediated increase in cAMP. Here we used modified yeast strains that couple receptor activation to cell growth, via chimeric yeast/Gα subunits, and HEK-293 cells to characterize the effect of different RAMP and ligand combinations on this pathway. We not only demonstrate functional couplings to both Gαs and Gαq but also identify a Gαi component to CLR signaling in both yeast and HEK-293 cells, which is absent in HEK-293S cells. We show that the CGRP family of receptors displays both ligand- and RAMP-dependent signaling bias among the Gαs, Gαi, and Gαq/11 pathways. The results are discussed in the context of RAMP interactions probed through molecular modeling and molecular dynamics simulations of the RAMP-GPCR-G protein complexes. This study further highlights the importance of RAMPs to CLR pharmacology and to bias in general, as well as identifying the importance of choosing an appropriate model system for the study of GPCR pharmacology. PMID:27566546

  8. Endothelin in normal lung tissue of newborn mammals: immunocytochemical distribution and co-localization with serotonin and calcitonin gene-related peptide.

    PubMed

    Seldeslagh, K A; Lauweryns, J M

    1993-10-01

    We demonstrated immunoreactivity for endothelins (ET)-1, -2, and -3 and for the precursor, big-ET-1, in the pulmonary diffuse neuroendocrine system (PDNES) of newborn cat, rat, hamster, and mouse. ET-like positive neuroepithelial bodies (NEB) were numerous in the intrapulmonary airways and the alveolar parenchyma. Single neuroendocrine cells (NEC) were less often labeled and mainly localized in the larger bronchi. ET-3-reactive neuronal elements were rarely observed. The intensity and number of immunostained NEB were highest for ET-3, followed in declining order by big-ET-1, ET-1, and ET-2. ET-like possessing NEB displayed interspecies differences. We conclude that ET-3 represents a neuroendocrine form of the ET peptide family. NEB expressing several ET isoforms can be grouped into NEB containing either big-ET-1 and ET-1 or ET-3 only. ET-like immunoreactivity was present in a subpopulation of serotonin (5HT)- and/or calcitonin gene-related peptide (CGRP)-positive NEB. As ET, 5HT, and CGRP have potent pulmonary vaso- and/or bronchomotor effects, our observations suggest that they play a separate or synergistic role in regulatory function of the mammalian PDNES, exerting their influence by paracrine, endocrine, and neurocrine pathways or a combination of these.

  9. Calcitonin gene-related peptide is a key factor in the homing of transplanted human MSCs to sites of spinal cord injury

    PubMed Central

    Zhang, Yu; Yang, Jinhua; Zhang, Peng; Liu, Tao; Xu, Jianwei; Fan, Zhihai; Shen, Yixin; Li, Wenjie; Zhang, Huanxiang

    2016-01-01

    Mesenchymal stem cells (MSCs) can be used to treat many diseases, including spinal cord injury (SCI). Treatment relies mostly on the precise navigation of cells to the injury site for rebuilding the damaged spinal cord. However, the key factors guiding MSCs to the epicenter of SCI remain unknown. Here, we demonstrated that calcitonin gene-related peptide (CGRP), a neural peptide synthesized in spinal cord, can dramatically aid the homing of human umbilical cord mesenchymal stem cells (HUMSCs) in spinal cord-transected SCI rats. First, HUMSCs exhibited chemotactic responses in vitro to CGRP. By time-lapse video analysis, increased chemotactic index (CMI), forward migration index (FMI) and speed contributed to this observed migration. Then, through enzyme immunoassay, higher CGRP concentrations at the lesion site were observed after injury. The release of CGRP directed HUMSCs to the injury site, which was suppressed by CGRP 8–37, a CGRP antagonist. We also verified that the PI3K/Akt and p38MAPK signaling pathways played a critical role in the CGRP-induced chemotactic migration of HUMSCs. Collectively, our data reveal that CGRP is a key chemokine that helps HUMSCs migrate to the lesion site and thereby can be used as a model molecule to study MSCs homing after SCI. PMID:27296555

  10. Colocalization and shared distribution of endomorphins with substance P, calcitonin gene-related peptide, gamma-aminobutyric acid, and the mu opioid receptor.

    PubMed

    Greenwell, Thomas N; Martin-Schild, Sheryl; Inglis, Fiona M; Zadina, James E

    2007-07-10

    The endomorphins are endogenous opioids with high affinity and selectivity for the mu opioid receptor (MOR, MOR-1, MOP). Endomorphin-1 (Tyr-Pro-Trp-Phe-NH(2); EM1) and endomorphin-2 (Tyr-Pro-Phe-Phe-NH(2); EM2) have been localized to many regions of the central nervous system (CNS), including those that regulate antinociception, autonomic function, and reward. Colocalization or shared distribution (overlap) of two neurotransmitters, or a transmitter and its cognate receptor, may imply an interaction of these elements in the regulation of functions mediated in that region. For example, previous evidence of colocalization of EM2 with substance P (SP), calcitonin gene-related peptide (CGRP), and MOR in primary afferent neurons suggested an interaction of these peptides in pain modulation. We therefore investigated the colocalization of EM1 and EM2 with SP, CGRP, and MOR in other areas of the CNS. EM2 was colocalized with SP and CGRP in the nucleus of the solitary tract (NTS) and with SP, CGRP and MOR in the parabrachial nucleus. Several areas in which EM1 and EM2 showed extensive shared distributions, but no detectable colocalization with other signaling molecules, are also described.

  11. Involvement of multiple receptors in the biological effects of calcitonin gene-related peptide and amylin in rat and guinea-pig preparations.

    PubMed Central

    Giuliani, S.; Wimalawansa, S. J.; Maggi, C. A.

    1992-01-01

    1. The activity of rat alpha and beta calcitonin gene-related peptide (CGRP) as compared to the structurally related peptide, rat amylin, has been investigated in the guinea-pig isolated left atrium (electrically driven), in mucosa-free strips from the base of the guinea-pig urinary bladder and in the rat isolated vas deferens (pars prostatica). The antagonist activity of the C-terminal fragment of human alpha CGRP, alpha CGRP(8-37), was also investigated. 2. In the guinea-pig isolated left atrium the three peptides produced a concentration-related positive inotropic effect, amylin being about 16 and 31 times less potent than alpha or beta CGRP, respectively. Human alpha CGRP(8-37) produced a rightward displacement of the log concentration-response curve to the three agonists tested, without depression of maximal response attainable. Apparent pKB values calculated on the basis of the displacement produced by 1 microM human alpha CGRP(8-37) indicated an agonist-independent affinity of the antagonist (6.66 +/- 0.11 for alpha CGRP, 6.42 +/- 0.17 for beta CGRP and 6.95 +/- 0.11 for amylin). 3. In the guinea-pig isolated urinary bladder, alpha or beta CGRP or amylin produce a concentration-related inhibition of twitch contractions evoked by train electrical field stimulation (10 Hz frequency, 0.25 ms duration at 100 V for 0.5 s every 60 s). Amylin was about 100 times less potent than alpha or beta CGRP. Human alpha CGRP(8-37) (3 microM) did not significantly affect the inhibitory action of the three agonists tested.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1330181

  12. Developmental localization of calcitonin gene-related peptide in dorsal sensory axons and ventral motor neurons of mouse cervical spinal cord.

    PubMed

    Kim, Jeongtae; Sunagawa, Masanobu; Kobayashi, Shiori; Shin, Taekyun; Takayama, Chitoshi

    2016-04-01

    Calcitonin gene-related peptide (CGRP) is a 37-amino-acid neuropeptide, synthesized by alternative splicing of calcitonin gene mRNA. CGRP is characteristically distributed in the nervous system, and its function varies depending on where it is expressed. To reveal developmental formation of the CGRP network and its function in neuronal maturation, we examined the immunohistochemical localization of CGRP in the developing mouse cervical spinal cord and dorsal root ganglion. CGRP immunolabeling (IL) was first detected in motor neurons on E13, and in ascending axons of the posterior funiculus and DRG neurons on E14. CGRP-positive sensory axon fibers entered Laminae I and II on E16, and Laminae I through IV on E18. The intensity of the CGRP-IL gradually increased in both ventral and dorsal horns during embryonic development, but markedly decreased in the ventral horn after birth. These results suggest that CGRP is expressed several days after neuronal settling and entry of sensory fibers, and that the CGRP network is formed in chronological and sequential order. Furthermore, because CGRP is markedly expressed in motor neurons when axons are vastly extending and innervating targets, CGRP may also be involved in axonal elongation and synapse formation during normal development.

  13. Calcitonin gene-related peptide erases the fear memory and facilitates long-term potentiation in the central nucleus of the amygdala in rats.

    PubMed

    Wu, Xin; Zhang, Jie-Ting; Liu, Jue; Yang, Si; Chen, Tao; Chen, Jian-Guo; Wang, Fang

    2015-11-01

    Calcitonin gene-related peptide (CGRP) is a 37 amino acid neuropeptide, which plays a critical role in the central nervous system. CGRP binds to G protein-coupled receptors, including CGRP1, which couples positively to adenylyl cyclase (AC) and protein kinase A (PKA) activation. CGRP and CGRP1 receptors are enriched in central nucleus of the amygdala (CeA), the main part of the amygdala, which regulates conditioned fear memories. Here, we reported the importance of CGRP and CGRP1 receptor for synaptic plasticity in the CeA and the extinction of fear memory in rats. Our electrophysiological and behavioral in vitro and in vivo results showed exogenous application of CGRP induced an immediate and lasting long-term potentiation in the basolateral nucleus of amygdala-CeA pathway, but not in the lateral nucleus of amygdala-CeA pathway, while bilateral intra-CeA infusion CGRP (0, 5, 13 and 21 μM/side) dose dependently enhanced fear memory extinction. The effects were blocked by CGRP1 receptor antagonist (CGRP8-37 ), N-methyl-d-aspartate receptors antagonist MK801 and PKA inhibitor H89. These results demonstrate that CGRP can lead to long-term potentiation of basolateral nucleus of amygdala-CeA pathway through a PKA-dependent postsynaptic mechanism that involved N-methyl-d-aspartate receptors and enhance the extinction of fear memory in rats. Together, the results strongly support a pivotal role of CGRP in the synaptic plasticity of CeA and extinction of fear memory. Calcitonin gene-related peptide (CGRP) plays an essential role in synaptic plasticity in the amygdala and fear memory. We found that CGRP-induced chemical long-term potentiation (LTP) in a dose-dependent way in the BLA-CeA (basolateral and central nucleus of amygdala, respectively) pathway and enhanced fear memory extinction in rats through a protein kinase A (PKA)-dependent postsynaptic mechanism that involved NMDA receptors. These results support a pivotal role of CGRP in amygdala.

  14. High arterial compliance in cirrhosis is related to low adrenaline and elevated circulating calcitonin gene related peptide but not to activated vasoconstrictor systems

    PubMed Central

    Henriksen, J; Moller, S; Schifter, S; Abrahamsen, J; Becker, U

    2001-01-01

    BACKGROUND AND AIMS—Static and dynamic functions of the wall of large arteries are largely unknown in cirrhosis in vivo. The present study was undertaken to determine arterial compliance (COMPart) in relation to vasodilator and vasoconstrictor systems in patients with cirrhosis. In addition, vasoactivity was manipulated by inhalation of oxygen.
STUDY POPULATION AND METHODS—In 20 patients with alcoholic cirrhosis and 12 controls we determined COMPart (stroke volume relative to pulse pressure), cardiac output, plasma volume, systemic vascular resistance, central circulation time, plasma catecholamines, renin activity, endothelin-1, and calcitonin gene related peptide (CGRP) at baseline and during oxygen inhalation.
RESULTS—COMPart was significantly increased in cirrhotic patients compared with controls (1.32 v 1.06 ml/mm Hg; p< 0.05) and inversely related to plasma adrenaline levels (r=−0.53; p<0.02) but positively related to circulating levels of CGRP (r=0.58; p<0.01). No significant relation was found for plasma noradrenaline, renin activity, or endothelin-1. COMPart was positively related to plasma volume (r=0.50; p<0.02) and inversely to systemic vascular resistance (r=−0.69; p<0.001) and central circulation time (r=−0.49; p<0.02). During oxygen inhalation, COMPart decreased (−13%; p<0.005) and systemic vascular resistance increased (+10%; p<0.001) towards normal values without significant changes in mean arterial pressure. Plasma adrenaline (−16%; p<0.01) decreased and the relation to COMPart disappeared. The relation of COMPart to CGRP and circulatory variables remained unchanged.
CONCLUSION—Elevated arterial compliance in cirrhosis is related to low adrenaline, high CGRP, and systemic hyperdynamics but not to indicators of the activated vasoconstrictor systems (noradrenaline, renin, endothelin-1). Thus the altered static and dynamic characteristics of the wall of large arteries are intimately associated with circulatory and

  15. An ongoing role of α-calcitonin gene-related peptide as part of a protective network against hypertension, vascular hypertrophy, and oxidative stress.

    PubMed

    Smillie, Sarah-Jane; King, Ross; Kodji, Xenia; Outzen, Emilie; Pozsgai, Gabor; Fernandes, Elizabeth; Marshall, Nichola; de Winter, Patricia; Heads, Richard J; Dessapt-Baradez, Cecile; Gnudi, Luigi; Sams, Anette; Shah, Ajay M; Siow, Richard C; Brain, Susan D

    2014-05-01

    α-Calcitonin gene-related peptide (αCGRP) is a vasodilator, but there is limited knowledge of its long-term cardiovascular protective influence. We hypothesized that αCGRP protects against the onset and development of angiotensin II-induced hypertension and have identified protective mechanisms at the vascular level. Wild-type and αCGRP knockout mice that have similar baseline blood pressure were investigated in the angiotensin II hypertension model for 14 and 28 days. αCGRP knockout mice exhibited enhanced hypertension and aortic hypertrophy. αCGRP gene expression was increased in dorsal root ganglia and at the conduit and resistance vessel level of wild-type mice at both time points. βCGRP gene expression was also observed and shown to be linked to plasma levels of CGRP. Mesenteric artery contractile and relaxant responses in vitro and endothelial NO synthase expression were similar in all groups. The aorta exhibited vascular hypertrophy, increased collagen formation, and oxidant stress markers in response to angiotensin II, with highest effects observed in αCGRP knockout mice. Gene and protein expression of endothelial NO synthase was lacking in the aortae after angiotensin II treatment, especially in αCGRP knockout mice. These results demonstrate the ongoing upregulation of αCGRP at the levels of both conduit and resistance vessels in vascular tissue in a model of hypertension and the direct association of this with protection against aortic vascular hypertrophy and fibrosis. This upregulation is maintained at a time when expression of aortic endothelial NO synthase and antioxidant defense genes have subsided, in keeping with the concept that the protective influence of αCGRP in hypertension may have been previously underestimated.

  16. The potentiating effect of calcitonin gene-related peptide on transient receptor potential vanilloid-1 activity and the electrophysiological responses of rat trigeminal neurons to nociceptive stimuli.

    PubMed

    Chatchaisak, Duangthip; Connor, Mark; Srikiatkhachorn, Anan; Chetsawang, Banthit

    2017-02-15

    Growing evidence suggests that calcitonin gene-related peptide (CGRP) participates in trigeminal nociceptive responses. However, the role of CGRP in sensitization or desensitization of nociceptive transduction remains poorly understood. In this study, we sought to further investigate the CGRP-induced up-regulation of transient receptor potential vanilloid-1 (TRPV1) and the responses of trigeminal neurons to nociceptive stimuli. Rat trigeminal ganglion (TG) organ cultures and isolated trigeminal neurons were incubated with CGRP. An increase in TRPV1 levels was observed in CGRP-incubated TG organ cultures. CGRP potentiated capsaicin-induced increase in phosphorylated CaMKII levels in the TG organ cultures. The incubation of the trigeminal neurons with CGRP significantly increased the inward currents in response to capsaicin challenge, and this effect was inhibited by co-incubation with the CGRP receptor antagonist, BIBN4068BS or the inhibitor of protein kinase A, H-89. These findings reveal that CGRP acting on trigeminal neurons may play a significant role in facilitating cellular events that contribute to the peripheral sensitization of the TG in nociceptive transmission.

  17. Quinoline derivatives: candidate drugs for a Class B G-protein coupled receptor, the Calcitonin gene-related peptide receptor, a cause of migraines

    PubMed Central

    Iftikhar, Hira; Ahmad, Iqra; Gan, Siew Hua; Shaik, Munvar Miya; Iftikhar, Naveed; Nawaz, Muhammad Sulaman; Greig, Nigel H.; Kamal, Mohammad A

    2016-01-01

    Class B G-protein coupled receptors are involved in a wide variety of diseases and are a major focus in drug design. Migraines are a common problem, and one of their major causative agents is class B G-protein coupled receptor, Calcitonin gene-related peptide (CGRP) receptor, a target for competitive drug discovery. The calcitonin receptor-like receptor generates complexes with a receptor activity-modifying protein, which determines the type of receptor protein formed. The CGRP receptor comprises a complex formed from the calcitonin receptor-like receptor and receptor activity-modifying protein 1. In this study, an in silico docking approach was used to target calcitonin receptor-like receptor in the bound form with receptor activity-modifying protein 1 (CGRP receptor), as well as in the unbound form. In both cases, the resulting inhibitors bound to the same cavity of the calcitonin receptor-like receptor. The twelve evaluated compounds were competitive inhibitors and showed efficient inhibitory activity against the CGRP receptor and Calcitonin receptor-like receptor. The two studied quinoline derivatives demonstrated potentially ideal inhibitory activity in terms of binding interactions and low range nano-molar inhibition constants. These compounds could prove helpful in designing drugs for the effective treatment of migraines. We propose that quinoline derivatives possess inhibitory activity by disturbing CGRP binding in the trigeminovascular system and may be considered for further preclinical appraisal for the treatment of migraines. PMID:25230231

  18. Role of calcitonin gene-related peptide in the sensitization of dorsal horn neurons to mechanical stimulation after intradermal injection of capsaicin.

    PubMed

    Sun, Rui-Qing; Lawand, Nada B; Lin, Qing; Willis, William D

    2004-07-01

    This study was designed to assess the role of calcitonin gene-related peptide (CGRP) and its receptor in the sensitization of dorsal horn neurons induced by intradermal injection of capsaicin in rats. Extracellular recordings were made from wide dynamic range (WDR) dorsal horn neurons with receptive fields on the hindpaw in the lumbar enlargement of anesthetized rats. The background activity and responses to brushing, pressing, and pinching the skin were assessed. A postsuperfusion or a presuperfusion of CGRP(8-37) paradigm was followed. When tested 30 min after capsaicin injection, there was an increase in background activity and responses to brush, press, and pinch applied to the receptive field. Superfusion of CGRP(8-37) into the spinal cord at 45 min after capsaicin injection significantly reversed the increased background activity and responses to brush, press, and pinch applied to the receptive field. On the other hand, spinal superfusion of CGRP(8-37) prior to capsaicin injection prevented the increased background activity and responses to brush, press, and pinch of WDR neurons that occurred following capsaicin injection in control experiments. A sensitization of spinal dorsal horn neurons could also be induced by superfusion of the spinal cord with CGRP. The effect could be blocked by CGRP(8-37) dose-dependently. Collectively, these results suggest that CGRP and its receptors are involved in the spinal cord central sensitization induced by intradermal injection of capsaicin.

  19. Quantitative analysis of afferents expressing substance P, calcitonin gene-related peptide, isolectin B4, neurofilament 200, and Peripherin in the sensory root of the rat trigeminal ganglion.

    PubMed

    Bae, Jin Young; Kim, Jae Hyun; Cho, Yi Sul; Mah, Won; Bae, Yong Chul

    2015-01-01

    Substance P (SP), calcitonin gene-related peptide (CGRP), and isolectin B4 (IB4) are widely used as markers for peripheral neurons with unmyelinated fibers, whereas neurofilament 200 (NF200), and Peripherin are used as markers for neurons with myelinated fibers, and with unmyelinated or small-caliber fibers, respectively. To study the selectivity of these markers for specific neuronal types, we analyzed their expression in neurons in the rat trigeminal ganglion by light- and electron-microscopic immunocytochemistry. Most SP-immunopositive (+), CGRP+, and IB4+ fibers were unmyelinated, but a small fraction (∼5%) were small myelinated fibers (<20 µm(2) in cross-sectional area, equivalent to <5 µm in diameter, Aδ fiber). Similarly, whereas the majority of NF200+ fibers were myelinated, a large fraction (23.9%) were unmyelinated, and whereas the majority of Peripherin+ fibers were unmyelinated and small myelinated, a significant fraction (15.5%) were large myelinated (>20 µm(2) in cross-sectional area, equivalent to >5 µm in diameter, Aβ fiber). Our findings confirm that SP, CGRP, and IB4 can be used as reliable markers for neurons with unmyelinated fibers, and question the suitability of NF200 as a marker for neurons with myelinated fibers, and of Peripherin as a marker for neurons with unmyelinated, or fine-caliber fibers.

  20. Topographic distribution of serotonin-immunoreactive urethral endocrine cells and their relationship with calcitonin gene-related peptide-immunoreactive nerves in male rats.

    PubMed

    Yokoyama, Takuya; Saino, Tomoyuki; Nakamuta, Nobuaki; Yamamoto, Yoshio

    2017-01-01

    We investigated the topographic distribution and morphology of serotonin (5-HT)-immunoreactive endocrine cells in the urethra of male rats, and focused on their relationship with peptidergic nerve fibers immunoreactive for calcitonin gene-related peptide (CGRP). Urethral endocrine cells immunoreactive for 5-HT were densely distributed in the epithelial layers of the prostatic part, but were sparsely distributed in the membranous and spongy parts of urethra. Distribution of urethral endocrine cells with 5-HT immunoreactivity in the prostatic part was restricted from the internal urethral orifice to the region of seminal colliculus. 5-HT-immunoreactive endocrine cells were also observed in the ductal epithelial layers of coagulating glands, prostatic glands, and seminal vesicles. 5-HT-immunoreactive endocrine cells were triangular or flask in shape and possessed an apical projection extending toward the urethral lumen, and basal or lateral protrusions intruding between other epithelial cells were also detected in some cells. Double immunolabeling for 5-HT and CGRP revealed that CGRP-immunoreactive nerve fibers attached to urethral endocrine cells with 5-HT immunoreactivity in the prostatic part. These results suggest that urethral endocrine cells may release 5-HT in response to luminal stimuli, and that these cells and CGRP-immunoreactive nerves may regulate each other by an axon reflex mechanism.

  1. Variation of plasma levels of endothelin, calcitonin gene-related peptide, nitric oxide, and malondialdehyde in acute myocardial ischemia reperfusion injury in a rabbit model.

    PubMed

    Zhao, Y B; Wang, Y Z; Yue, Y H; Zhao, W C; Feng, G X

    2015-05-25

    We examined the variation in plasma levels of endothelin (ET), calcitonin gene-related peptide (CGRP), nitric oxide (NO), and malondialdehyde (MDA), as well as superoxide dismutase (SOD) activity, in acute myocardial ischemia reperfusion injury in a rabbit model. Seventy rabbits were randomly assigned into 3 groups. Open-chest surgery (OCS) was performed for all rabbits. Group A (N = 20) received sham-surgery, group B (N = 25) was the reperfusion group, and group C (N = 25) was the infarction group. At 12 h after chest clo-sure, plasma ET levels in groups B and C were clearly increased, while CGRP levels were clearly decreased, particularly in group B. At 24 h after chest closure, ET levels were higher than before OCS, while there was no significant difference between groups B and C. ET in group B was decreased, while that in group C was increased at 12 h. No significant difference in CGRP was observed between 12 and 24 h after chest closure. NO levels in groups B and C at 12 h after chest closure were significantly decreased compared to those before OCS. NO levels in group B at 24, 48, and 72 h were significantly lower than those at 12 h, while those of group C were not significantly changed after 12 h. Dynamic monitoring and comparison of plasma levels of ET, CGRP, NO, and MDA as well as SOD activity revealed that appropriate intervention of these factors may reduce reperfusion injury.

  2. Involvement of calcitonin gene-related peptide and CCL2 production in CD40-mediated behavioral hypersensitivity in a model of neuropathic pain

    PubMed Central

    MALON, JENNIFER T.; MADDULA, SWATHI; BELL, HARMONY; CAO, LING

    2014-01-01

    The neuropeptide calcitonin gene-related peptide (CGRP) is known to play a pro-nociceptive role after peripheral nerve injury upon its release from primary afferent neurons in preclinical models of neuropathic pain. We previously demonstrated a critical role for spinal cord microglial CD40 in the development of spinal nerve L5 transection (L5Tx)-induced mechanical hypersensitivity. Herein, we investigated whether CGRP is involved in the CD40-mediated behavioral hypersensitivity. First, L5Tx was found to significantly induce CGRP expression in wild-type (WT) mice up to 14 days post-L5Tx. This increase in CGRP expression was reduced in CD40 knockout (KO) mice at day 14 post-L5Tx. Intrathecal injection of the CGRP antagonist CGRP8–37 significantly blocked L5Tx-induced mechanical hypersensitivity. In vitro, CGRP induced glial IL-6 and CCL2 production, and CD40 stimulation added to the effects of CGRP in neonatal glia. Further, there was decreased CCL2 production in CD40 KO mice compared to WT mice 21 days post-L5Tx. However, CGRP8–37 did not significantly affect spinal cord CCL2 production following L5Tx in WT mice. Altogether, these data suggest that CD40 contributes to the maintenance of behavioral hypersensitivity following peripheral nerve injury in part through two distinct pathways, the enhancement of CGRP expression and spinal cord CCL2 production. PMID:22377050

  3. Antidromic effect of calcitonin gene-related peptide containing nerves on cerebral arteries in rats--a possible role of sensory nerves on cerebral circulatio.

    PubMed

    Asari, J; Suzuki, K; Matsumoto, M; Sasaki, T; Kodama, N

    2001-12-01

    It has generally been thought that the neurogenic control of cerebral circulation is decided mainly by the autonomic nervous system. Recent studies, however, indicate that sensory nerves rich in calcitonin gene-related peptide (CGRP) are also distributed on cerebral arteries. CGRP is one of neuropeptides that has strong vasodilative effect. This indicates that sensory nerves may antidromically dilate cerebral arteries mediated by CGRP. The aim of this study is to investigate the relationship between the CGRP containing nerves and cerebral circulation. Firstly, we developed a selective denervation model of CGRP containing nerves. The denervation was performed with intrathecal administration of capsaicin in rats. Secondly, we measured the change of regional cerebral blood flow (rCBF) during the occlusion of bilateral common carotid artery or systemic hypotension. CGRP immunoreactivity around cerebral arteries disappeared after capsaicin treatment. The rCBF during the occlusion of bilateral common carotid artery decreased more in the capsaicin group than in the control group. There was no significant difference in the changes of rCBF during systemic hypotension. These results showed that CGRP containing nerves would participate in the vascular response of cerebral arteries. It is likely that sensory nerves with CGRP should have antidromic effect on cerebral circulation.

  4. Calcitonin gene-related peptide produces skeletal muscle vasodilation following antidromic stimulation of unmyelinated afferents in the dorsal root in rats.

    PubMed

    Sato, A; Sato, Y; Shimura, M; Uchida, S

    2000-04-07

    In anesthetized rats, the contribution of calcitonin gene-related peptide (CGRP) to antidromic vasodilation of skeletal muscle blood flow (MBF) following electrical stimulation of muscle afferent was investigated by measuring biceps femoris MBF using laser Doppler flowmetry. Repetitive antidromic electrical stimulation of unmyelinated C fibers in ipsilateral dorsal roots at the 3rd-5th lumbar segments for 30 s caused an increase in MBF for 3-15 min (mean 4.5 min) without significant change in systemic arterial blood pressure. The increase in skeletal MBF started about 10 s after the onset of stimulation, and peaked at approximately 130% of the control value at about 30 s after the end of the 30 s period of stimulation. The MBF response was totally abolished by topical application of hCGRP (8-37), a CGRP receptor antagonist. It is concluded that antidromic vasodilation in skeletal muscles following stimulation of unmyelinated C afferents in dorsal roots is independent of systemic blood pressure and is mediated essentially by CGRP. It is suggested that this CGRP-related antidromic vasodilation may be important in the clinical improvement of skeletal MBF produced by physical therapy, e.g. acupuncture.

  5. Calcitonin gene-related peptide immunoreactive neurons innervating the soft palate, the root of tongue, and the pharynx in the superior glossopharyngeal ganglion of the rat.

    PubMed

    Hayakawa, Tetsu; Kuwahara, Sachi; Maeda, Seishi; Tanaka, Koichi; Seki, Makoto

    2010-07-01

    We have examined whether calcitonin gene-related peptide immunoreactive (CGRP-ir) neurons in the glossopharyngeal ganglia innervate the soft palate, the root of tongue, and the pharynx of the rat. Immunohistochemical observations revealed that numerous CGRP-ir neurons are located in the superior glossopharyngeal ganglion located ventrolateral to the medulla oblongata in the cranial cavity, and that CGRP-ir neurons are also located in the inferior glossopharyngeal ganglion at the jugular foramen. When Fluorogold was injected into the soft palate, the root of tongue, or the pharyngeal constrictor muscles, many retrogradely Fluorogold-labeled neurons were found in the superior glossopharyngeal ganglion and the nodose ganglion, and several Fluorogold-labeled neurons were found in the inferior glossopharyngeal ganglion. Double labeling with immunohistochemistry for CGRP and Fluorogold showed that in every case of injections of Fluorogold into the soft palate, the root of tongue, or the pharynx, about 30% of the Fluorogold-labeled neurons in the superior glossopharyngeal ganglion expressed CGRP-like immunoreactivity, while no double-labeled neurons were found in the inferior glossopharyngeal ganglion or the nodose ganglion. These results indicate that nociceptive sensory information from the soft palate, the root of tongue, and the pharynx might be conveyed by the neurons in the superior glossopharyngeal ganglion to the nucleus tractus solitarii.

  6. Effects of calcitonin gene-related peptide on canine cerebral artery strips and the in-vivo vertebral blood flow in dogs.

    PubMed

    Ikegaki, I; Suzuki, Y; Satoh, S; Asano, T; Shibuya, M; Sugita, K

    1989-10-01

    The effects of calcitonin gene-related peptide (CGRP) on canine cerebral arteries and on vertebral blood flow were investigated in-vivo and in-vitro and the findings compared with the effects of vasoactive intestinal peptide (VIP) and substance P. Administration of CGRP into the vertebral artery caused a dose-dependent and long-lasting increase in blood flow. The in-vivo vasodilatory effects of substance P and VIP were short-lasting. CGRP (0.1 to 100 nmol/l) elicited a concentration-dependent relaxation of the isolated middle cerebral and basilar arteries when the tissues were precontracted by exposure to prostaglandin F2 alpha (PGF2 alpha). This effect was not antagonized by propranolol, atropine, tetrodotoxin, (N-Ac-Tyr1, D-Phe2)-growth hormone-releasing factor(1-29)-NH2 or (D-Pro2, D-Trp7,9) substance P. CGRP also reduced concentration-dependently the contraction of cerebral arteries induced by KCl or 9,11-epithio-11,12-metano-thromboxane A2 (STXA2). Mechanical removal of the endothelium did not abolish the vasodilatory response to CGRP. In PGF2 alpha-contracted canine cerebral arteries, VIP (0.1 to 100 nmol/l) was less potent a vasodilator than CGRP. At low concentrations (0.01 to 1 nmol/l) substance P elicited a rapid and short-lasting relaxation, and in the absence of endothelium this relaxation disappeared. These findings are clear evidence that CGRP modulates vascular tone.

  7. Impact of Food Components on in vitro Calcitonin Gene-Related Peptide Secretion-A Potential Mechanism for Dietary Influence on Migraine.

    PubMed

    Slavin, Margaret; Bourguignon, Julia; Jackson, Kyle; Orciga, Michael-Angelo

    2016-07-01

    Calcitonin gene-related peptide (CGRP) is a pivotal messenger in the inflammatory process in migraine. Limited evidence indicates that diet impacts circulating levels of CGRP, suggesting that certain elements in the diet may influence migraine outcomes. Interruption of calcium signaling, a mechanism which can trigger CGRP release, has been suggested as one potential route by which exogenous food substances may impact CGRP secretion. The objective of this study was to investigate the effects of foods and a dietary supplement on two migraine-related mechanisms in vitro: CGRP secretion from neuroendocrine CA77 cells, and calcium uptake by differentiated PC12 cells. Ginger and grape pomace extracts were selected for their anecdotal connections to reducing or promoting migraine. S-petasin was selected as a suspected active constituent of butterbur extract, the migraine prophylactic dietary supplement. Results showed a statistically significant decrease in stimulated CGRP secretion from CA77 cells following treatment with ginger (0.2 mg dry ginger equivalent/mL) and two doses of grape pomace (0.25 and 1.0 mg dry pomace equivalent/mL) extracts. Relative to vehicle control, CGRP secretion decreased by 22%, 43%, and 87%, respectively. S-petasin at 1.0 μM also decreased CGRP secretion by 24%. Meanwhile, S-petasin and ginger extract showed inhibition of calcium influx, whereas grape pomace had no effect on calcium. These results suggest that grape pomace and ginger extracts, and S-petasin may have anti-inflammatory propensity by preventing CGRP release in migraine, although potentially by different mechanisms, which future studies may elucidate further.

  8. Calcitonin gene-related peptide protects rats from cerebral ischemia/reperfusion injury via a mechanism of action in the MAPK pathway

    PubMed Central

    YANG, SI; YUAN, YONGJIE; JIAO, SHAN; LUO, QI; YU, JINLU

    2016-01-01

    The aim of the present study was to investigate the protective function and underlying mechanism of calcitonin gene-related peptide (CGRP) on cerebral ischemia/reperfusion damage in rats. Adult male Wistar rats were selected for the establishment of an ischemia/reperfusion injury model through the application of a middle cerebral artery occlusion. Animals were randomly divided into 6 groups of 24 animals. Drugs were administered according to the design of each group; animals were administered CGRP, CGRP8–37, PD98059 and SB20358. The neurobehavioral scores of the rat cerebral ischemia model in each group were calculated. The infarction range of the rat brain tissues was observed by 2,3,5-triphenyltetrazolium chloride staining. The expression levels of three proteins, phosphorylated c-Jun N-terminal kinase (JNK)/JNK, phosphorylated extracellular signal-regulated protein kinase (ERK)/ERK and p-p38/p38, in the mitogen-activated protein kinase (MAPK) pathway in the brain tissues was detected by western blotting. The results showed that CGRP could improve the neurobehavioral function of the ischemic rats and reduce the infarction range. Western blotting results confirmed that the function of the CGRP was mediated mainly through the reduction of the JNK and p38 phosphorylation and the promotion of ERK phosphorylation. Therefore, the present study confirmed that an increase in the exogenous CRGP could effectively improve ischemia/reperfusion injury of the brain tissue. The mechanisms of action were achieved through a reduction in JNK and p38 phosphorylation and an increase in ERL phosphorylation in the MAPK pathway. These mechanisms were interdependent. PMID:27284409

  9. A potent and selective calcitonin gene-related peptide (CGRP) receptor antagonist, MK-8825, inhibits responses to nociceptive trigeminal activation: Role of CGRP in orofacial pain.

    PubMed

    Romero-Reyes, Marcela; Pardi, Vanessa; Akerman, Simon

    2015-09-01

    Temporomandibular disorders (TMDs) are orofacial pains within the trigeminal distribution, which involve the masticatory musculature, the temporomandibular joint or both. Their pathophysiology remains unclear, as inflammatory mediators are thought to be involved, and clinically TMD presents pain and sometimes limitation of function, but often appears without gross indications of local inflammation, such as visible edema, redness and increase in temperature. Calcitonin gene-related peptide (CGRP) has been implicated in other pain disorders with trigeminal distribution, such as migraine, of which TMD shares a significant co-morbidity. CGRP causes activation and sensitization of trigeminal primary afferent neurons, independent of any inflammatory mechanisms, and thus may also be involved in TMD. Here we used a small molecule, selective CGRP receptor antagonist, MK-8825, to dissect the role of CGRP in inducing spontaneous nociceptive facial grooming behaviors, neuronal activation in the trigeminal nucleus, and systemic release of pro-inflammatory cytokines, in a mouse model of acute orofacial masseteric muscle pain that we have developed, as a surrogate of acute TMD. We show that CFA masseteric injection causes significant spontaneous orofacial pain behaviors, neuronal activation in the trigeminal nucleus, and release of interleukin-6 (IL-6). In mice pre-treated with MK-8825 there is a significant reduction in these spontaneous orofacial pain behaviors. Also, at 2 and 24h after CFA injection the level of Fos immunoreactivity in the trigeminal nucleus, used as a marker of neuronal activation, was much lower on both ipsilateral and contralateral sides after pre-treatment with MK-8825. There was no effect of MK-8825 on the release of IL-6. These data suggest that CGRP may be involved in TMD pathophysiology, but not via inflammatory mechanisms, at least in the acute stage. Furthermore, CGRP receptor antagonists may have therapeutic efficacy in the treatment of TMD, as they

  10. Changes in the Expressions of Iba1 and Calcitonin Gene-Related Peptide in Adjacent Lumbar Spinal Segments after Lumbar Disc Herniation in a Rat Model.

    PubMed

    Cho, Hee Kyung; Ahn, Sang Ho; Kim, So-Yeon; Choi, Mi-Jung; Hwang, Se Jin; Cho, Yun Woo

    2015-12-01

    Lumbar disc herniation is commonly encountered in clinical practice and can induce sciatica due to mechanical and/or chemical irritation and the release of proinflammatory cytokines. However, symptoms are not confined to the affected spinal cord segment. The purpose of this study was to determine whether multisegmental molecular changes exist between adjacent lumbar spinal segments using a rat model of lumbar disc herniation. Twenty-nine male Sprague-Dawley rats were randomly assigned to either a sham-operated group (n=10) or a nucleus pulposus (NP)-exposed group (n=19). Rats in the NP-exposed group were further subdivided into a significant pain subgroup (n=12) and a no significant pain subgroup (n=7) using mechanical pain thresholds determined von Frey filaments. Immunohistochemical stainings of microglia (ionized calcium-binding adapter molecule 1; Iba1), astrocytes (glial fibrillary acidic protein; GFAP), calcitonin gene-related peptide (CGRP), and transient receptor potential vanilloid 1 (TRPV1) was performed in spinal dorsal horns and dorsal root ganglions (DRGs) at 10 days after surgery. It was found immunoreactivity for Iba1-positive microglia was higher in the L5 (P=0.004) dorsal horn and in the ipsilateral L4 (P=0.009), L6 (P=0.002), and S1 (P=0.002) dorsal horns in the NP-exposed group than in the sham-operated group. The expression of CGRP was also significantly higher in ipsilateral L3, L4, L6, and S1 segments and in L5 DRGs at 10 days after surgery in the NP-exposed group than in the sham-operated group (P<0.001). Our results indicate that lumbar disc herniation upregulates microglial activity and CGRP expression in many adjacent and ipsilateral lumbar spinal segments.

  11. Sensitization of Primary Afferent Nociceptors Induced by Intradermal Capsaicin Involves the Peripheral Release of Calcitonin Gene-Related Peptide Driven by Dorsal Root Reflexes

    PubMed Central

    Li, Dingge; Ren, Yong; Xu, Xijin; Zou, Xiaoju; Fang, Li; Lin, Qing

    2008-01-01

    Neuropeptides released from axons of primary afferent nociceptive neurons are the key elements for the incidence of neurogenic inflammation and their release is associated with dorsal root reflexes (DRRs). However, whether the release is due to the triggering of DRRs and plays a role in inflammation-induced pain still remain to be determined. The present study assessed the role of calcitonin gene-related peptide (CGRP) in sensitization of primary afferent nociceptors induced by activation of transient receptor potential vanilloid-1 (TRPV1) following intradermal injection of capsaicin and determined if this release is due to activation of primary afferent neurons antidromically by triggering of DRRs. Under dorsal root intact conditions, primary afferent nociceptive fibers recorded in anesthetized rats could be sensitized by capsaicin injection, as shown by an increase in afferent responses and lowering of the response threshold to mechanical stimuli. After DRRs were removed by dorsal rhizotomy, the capsaicin-evoked sensitization was significantly reduced. In dorsal root intact rats, peripheral pretreatment with a CGRP receptor antagonist could dose-dependently reduce the capsaicin-induced sensitization. Peripheral post-treatment with CGRP could dose-dependently restore the capsaicin-induced sensitization under dorsal rhizotomized conditions. Capsaicin injection evoked increases in numbers of single and double labeled TRPV1 and CGRP neurons in ipsilateral dorsal root ganglia (DRG). After dorsal rhizotomy, these evoked expressions were significantly inhibited. Perspective These data indicate that the DRR-mediated neurogenic inflammation enhances sensitization of primary afferent nociceptors induced by capsaicin injection. The underlying mechanism involves antidromic activation of DRG neurons via up-regulation of TRPV1 receptors whereby CGRP is released peripherally. PMID:18701354

  12. Impact of Food Components on in vitro Calcitonin Gene-Related Peptide Secretion—A Potential Mechanism for Dietary Influence on Migraine

    PubMed Central

    Slavin, Margaret; Bourguignon, Julia; Jackson, Kyle; Orciga, Michael-Angelo

    2016-01-01

    Calcitonin gene-related peptide (CGRP) is a pivotal messenger in the inflammatory process in migraine. Limited evidence indicates that diet impacts circulating levels of CGRP, suggesting that certain elements in the diet may influence migraine outcomes. Interruption of calcium signaling, a mechanism which can trigger CGRP release, has been suggested as one potential route by which exogenous food substances may impact CGRP secretion. The objective of this study was to investigate the effects of foods and a dietary supplement on two migraine-related mechanisms in vitro: CGRP secretion from neuroendocrine CA77 cells, and calcium uptake by differentiated PC12 cells. Ginger and grape pomace extracts were selected for their anecdotal connections to reducing or promoting migraine. S-petasin was selected as a suspected active constituent of butterbur extract, the migraine prophylactic dietary supplement. Results showed a statistically significant decrease in stimulated CGRP secretion from CA77 cells following treatment with ginger (0.2 mg dry ginger equivalent/mL) and two doses of grape pomace (0.25 and 1.0 mg dry pomace equivalent/mL) extracts. Relative to vehicle control, CGRP secretion decreased by 22%, 43%, and 87%, respectively. S-petasin at 1.0 μM also decreased CGRP secretion by 24%. Meanwhile, S-petasin and ginger extract showed inhibition of calcium influx, whereas grape pomace had no effect on calcium. These results suggest that grape pomace and ginger extracts, and S-petasin may have anti-inflammatory propensity by preventing CGRP release in migraine, although potentially by different mechanisms, which future studies may elucidate further. PMID:27376323

  13. Distribution and morphology of calcitonin gene-related peptide and substance P immunoreactive axons in the whole-mount atria of mice.

    PubMed

    Li, Liang; Hatcher, Jeffrey T; Hoover, Donald B; Gu, He; Wurster, Robert D; Cheng, Zixi Jack

    2014-04-01

    The murine model has been used to investigate the role of cardiac sensory axons in various disease states. However, the distribution and morphological structures of cardiac nociceptive axons in normal murine tissues have not yet been well characterized. In this study, whole-mount atria from FVB mice were processed with calcitonin gene-related peptide (CGRP) and substance P (SP) primary antibodies followed by secondary antibodies, and then examined using confocal microscopy. We found: 1) Large CGRP-IR axon bundles entered the atria with the major veins, and these large bundles bifurcated into small bundles and single axons that formed terminal end-nets and free endings in the epicardium. Varicose CGRP-IR axons had close contacts with muscle fibers, and some CGRP-IR axons formed varicosities around principle neurons (PNs) within intrinsic cardiac ganglia (ICGs). 2) SP-IR axons also were found in the same regions of the atria, attached to veins, and within cardiac ganglia. Similar to CGRP-IR axons, these SP-IR axons formed terminal end-nets and free endings in the atrial epicardium and myocardium. Within ICGs, SP-IR axons formed varicose endings around PNs. However, SP-IR nerve fibers were less abundant than CGRP-IR fibers in the atria. 3) None of the PNs were CGRP-IR or SP-IR. 4) CGRP-IR and SP-IR often colocalized in terminal varicosities around PNs. Collectively, our data document the distribution pattern and morphology of CGRP-IR and SP-IR axons and terminals in different regions of the atria. This knowledge provides useful information for CGRP-IR and SP-IR axons that can be referred to in future studies of pathological remodeling.

  14. Changes in the Expressions of Iba1 and Calcitonin Gene-Related Peptide in Adjacent Lumbar Spinal Segments after Lumbar Disc Herniation in a Rat Model

    PubMed Central

    2015-01-01

    Lumbar disc herniation is commonly encountered in clinical practice and can induce sciatica due to mechanical and/or chemical irritation and the release of proinflammatory cytokines. However, symptoms are not confined to the affected spinal cord segment. The purpose of this study was to determine whether multisegmental molecular changes exist between adjacent lumbar spinal segments using a rat model of lumbar disc herniation. Twenty-nine male Sprague-Dawley rats were randomly assigned to either a sham-operated group (n=10) or a nucleus pulposus (NP)-exposed group (n=19). Rats in the NP-exposed group were further subdivided into a significant pain subgroup (n=12) and a no significant pain subgroup (n=7) using mechanical pain thresholds determined von Frey filaments. Immunohistochemical stainings of microglia (ionized calcium-binding adapter molecule 1; Iba1), astrocytes (glial fibrillary acidic protein; GFAP), calcitonin gene-related peptide (CGRP), and transient receptor potential vanilloid 1 (TRPV1) was performed in spinal dorsal horns and dorsal root ganglions (DRGs) at 10 days after surgery. It was found immunoreactivity for Iba1-positive microglia was higher in the L5 (P=0.004) dorsal horn and in the ipsilateral L4 (P=0.009), L6 (P=0.002), and S1 (P=0.002) dorsal horns in the NP-exposed group than in the sham-operated group. The expression of CGRP was also significantly higher in ipsilateral L3, L4, L6, and S1 segments and in L5 DRGs at 10 days after surgery in the NP-exposed group than in the sham-operated group (P<0.001). Our results indicate that lumbar disc herniation upregulates microglial activity and CGRP expression in many adjacent and ipsilateral lumbar spinal segments. PMID:26713069

  15. Enhancement by calcitonin gene-related peptide of nicotinic receptor-operated noncontractile Ca2+ mobilization at the mouse neuromuscular junction.

    PubMed Central

    Kimura, I.; Tsuneki, H.; Dezaki, K.; Kimura, M.

    1993-01-01

    1. The involvement of calcitonin gene-related peptide (CGRP) in the mechanism of nicotinic acetylcholine receptor-operated noncontractile Ca2+ mobilization (not accompanied by twitch tension) was investigated by measuring Ca(2+)-aequorin luminescence at the neuromuscular junction of mouse diaphragm muscle treated with neostigmine. 2. Noncontractile Ca2+ transients were enhanced by 4-aminopyridine (100 microM), a K+ channel blocker, and inhibited by botulinum toxin (1-100 micrograms, i.p.) and hexamethonium (10-100 microM), a neuronal nicotinic receptor antagonist. 3. Noncontractile Ca2+ transients were diminished by CGRP8-37 (10-20 microM), a CGRP antagonist. CGRP (0.3-10 nM) prolonged the duration of noncontractile Ca2+ transients. The effect of CGRP was suppressed by CGRP8-37 (0.1 microM). 4. Noncontractile Ca2+ transients were inhibited by H-89 (0.1-1 microM), a protein kinase-A inhibitor. The catalytic subunit of protein kinase-A and AA373 (300 microM), a protein kinase-A activator, prolonged the duration of noncontractile transients. The prolongations either by CGRP or by AA373 were not observed in the presence of H-89 (0.1 microM). 5. Contractile (accompanied by twitch tension) but not noncontractile Ca2+ transients were decreased by 12-O-tetradecanoyl phorbol 13-acetate (TPA, 0.3-1 microM), a protein kinase-C activator. Phospholipase A2 increased only contractile Ca2+ transients. Calmodulin-related agents affected neither type of Ca2+ transients. 6. These results provide the first evidence that nicotinic acetylcholine receptor-operated noncontractile Ca2+ mobilization is promoted by nerve-released CGRP activating protein kinase-A, and is dependent on the accumulated amounts of acetylcholine at the neuromuscular junction where desensitization might readily develop. PMID:8242236

  16. Role of peptidergic nerve terminals in the skin: reversal of thermal sensation by calcitonin gene-related peptide in TRPV1-depleted neuropathy.

    PubMed

    Hsieh, Yu-Lin; Lin, Chih-Lung; Chiang, Hao; Fu, Yaw-Syan; Lue, June-Horng; Hsieh, Sung-Tsang

    2012-01-01

    To investigate the contribution of peptidergic intraepidermal nerve fibers (IENFs) to nociceptive responses after depletion of the thermal-sensitive receptor, transient receptor potential vanilloid subtype 1 (TRPV1), we took advantage of a resiniferatoxin (RTX)-induced neuropathy which specifically affected small-diameter dorsal root ganglion (DRG) neurons and their corresponding nerve terminals in the skin. Thermal hypoalgesia (p<0.001) developed from RTX-treatment day 7 (RTXd7) and became normalized from RTXd56 to RTXd84. Substance P (SP)(+) and TRPV1(+) neurons were completely depleted (p = 0.0001 and p<0.0001, respectively), but RTX had a relatively minor effect on calcitonin gene-related peptide (CGRP)(+) neurons (p = 0.029). Accordingly, SP(+) (p<0.0001) and TRPV1(+) (p = 0.0008) IENFs were permanently depleted, but CGRP(+) IENFs (p = 0.012) were only transiently reduced and had recovered by RTXd84 (p = 0.83). The different effects of RTX on peptidergic neurons were attributed to the higher co-localization ratio of TRPV1/SP than of TRPV1/CGRP (p = 0.029). Thermal hypoalgesia (p = 0.0018) reappeared with an intraplantar injection of botulinum toxin type A (botox), and the temporal course of withdrawal latencies in the hot-plate test paralleled the innervation of CGRP(+) IENFs (p = 0.0003) and CGRP contents in skin (p = 0.01). In summary, this study demonstrated the preferential effects of RTX on depletion of SP(+) IENFs which caused thermal hypoalgesia. In contrast, the skin was reinnervated by CGRP(+) IENFs, which resulted in a normalization of nociceptive functions.

  17. Co-expression of Achaete-Scute Homologue-1 and Calcitonin Gene-Related Peptide during NNK-Induced Pulmonary Neuroendocrine Hyperplasia and Carcinogenesis in Hamsters

    PubMed Central

    Naizhen, Xu; Linnoila, R. Ilona; Kimura, Shioko

    2016-01-01

    Achaete-scute homologue-1 or ASCL1 (MASH1, hASH1) plays roles in neural development and pulmonary neuroendocrine (NE) differentiation, and it is expressed in certain lung cancers. This study was aimed to assess whether and/or how ASCL1 plays a role in 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)-induced pulmonary NE hyperplasia and carcinogenesis in hamsters. Hamsters were injected 3 times weekly with either NNK or solvent alone (control) for treatment periods of 6 and 24 weeks, both without and with 6-week recovery. Immunohistochemical analysis was carried out to examine the expressions of ASCL1, CGRP (calcitonin gene-related peptide), secretoglobin SCGB1A1 (club [Clara] cell specific 10 kD protein, CC10, CCSP), synaptophysin (SYP), and PCNA (proliferating cell nuclear antigen). The number of ASCL1-expressing NE foci per airway increased from 0.8 in controls to 1.6 and 2.0 during NNK exposure for 6 and 24 weeks, respectively, and the number of cells per foci doubled after NNK exposure. Most ASCL1-expressing cells in NEBs (neuroepithelial bodies) were also CGRP immunoreactive; NNK enhanced this co-expression with CGRP, a NE marker with known proliferation-promoting properties. NNK also increased PCNA expression within NE foci. NNK-induced tumors showed no immunoreactivity for NE markers. This study confirms ASCL1 as an excellent marker for pulmonary NE cells and demonstrates CGRP co-expression in ASCL1-positive NEB cells participating in NNK-induced NE hyperplasia. PMID:27877229

  18. The effect of 17β-estradiol on gene expression of calcitonin gene-related peptide and some pro-inflammatory mediators in peripheral blood mononuclear cells from patients with pure menstrual migraine

    PubMed Central

    Karkhaneh, Azam; Ansari, Mohammad; Emamgholipour, Solaleh; Rafiee, Mohammad Hessam

    2015-01-01

    Objective(s): The neuropeptide calcitonin gene-related peptide (CGRP) has long been postulated to play an integral role in the pathophysiology of migraine. Earlier studies showed that CGRP can stimulate the synthesis and release of nitric oxide (NO) and cytokines from trigeminal ganglion glial cells. The purpose of this study was to determine the effect of 17β-estradiol in regulation of CGRP expression, inducible nitric oxide synthase (iNOS) activity, and NO and interleukin-1beta (IL-1β) release in cultured peripheral blood mononuclear cells (PBMCs) from patients with pure menstrual migraine and healthy individuals. Materials and Methods: This study was performed on twelve patients with pure menstrual migraine and twelve age-and sex-matched healthy individuals. PBMCs treated with 17β-estradiol for 24 hr at physiological and pharmacological doses. Gene expression was evaluated by real time-PCR. CGRP and IL-1β proteins in culture supernatant were determined by ELISA method. Activity of iNOS in PBMCs and total nitrite in the culture supernatant were measured by colorimetric assays. Results: Treatment with 17β-estradiol had a biphasic effect on expression of CGRP. We found that 17β-estradiol treatment at pharmacological dose significantly increases mRNA expression of CGRP in both groups (P<0.001), whereas at physiological dose it could significantly decrease CGRP mRNA expression (P<0.001), CGRP protein levels, IL-1β release, NO production and iNOS activity only in patient groups (P<0.05). Conclusion: Collectively, it appears that 17β-estradiol can exert protective effect on decrease of inflammation in migraine via decrease in levels of CGRP, IL-1β and iNOS activity; however, more studies are necessary in this regard. PMID:26526225

  19. The effect of combined regulation of the expression of peroxisome proliferator-activated receptor-γ and calcitonin gene-related peptide on alcohol-induced adipogenic differentiation of bone marrow mesenchymal stem cells.

    PubMed

    Li, Jinfeng; Wang, Yisheng; Li, Yuebai; Sun, Junkui; Zhao, Guoqiang

    2014-07-01

    Studies have shown that alcohol can upregulate the expression of peroxisome proliferator-activated receptor-γ (PPARγ) gene in bone marrow mesenchymal stem cells (BMSCs). High expression of PPARγ can promote adipogenic differentiation of BMSCs, and reduce their osteogenic differentiation. Abnormal proliferation of adipocytes and fatty accumulation in osteocytes can result in high intraosseous pressure and disturbance of blood circulation in the femoral head, which induces osteonecrosis of the femoral head (ONFH). Downregulation of PPARγ is efficient in inhibiting adipogenesis and maintaining osteogenesis of BMSCs, which might potentially reduce the incidence of ONFH. Calcitonin gene-related peptide (CGRP) is a neuropeptide gene which has been closely associated with bone regeneration. In this study, we aimed to observe the effect of combined regulation of the expression of PPARγ and CGRP genes on alcohol-induced adipogenic differentiation of BMSCs. Our results demonstrated that simultaneous downregulation of PPARγ and upregulation of CGRP was efficient in suppressing adipogenic differentiation of BMSCs and promoting their osteogenic differentiation. These findings might enlighten a novel approach for the prevention of ONFH.

  20. The Influence of Low Doses of Zearalenone and T-2 Toxin on Calcitonin Gene Related Peptide-Like Immunoreactive (CGRP-LI) Neurons in the ENS of the Porcine Descending Colon

    PubMed Central

    Makowska, Krystyna; Obremski, Kazimierz; Zielonka, Lukasz; Gonkowski, Slawomir

    2017-01-01

    The enteric nervous system (ENS) can undergo adaptive and reparative changes in response to physiological and pathological stimuli. These manifest primarily as alterations in the levels of active substances expressed by the enteric neuron. While it is known that mycotoxins can affect the function of the central and peripheral nervous systems, knowledge about their influence on the ENS is limited. Therefore, the aim of the present study was to investigate the influence of low doses of zearalenone (ZEN) and T-2 toxin on calcitonin gene related peptide-like immunoreactive (CGRP-LI) neurons in the ENS of the porcine descending colon using a double immunofluorescence technique. Both mycotoxins led to an increase in the percentage of CGRP-LI neurons in all types of enteric plexuses and changed the degree of co-localization of CGRP with other neuronal active substances, such as substance P, galanin, nitric oxide synthase, and cocaine- and amphetamine-regulated transcript peptide. The obtained results demonstrate that even low doses of ZEN and T-2 can affect living organisms and cause changes in the neurochemical profile of enteric neurons. PMID:28287437

  1. CALCITONIN GENE-RELATED PEPTIDE IN THE BED NUCLEUS OF THE STRIA TERMINALIS PRODUCES AN ANXIETY-LIKE PATTERN OF BEHAVIOR AND INCREASES NEURAL ACTIVATION IN ANXIETY-RELATED STRUCTURES

    PubMed Central

    Sink, KS; Walker, DL; Yang, Y; Davis, M

    2011-01-01

    Calcitonin gene-related peptide (CGRP) evokes anxiety-like responses when infused into the lateral ventricle of rats. Because the bed nucleus of the stria terminalis (BNST) lies immediately adjacent to the lateral ventricle, is rich in CGRP receptors, and has itself been implicated in anxiety, we evaluated the hypothesis that these effects are attributable to stimulation of CGRP receptors within the BNST itself. Bilateral intra-BNST, but not dorsal, CGRP infusions (0, 200, 400, 800 ng/side) dose-dependently enhanced startle amplitude, and produced an anxiety-like response on the elevated plus maze. Intra-BNST infusion of the CGRP antagonist, αCGRP8-37, blocked the effect of CGRP on startle, and also blocked startle potentiation produced by exposure to trimethylthiazoline (TMT – a component of fox feces that induces anxiety-like behavior in rats). Intra-BNST, but not dorsal, CGRP infusions also increased c-Fos immunoreactivity in a number of anxiety-related brain areas (central nucleus of the amygdala, locus coeruleus, ventrolateral septal nucleus, paraventricular hypothalamic nucleus, lateral hypothalamus, lateral parabrachial nucleus, dorsal raphe nucleus, and nucleus accumbens shell), all of which receive direct projections from the BNST. Together, the results indicate that the activation of BNST CGRP receptors is both necessary and sufficient for some anxiety responses and that these effects may be mediated by activation of a wider network of BNST efferent structures. If so, inhibition of CGRP receptors may be a clinically useful strategy for anxiety reduction. PMID:21289190

  2. Depletion of substance P, neurokinin A and calcitonin gene-related peptide from the contralateral and ipsilateral caudal trigeminal nucleus following unilateral electrical stimulation of the trigeminal ganglion; a possible neurophysiological and neuroanatomical link to generalized head pain.

    PubMed

    Samsam, M; Coveñas, R; Csillik, B; Ahangari, R; Yajeya, J; Riquelme, R; Narváez, J A; Tramu, G

    2001-03-01

    Primary trigeminal neurons of the trigeminal ganglion (TG) innervate major parts of the face and head, including the dura. Electrical stimulation of the TG at specific parameters, can activate its nociceptive neurons and may serve as an experimental pain model. Markowitz [J. Neurosci. 7 (1987) 4129] reported that electrical stimulation of the trigeminal ganglion (TG) causes extravasation of plasma proteins from venules of the trigeminally innervated domain possibly due to the release of vasoactive substances. Neurogenic inflammation (vasodilatation, plasma protein extravasation, release of vasoactive peptides) in dura may serve as one of the possible pathomechanisms underlying vascular head pain [Moskowitz, Ann. Neurol. 16 (1984) 157]. We performed a unilateral electrical stimulation (7.5 Hz, 5 ms, 0.8-1.4 mA for 5 min) of the TG in rat, to induce a neurogenic inflammation in the peripheral trigeminal domain including the dura, looking for calcitonin gene related peptide (CGRP), substance P (SP) and neurokinin A (NKA) immunoreactivity (IR) in the caudal trigeminal nucleus (CTN) into which massive central trigeminal processes terminate. Here, we show patchy depletion(s) of CGRP-, SP- and NKA-IRs in the contralateral CTN of the rat in addition to their ipsilateral depletion. Such depletion is due to the release of these neuropeptides in the CTN leading to the activation of bilateral trigeminal nociceptive pathway. These data afford the possibility that under specific frequencies (which may roughly correlate to the intensity of the painful stimulus) and/or specific intensities (may correlate to specific areas of the peripheral trigeminal domain) of stimulation, activation of one side of the TG may activate bilateral trigeminal nociceptive pathway leading to the perception of an ill localized/generalized pain or headache rather than a unilateral one.

  3. In vivo quantification of calcitonin gene-related peptide receptor occupancy by telcagepant in rhesus monkey and human brain using the positron emission tomography tracer [11C]MK-4232.

    PubMed

    Hostetler, Eric D; Joshi, Aniket D; Sanabria-Bohórquez, Sandra; Fan, Hong; Zeng, Zhizhen; Purcell, Mona; Gantert, Liza; Riffel, Kerry; Williams, Mangay; O'Malley, Stacey; Miller, Patricia; Selnick, Harold G; Gallicchio, Steven N; Bell, Ian M; Salvatore, Christopher A; Kane, Stefanie A; Li, Chi-Chung; Hargreaves, Richard J; de Groot, Tjibbe; Bormans, Guy; Van Hecken, Anne; Derdelinckx, Inge; de Hoon, Jan; Reynders, Tom; Declercq, Ruben; De Lepeleire, Inge; Kennedy, W P; Blanchard, Rebecca; Marcantonio, Eugene E; Sur, Cyrille; Cook, Jacquelynn J; Van Laere, Koen; Evelhoch, Jeffrey L

    2013-11-01

    Calcitonin gene-related peptide (CGRP) is a potent neuropeptide whose agonist interaction with the CGRP receptor (CGRP-R) in the periphery promotes vasodilation, neurogenic inflammation and trigeminovascular sensory activation. This process is implicated in the cause of migraine headaches, and CGRP-R antagonists in clinical development have proven effective in treating migraine-related pain in humans. CGRP-R is expressed on blood vessel smooth muscle and sensory trigeminal neurons and fibers in the periphery as well as in the central nervous system. However, it is not clear what role the inhibition of central CGRP-R plays in migraine pain relief. To this end, the CGRP-R positron emission tomography (PET) tracer [(11)C]MK-4232 (2-[(8R)-8-(3,5-difluorophenyl)-6,8-[6-(11)C]dimethyl-10-oxo-6,9-diazaspiro[4.5]decan-9-yl]-N-[(2R)-2'-oxospiro[1,3-dihydroindene-2,3'-1H-pyrrolo[2,3-b]pyridine]-5-yl]acetamide) was discovered and developed for use in clinical PET studies. In rhesus monkeys and humans, [(11)C]MK-4232 displayed rapid brain uptake and a regional brain distribution consistent with the known distribution of CGRP-R. Monkey PET studies with [(11)C]MK-4232 after intravenous dosing with CGRP-R antagonists validated the ability of [(11)C]MK-4232 to detect changes in CGRP-R occupancy in proportion to drug plasma concentration. Application of [(11)C]MK-4232 in human PET studies revealed that telcagepant achieved only low receptor occupancy at an efficacious dose (140 mg PO). Therefore, it is unlikely that antagonism of central CGRP-R is required for migraine efficacy. However, it is not known whether high central CGRP-R antagonism may provide additional therapeutic benefit.

  4. Activation of TRPV1 mediates calcitonin gene-related peptide release, which excites trigeminal sensory neurons and is attenuated by a retargeted botulinum toxin with anti-nociceptive potential.

    PubMed

    Meng, Jianghui; Ovsepian, Saak V; Wang, Jiafu; Pickering, Mark; Sasse, Astrid; Aoki, K Roger; Lawrence, Gary W; Dolly, J Oliver

    2009-04-15

    Excessive release of inflammatory/pain mediators from peripheral sensory afferents renders nerve endings hyper-responsive, causing central sensitization and chronic pain. Herein, the basal release of proinflammatory calcitonin gene-related peptide (CGRP) was shown to increase the excitability of trigeminal sensory neurons in brainstem slices via CGRP1 receptors because the effect was negated by an antagonist, CGRP8-37. This excitatory action could be prevented by cleaving synaptosomal-associated protein of M(r) 25,000 (SNAP-25) with botulinum neurotoxin (BoNT) type A, a potent inhibitor of exocytosis. Strikingly, BoNT/A proved unable to abolish the CGRP1 receptor-mediated effect of capsaicin, a nociceptive TRPV1 stimulant, or its elevation of CGRP release from trigeminal ganglionic neurons (TGNs) in culture. Although the latter was also not susceptible to BoNT/E, apparently attributable to a paucity of its acceptors (glycosylated synaptic vesicle protein 2 A/B), this was overcome by using a recombinant chimera (EA) of BoNT/A and BoNT/E. It bound effectively to the C isoform of SV2 abundantly expressed in TGNs and cleaved SNAP-25, indicating that its /A binding domain (H(C)) mediated uptake of the active /E protease. The efficacy of /EA is attributable to removal of 26 C-terminal residues from SNAP-25, precluding formation of SDS-resistant SNARE complexes. In contrast, exocytosis could be evoked after deleting nine of the SNAP-25 residues with /A but only on prolonged elevation of [Ca(2+)](i) with capsaicin. This successful targeting of /EA to nociceptive neurons and inhibition of CGRP release in vitro and in situ highlight its potential as a new therapy for sensory dysmodulation and chronic pain.

  5. [Involvement of the receptor component protein in the regulation of vascular peroxidase-1 expression induced by calcitonin gene-related peptide and angiotensin II in vascular smooth muscle cell].

    PubMed

    Liu, Yan-Mei; Peng, Hong-Yan; Guo, Feng; Quan, Hai-Yan; Luo, Jing-Fei; Qin, Xu-Ping

    2015-04-25

    Angiotensin II (Ang II) and calcitonin gene-related peptide (CGRP) play important roles in vascular injury and protection. In order to determine the role of CGRP receptor component protein (RCP) in signal transduction whereby CGRP and Ang II mediate the expression of vascular peroxidase-1 (VPO1) in vascular smooth muscle cell (VSMC), mouse derived A10 vascular smooth muscle cell line (A10VSMC) was cultured with CGRP or/and Ang II in vitro. RCP-specific small interference RNA (siRNA-RCP) was used to silence oligonucleotide sequence. Western blot and RT-PCR were used to determine the protein and mRNA expressions of RCP and VPO1, respectively. The results showed that the expressions of RCP and VPO1 were increased in the presence of CGRP or Ang II in the quiescent A10VSMC. But the protein expressions of RCP and VPO1 induced by Ang II were decreased by pretreatment of CGRP (P < 0.05). The expressions of VPO1 were decreased in all the groups treated with siRNA-RCP, compared with those of wide-type counterparts. Meanwhile, the expression of VPO1 was significantly induced by CGRP but not Ang II in the siRNA-RCP treated A10VSMCs. Ang II in combination with CGRP increased the protein expression of VPO1 in the siRNA-RCP-transfected cells, compared with Ang II alone, and this effect could be abolished by catalase. The results suggest that RCP may play an important role in the integration of signal transduction whereby CGRP and Ang II receptors jointly regulate VPO1 expression in VSMC.

  6. Source and origin of nerve fibres immunoreactive for substance P and calcitonin gene-related peptide in the normal and chronically denervated superior cervical sympathetic ganglion of the rat.

    PubMed

    Zaidi, Z F; Matthews, M R

    2013-01-01

    Immunohistochemical studies of sympathetic ganglia have indicated that the normal rat superior cervical ganglion contains both SP-IR and CGRP-IR fibres, and CGRP- and SP-immunoreactivity coexist in some fibres. In rat sympathetic ganglia decentralization by preganglionic denervation leads to intraganglionic increase of peptidergic fibres immunoreactive (IR) for substance P (SP) and calcitonin gene-related peptide. We explored the sources of SP- and CGRP-IR fibres in normal and in chronically decentralized rat SCGs. The distribution of immunoreactivities for CGRP and SP was determined in SCGs of normal rats and of rats following preganglionic denervation followed by sensory denervation. Ganglia were studied after short-term (2-5 days) sensory denervation, and long-term (7-16 months) sympathetic denervation followed by short-term (2 days) sensory denervation. To explore for the production of SP and CGRP by intrinsic neurones within the ganglion, normal and chronically decentralized SCGs were examined following pretreatment by local in vivo application of colchicine. Normal and chronically decentralized ganglia were also injected with fluorescent tracer Fluorogold for retrograde tracing of extrinsic fibres back to their neurones of origin. The observations suggest that in normal SCG in the rat the SP-IR and CGRP-IR nerve fibres are derived via direct links from vagus and glossopharyngeal nerves and the cervical plexus, or from nerve fibres running along the cervical sympathetic trunk, and the external carotid and the internal carotid nerves. Sensory nerve inputs to the rat SCG following decentralization may contribute to the low levels of ganglionic activation observable in the autonomic failure of multiple system atrophy in man.

  7. Differential expression of genes related to gain and intake in the liver of beef cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: To better understand which genes play a role in cattle feed intake and gain, we evaluated differential expression of genes related to gain and intake in the liver of crossbred beef steers. Based on past transcriptomics studies on cattle liver, we hypothesized that genes related to metabo...

  8. Discovery of (5S,6S,9R)-5-amino-6-(2,3-difluorophenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-9-yl 4-(2-oxo-2,3-dihydro-1H-imidazo[4,5-b]pyridin-1-yl)piperidine-1-carboxylate (BMS-927711): an oral calcitonin gene-related peptide (CGRP) antagonist in clinical trials for treating migraine.

    PubMed

    Luo, Guanglin; Chen, Ling; Conway, Charles M; Denton, Rex; Keavy, Deborah; Signor, Laura; Kostich, Walter; Lentz, Kimberley A; Santone, Kenneth S; Schartman, Richard; Browning, Marc; Tong, Gary; Houston, John G; Dubowchik, Gene M; Macor, John E

    2012-12-13

    Calcitonin gene-related peptide (CGRP) receptor antagonists have demonstrated clinical efficacy in the treatment of acute migraine. Herein, we describe the design, synthesis, and preclinical characterization of a highly potent, oral CGRP receptor antagonist BMS-927711 (8). Compound 8 has good oral bioavailability in rat and cynomolgus monkey, attractive overall preclinical properties, and shows dose-dependent activity in a primate model of CGRP-induced facial blood flow. Compound 8 is presently in phase II clinical trials.

  9. Differential sorting and packaging of capa-gene related products in an insect.

    PubMed

    Pollák, Edit; Eckert, Manfred; Molnár, László; Predel, Reinhard

    2005-01-03

    A unique costorage of neuropeptides was recently found in the abdominal perisympathetic organs (PSOs) of the American cockroach, Periplaneta americana. Having specific antisera directed against all peptides belonging to this neurosecretory system, we examined the sorting of PSO-peptides in the soma of the median neurosecretory cells of abdominal ganglia by using immunoelectron microscopic double stainings. The data indicate that all six abundant neuropeptides of this neurohormonal system, which includes three capa-gene related products, are primarily incorporated into separate vesicles. These vesicles fuse with each other in the cytoplasm and become translucent on their way to the axon hillock. By means of light microscopy and MALDI-TOF mass spectrometry, an identical population of neuropeptides was found in interneurons of the brain. As revealed by subsequent immunoelectron microscopic analysis, the peptides of these cells are separately packed into dense core vesicles but do not fuse with each other. Thus, hitherto unknown cell-type-specific sorting mechanisms occur in neurosecretory cells and interneurons, respectively.

  10. Identifying genes related with rheumatoid arthritis via system biology analysis.

    PubMed

    Liu, Tao; Lin, Xinmei; Yu, Hongjian

    2015-10-15

    Rheumatoid arthritis (RA) is a chronic, inflammatory joint disease that mainly attacks synovial joints. However, the underlying systematic relationship among different genes and biological processes involved in the pathogenesis are still unclear. By analyzing and comparing the transcriptional profiles from RA, OA (osteoarthritis) patients as well as ND (normal donors) with bioinformatics methods, we tend to uncover the potential molecular networks and critical genes which play important roles in RA and OA development. Initially, hierarchical clustering was performed to classify the overall transcriptional profiles. Differentially expressed genes (DEGs) between ND and RA and OA patients were identified. Furthermore, PPI networks were constructed, functional modules were extracted, and functional annotation was also applied. Our functional analysis identifies 22 biological processes and 2 KEGG pathways enriched in the commonly-regulated gene set. However, we found that number of set of genes differentially expressed genes only between RA and ND reaches up to 244, indicating this gene set may specifically accounts for processing to disease of RA. Additionally, 142 biological processes and 19 KEGG pathways are over-represented by these 244 genes. Meanwhile, although another 21 genes were differentially expressed only in OA and ND, no biological process nor pathway is over-represented by them.

  11. Identifying Novel Candidate Genes Related to Apoptosis from a Protein-Protein Interaction Network

    PubMed Central

    Wang, Baoman; Yuan, Fei; Kong, Xiangyin; Hu, Lan-Dian; Cai, Yu-Dong

    2015-01-01

    Apoptosis is the process of programmed cell death (PCD) that occurs in multicellular organisms. This process of normal cell death is required to maintain the balance of homeostasis. In addition, some diseases, such as obesity, cancer, and neurodegenerative diseases, can be cured through apoptosis, which produces few side effects. An effective comprehension of the mechanisms underlying apoptosis will be helpful to prevent and treat some diseases. The identification of genes related to apoptosis is essential to uncover its underlying mechanisms. In this study, a computational method was proposed to identify novel candidate genes related to apoptosis. First, protein-protein interaction information was used to construct a weighted graph. Second, a shortest path algorithm was applied to the graph to search for new candidate genes. Finally, the obtained genes were filtered by a permutation test. As a result, 26 genes were obtained, and we discuss their likelihood of being novel apoptosis-related genes by collecting evidence from published literature. PMID:26543496

  12. Negative pressure wound therapy-associated tissue trauma and pain: a controlled in vivo study comparing foam and gauze dressing removal by immunohistochemistry for substance P and calcitonin gene-related peptide in the wound edge.

    PubMed

    Malmsjö, Malin; Gustafsson, Lotta; Lindstedt, Sandra; Ingemansson, Richard

    2011-12-01

    Pain upon negative pressure wound therapy (NPWT) dressing removal has been reported and is believed to be associated with the observation that granulation tissue grows into foam. Wound tissue damage upon removal of the foam may cause the reported pain. Calcitonin gene-related peptide (CGRP) and substance P are neuropeptides that cause inflammation and signal pain and are known to be released when tissue trauma occurs. The aim of this controlled in vivo study was to compare the expression of CGRP and substance P in the wound bed in control wounds and following NPWT and foam or gauze dressing removal. Eight pigs with two wounds each were treated with open-pore structure polyurethane foam or AMD gauze and NPWT of 0 (control) or -80 mm Hg for 72 hours. Following removal of the wound filler, the expression of CGRP and substance P was measured, using arbitrary units, in sections of biopsies from the wound bed using immunofluorescence techniques. Substance P and CGRP were more abundant in the wound edge following the removal of foam than of gauze dressings and least abundant in control wounds. The immunofluorescence staining of the wound edge for CGRP was 52 ± 3 au after the removal of gauze and 97 ± 5 au after the removal of foam (P <0.001). For substance P, the staining was 55 ± 3 au after gauze removal and 95 ± 4 au after foam removal (P <0.001). CGRP and substance P staining was primarily located to nerves and leukocytes. The increase in CGRP and substance P immunofluorescence was especially prominent in the dermis but also was seen in subcutaneous and muscle tissue. Using gauze may be one way of reducing NPWT dressing change-related pain. New wound fillers designed to optimize granulation tissue formation and minimize pain issues presumably will be developed in the near future.

  13. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  14. [Progress in genes related to seed-coat color in soybean].

    PubMed

    Song, Jian; Guo, Yong; Yu, Li-Jie; Qiu, Li-Juan

    2012-06-01

    Seed-coat color has changed from black to yellow during natural and artificial selection of cultivated soybean from wild soybean, and it is also an important morphological marker. Therefore, discovering genes related to the soybean seed-coat color will play a very important role in breeding and evolutionary study. Different seed-coat colors caused by deposition of various anthocyanin pigments. Although pigmentation has been well dissected at molecular level in several plant species, the genes controlling natural variation of seed-coat color in soybean remain to be unknown. Genes related to seed-coat color in soybean were discussed in this paper, including 5 genetic loci (I, T, W1, R and O). Locus I is located in a region that riches in chalcone synthase (CHS) genes on chromosome 8. Gene CHS is a multi-gene family with highly conserved sequences in soybean. Locus T located on chromosome 6 has been cloned and verified, which encodes a flavon-oid-3'-hydroxylase. Mutant of F3'H can not interact with the heme-binding domain due to lack of conservative domain GGEK caused by a nucleotide deletion in the coding region of F3'H. Locus R is located between A668-1 and K387-1 on chromosome 9 (linkage group K). This locus may encode a R2R3 MYB transcription factor or a UDP flavonoid 3-O glyco-syltransferase. Locus O is located between Satt207 and Satt493 on chromosome 8 (linkage group A2) and its molecular characteristics has not been characterized. Locus W1 may be a homology of F3'5'H gene.

  15. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.)

    PubMed Central

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-01-01

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar ‘EP6392’ which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296

  16. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.).

    PubMed

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-05-11

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar 'EP6392' which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns.

  17. Identification of Genes Related to Paulownia Witches’ Broom by AFLP and MSAP

    PubMed Central

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-01-01

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches’ broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L−1 MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB. PMID:25196603

  18. Identification of genes related to Paulownia witches' broom by AFLP and MSAP.

    PubMed

    Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng

    2014-08-21

    DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches' broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L(-1) MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB.

  19. Extracting microRNA-gene relations from biomedical literature using distant supervision

    PubMed Central

    Clarke, Luka A.; Couto, Francisco M.

    2017-01-01

    Many biomedical relation extraction approaches are based on supervised machine learning, requiring an annotated corpus. Distant supervision aims at training a classifier by combining a knowledge base with a corpus, reducing the amount of manual effort necessary. This is particularly useful for biomedicine because many databases and ontologies have been made available for many biological processes, while the availability of annotated corpora is still limited. We studied the extraction of microRNA-gene relations from text. MicroRNA regulation is an important biological process due to its close association with human diseases. The proposed method, IBRel, is based on distantly supervised multi-instance learning. We evaluated IBRel on three datasets, and the results were compared with a co-occurrence approach as well as a supervised machine learning algorithm. While supervised learning outperformed on two of those datasets, IBRel obtained an F-score 28.3 percentage points higher on the dataset for which there was no training set developed specifically. To demonstrate the applicability of IBRel, we used it to extract 27 miRNA-gene relations from recently published papers about cystic fibrosis. Our results demonstrate that our method can be successfully used to extract relations from literature about a biological process without an annotated corpus. The source code and data used in this study are available at https://github.com/AndreLamurias/IBRel. PMID:28263989

  20. miRTex: A Text Mining System for miRNA-Gene Relation Extraction

    PubMed Central

    Li, Gang; Ross, Karen E.; Arighi, Cecilia N.; Peng, Yifan; Wu, Cathy H.; Vijay-Shanker, K.

    2015-01-01

    MicroRNAs (miRNAs) regulate a wide range of cellular and developmental processes through gene expression suppression or mRNA degradation. Experimentally validated miRNA gene targets are often reported in the literature. In this paper, we describe miRTex, a text mining system that extracts miRNA-target relations, as well as miRNA-gene and gene-miRNA regulation relations. The system achieves good precision and recall when evaluated on a literature corpus of 150 abstracts with F-scores close to 0.90 on the three different types of relations. We conducted full-scale text mining using miRTex to process all the Medline abstracts and all the full-length articles in the PubMed Central Open Access Subset. The results for all the Medline abstracts are stored in a database for interactive query and file download via the website at http://proteininformationresource.org/mirtex. Using miRTex, we identified genes potentially regulated by miRNAs in Triple Negative Breast Cancer, as well as miRNA-gene relations that, in conjunction with kinase-substrate relations, regulate the response to abiotic stress in Arabidopsis thaliana. These two use cases demonstrate the usefulness of miRTex text mining in the analysis of miRNA-regulated biological processes. PMID:26407127

  1. miRTex: A Text Mining System for miRNA-Gene Relation Extraction.

    PubMed

    Li, Gang; Ross, Karen E; Arighi, Cecilia N; Peng, Yifan; Wu, Cathy H; Vijay-Shanker, K

    2015-01-01

    MicroRNAs (miRNAs) regulate a wide range of cellular and developmental processes through gene expression suppression or mRNA degradation. Experimentally validated miRNA gene targets are often reported in the literature. In this paper, we describe miRTex, a text mining system that extracts miRNA-target relations, as well as miRNA-gene and gene-miRNA regulation relations. The system achieves good precision and recall when evaluated on a literature corpus of 150 abstracts with F-scores close to 0.90 on the three different types of relations. We conducted full-scale text mining using miRTex to process all the Medline abstracts and all the full-length articles in the PubMed Central Open Access Subset. The results for all the Medline abstracts are stored in a database for interactive query and file download via the website at http://proteininformationresource.org/mirtex. Using miRTex, we identified genes potentially regulated by miRNAs in Triple Negative Breast Cancer, as well as miRNA-gene relations that, in conjunction with kinase-substrate relations, regulate the response to abiotic stress in Arabidopsis thaliana. These two use cases demonstrate the usefulness of miRTex text mining in the analysis of miRNA-regulated biological processes.

  2. Identification of genes related to nitrogen uptake in wine strains of Saccharomyces cerevisiae.

    PubMed

    Contreras, A; García, V; Salinas, F; Urzúa, U; Ganga, M A; Martínez, C

    2012-03-01

    The yeast Saccharomyces cerevisiae is the main microorganism responsible for wine fermentation and its development influences the quality of wine. A problem affecting these types of fermentations, generating important losses in this industry, are the slow or stuck fermentations which may result from low nitrogen availability in the must. Therefore, several studies have been directed towards identifying genes involved in nitrogen metabolism using high throughput strategies which include subjecting the yeast to changes in the type or concentration of the available nitrogen source. However, this type of approach can also generate responses in the yeast that do not necessarily alter the expression of genes related to nitrogen metabolism. In this work, by using intraspecific hybridisation of wild wine yeast strains we obtained genetically and oenologically similar strains with differences in the consumption of nitrogen sources. Using the same must, the global expression patterns of these yeasts were compared by microarrays, the analysis of which identified 276 genes that varied in their expression between the strains analysed. The functional analysis of the genes with a known function indicates that some participate in nitrogen metabolism, alcoholic fermentation, ion transport and transcriptional regulation. Furthermore, differences were observed in the expression of genes which have been partially associated to nitrogen, as in the case of ZRT1 and ATO2. Interestingly, many of the genes identified have no known function or have not been previously associated to this phenotype.

  3. Deregulation of Genes Related to Iron and Mitochondrial Metabolism in Refractory Anemia with Ring Sideroblasts

    PubMed Central

    del Rey, Mónica; Benito, Rocío; Fontanillo, Celia; Campos-Laborie, Francisco J.; Janusz, Kamila; Velasco-Hernández, Talía; Abáigar, María; Hernández, María; Cuello, Rebeca; Borrego, Daniel; Martín-Zanca, Dionisio; De Las Rivas, Javier; Mills, Ken I.; Hernández-Rivas, Jesús M.

    2015-01-01

    The presence of SF3B1 gene mutations is a hallmark of refractory anemia with ring sideroblasts (RARS). However, the mechanisms responsible for iron accumulation that characterize the Myelodysplastic Syndrome with ring sideroblasts (MDS-RS) are not completely understood. In order to gain insight in the molecular basis of MDS-RS, an integrative study of the expression and mutational status of genes related to iron and mitochondrial metabolism was carried out. A total of 231 low-risk MDS patients and 81 controls were studied. Gene expression analysis revealed that iron metabolism and mitochondrial function had the highest number of genes deregulated in RARS patients compared to controls and the refractory cytopenias with unilineage dysplasia (RCUD). Thus mitochondrial transporters SLC25 (SLC25A37 and SLC25A38) and ALAD genes were over-expressed in RARS. Moreover, significant differences were observed between patients with SF3B1 mutations and patients without the mutations. The deregulation of genes involved in iron and mitochondrial metabolism provides new insights in our knowledge of MDS-RS. New variants that could be involved in the pathogenesis of these diseases have been identified. PMID:25955609

  4. Epilepsy in Rett syndrome, and CDKL5- and FOXG1-gene-related encephalopathies.

    PubMed

    Guerrini, Renzo; Parrini, Elena

    2012-12-01

    Rett syndrome is an X-linked neurodevelopmental disorder that manifests in early childhood with developmental stagnation, and loss of spoken language and hand use, with the development of distinctive hand stereotypies, severe cognitive impairment, and autistic features. About 60% of patients have epilepsy. Seizure onset before the age of 3 years is unlikely, and onset after age 20 is rare. Diagnosis of Rett syndrome is based on key clinical elements that identify "typical" Rett syndrome but also "variant" or "atypical" forms. Diagnostic criteria have been modified only slightly over time, even after discovering that MECP2 gene alterations are present in >90% of patients with typical Rett syndrome but only in 50-70% of atypical cases. Over the last several years, intragenic or genomic alterations of the CDKL5 and FOXG1 genes have been associated with severe cognitive impairment, early onset epilepsy and, often, dyskinetic movement disorders, which have variably been defined as Rett variants. It is now clearly emerging that epilepsy has distinctive characteristics in typical Rett syndrome and in the different syndromes caused by CDKL5 and FOXG1 gene alterations. The progressive parting of CDKL5- and FOXG1-gene-related encephalopathies from the core Rett syndrome is reflected by the effort to produce clearer diagnostic criteria for typical and atypical Rett syndrome. Efforts to characterize the molecular pathology underlying these developmental encephalopathies are pointing to abnormalities of telencephalic development, neuronal morphogenesis, maturation and maintenance, and dendritic arborization.

  5. Down regulation of gene related sex hormone synthesis pathway in mouse testes by miroestrol and deoxymiroestrol.

    PubMed

    Udomsuk, Latiporn; Juengwatanatrakul, Thaweesak; Putalun, Waraporn; Jarukamjorn, Kanokwan

    2011-12-01

    Miroestrol and deoxymiroestrol are phytoestrogens isolated from tuberous root of Pueraria candollei var. mirifica. Modulatory effects of miroestrol and deoxymiroestrol on enzymes involved in sex-hormone synthesis pathway in male C57BL/6 mice were investigated using semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR). Miroestrol and deoxymiroestrol suppressed the expressions of 3β-HSD, 17β-HSD1, and CYP17 while CYP19 mRNA expression was slightly decreased. In addition, the expression of 17β-HSD2 was induced in correlation with those did by estradiol. These observations supported that miroestrol and deoxymiroestrol could exhibit the same effect as estradiol regarding regulation of testicular gene related sex hormone synthesis pathway.

  6. Arsenic-induced alteration in the expression of genes related to type 2 diabetes mellitus

    SciTech Connect

    Diaz-Villasenor, Andrea Burns, Anna L.; Hiriart, Marcia; Cebrian, Mariano E.; Ostrosky-Wegman, Patricia

    2007-12-01

    Chronic exposure to high concentrations of arsenic in drinking water is associated with an increased risk for developing type 2 diabetes. The present revision focuses on the effect of arsenic on tissues that participate directly in glucose homeostasis, integrating the most important published information about the impairment of the expression of genes related to type 2 diabetes by arsenic as one of the possible mechanisms by which it leads to the disease. Many factors are involved in the manner in which arsenic contributes to the occurrence of diabetes. The reviewed studies suggest that arsenic might increase the risk for type 2 diabetes via multiple mechanisms, affecting a cluster of regulated events, which in conjunction trigger the disease. Arsenic affects insulin sensitivity in peripheral tissue by modifying the expression of genes involved in insulin resistance and shifting away cells from differentiation to the proliferation pathway. In the liver arsenic disturbs glucose production, whereas in pancreatic beta-cells arsenic decreases insulin synthesis and secretion and reduces the expression of antioxidant enzymes. The consequences of these changes in gene expression include the reduction of insulin secretion, induction of oxidative stress in the pancreas, alteration of gluconeogenesis, abnormal proliferation and differentiation pattern of muscle and adipocytes as well as peripheral insulin resistance.

  7. [Differential expression of genes related to bacterial wilt resistance in peanut (Arachis hypogaea L.)].

    PubMed

    Peng, Wen-Fang; Lv, Jian-Wei; Ren, Xiao-Ping; Huang, Li; Zhao, Xin-Yan; Wen, Qi-Gen; Jiang, Hui-Fang

    2011-04-01

    Peanut bacterial wilt (BW) caused by Ralstonia solanacearum is one of the most devastating diseases for peanut production in the world. It is believed that breeding and subsequent planting BW-resistant cultivars of peanut (Arachis hypogaea L.) should represent the most effective and economic means of controlling the disease. To illustrate the molecular mechanism of peanut resistant to BW, a BW-resistant cultivar, 'Yuanza 9102', and a BW-sensitive one, 'Zhonghua 12', were infected with Ralstonia solanacearum and differential expression of the genes related to BW-resistance was analyzed using complementary DNA amplified length polymorphism (cDNA-AFLP) technique. The infected 3-leaflet seedlings were followed for 48 h and root samples were taken at 0, 2, 10, 24 and 48 h after inoculation, respectively. A total of 12596 transcript-derived fragments (TDFs) were amplified with 256 primer combinations, including 709 differential expressed TDFs, which were generated from 119 primer combinations. Ninety-eight TDFs were randomly chosen for DNA sequence analysis. BLASTx analysis of the obtained sequences revealed that 40 TDFs encoded gene products associated with energy, transcription, signal transduction, defense, metabolism, cell growth, cell structure or/and protein synthesis. Analysis of the expression of four genes by qRT-PCR verified the results from cDNA-AFLP. Strikingly, one of the identified TDFs, 32-54-1, occurred for 47 times in a known BW-resistant SSH library. These results suggest that resistance to BW in peanut involves multifaceted biochemical and physiological reactions, including regulation of the genes involved in different pathways, such as defense, singal transduction, metabolism, transcription and abiotic stresses. The TDF 32-54-1 was predicted to be closely related to BW resistance in peanut.

  8. Identification of genes related to beak deformity of chickens using digital gene expression profiling.

    PubMed

    Bai, Hao; Zhu, Jing; Sun, Yanyan; Liu, Ranran; Liu, Nian; Li, Dongli; Wen, Jie; Chen, Jilan

    2014-01-01

    Frequencies of up to 3% of beak deformity (normally a crossed beak) occur in some indigenous chickens in China, such as and Beijing-You. Chickens with deformed beaks have reduced feed intake, growth rate, and abnormal behaviors. Beak deformity represents an economic as well as an animal welfare problem in the poultry industry. Because the genetic basis of beak deformity remains incompletely understood, the present study sought to identify important genes and metabolic pathways involved in this phenotype. Digital gene expression analysis was performed on deformed and normal beaks collected from Beijing-You chickens to detect global gene expression differences. A total of >11 million cDNA tags were sequenced, and 5,864,499 and 5,648,877 clean tags were obtained in the libraries of deformed and normal beaks, respectively. In total, 1,156 differentially expressed genes (DEG) were identified in the deformed beak with 409 being up-regulated and 747 down-regulated in the deformed beaks. qRT-PCR using eight genes was performed to verify the results of DGE profiling. Gene ontology (GO) analysis highlighted that genes of the keratin family on GGA25 were abundant among the DEGs. Pathway analysis showed that many DEGs were linked to the biosynthesis of unsaturated fatty acids and glycerolipid metabolism. Combining the analyses, 11 genes (MUC, LOC426217, BMP4, ACAA1, LPL, ALDH7A1, GLA, RETSAT, SDR16C5, WWOX, and MOGAT1) were highlighted as potential candidate genes for beak deformity in chickens. Some of these genes have been identified previously, while others have unknown function with respect to thus phenotype. To the best of our knowledge, this is the first genome-wide study to investigate the transcriptome differences in the deformed and normal beaks of chickens. The DEGs identified here are worthy of further functional characterization.

  9. Identification of Genes Related to Beak Deformity of Chickens Using Digital Gene Expression Profiling

    PubMed Central

    Sun, Yanyan; Liu, Ranran; Liu, Nian; Li, Dongli; Wen, Jie; Chen, Jilan

    2014-01-01

    Frequencies of up to 3% of beak deformity (normally a crossed beak) occur in some indigenous chickens in China, such as and Beijing-You. Chickens with deformed beaks have reduced feed intake, growth rate, and abnormal behaviors. Beak deformity represents an economic as well as an animal welfare problem in the poultry industry. Because the genetic basis of beak deformity remains incompletely understood, the present study sought to identify important genes and metabolic pathways involved in this phenotype. Digital gene expression analysis was performed on deformed and normal beaks collected from Beijing-You chickens to detect global gene expression differences. A total of >11 million cDNA tags were sequenced, and 5,864,499 and 5,648,877 clean tags were obtained in the libraries of deformed and normal beaks, respectively. In total, 1,156 differentially expressed genes (DEG) were identified in the deformed beak with 409 being up-regulated and 747 down-regulated in the deformed beaks. qRT-PCR using eight genes was performed to verify the results of DGE profiling. Gene ontology (GO) analysis highlighted that genes of the keratin family on GGA25 were abundant among the DEGs. Pathway analysis showed that many DEGs were linked to the biosynthesis of unsaturated fatty acids and glycerolipid metabolism. Combining the analyses, 11 genes (MUC, LOC426217, BMP4, ACAA1, LPL, ALDH7A1, GLA, RETSAT, SDR16C5, WWOX, and MOGAT1) were highlighted as potential candidate genes for beak deformity in chickens. Some of these genes have been identified previously, while others have unknown function with respect to thus phenotype. To the best of our knowledge, this is the first genome-wide study to investigate the transcriptome differences in the deformed and normal beaks of chickens. The DEGs identified here are worthy of further functional characterization. PMID:25198128

  10. Genome-Wide Association Study to Identify Genes Related to Renal Mercury Concentrations in Mice

    PubMed Central

    Alkaissi, Hammoudi; Ekstrand, Jimmy; Jawad, Aksa; Nielsen, Jesper Bo; Havarinasab, Said; Soderkvist, Peter; Hultman, Per

    2016-01-01

    , Hultman P. 2016. Genome-wide association study to identify genes related to renal mercury concentrations in mice. Environ Health Perspect 124:920–926; http://dx.doi.org/10.1289/ehp.1409284 PMID:26942574

  11. Comparative Transcriptome Analysis Identifies Candidate Genes Related to Skin Color Differentiation in Red Tilapia

    PubMed Central

    Zhu, Wenbin; Wang, Lanmei; Dong, Zaijie; Chen, Xingting; Song, Feibiao; Liu, Nian; Yang, Hui; Fu, Jianjun

    2016-01-01

    Red tilapia is becoming more popular for aquaculture production in China in recent years. However, the pigmentation differentiation in genetic breeding is the main problem limiting its development of commercial red tilapia culture and the genetic basis of skin color variation is still unknown. In this study, we conducted Illumina sequencing of transcriptome on three color variety red tilapia. A total of 224,895,758 reads were generated, resulting in 160,762 assembled contigs that were used as reference contigs. The contigs of red tilapia transcriptome had hits in the range of 53.4% to 86.7% of the unique proteins of zebrafish, fugu, medaka, three-spined stickleback and tilapia. And 44,723 contigs containing 77,423 simple sequence repeats (SSRs) were identified, with 16,646 contigs containing more than one SSR. Three skin transcriptomes were compared pairwise and the results revealed that there were 148 common significantly differentially expressed unigenes and several key genes related to pigment synthesis, i.e. tyr, tyrp1, silv, sox10, slc24a5, cbs and slc7a11, were included. The results will facilitate understanding the molecular mechanisms of skin pigmentation differentiation in red tilapia and accelerate the molecular selection of the specific strain with consistent skin colors. PMID:27511178

  12. Mapping of a family of heterogeneous nuclear ribonucleoprotein [hnRNP] genes related to the fragile X gene - fmr1

    SciTech Connect

    Srinivasan, S.; Siomi, M.; Siomi, H.

    1994-09-01

    RNA binding proteins are involved in a wide range of cellular processes in the nucleus and cytoplasm including regulation of pre-mRNA splicing, mRNA stability, translation efficiency and the transport of RNAs between the nucleus and the cytoplasm. The gene involved in the Fragile X syndrome encodes a protein that contains two types of sequence motifs found in RNA binding proteins: an RGG box as seen in hnRNP U and two KH (hnRNP K homology) domains. The FMR1 gene product binds RNA in vitro and a missense mutation in a highly conserved isoleucine residue in the KH domain of fmr1 impairs RNA binding, demonstrating the importance of the KH domain in the RNA binding ability of FMR1. We have identified a new gene, fxr1 (fmr1 cross-hybridizing related), that bears striking homology to the fmr1 gene. The two genes are highly homologous at the amino acid level. Fxr1 has two KH domains, as does fmr1. This suggests that fmr1 may be only one of a family of RNA binding proteins that have yet to be characterized, but are potentially important for normal cellular function. We are systematically mapping hnRNP genes related to fmrl as a first step towards investigating the role of these proteins in human disease states. We have mapped fxr1 to chromosome 12 using a somatic cell hybrid panel and are currently using YACs containing fxr1 to perform FISH to further pinpoint the exact location of fxr1. HnRNP K and U share common sequence motifs with fmr1 and fxr1 that seem to be important for RNA binding function. We are also mapping these genes by both somatic cell hybrid panels and by FISH with the corresponding YACs.

  13. Expression Profiling of Genes Related to Endothelial Cells Biology in Patients with Type 2 Diabetes and Patients with Prediabetes

    PubMed Central

    Wan Sulaiman, Wan Aliaa

    2016-01-01

    Endothelial dysfunction appears to be an early sign indicating vascular damage and predicts the progression of atherosclerosis and cardiovascular disorders. Extensive clinical and experimental evidence suggests that endothelial dysfunction occurs in Type 2 Diabetes Mellitus (T2DM) and prediabetes patients. This study was carried out with an aim to appraise the expression levels in the peripheral blood of 84 genes related to endothelial cells biology in patients with diagnosed T2DM or prediabetes, trying to identify new genes whose expression might be changed under these pathological conditions. The study covered a total of 45 participants. The participants were divided into three groups: group 1, patients with T2DM; group 2, patients with prediabetes; group 3, control group. The gene expression analysis was performed using the Endothelial Cell Biology RT2 Profiler PCR Array. In the case of T2DM, 59 genes were found to be upregulated, and four genes were observed to be downregulated. In prediabetes patients, increased expression was observed for 49 genes, with two downregulated genes observed. Our results indicate that diabetic and prediabetic conditions change the expression levels of genes related to endothelial cells biology and, consequently, may increase the risk for occurrence of endothelial dysfunction. PMID:27781209

  14. Molecular evolution and phylogenetic analysis of genes related to cotton fibers development from wild and domesticated cotton species in Gossypium.

    PubMed

    Zhu, Huayu; Lv, Junhong; Zhao, Liang; Tong, Xiangchao; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2012-06-01

    The domestication of both diploid and tetraploid cotton species was carried out for fiber utilization. To understand the origin and domestication of fibers, 18 genes related to fiber development were individually cloned and sequenced from 22 different cotton species. Their structures, phylogenetic relationship and molecular evolution were further studied. In the orthologous and homeologous loci of the 18 genes, the sequence and structure of 72.22% were conserved and 27.78% were diverse. Tree topologies constructed based on the combined sequences showed that all 13 D-genome species were congruent with Fryxell's subsection taxonomy, the A- and D-subgenomes independently evolved in the allopolyploid after polyploid formation, and Gossypium raimondii had the closest relationship with all allotetraploids of D-subgenomes. The molecular evolutionary rates revealed approximately equivalent rates among different D-genome species, and purifying selection acted on all genes in the wild D-genome species. Among orthologs and homeologs, the D-subgenomes had higher evolutionary rates than the A-subgenomes in tetraploid cotton species, and the cultivars had higher evolutionary rates than either the semi-domesticated or wild species. Our study revealed that human domestication altered the molecular evolutionary pattern of genes related to fiber development, and Gossypium hirsutum endured greater selective pressures than Gossypium barbadense during the domestication process.

  15. Layer and broiler chicks exhibit similar hypothalamic expression of orexigenic neuropeptides but distinct expression of genes related to energy homeostasis and obesity.

    PubMed

    Yuan, Lixia; Ni, Yingdong; Barth, Stephan; Wang, Yufeng; Grossmann, Roland; Zhao, Ruqian

    2009-06-01

    Layer and broiler chickens demonstrate striking differences in body weight and body composition. However, the mechanism underlying such difference is elusive. Hypothalamus-pituitary-adrenal (HPA) axis regulates energy homeostasis and body size in mammals, but information in birds is scarce. Here we test the hypothesis that such breed difference is more associated with hypothalamic expression of genes related to HPA axis, rather than orexigenic neuropeptides. Broiler chicks exhibit significantly higher body weight and food intake at day (D) 7 posthatching, but the food intake relative to body weight gain was actually lower. No breed differences were observed for hypothalamic expression of neuropeptide Y (NPY), agouti-related protein (AGRP), proopiomelanocortin (POMC), orexin (ORX), leptin receptor (LEPR), acetyl-CoA carboxylase (ACC) or fatty acid synthase (FAS). However, broiler chicks expressed significantly higher glucocorticoid receptor (GR) mRNA (P<0.05) and protein (P<0.01) in hypothalamus compared to layer chicks, which is associated with lower corticotropin-releasing hormone (CRH) mRNA (P<0.05) yet higher accumulation of CRH peptide in hypothalamus, suggesting an augmented GR-mediated negative feedback regulation of CRH transcription and release in broiler chicks. Furthermore, fat mass and obesity associated (FTO) gene was also more highly expressed in hypothalamus of broiler chicks (P<0.05). These results suggest that the genes related to energy homeostasis and obesity, such as GR, CRH and FTO, rather than orexigenic neuropeptides, are impacted by the genetic selection practices and play a role in breed-specific body weight setpoint regulation in the chicken.

  16. Effect of Ipr1 on expression levels of immune genes related to macrophage anti-infection of mycobacterium tuberculosis

    PubMed Central

    Li, Na; Liu, Pengfei; Wang, Lianwen; Liu, Jingbo; Yuan, Xiao; Meng, Wei; Dong, Yan; Li, Boqing

    2015-01-01

    Background: Intracellular pathogen resistance 1 (Ipr1) has been found in macrophages and plays a pivotal role in fighting against Mycobacterium tuberculosis (Mtb) infection. This study is designed to evaluate the effect of Iprl on the expression of macrophage genes related to the anti-infection of Mtb. Design or methods: In the experimental and control groups, the macrophages were infected with Mycobacterium H37Ra, and then the related immune genes between two groups were detected using microarray assay. Real-time quantitative PCR was applied to detect the differences in the expression of three up-regulated genes detected by microarray assay and to verify the reliability of microarray assay. Results: The expression of Iprl up-regulated 11 genes related to macrophage anti-immunity involved TLRs signaling pathway including TLR2 and TLR4, Irak1, Traf7, Ifngr1 and Tnfrsfla. No significant difference was found in terms of the molecular expression involved in regulation of the adaptive immune response, such as IL-1 and IL-12. The results of real-time PCR were consistent with the findings of microarray assay. Conclusions: The expression of Iprl gene probably promotes macrophage activity and enhances the ability of macrophages to fight against Mtb infection. The underlying mechanism may be achieved by up-regulating the expression levels of innate immunity genes, especially TLR2/TLR4 and signal transduction molecules, which is determined using microarray assay. All these findings offer the basis for subsequent study of the mechanisms of Ipr1 gene in host innate immunity against Mtb infection. PMID:26064231

  17. Laughter up-regulates the genes related to NK cell activity in diabetes.

    PubMed

    Hayashi, Takashi; Tsujii, Satoru; Iburi, Tadao; Tamanaha, Tamiko; Yamagami, Keiko; Ishibashi, Rieko; Hori, Miyo; Sakamoto, Shigeko; Ishii, Hitoshi; Murakami, Kazuo

    2007-12-01

    To elucidate the sustainable effects of laughter on gene expression, we recruited type 2 diabetic patients who were in-patient for receiving self-management education and examined time-dependent regulation for gene expression by laughter. Two-day experiment was performed. On one day, the patients watched comic video and laughed together with hospital staffs. On the other day, they participated in an inpatient diabetes educational program. Blood samples were collected before and 1.5, 4 h after watching comic video or spending lecture time, and changes in gene expression were comprehensively analyzed by microarray technique. Of the 41,000 genes analyzed, the laughter relatively up-regulated 39 genes, among which, 27 genes were relatively increased in the expression for all the observation period after watching comic video. By functional classification of these genes, 14 genes were found to be related to natural killer cell activity. No genes were included that are directly involved in blood glucose regulation, though successive suppression of postprandial blood glucose levels was observed. These results suggest that the laughter influences the expression of many genes classified into immune responses, and may contribute to amelioration of postprandial blood glucose elevation through a modulation of NK cell activity caused by up-regulation of relating genes.

  18. Viral oncogenes, proto-oncogenes and homoeotic genes related to cell proliferation and differentiation.

    PubMed

    Antohi, S; Antohi-Talle, O

    1987-01-01

    Molecular studies on viral oncogenes and their products have led to the discovery of physiological proto-oncogenes, involved in the control of cell proliferation and gene activation. Other genetic and molecular investigations, initiated in Drosophila melanogaster and continued in different multicellular eukaryotes, have made evident the homoeotic genes, which are directly correlated with cell specialization, in the complex processes of differentiation and morphogenesis. Both gene classes are conserved to a high extent during evolution. They are involved in the eukaryotic mechanisms of differentiation control and proto-oncogenes, in particular, are related to malignant transformation. Some available data suggest a certain extent of relatedness between the gene products of both gene classes. A differentiation trigger model, including retroviral transposition, homoeotic genes and proto-oncogenes is discussed.

  19. Discovery of new candidate genes related to brain development using protein interaction information.

    PubMed

    Chen, Lei; Chu, Chen; Kong, Xiangyin; Huang, Tao; Cai, Yu-Dong

    2015-01-01

    Human brain development is a dramatic process composed of a series of complex and fine-tuned spatiotemporal gene expressions. A good comprehension of this process can assist us in developing the potential of our brain. However, we have only limited knowledge about the genes and gene functions that are involved in this biological process. Therefore, a substantial demand remains to discover new brain development-related genes and identify their biological functions. In this study, we aimed to discover new brain-development related genes by building a computational method. We referred to a series of computational methods used to discover new disease-related genes and developed a similar method. In this method, the shortest path algorithm was executed on a weighted graph that was constructed using protein-protein interactions. New candidate genes fell on at least one of the shortest paths connecting two known genes that are related to brain development. A randomization test was then adopted to filter positive discoveries. Of the final identified genes, several have been reported to be associated with brain development, indicating the effectiveness of the method, whereas several of the others may have potential roles in brain development.

  20. Transcriptome Analysis of Blunt Snout Bream (Megalobrama amblycephala) Reveals Putative Differential Expression Genes Related to Growth and Hypoxia

    PubMed Central

    Li, Fu-Gui; Chen, Jie; Jiang, Xia-Yun; Zou, Shu-Ming

    2015-01-01

    The blunt snout bream (Megalobrama amblycephala) is an important freshwater aquaculture species, but it is sensitive to hypoxia. No transcriptome data related to growth and hypoxia response are available for this species. In this study, we performed de novo transcriptome sequencing for the liver and gills of the fast-growth family and slow-growth family derived from ‘Pujiang No.1’ F10 blunt snout bream that were under hypoxic stress and normoxia, respectively. The fish were divided into the following 4 groups: fast-growth family under hypoxic stress, FH; slow-growth family under hypoxic stress, SH; fast-growth family under normoxia, FN; and slow-growth family under normoxia, SN. A total of 185 million high-quality reads were obtained from the normalized cDNA of the pooled samples, which were assembled into 465,582 contigs and 237,172 transcripts. A total of 31,338 transcripts from the same locus (unigenes) were annotated and assigned to 104 functional groups, and 23,103 unigenes were classified into seven main categories, including 45 secondary KEGG pathways. A total of 22,255 (71%) known putative unigenes were found to be shared across the genomes of five model fish species and mammals, and a substantial number (9.4%) of potentially novel genes were identified. When 6,639 unigenes were used in the analysis of differential expression (DE) genes, the number of putative DE genes related to growth pathways in FH, SH, SN and FN was 159, 118, 92 and 65 in both the liver and gills, respectively, and the number of DE genes related to hypoxic response was 57, 33, 23 and 21 in FH, FN, SH and SN, respectively. Our results suggest that growth performance of the fast-growth family should be due to complex mutual gene regulatory mechanisms of these putative DE genes between growth and hypoxia. PMID:26554582

  1. MicroRNA-122 targets genes related to liver metabolism in chickens.

    PubMed

    Wang, Xingguo; Shao, Fang; Yu, Jianfeng; Jiang, Honglin; Gong, Daoqing; Gu, Zhiliang

    2015-06-01

    MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression by targeting mRNAs. MicroRNA-122 (miR-122) has important functions in mammalian and fish livers, but its functions in the poultry liver are largely unknown. In this study, we determined the expression patterns of miR-122 in the chicken and identified its target genes in the chicken liver. We found that chicken miR-122 was highly expressed in the liver and that its expression in the liver was up-regulated during the early posthatch life. By bioinformatics and reporter gene analyses, we identified PKM2, TGFB3, FABP5 and ARCN1 as miR-122 target genes in the chicken liver. miR-122 knockdown in primary chicken hepatocytes and expression analysis of miR-122 and predicted target mRNAs in the chicken liver suggested that the expression of PKM2 and FABP5 in the chicken liver is regulated by miR-122. Knockdown of miR-122 affected the expression of 123 genes in cultured chicken hepatocytes. Among these genes, the largest cluster, which consisted of 21 genes, was involved in liver metabolism. These findings suggest that miR-122 plays a role in liver metabolism in the chicken by directly or indirectly regulating the expression of genes involved in liver metabolism.

  2. Effect of Goji (Lycium barbarum) on expression of genes related to cell survival.

    PubMed

    Lin, Nien-Chen; Lin, Jing-Chi; Chen, Shih-Hsin; Ho, Chi-Tang; Yeh, An-I

    2011-09-28

    This study investigated the interrelationship between Lycium barbarum (goji) and gene expression in mouse spleen. Oligomicroarray technology was employed to explore the comprehensive response of gene expression and to screen candidate marker genes in the spleens of mice fed a goji suspension. Goji was micronized by media milling and then used to evaluate the effect of size reduction. The average diameter of nano/submicrometer goji was about 100 nm, which exhibited no cytotoxicity to cell lines IEC-6 (rat normal small intestinal cell line) and Caco-2 (human colon adenocarcinoma cell line). It was found that three genes, TNF, Nfkb1, and Bcl-2, were up-regulated and two genes, APAF-1 and caspase-3, were down-regulated by goji. This phenomenon could be helpful for cytoprotection when cells undergo stress or damage that induces the apoptotic pathway. Size reduction into nano/submicrometer scale enhanced bioactivity.

  3. Exercise training alters DNA methylation patterns in genes related to muscle growth and differentiation in mice.

    PubMed

    Kanzleiter, Timo; Jähnert, Markus; Schulze, Gunnar; Selbig, Joachim; Hallahan, Nicole; Schwenk, Robert Wolfgang; Schürmann, Annette

    2015-05-15

    The adaptive response of skeletal muscle to exercise training is tightly controlled and therefore requires transcriptional regulation. DNA methylation is an epigenetic mechanism known to modulate gene expression, but its contribution to exercise-induced adaptations in skeletal muscle is not well studied. Here, we describe a genome-wide analysis of DNA methylation in muscle of trained mice (n = 3). Compared with sedentary controls, 2,762 genes exhibited differentially methylated CpGs (P < 0.05, meth diff >5%, coverage >10) in their putative promoter regions. Alignment with gene expression data (n = 6) revealed 200 genes with a negative correlation between methylation and expression changes in response to exercise training. The majority of these genes were related to muscle growth and differentiation, and a minor fraction involved in metabolic regulation. Among the candidates were genes that regulate the expression of myogenic regulatory factors (Plexin A2) as well as genes that participate in muscle hypertrophy (Igfbp4) and motor neuron innervation (Dok7). Interestingly, a transcription factor binding site enrichment study discovered significantly enriched occurrence of CpG methylation in the binding sites of the myogenic regulatory factors MyoD and myogenin. These findings suggest that DNA methylation is involved in the regulation of muscle adaptation to regular exercise training.

  4. Phylogenetic analysis of ALAD and MGP genes related to lead toxicity.

    PubMed

    Shaik, A P; Khan, M; Jamil, K

    2009-07-01

    Experimental studies in our laboratory have established the role of delta-aminolevulinic acid dehydratase (ALAD) and matrix gamma-carboxyglutamic acid (MGP) gene polymorphisms in the etiology of lead toxicity. Polymorphisms in these genes influenced the levels of lead in subjects exposed to this metal. In extension to our studies, we aimed to investigate the possible role of these proteins in evolution by studying the phylogenetic relationship and divergence of ALAD and MGP genes using computational phylogenetic methods. The human ALAD and MGP protein sequences from various species were retrieved from Swiss-Prot database and were compared using Basic Local Alignment Search Tool. Multiple sequence alignment was carried out using ClustalW with defaults, and phylogenetic trees for both the genes were built using neighbor-joining method as in Mega software. Our study indicated that ALAD is a highly conserved protein with the same metal binding site distributed in all the phyla (from archaea to chordates). Phylogenetic analysis of MGP gene revealed that it had an important role in the evolution of endogenous skeleton in contrast to exoskeleton of insects. Occurrence of these genes in evolution with conserved metal binding sites strengthens the role of ALAD and MGP genes in regulating heme biosynthesis and mineralization, respectively, in evolution and helps in better understanding of lead poisoning.

  5. Discovery of genes related to witches broom disease in Paulownia tomentosa × Paulownia fortunei by a De Novo assembled transcriptome.

    PubMed

    Liu, Rongning; Dong, Yanpeng; Fan, Guoqiang; Zhao, Zhenli; Deng, Minjie; Cao, Xibing; Niu, Suyan

    2013-01-01

    In spite of its economic importance, very little molecular genetics and genomic research has been targeted at the family Paulownia spp. The little genetic information on this plant is a big obstacle to studying the mechanisms of its ability to resist Paulownia Witches' Broom (PaWB) disease. Analysis of the Paulownia transcriptome and its expression profile data are essential to extending the genetic resources on this species, thus will greatly improves our studies on Paulownia. In the current study, we performed the de novo assembly of a transcriptome on P. tomentosa × P. fortunei using the short-read sequencing technology (Illumina). 203,664 unigenes with a mean length of 1,328 bp was obtained. Of these unigenes, 32,976 (30% of all unigenes) containing complete structures were chosen. Eukaryotic clusters of orthologous groups, gene orthology, and the Kyoto Encyclopedia of Genes and Genomes annotations were performed of these unigenes. Genes related to PaWB disease resistance were analyzed in detail. To our knowledge, this is the first study to elucidate the genetic makeup of Paulownia. This transcriptome provides a quick way to understanding Paulownia, increases the number of gene sequences available for further functional genomics studies and provides clues to the identification of potential PaWB disease resistance genes. This study has provided a comprehensive insight into gene expression profiles at different states, which facilitates the study of each gene's roles in the developmental process and in PaWB disease resistance.

  6. Transcriptome sequencing of Hydrangea macrophylla to uncover genes related to reblooming and powdery mildew resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Massively parallel pyrosequencing technology has been used extensively on agronomic crops and model plants. Transcriptome sequencing is a useful first step in functional genomic studies, microarray and gene expression studies, single nucleotide polymorphism (SNP) surveys, quantitative trait loci (QT...

  7. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    DOEpatents

    Wohlbach, Dana J.; Gasch, Audrey P.

    2014-08-05

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  8. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    SciTech Connect

    Wohlbach, Dana J.; Gasch, Audrey P.

    2015-09-29

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  9. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    DOEpatents

    Wohlbach, Dana J.; Gasch, Audrey P.

    2016-11-29

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  10. Evolution of vertebrate genes related to prion and Shadoo proteins--clues from comparative genomic analysis.

    PubMed

    Premzl, Marko; Gready, Jill E; Jermiin, Lars S; Simonic, Tatjana; Marshall Graves, Jennifer A

    2004-12-01

    Recent findings of new genes in fish related to the prion protein (PrP) gene PRNP, including our recent report of SPRN coding for Shadoo (Sho) protein found also in mammals, raise issues of their function and evolution. Here we report additional novel fish genes found in public databases, including a duplicated SPRN gene, SPRNB, in Fugu, Tetraodon, carp, and zebrafish encoding the Sho2 protein, and we use comparative genomic analysis to analyze the evolutionary relationships and to infer evolutionary trajectories of the complete data set. Phylogenetic footprinting performed on aligned human, mouse, and Fugu SPRN genes to define candidate regulatory promoter regions, detected 16 conserved motifs, three of which are known transcription factor-binding sites for a receptor and transcription factors specific to or associated with expression in brain. This result and other homology-based (VISTA global genomic alignment; protein sequence alignment and phylogenetics) and context-dependent (genomic context; relative gene order and orientation) criteria indicate fish and mammalian SPRN genes are orthologous and suggest a strongly conserved basic function in brain. Whereas tetrapod PRNPs share context with the analogous stPrP-2-coding gene in fish, their sequences are diverged, suggesting that the tetrapod and fish genes are likely to have significantly different functions. Phylogenetic analysis predicts the SPRN/SPRNB duplication occurred before divergence of fish from tetrapods, whereas that of stPrP-1 and stPrP-2 occurred in fish. Whereas Sho appears to have a conserved function in vertebrate brain, PrP seems to have an adaptive role fine-tuned in a lineage-specific fashion. An evolutionary model consistent with our findings and literature knowledge is proposed that has an ancestral prevertebrate SPRN-like gene leading to all vertebrate PrP-related and Sho-related genes. This provides a new framework for exploring the evolution of this unusual family of proteins and for

  11. Identification and characterization of genes related to cellulolytic activity in basidiomycetes.

    PubMed

    Volpini, A F N; Thomazine, T; Umeo, S H; Pereira, G A; Linde, G A; Valle, J S; Colauto, N B; Barcellos, F G; Souza, S G H

    2016-09-16

    Enzymes produced by basidiomycetes that are involved in the cellulose degradation process, and their respective codifying genes, must be identified to facilitate the development of novel biotechnological strategies and applications in the agro-industry. The objective of this study was to identify prospective cellulase-producing genes and characterize their cellulolytic activity, in order to elucidate the potential biotechnological applications (with respect to vegetal residues) of basidiomycetes. The basidiomycete strains Lentinula edodes U8-1, Lentinus crinitus U9-1, and Schizophyllum commune U6-7 were analyzed in this study. The cellulolytic activities of these fungi were evaluated based on the halo formation in carboxymethyl cellulose culture medium after dyeing with Congo red. The presence of cellulase-codifying genes (cel7A, cel6B, cel3A, and egl) in these fungal strains was also evaluated. L. edodes and S. commune presented the highest cellulolytic halo to mycelial growth radius ratio, followed by L. crinitus. Four genes were amplified in the L. edodes strain, whereas three and one genes were isolated from L. crinitus and S. commune, respectively. The cel6B gene (L. edodes) presented the conserved domain glyco_hydro_6 and characterized as cellobiohydrolase gene. The results of this study contribute to the existing knowledge on cellulases in basidiomycetes, and serve as a basis for future studies on the expression of these genes and the characterization of the catalytic activity of these enzymes. This allows for better utilization of these fungi in degrading vegetal fibers from agro-industrial residues and in other biotechnological applications.

  12. Identification and expression analysis of chitinase genes related to biotic stress resistance in Brassica.

    PubMed

    Ahmed, Nasar Uddin; Park, Jong-In; Seo, Mi-Suk; Kumar, Thamilarasan Senthil; Lee, In-Ho; Park, Beom-Seok; Nou, Ill-Sup

    2012-04-01

    Brassica is a very important vegetable group because of its contribution to human nutrition and consequent economic benefits. However, biotic stress is a major concern for these crops and molecular biology techniques offer the most efficient of approaches to address this concern. Chitinase is an important biotic stress resistance-related gene. We identified three genes designated as Brassica chitinase like protein (BrCLP1), BrCLP2 and BrCLP3 from a full-length cDNA library of Brassica rapa cv. Osome. Sequence analysis of these genes confirmed that BrCLP1 was a class IV chitinase, and BrCLP2 and BrCLP3 were class VII chitinases. Also, these genes showed a high degree of homology with other biotic stress resistance-related plant chitinases. In expression analysis, organ-specific expression of all three genes was high except BrCLP1 in all the organs tested and BrCLP2 showed the highest expression compared to the other genes in flower buds. All these genes also showed expression during all developmental growth stages of Chinese cabbage. In addition, BrCLP1 was up-regulated with certain time of infection by Pectobacterium carotovorum subsp. carotovorum in Chinese cabbage plants during microarray expression analysis. On the other hand, expression of BrCLP2 and BrCLP3 were increased after 6 h post inoculation (hpi) but decreased from 12 hpi. All these data suggest that these three chitinase genes may be involved in plant resistance against biotic stresses.

  13. 'RetinoGenetics': a comprehensive mutation database for genes related to inherited retinal degeneration.

    PubMed

    Ran, Xia; Cai, Wei-Jun; Huang, Xiu-Feng; Liu, Qi; Lu, Fan; Qu, Jia; Wu, Jinyu; Jin, Zi-Bing

    2014-01-01

    Inherited retinal degeneration (IRD), a leading cause of human blindness worldwide, is exceptionally heterogeneous with clinical heterogeneity and genetic variety. During the past decades, tremendous efforts have been made to explore the complex heterogeneity, and massive mutations have been identified in different genes underlying IRD with the significant advancement of sequencing technology. In this study, we developed a comprehensive database, 'RetinoGenetics', which contains informative knowledge about all known IRD-related genes and mutations for IRD. 'RetinoGenetics' currently contains 4270 mutations in 186 genes, with detailed information associated with 164 phenotypes from 934 publications and various types of functional annotations. Then extensive annotations were performed to each gene using various resources, including Gene Ontology, KEGG pathways, protein-protein interaction, mutational annotations and gene-disease network. Furthermore, by using the search functions, convenient browsing ways and intuitive graphical displays, 'RetinoGenetics' could serve as a valuable resource for unveiling the genetic basis of IRD. Taken together, 'RetinoGenetics' is an integrative, informative and updatable resource for IRD-related genetic predispositions. Database URL: http://www.retinogenetics.org/.

  14. Identifying genes related to choriogenesis in insect panoistic ovaries by Suppression Subtractive Hybridization

    PubMed Central

    Irles, Paula; Bellés, Xavier; Piulachs, M Dolors

    2009-01-01

    Background Insect ovarioles are classified into two categories: panoistic and meroistic, the later having apparently evolved from an ancestral panoistic type. Molecular data on oogenesis is practically restricted to meroistic ovaries. If we aim at studying the evolutionary transition from panoistic to meroistic, data on panoistic ovaries should be gathered. To this end, we planned the construction of a Suppression Subtractive Hybridization (SSH) library to identify genes involved in panoistic choriogenesis, using the cockroach Blattella germanica as model. Results We constructed a post-vitellogenic ovary library by SSH to isolate genes involved in choriogenesis in B. germanica. The tester library was prepared with an ovary pool from 6- to 7-day-old females, whereas the driver library was prepared with an ovary pool from 3- to 4-day-old females. From the SSH library, we obtained 258 high quality sequences which clustered into 34 unique sequences grouped in 19 contigs and 15 singlets. The sequences were compared against non-redundant NCBI databases using BLAST. We found that 44% of the unique sequences had homologous sequences in known genes of other organisms, whereas 56% had no significant similarity to any of the databases entries. A Gene Ontology analysis was carried out, classifying the 34 sequences into different functional categories. Seven of these gene sequences, representative of different categories and processes, were chosen to perform expression studies during the first gonadotrophic cycle by real-time PCR. Results showed that they were mainly expressed during post-vitellogenesis, which validates the SSH technique. In two of them corresponding to novel genes, we demonstrated that they are specifically expressed in the cytoplasm of follicular cells in basal oocytes at the time of choriogenesis. Conclusion The SSH approach has proven to be useful in identifying ovarian genes expressed after vitellogenesis in B. germanica. For most of the genes, functions

  15. Genes related to antioxidant metabolism are involved in Methylobacterium mesophilicum-soybean interaction.

    PubMed

    Araújo, Welington Luiz; Santos, Daiene Souza; Dini-Andreote, Francisco; Salgueiro-Londoño, Jennifer Katherine; Camargo-Neves, Aline Aparecida; Andreote, Fernando Dini; Dourado, Manuella Nóbrega

    2015-10-01

    The genus Methylobacterium is composed of pink-pigmented methylotrophic bacterial species that are widespread in natural environments, such as soils, stream water and plants. When in association with plants, this genus colonizes the host plant epiphytically and/or endophytically. This association is known to promote plant growth, induce plant systemic resistance and inhibit plant infection by phytopathogens. In the present study, we focused on evaluating the colonization of soybean seedling-roots by Methylobacterium mesophilicum strain SR1.6/6. We focused on the identification of the key genes involved in the initial step of soybean colonization by methylotrophic bacteria, which includes the plant exudate recognition and adaptation by planktonic bacteria. Visualization by scanning electron microscopy revealed that M. mesophilicum SR1.6/6 colonizes soybean roots surface effectively at 48 h after inoculation, suggesting a mechanism for root recognition and adaptation before this period. The colonization proceeds by the development of a mature biofilm on roots at 96 h after inoculation. Transcriptomic analysis of the planktonic bacteria (with plant) revealed the expression of several genes involved in membrane transport, thus confirming an initial metabolic activation of bacterial responses when in the presence of plant root exudates. Moreover, antioxidant genes were mostly expressed during the interaction with the plant exudates. Further evaluation of stress- and methylotrophic-related genes expression by qPCR showed that glutathione peroxidase and glutathione synthetase genes were up-regulated during the Methylobacterium-soybean interaction. These findings support that glutathione (GSH) is potentially a key molecule involved in cellular detoxification during plant root colonization. In addition to methylotrophic metabolism, antioxidant genes, mainly glutathione-related genes, play a key role during soybean exudate recognition and adaptation, the first step in

  16. Enhanced seed oil content by overexpressing genes related to triacylglyceride synthesis.

    PubMed

    Liu, Fang; Xia, Yuping; Wu, Lei; Fu, Donghui; Hayward, Alice; Luo, Junling; Yan, Xiaohong; Xiong, Xiaojuan; Fu, Ping; Wu, Gang; Lu, Changming

    2015-02-25

    Oilseed rape (Brassica napus) is one of the most important oilseed crops globally. To meet increasing demand for oil-based products, the ability to enhance desirable oil content in the seed is required. This study assessed the capability of five genes in the triacylglyceride (TAG) synthesis pathway to enhance oil content. The genes BnGPDH, BnGPAT, BnDGAT, ScGPDH and ScLPAAT were overexpressed separately in a tobacco (Nicotiana benthamiana) model system, and simultaneously by pyramiding in B. napus, under the control of a seed specific Napin promoter. ScLPAAT transgenic plants showed a significant increase of 6.84% to 8.55% in oil content in tobacco seeds, while a ~4% increase was noted for BnGPDH and BnGPAT transgenic seeds. Seed-specific overexpression of all four genes in B. napus resulted in as high a 12.57% to 14.46% increased in seed oil content when compared to WT, equaling close to the sum of the single-gene overexpression increases in tobacco. Taken together, our study demonstrates that BnGPDH, BnGPAT and ScLPAAT may effectively increase seed oil content, and that simultaneous overexpression of these in transgenic B. napus may further enhance the desirable oil content relative to single-gene overexpressors.

  17. Tobacco smoking and methylation of genes related to lung cancer development

    PubMed Central

    Gao, Xu; Zhang, Yan; Breitling, Lutz Philipp; Brenner, Hermann

    2016-01-01

    Lung cancer is a leading cause of cancer-related mortality worldwide, and cigarette smoking is the major environmental hazard for its development. This study intended to examine whether smoking could alter methylation of genes at lung cancer risk loci identified by genome-wide association studies (GWASs). By systematic literature review, we selected 75 genomic candidate regions based on 120 single-nucleotide polymorphisms (SNPs). DNA methylation levels of 2854 corresponding cytosine-phosphate-guanine (CpG) candidates in whole blood samples were measured by the Illumina Infinium Human Methylation450 Beadchip array in two independent subsamples of the ESTHER study. After correction for multiple testing, we successfully confirmed associations with smoking for one previously identified CpG site within the KLF6 gene and identified 12 novel sites located in 7 genes: STK32A, TERT, MSH5, ACTA2, GATA3, VTI1A and CHRNA5 (FDR <0.05). Current smoking was linked to a 0.74% to 2.4% decrease of DNA methylation compared to never smoking in 11 loci, and all but one showed significant associations (FDR <0.05) with life-time cumulative smoking (pack-years). In conclusion, our study demonstrates the impact of tobacco smoking on DNA methylation of lung cancer related genes, which may indicate that lung cancer susceptibility genes might be regulated by methylation changes in response to smoking. Nevertheless, this mechanism warrants further exploration in future epigenetic and biomarker studies. PMID:27323854

  18. Preliminary investigation of bottlenose dolphins (Tursiops truncatus) for hfe gene-related hemochromatosis.

    PubMed

    Phillips, Brianne E; Venn-Watson, Stephanie; Archer, Linda L; Nollens, Hendrik H; Wellehan, James F X

    2014-10-01

    Hemochromatosis (iron storage disease) has been reported in diverse mammals including bottlenose dolphins (Tursiops truncatus). The primary cause of excessive iron storage in humans is hereditary hemochromatosis. Most human hereditary hemochromatosis cases (up to 90%) are caused by a point mutation in the hfe gene, resulting in a C282Y substitution leading to iron accumulation. To evaluate the possibility of a hereditary hemochromatosis-like genetic predisposition in dolphins, we sequenced the bottlenose dolphin hfe gene, using reverse transcriptase-PCR and hfe primers designed from the dolphin genome, from liver of affected and healthy control dolphins. Sample size included two case animals and five control animals. Although isotype diversity was evident, no coding differences were identified in the hfe gene between any of the animals examined. Because our sample size was small, we cannot exclude the possibility that hemochromatosis in dolphins is due to a coding mutation in the hfe gene. Other potential causes of hemochromatosis, including mutations in different genes, diet, primary liver disease, and insulin resistance, should be evaluated.

  19. ‘RetinoGenetics’: a comprehensive mutation database for genes related to inherited retinal degeneration

    PubMed Central

    Ran, Xia; Cai, Wei-Jun; Huang, Xiu-Feng; Liu, Qi; Lu, Fan; Qu, Jia; Wu, Jinyu; Jin, Zi-Bing

    2014-01-01

    Inherited retinal degeneration (IRD), a leading cause of human blindness worldwide, is exceptionally heterogeneous with clinical heterogeneity and genetic variety. During the past decades, tremendous efforts have been made to explore the complex heterogeneity, and massive mutations have been identified in different genes underlying IRD with the significant advancement of sequencing technology. In this study, we developed a comprehensive database, ‘RetinoGenetics’, which contains informative knowledge about all known IRD-related genes and mutations for IRD. ‘RetinoGenetics’ currently contains 4270 mutations in 186 genes, with detailed information associated with 164 phenotypes from 934 publications and various types of functional annotations. Then extensive annotations were performed to each gene using various resources, including Gene Ontology, KEGG pathways, protein–protein interaction, mutational annotations and gene–disease network. Furthermore, by using the search functions, convenient browsing ways and intuitive graphical displays, ‘RetinoGenetics’ could serve as a valuable resource for unveiling the genetic basis of IRD. Taken together, ‘RetinoGenetics’ is an integrative, informative and updatable resource for IRD-related genetic predispositions. Database URL: http://www.retinogenetics.org/. PMID:24939193

  20. Discovery of Genes Related to Witches Broom Disease in Paulownia tomentosa × Paulownia fortunei by a De Novo Assembled Transcriptome

    PubMed Central

    Liu, Rongning; Dong, Yanpeng; Fan, Guoqiang; Zhao, Zhenli; Deng, Minjie; Cao, Xibing; Niu, Suyan

    2013-01-01

    In spite of its economic importance, very little molecular genetics and genomic research has been targeted at the family Paulownia spp. The little genetic information on this plant is a big obstacle to studying the mechanisms of its ability to resist Paulownia Witches’ Broom (PaWB) disease. Analysis of the Paulownia transcriptome and its expression profile data are essential to extending the genetic resources on this species, thus will greatly improves our studies on Paulownia. In the current study, we performed the de novo assembly of a transcriptome on P. tomentosa × P. fortunei using the short-read sequencing technology (Illumina). 203,664 unigenes with a mean length of 1,328 bp was obtained. Of these unigenes, 32,976 (30% of all unigenes) containing complete structures were chosen. Eukaryotic clusters of orthologous groups, gene orthology, and the Kyoto Encyclopedia of Genes and Genomes annotations were performed of these unigenes. Genes related to PaWB disease resistance were analyzed in detail. To our knowledge, this is the first study to elucidate the genetic makeup of Paulownia. This transcriptome provides a quick way to understanding Paulownia, increases the number of gene sequences available for further functional genomics studies and provides clues to the identification of potential PaWB disease resistance genes. This study has provided a comprehensive insight into gene expression profiles at different states, which facilitates the study of each gene’s roles in the developmental process and in PaWB disease resistance. PMID:24278262

  1. Novel Genes Related to Ceftriaxone Resistance Found among Ceftriaxone-Resistant Neisseria gonorrhoeae Strains Selected In Vitro

    PubMed Central

    Gong, Zijian; Liu, Min; Hua, Zhengshuang; Sun, Yayin; Xu, Qingfang; Xia, Yue; Zhao, Yue; Xie, Xiaoyuan

    2016-01-01

    The emergence of ceftriaxone-resistant Neisseria gonorrhoeae is currently a global public health concern. However, the mechanism of ceftriaxone resistance is not yet fully understood. To investigate the potential genes related to ceftriaxone resistance in Neisseria gonorrhoeae, we subcultured six gonococcal strains with increasing concentrations of ceftriaxone and isolated the strains that became resistant. After analyzing several frequently reported genes involved in ceftriaxone resistance, we found only a single mutation in penA (A501V). However, differential analysis of the genomes and transcriptomes between pre- and postselection strains revealed many other mutated genes as well as up- and downregulated genes. Transformation of the mutated penA gene into nonresistant strains increased the MIC between 2.0- and 5.3-fold, and transformation of mutated ftsX increased the MIC between 3.3- and 13.3-fold. Genes encoding the ABC transporters FarB, Tfq, Hfq, and ExbB were overexpressed, while pilM, pilN, and pilQ were downregulated. Furthermore, the resistant strain developed cross-resistance to penicillin and cefuroxime, had an increased biochemical metabolic rate, and presented fitness defects such as prolonged growth time and downregulated PilMNQ. In conclusion, antimicrobial pressure could result in the emergence of ceftriaxone resistance, and the evolution of resistance of Neisseria gonorrhoeae to ceftriaxone is a complicated process at both the pretranscriptional and posttranscriptional levels, involving several resistance mechanisms of increased efflux and decreased entry. PMID:26787702

  2. Detection of arc genes related with the ethyl carbamate precursors in wine lactic acid bacteria.

    PubMed

    Araque, Isabel; Gil, Joana; Carreté, Ramon; Bordons, Albert; Reguant, Cristina

    2009-03-11

    Trace amounts of the carcinogen ethyl carbamate can appear in wine by the reaction of ethanol with compounds such as citrulline and carbamyl phosphate, which are produced from arginine degradation by some wine lactic acid bacteria (LAB). In this work, the presence of arc genes for the arginine-deiminase pathway was studied in several strains of different species of LAB. Their ability to degrade arginine was also studied. To detect the presence of arc genes, degenerate primers were designed from the alignment of protein sequences in already sequenced LAB. The usefulness of these degenerate primers has been proven by sequencing some of the amplified PCR fragments and searching for homologies with published sequences of the same species and related ones. Correlation was found between the presence of genes and the ability to degrade arginine. Degrading strains included all heterofermentative lactobacilli, Oenococcus oeni , Pediococcus pentosaceus , and some strains of Leuconostoc mesenteroides and Lactobacillus plantarum .

  3. An advanced reference genome of Trifolium subterraneum L. reveals genes related to agronomic performance.

    PubMed

    Kaur, Parwinder; Bayer, Philipp E; Milec, Zbyněk; Vrána, Jan; Yuan, Yuxuan; Appels, Rudi; Edwards, David; Batley, Jacqueline; Nichols, Phillip; Erskine, William; Doležel, Jaroslav

    2017-01-23

    Subterranean clover is an important annual forage legume, whose diploidy and inbreeding nature make it an ideal model for genomic analysis in Trifolium. We reported a draft genome assembly of the subterranean clover TSUd_r1.1. Here we evaluate genome mapping on nanochannel arrays and generation of a transcriptome atlas across tissues to advance the assembly and gene annotation. Using a BioNano-based assembly spanning 512 Mb (93% genome coverage), we validated the draft assembly, anchored unplaced contigs and resolved misassemblies. Multiple contigs (264) from the draft assembly coalesced into 97 super-scaffolds (43% of genome). Sequences longer than >1 Mb increased from 40 to 189 Mb giving 1.4-fold increase in N50 with total genome in pseudomolecules improved from 73 to 80%. The advanced assembly was re-annotated using transcriptome atlas data to contain 31,272 protein-coding genes capturing >96% of the gene content. Functional characterisation and GO enrichment confirmed gene expression for response to water deprivation, flavonoid biosynthesis, and embryo development ending in seed dormancy, reflecting adaptation to the harsh Mediterranean environment. Comparative analyses across Papilionoideae identified 24,893 Trifolium-specific and 6,325 subterranean-clover-specific genes that could be mined further for traits such as geocarpy and grazing tolerance. Eight key traits, including persistence, improved livestock health by isoflavonoid production in addition to important agro-morphological traits, were fine-mapped on the high density SNP linkage map anchored to the assembly. This new genomic information is crucial to identify loci governing traits allowing marker-assisted breeding, comparative mapping and identification of tissue-specific gene promoters for biotechnological improvement of forage legumes. This article is protected by copyright. All rights reserved.

  4. Apoptosis-associated genes related to photodynamic therapy in breast carcinomas.

    PubMed

    Silva, J C; Ferreira-Strixino, J; Fontana, L C; Paula, L M; Raniero, L; Martin, A A; Canevari, R A

    2014-07-01

    The aim of this study was to find the apoptosis molecular markers involved in the cell death that might be related to photodynamic therapy (PDT) mechanisms in breast cancer. The mammary tumors were induced in 25 Sprague-Dawley female rats by a single, oral gavage of 7,12-dimethylbenz(a)anthracene (DMBA; 70 mg/kg body weight). Animals were divided into four groups: G1 (normal, without DMBA), G2 (control, without PDT treatment), G3 (euthanized 48 h after PDT), and G4 (euthanized 24 h after PDT). For PDT experiments, the photosensitizer used was Photodithazine, and 100 J/cm of light at a fluence rate of 100 mW/cm was delivered to treat lesions. A sample of each animal was investigated by quantitative real-time PCR using Rat Apoptosis RT2 Profiler™ PCR Array platform. The results showed 20 genes with differential expression between PDT and control groups. A significant upregulation was observed for pro-apoptotic genes CASP4, CASP12, CIDEA, GADD45A, and FAS and downregulation of anti-apoptotic genes MAPK8IP1, TNFRSF11B, and NAIP2 in PDT-treated tumors. These results indicate that these genes are more directly involved in cell apoptosis induced by PDT.

  5. Single nucleotide polymorphisms in candidate genes related to daughter pregnancy rate in Holstein cows

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ABSTRACT: Previously, a candidate gene approach identified 40 SNPs associated with daughter pregnancy rate (DPR) in dairy bulls. We evaluated 39 of these SNPs for relationship to DPR in a separate population of Holstein cows grouped on their predicted transmitting ability for DPR: <= -1 (n=1266) a...

  6. Transcriptome Sequencing of Gracilariopsis lemaneiformis to Analyze the Genes Related to Optically Active Phycoerythrin Synthesis

    PubMed Central

    Huang, Xiaoyun; Zang, Xiaonan; Wu, Fei; Jin, Yuming; Wang, Haitao; Liu, Chang; Ding, Yating; He, Bangxiang; Xiao, Dongfang; Song, Xinwei; Liu, Zhu

    2017-01-01

    Gracilariopsis lemaneiformis (aka Gracilaria lemaneiformis) is a red macroalga rich in phycoerythrin, which can capture light efficiently and transfer it to photosystemⅡ. However, little is known about the synthesis of optically active phycoerythrinin in G. lemaneiformis at the molecular level. With the advent of high-throughput sequencing technology, analysis of genetic information for G. lemaneiformis by transcriptome sequencing is an effective means to get a deeper insight into the molecular mechanism of phycoerythrin synthesis. Illumina technology was employed to sequence the transcriptome of two strains of G. lemaneiformis- the wild type and a green-pigmented mutant. We obtained a total of 86915 assembled unigenes as a reference gene set, and 42884 unigenes were annotated in at least one public database. Taking the above transcriptome sequencing as a reference gene set, 4041 differentially expressed genes were screened to analyze and compare the gene expression profiles of the wild type and green mutant. By GO and KEGG pathway analysis, we concluded that three factors, including a reduction in the expression level of apo-phycoerythrin, an increase of chlorophyll light-harvesting complex synthesis, and reduction of phycoerythrobilin by competitive inhibition, caused the reduction of optically active phycoerythrin in the green-pigmented mutant. PMID:28135287

  7. Odd-skipped related 2 regulates genes related to proliferation and development

    SciTech Connect

    Kawai, Shinji; Abiko, Yoshimitsu; Amano, Atsuo

    2010-07-23

    Cell proliferation is a biological process in which chromosomes replicate in one cell and equally divide into two daughter cells. Our previous findings suggested that Odd-skipped related 2 (Osr2) plays an important role in cellular quiescence and proliferation under epigenetic regulation. However, the mechanism used by Osr2 to establish and maintain proliferation is unknown. To examine the functional role of Osr2 in cell proliferation, we analyzed its downstream target genes using microarray analysis following adenovirus-induced overexpression of Osr2 as well as knockdown with Osr2 siRNA, which showed that Osr2 regulates a multitude of genes involved in proliferation and the cell cycle, as well as development. Additional proliferation assays also indicated that Osr2 likely functions to elicit cell proliferation. Together, these results suggest that Osr2 plays important roles in proliferation and development.

  8. Variation in genes related to hepatic lipid metabolism and changes in waist circumference and body weight.

    PubMed

    Meidtner, Karina; Fisher, Eva; Angquist, Lars; Holst, Claus; Vimaleswaran, Karani S; Boer, Jolanda M A; Halkjær, Jytte; Masala, Giovanna; Ostergaard, Jane N; Mortensen, Lotte M; van der A, Daphne L; Tjønneland, Anne; Palli, Domenico; Overvad, Kim; Wareham, Nicholas J; Loos, Ruth J F; Sørensen, Thorkild I A; Boeing, Heiner

    2014-03-01

    We analysed single nucleotide polymorphisms (SNPs) tagging the genetic variability of six candidate genes (ATF6, FABP1, LPIN2, LPIN3, MLXIPL and MTTP) involved in the regulation of hepatic lipid metabolism, an important regulatory site of energy balance for associations with body mass index (BMI) and changes in weight and waist circumference. We also investigated effect modification by sex and dietary intake. Data of 6,287 individuals participating in the European prospective investigation into cancer and nutrition were included in the analyses. Data on weight and waist circumference were followed up for 6.9 ± 2.5 years. Association of 69 tagSNPs with baseline BMI and annual changes in weight as well as waist circumference were investigated using linear regression analysis. Interactions with sex, GI and intake of carbohydrates, fat as well as saturated, monounsaturated and polyunsaturated fatty acids were examined by including multiplicative SNP-covariate terms into the regression model. Neither baseline BMI nor annual weight or waist circumference changes were significantly associated with variation in the selected genes in the entire study population after correction for multiple testing. One SNP (rs1164) in LPIN2 appeared to be significantly interacting with sex (p = 0.0003) and was associated with greater annual weight gain in men (56.8 ± 23.7 g/year per allele, p = 0.02) than in women (-25.5 ± 19.8 g/year per allele, p = 0.2). With respect to gene-nutrient interaction, we could not detect any significant interactions when accounting for multiple testing. Therefore, out of our six candidate genes, LPIN2 may be considered as a candidate for further studies.

  9. Genomic Regions Associated With Interspecies Communication in Dogs Contain Genes Related to Human Social Disorders

    PubMed Central

    Persson, Mia E.; Wright, Dominic; Roth, Lina S. V.; Batakis, Petros; Jensen, Per

    2016-01-01

    Unlike their wolf ancestors, dogs have unique social skills for communicating and cooperating with humans. Previously, significant heritabilities for human-directed social behaviors have been found in laboratory beagles. Here, a Genome-Wide Association Study identified two genomic regions associated with dog’s human-directed social behaviors. We recorded the propensity of laboratory beagles, bred, kept and handled under standardized conditions, to initiate physical interactions with a human during an unsolvable problem-task, and 190 individuals were genotyped with an HD Canine SNP-chip. One genetic marker on chromosome 26 within the SEZ6L gene was significantly associated with time spent close to, and in physical contact with, the human. Two suggestive markers on chromosome 26, located within the ARVCF gene, were also associated with human contact seeking. Strikingly, four additional genes present in the same linkage blocks affect social abilities in humans, e.g., SEZ6L has been associated with autism and COMT affects aggression in adolescents with ADHD. This is, to our knowledge, the first genome-wide study presenting candidate genomic regions for dog sociability and inter-species communication. These results advance our understanding of dog domestication and raise the use of the dog as a novel model system for human social disorders. PMID:27685260

  10. Steroids and genes related to steroid biosynthesis in the female giant freshwater prawn, Macrobrachium rosenbergii.

    PubMed

    Thongbuakaew, Tipsuda; Siangcham, Tanapan; Suwansa-ard, Saowaros; Elizur, Abigail; Cummins, Scott F; Sobhon, Prasert; Sretarugsa, Prapee

    2016-03-01

    The giant freshwater prawn, Macrobrachium rosenbergii, is important to many Asian countries due to its high economic value as an aquaculture product. With demand increasing, there is requirement for a better understanding of the biosynthetic components that regulate its growth and reproduction, including steroids, in order to help increase production. Vertebrate-type steroids and their receptors were identified in crustaceans and implicated in reproduction. In this study, we presented the sex steroids estradiol and progesterone by LC-MS/MS in female M. rosenbergii, and reveal steroidogenic-related genes by in silico analysis of de novo assembled transcriptomes. Comparative analysis with other species was performed to confirm their putative role, as well as tissue-specific and quantitative gene expression. We reveal 29 transcripts that encode for steroidogenic-related proteins, including steroidogenic enzymes, a nuclear steroid hormone receptors, and a steroidogenic factor. Moreover, we identified for the first time the presence of steroidogenic factor 1, StAR-related lipid transfer protein, estradiol receptor- and progesterone-like protein in M. rosenbergii. Those targeted for gene expression analysis (3 beta-hydroxysteroid dehydrogenase, 17 beta-hydroxysteroid dehydrogenase, estrogen sulfotransferase and progesterone receptor-like) showed widespread expression within many tissues, and at relatively high levels in the central nervous system (CNS) during ovarian maturation. In summary, we provide further evidence for the existence of steroidogenic pathways in crustaceans, which may be useful for advancing prawn aquaculture.

  11. Genomic Regions Associated With Interspecies Communication in Dogs Contain Genes Related to Human Social Disorders.

    PubMed

    Persson, Mia E; Wright, Dominic; Roth, Lina S V; Batakis, Petros; Jensen, Per

    2016-09-29

    Unlike their wolf ancestors, dogs have unique social skills for communicating and cooperating with humans. Previously, significant heritabilities for human-directed social behaviors have been found in laboratory beagles. Here, a Genome-Wide Association Study identified two genomic regions associated with dog's human-directed social behaviors. We recorded the propensity of laboratory beagles, bred, kept and handled under standardized conditions, to initiate physical interactions with a human during an unsolvable problem-task, and 190 individuals were genotyped with an HD Canine SNP-chip. One genetic marker on chromosome 26 within the SEZ6L gene was significantly associated with time spent close to, and in physical contact with, the human. Two suggestive markers on chromosome 26, located within the ARVCF gene, were also associated with human contact seeking. Strikingly, four additional genes present in the same linkage blocks affect social abilities in humans, e.g., SEZ6L has been associated with autism and COMT affects aggression in adolescents with ADHD. This is, to our knowledge, the first genome-wide study presenting candidate genomic regions for dog sociability and inter-species communication. These results advance our understanding of dog domestication and raise the use of the dog as a novel model system for human social disorders.

  12. Differential effects of antifungal agents on expression of genes related to formation of Candida albicans biofilms.

    PubMed

    Chatzimoschou, Athanasios; Simitsopoulou, Maria; Antachopoulos, Charalampos; Walsh, Thomas J; Roilides, Emmanuel

    2016-01-01

    The purpose of this study was to analyse specific molecular mechanisms involved in the intrinsic resistance of C. albicans biofilms to antifungals. We investigated the transcriptional profile of three genes (BGL2, SUN41, ECE1) involved in Candida cell wall formation in response to voriconazole or anidulafungin after the production of intermediate and mature biofilms. C. albicans M61, a well-documented biofilm producer strain, was used for the development of intermediate (12 h and 18 h) and completely mature biofilms (48 h). After exposure of cells from each biofilm growth mode to voriconazole (128 and 512 mg l(-1)) or anidulafungin (0.25 and 1 mg l(-1)) for 12-24 h, total RNA samples extracted from biofilm cells were analysed by RT-PCR. The voriconazole and anidulafungin biofilm MIC was 512 and 0.5 mg l(-1) respectively. Anidulafungin caused significant up-regulation of SUN41 (3.7-9.3-fold) and BGL2 (2.2-2.8 fold) in intermediately mature biofilms; whereas, voriconazole increased gene expression in completely mature biofilms (SUN41 2.3-fold, BGL2 2.1-fold). Gene expression was primarily down-regulated by voriconazole in intermediately, but not completely mature biofilms. Both antifungals caused down-regulation of ECE1 in intermediately mature biofilms.

  13. Transcriptomic Analysis Reveals Key Genes Related to Betalain Biosynthesis in Pulp Coloration of Hylocereus polyrhizus

    PubMed Central

    Qingzhu, Hua; Chengjie, Chen; Zhe, Chen; Pengkun, Chen; Yuewen, Ma; Jingyu, Wu; Jian, Zheng; Guibing, Hu; Jietang, Zhao; Yonghua, Qin

    2016-01-01

    Betalains have high nutritional value and bioactivities. Red pulp pitaya (Hylocereus polyrhizus) is the only fruit containing abundant betalains for consumer. However, no information is available about genes involved in betalain biosynthesis in H. polyrhizus. Herein, two cDNA libraries of pitaya pulps with two different coloration stages (white and red pulp stages) of Guanhuahong (H. polyrhizus) were constructed. A total of about 12 Gb raw RNA-Seq data was generated and was de novo assembled into 122,677 transcripts with an average length of 1183 bp and an N50 value of 2008. Approximately 99.99% of all transcripts were annotated based on seven public databases. A total of 8871 transcripts were significantly regulated. Thirty-three candidate transcripts related to betalain biosynthesis were obtained from the transcriptome data. Transcripts encoding enzymes involved in betalain biosynthesis were analyzed using RT-qPCR at the whole pulp coloration stages of H. polyrhizus (7-1) and H. undatus (132-4). Nine key transcripts of betalain biosynthesis were identified. They were assigned to four kinds of genes in betalain biosynthetic pathway, including tyrosinase, 4, 5-DOPA dioxygenase extradiol, cytochrome P450 and glucosyltransferase. Ultimately, a preliminary betalain biosynthetic pathway for pitaya was proposed based on betalain analyses, gene expression profiles and published documents. PMID:26779215

  14. Transcriptomic Analysis Reveals Key Genes Related to Betalain Biosynthesis in Pulp Coloration of Hylocereus polyrhizus.

    PubMed

    Qingzhu, Hua; Chengjie, Chen; Zhe, Chen; Pengkun, Chen; Yuewen, Ma; Jingyu, Wu; Jian, Zheng; Guibing, Hu; Jietang, Zhao; Yonghua, Qin

    2015-01-01

    Betalains have high nutritional value and bioactivities. Red pulp pitaya (Hylocereus polyrhizus) is the only fruit containing abundant betalains for consumer. However, no information is available about genes involved in betalain biosynthesis in H. polyrhizus. Herein, two cDNA libraries of pitaya pulps with two different coloration stages (white and red pulp stages) of Guanhuahong (H. polyrhizus) were constructed. A total of about 12 Gb raw RNA-Seq data was generated and was de novo assembled into 122,677 transcripts with an average length of 1183 bp and an N50 value of 2008. Approximately 99.99% of all transcripts were annotated based on seven public databases. A total of 8871 transcripts were significantly regulated. Thirty-three candidate transcripts related to betalain biosynthesis were obtained from the transcriptome data. Transcripts encoding enzymes involved in betalain biosynthesis were analyzed using RT-qPCR at the whole pulp coloration stages of H. polyrhizus (7-1) and H. undatus (132-4). Nine key transcripts of betalain biosynthesis were identified. They were assigned to four kinds of genes in betalain biosynthetic pathway, including tyrosinase, 4, 5-DOPA dioxygenase extradiol, cytochrome P450 and glucosyltransferase. Ultimately, a preliminary betalain biosynthetic pathway for pitaya was proposed based on betalain analyses, gene expression profiles and published documents.

  15. Sugarcane Giant Borer Transcriptome Analysis and Identification of Genes Related to Digestion

    PubMed Central

    de Assis Fonseca, Fernando Campos; Firmino, Alexandre Augusto Pereira; de Macedo, Leonardo Lima Pepino; Coelho, Roberta Ramos; de Sousa Júnior, José Dijair Antonino; Silva-Junior, Orzenil Bonfim; Togawa, Roberto Coiti; Pappas, Georgios Joannis; de Góis, Luiz Avelar Brandão; da Silva, Maria Cristina Mattar; Grossi-de-Sá, Maria Fátima

    2015-01-01

    Sugarcane is a widely cultivated plant that serves primarily as a source of sugar and ethanol. Its annual yield can be significantly reduced by the action of several insect pests including the sugarcane giant borer (Telchin licus licus), a lepidopteran that presents a long life cycle and which efforts to control it using pesticides have been inefficient. Although its economical relevance, only a few DNA sequences are available for this species in the GenBank. Pyrosequencing technology was used to investigate the transcriptome of several developmental stages of the insect. To maximize transcript diversity, a pool of total RNA was extracted from whole body insects and used to construct a normalized cDNA database. Sequencing produced over 650,000 reads, which were de novo assembled to generate a reference library of 23,824 contigs. After quality score and annotation, 43% of the contigs had at least one BLAST hit against the NCBI non-redundant database, and 40% showed similarities with the lepidopteran Bombyx mori. In a further analysis, we conducted a comparison with Manduca sexta midgut sequences to identify transcripts of genes involved in digestion. Of these transcripts, many presented an expansion or depletion in gene number, compared to B. mori genome. From the sugarcane giant borer (SGB) transcriptome, a number of aminopeptidase N (APN) cDNAs were characterized based on homology to those reported as Cry toxin receptors. This is the first report that provides a large-scale EST database for the species. Transcriptome analysis will certainly be useful to identify novel developmental genes, to better understand the insect’s biology and to guide the development of new strategies for insect-pest control. PMID:25706301

  16. Transcriptome Analysis of Medicinal Plant Salvia miltiorrhiza and Identification of Genes Related to Tanshinone Biosynthesis

    PubMed Central

    Yang, Lei; Ding, Guohui; Lin, Haiyan; Cheng, Haining; Kong, Yu; Wei, Yukun; Fang, Xin; Liu, Renyi; Wang, Lingiian; Chen, Xiaoya; Yang, Changqing

    2013-01-01

    Salvia miltiorrhiza Bunge, a perennial plant of Lamiaceae, accumulates abietane-type diterpenoids of tanshinones in root, which have been used as traditional Chinese medicine to treat neuroasthenic insomnia and cardiovascular diseases. However, to date the biosynthetic pathway of tanshinones is only partially elucidated and the mechanism for their root-specific accumulation remains unknown. To identify enzymes and transcriptional regulators involved in the biosynthesis of tanshinones, we conducted transcriptome profiling of S. miltiorrhiza root and leaf tissues using the 454 GS-FLX pyrosequencing platform, which generated 550,546 and 525,292 reads, respectively. RNA sequencing reads were assembled and clustered into 64,139 unigenes (29,883 isotigs and 34,256 singletons). NCBI non-redundant protein databases (NR) and Swiss-Prot database searches anchored 32,096 unigenes (50%) with functional annotations based on sequence similarities. Further assignments with Gene Ontology (GO) terms and KEGG biochemical pathways identified 168 unigenes referring to the terpenoid backbone biosynthesis (including 144 MEP and MVA pathway genes and 24 terpene synthases). Comparative analysis of the transcriptomes identified 2,863 unigenes that were highly expressed in roots, including those encoding enzymes of early steps of tanshinone biosynthetic pathway, such as copalyl diphosphate synthase (SmCPS), kaurene synthase-like (SmKSL) and CYP76AH1. Other differentially expressed unigenes predicted to be related to tanshinone biosynthesis fall into cytochrome P450 monooxygenases, dehydrogenases and reductases, as well as regulatory factors. In addition, 21 P450 genes were selectively confirmed by real-time PCR. Thus we have generated a large unigene dataset which provides a valuable resource for further investigation of the radix development and biosynthesis of tanshinones. PMID:24260395

  17. The molecular signature of AML mesenchymal stromal cells reveals candidate genes related to the leukemogenic process.

    PubMed

    Binato, Renata; de Almeida Oliveira, Nathalia Correa; Du Rocher, Barbara; Abdelhay, Eliana

    2015-12-01

    Acute myeloid leukemia (AML) is a heterogeneous disease characterized by myeloid precursor proliferation in the bone marrow, apoptosis reduction and differentiation arrest. Although there are several studies in this field, events related to disease initiation and progression remain unknown. The malignant transformation of hematopoietic stem cells (HSC) is thought to generate leukemic stem cells, and this transformation could be related to changes in mesenchymal stromal cell (hMSC) signaling. Thus, the aim of this work was to analyze the gene expression profile of hMSC from AML patients (hMSC-AML) compared to healthy donors hMSCs (hMSC-HD). The results showed a common molecular signature for all hMSC-AML. Other assays were performed with a large number of patients and the results confirmed a molecular signature that is capable of distinguishing hMSC-AML from hMSC-HD. Moreover, CCL2 and BMP4 genes encode secreted proteins that could affect HSCs. To verify whether these proteins are differentially expressed in AML patients, ELISA was performed with plasma samples. CCL2 and BMP4 proteins are differentially expressed in AML patients, indicating changes in hMSC-AML signaling. Altogether, hMSCs-AML signaling alterations could be an important factor in the leukemic transformation process.

  18. Investigation of possible involvement of several genes related to development of hepatocarcinogenesis in rats.

    PubMed

    Todaka, N; Higashi, K; Yan, Y; Abe, T; Yamashiro, K; Hiai, H

    2000-06-01

    A comparative study on the possible involvement of several genes in the susceptibility of chemical carcinogenesis was carried out using carcinogen-resistant DRH rat and -sensitive Donryu and F344 rats. Previously, we observed that the induction of glutathione S-transferase placental form (GST-P) in the liver of Donryu rats by 3'-methyl-4-dimethylaminoazobenzene (3'-Me-DAB) was significantly greater than that of DRH rats. In the present study, we tentatively determined base sequences of the enhancer region including GPE-I and GPE-II (GST-P enhancers I and II) of GST-P genes of DRH, Donryu and F344 rats, but we did not observe any nucleotide polymorphism around these regions. Furthermore, the mRNA levels of silencer binding protein (NFA-1) for the GST-P promoter of rat liver were also similar in the DRH and Donryu rats. Since clonal expansion of putative preneoplastic GST-P-positive foci in the DRH rat liver was significantly suppressed during 3'-Me-DAB administration, we examined whether two opposite growth controlling factors, TGF-alpha and TGF-beta, may participate in such suppression of growth. It was supposed that mannose 6-phosphate/insulin-like growth factor 2 receptor (M6P/IGF2R), at least in part, activates TGF-beta preproprotein. However, we observed that the levels of M6P/IGF2R mRNA in the livers of DRH were not higher than those of Donryu rats after being fed 3'-Me-DAB for 8 weeks. Another important factor in the carcinogenesis is insulin-like growth factor II itself. Although liver tumors induced by 3'-Me-DAB in F344 had high levels of IGF-II mRNA, little IGF-II gene expression existed in normal adult livers of Donryu, F344 and DRH rats. High levels of IGF-II mRNA were detected similarly in the livers of neonates from all these three strains of rats. Finally, we detected a significant increase of AFP (alpha-fetoprotein) mRNA in the livers of Donryu rats around 6 to 8 weeks from the start of 3'-Me-DAB feeding, which is in parallel with detrimental effects

  19. Differential activation of genes related to aluminium tolerance in two contrasting rice cultivars.

    PubMed

    Roselló, Maite; Poschenrieder, Charlotte; Gunsé, Benet; Barceló, Juan; Llugany, Mercè

    2015-11-01

    Rice (Oryza sativa) is a highly Al-tolerant crop. Among other mechanisms, a higher expression of STAR1/STAR2 (sensitive to Al rhizotoxicity1/2) genes and of Nrat1 (NRAMP Aluminium Transporter 1), and ALS1 (Aluminium sensitive 1) can at least in part be responsible for the inducible Al tolerance in this species. Here we analysed the responses to Al in two contrasting rice varieties. All analysed toxicity/tolerance markers (root elongation, Evans blue, morin and haematoxylin staining) indicated higher Al-tolerance in variety Nipponbare, than in variety Modan. Nipponbare accumulated much less Al in the roots than Modan. Aluminium supply caused stronger expression of STAR1 in Nipponbare than in Modan. A distinctively higher increase of Al-induced abscisic acid (ABA) accumulation was found in the roots of Nipponbare than in Modan. Highest ABA levels were observed in Nipponbare after 48 h exposure to Al. This ABA peak was coincident in time with the highest expression level of STAR1. It is proposed that ABA may be required for cell wall remodulation facilitated by the enhanced UDP-glucose transport to the walls through STAR1/STAR2. Contrastingly, in the roots of Modan the expression of both Nrat1 coding for a plasma membrane Al-transporter and of ALS1 coding for a tonoplast-localized Al transporter was considerably enhanced. Moreover, Modan had a higher Al-induced expression of ASR1 a gene that has been proposed to code for a reactive oxygen scavenging protein. In conclusion, the Al-exclusion strategy of Nipponbare, at least in part mediated by STAR1 and probably regulated by ABA, provided better protection against Al toxicity than the accumulation and internal detoxification strategy of Modan mediated by Nrat1, ALS1 and ARS1.

  20. Expression of genes related to muscle plasticity after strength and power training regimens.

    PubMed

    Lamas, L; Aoki, M S; Ugrinowitsch, C; Campos, G E R; Regazzini, M; Moriscot, A S; Tricoli, V

    2010-04-01

    The purpose of our study was to compare the effects of 8-week progressive strength and power training regimens on strength gains and muscle plasticity [muscle fiber hypertrophy and phenotype shift, mammalian target of rapamycin (mTOR), regulatory-associated protein of mTOR (RAPTOR), rapamycin-insensitive companion of m-TOR (RICTOR), calcineurin and calcipressin gene expression]. Twenty-nine physically active subjects were divided into three groups: strength training (ST), power training (PT) and control (C). Squat 1 RM and muscle biopsies were obtained before and after the training period. Strength increased similarly for both ST and PT groups (P<0.001). Fiber types I, IIa and IIb presented hypertrophy main time effect (P<0.05). Only type IIb percentage decreased from pre- to post-test (main time effect, P<0.05). mTOR and RICTOR mRNA expression increased similarly from pre- to post-test (P<0.01). RAPTOR increased after training for both groups (P<0.0001), but to a greater extent in the ST (P<0.001) than in the PT group. 4EBP-1 decreased after training when the ST and PT groups were pooled (P<0.05). Calcineurin levels did not change after training, while calcipressin increased similarly from pre- to post-test (P<0.01). In conclusion, our data indicate that these training regimens produce similar performance improvements; however, there was a trend toward greater hypertrophy-related gene expression and muscle fiber hypertrophy in the ST group.

  1. Screening of genes related to ovarian development in the swimming crab, Portunus trituberculatus, by suppression subtractive hybridization.

    PubMed

    Yu, Z B; Mu, C K; Song, W W; Li, R H; Chen, Y E; Wang, C L

    2015-12-29

    The swimming crab, Portunus trituberculatus, is an important marine animal and is widely cultured in China. In the present study, suppression subtractive hybridization was applied to identify the differentially expressed genes in the ovaries of mature and immature P. trituberculatus. One hundred and seventy six expressed sequence tag (ESTs) were identified, of which 100 were down-regulated, and 76 up-regulated. BLAST analysis identified 51 unigenes, of which 27 were down-regulated, and 24 up-regulated. Quantitative real-time reverse transcriptase polymerase chain reaction results indicated that the SSH technique is valuable in screening genes related to ovarian development. Genes identified in this study encoded proteins corresponding to a wide range of functions and included immune response protein, transcription initiation factor, metabolic proteins, chromosome, histone h3, ovarian development-related protein, and vitellogenin. In addition, 64 metabolic pathways were annotated in differentially expressed ESTs by using the Kyoto Encyclopedia of Genes and Genomes pathway. Four annotated pathways (oxidative phosphorylation, carbon metabolism, fatty acid degradation, and protein digestion and absorption) appeared to be involved in ovarian development. In ontology analysis, 5.83% of the cellular process genes in reverse subtraction cDNA library are involved in reproduction, and 5.88% involved in developmental process. In up-regulated genes, myosin II-expressed polehole-like protein; histone h3; ovigerous-hair stripping substance; peritrophin 48; and ovarian development-related protein appeared to be involved in ovarian development. Identification of differentially expressed genes in the mature and immature ovary of the swimming crab provides new insights for further studies on the mechanism underlying ovarian development in this species.

  2. Transcriptome Sequencing of Chemically Induced Aquilaria sinensis to Identify Genes Related to Agarwood Formation

    PubMed Central

    Ye, Wei; Wu, Hongqing; He, Xin; Wang, Lei; Zhang, Weimin; Li, Haohua; Fan, Yunfei; Tan, Guohui; Liu, Taomei; Gao, Xiaoxia

    2016-01-01

    Background Agarwood is a traditional Chinese medicine used as a clinical sedative, carminative, and antiemetic drug. Agarwood is formed in Aquilaria sinensis when A. sinensis trees are threatened by external physical, chemical injury or endophytic fungal irritation. However, the mechanism of agarwood formation via chemical induction remains unclear. In this study, we characterized the transcriptome of different parts of a chemically induced A. sinensis trunk sample with agarwood. The Illumina sequencing platform was used to identify the genes involved in agarwood formation. Methodology/Principal Findings A five-year-old Aquilaria sinensis treated by formic acid was selected. The white wood part (B1 sample), the transition part between agarwood and white wood (W2 sample), the agarwood part (J3 sample), and the rotten wood part (F5 sample) were collected for transcriptome sequencing. Accordingly, 54,685,634 clean reads, which were assembled into 83,467 unigenes, were obtained with a Q20 value of 97.5%. A total of 50,565 unigenes were annotated using the Nr, Nt, SWISS-PROT, KEGG, COG, and GO databases. In particular, 171,331,352 unigenes were annotated by various pathways, including the sesquiterpenoid (ko00909) and plant–pathogen interaction (ko03040) pathways. These pathways were related to sesquiterpenoid biosynthesis and defensive responses to chemical stimulation. Conclusions/Significance The transcriptome data of the different parts of the chemically induced A. sinensis trunk provide a rich source of materials for discovering and identifying the genes involved in sesquiterpenoid production and in defensive responses to chemical stimulation. This study is the first to use de novo sequencing and transcriptome assembly for different parts of chemically induced A. sinensis. Results demonstrate that the sesquiterpenoid biosynthesis pathway and WRKY transcription factor play important roles in agarwood formation via chemical induction. The comparative analysis of

  3. Identification of differentially expressed genes related to metabolic syndrome induced with high-fat diet in E3 rats.

    PubMed

    Lan, Xi; Li, Dongmin; Zhong, Bo; Ren, Juan; Wang, Xuan; Sun, Qingzhu; Li, Yue; Liu, Lee; Liu, Li; Lu, Shemin

    2015-02-01

    Understanding the genes differentially expressing in aberrant organs of metabolic syndrome (MetS) facilitates the uncovering of molecular mechanisms and the identification of novel therapeutic targets for the disease. This study aimed to identify differentially expressed genes related to MetS in livers of E3 rats with high-fat-diet-induced metabolic syndrome (HFD-MetS). E3 rats were fed with high-fat diet for 24 weeks to induce MetS. Then, suppression subtractive hybridization (SSH) technology was used to identify the genes differentially expressed between HFD-MetS and control E3 rat livers. Twenty positive recombinant clones were chosen randomly from forward subtractive library and sent to sequence. BLAST analysis in GenBank database was used to determine the property of each cDNA fragment. In total, 11 annotated genes, 3 ESTs, and 2 novel gene fragments were identified by SSH technology. The expression of four genes (Alb, Pip4k2a, Scd1, and Tf) known to be associated with MetS and other five genes (Eif1, Rnase4, Rps12, Rup2, and Tmsb4) unknown to be relevant to MetS was significantly up-regulated in the livers of HFD-MetS E3 rats compared with control rats using real-time quantitative PCR (RT-qPCR). By analyzing the correlations between the expression of these nine genes and serum concentrations of TG, Tch, HDL-C, and LDL-C, we found that there were significant positive correlations between TG and the expression of five genes (Alb, Eif1, Pip4k2a, Rps12, and Tmsb4x), Tch and three genes (Rnase4, Scd1, and Tmsb4x), and LDL-C and two genes (Rnase4 and Scd1), as well there were significant negative correlations between HDL-C and the expression of three genes (Rup2, Scd1, and Tf). This study provides important clues for unraveling the molecular mechanisms of MetS.

  4. Genes related to iron metabolism and susceptibility to Alzheimer's disease in Basque population.

    PubMed

    Blázquez, L; De Juan, D; Ruiz-Martínez, J; Emparanza, J I; Sáenz, A; Otaegui, D; Sistiaga, A; Martínez-Lage, P; Lamet, I; Samaranch, L; Buiza, C; Etxeberria, I; Arriola, E; Cuadrado, E; Urdaneta, E; Yanguas, J; López de Munain, A

    2007-12-01

    Alzheimer's disease (AD) is the most common dementing disorder and presents with a progressive and irreversible cognitive decline of gradual onset. To date, several reports have involved iron in AD physiopathology. In this study, we have analysed TFC2 variant and HFE mutations (H63D and C282Y) in 211 AD patients and 167 controls recruited from an area of the Basque Country. Furthermore, we have studied APOE genotype as it is a well-known risk factor for AD. APOE epsilon 4 allele was associated with an increased risk of AD and an earlier age at onset, whereas no association was found between TFC2 or HFE C282Y mutation and disease susceptibility. The frequency of H63D mutation was higher in control population (29.9%) than in AD patients (18%), suggesting a protective role of this allele on AD either due to the presence of the mutation itself or through the effect of other related genes in the ancestral haplotype in which it is included.

  5. Use of Galerina marginata genes and proteins for peptide production

    DOEpatents

    Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D.; Luo, Hong

    2017-03-21

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptides and cyclic peptide production in mushrooms. In particular, the present invention relates to using genes and proteins from Galerina species encoding peptides specifically relating to amatoxins in addition to proteins involved with processing cyclic peptide toxins. In a preferred embodiment, the present invention also relates to methods for making small peptides and small cyclic peptides including peptides similar to amanitin. Further, the present inventions relate to providing kits for making small peptides.

  6. Use of Galerina marginata genes and proteins for peptide production

    DOEpatents

    Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D.; Luo, Hong

    2016-03-01

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptides and cyclic peptide production in mushrooms. In particular, the present invention relates to using genes and proteins from Galerina species encoding peptides specifically relating to amatoxins in addition to proteins involved with processing cyclic peptide toxins. In a preferred embodiment, the present invention also relates to methods for making small peptides and small cyclic peptides including peptides similar to amanitin. Further, the present inventions relate to providing kits for making small peptides.

  7. Genome Analysis of a Zygomycete Fungus Choanephora cucurbitarum Elucidates Necrotrophic Features Including Bacterial Genes Related to Plant Colonization

    PubMed Central

    Min, Byoungnam; Park, Ji-Hyun; Park, Hongjae; Shin, Hyeon-Dong; Choi, In-Geol

    2017-01-01

    A zygomycete fungus, Choanephora cucurbitarum is a plant pathogen that causes blossom rot in cucurbits and other plants. Here we report the genome sequence of Choanephora cucurbitarum KUS-F28377 isolated from squash. The assembled genome has a size of 29.1 Mbp and 11,977 protein-coding genes. The genome analysis indicated that C. cucurbitarum may employ a plant pathogenic mechanism similar to that of bacterial plant pathogens. The genome contained 11 genes with a Streptomyces subtilisin inhibitor-like domain, which plays an important role in the defense against plant immunity. This domain has been found only in bacterial genomes. Carbohydrate active enzyme analysis detected 312 CAZymes in this genome where carbohydrate esterase family 6, rarely found in dikaryotic fungal genomes, was comparatively enriched. The comparative genome analysis showed that the genes related to sexual communication such as the biosynthesis of β-carotene and trisporic acid were conserved and diverged during the evolution of zygomycete genomes. Overall, these findings will help us to understand how zygomycetes are associated with plants. PMID:28091548

  8. Calcitonin gene-related peptide released within the amygdala is involved in Pavlovian auditory fear conditioning.

    PubMed

    Kocorowski, L H; Helmstetter, F J

    2001-03-01

    The effects of CGRP and the CGRP receptor antagonist hCGRP(8-37) injected into the amygdala on both the acquisition and expression of fear behavior to a discrete auditory conditional stimulus (CS) and the training context were assessed. In Experiment 1, pretraining injections of CGRP but not hCGRP(8-37) produced fear-like behavior before any aversive stimuli were presented. While both compounds attenuated freezing to the contextual CS on the test day, neither affected learning about the auditory CS. In Experiment 2, pretesting injections of hCGRP(8-37) (0.63 mM) selectively attenuated freezing to the auditory CS but left freezing to the contextual CS intact. These data suggest that CGRP in the amygdala may selectively contribute to the expression of learning about auditory stimuli during fear conditioning.

  9. Equine Chorionic Gonadotropin Modulates the Expression of Genes Related to the Structure and Function of the Bovine Corpus Luteum

    PubMed Central

    Mendes, Gabriela Pacheco; Campos, Danila Barreiro; Baruselli, Pietro Sampaio; Papa, Paula de Carvalho

    2016-01-01

    We hypothesized that stimulatory and superovulatory treatments, using equine chorionic gonadotropin (eCG), modulate the expression of genes related to insulin, cellular modelling and angiogenesis signaling pathways in the bovine corpus luteum (CL). Therefore, we investigated: 1—the effect of these treatments on circulating insulin and somatomedin C concentrations and on gene and protein expression of INSR, IGF1 and IGFR1, as well as other insulin signaling molecules; 2—the effects of eCG on gene and protein expression of INSR, IGF1, GLUT4 and NFKB1A in bovine luteal cells; and 3—the effect of stimulatory and superovulatory treatments on gene and protein expression of ANG, ANGPT1, NOS2, ADM, PRSS2, MMP9 and PLAU. Serum insulin did not differ among groups (P = 0.96). However, serum somatomedin C levels were higher in both stimulated and superovulated groups compared to the control (P = 0.01). In stimulated cows, lower expression of INSR mRNA and higher expression of NFKB1A mRNA and IGF1 protein were observed. In superovulated cows, lower INSR mRNA expression, but higher INSR protein expression and higher IGF1, IGFR1 and NFKB1A gene and protein expression were observed. Expression of angiogenesis and cellular modelling pathway-related factors were as follows: ANGPT1 and PLAU protein expression were higher and MMP9 gene and protein expression were lower in stimulated animals. In superovulated cows, ANGPT1 mRNA expression was higher and ANG mRNA expression was lower. PRSS2 gene and protein expression were lower in both stimulated and superovulated animals related to the control. In vitro, eCG stimulated luteal cells P4 production as well as INSR and GLUT4 protein expression. In summary, our results suggest that superovulatory treatment induced ovarian proliferative changes accompanied by increased expression of genes providing the CL more energy substrate, whereas stimulatory treatment increased lipogenic activity, angiogenesis and plasticity of the extracellular

  10. Nicotine mediates expression of genes related to antioxidant capacity and oxidative stress response in HIV-1 transgenic rat brain.

    PubMed

    Song, Guohua; Nesil, Tanseli; Cao, Junran; Yang, Zhongli; Chang, Sulie L; Li, Ming D

    2016-02-01

    Oxidative stress plays an important role in the progression of HIV-1 infection. Nicotine can either protect neurons from neurodegeneration or induce oxidative stress, depending on its dose and degree of oxidative stress impairment. However, the relationship between nicotine and oxidative stress in the HIV-1-infected individuals remains largely unknown. The purpose of this study was to determine the effect of nicotine on expression of genes related to the glutathione (GSH)-centered antioxidant system and oxidative stress in the nucleus accumbens (NAc) and ventral tegmental area (VTA) of HIV-1 transgenic (HIV-1Tg) and F344 control rats. Adult HIV-1Tg and F344 rats received nicotine (0.4 mg/kg, base, s.c.) or saline injections once per day for 27 days. At the end of treatment, various brain regions including the NAc and VTA were collected from each rat. Following total RNA extraction and complementary DNA (cDNA) synthesis of each sample, quantitative reverse transcription PCR (RT-PCR) analysis was performed for 43 oxidative-stress-related genes. Compared with F344 control rats, HIV-1Tg rats showed a significant downregulation of genes involved in ATPase and cyctochrome oxidase at the messenger RNA (mRNA) level in both regions. Further, we found a significant downregulation of Gstm5 in the NAc and upregulation of Cox1, Cox3, and Gsta6 in the VTA of HIV-1Tg rats. HIV-1Tg rats showed brain-region-specific responses to chronic nicotine treatment. This response resulted in a change in the expression of genes involved in antioxidant mechanisms including the downregulation of genes such as Atp5h, Calml1, Gpx7, Gstm5, Gsr, and Gsta6 and upregulation of Sod1 in the NAc, as well as downregulation of genes like Cox5a, Gpx4, Gpx6, Gpx7, Gstm5, and Sod1 in the VTA of HIV-1Tg rats. Together, we conclude that chronic nicotine treatment has a dual effect on the antioxidant defense system and oxidative-stress-induced apoptosis signaling in HIV-1Tg rats. These findings suggest that

  11. Association study of 37 genes related to serotonin and dopamine neurotransmission and neurotrophic factors in cocaine dependence.

    PubMed

    Fernàndez-Castillo, N; Roncero, C; Grau-Lopez, L; Barral, C; Prat, G; Rodriguez-Cintas, L; Sánchez-Mora, C; Gratacòs, M; Ramos-Quiroga, J A; Casas, M; Ribasés, M; Cormand, B

    2013-02-01

    Cocaine dependence is a neuropsychiatric disorder in which both environmental and genetic factors are involved. Several processes, that include reward and neuroadaptations, mediate the transition from use to dependence. In this regard, dopamine and serotonin neurotransmission systems are clearly involved in reward and other cocaine-related effects, whereas neurotrophic factors may be responsible for neuroadaptations associated with cocaine dependence. We examined the contribution to cocaine dependence of 37 genes related to the dopaminergic and serotoninergic systems, neurotrophic factors and their receptors through a case-control association study with 319 single nucleotide polymorphisms selected according to genetic coverage criteria in 432 cocaine-dependent patients and 482 sex-matched unrelated controls. Single marker analyses provided evidence for association of the serotonin receptor HTR2A with cocaine dependence [rs6561333; nominal P-value adjusted for age = 1.9e-04, odds ratio = 1.72 (1.29-2.30)]. When patients were subdivided according to the presence or absence of psychotic symptoms, we confirmed the association between cocaine dependence and HTR2A in both subgroups of patients. Our data show additional evidence for the involvement of the serotoninergic system in the genetic susceptibility to cocaine dependence.

  12. The stimulatory effect of LED light spectra on genes related to photoreceptors and skin pigmentation in goldfish (Carassius auratus).

    PubMed

    Shin, Hyun Suk; Choi, Cheol Young

    2014-08-01

    This study aimed to assess differences in genes related to skin color of goldfish (Carassius auratus) exposed to light-emitting diodes (LEDs): red, green, and purple. We investigated differences in the expression of mammalian-like melanopsin (Opn4m), rhodopsin (RH), melanin-concentrating hormone (MCH), melanin-concentrating hormone receptor (MCH-R), and proopiomelanocortin (POMC) in goldfish exposed to different LED light spectra. Opn4m, RH, MCH, and MCH-R mRNA levels were significantly higher in the green and purple LED groups than in the white fluorescent bulb (control) and red LED groups. Furthermore, skin cells were isolated to measure the MCH-R mRNA expression levels. The results show that the mRNA expression levels were significantly higher in the green and purple LED groups than in the control and red LED groups. In addition, body weights in the green and purple LED groups were significantly higher than those in the control and red LED groups. However, POMC mRNA expression levels in the green and purple LED groups were significantly lower than those in the control and red LED groups. These results suggest that specific wavelengths regulate fish skin color through neuropeptide hormones and photoreceptors, and POMC, which is related to stress hormones and melatonin, is associated with stress levels as well as skin color.

  13. Daily variations in dietary lysine content alter the expression of genes related to proteolysis in chicken pectoralis major muscle.

    PubMed

    Tesseraud, Sophie; Bouvarel, Isabelle; Collin, Anne; Audouin, Estelle; Crochet, Sabine; Seiliez, Iban; Leterrier, Christine

    2009-01-01

    Amino acids are known to be anabolic factors that affect protein metabolism, but the response of animals to daily amino acid changes is little understood. We aimed to test the effects of feeding birds with alternations of diets varying in lysine content on the expression of genes related to proteolysis in chicken muscle. Cyclic feeding programs with 2 diets, each given for 24 h during 48-h cycles, were carried out from 10 d of age. Three programs were used: 1) control treatment with continuous distribution of a complete diet containing standard medium lysine level (ML; 11.9 g/kg); 2) alternation of diets with high (HL) and low (LL) lysine levels; 3) alternation of ML and LL diets, where LL = 70%, ML = 100%, HL = 130% of standard lysine level. The Pectoralis major muscles were sampled after 2 wk of cyclic feeding. Measurements included the expression patterns of 6 genes involved in proteolysis, and mammalian target of rapamycin and Forkhead box-O transcription factor (FoxO) signaling. Cathepsin B, m-calpain, and E3 ubiquitin ligases Muscle Ring Finger-1 and Muscle Atrophy F box were significantly overexpressed in chickens transiently fed the LL diet, whereas the mRNA levels of 20S proteasome C2 subunit and ubiquitin remained unchanged. Modifications of E3 ubiquitin ligase expression can be partly explained by significant changes in FoxO phosphorylation with cyclic dietary treatments. Our results suggest timing-sensitive regulation of proteolysis in chicken muscle according to dietary treatment and a high metabolism capacity to compensate for changes in amino acid supply, which might be used for nutritional purposes.

  14. Probing the evolution of biological nitrogen fixation by examining phylogenetic relationships of nitrogen fixation genes related by gene duplication

    NASA Astrophysics Data System (ADS)

    Peters, J.; Boyd, E. S.; Hamilton, T.

    2011-12-01

    Mounting evidence indicates the presence of a near complete biological nitrogen cycle in redox stratified oceans during the late Archean to early Proterozoic (~2.5 to 2.0 Ga). It has been suggested that the iron (Fe)-only or vanadium (V)-dependent alternative forms of nitrogenase rather than molybdenum (Mo)-dependent form was responsible for dinitrogen (N2) fixation during this time because oceans were depleted in Mo and rich in Fe. However, the only extant nitrogen fixing organisms that harbor alternative nitrogenases also harbor a Mo-dependent nitrogenase. Furthermore, our recent global gene expression analysis revealed that the alternative enzymes rely on genes encoding biosynthetic machinery to assemble active enzymes that are associated with the Mo-dependent nitrogenase. In our recent work we conducted an in-depth phylogenetic analysis of the proteins required for molybdenum (Mo)-nitrogenase that arose from gene fusion and duplication, expanding on previous analyses of single gene loci and multiple gene loci. The results of this analysis are highly suggestive that Mo-nitrogenase is unlikely to have been associated with the last universal common ancestor (LUCA). Rather, the oldest extant organisms harboring Mo-nitrogenase can be traced to hydrogenotrophic methanogens with acquisition in the bacterial domain via lateral gene transfer involving an anaerobic member of the Firmicutes. An origin and ensuing proliferation of Mo-nitrogenase under anoxic conditions would likely have occurred in an environment where anaerobic methanogens and Firmicutes coexisted and where Mo was at least episodically available, such as in a redox stratified Proterozoic ocean basin. In more recent work we have examined the hypothesis that the alternative forms predate the Mo-dependent nitrogenase by examining the phylogenetic relationships of the genetically distinct structural proteins of the Fe-only, V-, and Mo-nitrogenase that are required for activity. As a result, a clear and

  15. The mouse Enhancer trap locus 1 (Etl-1): a novel mammalian gene related to Drosophila and yeast transcriptional regulator genes.

    PubMed

    Soininen, R; Schoor, M; Henseling, U; Tepe, C; Kisters-Woike, B; Rossant, J; Gossler, A

    1992-11-01

    A novel mouse gene, Enhancer trap locus 1 (Etl-1), was identified in close proximity to a lacZ enhancer trap integration in the mouse genome showing a specific beta-galactosidase staining pattern during development. In situ analysis revealed a widespread but not ubiquitous expression of Etl-1 throughout development with particularly high levels in the central nervous system and epithelial cells. The amino acid sequence of the Etl-1 protein deduced from the cDNA shows strong similarity, over a stretch of 500 amino acids, to the Drosophila brahma protein involved in the regulation of homeotic genes and to the yeast transcriptional activator protein SNF2/SWI2 as well as to the RAD54 protein and the recently described helicase-related yeast proteins STH1 and MOT1. Etl-1 is the first mammalian member of this group of proteins that are implicated in gene regulation and/or influencing chromatin structure. The homology to the regulatory proteins SNF2/SWI2 and brahma and the expression pattern during embryogenesis suggest that Etl-1 protein might be involved in gene regulating pathways during mouse development.

  16. Molecular Cloning, Bioinformatic Analysis, and Expression of Bombyx mori Lebocin 5 Gene Related to Beauveria bassiana Infection

    PubMed Central

    Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian

    2017-01-01

    A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori, by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana, the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm. PMID:28194425

  17. Molecular Cloning, Bioinformatic Analysis, and Expression of Bombyx mori Lebocin 5 Gene Related to Beauveria bassiana Infection.

    PubMed

    Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian; Guo, Xijie

    2017-01-01

    A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori, by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana, the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm.

  18. Functional identification of a Leishmania gene related to the peroxin 2 gene reveals common ancestry of glycosomes and peroxisomes.

    PubMed Central

    Flaspohler, J A; Rickoll, W L; Beverley, S M; Parsons, M

    1997-01-01

    Glycosomes are membrane-bounded microbody organelles that compartmentalize glycolysis as well as other important metabolic processes in trypanosomatids. The compartmentalization of these enzymatic reactions is hypothesized to play a crucial role in parasite physiology. Although the metabolic role of glycosomes differs substantially from that of the peroxisomes that are found in other eukaryotes, similarities in signals targeting proteins to these organelles suggest that glycosomes and peroxisomes may have evolved from a common ancestor. To examine this hypothesis, as well as gain insights into the function of the glycosome, we used a positive genetic selection procedure to isolate the first Leishmania mutant (gim1-1 [glycosome import] mutant) with a defect in the import of glycosomal proteins. The mutant retains glycosomes but mislocalizes a subset glycosomal proteins to the cytoplasm. Unexpectedly, the gim1-1 mutant lacks lipid bodies, suggesting a heretofore unknown role of the glycosome. We used genetic approaches to identify a gene, GIM1, that is able to restore import and lipid bodies. A nonsense mutation was found in one allele of this gene in the mutant line. The predicted Gim1 protein is related the peroxin 2 family of integral membrane proteins, which are required for peroxisome biogenesis. The similarities in sequence and function provide strong support for the common origin model of glycosomes and peroxisomes. The novel phenotype of gim1-1 and distinctive role of Leishmania glycosomes suggest that future studies of this system will provide a new perspective on microbody biogenesis and function. PMID:9032236

  19. Improving gene annotation using peptide mass spectrometry

    PubMed Central

    Tanner, Stephen; Shen, Zhouxin; Ng, Julio; Florea, Liliana; Guigó, Roderic; Briggs, Steven P.; Bafna, Vineet

    2007-01-01

    Annotation of protein-coding genes is a key goal of genome sequencing projects. In spite of tremendous recent advances in computational gene finding, comprehensive annotation remains a challenge. Peptide mass spectrometry is a powerful tool for researching the dynamic proteome and suggests an attractive approach to discover and validate protein-coding genes. We present algorithms to construct and efficiently search spectra against a genomic database, with no prior knowledge of encoded proteins. By searching a corpus of 18.5 million tandem mass spectra (MS/MS) from human proteomic samples, we validate 39,000 exons and 11,000 introns at the level of translation. We present translation-level evidence for novel or extended exons in 16 genes, confirm translation of 224 hypothetical proteins, and discover or confirm over 40 alternative splicing events. Polymorphisms are efficiently encoded in our database, allowing us to observe variant alleles for 308 coding SNPs. Finally, we demonstrate the use of mass spectrometry to improve automated gene prediction, adding 800 correct exons to our predictions using a simple rescoring strategy. Our results demonstrate that proteomic profiling should play a role in any genome sequencing project. PMID:17189379

  20. Adaptation of mycoplasmas to antimicrobial agents: Acholeplasma laidlawii extracellular vesicles mediate the export of ciprofloxacin and a mutant gene related to the antibiotic target.

    PubMed

    Medvedeva, Elena S; Baranova, Natalia B; Mouzykantov, Alexey A; Grigorieva, Tatiana Yu; Davydova, Marina N; Trushin, Maxim V; Chernova, Olga A; Chernov, Vladislav M

    2014-01-01

    This study demonstrated that extracellular membrane vesicles are involved with the development of resistance to fluoroquinolones by mycoplasmas (class Mollicutes). This study assessed the differences in susceptibility to ciprofloxacin among strains of Acholeplasma laidlawii PG8. The mechanisms of mycoplasma resistance to antibiotics may be associated with a mutation in a gene related to the target of quinolones, which could modulate the vesiculation level. A. laidlawii extracellular vesicles mediated the export of the nucleotide sequences of the antibiotic target gene as well as the traffic of ciprofloxacin. These results may facilitate the development of effective approaches to control mycoplasma infections, as well as the contamination of cell cultures and vaccine preparations.

  1. CDKL5 Gene-Related Epileptic Encephalopathy in Estonia: Four Cases, One Novel Mutation Causing Severe Phenotype in a Boy, and Overview of the Literature.

    PubMed

    Lilles, Stella; Talvik, Inga; Noormets, Klari; Vaher, Ulvi; Õunap, Katrin; Reimand, Tiia; Sander, Valentin; Ilves, Pilvi; Talvik, Tiina

    2016-12-01

    Cyclin-dependent kinase-like 5 (CDKL5) gene mutations have mainly been found in females with early infantile epileptic encephalopathy (EIEE), severe intellectual disability, and Rett-like features. To date, only 22 boys have been reported, presenting with far more severe phenotypic features. We report the first cases of CDKL5 gene-related EIEE in Estonia diagnosed using panels of epilepsy-associated genes and describe the phenotype-genotype correlations in three male and one female patient. One of the mutations, identified in a male patient, was a novel de novo hemizygous frameshift mutation (NM_003159.2:c.2225_2228del (p.Glu742Afs*41)) in exon 15 of CDKL5. All boys have a more severe phenotype than the female patient. In boys with early onset of seizures and poor development with absent or poor eye contact, CDKL5 gene-related EIEE can be suspected and epilepsy-associated genes should be analyzed for early etiological diagnosis. Early genetic diagnosis would be the cornerstone in personalized treatment in the future.

  2. The Saccharomyces cerevisiae flavodoxin-like proteins Ycp4 and Rfs1 play a role in stress response and in the regulation of genes related to metabolism.

    PubMed

    Cardona, Fernando; Orozco, Helena; Friant, Sylvie; Aranda, Agustín; del Olmo, Marcel lí

    2011-07-01

    SPI1 is a gene whose expression responds to many environmental stimuli, including entry into stationary phase. We have performed a screening to identify genes that activate SPI1 promoter when overexpressed. The phosphatidylinositol-4-phosphate 5-kinase gene MSS4 was identified as a positive activator of SPI1. Another SPI1 transcriptional regulator isolated was the flavodoxin-like gene YCP4. YCP4 and its homolog RFS1 regulate the expression of many genes during the late stages of growth. The double deletion mutant in YCP4 and its homolog RFS1 has an impact on gene expression related to metabolism by increasing the expression of genes involved in hexose transport and glycolysis, and decreasing expression of genes of amino acid metabolism pathways. Genes related to mating and response to pheromone show a decreased expression in the double mutant, while transcription of genes involved in translational elongation is increased. Deletion of these genes, together with the third member of the family, PST2, has a complex effect on the stress response. For instance, double mutant ycp4Δrfs1Δ has an increased response to oxidative stress, but a decreased tolerance to cell-damaging agent SDS. Additionally, this mutation affects chronological aging and slightly increases fermentative capacity.

  3. Expression profile of hepatic genes related to lipid homeostasis in LSR heterozygous mice contributes to their increased response to high-fat diet.

    PubMed

    Akbar, Samina; Pinçon, Anthony; Lanhers, Marie-Claire; Claudepierre, Thomas; Corbier, Catherine; Gregory-Pauron, Lynn; Malaplate-Armand, Catherine; Visvikis, Athanase; Oster, Thierry; Yen, Frances T

    2016-12-01

    Perturbations of lipid homeostasis manifest as dyslipidemias and obesity, which are significant risk factors for atherosclerosis and diabetes. Lipoprotein receptors in the liver are key players in the regulation of lipid homeostasis, among which the hepatic lipolysis stimulated lipoprotein receptor, LSR, was recently shown to play an important role in the removal of lipoproteins from the circulation during the postprandial phase. Since heterozygous LSR+/- mice demonstrate moderate dyslipidemia and develop higher body weight gain in response to high-fat diet compared with littermate LSR+/+ controls, we questioned if LSR heterozygosity could affect genes related to hepatic lipid metabolism. A target-specific qPCR array for 84 genes related to lipid metabolism was performed on mRNA isolated from livers of 6 mo old female LSR+/- mice and LSR+/+ littermates following a 6 wk period on a standard (STD) or high-fat diet (60% kcal, HFD). Of the 84 genes studied, 32 were significantly downregulated in STD-LSR+/- mice compared with STD-LSR+/+, a majority of which were PPARα target genes involved in lipid metabolism and transport, and insulin and adipokine-signaling pathways. Of these 32 genes, 80% were also modified in HFD-LSR+/+, suggesting that STD-LSR+/- mice demonstrated a predisposition towards a "high-fat"-like profile, which could reflect dysregulation of liver lipid homeostasis. Since similar profiles of genes were affected by either LSR heterozygosity or by high-fat diet, this would suggest that LSR is a key receptor in regulating hepatic lipid homeostasis, and whose downregulation combined with a Western-type diet may increase predisposition to diet-induced obesity.

  4. Characterization of reducible peptide oligomers as carriers for gene delivery.

    PubMed

    Kiselev, Anton; Egorova, Anna; Laukkanen, Antti; Baranov, Vladislav; Urtti, Arto

    2013-01-30

    The stability of DNA-polyplexes and intracellular DNA release are important features of gene delivery systems. To study these features, we have evaluated reducible cysteine-flanked linear lysine and arginine-rich peptides, modified with histidine residues. The reducible disulfide bonds in cysteine flanked peptides and histidine residues should augment DNA release from the peptide-DNA complexes upon disintegration of the reducible bonds. Template polymerization and oxidative polycondensation were applied to obtain peptide oligomers used for DNA-polyplex preparation. The peptides and DNA-peptide complexes were investigated with physical, chemical and transfection measurements. Physicochemical and transfection properties of DNA-polyplexes depended on the amino acid sequence of the peptidic polymers and type of the polymerization. MALDI-TOF analysis of oxidatively polycondensed products revealed several forms of peptide oligomers corresponding to 5-8 amino acid monomers. DNA-peptide particles based on template-polymerized complexes were more resistant to relaxation by negatively charged heparan sulfate than polyplexes formed with oxidatively condensed peptides. Complexes of DNA with the polycations prepared by oxidative polycondensation exhibited a 100-1000-fold higher level of gene expression compared to DNA/template-polymerized peptide complexes. The most efficient transgene expression was shown with arginine-rich polyplexes. Transfection efficacy of the arginine-rich polyplexes was even 10-fold better than that of DNA/PEI complexes. On average, polyplexes based on cysteine-flanked peptide oligomers showed lower cytotoxicity than non-reducible high molecular weight polylysine/DNA particles. We conclude that reducible peptide oligomers provide efficient DNA transfection and have the potential as vehicles for gene delivery.

  5. Expression profiling reveals functionally redundant multiple-copy genes related to zinc, iron and cadmium responses in Brassica rapa.

    PubMed

    Li, Jimeng; Liu, Bo; Cheng, Feng; Wang, Xiaowu; Aarts, Mark G M; Wu, Jian

    2014-07-01

    Genes underlying environmental adaptability tend to be over-retained in polyploid plant species. Zinc deficiency (ZnD) and iron deficiency (FeD), excess Zn (ZnE) and cadmium exposure (CdE) are major environmental problems for crop cultivation, but little is known about the differential expression of duplicated genes upon these stress conditions. Applying Tag-Seq technology to leaves of Brassica rapa grown under FeD, ZnD, ZnE or CdE conditions, with normal conditions as a control, we examined global gene expression changes and compared the expression patterns of multiple paralogs. We identified 812, 543, 331 and 447 differentially expressed genes under FeD, ZnD, ZnE and CdE conditions, respectively, in B. rapa leaves. Genes involved in regulatory networks centered on the transcription factors bHLH038 or bHLH100 were differentially expressed under (ZnE-induced) FeD. Further analysis revealed that genes associated with Zn, Fe and Cd responses tended to be over-retained in the B. rapa genome. Most of these multiple-copy genes showed the same direction of expression change under stress conditions. We conclude that the duplicated genes involved in trace element responses in B. rapa are functionally redundant, making the regulatory network more complex in B. rapa than in Arabidopsis thaliana.

  6. Pathway-Based Analysis of a Melanoma Genome-Wide Association Study: Analysis of Genes Related to Tumour-Immunosuppression

    PubMed Central

    Schoof, Nils; Iles, Mark M.; Bishop, D. Timothy; Newton-Bishop, Julia A.; Barrett, Jennifer H.; consortium, GenoMEL

    2011-01-01

    Systemic immunosuppression is a risk factor for melanoma, and sunburn-induced immunosuppression is thought to be causal. Genes in immunosuppression pathways are therefore candidate melanoma-susceptibility genes. If variants within these genes individually have a small effect on disease risk, the association may be undetected in genome-wide association (GWA) studies due to low power to reach a high significance level. Pathway-based approaches have been suggested as a method of incorporating a priori knowledge into the analysis of GWA studies. In this study, the association of 1113 single nucleotide polymorphisms (SNPs) in 43 genes (39 genomic regions) related to immunosuppression have been analysed using a gene-set approach in 1539 melanoma cases and 3917 controls from the GenoMEL consortium GWA study. The association between melanoma susceptibility and the whole set of tumour-immunosuppression genes, and also predefined functional subgroups of genes, was considered. The analysis was based on a measure formed by summing the evidence from the most significant SNP in each gene, and significance was evaluated empirically by case-control label permutation. An association was found between melanoma and the complete set of genes (pemp = 0.002), as well as the subgroups related to the generation of tolerogenic dendritic cells (pemp = 0.006) and secretion of suppressive factors (pemp = 0.0004), thus providing preliminary evidence of involvement of tumour-immunosuppression gene polymorphisms in melanoma susceptibility. The analysis was repeated on a second phase of the GenoMEL study, which showed no evidence of an association. As one of the first attempts to replicate a pathway-level association, our results suggest that low power and heterogeneity may present challenges. PMID:22216283

  7. Genes Related to Mitochondrial Functions, Protein Degradation, and Chromatin Folding Are Differentially Expressed in Lymphomonocytes of Rett Syndrome Patients

    PubMed Central

    Leoni, Guido; Cervellati, Franco; Canali, Raffaella; Cortelazzo, Alessio; De Felice, Claudio; Ciccoli, Lucia; Hayek, Joussef

    2013-01-01

    Rett syndrome (RTT) is mainly caused by mutations in the X-linked methyl-CpG binding protein (MeCP2) gene. By binding to methylated promoters on CpG islands, MeCP2 protein is able to modulate several genes and important cellular pathways. Therefore, mutations in MeCP2 can seriously affect the cellular phenotype. Today, the pathways that MeCP2 mutations are able to affect in RTT are not clear yet. The aim of our study was to investigate the gene expression profiles in peripheral blood lymphomonocytes (PBMC) isolated from RTT patients to try to evidence new genes and new pathways that are involved in RTT pathophysiology. LIMMA (Linear Models for MicroArray) and SAM (Significance Analysis of Microarrays) analyses on microarray data from 12 RTT patients and 7 control subjects identified 482 genes modulated in RTT, of which 430 were upregulated and 52 were downregulated. Functional clustering of a total of 146 genes in RTT identified key biological pathways related to mitochondrial function and organization, cellular ubiquitination and proteosome degradation, RNA processing, and chromatin folding. Our microarray data reveal an overexpression of genes involved in ATP synthesis suggesting altered energy requirement that parallels with increased activities of protein degradation. In conclusion, these findings suggest that mitochondrial-ATP-proteasome functions are likely to be involved in RTT clinical features. PMID:24453408

  8. Analysis of Differentially Expressed Genes Related to Resistance in Spinosad- and Neonicotinoid-Resistant Musca domestica L. (Diptera: Muscidae) Strains

    PubMed Central

    Højland, Dorte H.

    2017-01-01

    Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes in these two resistant strains related to metabolism in comparison with an insecticide-susceptible reference strain. Results Genes involved in metabolism of xenobiotics were primarily up-regulated in resistant flies with some differences between resistant strains. The cyp4g98 and cyp6g4 genes proved interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked to the alteration of a single gene but is composed of several changes including differential expression of genes encoding metabolic detoxification enzymes. PMID:28125739

  9. The mRNA expression profile of metabolic genes relative to MHC isoform pattern in human skeletal muscles.

    PubMed

    Plomgaard, Peter; Penkowa, Milena; Leick, Lotte; Pedersen, Bente K; Saltin, Bengt; Pilegaard, Henriette

    2006-09-01

    The metabolic profile of rodent muscle is generally reflected in the myosin heavy chain (MHC) fiber-type composition. The present study was conducted to test the hypothesis that metabolic gene expression is not tightly coupled with MHC fiber-type composition for all genes in human skeletal muscle. Triceps brachii, vastus lateralis quadriceps, and soleus muscle biopsies were obtained from normally physically active, healthy, young male volunteers, because these muscles are characterized by different fiber-type compositions. As expected, citrate synthase and 3-hydroxyacyl dehydrogenase activity was more than twofold higher in soleus and vastus than in triceps. Contrary, phosphofructokinase and total lactate dehydrogenase (LDH) activity was approximately three- and twofold higher in triceps than in both soleus and vastus. Expression of metabolic genes was assessed by determining the mRNA content of a broad range of metabolic genes. The triceps muscle had two- to fivefold higher MHC IIa, phosphofructokinase, and LDH A mRNA content and two- to fourfold lower MHC I, lipoprotein lipase, CD36, hormone-sensitive lipase, and LDH B and hexokinase II mRNA than vastus lateralis or soleus. Interestingly, such mRNA differences were not evident for any of the genes encoding mitochondrial oxidative proteins, 3-hydroxyacyl dehydrogenase, carnitine palmitoyl transferase I, citrate synthase, alpha-ketogluterate dehydrogenase, and cytochrome c, nor for the transcriptional regulators peroxisome proliferator activator receptor gamma coactivator-1alpha, forkhead box O1, or peroxisome proliferator activator receptor-alpha. Thus the mRNA expression of genes encoding mitochondrial proteins and transcriptional regulators does not seem to be fiber type specific as the genes encoding glycolytic and lipid metabolism genes, which suggests that basal mRNA regulation of genes encoding mitochondrial proteins does not match the wide differences in mitochondrial content of these muscles.

  10. Effect of vitamin E supplementation or alfalfa grazing on fatty acid composition and expression of genes related to lipid metabolism in lambs.

    PubMed

    González-Calvo, L; Joy, M; Blanco, M; Dervishi, E; Molino, F; Sarto, P; Ripoll, G; Serrano, M; Calvo, J H

    2015-06-01

    The aim of this study was to investigate the effects of vitamin E (VE) supplementation and alfalfa grazing during fattening on fatty acid composition and mRNA expression of genes related to lipid metabolism in the LM of Rasa Aragonesa light lambs. After weaning, 48 lambs were kept indoors and fed a commercial concentrate and a VE supplemented concentrate (480 mg DL-α-tocopheryl acetate/kg DM) for 0 (control [CON]), 10 (VE10d), 20 (VE20d), and 30 d (VE30d) before slaughtering at 22 to 24 kg. Simultaneously, 8 unweaned lambs grazed in alfalfa (154 mg α-tocopherol/kg DM) paddocks with their dams and supplemented with the commercial concentrate (ALF). Immediately after slaughter, LM was sampled to determine gene expression. After 24 h of cooling at 4°C, LM was extracted to determine intramuscular fat (IMF) content and fatty acid composition. The IMF content did not differ with the dietary treatment ( = 0.212). Unweaned grazing alfalfa lambs had greater concentration of rumenic acid (C18:2 c9,t11; P < 0.001) and lower oleic acid (C18:1 c9; = 0.001) content and PUFA n-6:n-3 ratio (P < 0.001) but similar expression of genes implicated in lipid metabolism compared to the concentrate-fed lambs. Vitamin E supplementation did not modify muscle fatty acid composition; however, it increased the expression of FADS2 and ELOVL6, which are involved in desaturation of long-chain fatty acid and the elongation of SFA and MUFA. The results showed that a short period of VE supplementation, especially 10 (VE10d) and 20 d (VE20d), modified gene expression. Overall, the results showed that VE may be acting as a regulatory factor for transcriptional control of genes related to lipid metabolism in the muscle of Rasa Aragonesa light lambs (22-24 kg live weight and younger than 90 d old).

  11. Deletion of the Small RNA Chaperone Protein Hfq down Regulates Genes Related to Virulence and Confers Protection against Wild-Type Brucella Challenge in Mice

    PubMed Central

    Lei, Shuangshuang; Zhong, Zhijun; Ke, Yuehua; Yang, Mingjuan; Xu, Xiaoyang; Ren, Hang; An, Chang; Yuan, Jiuyun; Yu, Jiuxuan; Xu, Jie; Qiu, Yefeng; Shi, Yanchun; Wang, Yufei; Peng, Guangneng; Chen, Zeliang

    2016-01-01

    Brucellosis is one of the most common zoonotic epidemics worldwide. Brucella, the etiological pathogen of brucellosis, has unique virulence characteristics, including the ability to survive within the host cell. Hfq is a bacterial chaperone protein that is involved in the survival of the pathogen under stress conditions. Moreover, hfq affects the expression of a large number of target genes. In the present study, we characterized the expression and regulatory patterns of the target genes of Hfq during brucellosis. The results revealed that hfq expression is highly induced in macrophages at the early infection stage and at the late stage of mouse infection. Several genes related to virulence, including omp25, omp31, vjbR, htrA, gntR, and dnaK, were found to be regulated by hfq during infection in BALB/c mice. Gene expression and cytokine secretion analysis revealed that an hfq-deletion mutant induced different cytokine profiles compared with that induced by 16M. Infection with the hfq-deletion mutant induced protective immune responses against 16M challenge. Together, these results suggest that hfq is induced during infection and its deletion results in significant attenuation which affects the host immune response caused by Brucella infection. By regulating genes related to virulence, hfq promotes the virulence of Brucella. The unique characteristics of the hfq-deletion mutant, including its decreased virulence and the ability to induce protective immune response upon infection, suggest that it represents an attractive candidate for the design of a live attenuated vaccine against Brucella. PMID:26834720

  12. Genetic polymorphisms located in genes related to immune and inflammatory processes are associated with end-stage renal disease: a preliminary study

    PubMed Central

    2012-01-01

    Background Chronic kidney disease progression has been linked to pro-inflammatory cytokines and markers of inflammation. These markers are also elevated in end-stage renal disease (ESRD), which constitutes a serious public health problem. Objective To investigate whether single nucleotide polymorphisms (SNPs) located in genes related to immune and inflammatory processes, could be associated with ESRD development. Design and methods A retrospective case-control study was carried out on 276 patients with ESRD and 288 control subjects. Forty-eight SNPs were genotyped via SNPlex platform. Logistic regression was used to assess the relationship between each sigle polymorphism and the development of ESRD. Results Four polymorphisms showed association with ESRD: rs1801275 in the interleukin 4 receptor (IL4R) gene (OR: 0.66 (95%CI = 0.46-0.95); p = 0.025; overdominant model), rs4586 in chemokine (C-C motif) ligand 2 (CCL2) gene (OR: 0.70 (95%CI = 0.54-0.90); p = 0.005; additive model), rs301640 located in an intergenic binding site for signal transducer and activator of transcription 4 (STAT4) (OR: 1.82 (95%CI = 1.17-2.83); p = 0.006; additive model) and rs7830 in the nitric oxide synthase 3 (NOS3) gene (OR: 1.31 (95%CI = 1.01-1.71); p = 0.043; additive model). After adjusting for multiple testing, results lost significance. Conclusion Our preliminary data suggest that four genetic polymorphisms located in genes related to inflammation and immune processes could help to predict the risk of developing ESRD. PMID:22817530

  13. Identification of Candidate Genes Related to Inflammatory Bowel Disease Using Minimum Redundancy Maximum Relevance, Incremental Feature Selection, and the Shortest-Path Approach

    PubMed Central

    Zhang, Yu-Hang; Kong, Xiang-Yin

    2017-01-01

    Identification of disease genes is a hot topic in biomedicine and genomics. However, it is a challenging problem because of the complexity of diseases. Inflammatory bowel disease (IBD) is an idiopathic disease caused by a dysregulated immune response to host intestinal microflora. It has been proven to be associated with the development of intestinal malignancies. Although the specific pathological characteristics and genetic background of IBD have been partially revealed, it is still an overdetermined disease and the blueprint of all genetic variants still needs to be improved. In this study, a novel computational method was built to identify genes related to IBD. Samples from two subtypes of IBD (ulcerative colitis and Crohn's disease) and normal samples were employed. By analyzing the gene expression profiles of these samples using minimum redundancy maximum relevance and incremental feature selection, 21 genes were obtained that could effectively distinguish samples from the two subtypes of IBD and the normal samples. Then, the shortest-path approach was used to search for an additional 20 genes in a large network constructed using protein-protein interactions based on the above-mentioned 21 genes. Analyses of the 41 genes obtained indicate that they are closely associated with this disease. PMID:28293637

  14. Characterization of Antimicrobial Susceptibility and Its Association with Virulence Genes Related to Adherence, Invasion, and Cytotoxicity in Campylobacter jejuni and Campylobacter coli Isolates from Animals, Meat, and Humans.

    PubMed

    Lapierre, Lisette; Gatica, María A; Riquelme, Víctor; Vergara, Constanza; Yañez, José Manuel; San Martín, Betty; Sáenz, Leonardo; Vidal, Maricel; Martínez, María Cristina; Araya, Pamela; Flores, Roberto; Duery, Oscar; Vidal, Roberto

    2016-07-01

    The aim of this research was to statistically analyze the association between antimicrobial susceptibility/resistance to erythromycine, gentamicin, ciprofloxacin, and tetracycline and 11 virulence genes associated with adherence, invasion, and cytotoxicity in 528 isolates of Campylobacter coli and Campylobacter jejuni obtained from retail meat and fecal samples from food-producing animals and human patients. A high percentage of Campylobacter strains were resistant to antimicrobials, specifically ciprofloxacin and tetracycline. Moreover, we observed a wide distribution of virulence genes within the analyzed strains. C. jejuni strains were more susceptible to antimicrobials, and showed greater number of virulence genes than C. coli strains. Genes related to invasion capability, such as racR, ciaB, and pldA, were associated with antimicrobial-susceptible strains in both species. The genes cdtA and dnaJ, a citotoxin unit and an adherence-related gene, respectively, were associated with antimicrobial-resistant strains in both species. In conclusion, Campylobacter strains show a statistically significant association between antimicrobial susceptibility and the presence of virulence genes.

  15. Identification of genes related to learning and memory in the brain transcriptome of the mollusc, Hermissenda crassicornis.

    PubMed

    Tamvacakis, Arianna N; Senatore, Adriano; Katz, Paul S

    2015-12-01

    The sea slug Hermissenda crassicornis (Mollusca, Gastropoda, Nudibranchia) has been studied extensively in associative learning paradigms. However, lack of genetic information previously hindered molecular-level investigations. Here, the Hermissenda brain transcriptome was sequenced and assembled de novo, producing 165,743 total transcripts. Orthologs of 95 genes implicated in learning were identified. These included genes for a serotonin receptor and a GABA-B receptor subunit that had not been previously described in molluscs, as well as an adenylyl cyclase gene not previously described in gastropods. This study illustrates the Hermissenda transcriptome's potential as an important genetic tool in future learning and memory research.

  16. Identification of genes related to learning and memory in the brain transcriptome of the mollusc, Hermissenda crassicornis

    PubMed Central

    Tamvacakis, Arianna N.; Senatore, Adriano

    2015-01-01

    The sea slug Hermissenda crassicornis (Mollusca, Gastropoda, Nudibranchia) has been studied extensively in associative learning paradigms. However, lack of genetic information previously hindered molecular-level investigations. Here, the Hermissenda brain transcriptome was sequenced and assembled de novo, producing 165,743 total transcripts. Orthologs of 95 genes implicated in learning were identified. These included genes for a serotonin receptor and a GABA-B receptor subunit that had not been previously described in molluscs, as well as an adenylyl cyclase gene not previously described in gastropods. This study illustrates the Hermissenda transcriptome's potential as an important genetic tool in future learning and memory research. PMID:26572652

  17. Transcriptome Analysis Reveals Candidate Genes Related to Color Fading of ‘Red Bartlett’ (Pyrus communis L.)

    PubMed Central

    Wang, Zhigang; Du, Hong; Zhai, Rui; Song, Linyan; Ma, Fengwang; Xu, Lingfei

    2017-01-01

    The red color of fruit is an attractive plant trait for consumers. Plants with color-faded fruit have a lower commercial value, such as ‘Red Bartlett’ pears (Pyrus communis L.) that have dark-red fruit in the early stages of fruit development that subsequently fade to red-green at maturity. To identify the reason for color fading, we first analyzed the anthocyanin content of peel from ‘Red Bartlett,’ which displays the color fading phenomenon, and ‘Starkrimson,’ which has no color fading. Results showed that the anthocyanin content of ‘Red Bartlett’ peel decreased significantly late in fruit development, while in ‘Starkrimson’ there was no significant decrease. Next, RNA-Sequencing was used to identify 947 differentially expressed genes (DEGs) between ‘Red Bartlett’ and ‘Starkrimson.’ Among them, 471 genes were upregulated and 476 genes were downregulated in ‘Red Bartlett’ at the late development stage relative to ‘Starkrimson.’ During ‘Red Bartlett’ color fading, the structural gene LDOX and six GST family genes were downregulated, while FLS, LAC, POD, and five light-responding genes were significantly upregulated. Additionally, 45 genes encoding transcription factors MYB, bHLH, WRKY, NAC, ERF, and zinc finger were identified among 947 DEGs. Changes in the expression of these genes may be responsible for the decrease in anthocyanin accumulation in ‘Red Bartlett’ fruit. Taken together, this study demonstrated that color fading of ‘Red Bartlett’ was closely linked to reduced anthocyanin biosynthesis, increased anthocyanin degradation and suppression of anthocyanin transport. It also provided novel evidence for the involvement of light signals in the color fading of red-skinned pears.

  18. Discovery of Genes Related to Insecticide Resistance in Bactrocera dorsalis by Functional Genomic Analysis of a De Novo Assembled Transcriptome

    PubMed Central

    Hsu, Ju-Chun; Wu, Wen-Jer; Feng, Hai-Tung; Haymer, David S.; Chen, Chien-Yu

    2012-01-01

    Insecticide resistance has recently become a critical concern for control of many insect pest species. Genome sequencing and global quantization of gene expression through analysis of the transcriptome can provide useful information relevant to this challenging problem. The oriental fruit fly, Bactrocera dorsalis, is one of the world's most destructive agricultural pests, and recently it has been used as a target for studies of genetic mechanisms related to insecticide resistance. However, prior to this study, the molecular data available for this species was largely limited to genes identified through homology. To provide a broader pool of gene sequences of potential interest with regard to insecticide resistance, this study uses whole transcriptome analysis developed through de novo assembly of short reads generated by next-generation sequencing (NGS). The transcriptome of B. dorsalis was initially constructed using Illumina's Solexa sequencing technology. Qualified reads were assembled into contigs and potential splicing variants (isotigs). A total of 29,067 isotigs have putative homologues in the non-redundant (nr) protein database from NCBI, and 11,073 of these correspond to distinct D. melanogaster proteins in the RefSeq database. Approximately 5,546 isotigs contain coding sequences that are at least 80% complete and appear to represent B. dorsalis genes. We observed a strong correlation between the completeness of the assembled sequences and the expression intensity of the transcripts. The assembled sequences were also used to identify large numbers of genes potentially belonging to families related to insecticide resistance. A total of 90 P450-, 42 GST-and 37 COE-related genes, representing three major enzyme families involved in insecticide metabolism and resistance, were identified. In addition, 36 isotigs were discovered to contain target site sequences related to four classes of resistance genes. Identified sequence motifs were also analyzed to

  19. ‘Obesity’ is healthy for cetaceans? Evidence from pervasive positive selection in genes related to triacylglycerol metabolism

    PubMed Central

    Wang, Zhengfei; Chen, Zhuo; Xu, Shixia; Ren, Wenhua; Zhou, Kaiya; Yang, Guang

    2015-01-01

    Cetaceans are a group of secondarily adapted marine mammals with an enigmatic history of transition from terrestrial to fully aquatic habitat and subsequent adaptive radiation in waters around the world. Numerous physiological and morphological cetacean characteristics have been acquired in response to this drastic habitat transition; for example, the thickened blubber is one of the most striking changes that increases their buoyancy, supports locomotion, and provides thermal insulation. However, the genetic basis underlying the blubber thickening in cetaceans remains poorly explored. Here, 88 candidate genes associated with triacylglycerol metabolism were investigated in representative cetaceans and other mammals to test whether the thickened blubber matched adaptive evolution of triacylglycerol metabolism-related genes. Positive selection was detected in 41 of the 88 candidate genes, and functional characterization of these genes indicated that these are involved mainly in triacylglycerol synthesis and lipolysis processes. In addition, some essential regulatory genes underwent significant positive selection in cetacean-specific lineages, whereas no selection signal was detected in the counterpart terrestrial mammals. The extensive occurrence of positive selection in triacylglycerol metabolism-related genes is suggestive of their essential role in secondary adaptation to an aquatic life, and further implying that ‘obesity’ might be an indicator of good health for cetaceans. PMID:26381091

  20. Genome-wide transcriptome analysis in the ovaries of two goats identifies differentially expressed genes related to fecundity.

    PubMed

    Miao, Xiangyang; Luo, Qingmiao; Qin, Xiaoyu

    2016-05-10

    The goats are widely kept as livestock throughout the world. Two excellent domestic breeds in China, the Laiwu Black and Jining Grey goats, have different fecundities and prolificacies. Although the goat genome sequences have been resolved recently, little is known about the gene regulations at the transcriptional level in goat. To understand the molecular and genetic mechanisms related to the fecundities and prolificacies, we performed genome-wide sequencing of the mRNAs from two breeds of goat using the next-generation RNA-Seq technology and used functional annotation to identify pathways of interest. Digital gene expression analysis showed 338 genes were up-regulated in the Jining Grey goats and 404 were up-regulated in the Laiwu Black goats. Quantitative real-time PCR verified the reliability of the RNA-Seq data. This study suggests that multiple genes responsible for various biological functions and signaling pathways are differentially expressed in the two different goat breeds, and these genes might be involved in the regulation of goat fecundity and prolificacy. Taken together, our study provides insight into the transcriptional regulation in the ovaries of 2 species of goats that might serve as a key resource for understanding goat fecundity, prolificacy and genetic diversity between species.

  1. In silico analysis of nonribosomal peptide synthetases of Xanthomonas axonopodis pv. citri: identification of putative siderophore and lipopeptide biosynthetic genes.

    PubMed

    Etchegaray, Augusto; Silva-Stenico, Maria E; Moon, David H; Tsai, Siu M

    2004-01-01

    The genomes of the plant pathogens Xanthomonas axonopodis (Xac) and Xanthomonas campestris (Xcc) were analysed with the aim of deducing their ability to produce nonribosomal peptides. Nonribosomal peptide synthetase (NRPS) genes were identified in two separate loci of Xac. While the genes of locus 1 are common to both strains, locus 2 was only found in Xac. Dissection and phylogenetic analysis of the condensation and thioesterase domains of the NRPSs of loci 1 and 2 of Xac revealed homology, respectively, with siderophore and lipopeptide synthetases. Further analysis of locus 1 revealed genes related to polyketide and polyamine biosynthesis that could be involved in the assembly of substrates for siderophore biosynthesis in both strains. In vitro production of siderophores by both Xac and Xcc was confirmed. Since bacterial siderophores and lipopeptides can be pathogenic and are typically produced nonribosomally, these results suggest that the identified genes could be involved in phytotoxin production.

  2. Characterization and Functional Analysis of Five MADS-Box B Class Genes Related to Floral Organ Identification in Tagetes erecta

    PubMed Central

    Ai, Ye; Zhang, Chunling; Sun, Yalin; Wang, Weining; Bao, Manzhu

    2017-01-01

    According to the floral organ development ABC model, B class genes specify petal and stamen identification. In order to study the function of B class genes in flower development of Tagetes erecta, five MADS-box B class genes were identified and their expression and putative functions were studied. Sequence comparisons and phylogenetic analyses indicated that there were one PI-like gene—TePI, two euAP3-like genes—TeAP3-1 and TeAP3-2, and two TM6-like genes—TeTM6-1 and TeTM6-2 in T. erecta. Strong expression levels of these genes were detected in stamens of the disk florets, but little or no expression was detected in bracts, receptacles or vegetative organs. Yeast hybrid experiments of the B class proteins showed that TePI protein could form a homodimer and heterodimers with all the other four B class proteins TeAP3-1, TeAP3-2, TeTM6-1 and TeTM6-2. No homodimer or interaction was observed between the euAP3 and TM6 clade members. Over-expression of five B class genes of T. erecta in Nicotiana rotundifolia showed that only the transgenic plants of 35S::TePI showed altered floral morphology compared with the non-transgenic line. This study could contribute to the understanding of the function of B class genes in flower development of T. erecta, and provide a theoretical basis for further research to change floral organ structures and create new materials for plant breeding. PMID:28081202

  3. Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function

    PubMed Central

    Chasman, Daniel I.; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A.; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C.; O'Seaghdha, Conall M.; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V.; O'Connell, Jeffrey R.; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D.; Gierman, Hinco J.; Feitosa, Mary F.; Hwang, Shih-Jen; Atkinson, Elizabeth J.; Lohman, Kurt; Cornelis, Marilyn C.; Johansson, Åsa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G.; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y.; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B.; Launer, Lenore J.; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D.; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A.; de Andrade, Mariza; Turner, Stephen T.; Ding, Jingzhong; Andrews, Jeanette S.; Freedman, Barry I.; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E.; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H.; Wright, Alan F.; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K.; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G.; Rivadeneira, Fernando; Aulchenko, Yurii S.; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K.; Portas, Laura; Ford, Ian; Buckley, Brendan M.; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K.; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J. Wouter; Probst-Hensch, Nicole M.; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R.; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S.; van Duijn, Cornelia M.; Borecki, Ingrid B.; Kardia, Sharon L.R.; Liu, Yongmei; Curhan, Gary C.; Rudan, Igor; Gyllensten, Ulf; Wilson, James F.; Franke, Andre; Pramstaller, Peter P.; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M.; Kao, W.H. Linda; Fox, Caroline S.; Köttgen, Anna

    2012-01-01

    In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10−9) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10−4–2.2 × 10−7. Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general. PMID:22962313

  4. Shared genes related to aggression, rather than chemical communication, are associated with reproductive dominance in paper wasps (Polistes metricus)

    PubMed Central

    2014-01-01

    Background In social groups, dominant individuals may socially inhibit reproduction of subordinates using aggressive interactions or, in the case of highly eusocial insects, pheromonal communication. It has been hypothesized these two modes of reproductive inhibition utilize conserved pathways. Here, we use a comparative framework to investigate the chemical and genomic underpinnings of reproductive dominance in the primitively eusocial wasp Polistes metricus. Our goals were to first characterize transcriptomic and chemical correlates of reproductive dominance and second, to test whether dominance-associated mechanisms in paper wasps overlapped with aggression or pheromone-related gene expression patterns in other species. To explore whether conserved molecular pathways relate to dominance, we compared wasp transcriptomic data to previous studies of gene expression associated with pheromonal communication and queen-worker differences in honey bees, and aggressive behavior in bees, Drosophila, and mice. Results By examining dominant and subordinate females from queen and worker castes in early and late season colonies, we found that cuticular hydrocarbon profiles and genome-wide patterns of brain gene expression were primarily associated with season/social environment rather than dominance status. In contrast, gene expression patterns in the ovaries were associated primarily with caste and ovary activation. Comparative analyses suggest genes identified as differentially expressed in wasp brains are not related to queen pheromonal communication or caste in bees, but were significantly more likely to be associated with aggression in other insects (bees, flies), and even a mammal (mice). Conclusions This study provides the first comprehensive chemical and molecular analysis of reproductive dominance in paper wasps. We found little evidence for a chemical basis for reproductive dominance in P. metricus, and our transcriptomic analyses suggest that different pathways

  5. Transient expression of βC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions

    PubMed Central

    2010-01-01

    Background Geminiviruses are emerging plant pathogens that infect a wide variety of crops including cotton, cassava, vegetables, ornamental plants and cereals. The geminivirus disease complex consists of monopartite begomoviruses that require betasatellites for the expression of disease symptoms. These complexes are widespread throughout the Old World and cause economically important diseases on several crops. A single protein encoded by betasatellites, termed βC1, is a suppressor of gene silencing, inducer of disease symptoms and is possibly involved in virus movement. Studies of the interaction of βC1 with hosts can provide useful insight into virus-host interactions and aid in the development of novel control strategies. We have used the differential display technique to isolate host genes which are differentially regulated upon transient expression of the βC1 protein of chili leaf curl betasatellite (ChLCB) in Nicotiana tabacum. Results Through differential display analysis, eight genes were isolated from Nicotiana tabacum, at two and four days after infitration with βC1 of ChLCB, expressed under the control of the Cauliflower mosaic virus 35S promoter. Cloning and sequence analysis of differentially amplified products suggested that these genes were involved in ATP synthesis, and acted as electron carriers for respiration and photosynthesis processes. These differentially expressed genes (DEGs) play an important role in plant growth and development, cell protection, defence processes, replication mechanisms and detoxification responses. Kegg orthology based annotation system analysis of these DEGs demonstrated that one of the genes, coding for polynucleotide nucleotidyl transferase, is involved in purine and pyrimidine metabolic pathways and is an RNA binding protein which is involved in RNA degradation. Conclusion βC1 differentially regulated genes are mostly involved in chloroplast and mitochondrial functions. βC1 also increases the expression of those

  6. Fungal endophytes of Catharanthus roseus enhance vindoline content by modulating structural and regulatory genes related to terpenoid indole alkaloid biosynthesis

    PubMed Central

    Pandey, Shiv S.; Singh, Sucheta; Babu, C. S. Vivek; Shanker, Karuna; Srivastava, N. K.; Shukla, Ashutosh K.; Kalra, Alok

    2016-01-01

    Not much is known about the mechanism of endophyte-mediated induction of secondary metabolite production in Catharanthus roseus. In the present study two fungal endophytes, Curvularia sp. CATDLF5 and Choanephora infundibulifera CATDLF6 were isolated from the leaves of the plant that were found to enhance vindoline content by 229–403%. The isolated endophytes did not affect the primary metabolism of the plant as the maximum quantum efficiency of PSII, net CO2 assimilation, plant biomass and starch content of endophyte-inoculated plants was similar to endophyte-free control plants. Expression of terpenoid indole alkaloid (TIA) pathway genes, geraniol 10-hydroxylase (G10H), tryptophan decarboxylase (TDC), strictosidine synthase (STR), 16-hydoxytabersonine-O-methyltransferase (16OMT), desacetoxyvindoline-4-hydroxylase (D4H), deacetylvindoline-4-O-acetyltransferase (DAT) were upregulated in endophyte-inoculated plants. Endophyte inoculation upregulated the expression of the gene for transcriptional activator octadecanoid-responsive Catharanthus AP2-domain protein (ORCA3) and downregulated the expression of Cys2/His2-type zinc finger protein family transcriptional repressors (ZCTs). The gene for the vacuolar class III peroxidase (PRX1), responsible for coupling vindoline and catharanthine, was upregulated in endophyte-inoculated plants. These endophytes may enhance vindoline production by modulating the expression of key structural and regulatory genes of vindoline biosynthesis without affecting the primary metabolism of the host plant. PMID:27220774

  7. Genome Sequence of Listeria monocytogenes Plasmid pLM-C-273 Carrying Genes Related to Stress Resistance.

    PubMed

    Liang, Lindsay; Gnaneshan, Saravanamuttu; Garduño, Rafael A; Mallo, Gustavo V

    2016-10-13

    Mobile genetic elements in bacteria, such as plasmids, act as important vectors for the transfer of antibiotic resistance, virulence, and metal resistance genes. Here, we report the genome sequence of a new plasmid pLM-C-273, identified in a Listeria monocytogenes strain isolated from a clinical sample in Ontario, Canada.

  8. Dietary lysine affected the expression of genes related to lipid metabolism in skeletal muscle of finishing pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    It has been reported that some amino acids can function as signaling molecules to regulate skeletal muscle growth in mammals. This study was conducted to identify those genes that may be regulated by amino acid lysine and responsible for muscle growth and meat quality of pigs. Nine crossbred barrows...

  9. Genome Sequence of Listeria monocytogenes Plasmid pLM-C-273 Carrying Genes Related to Stress Resistance

    PubMed Central

    Liang, Lindsay; Gnaneshan, Saravanamuttu; Garduño, Rafael A.

    2016-01-01

    Mobile genetic elements in bacteria, such as plasmids, act as important vectors for the transfer of antibiotic resistance, virulence, and metal resistance genes. Here, we report the genome sequence of a new plasmid pLM-C-273, identified in a Listeria monocytogenes strain isolated from a clinical sample in Ontario, Canada. PMID:27738039

  10. Development and application of microsatellites in candidate genes related to wood properties in the Chinese white poplar (Populus tomentosa Carr.).

    PubMed

    Du, Qingzhang; Gong, Chenrui; Pan, Wei; Zhang, Deqiang

    2013-02-01

    Gene-derived simple sequence repeats (genic SSRs), also known as functional markers, are often preferred over random genomic markers because they represent variation in gene coding and/or regulatory regions. We characterized 544 genic SSR loci derived from 138 candidate genes involved in wood formation, distributed throughout the genome of Populus tomentosa, a key ecological and cultivated wood production species. Of these SSRs, three-quarters were located in the promoter or intron regions, and dinucleotide (59.7%) and trinucleotide repeat motifs (26.5%) predominated. By screening 15 wild P. tomentosa ecotypes, we identified 188 polymorphic genic SSRs with 861 alleles, 2-7 alleles for each marker. Transferability analysis of 30 random genic SSRs, testing whether these SSRs work in 26 genotypes of five genus Populus sections (outgroup, Salix matsudana), showed that 72% of the SSRs could be amplified in Turanga and 100% could be amplified in Leuce. Based on genotyping of these 26 genotypes, a neighbour-joining analysis showed the expected six phylogenetic groupings. In silico analysis of SSR variation in 220 sequences that are homologous between P. tomentosa and Populus trichocarpa suggested that genic SSR variations between relatives were predominantly affected by repeat motif variations or flanking sequence mutations. Inheritance tests and single-marker associations demonstrated the power of genic SSRs in family-based linkage mapping and candidate gene-based association studies, as well as marker-assisted selection and comparative genomic studies of P. tomentosa and related species.

  11. The Effect of Selenium Supplementation on Glucose Homeostasis and the Expression of Genes Related to Glucose Metabolism.

    PubMed

    Jablonska, Ewa; Reszka, Edyta; Gromadzinska, Jolanta; Wieczorek, Edyta; Krol, Magdalena B; Raimondi, Sara; Socha, Katarzyna; Borawska, Maria H; Wasowicz, Wojciech

    2016-12-13

    The aim of the study was to evaluate the effect of selenium supplementation on the expression of genes associated with glucose metabolism in humans, in order to explain the unclear relationship between selenium and the risk of diabetes. For gene expression analysis we used archival samples of cDNA from 76 non-diabetic subjects supplemented with selenium in the previous study. The supplementation period was six weeks and the daily dose of selenium was 200 µg (as selenium yeast). Blood for mRNA isolation was collected at four time points: before supplementation, after two and four weeks of supplementation, and after four weeks of washout. The analysis included 15 genes encoding selected proteins involved in insulin signaling and glucose metabolism. In addition, HbA1c and fasting plasma glucose were measured at three and four time points, respectively. Selenium supplementation was associated with a significantly decreased level of HbA1c but not fasting plasma glucose (FPG) and significant down-regulation of seven genes: INSR, ADIPOR1, LDHA, PDHA, PDHB, MYC, and HIF1AN. These results suggest that selenium may affect glycemic control at different levels of regulation, linked to insulin signaling, glycolysis, and pyruvate metabolism. Further research is needed to investigate mechanisms of such transcriptional regulation and its potential implication in direct metabolic effects.

  12. The Effect of Selenium Supplementation on Glucose Homeostasis and the Expression of Genes Related to Glucose Metabolism

    PubMed Central

    Jablonska, Ewa; Reszka, Edyta; Gromadzinska, Jolanta; Wieczorek, Edyta; Krol, Magdalena B.; Raimondi, Sara; Socha, Katarzyna; Borawska, Maria H.; Wasowicz, Wojciech

    2016-01-01

    The aim of the study was to evaluate the effect of selenium supplementation on the expression of genes associated with glucose metabolism in humans, in order to explain the unclear relationship between selenium and the risk of diabetes. For gene expression analysis we used archival samples of cDNA from 76 non-diabetic subjects supplemented with selenium in the previous study. The supplementation period was six weeks and the daily dose of selenium was 200 µg (as selenium yeast). Blood for mRNA isolation was collected at four time points: before supplementation, after two and four weeks of supplementation, and after four weeks of washout. The analysis included 15 genes encoding selected proteins involved in insulin signaling and glucose metabolism. In addition, HbA1c and fasting plasma glucose were measured at three and four time points, respectively. Selenium supplementation was associated with a significantly decreased level of HbA1c but not fasting plasma glucose (FPG) and significant down-regulation of seven genes: INSR, ADIPOR1, LDHA, PDHA, PDHB, MYC, and HIF1AN. These results suggest that selenium may affect glycemic control at different levels of regulation, linked to insulin signaling, glycolysis, and pyruvate metabolism. Further research is needed to investigate mechanisms of such transcriptional regulation and its potential implication in direct metabolic effects. PMID:27983572

  13. Identification of a subtype-specific ENC1 gene related to invasiveness in human pituitary null cell adenoma and oncocytomas.

    PubMed

    Feng, Jie; Hong, Lichuan; Wu, Yonggang; Li, Chuzhong; Wan, Hong; Li, Guilin; Sun, Yilin; Yu, Shenyuan; Chittiboina, Prashant; Montgomery, Blake; Zhuang, Zhengping; Zhang, Yazhuo

    2014-09-01

    Non-functioning pituitary adenomas (NFPAs) may be locally invasive. Surgery is a treatment option, but unlike the case for functional pituitary adenomas, there are almost no drug treatments available for NFPAs. Markers of invasiveness are needed to guide therapeutic decision-making and identify potential adjuvant drugs. Owing to the highly heterogeneous nature of NFPAs, little is known regarding the subtype-specific gene expression profiles associated with invasiveness. To identify important biomarkers of invasiveness, we selected 23 null cell adenomas and 20 oncocytomas. These tumors were classified as invasive or non-invasive adenomas based on magnetic resonance imaging, pathology slides and surgical findings. Firstly, we observed that there were significant differences in expression between invasive (n = 3) and non-invasive (n = 4) adenomas by gene expression microarray. A total of 1,188 genes were differentially expressed in the invasive and non-invasive adenomas. Among these 1,188 genes, 578 were upregulated and 610 were downregulated in invasive adenomas. Secondly, the expression of ENC1, which displayed the significant alterations, was further confirmed by qRT-PCR and Western blot analysis in all 43 tumor samples and three normal pituitary glands. Low levels of ENC1 were found in tumor samples, while high levels were detected in normal pituitary glands. Interestingly, the ENC1 expression level was low in invasive null cell adenomas compared with non-invasive adenomas, but this relationship was not observed in invasive oncocytomas. Immunohistochemistry also demonstrated that the staining of ENC1 was different between invasive and non-invasive null cell adenomas. In addition, bioinformatics studies, including gene ontology and protein interaction analyses, were also performed to better understand the critical role of ENC1 in the development and progression of null cell adenomas and oncocytomas. Consequently, ENC1 may be an important biomarker for null cell

  14. Microarray profiling of mononuclear peripheral blood cells identifies novel candidate genes related to chemoradiation response in rectal cancer.

    PubMed

    Palma, Pablo; Cuadros, Marta; Conde-Muíño, Raquel; Olmedo, Carmen; Cano, Carlos; Segura-Jiménez, Inmaculada; Blanco, Armando; Bueno, Pablo; Ferrón, J Antonio; Medina, Pedro

    2013-01-01

    Preoperative chemoradiation significantly improves oncological outcome in locally advanced rectal cancer. However there is no effective method of predicting tumor response to chemoradiation in these patients. Peripheral blood mononuclear cells have emerged recently as pathology markers of cancer and other diseases, making possible their use as therapy predictors. Furthermore, the importance of the immune response in radiosensivity of solid organs led us to hypothesized that microarray gene expression profiling of peripheral blood mononuclear cells could identify patients with response to chemoradiation in rectal cancer. Thirty five 35 patients with locally advanced rectal cancer were recruited initially to perform the study. Peripheral blood samples were obtained before neaodjuvant treatment. RNA was extracted and purified to obtain cDNA and cRNA for hybridization of microarrays included in Human WG CodeLink bioarrays. Quantitative real time PCR was used to validate microarray experiment data. Results were correlated with pathological response, according to Mandard´s criteria and final UICC Stage (patients with tumor regression grade 1-2 and downstaging being defined as responders and patients with grade 3-5 and no downstaging as non-responders). Twenty seven out of 35 patients were finally included in the study. We performed a multiple t-test using Significance Analysis of Microarrays, to find those genes differing significantly in expression, between responders (n = 11) and non-responders (n = 16) to CRT. The differently expressed genes were: BC 035656.1, CIR, PRDM2, CAPG, FALZ, HLA-DPB2, NUPL2, and ZFP36. The measurement of FALZ (p = 0.029) gene expression level determined by qRT-PCR, showed statistically significant differences between the two groups. Gene expression profiling reveals novel genes in peripheral blood samples of mononuclear cells that could predict responders and non-responders to chemoradiation in patients with locally advanced

  15. De novo sequencing and comparative analysis of the blueberry transcriptome to discover putative genes related to antioxidants.

    PubMed

    Li, Xiaoyan; Sun, Haiyue; Pei, Jiabo; Dong, Yuanyuan; Wang, Fawei; Chen, Huan; Sun, Yepeng; Wang, Nan; Li, Haiyan; Li, Yadong

    2012-12-10

    Blueberry (Vaccinium spp.) is an important small fruit crop rich in antioxidants. However, tissue-specific transcriptome and genomic data in public databases are not sufficient for an understanding of the molecular mechanisms associated with antioxidants, especially the biosynthesis of anthocyanins. Here, we obtained more than 64 million sequencing reads from blueberry skin and pulp using Illumina sequencing technology. De novo assemblies yielded 34,464 unigenes, among them 1236 transcripts and 862 putative transcription factors involved in the main antioxidant biosynthesis pathway were identified. Comparative transcript profiling allowed the identification of 92 differentially expressed genes with potential relevance in regulating the fruit metabolism and anthocyanin content during ripening. A series of qRT-PCR confirmed the high expression level of the anthocyanin pathway genes in the skin of the blue fruit from the in silico study. This sequence collection provides a significant resource for the blueberry research and breeding work.

  16. Thrombotic events in MYH9 gene-related autosomal macrothrombocytopenias (old May-Hegglin, Sebastian, Fechtner and Epstein syndromes).

    PubMed

    Girolami, Antonio; Antonio, Girolami; Vettore, Silvia; Silvia, Vettore; Bonamigo, Emanuela; Emanuela, Bonamigo; Fabris, Fabrizio; Fabrizio, Fabris

    2011-11-01

    Congenital macrothrombocytopenia are a group of disorders which may be due to mutations in the MYH9 gene. This gene linked to chromosome 22 encodes for the nonmuscle heavy chain IIA that is expressed in platelets and in other tissues. In the past these disorders were known as May-Hegglin anomaly, Sebastian, Fechtner and Epstein syndromes. The main common feature is the presence of thrombocytopenia with large platelets. The evaluation of all reported cases indicates that thrombotic events appear to occur only in patients with May Hegglin variants. Whether this is due to the higher prevalence of this variant as compared with the others or to a specific difference is still unknown. However, the occurrence of thrombotic events in only one of these conditions may be used as a new tentative differentiability feature.

  17. Activating mutations in genes related to TCR signaling in angioimmunoblastic and other follicular helper T-cell-derived lymphomas.

    PubMed

    Vallois, David; Dobay, Maria Pamela D; Morin, Ryan D; Lemonnier, François; Missiaglia, Edoardo; Juilland, Mélanie; Iwaszkiewicz, Justyna; Fataccioli, Virginie; Bisig, Bettina; Roberti, Annalisa; Grewal, Jasleen; Bruneau, Julie; Fabiani, Bettina; Martin, Antoine; Bonnet, Christophe; Michielin, Olivier; Jais, Jean-Philippe; Figeac, Martin; Bernard, Olivier A; Delorenzi, Mauro; Haioun, Corinne; Tournilhac, Olivier; Thome, Margot; Gascoyne, Randy D; Gaulard, Philippe; de Leval, Laurence

    2016-09-15

    Angioimmunoblastic T-cell lymphoma (AITL) and other lymphomas derived from follicular T-helper cells (TFH) represent a large proportion of peripheral T-cell lymphomas (PTCLs) with poorly understood pathogenesis and unfavorable treatment results. We investigated a series of 85 patients with AITL (n = 72) or other TFH-derived PTCL (n = 13) by targeted deep sequencing of a gene panel enriched in T-cell receptor (TCR) signaling elements. RHOA mutations were identified in 51 of 85 cases (60%) consisting of the highly recurrent dominant negative G17V variant in most cases and a novel K18N in 3 cases, the latter showing activating properties in in vitro assays. Moreover, half of the patients carried virtually mutually exclusive mutations in other TCR-related genes, most frequently in PLCG1 (14.1%), CD28 (9.4%, exclusively in AITL), PI3K elements (7%), CTNNB1 (6%), and GTF2I (6%). Using in vitro assays in transfected cells, we demonstrated that 9 of 10 PLCG1 and 3 of 3 CARD11 variants induced MALT1 protease activity and increased transcription from NFAT or NF-κB response element reporters, respectively. Collectively, the vast majority of variants in TCR-related genes could be classified as gain-of-function. Accordingly, the samples with mutations in TCR-related genes other than RHOA had transcriptomic profiles enriched in signatures reflecting higher T-cell activation. Although no correlation with presenting clinical features nor significant impact on survival was observed, the presence of TCR-related mutations correlated with early disease progression. Thus, targeting of TCR-related events may hold promise for the treatment of TFH-derived lymphomas.

  18. Isolation and characterization of two putative cytokinin oxidase genes related to grain number per spike phenotype in wheat.

    PubMed

    Zhang, Jinpeng; Liu, Weihua; Yang, Xinming; Gao, Ainong; Li, Xiuquan; Wu, Xiaoyang; Li, Lihui

    2011-04-01

    Cytokinin oxidases are involved in the regulation of plant cytokinin levels, which are important in regulating plant growth and development, and may affect the yield of cereals. Here, we report the isolation and characterization of two putative cytokinin oxidase genes, TaCKX2.1 and TaCKX2.2, from wheat. Both TaCKX2.1 and TaCKX2.2 are mapped to the 0.24-0.55 region of the short arm of wheat chromosome 3D and their coding proteins are most closely related to OsCKX2. Phylogenetic tree analysis reveals that TaCKX2.1 and TaCKX2.2 belong to the clustered clade I of monocot plants. Tissue expression pattern show that both TaCKX2.1 and TaCKX2.2 genes are highly expressed in young spikes and culms of wheat. The detailed spatial expression pattern of TaCKX2.1 were further conducted by in situ hybridization and promoter-fused GUS expression in Arabidopsis experiments. A collection of 12 typical common wheat varieties exhibiting grain number per spike ranging from 31 to 139 were used for the transcription abundance detection of two TaCKX2 genes. A significantly positive correlation between expression level of two TaCKX2 genes and grain number per spike suggests that TaCKX2.1 and TaCKX2.2 on wheat chromosome 3DS may play an important role in wheat spike morphogenesis.

  19. Psychological factors and DNA methylation of genes related to immune/inflammatory system markers: the VA Normative Aging Study

    PubMed Central

    Kim, Daniel; Kubzansky, Laura D; Baccarelli, Andrea; Sparrow, David; Spiro, Avron; Tarantini, Letizia; Cantone, Laura; Vokonas, Pantel; Schwartz, Joel

    2016-01-01

    Objectives Although psychological factors have been associated with chronic diseases such as coronary heart disease (CHD), the underlying pathways for these associations have yet to be elucidated. DNA methylation has been posited as a mechanism linking psychological factors to CHD risk. In a cohort of community-dwelling elderly men, we explored the associations between positive and negative psychological factors with DNA methylation in promoter regions of multiple genes involved in immune/inflammatory processes related to atherosclerosis. Design Prospective cohort study. Setting Greater Boston, Massachusetts area. Participants Samples of 538 to 669 men participating in the Normative Aging Study cohort with psychological measures and DNA methylation measures, collected on 1–4 visits between 1999 and 2006 (mean age=72.7 years at first visit). Outcome measures We examined anxiety, depression, hostility and life satisfaction as predictors of leucocyte gene-specific DNA methylation. We estimated repeated measures linear mixed models, controlling for age, smoking, education, history of heart disease, stroke or diabetes, % lymphocytes, % monocytes and plasma folate. Results Psychological distress measured by anxiety, depression and hostility was positively associated, and happiness and life satisfaction were inversely associated with average Intercellular Adhesion Molecule-1 (ICAM-1) and coagulation factor III (F3) promoter methylation levels. There was some evidence that hostility was positively associated with toll-like receptor 2 (TLR-2) promoter methylation, and that life satisfaction was inversely associated with TLR-2 and inducible nitric oxide synthase (iNOS) promoter methylation. We observed less consistent and significant associations between psychological factors and average methylation for promoters of the genes for glucocorticoid receptor (NR3C1), interferon-γ (IFN-γ) and interleukin 6 (IL-6). Conclusions These findings suggest that positive and negative

  20. Carbohydrate Stress Affecting Fruitlet Abscission and Expression of Genes Related to Auxin Signal Transduction Pathway in Litchi

    PubMed Central

    Kuang, Jian-Fei; Wu, Jian-Yang; Zhong, Hai-Ying; Li, Cai-Qin; Chen, Jian-Ye; Lu, Wang-Jin; Li, Jian-Guo

    2012-01-01

    Auxin, a vital plant hormone, regulates a variety of physiological and developmental processes. It is involved in fruit abscission through transcriptional regulation of many auxin-related genes, including early auxin responsive genes (i.e., auxin/indole-3-acetic acid (AUX/IAA), Gretchen Hagen3 (GH3) and small auxin upregulated (SAUR)) and auxin response factors (ARF), which have been well characterized in many plants. In this study, totally five auxin-related genes, including one AUX/IAA (LcAUX/IAA1), one GH3 (LcGH3.1), one SAUR (LcSAUR1) and two ARFs (LcARF1 and LcARF2), were isolated and characterized from litchi fruit. LcAUX/IAA1, LcGH3.1, LcSAUR1, LcARF1 and LcARF2 contain open reading frames (ORFs) encoding polypeptides of 203, 613, 142, 792 and 832 amino acids, respectively, with their corresponding molecular weights of 22.67, 69.20, 11.40, 88.20 and 93.16 kDa. Expression of these genes was investigated under the treatment of girdling plus defoliation which aggravated litchi fruitlet abscission due to the blockage of carbohydrates transport and the reduction of endogenous IAA content. Results showed that transcript levels of LcAUX/IAA1, LcGH3.1 and LcSAUR1 mRNAs were increased after the treatment in abscission zone (AZ) and other tissues, in contrast to the decreasing accumulation of LcARF1 mRNA, suggesting that LcAUX/IAA1, LcSAUR1 and LcARF1 may play more important roles in abscission. Our results provide new insight into the process of fruitlet abscission induced by carbohydrate stress and broaden our understanding of the auxin signal transduction pathway in this process at the molecular level. PMID:23443112

  1. Regulation of genes related to immune signaling and detoxification in Apis mellifera by an inhibitor of histone deacetylation

    PubMed Central

    Hu, Yee-Tung; Wu, Tsai-Chin; Yang, En-Cheng; Wu, Pei-Chi; Lin, Po-Tse; Wu, Yueh-Lung

    2017-01-01

    The western honeybee (Apis mellifera) is essential for the global economy due to its important role in ecosystems and agriculture as a pollinator of numerous flowering plants and crops. Pesticide abuse has greatly impacted honeybees and caused tremendous loss of honeybee colonies worldwide. The reasons for colony loss remain unclear, but involvement of pesticides and pathogen-pesticide interactions has been hypothesized. Histone deacetylase inhibitors (HDACis) inhibit the activity of histone acetylase, which causes the hyperacetylation of histone cores and influences gene expression. In this study, sodium butyrate, an HDACi, was used as a dietary supplement for honeybees; after treatment, gene expression profiles were analyzed using quantitative PCR. The results showed that sodium butyrate up-regulated genes involved in anti-pathogen and detoxification pathways. The bioassay results showed that honeybees treated with sodium butyrate were more tolerant to imidacloprid. Additionally, sodium butyrate strengthened the immune response of honeybees to invasions of Nosema ceranae and viral infections. We also performed a bioassay in which honeybees were exposed to pesticides and pathogens. Our results provide additional data regarding the mechanism by which honeybees react to stress and the potential application of HDACis in beekeeping. PMID:28112264

  2. Regulation of genes related to immune signaling and detoxification in Apis mellifera by an inhibitor of histone deacetylation.

    PubMed

    Hu, Yee-Tung; Wu, Tsai-Chin; Yang, En-Cheng; Wu, Pei-Chi; Lin, Po-Tse; Wu, Yueh-Lung

    2017-01-23

    The western honeybee (Apis mellifera) is essential for the global economy due to its important role in ecosystems and agriculture as a pollinator of numerous flowering plants and crops. Pesticide abuse has greatly impacted honeybees and caused tremendous loss of honeybee colonies worldwide. The reasons for colony loss remain unclear, but involvement of pesticides and pathogen-pesticide interactions has been hypothesized. Histone deacetylase inhibitors (HDACis) inhibit the activity of histone acetylase, which causes the hyperacetylation of histone cores and influences gene expression. In this study, sodium butyrate, an HDACi, was used as a dietary supplement for honeybees; after treatment, gene expression profiles were analyzed using quantitative PCR. The results showed that sodium butyrate up-regulated genes involved in anti-pathogen and detoxification pathways. The bioassay results showed that honeybees treated with sodium butyrate were more tolerant to imidacloprid. Additionally, sodium butyrate strengthened the immune response of honeybees to invasions of Nosema ceranae and viral infections. We also performed a bioassay in which honeybees were exposed to pesticides and pathogens. Our results provide additional data regarding the mechanism by which honeybees react to stress and the potential application of HDACis in beekeeping.

  3. 2009 Pandemic H1N1 Influenza Virus Causes Disease and Upregulation of Genes Related to Inflammatory and Immune Responses, Cell Death, and Lipid Metabolism in Pigs▿

    PubMed Central

    Ma, Wenjun; Belisle, Sarah E.; Mosier, Derek; Li, Xi; Stigger-Rosser, Evelyn; Liu, Qinfang; Qiao, Chuanling; Elder, Jake; Webby, Richard; Katze, Michael G.; Richt, Juergen A.

    2011-01-01

    There exists limited information about whether adaptation is needed for cross-species transmission of the 2009 pandemic H1N1 influenza virus (pH1N1). Here, we compare the pathogenesis of two pH1N1 viruses, one derived from a human patient (A/CA/04/09 [CA09]) and the other from swine (A/swine/Alberta/25/2009 [Alb09]), with that of the 1918-like classical swine influenza virus (A/swine/Iowa/1930 [IA30]) in the pig model. Both pH1N1 isolates induced clinical symptoms such as coughing, sneezing, decreased activity, fever, and labored breathing in challenged pigs, but IA30 virus did not cause any clinical symptoms except fever. Although both the pH1N1 viruses and the IA30 virus caused lung lesions, the pH1N1 viruses were shed from the nasal cavities of challenged pigs whereas the IA30 virus was not. Global gene expression analysis indicated that transcriptional responses of the viruses were distinct. pH1N1-infected pigs had an upregulation of genes related to inflammatory and immune responses at day 3 postinfection that was not seen in the IA30 infection, and expression levels of genes related to cell death and lipid metabolism at day 5 postinfection were markedly different from those of IA30 infection. These results indicate that both pH1N1 isolates are more virulent due in part to differences in the host transcriptional response during acute infection. Our study also indicates that pH1N1 does not need prior adaptation to infect pigs, has a high potential to be maintained in naïve swine populations, and might reassort with currently circulating swine influenza viruses. PMID:21900171

  4. Comparative Transcriptome Analysis of Fetal Skin Reveals Key Genes Related to Hair Follicle Morphogenesis in Cashmere Goats

    PubMed Central

    Yan, Hailong; Zeng, Jie; Ma, Sen; Niu, Yiyuan; Zhou, Guangxian; Jiang, Yu; Chen, Yulin

    2016-01-01

    Cashmere goat skin contains two types of hair follicles (HF): primary hair follicles (PHF) and secondary hair follicles (SHF). Although multiple genetic determinants associated with HF formation have been identified, the molecules that determine the independent morphogenesis of HF in cashmere goats remain elusive. The growth and development of SHF directly influence the quantity and quality of cashmere production. Here, we report the transcriptome profiling analysis of nine skin samples from cashmere goats using 60- and 120-day-old embryos (E60 and E120, respectively), as well as newborns (NB), through RNA-sequencing (RNA-seq). HF morphological changes indicated that PHF were initiated at E60, with maturation from E120, while differentiation of SHF was identified at E120 until formation of cashmere occurred after birth (NB). The RNA-sequencing analysis generated over 20.6 million clean reads from each mRNA library. The number of differentially expressed genes (DEGs) in E60 vs. E120, E120 vs. NB, and E60 vs. NB were 1,024, 0 and 1,801, respectively, indicating that no significant differences were found at transcriptomic levels between E120 and NB. Key genes including B4GALT4, TNC, a-integrin, and FGFR1, were up-regulated and expressed in HF initiation from E60 to E120, while regulatory genes such as GPRC5D, PAD3, HOXC13, PRR9, VSIG8, LRRC15, LHX2, MSX-2, and FOXN1 were up-regulated and expressed in HF keratinisation and hair shaft differentiation from E120 and NB to E60. Several genes belonging to the KRT and KRTAP gene families were detected throughout the three HF developmental stages. The transcriptional trajectory analyses of all DEGs indicated that immune privilege, glycosaminoglycan biosynthesis, extracellular matrix receptor interaction, and growth factor receptors all played dominant roles in the epithelial-mesenchymal interface and HF formation. We found that the Wnt, transforming growth factor-beta/bone morphogenetic protein, and Notch family members

  5. Tumor-initiating cells of breast and prostate origin show alterations in the expression of genes related to iron metabolism

    PubMed Central

    Tomkova, Veronika; Korenkova, Vlasta; Langerova, Lucie; Simonova, Ekaterina; Zjablovskaja, Polina; Alberich-Jorda, Meritxell; Neuzil, Jiri; Truksa, Jaroslav

    2017-01-01

    The importance of iron in the growth and progression of tumors has been widely documented. In this report, we show that tumor-initiating cells (TICs), represented by spheres derived from the MCF7 cell line, exhibit higher intracellular labile iron pool, mitochondrial iron accumulation and are more susceptible to iron chelation. TICs also show activation of the IRP/IRE system, leading to higher iron uptake and decrease in iron storage, suggesting that level of properly assembled cytosolic iron-sulfur clusters (FeS) is reduced. This finding is confirmed by lower enzymatic activity of aconitase and FeS cluster biogenesis enzymes, as well as lower levels of reduced glutathione, implying reduced FeS clusters synthesis/utilization in TICs. Importantly, we have identified specific gene signature related to iron metabolism consisting of genes regulating iron uptake, mitochondrial FeS cluster biogenesis and hypoxic response (ABCB10, ACO1, CYBRD1, EPAS1, GLRX5, HEPH, HFE, IREB2, QSOX1 and TFRC). Principal component analysis based on this signature is able to distinguish TICs from cancer cells in vitro and also Leukemia-initiating cells (LICs) from non-LICs in the mouse model of acute promyelocytic leukemia (APL). Majority of the described changes were also recapitulated in an alternative model represented by MCF7 cells resistant to tamoxifen (TAMR) that exhibit features of TICs. Our findings point to the critical importance of redox balance and iron metabolism-related genes and proteins in the context of cancer and TICs that could be potentially used for cancer diagnostics or therapy. PMID:28031527

  6. RNAi-Mediated Functional Analysis of Bursicon Genes Related to Adult Cuticle Formation and Tanning in the Honeybee, Apis mellifera

    PubMed Central

    Elias-Neto, Moysés; Falcon, Tiago; Dallacqua, Rodrigo Pires; Martins, Juliana Ramos; Bitondi, Marcia Maria Gentile

    2016-01-01

    Bursicon is a heterodimeric neurohormone that acts through a G protein-coupled receptor named rickets (rk), thus inducing an increase in cAMP and the activation of tyrosine hydroxylase, the rate-limiting enzyme in the cuticular tanning pathway. In insects, the role of bursicon in the post-ecdysial tanning of the adult cuticle and wing expansion is well characterized. Here we investigated the roles of the genes encoding the bursicon subunits during the adult cuticle development in the honeybee, Apis mellifera. RNAi-mediated knockdown of AmBurs α and AmBurs β bursicon genes prevented the complete formation and tanning (melanization/sclerotization) of the adult cuticle. A thinner, much less tanned cuticle was produced, and ecdysis toward adult stage was impaired. Consistent with these results, the knockdown of bursicon transcripts also interfered in the expression of genes encoding its receptor, AmRk, structural cuticular proteins, and enzymes in the melanization/sclerotization pathway, thus evidencing roles for bursicon in adult cuticle formation and tanning. Moreover, the expression of AmBurs α, AmBurs β and AmRk is contingent on the declining ecdysteroid titer that triggers the onset of adult cuticle synthesis and deposition. The search for transcripts of AmBurs α, AmBurs β and candidate targets in RNA-seq libraries prepared with brains and integuments strengthened our data on transcript quantification through RT-qPCR. Together, our results support our premise that bursicon has roles in adult cuticle formation and tanning, and are in agreement with other recent studies pointing for roles during the pharate-adult stage, in addition to the classical post-ecdysial ones. PMID:27907116

  7. Abnormalities in the transcription of reprogramming genes related to global epigenetic events of cloned endangered felid embryos.

    PubMed

    Imsoonthornruksa, S; Lorthongpanich, C; Sangmalee, A; Srirattana, K; Laowtammathron, C; Tunwattana, W; Somsa, W; Ketudat-Cairns, M; Parnpai, R

    2010-01-01

    The present study examined transcription levels of the Oct4, DNMT1, DNMT3a, DNMT3b, HAT1 and HDAC1 genes in cloned felid embryos developing from single one-cell to blastocyst stages. IVF, cloned domestic and leopard cat embryos had low Oct4 and HAT1 levels during the early stages, but transcript expression increased at the eight-cell and blastocyst stages. In contrast, expression in the cloned marble cat embryos was low at all stages. Transcription patterns of HDAC1 were altered in cloned embryos compared with IVF embryos. Transcription levels of DNMT1 decreased markedly throughout development of both IVF and cloned embryos. In IVF embryos, DNMT3a transcripts rarely appeared in the four- to eight-cell stages, but levels increased in the morula to blastocyst stages. In contrast, in cloned embryos, DNMT3a transcript levels were high at the one- to two-cell stages, decreased during subsequent cell division and then increased again at the blastocyst stage. The IVF and cloned embryos showed similar DNMT3b transcription patterns, starting with low levels at the two-cell to morula stages and reaching a maximum at the blastocyst stage. These results suggest that the low level of Oct4 transcripts may be responsible, in part, for the failure of blastocyst production in the cloned marbled cat. However, higher transcription of the DNA methylation genes and lower transcription of the histone acetylation genes were observed in cloned compared with IVF embryos, suggesting that the felids' donor nucleus could not completely reprogramme the nuclear genome and so the re-establishment of embryonic totipotency was not achieved.

  8. RNAi-Mediated Functional Analysis of Bursicon Genes Related to Adult Cuticle Formation and Tanning in the Honeybee, Apis mellifera.

    PubMed

    Costa, Claudinéia Pereira; Elias-Neto, Moysés; Falcon, Tiago; Dallacqua, Rodrigo Pires; Martins, Juliana Ramos; Bitondi, Marcia Maria Gentile

    2016-01-01

    Bursicon is a heterodimeric neurohormone that acts through a G protein-coupled receptor named rickets (rk), thus inducing an increase in cAMP and the activation of tyrosine hydroxylase, the rate-limiting enzyme in the cuticular tanning pathway. In insects, the role of bursicon in the post-ecdysial tanning of the adult cuticle and wing expansion is well characterized. Here we investigated the roles of the genes encoding the bursicon subunits during the adult cuticle development in the honeybee, Apis mellifera. RNAi-mediated knockdown of AmBurs α and AmBurs β bursicon genes prevented the complete formation and tanning (melanization/sclerotization) of the adult cuticle. A thinner, much less tanned cuticle was produced, and ecdysis toward adult stage was impaired. Consistent with these results, the knockdown of bursicon transcripts also interfered in the expression of genes encoding its receptor, AmRk, structural cuticular proteins, and enzymes in the melanization/sclerotization pathway, thus evidencing roles for bursicon in adult cuticle formation and tanning. Moreover, the expression of AmBurs α, AmBurs β and AmRk is contingent on the declining ecdysteroid titer that triggers the onset of adult cuticle synthesis and deposition. The search for transcripts of AmBurs α, AmBurs β and candidate targets in RNA-seq libraries prepared with brains and integuments strengthened our data on transcript quantification through RT-qPCR. Together, our results support our premise that bursicon has roles in adult cuticle formation and tanning, and are in agreement with other recent studies pointing for roles during the pharate-adult stage, in addition to the classical post-ecdysial ones.

  9. Molecular character of a phosphatase 2C (PP2C) gene relation to stress tolerance in Arabidopsis thaliana.

    PubMed

    Zhang, Jihong; Li, Xiushan; He, Zhimin; Zhao, Xiaoying; Wang, Qiming; Zhou, Bo; Yu, Dashi; Huang, Xinqun; Tang, Dongying; Guo, Xinhong; Liu, Xuanming

    2013-03-01

    Protein phosphatases type 2C (PP2Cs) from group A, which includes the ABI1/HAB1 and PP2CA branches, are key negative regulators of ABA signaling. HAI-1 gene had been shown to affect both seed and vegetative responses to ABA, which is one of PP2Cs clade A in Arabidopsis thaliana. Transgenic plants containing pHAI-1::GUS (β-glucuronidase) displayed GUS activity existing in the vascular system of leave veins, stems and petioles. Green fluorescent protein fused HAI-1 (HAI-1-GFP) was found in the nucleus through transient transformation assays with onion epidermal cells. The water-loss assays indicated the loss-of-function mutants did not show symptoms of wilting and they had still turgid green rosette leaves. The assays of seed germination by exogenous ABA and NaCl manifested that the loss-of-function mutants displayed higher insensitivity than wild-type plants. Taken together, the final results suggest that the HAI-1 (AT5G59220) encoded a nuclear protein and it can be highly induced by ABA and wound in Arabidposis, the stress-tolerance phenotype showed a slightly improvement when HAI-1 gene was disrupted.

  10. Volatiles Emitted at Different Flowering Stages of Jasminum sambac and Expression of Genes Related to α-Farnesene Biosynthesis.

    PubMed

    Yu, Ying; Lyu, Shiheng; Chen, Dan; Lin, Yi; Chen, Jianjun; Chen, Guixin; Ye, Naixing

    2017-03-29

    Fresh jasmine flowers have been used to make jasmine teas in China, but there has been no complete information about volatile organic compound emissions in relation to flower developmental stages and no science-based knowledge about which floral stage should be used for the infusion. This study monitored volatile organic compounds emitted from living flowers of Jasminum sambac (L.) Ait. 'Bifoliatum' at five developmental stages and also from excised flowers. Among the compounds identified, α-farnesene, linalool, and benzyl acetate were most abundant. Since α-farnesene is synthesized through the Mevalonate pathway, four genes encoding 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR), farnesyl pyrophosphate synthase, and terpene synthase were isolated. Their expression patterns in living flowers at the five stages and in excised flowers coincided with the emission patterns of α-farnesene. Application of lovastatin, a HMGR inhibitor, significantly reduced the expression of the genes and greatly decreased the emission of α-farnesene. The sweet scent was diminished from lovastatin-treated flowers as well. These results indicate that α-farnesene is an important compound emitted from jasmine flowers, and its emission patterns suggest that flowers at the opening stage or flower buds 8 h after excision should be used for the infusion of tea leaves.

  11. Differential age- and disease-related effects on the expression of genes related to the arachidonic acid signaling pathway in schizophrenia.

    PubMed

    Tang, Bin; Capitao, Cristina; Dean, Brian; Thomas, Elizabeth A

    2012-04-30

    We have previously identified differential effects of age on global brain gene expression profiles in subjects with schizophrenia compared to normal controls. Here, we have focused on age-related effects of genes associated with the arachidonic acid-related inflammation pathway. Linear correlation analysis of published microarray expression data reveal strong age- and cell-type- specific-effects on the expression of genes related to the arachidonic acid signaling pathway, which differed in control subjects compared to those with schizophrenia. Using real-time qPCR analysis, we validated age and disease effects of arachidonic acid-related genes in a large cohort of subjects with schizophrenia and matched controls (n=76 subjects in total). We found that levels of prostaglandin-endoperoxide synthase 1 (PTGS1; aka COX-1) and prostaglandin-endoperoxide receptor 3 (PTGER3) mRNA are increased, and levels of prostaglandin-endoperoxide synthase 2 (PTGS2; aka COX-2) mRNA are decreased, in older subjects with schizophrenia (> 40years of age) compared to matched normal controls or younger subjects with schizophrenia (< 40years of age). These findings contribute to the accumulating evidence suggesting that inflammatory processes in the CNS contribute to pathophysiology of schizophrenia and further suggest that age may be an important factor in the potential use of anti-inflammatory therapies.

  12. Genome-Wide Analysis of MicroRNAs and Their Target Genes Related to Leaf Senescence of Rice

    PubMed Central

    Liu, Chaoping; Chen, Eryong; Chen, Qifeng; Zhuang, Jieyun; Shen, Bo

    2014-01-01

    Grain production of rice (Oryza sativa L.) is a top priority in ensuring food security for human beings. One of the approaches to increase yield is to delay leaf senescence and to extend the available time for photosynthesis. MicroRNAs (miRNAs) are key regulators of aging and cellular senescence in eukaryotes. Here, to help understand their biological role in rice leaf senescence, we report identification of miRNAs and their putative target genes by deep sequencing of six small RNA libraries, six RNA-seq libraries and two degradome libraries from the leaves of two super hybrid rice, Nei-2-You 6 (N2Y6, age-resistant rice) and Liang-You-Pei 9 (LYP9, age-sensitive rice). In total 372 known miRNAs, 162 miRNA candidates and 1145 targets were identified. Compared with the expression of miRNAs in the leaves of LYP9, the numbers of miRNAs up-regulated and down-regulated in the leaves of N2Y6 were 47 and 30 at early stage of grain-filling, 21 and 17 at the middle stage, and 11 and 37 at the late stage, respectively. Six miRNA families, osa-miR159, osa-miR160 osa-miR164, osa-miR167, osa-miR172 and osa-miR1848, targeting the genes encoding APETALA2 (AP2), zinc finger proteins, salicylic acid-induced protein 19 (SIP19), auxin response factors (ARF) and NAC transcription factors, respectively, were found to be involved in leaf senescence through phytohormone signaling pathways. These results provided valuable information for understanding the miRNA-mediated leaf senescence of rice, and offered an important foundation for rice breeding. PMID:25479006

  13. Practicality of intermittent fasting in humans and its effect on oxidative stress and genes related to aging and metabolism.

    PubMed

    Wegman, Martin P; Guo, Michael H; Bennion, Douglas M; Shankar, Meena N; Chrzanowski, Stephen M; Goldberg, Leslie A; Xu, Jinze; Williams, Tiffany A; Lu, Xiaomin; Hsu, Stephen I; Anton, Stephen D; Leeuwenburgh, Christiaan; Brantly, Mark L

    2015-04-01

    Caloric restriction has consistently been shown to extend life span and ameliorate aging-related diseases. These effects may be due to diet-induced reactive oxygen species acting to up-regulate sirtuins and related protective pathways, which research suggests may be partially inhibited by dietary anti-oxidant supplementation. Because caloric restriction is not sustainable long term for most humans, we investigated an alternative dietary approach, intermittent fasting (IF), which is proposed to act on similar biological pathways. We hypothesized that a modified IF diet, where participants maintain overall energy balance by alternating between days of fasting (25% of normal caloric intake) and feasting (175% of normal), would increase expression of genes associated with aging and reduce oxidative stress and that these effects would be suppressed by anti-oxidant supplementation. To assess the tolerability of the diet and to explore effects on biological mechanisms related to aging and metabolism, we recruited a cohort of 24 healthy individuals in a double-crossover, double-blinded, randomized clinical trial. Study participants underwent two 3-week treatment periods-IF and IF with anti-oxidant (vitamins C and E) supplementation. We found strict adherence to study-provided diets and that participants found the diet tolerable, with no adverse clinical findings or weight change. We detected a marginal increase (2.7%) in SIRT3 expression due to the IF diet, but no change in expression of other genes or oxidative stress markers analyzed. We also found that IF decreased plasma insulin levels (1.01 μU/mL). Although our study suggests that the IF dieting paradigm is acceptable in healthy individuals, additional research is needed to further assess the potential benefits and risks.

  14. De Novo Sequencing and Transcriptome Analysis of Wolfiporia cocos to Reveal Genes Related to Biosynthesis of Triterpenoids

    PubMed Central

    Shu, Shaohua; Chen, Bei; Zhou, Mengchun; Zhao, Xinmei; Xia, Haiyang; Wang, Mo

    2013-01-01

    Wolfiporia cocos Ryvarden et Gilbertson is a saprophytic fungus in the Basidiomycetes. Its dried sclerotium is widely used as a traditional crude drug in East Asia. Especially in China, the dried sclerotium is regarded as the silver of the Chinese traditional drugs, not only for its white color, but also its medicinal value. Furthermore, triterpenoids from W. cocos are the main active compounds with antitumor and anti-inflammatory activity. Biosynthesis of the triterpenoids has rarely been researched. In this study, the de novo sequencing of the mycelia and sclerotia of W. cocos were carried out by Illumina HiSeq 2000. A total of 3,484,996,740 bp from 38,722,186 sequence reads of mycelia, and 3,573,921,960 bp from 39,710,244 high quality sequence reads of sclerotium were obtained. These raw data were assembled into 60,354 contigs and 40,939 singletons, and 56,938 contigs and 37,220 singletons for mycelia and sclerotia, respectively. The transcriptomic data clearly showed that terpenoid biosynthesis was only via the MVA pathwayin W. cocos. The production of total triterpenoids and pachymic acid was examined in the dry mycelia and sclerotia. The content of total triterpenoids was 5.36% and 1.43% in mycelia and sclerotia, respectively, and the content of pachymic acid was 0.458% and 0.174%. Some genes involved in the triterpenoid biosynthetic pathway were chosen to be verified by qRT-PCR. The unigenes encoding diphosphomevalonate decarboxylase (Unigene 20430), farnesyl diphosphate synthase (Unigene 14106 and 21656), hydroxymethylglutaryl-CoA reductase (NADPH) (Unigene 6395_All) and lanosterol synthase (Unigene28001_All) were upregulated in the mycelia stage. It is likely that expression of these genes influences the biosynthesis of triterpenoids in the mycelia stage. PMID:23967197

  15. Expression profiles of genes related to carbohydrate metabolism provide new insights into carbohydrate accumulation in seeds and seedlings of Ricinus communis in response to temperature.

    PubMed

    Ribeiro, Paulo R; Ligterink, Wilco; Hilhorst, Henk W M

    2015-10-01

    Ricinus communis possesses a specific metabolic signature to adjust growth and developmental processes in response to temperature: carbohydrates are accumulated at low temperatures, whereas amino acids are accumulated at elevated temperatures. Our objective was to assess tissue-specific changes in transcript levels of genes related with carbohydrate biosynthesis and catabolism in response to temperature. For that, we measured transcript levels of genes encoding enzymes involved in starch biosynthesis, starch catabolism, and gluconeogenesis in R. communis leaves, roots, and seeds grown at 20 °C and 35 °C. Transcript levels of genes involved in starch catabolism were higher in leaves grown at 20 °C than at 35 °C, but up-regulation of genes involved in starch biosynthesis seems to compensate for this and, therefore, are the likely explanation for higher levels of starch in leaves grown at 20 °C. Higher levels of soluble carbohydrates in leaves grown at 20 °C may be caused by a coordinated increase in transcript level of genes associated with starch catabolism and gluconeogenesis pathways. In roots, transcript levels of genes associated with starch catabolism and gluconeogenesis seem to be enhanced at elevated temperatures. Higher levels of starch in seeds germinated at low temperatures is associated with higher transcript levels of genes involved in starch biosynthesis. Similarly, higher transcript levels of RcPEPCK and RcFBPase are most likely causal for fructose and glucose accumulation in seeds germinated at 20 °C. This study provides important insights in the understanding of the plasticity of R. communis in response to temperature that may apply to other species as well.

  16. Effects of melanocortin-4 receptor agonists and antagonists on expression of genes related to reproduction in spotted scat, Scatophagus argus.

    PubMed

    Jiang, Dong-Neng; Li, Jian-Tao; Tao, Ya-Xiong; Chen, Hua-Pu; Deng, Si-Ping; Zhu, Chun-Hua; Li, Guang-Li

    2017-02-14

    Melanocortin-4 receptor (Mc4r) function related to reproduction in fish has not been extensively investigated. Here, we report on gene expression changes by real-time PCR following treatment with Mc4r agonists and antagonists in the spotted scat (Scatophagus argus). Using in vitro incubated hypothalamus, the Mc4r nonselective agonist NDP-MSH ([Nle(4), D-Phe(7)]-α-melanocyte stimulating hormone; 10(-6) M) and selective agonist THIQ (N-[(3R)-1, 2, 3, 4-Tetrahydroisoquinolinium-3-ylcarbonyl]- (1R)-1-(4-chlorobenzyl)-2-[4-cyclohexyl-4-(1H-1,2,4-triazol-1-ylmethyl) piperidin-1-yl]-2-oxoethylamine; 10(-7) M) significantly increased the expression of gnrh (Gonadotropin releasing hormone), while the Mc4r nonselective antagonist SHU9119 (Ac-Nle-[Asp-His-DPhe/DNal(2')-Arg-Trp-Lys]-NH2; 10(-6) M) and selective antagonist Ipsen 5i (compound 5i synthesized in Ipsen Research Laboratories; 10(-6) M) significantly inhibited gnrh expression after 3 h of incubation. In incubated pituitary tissue, NDP-MSH and THIQ significantly increased the expression of fshb (Follicle-stimulating hormone beta subunit) and lhb (Luteinizing hormone beta subunit), while SHU9119 and Ipsen 5i significantly decreased fshb and lhb expression after 3 h of incubation. During the in vivo experiment, THIQ (1 mg/kg bw) significantly increased gnrh expression in hypothalamic tissue, as well as the fshb and lhb expression in pituitary tissue 12 h after abdominal injection. Furthermore, Ipsen 5i (1 mg/kg bw) significantly inhibited gnrh expression in hypothalamic tissue, as well as fshb and lhb gene expression in pituitary tissue 12 h after abdominal injection. In summary, Mc4r singling appears to stimulate gnrh expression in the hypothalamus, thereby modulating the synthesis of Fsh and Lh in the pituitary. In addition, Mc4r also appears to directly regulate fshb and lhb levels in the pituitary in spotted scat. Our study suggests that Mc4r, through the hypothalamus and pituitary, participates in

  17. Effects of DMSA-coated Fe3O4 nanoparticles on the transcription of genes related to iron and osmosis homeostasis.

    PubMed

    Liu, Yingxun; Wang, Jinke

    2013-02-01

    In this article, we checked the effect of 2,3-dimercaptosuccinic acid-coated Fe(3)O(4) nanoparticles on gene expression of mouse macrophage RAW264.7 cells and found that the transcription of several important genes related to intracellular iron homeostasis were significantly changed. We thus speculated that the cellular iron homeostasis might be disturbed by this nanoparticle through releasing iron ion in cells. To verify this speculation, we first confirmed the transcriptional changes of several key iron homeostasis- related genes, such as Tfrc, Trf, and Lcn2, using quantitative PCR, and found that an iron ion chelator, desferrioxamine, could alleviate the transcriptional alterations of two typical genes, Tfrc and Lcn2. Then, we designed and validated a method based on centrifugation for assaying intracellular irons in ion and nanoparticle state. After extensive measures of intracellular iron in two forms and total iron, we found that the intracellular iron ion significantly increased with intracellular total iron and nanoparticle iron, demonstrating degradation of this nanoparticle into iron ion in cells. We next mimicked the intralysosomal environment in vitro and verified that the internalized iron nanoparticle could release iron ion in lysosome. We found that as another important compensatory response to intracellular overload of iron ion, cells significantly downregulated the expressions of genes belonging to solute carrier family which are responsible for transferring many organic solutes into cells, such as Slc5a3 and Slc44a1, in order to prevent more organic solutes into cells and thus lower the intracellular osmosis. Based on these findings, we profiled a map of gene effects after cells were treated with this iron nanoparticle and concluded that the iron nanoparticles might be more detrimental to cell than iron ion due to its intracellular internalization fashion, nonspecific endocytosis.

  18. Bilberry anthocyanin-rich extract alters expression of genes related to atherosclerosis development in aorta of apo E-deficient mice.

    PubMed

    Mauray, A; Felgines, C; Morand, C; Mazur, A; Scalbert, A; Milenkovic, D

    2012-01-01

    Intake of anthocyanin-rich foods has been associated with a reduced risk of cardiovascular diseases. We recently reported that a nutritional supplementation with a bilberry anthocyanin-rich extract (BE) attenuates atherosclerotic lesion development in apolipoprotein E-deficient (apoE⁻/⁻) mice. However, the mechanism(s) of their preventive action are not completely understood. Anthocyanins may alter mRNA levels of genes related to atherosclerosis in cultured macrophages and endothelial cells, but in vivo studies remain scarce. The aim of the present study was to explore the in vivo mechanisms of action of the same bilberry extract, administered by supplementation at a nutritional level, in the aorta of apo E⁻/⁻ mice using a global transcriptomic approach. This study focused on the early stage of atherosclerosis development for better assessment of BE action on initiation mechanisms of this pathology. After a two week period, plasma lipid and antioxidant capacity were evaluated and the global genomic analysis was carried out using pangenomic microarrays. BE supplementation significantly improved hypercholesterolemia whereas the plasmatic antioxidant status remained unchanged. Nutrigenomic analysis identified 1261 genes which expression was modulated by BE in the aorta. Bioinformatic analysis revealed that these genes are implicated in different cellular processes such as oxidative stress, inflammation, transendothelial migration and angiogenesis, processes associated with atherosclerosis development/protection. Some of the most significantly down-regulated genes included genes coding for AOX1, CYP2E1 or TXNIP implicated in the regulation of oxidative stress, JAM-A coding for adhesion molecules or VEGFR2 implicate in regulation of angiogenesis. Other genes were up-regulated, such as CRB3, CLDN14 or CDH4 potentially associated with increased cell-cell adhesion and decreased paracellular permeability. These results provide a global integrated view of the

  19. Identification of genes related to agarwood formation: transcriptome analysis of healthy and wounded tissues of Aquilaria sinensis

    PubMed Central

    2013-01-01

    Background Agarwood is an expensive resinous heartwood derived from Aquilaria plants that is widely used in traditional medicines, incense and perfume. Only wounded trees can produce agarwood, and the huge demand for the agarwood products has led all Aquilaria spp. being endangered and listed in the Appendix II of the CITES (http://www.cites.org). The major components of agarwood are sesquiterpenes and phenylethyl chromones. Owing to a lack of genomic information, the molecular basis of wound-induced sesquiterpenes biosynthesis and agarwood formation remains unknown. Results To identify the primary genes that maybe related to agarwood formation, we sequenced 2 cDNA libraries generated from healthy and wounded A. sinensis (Lour.) Gilg. A total of 89,137 unigenes with an average length of 678.65 bp were obtained, and they were annotated in detail at bioinformatics levels. Of those associated with agarwood formation, 30 putatively encoded enzymes in the sesquiterpene biosynthesis pathway, and a handful of transcription factors and protein kinases were related to wound signal transduction. Three full-length cDNAs of sesquiterpene synthases (ASS1-3) were cloned and expressed in Escherichia coli, and enzyme assays revealed that they are active enzymes, with the major products being δ-guaiene. A methyl jasmonate (MJ) induction experiment revealed that the expression of ASS was significantly induced by MJ, and the production of sesquiterpenes was elevated accordingly. The expression of some transcription factors and protein kinases, especially MYB4, WRKY4, MPKK2 and MAPK2, was also induced by MJ and coordinated with ASS expression, suggesting they maybe positive regulators of ASS. Conclusions This study provides extensive transcriptome information for Aquilaria spp. and valuable clues for elucidating the mechanism of wound-induced agarwood sesquiterpenes biosynthesis and their regulation. PMID:23565705

  20. Naturally occurring mutations in large surface genes related to occult infection of hepatitis B virus genotype C.

    PubMed

    Kim, Hong; Lee, Seoung-Ae; Kim, Dong-Won; Lee, Sueng-Hyun; Kim, Bum-Joon

    2013-01-01

    Molecular mechanisms related to occult hepatitis B virus (HBV) infection, particularly those based on genotype C infection, have rarely been determined thus far in the ongoing efforts to determine infection mechanisms. Therefore, we aim to elucidate the mutation patterns in the surface open reading frame (S ORF) underlying occult infections of HBV genotype C in the present study. Nested PCRs were applied to 624 HBV surface antigen (HBsAg) negative Korean subjects. Cloning and sequencing of the S ORF gene was applied to 41 occult cases and 40 control chronic carriers. Forty-one (6.6%) of the 624 Korean adults with HBsAg-negative serostatus were found to be positive for DNA according to nested PCR tests. Mutation frequencies in the three regions labeled here as preS1, preS2, and S were significantly higher in the occult subjects compared to the carriers in all cases. A total of two types of deletions, preS1 deletions in the start codon and preS2 deletions as well as nine types of point mutations were significantly implicated in the occult infection cases. Mutations within the "a" determinant region in HBsAg were found more frequently in the occult subjects than in the carriers. Mutations leading to premature termination of S ORF were found in 16 occult subjects (39.0%) but only in one subject from among the carriers (2.5%). In conclusion, our data suggest that preS deletions, the premature termination of S ORF, and "a" determinant mutations are associated with occult infections of HBV genotype C among a HBsAg-negative population. The novel mutation patterns related to occult infection introduced in the present study can help to broaden our understanding of HBV occult infections.

  1. Leptin Administration Downregulates the Increased Expression Levels of Genes Related to Oxidative Stress and Inflammation in the Skeletal Muscle of ob/ob Mice

    PubMed Central

    Sáinz, Neira; Rodríguez, Amaia; Catalán, Victoria; Becerril, Sara; Ramírez, Beatriz; Gómez-Ambrosi, Javier; Frühbeck, Gema

    2010-01-01

    Obese leptin-deficient ob/ob mice exhibit a low-grade chronic inflammation together with a low muscle mass. Our aim was to analyze the changes in muscle expression levels of genes related to oxidative stress and inflammatory responses in leptin deficiency and to identify the effect of in vivo leptin administration. Ob/ob mice were divided in three groups as follows: control ob/ob, leptin-treated ob/ob (1 mg/kg/d) and leptin pair-fed ob/ob mice. Gastrocnemius weight was lower in control ob/ob than in wild type mice (P < .01) exhibiting an increase after leptin treatment compared to control and pair-fed (P < .01) ob/ob animals. Thiobarbituric acid reactive substances, markers of oxidative stress, were higher in serum (P < .01) and gastrocnemius (P = .05) of control ob/ob than in wild type mice and were significantly decreased (P < .01) by leptin treatment. Leptin deficiency altered the expression of 1,546 genes, while leptin treatment modified the regulation of 1,127 genes with 86 of them being involved in oxidative stress, immune defense and inflammatory response. Leptin administration decreased the high expression of Crybb1, Hspb3, Hspb7, Mt4, Cat, Rbm9, Serpinc1 and Serpinb1a observed in control ob/ob mice, indicating that it improves inflammation and muscle loss. PMID:20671928

  2. Polymorphisms in genes related to one-carbon metabolism are not related to pancreatic cancer in PanScan and PanC4

    PubMed Central

    Leenders, Max; Bhattacharjee, Samsiddhi; Vineis, Paolo; Stevens, Victoria; Bueno-de-Mesquita, H. Bas; Shu, Xiao-Ou; Amundadottir, Laufey; Gross, Myron; Tobias, Geoffrey S.; Wactawski-Wende, Jean; Arslan, Alan A.; Duell, Eric J.; Fuchs, Charles S.; Gallinger, Steven; Hartge, Patricia; Hoover, Robert N.; Holly, Elizabeth A.; Jacobs, Eric J.; Klein, Alison P.; Kooperberg, Charles; LaCroix, Andrea; Li, Donghui; Mandelson, Margaret T.; Olson, Sara H.; Petersen, Gloria; Risch, Harvey A.; Yu, Kai; Wolpin, Brian M.; Zheng, Wei; Agalliu, Ilir; Albanes, Demetrius; Boutron-Ruault, Marie-Christine; Bracci, Paige M.; Buring, Julie E.; Canzian, Federico; Chang, Kenneth; Chanock, Stephen J.; Cotterchio, Michelle; Gaziano, J. Michael; Giovanucci, Edward L.; Goggins, Michael; Hallmans, Göran; Hankinson, Susan E.; Hoffman-Bolton, Judith A.; Hunter, David J.; Hutchinson, Amy; Jacobs, Kevin B.; Jenab, Mazda; Khaw, Kay-Tee; Kraft, Peter; Krogh, Vittorio; Kurtz, Robert C.; McWilliams, Robert R.; Mendelsohn, Julie B.; Patel, Alpa V.; Rabe, Kari G.; Riboli, Elio; Tjønneland, Anne; Trichopoulos, Dimitrios; Virtamo, Jarmo; Visvanathan, Kala; Elena, Joanne W.; Yu, Herbert; Zeleniuch-Jacquotte, Anne; Stolzenberg-Solomon, Rachael Z.

    2014-01-01

    Purpose The evidence of a relation between folate intake and one-carbon metabolism (OCM) with pancreatic cancer (PanCa) is inconsistent. In this study, the association between genes and single-nucleotide polymorphisms (SNPs) related to OCM and PanCa was assessed. Methods Using biochemical knowledge of the OCM pathway, we identified thirty-seven genes and 834 SNPs to examine in association with PanCa. Our study included 1,408 cases and 1,463 controls nested within twelve cohorts (PanScan). The ten SNPs and five genes with lowest p values (<0.02) were followed up in 2,323 cases and 2,340 controls from eight case-control studies (PanC4) that participated in PanScan2. The correlation of SNPs with metabolite levels was assessed for 649 controls from the European Prospective Investigation into Cancer and Nutrition. Results When both stages were combined, we observed suggestive associations with PanCa for rs10887710 (MAT1A) (OR 1.13, 95%CI 1.04-1.23), rs1552462 (SYT9) (OR 1.27, 95%CI 1.02-1.59), and rs7074891 (CUBN) (OR 1.91, 95%CI 1.12-3.26). After correcting for multiple comparisons, no significant associations were observed in either the first or second stage. The three suggested SNPs showed no correlations with one-carbon biomarkers. Conclusions This is the largest genetic study to date to examine the relation between germline variations in OCM-related genes polymorphisms and the risk of PanCa. Suggestive evidence for an association between polymorphisms and PanCa was observed among the cohort-nested studies, but this did not replicate in the case-control studies. Our results do not strongly support the hypothesis that genes related to OCM play a role in pancreatic carcinogenesis. PMID:23334854

  3. Salt-induced expression of genes related to Na(+)/K(+) and ROS homeostasis in leaves of salt-resistant and salt-sensitive poplar species.

    PubMed

    Ding, Mingquan; Hou, Peichen; Shen, Xin; Wang, Meijuan; Deng, Shurong; Sun, Jian; Xiao, Fei; Wang, Ruigang; Zhou, Xiaoyang; Lu, Cunfu; Zhang, Deqiang; Zheng, Xiaojiang; Hu, Zanmin; Chen, Shaoliang

    2010-06-01

    Using the Affymetrix poplar genome array, we explored the leaf transcriptome of salt-tolerant Populus euphratica Oliv. and salt-sensitive P. popularis 35-44 (P. popularis) under control and saline conditions. Our objective was to clarify the genomic differences in regulating K(+)/Na(+) and reactive oxygen species (ROS) homeostasis between the two species. Compared to P. popularis, salt-tolerant P. euphratica responses to salinity involved induction of a relatively larger number of probesets after short-term (ST) exposure to 150 mM NaCl (24 h) and relatively fewer probesets after a long-term (LT) exposure to salinity (200 mM NaCl, 28 days). Compared to P. popularis, leaves of the control P. euphratica plants exhibited a higher transcript abundance of genes related to Na(+)/H(+) antiport (Na(+)/H(+) antiporters, H(+) pumps) and K(+) uptake and transport. Notably, the expression of these genes did not decrease (with a few exceptions) during salt treatment. Regarding ROS homeostasis, P. euphratica exhibited rapid up-regulation of a variety of antioxidant enzymes after exposure to ST salinity, indicating a rapid adaptive response to salt stress. However, the effect of NaCl on transcription in P. popularis leaves was more pronounced after exposure to prolonged salinity. LT-stressed P. popularis up-regulated some genes mediating K(+)/Na(+) homeostasis but decreased transcription of main scavengers of superoxide radicals and H(2)O(2) except for some isoforms of a few scavengers. Mineral and ROS analyses show that NaCl induced a marked increase of leaf Na(+) and H(2)O(2) in LT-stressed plants of the two species and the effects were even more pronounced in the salt-sensitive poplar. We place the transcription results in the context of our physiological measurements to infer some implications of NaCl-induced alterations in gene expression related to K(+)/Na(+) and ROS homeostasis.

  4. Effects of different dwarfing interstocks on key enzyme activities and the expression of genes related to malic acid metabolism in Red Fuji apples.

    PubMed

    Shi, J; Li, F F; Ma, H; Li, Z Y; Xu, J Z

    2015-12-22

    In this experiment, the test materials were 'Red Fuji' apple trees grafted onto three interstocks (No. 53, No. 111, and No. 236), which were chosen from SH40 seeding interstocks. The content of malic acid, the enzyme activities, and the expression of genes related to malic acid metabolism were determined during fruit development.The results showed that malic acid content in the ripe fruit on interstock No. 53 was higher than that in the interstock No. 111 fruit. The malate dehydrogenase (NAD-MDH) activity in apples on interstock No. 53 was highest on Day 30, Day 100, and Day 160 after bloom, and the malic enzyme (NADP-ME) activity in apples on interstock No. 111 was higher than in the interstock No. 53 fruit from Day 70 to Day 100 after bloom. The relative expression of NAD-MDH genes in interstock No. 53 fruit was higher than in No. 236 fruit on Day 100 after bloom, but the relative expression of NADP-ME in No. 236 interstock fruit was lower than in No. 53 fruit. The relative expression of NAD-MDH genes in No. 53 interstock fruit was highest on Day 160 after bloom. This might have been the main reason for the difference in the accumulation of malic acid in the ripe apples.There was a positive correlation between the relative expression of phosphoenolpyruvate carboxylase (PEPC) and the malic acid content of the fruit, and the content of malic acid in the apples was affected by the PEPC activity during the early developmental stage.

  5. Increasing levels of dietary crystalline methionine affect plasma methionine profiles, ammonia excretion, and the expression of genes related to the hepatic intermediary metabolism in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Rolland, Marine; Skov, Peter V; Larsen, Bodil K; Holm, Jørgen; Gómez-Requeni, Pedro; Dalsgaard, Johanne

    2016-08-01

    Strictly carnivorous fish with high requirements for dietary protein, such as rainbow trout (Oncorhynchus mykiss) are interesting models for studying the role of amino acids as key regulators of intermediary metabolism. Methionine is an essential amino acid for rainbow trout, and works as a signalling factor in different metabolic pathways. The study investigated the effect of increasing dietary methionine intake on the intermediary metabolism in the liver of juvenile rainbow trout. For this purpose, five diets were formulated with increasing methionine levels from 0.60 to 1.29% dry matter. The diets were fed in excess for six weeks before three sampling campaigns carried out successively to elucidate (i) the hepatic expression of selected genes involved in lipid, glucose and amino acid metabolism; (ii) the postprandial ammonia excretion; and (iii) the postprandial plasma methionine concentrations. The transcript levels of enzymes involved in lipid metabolism (fatty acid synthase, glucose 6 phosphate dehydrogenase and carnitine palmitoyl transferase 1 a), gluconeogenesis (fructose-1,6-biphosphatase) and amino acid catabolism (alanine amino transferase and glutamate dehydrogenase) were significantly affected by the increase in dietary methionine. Changes in gene expression reflected to some extent the decrease in ammonia excretion (P=0.022) and in the hepatosomatic index (HSI; P<0.001) when dietary methionine increased. Postprandial plasma methionine concentrations correlated positively with the dietary level (P<0.001) at the different sampling points. The study shows that the expression of several genes related to the hepatic intermediary metabolism in rainbow trout responded in a dose-dependent manner to increasing levels of dietary methionine.

  6. Murine genes related to the Drosophila AbdB homeotic genes are sequentially expressed during development of the posterior part of the body.

    PubMed Central

    Izpisúa-Belmonte, J C; Falkenstein, H; Dollé, P; Renucci, A; Duboule, D

    1991-01-01

    The cloning, characterization and developmental expression patterns of two novel murine Hox genes, Hox-4.6 and Hox-4.7, are reported. Structural data allow us to classify the four Hox-4 genes located in the most upstream (5') position in the HOX-4 complex as members of a large family of homeogenes related to the Drosophila homeotic gene Abdominal B (AbdB). It therefore appears that these vertebrate genes are derived from a selective amplification of an ancestral gene which gave rise, during evolution, to the most posterior of the insect homeotic genes so far described. In agreement with the structural colinearity, these genes have very posteriorly restricted expression profiles. In addition, their developmental expression is temporally regulated according to a cranio-caudal sequence which parallels the physical ordering of these genes along the chromosome. We discuss the phylogenetic alternative in the evolution of genetic complexity by amplifying either genes or regulatory sequences, as exemplified by this system in the mouse and Drosophila. Furthermore, the possible role of 'temporal colinearity' in the ontogeny of all coelomic (metamerized) metazoans showing a temporal anteroposterior morphogenetic progression is addressed. Images PMID:1676674

  7. Digital gene expression analysis of corky split vein caused by boron deficiency in 'Newhall' Navel Orange (Citrus sinensis Osbeck) for selecting differentially expressed genes related to vascular hypertrophy.

    PubMed

    Yang, Cheng-Quan; Liu, Yong-Zhong; An, Ji-Cui; Li, Shuang; Jin, Long-Fei; Zhou, Gao-Feng; Wei, Qing-Jiang; Yan, Hui-Qing; Wang, Nan-Nan; Fu, Li-Na; Liu, Xiao; Hu, Xiao-Mei; Yan, Ting-Shuai; Peng, Shu-Ang

    2013-01-01

    Corky split vein caused by boron (B) deficiency in 'Newhall' Navel Orange was studied in the present research. The boron-deficient citrus exhibited a symptom of corky split vein in mature leaves. Morphologic and anatomical surveys at four representative phases of corky split veins showed that the symptom was the result of vascular hypertrophy. Digital gene expression (DGE) analysis was performed based on the Illumina HiSeq™ 2000 platform, which was applied to analyze the gene expression profilings of corky split veins at four morphologic phases. Over 5.3 million clean reads per library were successfully mapped to the reference database and more than 22897 mapped genes per library were simultaneously obtained. Analysis of the differentially expressed genes (DEGs) revealed that the expressions of genes associated with cytokinin signal transduction, cell division, vascular development, lignin biosynthesis and photosynthesis in corky split veins were all affected. The expressions of WOL and ARR12 involved in the cytokinin signal transduction pathway were up-regulated at 1(st) phase of corky split vein development. Furthermore, the expressions of some cell cycle genes, CYCs and CDKB, and vascular development genes, WOX4 and VND7, were up-regulated at the following 2(nd) and 3(rd) phases. These findings indicated that the cytokinin signal transduction pathway may play a role in initiating symptom observed in our study.

  8. Expression of essential genes for biosynthesis of antimicrobial peptides of Bacillus is modulated by inactivated cells of target microorganisms.

    PubMed

    Leães, Fernanda Leal; Velho, Renata Voltolini; Caldas, Danielle Gregório Gomes; Ritter, Ana Carolina; Tsai, Siu Mui; Brandelli, Adriano

    2016-01-01

    Certain Bacillus strains are important producers of antimicrobial peptides with great potential for biological control. Antimicrobial peptide production by Bacillus amyloliquefaciens P11 was investigated in the presence of heat-inactivated cells of bacteria and fungi. B. amyloliquefaciens P11 exhibited higher antimicrobial activity in the presence of inactivated cells of Staphylococcus aureus and Aspergillus parasiticus compared to other conditions tested. Expression of essential genes related to biosynthesis of the antimicrobial peptides surfactin (sfp), iturin A (lpa-14 and ituD), subtilosin A (sboA) and fengycin (fenA) was investigated by quantitative real-time PCR (qRT-PCR). The genes lpa-14 and ituD were highly expressed in the presence of S. aureus (inactivated cells), indicating induction of iturin A production by B. amyloliquefaciens P11. The other inducing condition (inactivated cells of A. parasiticus) suppressed expression of lpa-14, but increased expression of ituD. A twofold increase in fenA expression was observed for both conditions, while strong suppression of sboA expression was observed in the presence of inactivated cells of S. aureus. An increase in antimicrobial activity was observed, indicating that synthesis of antimicrobial peptides may be induced by target microorganisms.

  9. rqh1+, a fission yeast gene related to the Bloom's and Werner's syndrome genes, is required for reversible S phase arrest.

    PubMed Central

    Stewart, E; Chapman, C R; Al-Khodairy, F; Carr, A M; Enoch, T

    1997-01-01

    In eukaryotic cells, S phase can be reversibly arrested by drugs that inhibit DNA synthesis or DNA damage. Here we show that recovery from such treatments is under genetic control and is defective in fission yeast rqh1 mutants. rqh1+, previously known as hus2+, encodes a putative DNA helicase related to the Escherichia coli RecQ helicase, with particular homology to the gene products of the human BLM and WRN genes and the Saccharomyces cerevisiae SGS1 gene. BLM and WRN are mutated in patients with Bloom's syndrome and Werner's syndrome respectively. Both syndromes are associated with genomic instability and cancer susceptibility. We show that, like BLM and SGS1, rqh1+ is required to prevent recombination and that in fission yeast suppression of inappropriate recombination is essential for reversible S phase arrest. PMID:9184215

  10. Increased Cell Proliferation and Gene Expression of Genes Related to Bone Remodeling, Cell Adhesion and Collagen Metabolism in the Periodontal Ligament of Unopposed Molars in Growing Rats

    PubMed Central

    Dorotheou, Domna; Farsadaki, Vassiliki; Bochaton-Piallat, Marie-Luce; Giannopoulou, Catherine; Halazonetis, Thanos D.; Kiliaridis, Stavros

    2017-01-01

    Tooth eruption, the process by which teeth emerge from within the alveolar bone into the oral cavity, is poorly understood. The post-emergent phase of tooth eruption continues throughout life, in particular, if teeth are not opposed by antagonists. The aim of the present study was to better understand the molecular processes underlying post-emergent tooth eruption. Toward this goal, we removed the crowns of the maxillary molars on one side of the mouth of 14 young rats and examined gene expression patterns in the periodontal ligaments (PDLs) of the ipsilateral and contralateral mandibular molars, 3 and 15 days later. Nine untreated rats served as controls. Expression of six genes, Adamts18, Ostn, P4ha3, Panx3, Pth1r, and Tnmd, was upregulated in unopposed molars relative to molars with antagonists. These genes function in osteoblast differentiation and proliferation, cell adhesion and collagen metabolism. Proliferation of PDL cells also increased following loss of the antagonist teeth. Interestingly, mutations in PTH1R have been linked to defects in the post-emergent phase of tooth eruption in humans. We conclude that post-emergent eruption of unopposed teeth is associated with gene expression patterns conducive to alveolar bone formation and PDL remodeling. PMID:28239357

  11. Cloning and expression profiling of four antibacterial peptide genes from the bumblebee Bombus ignitus.

    PubMed

    Choi, Yong Soo; Choo, Young Moo; Lee, Kwang Sik; Yoon, Hyung Joo; Kim, Iksoo; Je, Yeon Ho; Sohn, Hung Dae; Jin, Byung Rae

    2008-06-01

    Four antibacterial peptide genes (apidaecin, hymenoptaecin, abaecin, and defensin) were cloned from the bumblebee Bombus ignitus, and cDNAs and their genomic structures were sequenced and characterized. Comparative analysis revealed that the four antibacterial peptides of B. ignitus had similar characteristics to other bee antibacterial peptides identified to date. The transcriptional expression profiles of the four antibacterial peptide genes in the fat body of B. ignitus workers revealed that all four antibacterial peptide genes were acutely induced in a similar manner by PBS injection or LPS stimulation, indicating that antibacterial peptides from various classes are simultaneously expressed in a single insect upon infection or injury.

  12. Genome-wide analysis of CrRLK1L gene family in Gossypium and identification of candidate CrRLK1L genes related to fiber development.

    PubMed

    Niu, Erli; Cai, Caiping; Zheng, Yongjie; Shang, Xiaoguang; Fang, Lei; Guo, Wangzhen

    2016-06-01

    Members of the CrRLK1L family, a subgroup of the receptor-like kinase (RLK) gene family, are thought to act as sensors for the integrity of the cell wall and regulators of polar elongation. To better understand the various functions in fiber development, we conducted genome-wide identification and characterization analyses of CrRLK1L family in cotton. Here 44, 40, and 79 CrRLK1L genes were identified from three cotton species: diploid G. raimondii (D5), diploid G. arboreum (A2), and tetraploid G. hirsutum TM-1 (AD1), respectively. The 44 CrRLK1Ls in G. raimondii were anchored to the 12 chromosomes unevenly and were classified into six groups (I-VI), with group II and group IV being further divided into two subgroups (groups IIa and IIb, and IVa and IVb, respectively). These CrRLK1Ls displayed a highly regular pattern of developmental and spatial regulation in cotton. Using the transcriptome data of five chromosomal segment introgression lines (CSILs) and the physical integration of CrRLK1Ls with the quantitative trait loci (QTLs) related to fiber quality traits, we revealed that six CrRLK1L genes were highly associated with fiber development. This study brings new insights into the integrated genome-wide identification of CrRLK1Ls in cotton and provides references for the genetic improvement of cotton fiber.

  13. PPARγ, an important gene related to lipid metabolism and immunity in Megalobrama amblycephala: cloning, characterization and transcription analysis by GeNorm.

    PubMed

    Li, Su; Gul, Yasmeen; Wang, Weimin; Qian, Xueqiao; Zhao, Yuhua

    2013-01-10

    In order to be able to modulate and improve the function of PPARγ and decrease further some metabolic diseases of M. amblycephala, we have cloned and identified the full-length cDNA of PPARγ in M. amblycephala and examined its transcription patterns at different embryo developmental stages and in different tissues of adult and immature fish. We also accurately normalized seven reference genes by GeNorm and calculated their gene transcription normalization factors. The full-length of PPARγ was 1968 bp, consisting of 218 bp 5'-untranslated region, 1,533 bp open reading frame encoding 510 amino acids residues and 217 bp 3'-untranslated region. M. amblycephala PPARγ peptide was predicted to consist of 4 conserved domains, i.e. N-terminal domain, DNA-binding domain, ligand binding domain and flexible hinge region. PPARγ mRNAs were detected in all studied tissues of adult and immature fish including adipose tissue, gill, heart, liver, spleen, kidney, white muscle, intestine, brain and gonad. In adult fish, PPARγ transcription in liver was highest, followed by gills and it was lowest in female gonads. Moreover, the differences among liver, gill, intestine/brain, spleen/white muscle, kidney and female gonads were greatly significant (p<0.01). The transcription of PPARγ in male gonads was significantly higher than in female gonads (p<0.01). In immature fish, the transcription of PPARγ was highest in intestines followed by adipose tissue, and it was lowest in hearts and white muscles. A great difference was observed (p<0.01) in the transcription of PPARγ among adipose tissue, intestines, liver and heart/white muscles. At different embryo developmental stages, PPARγ transcription in unfertilized spermatozoa was greatly higher than in unfertilized ovum (p<0.01) and it was highest among different embryo developmental stages. The transcription of PPARγ increased gradually during 2 cells stage and 32 cells stage and then decreased until gastrula stage at which it was

  14. Identification of peptide-specific TCR genes by in vitro peptide stimulation and CDR3 length polymorphism analysis.

    PubMed

    Shao, Hongwei; Lin, Yanmei; Wang, Teng; Ou, Yusheng; Shen, Han; Tao, Changli; Wu, Fenglin; Zhang, Wenfeng; Bo, Huaben; Wang, Hui; Huang, Shulin

    2015-07-10

    Identification of TCR genes specific for tumor-associated antigens (TAAs) is necessary for TCR gene modification of T cells, which is applied in anti-tumor adoptive T cell therapy (ACT). The usual identification methods are based on isolating single peptide-responding T cells and cloning the TCR gene by in vitro expansion or by single-cell RT-PCR. However, the long and exacting in vitro culture period and demanding operational requirements restrict the application of these methods. Immunoscope is an effective tool that profiles a repertoire of TCRs and identifies significantly expanded clones through CDR3 length analysis. In this study, a survivin-derived mutant peptide optimized for HLA-A2 binding was selected to load DCs and activate T cells. The monoclonal expansion of TCRA and TCRB genes was separately identified by Immunoscope analysis and following sequence identification, the properly paired TCR genes were transferred into T cells. Peptide recognition and cytotoxicity assays indicated that TCR-modified PBMCs could respond to both the mutant and wild type peptides and lyse target cells. These results show that combining Immunoscope with in vitro peptide stimulation provides an alternative and superior method for identifying specific TCR genes, which represents a significant advance for the application of TCR gene-modified T cells.

  15. Cloning and heterologous expression of the antibiotic peptide (ABP) genes from Rhizopus oligosporus NBRC 8631.

    PubMed

    Yamada, Osamu; Sakamoto, Kazutoshi; Tominaga, Mihoko; Nakayama, Tasuku; Koseki, Takuya; Fujita, Akiko; Akita, Osamu

    2005-03-01

    We carried out protein sequencing of purified Antibiotic Peptide (ABP), and cloned two genes encoding this peptide as abp1 and abp2, from Rhizopus oligosporus NBRC 8631. Both genes contain an almost identical 231-bp segment, with only 3 nucleotide substitutions, encoding a 77 amino acid peptide. The abp gene product comprises a 28 amino acid signal sequence and a 49 amino acid mature peptide. Northern blot analysis showed that at least one of the abp genes is transcribed in R. oligosporus NBRC 8631. A truncated form of abp1 encoding only the mature peptide was fused with the alpha-factor signal peptide and engineered for expression in Pichia pastoris SMD1168H. Culture broth of the recombinant Pichia displayed ABP activity against Bacillus subtilis NBRC 3335 after induction of heterologous gene expression. This result indicates that mature ABP formed the active structure without the aid of other factors from R. oligosporus, and was secreted.

  16. A Cell-Penetrating Peptide with a Guanidinylethyl Amine Structure Directed to Gene Delivery

    PubMed Central

    Oba, Makoto; Kato, Takuma; Furukawa, Kaori; Tanaka, Masakazu

    2016-01-01

    A peptide composed of lysine with a guanidinylethyl (GEt) amine structure in the side chain [Lys(GEt)] was developed as a cell-penetrating peptide directed to plasmid DNA (pDNA) delivery. The GEt amine adopted a diprotonated form at neutral pH, which may have led to the more efficient cellular uptake of a Lys(GEt)-peptide than an arginine-peptide at a low concentration. Lys(GEt)-peptide/pDNA complexes showed the highest transfection efficiency due to efficient endosomal escape without any cytotoxicity. Lys(GEt)-peptide may be a promising candidate as a gene delivery carrier. PMID:26814673

  17. Loss of genes related to Nucleotide Excision Repair (NER) and implications for reductive genome evolution in symbionts of deep-sea vesicomyid clams

    PubMed Central

    Shimamura, Shigeru; Kaneko, Takashi; Ozawa, Genki; Matsumoto, Mamiko Nishino; Koshiishi, Takeru; Takaki, Yoshihiro; Kato, Chiaki; Takai, Ken; Yoshida, Takao; Fujikura, Katsunori; Barry, James P.

    2017-01-01

    Intracellular thioautotrophic symbionts of deep-sea vesicomyid clams lack some DNA repair genes and are thought to be undergoing reductive genome evolution (RGE). In this study, we addressed two questions, 1) how these symbionts lost their DNA repair genes and 2) how such losses affect RGE. For the first question, we examined genes associated with nucleotide excision repair (NER; uvrA, uvrB, uvrC, uvrD, uvrD paralog [uvrDp] and mfd) in 12 symbionts of vesicomyid clams belonging to two clades (5 clade I and 7 clade II symbionts). While uvrA, uvrDp and mfd were conserved in all symbionts, uvrB and uvrC were degraded in all clade I symbionts but were apparently intact in clade II symbionts. UvrD was disrupted in two clade II symbionts. Among the intact genes in Ca. Vesicomyosocius okutanii (clade I), expressions of uvrD and mfd were detected by reverse transcription-polymerase chain reaction (RT-PCR), but those of uvrA and uvrDp were not. In contrast, all intact genes were expressed in the symbiont of Calyptogena pacifica (clade II). To assess how gene losses affect RGE (question 2), genetic distances of the examined genes in symbionts from Bathymodiolus septemdierum were shown to be larger in clade I than clade II symbionts. In addition, these genes had lower guanine+cytosine (GC) content and higher repeat sequence densities in clade I than measured in clade II. Our results suggest that NER genes are currently being lost from the extant lineages of vesicomyid clam symbionts. The loss of NER genes and mutY in these symbionts is likely to promote increases in genetic distance and repeat sequence density as well as reduced GC content in genomic genes, and may have facilitated reductive evolution of the genome. PMID:28199404

  18. Genome-wide identification of cassava R2R3 MYB family genes related to abscission zone separation after environmental-stress-induced abscission

    PubMed Central

    Liao, Wenbin; Yang, Yiling; Li, Yayun; Wang, Gan; Peng, Ming

    2016-01-01

    Cassava plants (Manihot esculenta Crantz) resist environmental stresses by shedding leaves in leaf pulvinus abscission zones (AZs), thus leading to adaptation to new environmental conditions. Little is known about the roles of cassava R2R3 MYB factors in regulating AZ separation. Herein, 166 cassava R2R3 MYB genes were identified. Evolutionary analysis indicated that the 166 R2R3 MYB genes could be divided into 11 subfamilies. Transcriptome analysis indicated that 26 R2R3 MYB genes were expressed in AZs across six time points during both ethylene- and water-deficit stress-induced leaf abscission. Comparative expression profile analysis of similar SOTA (Self Organizing Tree Algorithm) clusters demonstrated that 10 R2R3 MYB genes had similar expression patterns at six time points in response to both treatments. GO (Gene Ontology) annotation confirmed that all 10 R2R3 MYB genes participated in the responses to stress and ethylene and auxin stimuli. Analysis of the putative 10 R2R3 MYB promoter regions showed that those genes primarily contained ethylene- and stress-related cis-elements. The expression profiles of the genes acting downstream of the selected MYBs were confirmed to be involved in cassava abscission zone separation. All these results indicated that R2R3 MYB plays an important regulatory role in AZ separation. PMID:27573926

  19. Ecological genomics of tropical trees: how local population size and allelic diversity of resistance genes relate to immune responses, cosusceptibility to pathogens, and negative density dependence.

    PubMed

    Marden, J H; Mangan, S A; Peterson, M P; Wafula, E; Fescemyer, H W; Der, J P; dePamphilis, C W; Comita, L S

    2017-01-02

    In tropical forests, rarer species show increased sensitivity to species-specific soil pathogens and more negative effects of conspecific density on seedling survival (NDD). These patterns suggest a connection between ecology and immunity, perhaps because small population size disproportionately reduces genetic diversity of hyperdiverse loci such as immunity genes. In an experiment examining seedling roots from six species in one tropical tree community, we found that smaller populations have reduced amino acid diversity in pathogen resistance (R) genes but not the transcriptome in general. Normalized R gene amino acid diversity varied with local abundance and prior measures of differences in sensitivity to conspecific soil and NDD. After exposure to live soil, species with lower R gene diversity had reduced defence gene induction, more cosusceptibility of maternal cohorts to colonization by potentially pathogenic fungi, reduced root growth arrest (an R gene-mediated response) and their root-associated fungi showed lower induction of self-defence (antioxidants). Local abundance was not related to the ability to induce immune responses when pathogen recognition was bypassed by application of salicylic acid, a phytohormone that activates defence responses downstream of R gene signalling. These initial results support the hypothesis that smaller local tree populations have reduced R gene diversity and recognition-dependent immune responses, along with greater cosusceptibility to species-specific pathogens that may facilitate disease transmission and NDD. Locally rare species may be less able to increase their equilibrium abundance without genetic boosts to defence via immigration of novel R gene alleles from a larger and more diverse regional population.

  20. Determination of the key innate genes related to individual variation in carbon tetrachloride-induced hepatotoxicity using a pre-biopsy procedure

    SciTech Connect

    Yun, Jun-Won; Kim, Chae-Wook; Bae, Il-Hong; Park, Young-Ho; Chung, Jin-Ho; Lim, Kyung-Min Kang, Kyung-Sun

    2009-08-15

    High inter-individual variation in chemical-induced liver injury is a frequent observation with many hepatotoxic chemicals, yet the mechanism underlying it remains poorly understood. Even with carbon tetrachloride (CCl{sub 4}), a well-known model hepatotoxicant, substantial individual variations are observed in the severity of liver injury. Using microarray, many attempts have been made to identify the key genes in CCl{sub 4}-induced liver injury but mostly, they examined the gene expression of liver after CCl{sub 4} exposure, unable to dissect out the complicating factors from pathological changes secondary to liver injury. To more accurately identify the genes for the individual variation in CCl{sub 4}-induced hepatotoxicity, we compared the innate gene expression of the individual liver samples pre-biopsied prior to CCl{sub 4}-treatment with the severity of liver injury after CCl{sub 4}-treatment. Effect of biopsy procedure and 3 week recovery period on liver function and gene expression were confirmed to be insignificant. Using this design, we found that the expression of genes associated with immunity and defense, lipid metabolism, transport and complement-mediated immunity, which are previously known to be suppressed by CCl{sub 4}-treatment, were innately lower in the susceptible animals than resistant animals. Moreover, we demonstrated that the genes such as Gsta2, Sult2a1, Fgl1 and C6 were newly found to be innately lower in the susceptible animals to CCl{sub 4}-hepatotoxicity. These naturally lower gene expression patterns were further confirmed by RT-PCR. We believe that this pre-biopsy design may provide a useful tool for understanding the cause of variability of hepatotoxicity and for the prediction and pre-screening of the susceptible individual to drug-induced hepatotoxicity.

  1. Molecular cloning and expression analysis of RrNHX1 and RrVHA-c genes related to salt tolerance in wild Rosa rugosa

    PubMed Central

    Feng, Liguo; Ding, Han; Wang, Jia; Wang, Meng; Xia, Wei; Zang, Shu; Sheng, Lixia

    2015-01-01

    Salt stress is one important factor influencing the growth and development of plants, and salt tolerance of plants is a result of combined action of multiple genes and mechanisms. Rosa rugosa is not only an important ornamental plant, but also the natural aromatic plant of high value. Wild R. rugosa which is naturally distributed on the coast and islands of China has a good salt tolerance due to the special living environment. Here, the vacuolar Na+/H+ reverse transporter gene (NHX1) and the vacuolar H+-ATPase subunit C gene (VHA-c) closely related to plant salt tolerance were isolated from wild R. rugosa, and the expression patterns in R. rugosa leaves of the two genes under NaCl stress were determined by real-time quantitative fluorescence PCR. The results showed that the RrNHX1 protein is a constitutive Na+/H+ reverse transporter, the expression of the RrNHX1 gene first increased and then decreased with the increasing salt concentration, and had a time-controlled effect. The RrVHA-c gene is suggestive of the housekeeping feature, its expression pattern showed a similar variation trend with the RrNHX1 gene under the stress of different concentrations of NaCl, and its temporal expression level under 200 mM NaCl stress presented bimodal change. These findings indicated that RrNHX1 and RrVHA-c genes are closely associated with the salt tolerance trait of wild R. rugosa. PMID:26150747

  2. Co-variations of bacterial composition and catabolic genes related to PAH degradation in a produced water treatment system consisting of successive anoxic and aerobic units.

    PubMed

    Wang, Zhenyu; Li, Jian; Hesham, Abd El-Latif; He, Shaowu; Zhang, Yu; Wang, Zijian; Yang, Min

    2007-02-01

    This paper reports on the investigation of concentration levels of PAHs, community structure, as well as the abundance of PAH-related catabolic genes including upper-pathway dioxygenase genes (nahAc and phnAc) and down-pathway catechol dioxygenase genes (C12O and C23O) in a successive anoxic and aerobic treatment of produced water from the Jidong Oilfield, China. 93% of total PAHs were removed, almost equally contributed by the anoxic and aerobic units. However, PAHs of more than 3 benzene rings remained almost unchanged. The signals for phnAc and C12O were undetectable in this biological system, whereas the existence of nahAc and C23O was confirmed in the system and the copies of the two genes in the aerobic tank were 2 or 3 orders higher than those in the influent water sample. The different behavior of C23O demonstrated that mineralization of PAHs might mainly occur in the aerobic unit. The existence of nahAc and C23O genes in the influent and the high similarity of genotype between the influent and the two sludge samples suggested that bacteria existing in the influent contributed to PAH removal and bacteria harboring PAH catabolic genes were enriched in the sludge.

  3. [Differential expression of genes related to photoperiod-temperature sensitive genic male sterility in wheat, revealed by mRNA differential display using G-box family primer].

    PubMed

    Cao, Shuang-He; Liu, Dong-Cheng; Liu, Li-Ke; Guo, Xiao-Li; Zhang, Ai-Min

    2003-01-01

    mRNA differential display with G-box family primer was used to analyze the differential expression of genes of the photoperiod-temperature sensitive genic male sterile(PTSGMS) line of wheat, BAU3338, between the sterile and fertile conditions. The result indicated that gene expression was significantly different between the two types of condition during the fertility transformation phase. The twelve qualitatively different DNA bands were identified with reverse Northern blot hybridization and five positive clones, HT1-G10, HT1-G3, HT2-G2, HT1-G4 and HT2-G5 were sequenced. The homology search indicated that HT1-G10 was highly homological (96%) to the partial sequences of Triticum aestivum chloroplast genes, rbcL and atpB, HT1-G3 was also homological (88%) to Triticum aestivum histone H2A gene and the other three gene fragments were new sequences in Gen-Bank. The analysis of the candidate gene fragments supplied some effective evidences to reveal the developmental mechanism of PTSGMS.

  4. Transcriptomic Analysis Identifies Candidate Genes Related to Intramuscular Fat Deposition and Fatty Acid Composition in the Breast Muscle of Squabs (Columba)

    PubMed Central

    Ye, Manhong; Zhou, Bin; Wei, Shanshan; Ding, MengMeng; Lu, Xinghui; Shi, Xuehao; Ding, Jiatong; Yang, Shengmei; Wei, Wanhong

    2016-01-01

    Despite the fact that squab is consumed throughout the world because of its high nutritional value and appreciated sensory attributes, aspects related to its characterization, and in particular genetic issues, have rarely been studied. In this study, meat traits in terms of pH, water-holding capacity, intramuscular fat content, and fatty acid profile of the breast muscle of squabs from two meat pigeon breeds were determined. Breed-specific differences were detected in fat-related traits of intramuscular fat content and fatty acid composition. RNA-Sequencing was applied to compare the transcriptomes of muscle and liver tissues between squabs of two breeds to identify candidate genes associated with the differences in the capacity of fat deposition. A total of 27 differentially expressed genes assigned to pathways of lipid metabolism were identified, of which, six genes belonged to the peroxisome proliferator-activated receptor signaling pathway along with four other genes. Our results confirmed in part previous reports in livestock and provided also a number of genes which had not been related to fat deposition so far. These genes can serve as a basis for further investigations to screen markers closely associated with intramuscular fat content and fatty acid composition in squabs. The data from this study were deposited in the National Center for Biotechnology Information (NCBI)’s Sequence Read Archive under the accession numbers SRX1680021 and SRX1680022. This is the first transcriptome analysis of the muscle and liver tissue in Columba using next generation sequencing technology. Data provided here are of potential value to dissect functional genes influencing fat deposition in squabs. PMID:27175015

  5. De novo characterization of fall dormant and nondormant alfalfa (Medicago sativa L.) leaf transcriptome and identification of candidate genes related to fall dormancy.

    PubMed

    Zhang, Senhao; Shi, Yinghua; Cheng, Ningning; Du, Hongqi; Fan, Wenna; Wang, Chengzhang

    2015-01-01

    Alfalfa (Medicago sativa L.) is one of the most widely cultivated perennial forage legumes worldwide. Fall dormancy is an adaptive character related to the biomass production and winter survival in alfalfa. The physiological, biochemical and molecular mechanisms causing fall dormancy and the related genes have not been well studied. In this study, we sequenced two standard varieties of alfalfa (dormant and non-dormant) at two time points and generated approximately 160 million high quality paired-end sequence reads using sequencing by synthesis (SBS) technology. The de novo transcriptome assembly generated a set of 192,875 transcripts with an average length of 856 bp representing about 165.1 Mb of the alfalfa leaf transcriptome. After assembly, 111,062 (57.6%) transcripts were annotated against the NCBI non-redundant database. A total of 30,165 (15.6%) transcripts were mapped to 323 Kyoto Encyclopedia of Genes and Genomes pathways. We also identified 41,973 simple sequence repeats, which can be used to generate markers for alfalfa, and 1,541 transcription factors were identified across 1,350 transcripts. Gene expression between dormant and non-dormant alfalfa at different time points were performed, and we identified several differentially expressed genes potentially related to fall dormancy. The Gene Ontology and pathways information were also identified. We sequenced and assembled the leaf transcriptome of alfalfa related to fall dormancy, and also identified some genes of interest involved in the fall dormancy mechanism. Thus, our research focused on studying fall dormancy in alfalfa through transcriptome sequencing. The sequencing and gene expression data generated in this study may be used further to elucidate the complete mechanisms governing fall dormancy in alfalfa.

  6. Identification of Differentially Expressed Genes Related to Dehydration Resistance in a Highly Drought-Tolerant Pear, Pyrus betulaefolia, as through RNA-Seq.

    PubMed

    Li, Kong-Qing; Xu, Xiao-Yong; Huang, Xiao-San

    2016-01-01

    Drought is a major abiotic stress that affects plant growth, development and productivity. Pear is one of the most important deciduous fruit trees in the world, but the mechanisms of drought tolerance in this plant are still unclear. To better understand the molecular basis regarding drought stress response, RNA-seq was performed on samples collected before and after dehydration in Pyrus betulaefolia. In total, 19,532 differentially expressed genes (DEGs) were identified. These genes were annotated into 144 Gene Ontology (GO) terms and 18 clusters of orthologous groups (COG) involved in 129 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. These DEGs comprised 49 (26 up-regulated, 23 down-regulated), 248 (166 up-regulated, 82 down-regulated), 3483 (1295 up-regulated, 2188 down-regulated), 1455 (1065 up-regulated, 390 down-regulated) genes from the 1 h, 3 h and 6 h dehydration-treated samples and a 24 h recovery samples, respectively. RNA-seq was validated by analyzing the expresson patterns of randomly selected 16 DEGs by quantitative real-time PCR. Photosynthesis, signal transduction, innate immune response, protein phosphorylation, response to water, response to biotic stimulus, and plant hormone signal transduction were the most significantly enriched GO categories amongst the DEGs. A total of 637 transcription factors were shown to be dehydration responsive. In addition, a number of genes involved in the metabolism and signaling of hormones were significantly affected by the dehydration stress. This dataset provides valuable information regarding the Pyrus betulaefolia transcriptome changes in response to dehydration and may promote identification and functional analysis of potential genes that could be used for improving drought tolerance via genetic engineering of non-model, but economically-important, perennial species.

  7. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  8. A genome-wide linkage and association study of musical aptitude identifies loci containing genes related to inner ear development and neurocognitive functions.

    PubMed

    Oikkonen, J; Huang, Y; Onkamo, P; Ukkola-Vuoti, L; Raijas, P; Karma, K; Vieland, V J; Järvelä, I

    2015-02-01

    Humans have developed the perception, production and processing of sounds into the art of music. A genetic contribution to these skills of musical aptitude has long been suggested. We performed a genome-wide scan in 76 pedigrees (767 individuals) characterized for the ability to discriminate pitch (SP), duration (ST) and sound patterns (KMT), which are primary capacities for music perception. Using the Bayesian linkage and association approach implemented in program package KELVIN, especially designed for complex pedigrees, several single nucleotide polymorphisms (SNPs) near genes affecting the functions of the auditory pathway and neurocognitive processes were identified. The strongest association was found at 3q21.3 (rs9854612) with combined SP, ST and KMT test scores (COMB). This region is located a few dozen kilobases upstream of the GATA binding protein 2 (GATA2) gene. GATA2 regulates the development of cochlear hair cells and the inferior colliculus (IC), which are important in tonotopic mapping. The highest probability of linkage was obtained for phenotype SP at 4p14, located next to the region harboring the protocadherin 7 gene, PCDH7. Two SNPs rs13146789 and rs13109270 of PCDH7 showed strong association. PCDH7 has been suggested to play a role in cochlear and amygdaloid complexes. Functional class analysis showed that inner ear and schizophrenia-related genes were enriched inside the linked regions. This study is the first to show the importance of auditory pathway genes in musical aptitude.

  9. Screening of genes related to sulfide metabolism in Urechis unicinctus (Echiura, Urechidae) using suppression subtractive hybridization and cDNA microarray analysis.

    PubMed

    Shi, Xiaoli; Shao, Mingyu; Zhang, Litao; Ma, Yubin; Zhang, Zhifeng

    2012-09-01

    Exogenous sulfide can generally induce metabolic injuries in most organisms and even cause death. However, organisms inhabiting intertidal zones, hydrothermal vents, and cold seeps, can tolerate, metabolize, and utilize sulfide. In this study, both suppression subtractive hybridization and cDNA microarray analysis were employed to screen sulfide metabolism-related genes from the body wall in echiuran worm Urechis unicinctus, a marine sediment species. A total of 3456 monoclones were isolated and 82 were identified as differentially expressed genes in worms exposed to 50 μM sulfide for 24 h, compared to controls. The identified genes encoded proteins with multiple processes, including metabolism, cellular process, biological regulation, response to stimulus, multicellular organismal process, localization, development, and cellular component organization. Eight genes, serase, vacuolar protein, src tyrosine kinase, sulfide oxidase-like oxidoreductase, aprataxin, SN-RNP, aminopeptidase, and predicted protein, were selected to verify expression in the worm using qRT-PCR. The agreement of gene expression evaluation was 62.5% between the results of microarray analysis and qRT-PCR. These new data will provide clues for further probing of the molecular mechanism of sulfide metabolism.

  10. Deletion of the transcriptional coactivator PGC1α in skeletal muscles is associated with reduced expression of genes related to oxidative muscle function.

    PubMed

    Hatazawa, Yukino; Minami, Kimiko; Yoshimura, Ryoji; Onishi, Takumi; Manio, Mark Christian; Inoue, Kazuo; Sawada, Naoki; Suzuki, Osamu; Miura, Shinji; Kamei, Yasutomi

    2016-12-09

    The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared with that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α's function in the oxidative energy metabolism of skeletal muscles.

  11. Knockout of the adp gene related with colonization in Bacillus nematocida B16 using customized transcription activator-like effectors nucleases

    PubMed Central

    Niu, Qiuhong; Zheng, Haoying; Zhang, Lin; Qin, Fujun; Facemire, Loryn; Zhang, Guo; Cao, Feng; Zhang, Ke-qin; Huang, Xiaowei; Yang, Jianwei; He, Lei; Liu, Chanjuan

    2015-01-01

    Bacillus nematocida B16 is able to dominate in the intestines of the worm Caenorhabditis elegans in ‘Trojan horse’ pathogenic mechanism. The adp is one candidate gene which potentially play a vital role in the colonization from our previous random mutagenesis screening results. To analyse the functional role of this gene, we constructed the adp knockout mutant through customized transcription activator-like effectors nucleases (TALEN), which has been successfully used in yeasts, nematodes, zebrafish and human pluripotent cells. Here, we first time report this knockout method in bacteria on this paper. Bioassay experiments demonstrated that the adp knockout mutant of B16 showed considerably lower colonization activity, reduced numbers of intestines and less than 80% nematocidal activity compared with the wild-type strain when infected for 48 h. However, no obvious change on proteolytic activity was observed in the mutant. Conversely, the complementation of adp gene restored most of the above deficient phenotypes. These results indicated that the adp gene was involved in surface adhesion and played a comparatively important role in colonizing host nematodes. Moreover, TALENs successfully disrupt target genes in bacteria. PMID:25912819

  12. A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo.

    PubMed Central

    Simeone, A; Acampora, D; Mallamaci, A; Stornaiuolo, A; D'Apice, M R; Nigro, V; Boncinelli, E

    1993-01-01

    We studied the expression of two vertebrate homeobox genes, Otx1 and Otx2, related to orthodenticle, a gene expressed in the developing head of Drosophila. Both genes are expressed in restricted regions of the developing rostral brain including the presumptive cerebral cortex and olfactory bulbs. The expression patterns of the two genes in diencephalon suggest that they both have a role in establishing the boundary between presumptive dorsal and ventral thalamus. They are also expressed in regions of the developing olfactory, auricolar and ocular system, including the covering of the optic nerve. Otx1 expression is detectable from day 8 of gestation in telencephalic, diencephalic and mesencephalic regions. From day 10.5 of gestation its expression extends to some metencephalic areas. Otx2 appears to be already expressed in the epiblast of prestreak embryos. It persists in the entire embryonic ectoderm for some time after the onset of gastrulation. In midstreak embryos its expression appears progressively restricted to the anterior embryonic ectoderm corresponding to presumptive fore- and mid-brain. In early midgestation embryos it is expressed in telencephalic, diencephalic and mesencephalic regions but from day 11.75 of gestation its expression disappears from dorsal telencephalon and is confined to diencephalic and mesencephalic regions. Otx2 is one of the earliest genes expressed in the epiblast and immediately afterwards is expressed in anterior neuroectoderm, demarcating rostral brain regions even before headfold formation. Its gene product contains a homeodomain of the bicoid class and is able to recognize and transactivate a bicoid target sequence. Images PMID:8101484

  13. Genome-Wide DNA Methylation Analysis of Chinese Patients with Systemic Lupus Erythematosus Identified Hypomethylation in Genes Related to the Type I Interferon Pathway

    PubMed Central

    Yeung, Kit San; Chung, Brian Hon-Yin; Choufani, Sanaa; Mok, Mo Yin; Wong, Wai Lap; Mak, Christopher Chun Yu; Yang, Wanling; Lee, Pamela Pui Wah; Wong, Wilfred Hing Sang; Chen, Yi-an; Grafodatskaya, Daria; Wong, Raymond Woon Sing; Lau, Chak Sing; Chan, Daniel Tak Mao; Weksberg, Rosanna; Lau, Yu-Lung

    2017-01-01

    Background Epigenetic variants have been shown in recent studies to be important contributors to the pathogenesis of systemic lupus erythematosus (SLE). Here, we report a 2-step study of discovery followed by replication to identify DNA methylation alterations associated with SLE in a Chinese population. Using a genome-wide DNA methylation microarray, the Illumina Infinium HumanMethylation450 BeadChip, we compared the methylation levels of CpG sites in DNA extracted from white blood cells from 12 female Chinese SLE patients and 10 healthy female controls. Results We identified 36 CpG sites with differential loss of DNA methylation and 8 CpG sites with differential gain of DNA methylation, representing 25 genes and 7 genes, respectively. Surprisingly, 42% of the hypomethylated CpG sites were located in CpG shores, which indicated the functional importance of the loss of DNA methylation. Microarray results were replicated in another cohort of 100 SLE patients and 100 healthy controls by performing bisulfite pyrosequencing of four hypomethylated genes, MX1, IFI44L, NLRC5 and PLSCR1. In addition, loss of DNA methylation in these genes was associated with an increase in mRNA expression. Gene ontology analysis revealed that the hypomethylated genes identified in the microarray study were overrepresented in the type I interferon pathway, which has long been implicated in the pathogenesis of SLE. Conclusion Our epigenetic findings further support the importance of the type I interferon pathway in SLE pathogenesis. Moreover, we showed that the DNA methylation signatures of SLE can be defined in unfractionated white blood cells. PMID:28085900

  14. Transcriptome Analysis Identifies Candidate Genes Related to Triacylglycerol and Pigment Biosynthesis and Photoperiodic Flowering in the Ornamental and Oil-Producing Plant, Camellia reticulata (Theaceae)

    PubMed Central

    Yao, Qiu-Yang; Huang, Hui; Tong, Yan; Xia, En-Hua; Gao, Li-Zhi

    2016-01-01

    Camellia reticulata, which is native to Southwest China, is famous for its ornamental flowers and high-quality seed oil. However, the lack of genomic information for this species has largely hampered our understanding of its key pathways related to oil production, photoperiodic flowering process and pigment biosynthesis. Here, we first sequenced and characterized the transcriptome of a diploid C. reticulata in an attempt to identify genes potentially involved in triacylglycerol biosynthesis (TAGBS), photoperiodic flowering, flavonoid biosynthesis (FlaBS), carotenoid biosynthesis (CrtBS) pathways. De novo assembly of the transcriptome provided a catalog of 141,460 unigenes with a total length of ~96.1 million nucleotides (Mnt) and an N50 of 1080 nt. Of them, 22,229 unigenes were defined as differentially expressed genes (DEGs) across five sequenced tissues. A large number of annotated genes in C. reticulata were found to have been duplicated, and differential expression patterns of these duplicated genes were commonly observed across tissues, such as the differential expression of SOC1_a, SOC1_b, and SOC1_c in the photoperiodic flowering pathway. Up-regulation of SAD_a and FATA genes and down-regulation of FAD2_a gene in the TAGBS pathway in seeds may be relevant to the ratio of monounsaturated fatty acid (MUFAs) to polyunsaturated fatty acid (PUFAs) in seed oil. MYBF1, a transcription regulator gene of the FlaBS pathway, was found with great sequence variation and alteration of expression patterns, probably resulting in functionally evolutionary differentiation in C. reticulata. MYBA1_a and some anthocyanin-specific biosynthetic genes in the FlaBS pathway were highly expressed in both flower buds and flowers, suggesting important roles of anthocyanin biosynthesis in flower development. Besides, a total of 40,823 expressed sequence tag simple sequence repeats (EST-SSRs) were identified in the C. reticulata transcriptome, providing valuable marker resources for

  15. Expression pattern of potential biomarker genes related to growth, ion regulation and stress in response to ammonia exposure, food deprivation and exercise in common carp (Cyprinus carpio).

    PubMed

    Sinha, Amit Kumar; Diricx, Marjan; Chan, Lai Pong; Liew, Hon Jung; Kumar, Vikas; Blust, Ronny; De Boeck, Gudrun

    2012-10-15

    Waterborne ammonia has become a persistent pollutant of aquatic habitats. During certain periods (e.g. winter), food deprivation may occur simultaneously in natural water. Additionally, under such stressful circumstances, fish may be enforced to swim at a high speed in order to catch prey, avoid predators and so on. Consequently, fish need to cope with all these stressors by altering physiological processes which in turn are controlled by their genes. In this present study, toxicogenomic analyses using real time PCR was used to characterize expression patterns of potential biomarker genes controlling growth, ion regulation and stress responses in common carp subjected to elevated ammonia (1 mg/L; Flemish water quality guideline for surface water) following periods of feeding (2% body weight) and fasting (unfed for 7 days prior to sampling). Both feeding groups of fish were exposed to high environment ammonia (HEA) for 0 h (control), 3h, 12h, 1 day, 4 days, 10 days, 21 days and 28 days, and were sampled after performing swimming at different speeds (routine versus exhaustive). Results show that the activity and expression of Na(+)/K(+)-ATPase, an important branchial ion regulatory enzyme, was increased after 4-10 days of exposure. Effect of HEA was also evident on expression patterns of other ion-regulatory hormone and receptor genes; prolactin and cortisol receptor mRNA level(s) were down-regulated and up-regulated respectively after 4, 10 and 21 days. Starvation and exhaustive swimming, the additional challenges in present study significantly further enhanced the HEA effect on the expression of these two genes. mRNA transcript of growth regulating hormone and receptor genes such as Insulin-like growth factor I, growth hormone receptor, and the thyroid hormone receptor were reduced in response to HEA and the effect of ammonia was exacerbated in starved fish, with levels that were remarkably reduced compared to fed exposed fish. However, the expression of the growth

  16. Hexane extract of Raphanus sativus L. roots inhibits cell proliferation and induces apoptosis in human cancer cells by modulating genes related to apoptotic pathway.

    PubMed

    Beevi, Syed Sultan; Mangamoori, Lakshmi Narasu; Subathra, Murugan; Edula, Jyotheeswara Reddy

    2010-09-01

    Raphanus sativus, a common cruciferous vegetable has been attributed to possess a number of pharmacological and therapeutic properties. It has been used in indigenous system of medicine for the treatment of various human ailments in India. This present study evaluated the chemopreventive efficacy of different parts of R. sativus such as root, stem and leaves, extracted with solvents of varying polarity and investigated the molecular mechanism leading to growth arrest and apoptotic cell death in human cancer cell lines. Of the different parts, significant growth inhibitory effect was observed with hexane extract of R. sativus root. Analysis of hexane extract by GC-MS revealed the presence of several isothiocyanates (ITCs) such as 4-(methylthio)-3-butenyl isothiocyanate (MTBITC), 4-(methylthio)-3-butyl isothiocyanate (erucin), 4-methylpentyl isothiocyanate, 4-pentenyl isothiocyanate and sulforaphene. R. sativus root extract induced cell death both in p53 proficient and p53 deficient cell lines through induction of apoptotic signaling pathway regardless of the p53 status of cells. The molecular mechanisms underlying R. sativus-induced apoptosis may involve interactions among Bcl(2) family genes, as evidenced by up-regulation of pro-apoptotic genes and down-regulation of anti-apoptotic genes along with activation of Caspase-3. Our findings present the first evidence that hexane extract of R. sativus root exerts potential chemopreventive efficacy and induces apoptosis in cancer cell lines through modulation of genes involved in apoptotic signaling pathway.

  17. Characterization of BcMF23a and BcMF23b, two putative pectin methylesterase genes related to pollen development in Brassica campestris ssp. chinensis.

    PubMed

    Lin, Sue; Huang, Li; Yu, Xiaolin; Xiong, Xingpeng; Yue, Xiaoyan; Liu, Tingting; Liang, Ying; Lv, Meiling; Cao, Jiashu

    2017-02-01

    Two homologous genes, Brassica campestris Male Fertility 23a (BcMF23a) and Brassica campestris Male Fertility 23b (BcMF23b), encoding putative pectin methylesterases (PMEs) were isolated from Brassica campestris ssp. chinensis (syn. Brassica rapa ssp. chinensis). These two genes sharing high sequence identity with each other were highly expressed in the fertile flower buds but silenced in the sterile ones of genic male sterile line system ('Bcajh97-01A/B'). Results of RT-PCR and in situ hybridization suggested that BcMF23a and BcMF23b were pollen-expressed genes, whose transcripts were first detected at the binucleate pollen and maintained throughout to the mature pollen grains. Western blot indicated that both of the putative BcMF23a and BcMF23b proteins are approximately 40 kDa, which exhibited extracellular localization revealed by transient expression analysis in the onion epidermal cells. The promoter of BcMF23a was active specifically in pollen during the late pollen developmental stages, while, in addition to the pollen, BcMF23b promoter drove an extra gene expression in the valve margins, abscission layer at the base of the first true leaves, taproot and lateral roots in seedlings.

  18. Suppression of adipogenic differentiation by muscle cell-induced decrease in genes related to lipogenesis in muscle and fat co-culture system.

    PubMed

    Park, Sungkwon; Baek, Kyunghoon; Choi, Changbon

    2013-09-01

    Intercellular signalling communication between adipose and muscle tissue has been investigated. To test the effect of muscle cells on adipogenic gene expression, we utilised an in vitro co-culture system, in which fat (3T3-L1) and muscle (L-6) cells were physically separated but chemically exposed each other via insert with 0.4 µm porous membrane. When 3T3-L1 and L-6 cells reached at 80 and 40% confluence, respectively in separate wells, L-6 cells grown in insert were transferred onto 6-well plates where 3T3-L1 cells were being grown. When both cells were fully differentiated in co-culture plates, morphology of 3T3-L1 was examined by staining with Oil-red-O. Activity of glycerol-3-phosphate dehydrogenase (GPDH) and adipogenic gene expression including lipoprotein lipase (LPL), adipsin, GPDH, peroxisome proliferator-activated receptor-γ (PPARγ) and CCAAT/enhancer binding protein (C/EBPα) were analysed. The presence of muscle cells during preadipocyte differentiation inhibited (P < 0.05) lipogenesis by suppressing lipogenic gene expression including LPL, adipsin and GPDH. Furthermore, GPDH activity was also decreased (P < 0.05) in 3T3-L1 cells by the presence of L-6 cells. These results suggest that presence of muscle cells suppresses adipogenic differentiation by inhibiting the adipogenic gene expression and GPDH activity in the muscle and fat cell co-culture system.

  19. Gestational N-hexane inhalation alters the expression of genes related to ovarian hormone production and DNA methylation states in adult female F1 rat offspring.

    PubMed

    Li, Hong; Zhang, Chenyun; Ni, Feng; Guo, Suhua; Wang, Wenxiang; Liu, Jing; Lu, Xiaoli; Huang, Huiling; Zhang, Wenchang

    2015-12-15

    Research has revealed that n-hexane can disrupt adult female endocrine functions; however, few reports have focused on endocrine changes in adult F1 females after maternal exposure during gestation. In this study, female Wistar rats inhaled 100, 500, 2500, or 12,500 ppm n-hexane for 4 h daily during their initial 20 gestational days. The F1 female offspring exhibited abnormal oestrus cycles. Compared with the controls, the in vitro-cultured ovarian granulosa cells of the 12,500 ppm group showed significantly reduced in vitro progesterone and oestradiol secretion. Elevated progesterone secretion was observed in the 500 ppm group, and decreased and significantly upregulated mRNA expression of the Star, Cyp11a1, Cyp17a1, and Hsd3b genes was observed in the 12,500 ppm and 500 ppm groups, respectively. The protein expression levels were consistent with the mRNA expression levels. Methylation screening of the promoter regions of these genes was performed using MeDIP-chip and confirmed by methylation-sensitive high-resolution melting (MS-HRM), and the observed methylation state changes of the promoter regions were correlated with the gene expression levels. The results suggest that the hormone levels in the female offspring after gestational n-hexane inhalation correspond to the expression levels and DNA methylation states of the hormone production genes.

  20. Detection of a Putative TetR-Like Gene Related to Mycobacterium bovis BCG Growth in Cholesterol Using a gfp-Transposon Mutagenesis System

    PubMed Central

    Otal, Isabel; Pérez-Herrán, Esther; Garcia-Morales, Lazaro; Menéndez, María C.; Gonzalez-y-Merchand, Jorge A.; Martín, Carlos; García, María J.

    2017-01-01

    In vitro transposition is a powerful genetic tool for identifying mycobacterial virulence genes and studying virulence factors in relation to the host. Transposon shuttle mutagenesis is a method for constructing stable insertions in the genome of different microorganisms including mycobacteria. Using an IS1096 derivative, we have constructed the Tngfp, a transposon containing a promoterless green fluorescent protein (gfp) gene. This transposon was able to transpose randomly in Mycobacterium bovis BCG. Bacteria with a single copy of the gfp gene per chromosome from an M. bovis BCG::Tngfp library were analyzed and cells exhibiting high levels of fluorescence were detected by flow cytometry. Application of this approach allowed for the selection of a mutant, BCG_2177c::Tngfp (BCG-Tn), on the basis of high level of long-standing fluorescence at stationary phase. This BCG-Tn mutant showed some particular phenotypic features compared to the wild type strain, mainly during stationary phase, when cholesterol was used as a sole carbon source, thus supporting the relationships of the targeted gene with the regulation of cholesterol metabolism in this bacteria. This approach showed that Tngfp is a potentially useful tool for studying the involvement of the targeted loci in metabolic pathways of mycobacteria. PMID:28321208

  1. Multiple Genes Related to Muscle Identified through a Joint Analysis of a Two-stage Genome-wide Association Study for Racing Performance of 1,156 Thoroughbreds.

    PubMed

    Shin, Dong-Hyun; Lee, Jin Woo; Park, Jong-Eun; Choi, Ik-Young; Oh, Hee-Seok; Kim, Hyeon Jeong; Kim, Heebal

    2015-06-01

    Thoroughbred, a relatively recent horse breed, is best known for its use in horse racing. Although myostatin (MSTN) variants have been reported to be highly associated with horse racing performance, the trait is more likely to be polygenic in nature. The purpose of this study was to identify genetic variants strongly associated with racing performance by using estimated breeding value (EBV) for race time as a phenotype. We conducted a two-stage genome-wide association study to search for genetic variants associated with the EBV. In the first stage of genome-wide association study, a relatively large number of markers (~54,000 single-nucleotide polymorphisms, SNPs) were evaluated in a small number of samples (240 horses). In the second stage, a relatively small number of markers identified to have large effects (170 SNPs) were evaluated in a much larger number of samples (1,156 horses). We also validated the SNPs related to MSTN known to have large effects on racing performance and found significant associations in the stage two analysis, but not in stage one. We identified 28 significant SNPs related to 17 genes. Among these, six genes have a function related to myogenesis and five genes are involved in muscle maintenance. To our knowledge, these genes are newly reported for the genetic association with racing performance of Thoroughbreds. It complements a recent horse genome-wide association studies of racing performance that identified other SNPs and genes as the most significant variants. These results will help to expand our knowledge of the polygenic nature of racing performance in Thoroughbreds.

  2. Identification of MicroRNAs and Their Target Genes Related to the Accumulation of Anthocyanins in Litchi chinensis by High-Throughput Sequencing and Degradome Analysis

    PubMed Central

    Liu, Rui; Lai, Biao; Hu, Bing; Qin, Yonghua; Hu, Guibing; Zhao, Jietang

    2017-01-01

    Litchi (Litchi chinensis Sonn.) is an important subtropical fruit in southern China and the fruit pericarp has attractive red skin at maturity, which is provided by anthocyanins accumulation. To understand the anthocyanin biosynthesis at post-transcriptional level, we investigated the roles of microRNAs (miRNAs) during fruit coloring. In the present study, four small RNA libraries and a mixed degradome library from pericarps of ‘Feizixiao’ litchi at different developmental phases were constructed and sequenced by Solexa technology. A total of 78 conserved miRNAs belonging to 35 miRNA families and 41 novel miRNAs were identified via high-throughput sequencing, and 129 genes were identified as their targets by the recently developed degradome sequencing. miR156a and a novel microRNA (NEW41) were found to be differentially expressed during fruit coloring, indicating they might affect anthocyanin biosynthesis through their target genes in litchi. qRT-PCR analysis confirmed the expression changes of miR156a and the novel microRNA (NEW41) were inversely correlated with the expression profiles of their target genes LcSPL1/2 and LcCHI, respectively, suggesting regulatory roles of these miRNAs during anthocyanin biosynthesis. The target genes of miR156a, LcSPL1/2, encode transcription factors, as evidenced by a localization in the nucleus, that might play roles in the regulation of transcription. To further explore the relationship of LcSPL1/2 with the anthocyanin regulatory genes, yeast two-hybrid and BiFC analyses showed that LcSPL1 proteins could interact with LcMYB1, which is the key regulatory gene in anthocyanin biosynthesis in litchi. This study represents a comprehensive expression profiling of miRNAs in anthocyanin biosynthesis during litchi fruit maturity and confirmed that the miR156- SPLs module was conserved in anthocyanin biosynthesis in litchi. PMID:28119728

  3. Analysis of Sensitive CO2 Pathways and Genes Related to Carbon Uptake and Accumulation in Chlamydomonas reinhardtii through Genomic Scale Modeling and Experimental Validation

    PubMed Central

    Winck, Flavia V.; Melo, David O. Páez; Riaño-Pachón, Diego M.; Martins, Marina C. M.; Caldana, Camila; Barrios, Andrés F. González

    2016-01-01

    The development of microalgae sustainable applications needs better understanding of microalgae biology. Moreover, how cells coordinate their metabolism toward biomass accumulation is not fully understood. In this present study, flux balance analysis (FBA) was performed to identify sensitive metabolic pathways of Chlamydomonas reinhardtii under varied CO2 inputs. The metabolic network model of Chlamydomonas was updated based on the genome annotation data and sensitivity analysis revealed CO2 sensitive reactions. Biological experiments were performed with cells cultivated at 0.04% (air), 2.5, 5, 8, and 10% CO2 concentration under controlled conditions and cell growth profiles and biomass content were measured. Pigments, lipids, proteins, and starch were further quantified for the reference low (0.04%) and high (10%) CO2 conditions. The expression level of candidate genes of sensitive reactions was measured and validated by quantitative real time PCR. The sensitive analysis revealed mitochondrial compartment as the major affected by changes on the CO2 concentrations and glycolysis/gluconeogenesis, glyoxylate, and dicarboxylate metabolism among the affected metabolic pathways. Genes coding for glycerate kinase (GLYK), glycine cleavage system, H-protein (GCSH), NAD-dependent malate dehydrogenase (MDH3), low-CO2 inducible protein A (LCIA), carbonic anhydrase 5 (CAH5), E1 component, alpha subunit (PDC3), dual function alcohol dehydrogenase/acetaldehyde dehydrogenase (ADH1), and phosphoglucomutase (GPM2), were defined, among other genes, as sensitive nodes in the metabolic network simulations. These genes were experimentally responsive to the changes in the carbon fluxes in the system. We performed metabolomics analysis using mass spectrometry validating the modulation of carbon dioxide responsive pathways and metabolites. The changes on CO2 levels mostly affected the metabolism of amino acids found in the photorespiration pathway. Our updated metabolic network was

  4. Acute exposure to high-fat diets increases hepatic expression of genes related to cell repair and remodeling in female rats.

    PubMed

    Miller, Colette N; Morton, Heidi P; Cooney, Paula T; Winters, Tricia G; Ramseur, Keshia R; Rayalam, Srujana; Della-Fera, Mary Anne; Baile, Clifton A; Brown, Lynda M

    2014-01-01

    High-fat diets (HFD) promote the development of both obesity and fatty liver disease through the up-regulation of hepatic lipogenesis. Insulin resistance, a hallmark of both conditions, causes dysfunctional fuel partitioning and increases in lipogenesis. Recent work has demonstrated that systemic insulin resistance occurs in as little as the first 72 hours of an HFD, suggesting the potential for hepatic disruption with HFD at this time point. The current study sought to determine differences in expression of lipogenic genes between sexes in 3-month-old male and female Long-Evans rats after 72 hours of a 40% HFD or a 17% fat (chow) diet. Owing to the response of estrogen on hepatic signaling, we hypothesized that a sexual dimorphic response would occur in the expression of lipogenic enzymes, inflammatory cytokines, apoptotic, and cell repair and remodeling genes. Both sexes consumed more energy when fed an HFD compared with their low fat-fed controls. However, only the males fed the HFD had a significant increase in body fat. Regardless of sex, HFD caused down-regulation of lipogenic and inflammatory genes. Interestingly, females fed an HFD had up-regulated expression of apoptotic and cell repair-related genes compared with the males. This may suggest that females are more responsive to the acute hepatic injury effects caused by HFDs. In summary, neither male nor female rats displayed disrupted hepatic metabolic pathways after 72 hours of the HFD treatment. In addition, female rats appear to have protection from increases in fat deposition, possibly due to increased caloric expenditure; male rats fed an HFD were less active, as demonstrated by distance traveled in their home cage.

  5. Analysis of Sensitive CO2 Pathways and Genes Related to Carbon Uptake and Accumulation in Chlamydomonas reinhardtii through Genomic Scale Modeling and Experimental Validation.

    PubMed

    Winck, Flavia V; Melo, David O Páez; Riaño-Pachón, Diego M; Martins, Marina C M; Caldana, Camila; Barrios, Andrés F González

    2016-01-01

    The development of microalgae sustainable applications needs better understanding of microalgae biology. Moreover, how cells coordinate their metabolism toward biomass accumulation is not fully understood. In this present study, flux balance analysis (FBA) was performed to identify sensitive metabolic pathways of Chlamydomonas reinhardtii under varied CO2 inputs. The metabolic network model of Chlamydomonas was updated based on the genome annotation data and sensitivity analysis revealed CO2 sensitive reactions. Biological experiments were performed with cells cultivated at 0.04% (air), 2.5, 5, 8, and 10% CO2 concentration under controlled conditions and cell growth profiles and biomass content were measured. Pigments, lipids, proteins, and starch were further quantified for the reference low (0.04%) and high (10%) CO2 conditions. The expression level of candidate genes of sensitive reactions was measured and validated by quantitative real time PCR. The sensitive analysis revealed mitochondrial compartment as the major affected by changes on the CO2 concentrations and glycolysis/gluconeogenesis, glyoxylate, and dicarboxylate metabolism among the affected metabolic pathways. Genes coding for glycerate kinase (GLYK), glycine cleavage system, H-protein (GCSH), NAD-dependent malate dehydrogenase (MDH3), low-CO2 inducible protein A (LCIA), carbonic anhydrase 5 (CAH5), E1 component, alpha subunit (PDC3), dual function alcohol dehydrogenase/acetaldehyde dehydrogenase (ADH1), and phosphoglucomutase (GPM2), were defined, among other genes, as sensitive nodes in the metabolic network simulations. These genes were experimentally responsive to the changes in the carbon fluxes in the system. We performed metabolomics analysis using mass spectrometry validating the modulation of carbon dioxide responsive pathways and metabolites. The changes on CO2 levels mostly affected the metabolism of amino acids found in the photorespiration pathway. Our updated metabolic network was

  6. Effects of BPA and E2 on expression profiles of genes related to hypothalamic-pituitary-gonadal axis of half-smooth tongue sole Cynoglossus semilaevis

    NASA Astrophysics Data System (ADS)

    Li, Fengling; Li, Zhaoxin; Wang, Qingyin; Zhai, Yuxiu

    2013-05-01

    Endocrine disrupting chemicals (EDCs) are increasingly viewed as persistent pollutants, similar to natural hormones in function. This paper describes the expression profiles of 7 genes ( DMRT, VTG GnRHR FSHR CYP17A CYP19A, and CYP19B) involved in sex steroid synthesis and action as well as sexual development in adult male and female Cynoglossus semilaevis, after exposure to different concentrations of Bisphenol A (BPA) and 17β-estradiol (E2). Both BPA (1, 10, 50, 125, and 250 mg/kg) and E2 (0.5, 5, and 10 mg/kg) induced changes in target gene expression, although the estrogenic effects of E2 as a model estrogen were stronger. Among the 7 genes, VTG CYP17A and CYP19 responded strongly to BPA or E2 exposure and can thus serve as reference biomarkers for estrogenic EDCs exposure in marine teleosts. These data will provide a window to establish a hypothalamic-pituitary-gonadal model in C. semilaevis to better understand the effect pathways of EDCs.

  7. Transcriptome-Wide Mapping of Pea Seed Ageing Reveals a Pivotal Role for Genes Related to Oxidative Stress and Programmed Cell Death

    PubMed Central

    Colville, Louise; Lorenzo, Oscar; Graeber, Kai; Küster, Helge; Leubner-Metzger, Gerhard; Kranner, Ilse

    2013-01-01

    Understanding of seed ageing, which leads to viability loss during storage, is vital for ex situ plant conservation and agriculture alike. Yet the potential for regulation at the transcriptional level has not been fully investigated. Here, we studied the relationship between seed viability, gene expression and glutathione redox status during artificial ageing of pea (Pisum sativum) seeds. Transcriptome-wide analysis using microarrays was complemented with qRT-PCR analysis of selected genes and a multilevel analysis of the antioxidant glutathione. Partial degradation of DNA and RNA occurred from the onset of artificial ageing at 60% RH and 50°C, and transcriptome profiling showed that the expression of genes associated with programmed cell death, oxidative stress and protein ubiquitination were altered prior to any sign of viability loss. After 25 days of ageing viability started to decline in conjunction with progressively oxidising cellular conditions, as indicated by a shift of the glutathione redox state towards more positive values (>−190 mV). The unravelling of the molecular basis of seed ageing revealed that transcriptome reprogramming is a key component of the ageing process, which influences the progression of programmed cell death and decline in antioxidant capacity that ultimately lead to seed viability loss. PMID:24205239

  8. Transcriptome-wide mapping of pea seed ageing reveals a pivotal role for genes related to oxidative stress and programmed cell death.

    PubMed

    Chen, Hongying; Osuna, Daniel; Colville, Louise; Lorenzo, Oscar; Graeber, Kai; Küster, Helge; Leubner-Metzger, Gerhard; Kranner, Ilse

    2013-01-01

    Understanding of seed ageing, which leads to viability loss during storage, is vital for ex situ plant conservation and agriculture alike. Yet the potential for regulation at the transcriptional level has not been fully investigated. Here, we studied the relationship between seed viability, gene expression and glutathione redox status during artificial ageing of pea (Pisum sativum) seeds. Transcriptome-wide analysis using microarrays was complemented with qRT-PCR analysis of selected genes and a multilevel analysis of the antioxidant glutathione. Partial degradation of DNA and RNA occurred from the onset of artificial ageing at 60% RH and 50°C, and transcriptome profiling showed that the expression of genes associated with programmed cell death, oxidative stress and protein ubiquitination were altered prior to any sign of viability loss. After 25 days of ageing viability started to decline in conjunction with progressively oxidising cellular conditions, as indicated by a shift of the glutathione redox state towards more positive values (>-190 mV). The unravelling of the molecular basis of seed ageing revealed that transcriptome reprogramming is a key component of the ageing process, which influences the progression of programmed cell death and decline in antioxidant capacity that ultimately lead to seed viability loss.

  9. Nitric oxide contributes to cadmium toxicity in Arabidopsis by promoting cadmium accumulation in roots and by up-regulating genes related to iron uptake.

    PubMed

    Besson-Bard, Angélique; Gravot, Antoine; Richaud, Pierre; Auroy, Pascaline; Duc, Céline; Gaymard, Frédéric; Taconnat, Ludivine; Renou, Jean-Pierre; Pugin, Alain; Wendehenne, David

    2009-03-01

    Nitric oxide (NO) functions as a cell-signaling molecule in plants. In particular, a role for NO in the regulation of iron homeostasis and in the plant response to toxic metals has been proposed. Here, we investigated the synthesis and the role of NO in plants exposed to cadmium (Cd(2+)), a nonessential and toxic metal. We demonstrate that Cd(2+) induces NO synthesis in roots and leaves of Arabidopsis (Arabidopsis thaliana) seedlings. This production, which is sensitive to NO synthase inhibitors, does not involve nitrate reductase and AtNOA1 but requires IRT1, encoding a major plasma membrane transporter for iron but also Cd(2+). By analyzing the incidence of NO scavenging or inhibition of its synthesis during Cd(2+) treatment, we demonstrated that NO contributes to Cd(2+)-triggered inhibition of root growth. To understand the mechanisms underlying this process, a microarray analysis was performed in order to identify NO-modulated root genes up- and down-regulated during Cd(2+) treatment. Forty-three genes were identified encoding proteins related to iron homeostasis, proteolysis, nitrogen assimilation/metabolism, and root growth. These genes include IRT1. Investigation of the metal and ion contents in Cd(2+)-treated roots in which NO synthesis was impaired indicates that IRT1 up-regulation by NO was consistently correlated to NO's ability to promote Cd(2+) accumulation in roots. This analysis also highlights that NO is responsible for Cd(2+)-induced inhibition of root Ca(2+) accumulation. Taken together, our results suggest that NO contributes to Cd(2+) toxicity by favoring Cd(2+) versus Ca(2+) uptake and by initiating a cellular pathway resembling those activated upon iron deprivation.

  10. Transcriptome analysis of genes related to resistance against powdery mildew in wheat-Thinopyrum alien addition disomic line germplasm SN6306.

    PubMed

    Li, Quanquan; Niu, Zubiao; Bao, Yinguang; Tian, Qiuju; Wang, Honggang; Kong, Lingrang; Feng, Deshun

    2016-09-15

    Wheat powdery mildew, which is mainly caused by Blumeria graminis f. sp. tritici (Bgt), seriously damages wheat production. The wheat-Thinopyrum intermedium alien addition disomic line germplasm SN6306, being one of the important sources of genes for wheat resistance, is highly resistant to Bgt E09 and to many other powdery mildew physiological races. However, knowledge on the resistance mechanism of SN6306 remains limited. Our study employed high-throughput RNA sequencing based on next-generation sequencing technology (Illumina) to obtain an overview of the transcriptome characteristics of SN6306 and its parent wheat Yannong 15 (YN15) during Bgt infection. The sequencing generated 104,773 unigenes, 9909 of which showed varied expression levels. Among the 9909 unigenes, 1678 unigenes showed 0 reads in YN15. The expression levels in Bgt-inoculated SN6306 and YN15 of exactly 39 unigenes that showed 0 or considerably low reads in YN15 were validated to identify the genes involved in Bgt resistance. Among the 39 unigenes, 12 unigenes were upregulated in SN6306 by 3-45 times. These unigenes mainly encoded kinase, synthase, proteases, and signal transduction proteins, which may play an important role in the resistance against Bgt. To confirm whether the unigenes that showed 0 reads in YN15 are really unique to SN6306, 8 unigenes were cloned and sequenced. Results showed that the selected unigenes are more similar to SN6306 and Th. intermedium than to the wheat cultivar YN15. The sequencing results further confirmed that the unigenes showing 0 reads in YN15 are unique to SN6306 and are most likely derived from Th. intermedium (Host) Nevski. Thus, the genes from Th. intermedium most probably conferred the resistance of SN6306 to Bgt.

  11. Nitric Oxide Contributes to Cadmium Toxicity in Arabidopsis by Promoting Cadmium Accumulation in Roots and by Up-Regulating Genes Related to Iron Uptake1[W

    PubMed Central

    Besson-Bard, Angélique; Gravot, Antoine; Richaud, Pierre; Auroy, Pascaline; Duc, Céline; Gaymard, Frédéric; Taconnat, Ludivine; Renou, Jean-Pierre; Pugin, Alain; Wendehenne, David

    2009-01-01

    Nitric oxide (NO) functions as a cell-signaling molecule in plants. In particular, a role for NO in the regulation of iron homeostasis and in the plant response to toxic metals has been proposed. Here, we investigated the synthesis and the role of NO in plants exposed to cadmium (Cd2+), a nonessential and toxic metal. We demonstrate that Cd2+ induces NO synthesis in roots and leaves of Arabidopsis (Arabidopsis thaliana) seedlings. This production, which is sensitive to NO synthase inhibitors, does not involve nitrate reductase and AtNOA1 but requires IRT1, encoding a major plasma membrane transporter for iron but also Cd2+. By analyzing the incidence of NO scavenging or inhibition of its synthesis during Cd2+ treatment, we demonstrated that NO contributes to Cd2+-triggered inhibition of root growth. To understand the mechanisms underlying this process, a microarray analysis was performed in order to identify NO-modulated root genes up- and down-regulated during Cd2+ treatment. Forty-three genes were identified encoding proteins related to iron homeostasis, proteolysis, nitrogen assimilation/metabolism, and root growth. These genes include IRT1. Investigation of the metal and ion contents in Cd2+-treated roots in which NO synthesis was impaired indicates that IRT1 up-regulation by NO was consistently correlated to NO's ability to promote Cd2+ accumulation in roots. This analysis also highlights that NO is responsible for Cd2+-induced inhibition of root Ca2+ accumulation. Taken together, our results suggest that NO contributes to Cd2+ toxicity by favoring Cd2+ versus Ca2+ uptake and by initiating a cellular pathway resembling those activated upon iron deprivation. PMID:19168643

  12. L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis

    SciTech Connect

    Rozen, R.; Ferreira-Rajabi, L.; Robb, L.

    1995-07-03

    Cystic fibrosis is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Over 400 mutations have been reported at this locus. Although severe forms of cystic fibrosis are usually associated with pancreatic insufficiency, pulmonary dysfunction, and elevated sweat chloride, there is a wide range of phenotypes, including congenital absence of the vas deferens, observed with some of the milder mutations. The L206W mutation, which was first identified in patients from South France, is relatively frequent in French Canadians from Quebec. In this report, we document the atypical form of cystic fibrosis associated with this mutation in a cohort of 7 French Canadian probands. 20 refs.

  13. Matrix-based three-dimensional culture of buffalo mammary epithelial cells showed higher induction of genes related to milk protein and fatty acid metabolism.

    PubMed

    Shandilya, Umesh K; Sharma, Ankita; Sodhi, Monika; Kapila, Neha; Kishore, Amit; Mohanty, Ashok; Kataria, Ranjit; Malakar, Dhruva; Mukesh, Manishi

    2016-02-01

    Demanding transcriptomic studies in livestock animal species could be replaced by good in vitro models mimicking the function of mammary gland. Mammary epithelial cells (MEC) are the functional unit of the mammary gland. Extracellular matrix is known to be a key factor providing normal homeostasis in three-dimensional (3D) environment as important signals are lost when cells are cultured in two-dimensional (2D) environment. The aims of this study were to establish a buffalo mammary epithelial cells (BMECs) in 3D culture using extracellular matrix and to determine whether such a 3D culture model has different expression pattern than 2D counterpart. The purified MEC generated after several passages were used to establish 3D culture using Geltrex matrix. The expression of milk casein genes viz., alpha S1-casein (CSN1S1), alpha S2-casein (CSN1S2), beta-casein (CSN2), kappa-casein (CSN3); and fatty acid metabolism genes viz., butyrophilin (BTN1A1), glycerol-3-phosphate acyltransferase (GPAM), fatty acid-binding protein 3 (FABP3), and stearoyl-CoA desaturase (SCD) was assessed in 3D culture in comparison to traditional monolayer culture using qRT-PCR. Notable morphological differences were observed for BMECs grown in 3D culture in comparison to 2D culture. Morphologically, epithelial structures grown in Geltrex matrix (3D) environment showed enhanced functional differentiation in comparison to 2D culture. In 3D culture, lumen and dome-like structures were formed by day 5, whereas polarized acinus-like structure were formed within 15 days of culturing. The expression data showed higher mRNA induction of milk casein and fatty acid metabolism genes in 10-day-old 3D BMECs culture in comparison to 2D monolayer culture. The result suggests that 3D organization of epithelial cells has favorable effect on induction of milk and fatty acid metabolism-related genes. Therefore, matrix-based 3D culture of MEC that recapitulate the structural and functional context of normal tissues

  14. Abiotic stresses differentially affect the expression of O-methyltransferase genes related to methoxypyrazine biosynthesis in seeded and parthenocarpic fruits of Vitis vinifera (L.).

    PubMed

    Vallarino, José G; Gainza-Cortés, Felipe; Verdugo-Alegría, Claudio; González, Enrique; Moreno, Yerko M

    2014-07-01

    MPs (3-alkyl-2-methoxypyrazines) are grape-derived aroma compounds that are associated with detrimental herbaceous flavours in some wines. It is well known that several viticultural and environmental parameters can modulate MP concentrations in grapes, although comprehensive molecular studies have not been conducted in this field. Although the biosynthesis pathway of MPs has not been fully elucidated, four Vitis vinifera O-methyltransferase genes (VvOMT1-4) have been related to be involved in MP biosynthesis. We assessed whether different abiotic stresses induction have an impact on MP levels in grapes and wines from seeded and parthenocarpic fruits. Our results show that the timing of VvOMT3 expression is associated with the period of MPs accumulation in seeded fruits during both abiotic stresses, whereas no association was found in parthenocarpic fruits. These results are discussed in the context of how different viticultural practices can modulate VvOMT gene expression, which has a direct impact on MPs levels in wines.

  15. Identification of a single nucleotide promoter polymorphism regulating the transcription of ubiquitin specific protease 18 gene related to the resistance to porcine reproductive and respiratory syndrome virus infection.

    PubMed

    Li, Yanping; Sun, Yi; Xing, Feng; Kang, Li; Wang, Pengfei; Wang, Liyuan; Liu, Hao; Li, Yi; Jiang, Yunliang

    2014-12-15

    Porcine reproductive and respiratory syndrome (PRRS), characterized by reproductive failure in sows and respiratory disease and mortality in piglets, is a major infectious disease that causes great economic loss throughout the world. Previous studies revealed that the overexpression of porcine ubiquitin specific protease 18 (USP18) gene inhibits PRRSV replication in vitro. The objective of this study is to compare the promoter activity of USP18 in Chinese indigenous Dapulian (DPL) pigs and Duroc×Landrace×Yorkshire (DLY) commercial pigs and screen single nucleotide polymorphism (SNP) affecting porcine USP18 transcription. We found that the promoter activity was significantly higher in DPL pigs than DLY commercial pigs (p<0.05), deletion of the promoter from -1790 to -1314bp decreased the transcriptional activity by roughly 60% (p<0.05) and a SNP G-1533A in this region increased the mRNA expression both prior to and post PRRSV infection in MARC-145 cells. Population genetics analysis showed that allele A was only detected in Chinese pig breeds which are generally resistant to PRRSV. These results suggest that the SNP G-1533A polymorphism in the promoter region of porcine USP18 gene is a potential DNA marker for the resistance to PRRSV.

  16. A Case of Transforming Growth Factor-β-Induced Gene-Related Oculorenal Syndrome: Granular Corneal Dystrophy Type II with a Unique Nephropathy

    PubMed Central

    Iwafuchi, Yoichi; Morioka, Tetsuo; Oyama, Yuko; Nozu, Kandai; Iijima, Kazumoto; Narita, Ichiei

    2016-01-01

    Many types of inherited renal diseases have ocular features that occasionally support a diagnosis. The following study describes an unusual example of a 40-year-old woman with granular corneal dystrophy type II complicated by renal involvement. These two conditions may coincidentally coexist; however, there are some reports that demonstrate an association between renal involvement and granular corneal dystrophy type II. Granular corneal dystrophy type II is caused by a mutation in the transforming growth factor-β-induced (TGFBI) gene. The patient was referred to us because of the presence of mild proteinuria without hematuria that was subsequently suggested to be granular corneal dystrophy type II. A kidney biopsy revealed various glomerular and tubular basement membrane changes and widening of the subendothelial space of the glomerular basement membrane by electron microscopy. However, next-generation sequencing revealed that she had no mutation in a gene that is known to be associated with monogenic kidney diseases. Conversely, real-time polymerase chain reaction, using a simple buccal swab, revealed TGFBI heteromutation (R124H). The TGFBI protein plays an important role in cell-collagen signaling interactions, including extracellular matrix proteins which compose the renal basement membrane. This mutation can present not only as corneal dystrophy but also as renal disease. TGFBI-related oculorenal syndrome may have been unrecognized. It is difficult to diagnose this condition without renal electron microscopic studies. To the best of our knowledge, this is the first detailed report of nephropathy associated with a TGFBI mutation. PMID:27781206

  17. Mutation in TOR1AIP1 encoding LAP1B in a form of muscular dystrophy: a novel gene related to nuclear envelopathies.

    PubMed

    Kayman-Kurekci, Gulsum; Talim, Beril; Korkusuz, Petek; Sayar, Nilufer; Sarioglu, Turkan; Oncel, Ibrahim; Sharafi, Parisa; Gundesli, Hulya; Balci-Hayta, Burcu; Purali, Nuhan; Serdaroglu-Oflazer, Piraye; Topaloglu, Haluk; Dincer, Pervin

    2014-07-01

    We performed genome-wide homozygosity mapping and mapped a novel myopathic phenotype to chromosomal region 1q25 in a consanguineous family with three affected individuals manifesting proximal and distal weakness and atrophy, rigid spine and contractures of the proximal and distal interphalangeal hand joints. Additionally, cardiomyopathy and respiratory involvement were noted. DNA sequencing of torsinA-interacting protein 1 (TOR1AIP1) gene encoding lamina-associated polypeptide 1B (LAP1B), showed a homozygous c.186delG mutation that causes a frameshift resulting in a premature stop codon (p.E62fsTer25). We observed that expression of LAP1B was absent in the patient skeletal muscle fibres. Ultrastructural examination showed intact sarcomeric organization but alterations of the nuclear envelope including nuclear fragmentation, chromatin bleb formation and naked chromatin. LAP1B is a type-2 integral membrane protein localized in the inner nuclear membrane that binds to both A- and B-type lamins, and is involved in the regulation of torsinA ATPase. Interestingly, luminal domain-like LAP1 (LULL1)-an endoplasmic reticulum-localized partner of torsinA-was overexpressed in the patient's muscle in the absence of LAP1B. Therefore, the findings suggest that LAP1 and LULL1 might have a compensatory effect on each other. This study expands the spectrum of genes associated with nuclear envelopathies and highlights the critical function for LAP1B in striated muscle.

  18. Polymorphisms in metabolic genes related to tobacco smoke and the risk of gastric cancer in the European prospective investigation into cancer and nutrition.

    PubMed

    Agudo, Antonio; Sala, Núria; Pera, Guillem; Capellá, Gabriel; Berenguer, Antonio; García, Nadia; Palli, Domenico; Boeing, Heiner; Del Giudice, Giuseppe; Saieva, Calogero; Carneiro, Fatima; Berrino, Franco; Sacerdote, Carlotta; Tumino, Rosario; Panico, Salvatore; Berglund, Göran; Simán, Henrik; Stenling, Roger; Hallmans, Göran; Martínez, Carmen; Bilbao, Roberto; Barricarte, Aurelio; Navarro, Carmen; Quirós, José R; Allen, Naomi; Key, Tim; Bingham, Sheila; Khaw, Kay-Tee; Linseisen, Jakob; Nagel, Gabriele; Overvad, Kim; Tjonneland, Anne; Olsen, Anja; Bueno-de-Mesquita, H Bas; Boshuizen, Hendriek C; Peeters, Petra H; Numans, Mattijs E; Clavel-Chapelon, Françoise; Boutron-Ruault, Marie-Christine; Trichopoulou, Antonia; Lund, Eiliv; Offerhaus, Johan; Jenab, Mazda; Ferrari, Pietro; Norat, Teresa; Riboli, Elio; González, Carlos A

    2006-12-01

    Metabolizing enzymes, which often display genetic polymorphisms, are involved in the activation of compounds present in tobacco smoke that may be relevant to gastric carcinogenesis. We report the results of a study looking at the association between risk of gastric adenocarcinoma and polymorphisms in genes CYP1A1, CYP1A2, EPHX1, and GSTT1. A nested case-control study was carried out within the European Prospective Investigation into Cancer and Nutrition, developed in 10 European countries. The study includes 243 newly diagnosed cases of histologically confirmed gastric adenocarcinoma and 946 controls matched by center, age, sex, and date of blood collection. Genotypes were determined in nuclear DNA from WBCs. We found an increased risk of gastric cancer for homozygotes for C (histidine) variant in Y113H of EPHX1 (odds ratio, 1.91; 95% confidence interval, 1.19-3.07) compared with subjects with TC/TT. There was also a significant increased risk for smokers carrying at least one variant allele A in Ex7+129C>A (m4) of CYP1A1 and never smokers with null GSTT1 and allele A in the locus -3859G>A of CYP1A2. Most of these genes are involved in the activation and detoxification of polycyclic aromatic hydrocarbons, suggesting a potential role of these compounds in gastric carcinogenesis.

  19. Occurrence of Mutations in the Antimicrobial Target Genes Related to Levofloxacin, Clarithromycin, and Amoxicillin Resistance in Helicobacter pylori Isolates from Buenos Aires City.

    PubMed

    Zerbetto De Palma, Gerardo; Mendiondo, Nicolas; Wonaga, Andrés; Viola, Luis; Ibarra, Daniela; Campitelli, Esteban; Salim, Nicolas; Corti, Rodolfo; Goldman, Cinthia; Catalano, Mariana

    2017-04-01

    Domain V of 23S rRNA, gyrA and gyrB Quinolones Resistance-Determining Region (QRDR), and pbp-1A gene point mutations were investigated in Helicobacter pylori-resistant isolates from three centres of Buenos Aires. Minimal inhibitory concentrations (MICs) were performed in 197 isolates from 52 H. pylori-positive naive patients by agar dilution method. Point mutations were achieved by amplification and sequencing of the target genes, and their association with resistance was determined by natural transformation assays. Resistance rates were as follows: metronidazole 28.8%, clarithromycin (CLA) 26.9%, levofloxacin (LEV) 32.7%, and amoxicillin (AMX) 7.6%. Nearly one-third of patients carried multidrug-resistant isolates. A2143G or A2142G in domain V of 23S-rRNA was found in all isolates showing high level of resistance to CLA (MIC >2 mg/L), accounting for 76.0% (38/50) of those with the resistant phenotype. The mutations A2267G or T1861C carried by 8/12 isolates with MIC 1-2 mg/L (low level) did not confer resistance by transformation. Substitutions at GyrA position 87 or 91, mainly N87K and D91G, were found in 92.8% (52/56) of the LEV-resistant isolates: 48 isolates with MIC 4-64 mg/L and 4/8 isolates with MIC 2 mg/L. The remaining four harboured K133N, also present in susceptible isolates. None of the substitutions in GyrB demonstrated to confer resistance. Transformation proved that PBP-1A N562Y and/or T556S substitutions confer the AMX resistance in our isolates, showing an additive effect. In conclusion, the usually reported mutations related to CLA, LEV, and AMX resistance were found in our isolates. However, low-level CLA resistance seems not to be due to mutations in Domain V of 23S rRNA gene.

  20. Transcriptome Analysis for Identification of Genes Related to Gonad Differentiation, Growth, Immune Response and Marker Discovery in The Turbot (Scophthalmus maximus)

    PubMed Central

    Ma, Deyou; Ma, Aijun; Huang, Zhihui; Wang, Guangning; Wang, Ting; Xia, Dandan; Ma, Benhe

    2016-01-01

    Background Turbot Scophthalmus maximus is an economically important species extensively aquacultured in China. The genetic selection program is necessary and urgent for the sustainable development of this industry, requiring more and more genome background knowledge. Transcriptome sequencing is an excellent alternative way to identify transcripts involved in specific biological processes and exploit a considerable quantity of molecular makers when no genome sequences are available. In this study, a comprehensive transcript dataset for major tissues of S. maximus was produced on basis of an Illumina platform. Results Total RNA was isolated from liver, spleen, kidney, cerebrum, gonad (testis and ovary) and muscle. Equal quantities of RNA from each type of tissues were pooled to construct two cDNA libraries (male and female). Using the Illumina paired-end sequencing technology, nearly 44.22 million clean reads in length of 100 bp were generated and then assembled into 106,643 contigs, of which 71,107 were named unigenes with an average length of 892 bp after the elimination of redundancies. Of these, 24,052 unigenes (33.83% of the total) were successfully annotated. GO, KEGG pathway mapping and COG analysis were performed to predict potential genes and their functions. Based on our sequence analysis and published documents, many candidate genes with fundamental roles in sex determination and gonad differentiation (dmrt1), growth (ghrh, myf5, prl/prlr) and immune response (TLR1/TLR21/TLR22, IL-15/IL-34), were identified for the first time in this species. In addition, a large number of credible genetic markers, including 21,192 SSRs and 8,642 SNPs, were identified in the present dataset. Conclusion This informative transcriptome provides valuable new data to increase genomic resources of Scophthalmus maximus. The future studies of corresponding gene functions will be very useful for the management of reproduction, growth and disease control in turbot aquaculture

  1. Association between individual and combined SNPs in genes related to innate immunity and incidence of CMV infection in seropositive kidney transplant recipients.

    PubMed

    Fernández-Ruiz, M; Corrales, I; Arias, M; Campistol, J M; Giménez, E; Crespo, J; López-Oliva, M O; Beneyto, I; Martín-Moreno, P L; Llamas-Fuente, F; Gutiérrez, A; García-Álvarez, T; Guerra-Rodríguez, R; Calvo, N; Fernández-Rodríguez, A; Tabernero-Romo, J M; Navarro, M D; Ramos-Verde, A; Aguado, J M; Navarro, D

    2015-05-01

    In this study, we assessed the association between single-nucleotide polymorphisms (SNPs) in seven candidate genes involved in orchestrating the immune response against cytomegalovirus (CMV) and the 12-month incidence of CMV infection in 315 CMV-seropositive kidney transplant (KT) recipients. Patients were managed either by antiviral prophylaxis or preemptive therapy. CMV infection occurred in 140 patients (44.4%), including 13 episodes of disease. After adjusting for various clinical covariates, patients harboring T-allele genotypes of interleukin-28B (IL28B) (rs12979860) SNP had lower incidence of CMV infection (adjusted hazard ratio [aHR]: 0.66; 95% confidence interval [CI]: 0.46-0.96; p-value = 0.029). In the analysis restricted to patients not receiving prophylaxis, carriers of the TT genotype of toll-like receptor 9 (TLR9) (rs5743836) SNP had lower incidence of infection (aHR: 0.61; 95% CI: 0.38-0.96; p-value = 0.035), whereas the GG genotype of dendritic cell-specific ICAM 3-grabbing nonintegrin (DC-SIGN) (rs735240) SNP exerted the opposite effect (aHR: 1.86; 95% CI: 1.18-2.94; p-value = 0.008). An independent association was found between the number of unfavorable SNP genotypes carried by the patient and the incidence of CMV infection. In conclusion, specific SNPs in IL28B, TLR9 and DC-SIGN genes may play a role in modulating the susceptibility to CMV infection in CMV-seropositive KT recipients.

  2. A pilot study examining the impact of exercise training on skeletal muscle genes related to the TLR signaling pathway in older adults following hip fracture recovery.

    PubMed

    McKenzie, Alec I; Briggs, Robert A; Barrows, Katherine M; Nelson, Daniel S; Kwon, Oh Sung; Hopkins, Paul N; Higgins, Thomas F; Marcus, Robin L; Drummond, Micah J

    2017-01-01

    Older adults after hip fracture surgery experience progressive muscle atrophy and weakness, limiting full recovery. Further understanding of the molecular mechanisms in muscle with adaptation to exercise training in this vulnerable population is necessary. Therefore, we conducted a pilot study to investigate the skeletal muscle inflammatory and ceramide biosynthesis gene expression levels associated with the toll-like receptor (TLR) pathway before (Pre) and following a 3-mo multicomponent exercise training program in older adults (3M, 4F; 78.4 ± 13.3 yr; 25.5 ± 2.3 kg/m(2)) ~4 mo after repair from hip fracture (HipFx). Vastus lateralis biopsies from the surgical limb were obtained before (Pre) and after training. Molecular end points and muscle function data were also compared with matched nonexercise healthy controls (CON). As a follow-up analysis, we evaluated specific sphingolipid pools in HipFx and CON muscle. Following training, quadriceps cross-sectional area, strength, and 6-min walk (6MW) increased in the surgical limb (P < 0.05). Additionally, MYD88, TAK1, NFKB1, IL6, SPT2, and CERS1 gene expression decreased after training (P ≤ 0.05), but some remained elevated above CON levels. Interestingly, MYD88 mRNA was inversely correlated to quadriceps CSA, strength, and 6MW. Finally, muscle dihydroceramides and phosphoceramides in HipFx were lower than CON at Pre (P ≤ 0.05), but after training differences from CON were removed. Together, our pilot data support that exercise training alters skeletal muscle inflammation and ceramide metabolism associated with TLR signaling in older adults recovering from hip fracture surgery and may be related to improvements in muscle function recovery.

  3. Identification and Comparative Study of Chemosensory Genes Related to Host Selection by Legs Transcriptome Analysis in the Tea Geometrid Ectropis obliqua

    PubMed Central

    Bian, Lei; Cai, Xiao-Ming; Luo, Zong-Xiu; Zhang, Yong-Jun; Chen, Zong-Mao

    2016-01-01

    Host selection by female moths is fundamental to the survival of their larvae. Detecting and perceiving the non-volatile chemicals of the plant surface involved in gustatory detection determine the host preference. In many lepidopteran species, tarsal chemosensilla are sensitive to non-volatile chemicals and responsible for taste detection. The tea geometrid Ectropis obliqua is one devastating chewing pest selectively feeding on limited plants, requiring the specialized sensors to forage certain host for oviposition. In present study, we revealed the distribution of chemosensilla in the ventral side of female fifth tarsomere in E. obliqua. To investigate its molecular mechanism of gustatory perception, we performed HiSeq 2500 sequencing of the male- and female- legs transcriptome and identified 24 candidate odorant binding proteins (OBPs), 21 chemosensory proteins (CSPs), 2 sensory neuron membrane proteins (SNMPs), 3 gustatory receptors (GRs) and 4 odorant receptors (ORs). Several leg-specific or enriched chemosensory genes were screened by tissue expression analysis, and clustered with functionally validated genes from other moths, suggesting the potential involvement in taste sensation or other physiological processes. The RPKM value analysis revealed that 9 EoblOBPs showed sex discrepancy in the leg expression, 8 being up-regulated in female and only 1 being over expressed in male. These female-biased EoblOBPs indicated an ecological adaption related with host-seeking and oviposition behaviors. Our work will provide basic knowledge for further studies on the molecular mechanism of gustatory perception, and enlighten a host-selection-based control strategy of insect pests. PMID:26930056

  4. Identification and Comparative Study of Chemosensory Genes Related to Host Selection by Legs Transcriptome Analysis in the Tea Geometrid Ectropis obliqua.

    PubMed

    Ma, Long; Li, Zhao-Qun; Bian, Lei; Cai, Xiao-Ming; Luo, Zong-Xiu; Zhang, Yong-Jun; Chen, Zong-Mao

    2016-01-01

    Host selection by female moths is fundamental to the survival of their larvae. Detecting and perceiving the non-volatile chemicals of the plant surface involved in gustatory detection determine the host preference. In many lepidopteran species, tarsal chemosensilla are sensitive to non-volatile chemicals and responsible for taste detection. The tea geometrid Ectropis obliqua is one devastating chewing pest selectively feeding on limited plants, requiring the specialized sensors to forage certain host for oviposition. In present study, we revealed the distribution of chemosensilla in the ventral side of female fifth tarsomere in E. obliqua. To investigate its molecular mechanism of gustatory perception, we performed HiSeq 2500 sequencing of the male- and female- legs transcriptome and identified 24 candidate odorant binding proteins (OBPs), 21 chemosensory proteins (CSPs), 2 sensory neuron membrane proteins (SNMPs), 3 gustatory receptors (GRs) and 4 odorant receptors (ORs). Several leg-specific or enriched chemosensory genes were screened by tissue expression analysis, and clustered with functionally validated genes from other moths, suggesting the potential involvement in taste sensation or other physiological processes. The RPKM value analysis revealed that 9 EoblOBPs showed sex discrepancy in the leg expression, 8 being up-regulated in female and only 1 being over expressed in male. These female-biased EoblOBPs indicated an ecological adaption related with host-seeking and oviposition behaviors. Our work will provide basic knowledge for further studies on the molecular mechanism of gustatory perception, and enlighten a host-selection-based control strategy of insect pests.

  5. Heavy metals in wild house mice from coal-mining areas of Colombia and expression of genes related to oxidative stress, DNA damage and exposure to metals.

    PubMed

    Guerrero-Castilla, Angélica; Olivero-Verbel, Jesús; Marrugo-Negrete, José

    2014-03-01

    Coal mining is a source of pollutants that impact on environmental and human health. This study examined the metal content and the transcriptional status of gene markers associated with oxidative stress, metal transport and DNA damage in livers of feral mice collected near coal-mining operations, in comparison with mice obtained from a reference site. Mus musculus specimens were caught from La Loma and La Jagua, two coal-mining sites in the north of Colombia, as well as from Valledupar (Cesar Department), a city located 100km north of the mines. Concentrations in liver tissue of Hg, Zn, Pb, Cd, Cu and As were determined by differential stripping voltammetry, and real-time PCR was used to measure gene expression. Compared with the reference group (Valledupar), hepatic concentrations of Cd, Cu and Zn were significantly higher in animals living near mining areas. In exposed animals, the mRNA expression of NQ01, MT1, SOD1, MT2, and DDIT3 was 4.2-, 7.3-, 2.5-, 4.6- and 3.4-fold greater in coal mining sites, respectively, than in animals from the reference site (p<0.05). These results suggest that activities related to coal mining may generate pollutants that could affect the biota, inducing the transcription of biochemical markers related to oxidative stress, metal exposure, and DNA damage. These changes may be in part linked to metal toxicity, and could have implications for the development of chronic disease. Therefore, it is essential to implement preventive measures to minimize the effects of coal mining on its nearby environment, in order to protect human health.

  6. Effects of low-level laser therapy on the expression of osteogenic genes related in the initial stages of bone defects in rats

    NASA Astrophysics Data System (ADS)

    Fernandes, Kelly Rossetti; Ribeiro, Daniel Araki; Rodrigues, Natália Camargo; Tim, Carla; Santos, Anderson Amaro; Parizotto, Nivaldo Antônio; de Araujo, Heloisa Selistre; Driusso, Patrícia; Rennó, Ana Claudia Muniz

    2013-03-01

    We evaluate the effects of low-level laser therapy (LLLT) on the histological modifications and temporal osteogenic genes expression during the initial phase of bone healing in a model of bone defect in rats. Sixty-four Wistar rats were divided into control and treated groups. Noncritical size bone defects were surgically created at the upper third of the tibia. Laser irradiation (Ga-Al-As laser 830 nm, 30 mW, 0.028 cm2, 1.071 W/cm2, 1 min and 34 s, 2.8 Joules, 100 J/cm2) was performed for 1, 2, 3, and 5 sessions. Histopathology revealed that treated animals presented higher inflammatory cells recruitment, especially 12 and 36 h postsurgery. Also, a better tissue organization at the site of the injury, with the presence of granulation tissue and new bone formation was observed on days three and five postsurgery in the treated animals. The quantitative real time polymerase chain reaction showed that LLLT produced a significantly increase in mRNA expression of Runx-2, 12 h and three days post-surgery, a significant upregulation of alkaline phosphatase mRNA expression after 36 h and three days post-surgery and a significant increase of osteocalcin mRNA expression after three and five days. We concluded that LLLT modulated the inflammatory process and accelerated bone repair, and this advanced repair pattern in the laser-treated groups may be related to the higher mRNA expression of genes presented by these animals.

  7. Variation in the TAS2R31 bitter taste receptor gene relates to liking for the nonnutritive sweetener Acesulfame-K among children and adults

    PubMed Central

    Bobowski, Nuala; Reed, Danielle R.; Mennella, Julie A.

    2016-01-01

    The nonnutritive sweetener (NNS) acesulfame potassium (Ace-K) elicits a bitter off-taste that varies among adults due to polymorphisms in a bitter taste receptor gene. Whether polymorphisms affect liking for Ace-K by children, who live in different sensory worlds, is unknown. We examined hedonic response to Ace-K among children compared to adults, and whether response was related to common variants of the TAS2R31 bitter taste receptor gene and to NNS intake. Children (N = 48) and their mothers (N = 34) rated liking of Ace-K, and mothers reported whether they or their children ever consume NNSs via questionnaire. Participants were genotyped for TAS2R31 variant sites associated with adult perception of Ace-K (R35W, L162M, A227V, and V240I). Regardless of age, more participants with 1 or no copies than with 2 copies of the TAS2R31 WMVI haplotype liked Ace-K (p = 0.01). NNS-sweetened products were consumed by 50% and 15% of mothers and children, respectively, with no association between intake and TAS2R31. The TAS2R31 WMVI haplotype was partly responsible for children’s hedonic response to Ace-K, highlighting a potential role for inborn differences in vulnerability to overconsumption of Ace-K-containing products. Currently available methods to measure NNS intake yield crude estimates at best, suggesting self-reports are not reflective of actual intake. PMID:27966661

  8. Global Proteome Response to Deletion of Genes Related to Mercury Methylation and Dissimilatory Metal Reduction Reveals Changes in Respiratory Metabolism in Geobacter sulfurreducens PCA

    SciTech Connect

    Qian, Chen; Johs, Alexander; Chen, Hongmei; Mann, Benjamin F.; Lu, Xia; Abraham, Paul E.; Hettich, Robert L.; Gu, Baohua

    2016-07-27

    Geobacter sulfurreducens PCA can reduce, sorb, and methylate mercury (Hg); however, the underlying biochemical mechanisms of these processes and interdependent metabolic pathways remain unknown. In this study, shotgun proteomics was used to compare global proteome profiles between wild-type G. sulfurreducens PCA and two mutant strains: a ΔhgcAB mutant, which is deficient in two genes known to be essential for Hg methylation and a ΔomcBESTZ mutant, which is deficient in five outer membrane c-type cytochromes and thus impaired in its ability for dissimilatory metal ion reduction. We were able to delineate the global response of G. sulfurreducens PCA in both mutants and identify cellular networks and metabolic pathways that were affected by the loss of these genes. Deletion of hgcAB increased the relative abundances of proteins implicated in extracellular electron transfer, including most of the c-type cytochromes, PilA-C, and OmpB, and is consistent with a previously observed increase in Hg reduction in the hgcAB mutant. Deletion of omcBESTZ was found to significantly increase relative abundances of various methyltransferases, suggesting that a loss of dissimilatory reduction capacity results in elevated activity among one-carbon metabolic pathways and thus increased methylation. We show that G. sulfurreducens PCA encodes only the folate branch of the Wood Ljungdahl pathway, and proteins associated with the folate branch were found at lower abundance in the ΔhgcAB mutant strain than the wild type. In conclusion, this observation supports the hypothesis that the function of HgcA and HgcB may be linked to one carbon metabolism through the folate branch of the Wood-Ljungdahl pathway by providing methyl groups required for Hg methylation.

  9. Global Proteome Response to Deletion of Genes Related to Mercury Methylation and Dissimilatory Metal Reduction Reveals Changes in Respiratory Metabolism in Geobacter sulfurreducens PCA

    DOE PAGES

    Qian, Chen; Johs, Alexander; Chen, Hongmei; ...

    2016-07-27

    Geobacter sulfurreducens PCA can reduce, sorb, and methylate mercury (Hg); however, the underlying biochemical mechanisms of these processes and interdependent metabolic pathways remain unknown. In this study, shotgun proteomics was used to compare global proteome profiles between wild-type G. sulfurreducens PCA and two mutant strains: a ΔhgcAB mutant, which is deficient in two genes known to be essential for Hg methylation and a ΔomcBESTZ mutant, which is deficient in five outer membrane c-type cytochromes and thus impaired in its ability for dissimilatory metal ion reduction. We were able to delineate the global response of G. sulfurreducens PCA in both mutantsmore » and identify cellular networks and metabolic pathways that were affected by the loss of these genes. Deletion of hgcAB increased the relative abundances of proteins implicated in extracellular electron transfer, including most of the c-type cytochromes, PilA-C, and OmpB, and is consistent with a previously observed increase in Hg reduction in the hgcAB mutant. Deletion of omcBESTZ was found to significantly increase relative abundances of various methyltransferases, suggesting that a loss of dissimilatory reduction capacity results in elevated activity among one-carbon metabolic pathways and thus increased methylation. We show that G. sulfurreducens PCA encodes only the folate branch of the Wood Ljungdahl pathway, and proteins associated with the folate branch were found at lower abundance in the ΔhgcAB mutant strain than the wild type. In conclusion, this observation supports the hypothesis that the function of HgcA and HgcB may be linked to one carbon metabolism through the folate branch of the Wood-Ljungdahl pathway by providing methyl groups required for Hg methylation.« less

  10. Stimulatory effect of sesamin on hepatic cytochrome P450 activities in Atlantic salmon (Salmo salar L.) is not directly associated with expression of genes related to xenobiotic metabolism.

    PubMed

    Zlabek, Vladimir; Vestergren, AnnaLotta Schiller; Trattner, Sofia; Wagner, Liane; Pickova, Jana; Zamaratskaia, Galia

    2015-01-01

    1. This study examined hepatic cytochrome P450 (CYP450) response to dietary sesamin in combination with different n-6/n-3 fatty acid ratios in fish diet. Over a period of 4 months, fish were fed seven different experimental diets an n-6/n-3 FA ratio of either 0.5 or 1.0 in combination with two sesamin levels: low sesamin = 1.16 g/kg feed and high sesamin = 5.8 g/kg feed. Control diets did not contain sesamin. 2. The CYP450-associated activities of ethoxyresorufin O-deethylase (EROD), 7-benzyloxy-4-trifluoromethylcoumarin O-debenzylation (BFCOD), pentoxyresorufin O-depentylase (PROD), coumarin hydroxylase (COH), methoxyresorufin O-deethylase (MROD) and p-nitrophenol hydroxylase (PNPH) were significantly induced by dietary sesamin in a dose-related manner. 3. Expressions of the genes CYP1A1, CYP1A3, CYP3A, AhR1α, AhR2β, AhR2δ and PXR involved in the regulation of CYP450 activities, was not the primary source of this induction.

  11. Suppression subtractive hybridization (SSH) for isolation and characterization of genes related to testicular development in the giant tiger shrimp Penaeus monodon.

    PubMed

    Leelatanawit, Rungnapa; Klinbunga, Sirawut; Aoki, Takashi; Hirono, Ikuo; Valyasevi, Rudd; Menasveta, Piamsak

    2008-11-30

    Suppression subtractive hybridization (SSH) cDNA libraries of the giant tiger shrimp, Penaeus monodon, were constructed. In total, 178 and 187 clones from the forward and reverse SSH libraries, respectively, of P. monodon were unidirectionally sequenced. From these, 37.1% and 53.5% Expressed Sequence Tags (ESTs) significantly matched known genes (E-value < 1e-04). Three isoforms of P. monodon progestin membrane receptor component 1: PM-PGMRC1-s (1980 bp), PM-PGMRC1-m (2848 bp), and PM-PGMRC1-l (2971 bp), with an identical ORF of 573 bp corresponding to a deduced polypeptide of 190 amino acids, were successfully identified by RACE-PCR. Interestingly, PMPGMRC1 showed a greater expression level in testes of juvenile than broodstock P. monodon (P < 0.05). Dopamine administration (10(-6) mol/shrimp) resulted in up-regulation of PMPGMRC1 in testes of juveniles at 3 hrs post treatment (P < 0.05), but had no effect on PM-Dmc1 (P > 0.05).

  12. Iron Dextran Increases Hepatic Oxidative Stress and Alters Expression of Genes Related to Lipid Metabolism Contributing to Hyperlipidaemia in Murine Model

    PubMed Central

    Silva, Maísa; Guerra, Joyce Ferreira da Costa; Sampaio, Ana Flávia Santos; de Lima, Wanderson Geraldo; Silva, Marcelo Eustáquio

    2015-01-01

    The objective of this study was to investigate the effects of iron dextran on lipid metabolism and to determine the involvement of oxidative stress. Fischer rats were divided into two groups: the standard group (S), which was fed the AIN-93M diet, and the standard plus iron group (SI), which was fed the same diet but also received iron dextran injections. Serum cholesterol and triacylglycerol levels were higher in the SI group than in the S group. Iron dextran was associated with decreased mRNA levels of pparα, and its downstream gene cpt1a, which is involved in lipid oxidation. Iron dextran also increased mRNA levels of apoB-100, MTP, and L-FABP indicating alterations in lipid secretion. Carbonyl protein and TBARS were consistently higher in the liver of the iron-treated rats. Moreover, a significant positive correlation was found between oxidative stress products, lfabp expression, and iron stores. In addition, a negative correlation was found between pparα expression, TBARS, carbonyl protein, and iron stores. In conclusion, our results suggest that the increase observed in the transport of lipids in the bloodstream and the decreased fatty acid oxidation in rats, which was promoted by iron dextran, might be attributed to increased oxidative stress. PMID:25685776

  13. CAGW Peptide- and PEG-Modified Gene Carrier for Selective Gene Delivery and Promotion of Angiogenesis in HUVECs in Vivo.

    PubMed

    Yang, Jing; Hao, Xuefang; Li, Qian; Akpanyung, Mary; Nejjari, Abdelilah; Neve, Agnaldo Luis; Ren, Xiangkui; Guo, Jintang; Feng, Yakai; Shi, Changcan; Zhang, Wencheng

    2017-02-08

    Gene therapy is a promising strategy for angiogenesis, but developing gene carriers with low cytotoxicity and high gene delivery efficiency in vivo is a key issue. In the present study, we synthesized the CAGW peptide- and poly(ethylene glycol) (PEG)-modified amphiphilic copolymers. CAGW peptide serves as a targeting ligand for endothelial cells (ECs). Different amounts of CAGW peptide were effectively conjugated to the amphiphilic copolymer via heterofunctional poly(ethylene glycol). These CAG- and PEG-modified copolymers could form nanoparticles (NPs) by self-assembly method and were used as gene carriers for the pEGFP-ZNF580 (pZNF580) plasmid. CAGW and PEG modification coordinately improved the hemocompatibility and cytocompatibility of NPs. The results of cellular uptake showed significantly enhanced internalization efficiency of pZNF580 after CAGW modification. Gene expression at mRNA and protein levels demonstrated that EC-targeted NPs possessed high gene delivery efficiency, especially the NPs with higher content of CAGW peptide (1.16 wt %). Furthermore, in vitro and in vivo vascularization assays also showed outstanding vascularization ability of human umbilical vein endothelial cells treated by the NP/pZNF580 complexes. This study demonstrates that the CAGW peptide-modified NP is a promising candidate for gene therapy in angiogenesis.

  14. Co-evolution between Grapevine rupestris stem pitting-associated virus and Vitis vinifera L. leads to decreased defence responses and increased transcription of genes related to photosynthesis.

    PubMed

    Gambino, Giorgio; Cuozzo, Danila; Fasoli, Marianna; Pagliarani, Chiara; Vitali, Marco; Boccacci, Paolo; Pezzotti, Mario; Mannini, Franco

    2012-10-01

    Grapevine rupestris stem pitting-associated virus (GRSPaV) is a widespread virus infecting Vitis spp. Although it has established a compatible viral interaction in Vitis vinifera without the development of phenotypic alterations, it can occur as distinct variants that show different symptoms in diverse Vitis species. The changes induced by GRSPaV in V. vinifera cv 'Bosco', an Italian white grape variety, were investigated by combining agronomic, physiological, and molecular approaches, in order to provide comprehensive information about the global effects of GRSPaV. In two years, this virus caused a moderate decrease in physiological efficiency, yield performance, and sugar content in berries associated with several transcriptomic alterations. Transcript profiles were analysed by a microarray technique in petiole, leaf, and berry samples collected at véraison and by real-time RT-PCR in a time course carried out at five grapevine developmental stages. Global gene expression analyses showed that transcriptomic changes were highly variable among the different organs and the different phenological phases. GRSPaV triggers some unique responses in the grapevine at véraison, never reported before for other plant-virus interactions. These responses include an increase in transcripts involved in photosynthesis and CO(2) fixation, a moderate reduction in the photosynthesis rate and some defence mechanisms, and an overlap with responses to water and salinity stresses. It is hypothesized that the long co-existence of grapevine and GRSPaV has resulted in the evolution of a form of mutual adaptation between the virus and its host. This study contributes to elucidating alternative mechanisms used by infected plants to contend with viruses.

  15. Chronic hyperprolactinemia evoked by disruption of lactotrope dopamine D2 receptors impacts on liver and adipocyte genes related to glucose and insulin balance.

    PubMed

    Luque, Guillermina María; Lopez-Vicchi, Felicitas; Ornstein, Ana María; Brie, Belén; De Winne, Catalina; Fiore, Esteban; Perez-Millan, Maria Inés; Mazzolini, Guillermo; Rubinstein, Marcelo; Becu-Villalobos, Damasia

    2016-12-01

    We studied the impact of high prolactin titers on liver and adipocyte gene expression related to glucose and insulin homeostasis in correlation with obesity onset. To that end we used mutant female mice that selectively lack dopamine type 2 receptors (D2Rs) from pituitary lactotropes (lacDrd2KO), which have chronic high prolactin levels associated with increased body weight, marked increments in fat depots, adipocyte size, and serum lipids, and a metabolic phenotype that intensifies with age. LacDrd2KO mice of two developmental ages, 5 and 10 mo, were used. In the first time point, obesity and increased body weight are marginal, although mice are hyperprolactinemic, whereas at 10 mo there is marked adiposity with a 136% increase in gonadal fat and a 36% increase in liver weight due to lipid accumulation. LacDrd2KO mice had glucose intolerance, hyperinsulinemia, and impaired insulin response to glucose already in the early stages of obesity, but changes in liver and adipose tissue transcription factors were time and tissue dependent. In chronic hyperprolactinemic mice liver Prlr were upregulated, there was liver steatosis, altered expression of the lipogenic transcription factor Chrebp, and blunted response of Srebp-1c to refeeding at 5 mo of age, whereas no effect was observed in the glycogenesis pathway. On the other hand, in adipose tissue a marked decrease in lipogenic transcription factor expression was observed when morbid obesity was already settled. These adaptive changes underscore the role of prolactin signaling in different tissues to promote energy storage.

  16. Effects of agmatine on secretion of interferon tau and catecholamines and expression of genes related to production of polyamines by ovine trophectoderm cells.

    PubMed

    Lenis, Yasser Y; Wang, Xiaoqiu; Tang, Wanjin; Wu, Guoyao; Bazer, Fuller W

    2016-10-01

    Embryonic survival requires histotrophic nutrition, including molecules secreted or transported into the uterine lumen by uterine epithelia. L-Arginine (Arg) is a common substrate for synthesis of nitric oxide, ornithine, proline, glutamate, creatinine, urea, polyamines and agmatine. Agmatine (Agm) is a product of arginine decarboxylation and it is a substrate for agmatinase for synthesis of putrescine and other polyamines in the ovine conceptus. Polyamines are essential for conceptus development. Therefore, this study compared effects of Arg and Agm on the behavior of ovine trophectoderm (oTr1) cells cultured in vitro. Arg, but not Agm, increased proliferation and migration of oTr1 cells, but neither Arg nor Agm affected cell adhesion. The total amount of IFNT in culture medium of oTr1 cells was increased by Arg, but Agm increased the IFNT production per oTr1 cell. Arg and Agm plus Arg decreased secretion of dopamine and norepinephrine by oTr1 cells. Agm upregulates expression of mRNAs SLC7A1, agmatinase and OAZ2 while the combination of Arg and Agm decreased expression of mRNAs for ODC1, SLC7A1, OAZ1 and OAZ3 by oTr1 cells. Although Agm does not stimulate proliferation, migration or adhesion of oTr1 cells or their secretion of catecholamines, Agm did increase transcription of SLC7A1, agmatinase and OAZ2 genes which would increase the capacity of oTr1 cells to produce polyamines. Collectively, our findings suggest a role for Arg and Agm in the regulation of transport of basic amino acids (including Arg), polyamine synthesis, and secretion of catecholamines by oTr1 cells.

  17. Effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and expression of genes related to the reproductive axis in laying hens.

    PubMed

    Long, L; Wu, S G; Yuan, F; Zhang, H J; Wang, J; Qi, G H

    2016-09-24

    This experiment was conducted to evaluate the effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and gene expression related to reproductive axis in laying hens to confirm the reproduction-promoting function of octacosanol. In total, 360 Hy-Line Brown (67-wk-old) laying hens were randomly assigned to one of three treatments with 0, 5, and 10 mg octacosanol (extracted from rice bran, purity >92%)/kg feed. The feeding trial lasted for 10 weeks. The results showed that the dietary addition of 5 and 10 mg/kg octacosanol improved feed efficiency by 4.9% and 3.4% (P < 0.01), increased the albumen height by 20.5% and 13.3% (P < 0.01), the Haugh unit score by 12.9% and 8.7% (P < 0.01), and the eggshell strength by 39.5% and 24.5% (P < 0.01), respectively, compared with the control diet. Dietary octacosanol addition significantly affected serum triiodothyronine, estradiol, follicle-stimulating hormone levels (P < 0.05), and progesterone and luteinizing hormone level (P < 0.01). Compared with the control, dietary addition of octacosanol at 5 mg/kg promoted the follicle-stimulating hormone receptor (FSHR) mRNA expression in different-sized follicles, and significantly increased the FSHR mRNA expression of granulosa cells from the F2 and F3 follicles (P < 0.05). Dietary supplementation with both 5 and 10 mg/kg octacosanol promoted the mRNA expression of luteinizing hormone receptor and prolactin receptor in different-sized follicles, and significantly up-regulated the expression levels in F1 granulosa cells (P < 0.05). The ovarian weight was significantly increased with the dietary addition of 5 mg/kg octacosanol (P < 0.05). The numbers of small yellow follicles and large white follicles were increased with the addition of dietary 5 and 10 mg/kg octacosanol (P < 0.01). This study provides evidence that octacosanol has the capacity to improve reproductive performance, indicating that it is a potentially effective

  18. Engineering biodegradable and multifunctional peptide-based polymers for gene delivery

    PubMed Central

    2013-01-01

    The complex nature of in vivo gene transfer establishes the need for multifunctional delivery vectors capable of meeting these challenges. An additional consideration for clinical translation of synthetic delivery formulations is reproducibility and scale-up of materials. In this review, we summarize our work over the last five years in developing a modular approach for synthesizing peptide-based polymers. In these materials, bioactive peptides that address various barriers to gene delivery are copolymerized with a hydrophilic backbone of N-(2-hydroxypropyl)methacrylamide (HPMA) using reversible-addition fragmentation chain-transfer (RAFT) polymerization. We demonstrate that this synthetic approach results in well-defined, narrowly-disperse polymers with controllable composition and molecular weight. To date, we have investigated the effectiveness of various bioactive peptides for DNA condensation, endosomal escape, cell targeting, and degradability on gene transfer, as well as the impact of multivalency and polymer architecture on peptide bioactivity. PMID:24156736

  19. Effects of different model diets on milk composition and expression of genes related to fatty acid synthesis in the mammary gland of lactating dairy goats.

    PubMed

    Zhang, H; Ao, C J; Khas-Erdene; Song, L W; Zhang, X F

    2015-07-01

    This study examined the effects of different roughage diets on milk composition and the expression of key genes associated with fatty acid (FA) synthesis in the mammary gland of lactating dairy goats. Eight multiparous lactating goats (body weight=43.6±2.5kg, 90±12 d in milk) fitted with external pudic artery and subcutaneous abdominal vein catheters were assigned to 2 treatments in a crossover design. The goats were fed different roughage diets with a similar concentrate-to-roughage ratio. The diets were (1) a high-quality roughage treatment (HQR) containing 28.5% Chinese wildrye hay, 19% corn silage, 9.5% alfalfa, and 43% concentrate or (2) a low-quality roughage treatment (LQR) containing 28% Chinese wildrye hay, 28% corn stover, and 44% concentrate, on a dry matter basis. Each feeding period lasted 21 d. The first 18 d served as an adaptation period, and the last 3 d served as a sample collection period. Dry matter intake, milk yield, and milk composition were measured. Milk and blood samples were collected for FA analysis. Mammary gland biopsies were performed after milking on the last day of each period and the tissues were analyzed for the mRNA expression of acetyl-coenzyme A carboxylase-α (ACACA), FA synthase (FASN), stearoyl CoA desaturase (SCD), and lipoprotein lipase (LPL). Dry matter intake and milk yield were not affected by the treatments. Milk fat (3.16 vs. 2.96%) and protein (2.99 vs. 2.89%) contents were higher in HQR goats than in LQR goats, and milk fat yield tended to be higher in HQR goats (16.7 vs. 15.1g/d). Milk FA composition was not different between treatments, except for C18:3n-3 (0.27 vs. 0.15g/100g). Compared with LQR goats, HQR goats had a higher vein concentration of total FA (0.62 vs. 0.44mg/mL). In HQR goats, the mammary balance of total FA increased (9.17 vs. 5.51g/d), whereas the clearance rate of total FA decreased (103.03 vs. 138.25 L/d). No differences were found in mammary blood flow, artery concentration, and mammary

  20. Comparison of the effects of salmon calcitonin (sCT) and calcitonin gene-related peptide (CGRP) in a number of in vivo and in vitro tests

    SciTech Connect

    Welch, S.P.; Brase, D.; Cooper, C.; Dewey, W.L.

    1986-03-05

    sCT and CGRP have been shown previously to have multiple activities in the central nervous system (CNS). Recent work has shown that CGRP (15 ..mu..g) intraventricularly (IVT) produces a naloxone reversible 37% inhibition in the p-phenylquinone test (PPQ) accompanied by severe diarrhea. The ED50 of sCT in the PPQ test is 362 ng and this effect is not reversed totally by naloxone. The onset of CGRP is more rapid than that of sCT. sCT and CGRP (10/sup -6/M) both produce naloxone reversible inhibition of the electrically stimulated guinea pig ileum (GPI) (25% and 50% respectively). Both sCT and CGRP (10/sup -6/ M) produce contracture (15% and 40% respectively) of the non-stimulated GPI that is not blocked by atropine. Both sCT and CGRP block the naloxone-induced contracture of the morphine (MS04) dependent ilea (29% and 68% respectively). Both sCT and CGRP produce biphasic shifts in the MS04 acetylcholine dose-effect curves in the stimulated and nonstimulated GPI, respectively. Neither sCT nor CGRP (10/sup -9/ to 10/sup -4/ M) displaces /sup 3/H-naloxone binding to mouse brain membranes. Both sCT and CGRP may produce their effects by modulation of CA/sup +2/ fluxes in the CNS and GPI.

  1. Indole-3-carbinol protects against cisplatin-induced acute nephrotoxicity: role of calcitonin gene-related peptide and insulin-like growth factor-1

    PubMed Central

    El-Naga, Reem N.; Mahran, Yasmen F.

    2016-01-01

    Nephrotoxicity associated with the clinical use of the anticancer drug cisplatin is a limiting problem. Thus, searching for new protective measures is required. Indole-3-carbinol is a powerful anti-oxidant, anti-inflammatory and anti-tumor agent. The present study aimed to investigate the potential protective effect of indole-3-carbinol against cisplatin-induced acute nephrotoxicity in rats. Rats were pre-treated with 20 mg/kg indole-3-carbinol orally before giving cisplatin (7 mg/kg). Cisplatin-induced acute nephrotoxicity was demonstrated where relative kidney weight, BUN and serum creatinine were significantly increased. Increased oxidative stress was evident in cisplatin group where GSH and SOD tissue levels were significantly depleted. Also, lipid peroxidation and NOX-1 were increased as compared to the control. Additionally, renal expression of pro-inflammatory mediators was induced by cisplatin. Cisplatin-induced cell death was shown by increased caspase-3 and decreased expression of EGF, IGF-1 and IGF-1 receptor. Nephrotoxicity, oxidative stress, inflammation and apoptotic effects induced by cisplatin were significantly ameliorated by indole-3-carbinol pre-treatment. Besides, the role of CGRP in cisplatin-induced nephrotoxicity was explored. Furthermore, cisplatin cytotoxic activity was significantly enhanced by indole-3-carbinol pre-treatment in vitro. In conclusion, indole-3-carbinol provides protection against cisplatin-induced nephrotoxicity. Also, reduced expression of CGRP may play a role in the pathogenesis of cisplatin-induced renal injury. PMID:27417335

  2. Peptide-conjugated micelles as a targeting nanocarrier for gene delivery

    NASA Astrophysics Data System (ADS)

    Lin, Wen Jen; Chien, Wei Hsuan

    2015-09-01

    The aim of this study was to develop peptide-conjugated micelles possessing epidermal growth factor receptor (EGFR) targeting ability for gene delivery. A sequence-modified dodecylpeptide, GE11(2R), with enhancing EGF receptor binding affinity, was applied in this study as a targeting ligand. The active targeting micelles were composed of poly( d,l-lactide- co-glycolide)-poly(ethylene glycol) (PLGA-PEG) copolymer conjugated with GE11(2R)-peptide. The particle sizes of peptide-free and peptide-conjugated micelles were 277.0 ± 5.1 and 308.7 ± 14.5 nm, respectively. The peptide-conjugated micelles demonstrated the cellular uptake significantly higher than peptide-free micelles in EGFR high-expressed MDA-MB-231 and MDA-MB-468 cells due to GE11(2R)-peptide specificity. Furthermore, the peptide-conjugated micelles were able to encapsulate plasmid DNA and expressed cellular transfection higher than peptide-free micelles in EGFR high-expressed cells. The EGFR-targeting delivery micelles enhanced DNA internalized into cells and achieved higher cellular transfection in EGFR high-expressed cells.

  3. Enhancement of gene delivery using novel homodimeric tat peptide formed by disulfide bond.

    PubMed

    Lee, Soo-Jin; Yoon, Sung-Hwa; Doh, Kyung-Oh

    2011-08-01

    Cationic liposomes have been actively used as gene delivery vehicle because of their minimal toxicity, but their relatively low efficiency of gene delivery is the major disadvantage of these vectors. Recently, cysteine residue incorporation to HIV-1 Tat peptide increased liposomemediated transfection compared with unmodified Tat peptide. Therefore, we designed a novel modified Tat peptide having a homodimeric (Tat-CTHD, Tat-NTHD) and closed structure (cyclic Tat) simply by using the disulfide bond between cysteines to develop a more efficient and safe nonviral gene delivery system. The mixing of Tat-CTHD and Tat-NTHD with DNA before mixing with lipofectamine increased the transfection efficiency compared with unmodified Tat peptide and lipofectamine only in MCF-7 breast cancer cells and rat vascular smooth muscle cells. However, cyclic Tat did not show any improvement in the transfection efficiency. In the gel retardation assay, Tat-CTHD and Tat-NTHD showed more strong binding with DNA than unmodified Tat and cyclic Tat peptide. This enhancement was only shown when Tat-CTHD and Tat-NTHD were mixed with DNA before mixing with lipofectamine. The effects of Tat- CTHD and Tat-NTHD were also valid in the experiment using DOTAP and DMRIE instead of lipofectamine. We could not find any significant cytotoxicity in the working concentration and more usage of these peptides. In conclusion, we have designed a novel transfection-enhancing peptide by easy homodimerization of Tat peptide, and the simple mix of these novel peptides with DNA increased the gene transfer of cationic lipids more efficiently with no additional cytotoxicity.

  4. Peptide targeting of adenoviral vectors to augment tumor gene transfer.

    PubMed

    Ballard, E N; Trinh, V T; Hogg, R T; Gerard, R D

    2012-07-01

    Adenovirus serotype 5 remains one of the most promising vectors for delivering genetic material to cancer cells for imaging or therapy, but optimization of these agents to selectively promote tumor cell infection is needed to further their clinical development. Peptide sequences that bind to specific cell surface receptors have been inserted into adenoviral capsid proteins to improve tumor targeting, often in the background of mutations designed to ablate normal ligand:receptor interactions and thereby reduce off target effects and toxicities in non-target tissues. Different tumor types also express highly variable complements of cell surface receptors, so a customized targeting strategy using a particular peptide in the context of specific adenoviral mutations may be needed to achieve optimal efficacy. To further investigate peptide targeting strategies in adenoviral vectors, we used a set of peptide motifs originally isolated using phage display technology that evince tumor specificity in vivo. To demonstrate their abilities as targeting motifs, we genetically incorporated these peptides into a surface loop of the fiber capsid protein to construct targeted adenovirus vectors. We then systematically evaluated the ability of these peptide targeted vectors to infect several tumor cell types, both in vitro and in vivo, in a variety of mutational backgrounds designed to reduce CAR and/or HSG-mediated binding. Results from this study support previous observations that peptide insertions in the HI loop of the fiber knob domain are generally ineffective when used in combination with HSG detargeting mutations. The evidence also suggests that this strategy can attenuate other fiber knob interactions, such as CAR-mediated binding, and reduce overall viral infectivity. The insertion of peptides into fiber proved more effective for targeting tumor cell types expressing low levels of CAR receptor, as this strategy can partially compensate for the very low infectivity of wild

  5. In Vivo Effect of Arsenic Trioxide on Keap1-p62-Nrf2 Signaling Pathway in Mouse Liver: Expression of Antioxidant Responsive Element-Driven Genes Related to Glutathione Metabolism

    PubMed Central

    Srivastava, Ritu; Sengupta, Archya; Mukherjee, Sandip; Chatterjee, Sarmishtha; Sudarshan, Muthammal; Chakraborty, Anindita; Bhattacharya, Shelley; Chattopadhyay, Ansuman

    2013-01-01

    Arsenic is a Group I human carcinogen, and chronic arsenic exposure through drinking water is a major threat to human population. Liver is one of the major organs for the detoxification of arsenic. The present study was carried out in mice in vivo after arsenic treatment through drinking water at different doses and time of exposure. Arsenic toxicity is found to be mediated by reactive oxygen species. Nuclear factor (erythroid-2 related) factor 2 (Nrf2)/Keap1 (Kelch-like ECH-associated protein 1)/ARE (antioxidant response element)—driven target gene system protects cells against oxidative stress and maintains cellular oxidative homeostasis. Our result showed 0.4 ppm, 2 ppm, and 4 ppm arsenic trioxide treatment through drinking water for 30 days and 90 days induced damages in the liver of Swiss albino mice as evidenced by histopathology, disturbances in liver function, induction of heat shock protein 70, modulation of trace elements, alteration in reduced glutathione level, glutathione-s-transferase and catalase activity, malondialdehyde production, and induction of apoptosis. Cellular Nrf2 protein level and mRNA level increased in all treatment groups. Keap1 protein as well as mRNA level decreased concomitantly in arsenic treated mice. Our study clearly indicates the important role of Nrf2 in activating ARE driven genes related to GSH metabolic pathway and also the adaptive response mechanisms in arsenic induced hepatotoxicity. PMID:27335833

  6. In Vivo Effect of Arsenic Trioxide on Keap1-p62-Nrf2 Signaling Pathway in Mouse Liver: Expression of Antioxidant Responsive Element-Driven Genes Related to Glutathione Metabolism.

    PubMed

    Srivastava, Ritu; Sengupta, Archya; Mukherjee, Sandip; Chatterjee, Sarmishtha; Sudarshan, Muthammal; Chakraborty, Anindita; Bhattacharya, Shelley; Chattopadhyay, Ansuman

    2013-01-01

    Arsenic is a Group I human carcinogen, and chronic arsenic exposure through drinking water is a major threat to human population. Liver is one of the major organs for the detoxification of arsenic. The present study was carried out in mice in vivo after arsenic treatment through drinking water at different doses and time of exposure. Arsenic toxicity is found to be mediated by reactive oxygen species. Nuclear factor (erythroid-2 related) factor 2 (Nrf2)/Keap1 (Kelch-like ECH-associated protein 1)/ARE (antioxidant response element)-driven target gene system protects cells against oxidative stress and maintains cellular oxidative homeostasis. Our result showed 0.4 ppm, 2 ppm, and 4 ppm arsenic trioxide treatment through drinking water for 30 days and 90 days induced damages in the liver of Swiss albino mice as evidenced by histopathology, disturbances in liver function, induction of heat shock protein 70, modulation of trace elements, alteration in reduced glutathione level, glutathione-s-transferase and catalase activity, malondialdehyde production, and induction of apoptosis. Cellular Nrf2 protein level and mRNA level increased in all treatment groups. Keap1 protein as well as mRNA level decreased concomitantly in arsenic treated mice. Our study clearly indicates the important role of Nrf2 in activating ARE driven genes related to GSH metabolic pathway and also the adaptive response mechanisms in arsenic induced hepatotoxicity.

  7. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  8. Ghrelin axis genes, peptides and receptors: recent findings and future challenges.

    PubMed

    Seim, Inge; Josh, Peter; Cunningham, Peter; Herington, Adrian; Chopin, Lisa

    2011-06-20

    The ghrelin axis consists of the gene products of the ghrelin gene (GHRL), and their receptors, including the classical ghrelin receptor GHSR. While it is well-known that the ghrelin gene encodes the 28 amino acid ghrelin peptide hormone, it is now also clear that the locus encodes a range of other bioactive molecules, including novel peptides and non-coding RNAs. For many of these molecules, the physiological functions and cognate receptor(s) remain to be determined. Emerging research techniques, including proteogenomics, are likely to reveal further ghrelin axis-derived molecules. Studies of the role of ghrelin axis genes, peptides and receptors, therefore, promises to be a fruitful area of basic and clinical research in years to come.

  9. Isolation, characterization, and expression analyses of plant elicitor peptides (pep) genes in maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    PROPEP1, PROPEP 2, and PROPEP3 genes appear to have roles in a feedback loop that amplifies defense signaling pathways initiated by pathogens. We present evidence to support the role of peptides derived from PROPEP genes as endogenous elicitors that are generated in response to pathogens. The preval...

  10. Toxic peptides and genes encoding toxin gamma of the Brazilian scorpions Tityus bahiensis and Tityus stigmurus.

    PubMed

    Becerril, B; Corona, M; Coronas, F I; Zamudio, F; Calderon-Aranda, E S; Fletcher, P L; Martin, B M; Possani, L D

    1996-02-01

    Seven toxic peptides from the venom of Tityus bahiensis and Tityus stigmurus was isolated and sequenced, five of them to completion. The most abundant peptide from each of these two species of scorpion was 95% identical with that of toxin gamma from the venom of Tityus serrulatus. They were consequently named gamma-b and gamma-st respectively. The genes encoding these new gamma-like peptides were cloned and sequenced by utilizing oligonucleotides synthesized according to known cDNA sequences of toxin gamma, and amplified by PCR on templates of DNA purified from both T. bahiensis and T. stigmurus. They contain an intron of approx. 470 bp. Possible mechanisms of processing and expressing these peptides are discussed, in view of the fact that glycine is the first residue of the N-terminal sequence of T. stigmurus, whereas lysine is the residue at position 1 of toxin gamma from T. serrulatus and T. bahiensis. In addition, chemical characterization of the less abundant toxic peptides showed the presence of at least four distinct families of peptides in all three species of the genus Tityus studied. There is a large degree of similarity among peptides from different venoms of the same family. By using specific horse and rabbit antisera, the venoms of T. bahiensis, T. serrulatus and T. stigmurus were compared. They showed an extended degree of cross-reactivity. Thus these three species of scorpion have similar toxic components, the genes of which are similarly organized, processed and expressed.

  11. Toxic peptides and genes encoding toxin gamma of the Brazilian scorpions Tityus bahiensis and Tityus stigmurus.

    PubMed Central

    Becerril, B; Corona, M; Coronas, F I; Zamudio, F; Calderon-Aranda, E S; Fletcher, P L; Martin, B M; Possani, L D

    1996-01-01

    Seven toxic peptides from the venom of Tityus bahiensis and Tityus stigmurus was isolated and sequenced, five of them to completion. The most abundant peptide from each of these two species of scorpion was 95% identical with that of toxin gamma from the venom of Tityus serrulatus. They were consequently named gamma-b and gamma-st respectively. The genes encoding these new gamma-like peptides were cloned and sequenced by utilizing oligonucleotides synthesized according to known cDNA sequences of toxin gamma, and amplified by PCR on templates of DNA purified from both T. bahiensis and T. stigmurus. They contain an intron of approx. 470 bp. Possible mechanisms of processing and expressing these peptides are discussed, in view of the fact that glycine is the first residue of the N-terminal sequence of T. stigmurus, whereas lysine is the residue at position 1 of toxin gamma from T. serrulatus and T. bahiensis. In addition, chemical characterization of the less abundant toxic peptides showed the presence of at least four distinct families of peptides in all three species of the genus Tityus studied. There is a large degree of similarity among peptides from different venoms of the same family. By using specific horse and rabbit antisera, the venoms of T. bahiensis, T. serrulatus and T. stigmurus were compared. They showed an extended degree of cross-reactivity. Thus these three species of scorpion have similar toxic components, the genes of which are similarly organized, processed and expressed. PMID:8611151

  12. Cholesterol-Peptide Hybrids to Form Liposome-Like Vesicles for Gene Delivery

    PubMed Central

    Tang, Qiong; Cao, Bin; Wu, Haiyan; Cheng, Gang

    2013-01-01

    In this paper, four amphiphilic cholesterol-peptide conjugates (Ch-R5H5, Ch-R3H3, Ch-R5 and Ch-R5) were designed and synthesized, and their properties in gene delivery were evaluated in vitro with an aim of developing more efficient gene delivery carriers. These amphiphilic cholesterol-peptide conjugates are composed of hydrophobic cholesterol and positively charged peptides. They were able to self-assemble into micelles at low concentrations and their critical micelle concentrations in phosphate buffered saline (pH 7.4) are ≤85 µg/mL. Amphiphilic cholesterol-peptide conjugates condensed DNA more efficiently than a hydrophilic cationic oligoarginine (R10) peptide with no hydrophobic segment. Their transfection efficiencies were at least two orders of magnitude greater than that of R10 peptide in HEK-293 cells. Moreover, the introduction of histidine residues in cholesterol-peptide conjugates led to higher gene expression efficiency compared with cholesterol-peptides without histidine (Ch-R5 and Ch-R3), and the luciferase expression level was comparable or even higher than that induced by PEI at its optimal N/P ratio. In particular, Ch-R5H5 condensed DNA into smaller nanoparticles than Ch-R3H3 at higher N/P ratios, and the minimum size of Ch-R5H5/DNA complexes was 180 nm with zeta potential of 23 mV, achieved at the N/P ratio of 30. This liposome-like vesicle may be a promising gene delivery carrier for intravenous therapy. PMID:23382899

  13. Genes and associated peptides involved with aestivation in a land snail.

    PubMed

    Adamson, K J; Wang, T; Rotgans, B A; Kruangkum, T; Kuballa, A V; Storey, K B; Cummins, S F

    2015-10-20

    Some animals can undergo a remarkable transition from active normal life to a dormant state called aestivation; entry into this hypometabolic state ensures that life continues even during long periods of environmental hardship. In this study, we aimed to identify those central nervous system (CNS) peptides that may regulate metabolic suppression leading to aestivation in land snails. Mass spectral-based neuropeptidome analysis of the CNS comparing active and aestivating states, revealed 19 differentially produced peptides; 2 were upregulated in active animals and 17 were upregulated in aestivated animals. Of those, the buccalin neuropeptide was further investigated since there is existing evidence in molluscs that buccalin modulates physiology by muscle contraction. The Theba pisana CNS contains two buccalin transcripts that encode precursor proteins that are capable of releasing numerous buccalin peptides. Of these, Tpi-buccalin-2 is most highly expressed within our CNS transcriptome derived from multiple metabolic states. No significant difference was observed at the level of gene expression levels for Tpi-buccalin-2 between active and aestivated animals, suggesting that regulation may reside at the level of post-translational control of peptide abundance. Spatial gene and peptide expression analysis of aestivated snail CNS demonstrated that buccalin-2 has widespread distribution within regions that control several physiological roles. In conclusion, we provide the first detailed molecular analysis of the peptides and associated genes that are related to hypometabolism in a gastropod snail known to undergo extended periods of aestivation.

  14. Adaptive radiation of venomous marine snail lineages and the accelerated evolution of venom peptide genes

    PubMed Central

    Olivera, Baldomero M.; Watkins, Maren; Bandyopadhyay, Pradip; Imperial, Julita S.; de la Cotera, Edgar P. Heimer; Aguilar, Manuel B.; Vera, Estuardo López; Concepcion, Gisela P.; Lluisma, Arturo

    2012-01-01

    An impressive biodiversity (>10,000 species) of marine snails (suborder Toxoglossa or superfamily Conoidea) have complex venoms, containing ca. 100 biologically active, disulfide-rich peptides. In the genus Conus, the most intensively investigated toxoglossan lineage (~500 species), a small set of venom gene superfamilies undergo rapid sequence hyperdiversification within their mature toxin regions. Each major lineage of Toxoglossa has its own distinct set of venom gene superfamilies. Two recently identified venom gene superfamilies are expressed in the large Turridae clade, but not in Conus. Thus, as major venomous molluscan clades expand, a small set of lineage specific venom gene superfamilies undergo accelerated evolution. The juxtaposition of extremely conserved signal sequences with hypervariable mature peptide regions is unprecedented and raises the possibility that in these gene superfamilies, the signal sequences are conserved as a result of an essential role they play in enabling rapid sequence evolution of the region of the gene that encodes the active toxin. PMID:22954218

  15. The albonoursin gene Cluster of S noursei biosynthesis of diketopiperazine metabolites independent of nonribosomal peptide synthetases.

    PubMed

    Lautru, Sylvie; Gondry, Muriel; Genet, Roger; Pernodet, Jean Luc

    2002-12-01

    Albonoursin [cyclo(deltaPhe-DeltaLeu)], an antibacterial peptide produced by Streptomyces noursei, is one of the simplest representatives of the large diketopiperazine (DKP) family. Formation of alpha,beta unsaturations was previously shown to occur on cyclo(L-Phe-L-Leu), catalyzed by the cyclic dipeptide oxidase (CDO). We used CDO peptide sequence information to isolate a 3.8 kb S. noursei DNA fragment that directs albonoursin biosynthesis in Streptomyces lividans. This fragment encompasses four complete genes: albA and albB, necessary for CDO activity; albC, sufficient for cyclic dipeptide precursor formation, although displaying no similarity to non ribosomal peptide synthetase (NRPS) genes; and albD, encoding a putative membrane protein. This first isolated DKP biosynthetic gene cluster should help to elucidate the mechanism of DKP formation, totally independent of NRPS, and to characterize novel DKP biosynthetic pathways that could be engineered to increase the molecular diversity of DKP derivatives.

  16. BAGEL3: automated identification of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides

    PubMed Central

    van Heel, Auke J.; de Jong, Anne; Montalbán-López, Manuel; Kok, Jan; Kuipers, Oscar P.

    2013-01-01

    Identifying genes encoding bacteriocins and ribosomally synthesized and posttranslationally modified peptides (RiPPs) can be a challenging task. Especially those peptides that do not have strong homology to previously identified peptides can easily be overlooked. Extensive use of BAGEL2 and user feedback has led us to develop BAGEL3. BAGEL3 features genome mining of prokaryotes, which is largely independent of open reading frame (ORF) predictions and has been extended to cover more (novel) classes of posttranslationally modified peptides. BAGEL3 uses an identification approach that combines direct mining for the gene and indirect mining via context genes. Especially for heavily modified peptides like lanthipeptides, sactipeptides, glycocins and others, this genetic context harbors valuable information that is used for mining purposes. The bacteriocin and context protein databases have been updated and it is now easy for users to submit novel bacteriocins or RiPPs. The output has been simplified to allow user-friendly analysis of the results, in particular for large (meta-genomic) datasets. The genetic context of identified candidate genes is fully annotated. As input, BAGEL3 uses FASTA DNA sequences or folders containing multiple FASTA formatted files. BAGEL3 is freely accessible at http://bagel.molgenrug.nl. PMID:23677608

  17. BAGEL3: Automated identification of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides.

    PubMed

    van Heel, Auke J; de Jong, Anne; Montalbán-López, Manuel; Kok, Jan; Kuipers, Oscar P

    2013-07-01

    Identifying genes encoding bacteriocins and ribosomally synthesized and posttranslationally modified peptides (RiPPs) can be a challenging task. Especially those peptides that do not have strong homology to previously identified peptides can easily be overlooked. Extensive use of BAGEL2 and user feedback has led us to develop BAGEL3. BAGEL3 features genome mining of prokaryotes, which is largely independent of open reading frame (ORF) predictions and has been extended to cover more (novel) classes of posttranslationally modified peptides. BAGEL3 uses an identification approach that combines direct mining for the gene and indirect mining via context genes. Especially for heavily modified peptides like lanthipeptides, sactipeptides, glycocins and others, this genetic context harbors valuable information that is used for mining purposes. The bacteriocin and context protein databases have been updated and it is now easy for users to submit novel bacteriocins or RiPPs. The output has been simplified to allow user-friendly analysis of the results, in particular for large (meta-genomic) datasets. The genetic context of identified candidate genes is fully annotated. As input, BAGEL3 uses FASTA DNA sequences or folders containing multiple FASTA formatted files. BAGEL3 is freely accessible at http://bagel.molgenrug.nl.

  18. Upregulation of genes related to bone formation by γ-amino butyric acid and γ-oryzanol in germinated brown rice is via the activation of GABAB-receptors and reduction of serum IL-6 in rats

    PubMed Central

    Muhammad, Sani Ismaila; Maznah, Ismail; Mahmud, Rozi; Zuki, Abu Bakar Zakaria; Imam, Mustapha Umar

    2013-01-01

    Background Osteoporosis and other bone degenerative diseases are among the most challenging non-communicable diseases to treat. Previous works relate bone loss due to osteoporosis with oxidative stress generated by free radicals and inflammatory cytokines. Alternative therapy to hormone replacement has been an area of interest to researchers for almost three decades due to hormone therapy-associated side effects. Methods In this study, we investigated the effects of gamma-amino butyric acid (GABA), gamma-oryzanol (ORZ), acylated steryl glucosides (ASG), and phenolic extracts from germinated brown rice (GBR) on the expression of genes related to bone metabolism, such as bone morphogenic protein-2 (BMP-2), secreted protein acidic and rich in cysteine (SPARC), runt-related transcription factor 2 (RUNX-2), osteoblast-specific transcription factor osterix (Osx), periostin, osteoblast specific factor (Postn), collagen 1&2 (Col1&2), calcitonin receptor gene (CGRP); body weight measurement and also serum interleukin-6 (IL-6) and osteocalcin, in serum and bone. Rats were treated with GBR, ORZ, GABA, and ASG at (100 and 200 mg/kg); estrogen (0.2 mg/kg), or remifemin (10 and 20 mg/kg), compared to ovariectomized non-treated group as well as non-ovariectomized non-treated (sham) group. Enzyme-linked immunosorbent assay was used to measure the IL-6 and osteocalcin levels at week 2, 4, and 8, while the gene expression in the bone tissue was determined using the Genetic Analysis System (Beckman Coulter Inc., Brea, CA, USA). Results The results indicate that groups treated with GABA (100 and 200 mg/kg) showed significant upregulation of SPARC, calcitonin receptor, and BMP-2 genes (P < 0.05), while the ORZ-treated group (100 and 200 mg/kg) revealed significant (P < 0.05) upregulation of Osx, Postn, RUNX-2, and Col1&2. Similarly, IL-6 concentration decreased, while osteocalcin levels increased significantly (P < 0.05) in the treated groups as compared to ovariectomized non

  19. The Dh gene of Drosophila melanogaster encodes a diuretic peptide that acts through cyclic AMP.

    PubMed

    Cabrero, Pablo; Radford, Jonathan C; Broderick, Kate E; Costes, Laurence; Veenstra, Jan A; Spana, Eric P; Davies, Shireen A; Dow, Julian A T

    2002-12-01

    Dh, the gene that encodes a CRF-like peptide in Drosophila melanogaster, is described. The product of this gene is a 44-amino-acid peptide (Drome-DH(44)) with a sequence almost identical to the Musca domestica and Stomoxys calcitrans diuretic hormones. There are no other similar peptides encoded within the known Drosophila genomic sequence. Functional studies showed that the deduced peptide stimulated fluid production, and that this effect was mediated by cyclic AMP in principal cells only: there was no effect on the levels of either cyclic GMP or intracellular calcium. Stimulation also elevated levels of cyclic AMP (but not cyclic GMP) phosphodiesterase, a new mode of action for this class of hormone. The transcript was localised by in situ hybridisation, and the peptide by immunocytochemistry, to two groups of three neurones in the pars intercerebralis within the brain. These cells also express receptors for leucokinin, another major diuretic peptide, implying that the cells may be important in homeostatic regulation.

  20. Gene introduction into the mitochondria of Arabidopsis thaliana via peptide-based carriers.

    PubMed

    Chuah, Jo-Ann; Yoshizumi, Takeshi; Kodama, Yutaka; Numata, Keiji

    2015-01-13

    Available methods in plant genetic transformation are nuclear and plastid transformations because similar procedures have not yet been established for the mitochondria. The double membrane and small size of the organelle, in addition to its large population in cells, are major obstacles in mitochondrial transfection. Here we report the intracellular delivery of exogenous DNA localized to the mitochondria of Arabidopsis thaliana using a combination of mitochondria-targeting peptide and cell-penetrating peptide. Low concentrations of peptides were sufficient to deliver DNA into the mitochondria and expression of imported DNA reached detectable levels within a short incubation period (12 h). We found that electrostatic interaction with the cell membrane is not a critical factor for complex internalization, instead, improved intracellular penetration of mitochondria-targeted complexes significantly enhanced gene transfer efficiency. Our results delineate a simple and effective peptide-based method, as a starting point for the development of more sophisticated plant mitochondrial transfection strategies.

  1. Analysis of gastrin-releasing peptide gene and gastrin-releasing peptide receptor gene in patients with agoraphobia.

    PubMed

    Zimmermann, Katrin; Görgens, Heike; Bräuer, David; Einsle, Franziska; Noack, Barbara; von Kannen, Stephanie; Grossmann, Maria; Hoyer, Jürgen; Strobel, Alexander; Köllner, Volker; Weidner, Kerstin; Ziegler, Andreas; Hemmelmann, Claudia; Schackert, Hans K

    2014-10-01

    A gastrin-releasing peptide receptor (GRPR) knock-out mouse model provided evidence that the gastrin-releasing peptide (GRP) and its neural circuitry operate as a negative feedback-loop regulating fear, suggesting a novel candidate mechanism contributing to individual differences in fear-conditioning and associated psychiatric disorders such as agoraphobia with/without panic disorder. Studies in humans, however, provided inconclusive evidence on the association of GRP and GRPR variations in agoraphobia with/without panic disorder. Based on these findings, we investigated whether GRP and GRPR variants are associated with agoraphobia. Mental disorders were assessed via the Munich-Composite International Diagnostic Interview (M-CIDI) in 95 patients with agoraphobia with/without panic disorder and 119 controls without any mental disorders. A complete sequence analysis of GRP and GRPR was performed in all participants. We found no association of 16 GRP and 7 GRPR variants with agoraphobia with/without panic disorder.

  2. A novel synthetic peptide vector system for optimal gene delivery to bone marrow stromal cells.

    PubMed

    Haitao, Pan; Qixin, Zheng; Xiaodong, Guo

    2007-03-01

    A 23-amino acid, bifunctional, integrin-targeted synthetic peptide was evaluated for ex vivo gene delivery to rabbit bone marrow stromal cells (BMSCs). The peptide (K)(16)GRGDSPC consists of an amino terminal domain of 16 lysines for electrostatic binding of DNA, and a 7-amino acid integrin-binding domain at the carboxyl terminal. PcDNA3-EGFP plasmids were transfected into BMSCs by (K)(16)GRGDSPC and the positive cells gave out a bright green fluorescence. High levels of gene delivery of pcDNA3-TGF-beta1 plasmids were obtained with 2 to 4 microg/ml DNA concentration, with (K)(16)GRGDSPC at an optimal peptide: DNA w/w ratio of 3:1, with a required exposure time of more than 4 h but shorter than 24 h for BMSC exposure to the peptide/DNA complexes with completely absent serum in the initial stage; with 100 microM chloroquine and at least 8 h exposure for BMSC exposure to chloroquine; with a fusogenic peptide at an optimal (K)(16)GRGDSPC/DNA/fusogenic peptide w/w ratio of 3:1:5; and with Lipofectamine 2000 at an optimal (K)(16)GRGDSPC/DNA/Lipofectamine 2000 w/w ratio of 3:1:2 at a constant DNA concentration of 2 microg/ml. Chloroquine, the fusogenic peptide and Lipofectamine 2000 all significantly promoted gene delivery, but chloroquine was more effective than the fusogenic peptide and had obvious synergistic effects with Lipofectamine 2000. Under optimal conditions, TGF-beta1 gene was transfected into BMSCs without observable toxicity, and the stable expression was examined by RT-PCR and Western blot analysis. The stable transgenic cells showed obvious bands. This novel synthetic peptide, providing a new way for the use of polylysine and RGD motif in DNA vector system, is potentially well suited to ex vivo gene delivery to BMSCs for experimental and clinical applications in the field of bone tissue engineering.

  3. Intestinotrophic Glucagon-Like Peptide-2 (GLP-2) Activates Intestinal Gene Expression and Growth Factor-Dependent Pathways Independent of the Vasoactive Intestinal Peptide Gene in Mice

    PubMed Central

    Yusta, Bernardo; Holland, Dianne; Waschek, James A.

    2012-01-01

    The enteroendocrine and enteric nervous systems convey signals through an overlapping network of regulatory peptides that act either as circulating hormones or as localized neurotransmitters within the gastrointestinal tract. Because recent studies invoke an important role for vasoactive intestinal peptide (VIP) as a downstream mediator of glucagon-like peptide-2 (GLP-2) action in the gut, we examined the importance of the VIP-GLP-2 interaction through analysis of Vip−/− mice. Unexpectedly, we detected abnormal villous architecture, expansion of the crypt compartment, increased crypt cell proliferation, enhanced Igf1 and Kgf gene expression, and reduced expression of Paneth cell products in the Vip−/− small bowel. These abnormalities were not reproduced by antagonizing VIP action in wild-type mice, and VIP administration did not reverse the intestinal phenotype of Vip−/− mice. Exogenous administration of GLP-2 induced the expression of ErbB ligands and immediate-early genes to similar levels in Vip+/+ vs. Vip−/− mice. Moreover, GLP-2 significantly increased crypt cell proliferation and small bowel growth to comparable levels in Vip+/+ vs. Vip−/− mice. Unexpectedly, exogenous GLP-2 administration had no therapeutic effect in mice with dextran sulfate-induced colitis; the severity of colonic injury and weight loss was modestly reduced in female but not male Vip−/− mice. Taken together, these findings extend our understanding of the complex intestinal phenotype arising from loss of the Vip gene. Furthermore, although VIP action may be important for the antiinflammatory actions of GLP-2, the Vip gene is not required for induction of a gene expression program linked to small bowel growth after enhancement of GLP-2 receptor signaling. PMID:22535770

  4. Mytilin B and MGD2, two antimicrobial peptides of marine mussels: gene structure and expression analysis.

    PubMed

    Mitta, G; Hubert, F; Dyrynda, E A; Boudry, P; Roch, P

    2000-06-01

    Previous research has shown that mytilins and MGDs are two types of 4-kDa, cysteine-rich, cationic antimicrobial peptides, which are abundant in hemocytes of the mussels, Mytilus galloprovincialis and M. edulis. The expression of the genes encoding these peptides has been analyzed in the hemocytes of animals subjected to various stress factors, as well as during larval development. Variations in gene expression in adult mussels have been tested under conditions of physical stress, bacterial challenge and heat shock. The results suggest that in adult mussels, the MGD2 gene may be over-expressed with physical and temperature stress, but that reduced expression occurs with bacterial challenge. Gene expression during development has been analyzed using different larval and post-larval stages, ranging from 4-day-old veliger larvae to 32-day-old post-larvae. The results show that the expression of both mytilin B and MGD2 is developmentally regulated, but neither gene is expressed in mussels until after larval settlement and metamorphosis. Finally, the genes encoding two isoforms of these peptides have been cloned and sequenced, revealing that both genes contain four exons and three introns.

  5. The sex-peptide gene (Acp70A) is duplicated in Drosophila subobscura.

    PubMed

    Cirera, S; Aguadé, M

    1998-04-14

    A 3.1-kb region of Drosphila subobscura homologous to the Acp70A region of D. melanogaster, which contains the sex-peptide gene, was cloned and sequenced. This region contains an approximately 600-bp duplication that includes the sex-peptide and its 5' and 3' flanking regions. The preproteins are 54 and 56 amino acids long, respectively (as compared to 55 amino acids in D. melanogaster), and each includes a 19-amino-acid-long signal peptide. The C-terminal part of the mature peptide is highly conserved between D. melanogaster and the two copies of D. subobscura. In this species, both copies of the gene are transcribed and, like in D. melangaster, only expressed in males. The duplicated region includes 300 bp upstream of the gene that would therefore seem sufficient for their expression in males. This region presents at its 5' end a stretch 93-bp that has a high similarity with the corresponding region of D. melanogaster and could be part of a still unidentified regulatory element of these genes.

  6. Inhibition of Growth and Gene Expression by PNA-peptide Conjugates in Streptococcus pyogenes

    PubMed Central

    Patenge, Nadja; Pappesch, Roberto; Krawack, Franziska; Walda, Claudia; Mraheil, Mobarak Abu; Jacob, Anette; Hain, Torsten; Kreikemeyer, Bernd

    2013-01-01

    While Streptococcus pyogenes is consistently susceptible toward penicillin, therapeutic failure of penicillin treatment has been reported repeatedly and a considerable number of patients exhibit allergic reactions to this substance. At the same time, streptococcal resistance to alternative antibiotics, e.g., macrolides, has increased. Taken together, these facts demand the development of novel therapeutic strategies. In this study, S. pyogenes growth was inhibited by application of peptide-conjugated antisense-peptide nucleic acids (PNAs) specific for the essential gyrase A gene (gyrA). Thereby, HIV-1 Tat peptide-coupled PNAs were more efficient inhibitors of streptococcal growth as compared with (KFF)3K-coupled PNAs. Peptide-anti-gyrA PNAs decreased the abundance of gyrA transcripts in S. pyogenes. Growth inhibition by antisense interference was enhanced by combination of peptide-coupled PNAs with protein-level inhibitors. Antimicrobial synergy could be detected with levofloxacin and novobiocin, targeting the gyrase enzyme, and with spectinomycin, impeding ribosomal function. The prospective application of carrier peptide-coupled antisense PNAs in S. pyogenes covers the use as an antimicrobial agent and the employment as a knock-down strategy for the investigation of virulence factor function. PMID:24193033

  7. The expanding roles of the ghrelin-gene derived peptide obestatin in health and disease.

    PubMed

    Seim, Inge; Walpole, Carina; Amorim, Laura; Josh, Peter; Herington, Adrian; Chopin, Lisa

    2011-06-20

    Obestatin is a 23 amino acid, ghrelin gene-derived peptide hormone produced in the stomach and a range of other tissues throughout the body. While it was initially reported that obestatin opposed the actions of ghrelin with regards to appetite and food intake, it is now clear that obestatin is not an endogenous ghrelin antagonist, but it is a multi-functional peptide hormone in its own right. In this review we will discuss the controversies associated with the discovery of obestatin and explore emerging central and peripheral roles of obestatin, which includes adipogenesis, pancreatic homeostasis and cancer.

  8. Efficient Gene Knockdown in Mouse Oocytes through Peptide Nanoparticle-Mediated SiRNA Transfection

    PubMed Central

    Jin, Zhen; Li, Ruichao; Zhou, Chunxiang; Shi, Liya; Zhang, Xiaolan; Yang, Zhixia; Zhang, Dong

    2016-01-01

    The use of mouse oocytes as a model for studying female meiosis is very important in reproductive medicine. Gene knockdown by specific small interfering RNA (siRNA) is usually the first step in the study of the function of a target gene in mouse oocytes during in vitro maturation. Traditionally, the only way to introduce siRNA into mouse oocytes is through microinjection, which is certainly less efficient and strenuous than siRNA transfection in somatic cells. Recently, in research using somatic cells, peptide nanoparticle-mediated siRNA transfection has been gaining popularity over liposome nanoparticle-mediated methods because of its high efficiency, low toxicity, good stability, and strong serum compatibility. However, no researchers have yet tried transfecting siRNA into mouse oocytes because of the existence of the protective zona pellucida surrounding the oocyte membrane (vitelline membrane). We therefore tested whether peptide nanoparticles can introduce siRNA into mouse oocytes. In the present study, we showed for the first time that our optimized program can efficiently knock down a target gene with high specificity. Furthermore, we achieved the expected meiotic phenotypes after we knocked down a test unknown target gene TRIM75. We propose that peptide nanoparticles may be superior for preliminary functional studies of unknown genes in mouse oocytes. PMID:26974323

  9. Efficient Gene Knockdown in Mouse Oocytes through Peptide Nanoparticle-Mediated SiRNA Transfection.

    PubMed

    Jin, Zhen; Li, Ruichao; Zhou, Chunxiang; Shi, Liya; Zhang, Xiaolan; Yang, Zhixia; Zhang, Dong

    2016-01-01

    The use of mouse oocytes as a model for studying female meiosis is very important in reproductive medicine. Gene knockdown by specific small interfering RNA (siRNA) is usually the first step in the study of the function of a target gene in mouse oocytes during in vitro maturation. Traditionally, the only way to introduce siRNA into mouse oocytes is through microinjection, which is certainly less efficient and strenuous than siRNA transfection in somatic cells. Recently, in research using somatic cells, peptide nanoparticle-mediated siRNA transfection has been gaining popularity over liposome nanoparticle-mediated methods because of its high efficiency, low toxicity, good stability, and strong serum compatibility. However, no researchers have yet tried transfecting siRNA into mouse oocytes because of the existence of the protective zona pellucida surrounding the oocyte membrane (vitelline membrane). We therefore tested whether peptide nanoparticles can introduce siRNA into mouse oocytes. In the present study, we showed for the first time that our optimized program can efficiently knock down a target gene with high specificity. Furthermore, we achieved the expected meiotic phenotypes after we knocked down a test unknown target gene TRIM75. We propose that peptide nanoparticles may be superior for preliminary functional studies of unknown genes in mouse oocytes.

  10. Digital Gene Expression Analysis of Corky Split Vein Caused by Boron Deficiency in ‘Newhall’ Navel Orange (Citrus sinensis Osbeck) for Selecting Differentially Expressed Genes Related to Vascular Hypertrophy

    PubMed Central

    Yang, Cheng-Quan; Liu, Yong-Zhong; An, Ji-Cui; Li, Shuang; Jin, Long-Fei; Zhou, Gao-Feng; Wei, Qing-Jiang; Yan, Hui-Qing; Wang, Nan-Nan; Fu, Li-Na; Liu, Xiao; Hu, Xiao-Mei; Yan, Ting-Shuai; Peng, Shu-Ang

    2013-01-01

    Corky split vein caused by boron (B) deficiency in ‘Newhall’ Navel Orange was studied in the present research. The boron-deficient citrus exhibited a symptom of corky split vein in mature leaves. Morphologic and anatomical surveys at four representative phases of corky split veins showed that the symptom was the result of vascular hypertrophy. Digital gene expression (DGE) analysis was performed based on the Illumina HiSeq™ 2000 platform, which was applied to analyze the gene expression profilings of corky split veins at four morphologic phases. Over 5.3 million clean reads per library were successfully mapped to the reference database and more than 22897 mapped genes per library were simultaneously obtained. Analysis of the differentially expressed genes (DEGs) revealed that the expressions of genes associated with cytokinin signal transduction, cell division, vascular development, lignin biosynthesis and photosynthesis in corky split veins were all affected. The expressions of WOL and ARR12 involved in the cytokinin signal transduction pathway were up-regulated at 1st phase of corky split vein development. Furthermore, the expressions of some cell cycle genes, CYCs and CDKB, and vascular development genes, WOX4 and VND7, were up-regulated at the following 2nd and 3rd phases. These findings indicated that the cytokinin signal transduction pathway may play a role in initiating symptom observed in our study. PMID:23755275

  11. Nuclear translocation uncovers the amyloid peptide Aβ42 as a regulator of gene transcription.

    PubMed

    Barucker, Christian; Harmeier, Anja; Weiske, Joerg; Fauler, Beatrix; Albring, Kai Frederik; Prokop, Stefan; Hildebrand, Peter; Lurz, Rudi; Heppner, Frank L; Huber, Otmar; Multhaup, Gerhard

    2014-07-18

    Although soluble species of the amyloid-β peptide Aβ42 correlate with disease symptoms in Alzheimer disease, little is known about the biological activities of amyloid-β (Aβ). Here, we show that Aβ peptides varying in lengths from 38 to 43 amino acids are internalized by cultured neuroblastoma cells and can be found in the nucleus. By three independent methods, we demonstrate direct detection of nuclear Aβ42 as follows: (i) biochemical analysis of nuclear fractions; (ii) detection of biotin-labeled Aβ in living cells by confocal laser scanning microscopy; and (iii) transmission electron microscopy of Aβ in cultured cells, as well as brain tissue of wild-type and transgenic APPPS1 mice (overexpression of amyloid precursor protein and presenilin 1 with Swedish and L166P mutations, respectively). Also, this study details a novel role for Aβ42 in nuclear signaling, distinct from the amyloid precursor protein intracellular domain. Chromatin immunoprecipitation showed that Aβ42 specifically interacts as a repressor of gene transcription with LRP1 and KAI1 promoters. By quantitative RT-PCR, we confirmed that mRNA levels of the examined candidate genes were exclusively decreased by the potentially neurotoxic Aβ42 wild-type peptide. Shorter peptides (Aβ38 or Aβ40) and other longer peptides (nontoxic Aβ42 G33A substitution or Aβ43) did not affect mRNA levels. Overall, our data indicate that the nuclear translocation of Aβ42 impacts gene regulation, and deleterious effects of Aβ42 in Alzheimer disease pathogenesis may be influenced by altering the expression profiles of disease-modifying genes.

  12. rbcS genes in Solanum tuberosum: conservation of transit peptide and exon shuffling during evolution.

    PubMed Central

    Wolter, F P; Fritz, C C; Willmitzer, L; Schell, J; Schreier, P H

    1988-01-01

    Five genes of the rbcS gene family of Solanum tuberosum (potato) were studied. One of these is a cDNA clone; the other four are located on two genomic clones representing two different chromosomal loci containing one (locus 1) and three genes (locus 2), respectively. The intron/exon structure of the three genes in locus 2 is highly conserved with respect to size and position. These genes contain two introns, whereas the gene from locus 1 contains three introns. Although in most cases the amino acid sequences in the transit peptide part of different rbcS genes from the same species varied considerably more than the corresponding mature amino acid sequences, one exception found in tomato and potato indicates that the transit peptide of rbcS could have a special function. A comparison of the rbcS genes of higher plants with those of prokaryotes offers suggestive evidence that introns first served as spacer material in the process of exon shuffling and then were removed stepwise during the evolution of higher plants. PMID:3422467

  13. Polyketide and nonribosomal peptide retro-biosynthesis and global gene cluster matching.

    PubMed

    Dejong, Chris A; Chen, Gregory M; Li, Haoxin; Johnston, Chad W; Edwards, Mclean R; Rees, Philip N; Skinnider, Michael A; Webster, Andrew L H; Magarvey, Nathan A

    2016-12-01

    Polyketides (PKs) and nonribosomal peptides (NRPs) are profoundly important natural products, forming the foundations of many therapeutic regimes. Decades of research have revealed over 11,000 PK and NRP structures, and genome sequencing is uncovering new PK and NRP gene clusters at an unprecedented rate. However, only ∼10% of PK and NRPs are currently associated with gene clusters, and it is unclear how many of these orphan gene clusters encode previously isolated molecules. Therefore, to efficiently guide the discovery of new molecules, we must first systematically de-orphan emergent gene clusters from genomes. Here we provide to our knowledge the first comprehensive retro-biosynthetic program, generalized retro-biosynthetic assembly prediction engine (GRAPE), for PK and NRP families and introduce a computational pipeline, global alignment for natural products cheminformatics (GARLIC), to uncover how observed biosynthetic gene clusters relate to known molecules, leading to the identification of gene clusters that encode new molecules.

  14. Polycistronic peptide coding genes in eukaryotes--how widespread are they?

    PubMed

    Tautz, Diethard

    2009-01-01

    The classical textbook assumption for the structure of an eukaryotic gene is that it codes for a single polypeptide of more than 100 amino acids in length. This is also the implicit assumption in most gene annotation pipelines. A gene family has now been discovered in insects that shows that an eukaryotic mRNA can code for peptides as short as eleven amino acids and that a single mRNA can code for several such peptides. This raises the question whether short open reading frames might also have a functional potential in other mRNAs, in particular those that occur in the 5'-UTR of many mRNAs. A number of these have been shown to act in cis to regulate the translation of the main open reading frame of the mRNA. But there may be others that could act in trans on other biological processes. The question of how many peptide-coding genes may exist is therefore worth revisiting. This poses new bioinformatic challenges that can only be resolved through multiple genome comparisons within a range of evolutionary distances.

  15. Gene Therapy Vectors with Enhanced Transfection Based on Hydrogels Modified with Affinity Peptides

    PubMed Central

    Shepard, Jaclyn A.; Wesson, Paul J.; Wang, Christine E.; Stevans, Alyson C.; Holland, Samantha J.; Shikanov, Ariella; Grzybowski, Bartosz A.; Shea, Lonnie D.

    2011-01-01

    Regenerative strategies for damaged tissue aim to present biochemical cues that recruit and direct progenitor cell migration and differentiation. Hydrogels capable of localized gene delivery are being developed to provide a support for tissue growth, and as a versatile method to induce the expression of inductive proteins; however, the duration, level, and localization of expression isoften insufficient for regeneration. We thus investigated the modification of hydrogels with affinity peptides to enhance vector retention and increase transfection within the matrix. PEG hydrogels were modified with lysine-based repeats (K4, K8), which retained approximately 25% more vector than control peptides. Transfection increased 5- to 15-fold with K8 and K4 respectively, over the RDG control peptide. K8- and K4-modified hydrogels bound similar quantities of vector, yet the vector dissociation rate was reduced for K8, suggesting excessive binding that limited transfection. These hydrogels were subsequently applied to an in vitro co-culture model to induce NGF expression and promote neurite outgrowth. K4-modified hydrogels promoted maximal neurite outgrowth, likely due to retention of both the vector and the NGF. Thus, hydrogels modified with affinity peptides enhanced vector retention and increased gene delivery, and these hydrogels may provide a versatile scaffold for numerous regenerative medicine applications. PMID:21514659

  16. Engineering a Recombinant Baculovirus with a Peptide Hormone Gene and its Effect on the Corn Earworm, Helicoverpa zea

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The helicokinins are peptides identified from Helicoverpa zea that when injected into the larvae were found to cause excessive diuresis and loss of feeding activity. Of the three peptides, helicokinin II (HezK-II) was found to be most potent. A synthetic gene encoding HezK-II was constructed based o...

  17. Rapid evolution of antimicrobial peptide genes in an insect host-social parasite system.

    PubMed

    Erler, Silvio; Lhomme, Patrick; Rasmont, Pierre; Lattorff, H Michael G

    2014-04-01

    Selection, as a major driver for evolution in host-parasite interactions, may act on two levels; the virulence of the pathogen, and the hosts' defence system. Effectors of the host defence system might evolve faster than other genes e.g. those involved in adaptation to changes in life history or environmental fluctuations. Host-parasite interactions at the level of hosts and their specific social parasites, present a special setting for evolutionarily driven selection, as both share the same environmental conditions and pathogen pressures. Here, we study the evolution of antimicrobial peptide (AMP) genes, in six host bumblebee and their socially parasitic cuckoo bumblebee species. The selected AMP genes evolved much faster than non-immune genes, but only defensin-1 showed significant differences between host and social parasite. Nucleotide diversity and codon-by-codon analyses confirmed that purifying selection is the main selective force acting on bumblebee defence genes.

  18. The effect of dexamethasone/cell-penetrating peptide nanoparticles on gene delivery for inner ear therapy

    PubMed Central

    Yoon, Ji Young; Yang, Keum-Jin; Park, Shi-Nae; Kim, Dong-Kee; Kim, Jong-Duk

    2016-01-01

    Dexamethasone (Dex)-loaded PHEA-g-C18-Arg8 (PCA) nanoparticles (PCA/Dex) were developed for the delivery of genes to determine the synergistic effect of Dex on gene expression. The cationic PCA nanoparticles were self-assembled to create cationic micelles containing an octadecylamine (C18) core with Dex and an arginine 8 (Arg8) peptide shell for electrostatic complexation with nucleic acids (connexin 26 [Cx26] siRNA, green fluorescent protein [GFP] DNA or brain-derived neurotrophic factor [BDNF] pDNA). The PCA/Dex nanoparticles conjugated with Arg8, a cell-penetrating peptide that enhances permeability through a round window membrane in the inner ear for gene delivery, exhibited high uptake efficiency in HEI-OC1 cells. This potential carrier co-delivering Dex and the gene into inner ear cells has a diameter of 120–140 nm and a zeta potential of 20–25 mV. Different types of genes were complexed with the Dex-loaded PCA nanoparticle (PCA/Dex/gene) for gene expression to induce additional anti-inflammatory effects. PCA/Dex showed mildly increased expression of GFP and lower mRNA expression of inflammatory cytokines (IL1b, IL12, and INFr) than did Dex-free PCA nanoparticles and Lipofectamine® reagent in HEI-OC1 cells. In addition, after loading Cx26 siRNA onto the surface of PCA/Dex, Cx26 gene expression was downregulated according to real-time polymerase chain reaction for 24 h, compared with that using Lipofectamine reagent. After loading BDNF DNA into PCA/Dex, increased expression of BDNF was observed for 30 h, and its signaling pathway resulted in an increase in phosphorylation of Akt, observed by Western blotting. Thus, Dex within PCA/Dex/gene nanoparticles created an anti-inflammatory effect and enhanced gene expression. PMID:27895484

  19. Identification of Mycobacterium avium genes associated with resistance to host antimicrobial peptides

    PubMed Central

    Motamedi, Nima; Danelishvili, Lia

    2014-01-01

    Antimicrobial peptides are an important component of the innate immune defence. Mycobacterium avium subsp. hominissuis (M. avium) is an organism that establishes contact with the respiratory and gastrointestinal mucosa as a necessary step for infection. M. avium is resistant to high concentrations of polymyxin B, a surrogate for antimicrobial peptides. To determine gene-encoding proteins that are associated with this resistance, we screened a transposon library of M. avium strain 104 for susceptibility to polymyxin B. Ten susceptible mutants were identified and the inactivated genes sequenced. The great majority of the genes were related to cell wall synthesis and permeability. The mutants were then examined for their ability to enter macrophages and to survive macrophage killing. Three clones among the mutants had impaired uptake by macrophages compared with the WT strain, and all ten clones were attenuated in macrophages. The mutants were also shown to be susceptible to cathelicidin (LL-37), in contrast to the WT bacterium. All but one of the mutants were significantly attenuated in mice. In conclusion, this study indicated that the M. avium envelope is the primary defence against host antimicrobial peptides. PMID:24836414

  20. Screening, Expression, Purification and Functional Characterization of Novel Antimicrobial Peptide Genes from Hermetia illucens (L.)

    PubMed Central

    Elhag, Osama; Zhou, Dingzhong; Song, Qi; Soomro, Abdul Aziz; Cai, Minmin; Zheng, Longyu; Yu, Ziniu; Zhang, Jibin

    2017-01-01

    Antimicrobial peptides from a wide spectrum of insects possess potent microbicidal properties against microbial-related diseases. In this study, seven new gene fragments of three types of antimicrobial peptides were obtained from Hermetia illucens (L), and were named cecropinZ1, sarcotoxin1, sarcotoxin (2a), sarcotoxin (2b), sarcotoxin3, stomoxynZH1, and stomoxynZH1(a). Among these genes, a 189-basepair gene (stomoxynZH1) was cloned into the pET32a expression vector and expressed in the Escherichia coli as a fusion protein with thioredoxin. Results show that Trx-stomoxynZH1 exhibits diverse inhibitory activity on various pathogens, including Gram-positive bacterium Staphylococcus aureus, Gram-negative bacterium Escherichia coli, fungus Rhizoctonia solani Khün (rice)-10, and fungus Sclerotinia sclerotiorum (Lib.) de Bary-14. The minimum inhibitory concentration of Trx-stomoxynZH1 is higher against Gram-positive bacteria than against Gram-negative bacteria but similar between the fungal strains. These results indicate that H. illucens (L.) could provide a rich source for the discovery of novel antimicrobial peptides. Importantly, stomoxynZH1 displays a potential benefit in controlling antibiotic-resistant pathogens. PMID:28056070

  1. Screening, Expression, Purification and Functional Characterization of Novel Antimicrobial Peptide Genes from Hermetia illucens (L.).

    PubMed

    Elhag, Osama; Zhou, Dingzhong; Song, Qi; Soomro, Abdul Aziz; Cai, Minmin; Zheng, Longyu; Yu, Ziniu; Zhang, Jibin

    2017-01-01

    Antimicrobial peptides from a wide spectrum of insects possess potent microbicidal properties against microbial-related diseases. In this study, seven new gene fragments of three types of antimicrobial peptides were obtained from Hermetia illucens (L), and were named cecropinZ1, sarcotoxin1, sarcotoxin (2a), sarcotoxin (2b), sarcotoxin3, stomoxynZH1, and stomoxynZH1(a). Among these genes, a 189-basepair gene (stomoxynZH1) was cloned into the pET32a expression vector and expressed in the Escherichia coli as a fusion protein with thioredoxin. Results show that Trx-stomoxynZH1 exhibits diverse inhibitory activity on various pathogens, including Gram-positive bacterium Staphylococcus aureus, Gram-negative bacterium Escherichia coli, fungus Rhizoctonia solani Khün (rice)-10, and fungus Sclerotinia sclerotiorum (Lib.) de Bary-14. The minimum inhibitory concentration of Trx-stomoxynZH1 is higher against Gram-positive bacteria than against Gram-negative bacteria but similar between the fungal strains. These results indicate that H. illucens (L.) could provide a rich source for the discovery of novel antimicrobial peptides. Importantly, stomoxynZH1 displays a potential benefit in controlling antibiotic-resistant pathogens.

  2. Intermedin in rat uterus: changes in gene expression and peptide levels across the estrous cycle and its effects on uterine contraction

    PubMed Central

    2013-01-01

    Background The present study demonstrates the expression of intermedin (IMD) and its receptor components in the uterus of the female rat during the estrous cycle and its effect on uterine contraction. Methods The gene expression level of intermedin and its receptor components and the peptide level of intermedin were studied by real-time RT-PCR and enzyme immunoassay (EIA) respectively. The separation of precursor and mature IMD was studied by gel filtration chromatography and EIA. The localization of IMD in the uterus was investigated by immunohistochemistry. The effect of IMD on in vitro uterine contraction was studied by organ bath technique. Results Uterine mRNAs of Imd and its receptor components and IMD levels displayed cyclic changes across the estrous cycle. Imd mRNA level was the highest at proestrus while the IMD level was the highest at diestrus. IMD was found in the luminal and glandular epithelia and IMD treatment significantly reduced the amplitude and frequency of uterine contraction but not the basal tone. Both calcitonin gene-related peptide (CGRP) receptor antagonist hCGRP8-37 and adrenomedullin (ADM) receptor antagonist hADM22-52 partially abolished the inhibitory effect of IMD on uterine contraction while the specific IMD receptor antagonist hIMD17-47 completely blocked the actions. The enzyme inhibitors of NO (L-NAME) and PI3K (Wortmannin) pathways diminished the IMD effects on uterine contraction while the cAMP/PKA blocker, KT5720, had no effect, indicating an involvement of NO and PI3K/Akt but not PKA. Conclusions IMD and the gene expression of its receptor components are differentially regulated in the uterus during the estrous cycle and IMD inhibits uterine contraction by decreasing the amplitude and frequency. PMID:23442365

  3. Bioplex technology: novel synthetic gene delivery pharmaceutical based on peptides anchored to nucleic acids.

    PubMed

    Simonson, Oscar E; Svahn, Mathias G; Törnquist, Elisabeth; Lundin, Karin E; Smith, C I E

    2005-01-01

    Non-viral gene delivery is an important approach in order to establish safe in vivo gene therapy in the clinic. Although viral vectors currently exhibit superior gene transfer efficacy, the safety aspect of viral gene delivery is a concern. In order to improve non-viral in vivo gene delivery we have designed a pharmaceutical platform called Bioplex (biological complex). The concept of Bioplex is to link functional entities via hybridising anchors, such as Peptide Nucleic Acids (PNA), directly to naked DNA. In order to promote delivery functional entities consisting of biologically active peptides or carbohydrates, are linked to the PNA anchor. The PNA acts as genetic glue and hybridises with DNA in a sequence specific manner. By using functional entities, which elicit receptor-mediated endocytosis, improved endosomal escape and enhance nuclear entry we wish to improve the transfer of genetic material into the cell. An important aspect is that the functional entities should also have tissue-targeting properties in vivo. Examples of functional entities investigated to date are the Simian virus 40 nuclear localisation signal to improve nuclear uptake and different carbohydrate ligands in order to achieve receptor specific uptake. The delivery system is also endowed with regulatory capability, since the release of functional entities can be controlled. The aim is to create a safe, pharmaceutically defined and stable delivery system for nucleic acids with enhanced transfection properties that can be used in the clinic.

  4. Core-Gene-Encoded Peptide Regulating Virulence-Associated Traits in Streptococcus mutans

    PubMed Central

    Kim, Jeong Nam; Stanhope, Michael J.

    2013-01-01

    Recently, high-coverage genome sequence of 57 isolates of Streptococcus mutans, the primary etiological agent of human dental caries, was completed. The SMU.1147 gene, encoding a 61-amino-acid (61-aa) peptide, was present in all sequenced strains of S. mutans but absent in all bacteria in current databases. Reverse transcription-PCR revealed that SMU.1147 is cotranscribed with scnK and scnR, which encode the histidine kinase and response regulator, respectively, of a two-component system (TCS). The C terminus of the SMU.1147 gene product was tagged with a FLAG epitope and shown to be expressed in S. mutans by Western blotting with an anti-FLAG antibody. A nonpolar mutant of SMU.1147 formed less biofilm in glucose-containing medium and grew slower than did the wild-type strain under aerobic and anaerobic conditions, at low pH, or in the presence of H2O2. Mutation of SMU.1147 dramatically reduced genetic competence and expression of comX and comY, compared to S. mutans UA159. The competence defect of the SMU.1147 mutant could not be overcome by addition of sigX-inducing peptide (XIP) in defined medium or by competence-stimulating peptide (CSP) in complex medium. Complementation with SMU.1147 on a plasmid restored all phenotypes. Interestingly, mutants lacking either one of the TCS components and a mutant lacking all three genes behaved like the wild-type strain for all phenotypes mentioned above, but all mutant strains grew slower than UA159 in medium supplemented with 0.3 M NaCl. Thus, the SMU.1147-encoded peptide affects virulence-related traits and dominantly controls quorum-sensing pathways for development of genetic competence in S. mutans. PMID:23603743

  5. Interaction of divalent cations with peptide fragments from Parkinson's disease genes.

    PubMed

    Remelli, Maurizio; Peana, Massimiliano; Medici, Serenella; Delogu, Lucia Gemma; Zoroddu, Maria Antonietta

    2013-05-07

    Protected Ac-PDEKHEL-NH(2) (PK9-H) and Ac-FCGDGANDCG-NH(2) (PK9-C) peptide fragments corresponding to sequences from residues 1165 to 1171 and 1184 to 1193, respectively, in the Park9 encoded protein from Parkinson's disease gene were tested for their protonation and complex formation capabilities with Cu(II), Zn(II) and Mn(II) ions by potentiometric and UV-Vis measurements. The effects of peptide titration with the metal ions have been followed by mono- and bi-dimensional NMR spectroscopy in order to support the potentiometric results and to understand the details of metal binding. Only mononuclear complexes have been evidenced for all the checked metal ions with PK9-H peptide. Mononuclear and bis-complexes with PK9-C peptide have been evidenced with Cu(II) and Zn(II) metal ions. From the dissociation-constants and pM values obtained for the binary competition diagrams for the systems containing Cu(II), Zn(II) or Mn(II) and the two ligands, the Cu(II) ion is able to bind more efficiently than Zn(II) and Mn(II) metal ions to both ligands.

  6. Gene coevolution and regulation lock cyclic plant defence peptides to their targets.

    PubMed

    Gilding, Edward K; Jackson, Mark A; Poth, Aaron G; Henriques, Sónia Troeira; Prentis, Peter J; Mahatmanto, Tunjung; Craik, David J

    2016-04-01

    Plants have evolved many strategies to protect themselves from attack, including peptide toxins that are ribosomally synthesized and thus adaptable directly by genetic polymorphisms. Certain toxins in Clitoria ternatea (butterfly pea) are cyclic cystine-knot peptides of c. 30 residues, called cyclotides, which have co-opted the plant's albumin-1 gene family for their production. How butterfly pea albumin-1 genes were commandeered and how these cyclotides are utilized in defence remain unclear. The role of cyclotides in host plant ecology and biotechnological applications requires exploration. We characterized the sequence diversity and expression dynamics of precursor and processing proteins implicated in butterfly pea cyclotide biosynthesis by expression profiling through RNA-sequencing (RNA-seq). Peptide-enriched extracts from various organs were tested for activity against insect-like membranes and the model nematode Caenorhabditis elegans. We found that the evolution and deployment of cyclotides involved their diversification to exhibit different chemical properties and expression between organs facing different defensive challenges. Cyclotide-enriched fractions from soil-contacting organs were effective at killing nematodes, whereas similar enriched fractions from aerial organs contained cyclotides that exhibited stronger interactions with insect-like membrane lipids. Cyclotides are employed as versatile and combinatorial mediators of defence in C. ternatea and have specialized to affect different classes of attacking organisms.

  7. Molecular Characterization of Antimicrobial Peptide Genes of the Carpenter Ant Camponotus floridanus

    PubMed Central

    Ratzka, Carolin; Förster, Frank; Liang, Chunguang; Kupper, Maria; Dandekar, Thomas; Feldhaar, Heike; Gross, Roy

    2012-01-01

    The production of antimicrobial peptides (AMPs) is a major defense mechanism against pathogen infestation and of particular importance for insects relying exclusively on an innate immune system. Here, we report on the characterization of three AMPs from the carpenter ant Camponotus floridanus. Due to sequence similarities and amino acid composition these peptides can be classified into the cysteine-rich (e.g. defensin) and glycine-rich (e.g. hymenoptaecin) AMP groups, respectively. The gene and cDNA sequences of these AMPs were established and their expression was shown to be induced by microbial challenge. We characterized two different defensin genes. The defensin-2 gene has a single intron, whereas the defensin-1 gene has two introns. The deduced amino acid sequence of the C. floridanus defensins is very similar to other known ant defensins with the exception of a short C-terminal extension of defensin-1. The hymenoptaecin gene has a single intron and a very peculiar domain structure. The corresponding precursor protein consists of a signal- and a pro-sequence followed by a hymenoptaecin-like domain and six directly repeated hymenoptaecin domains. Each of the hymenoptaecin domains is flanked by an EAEP-spacer sequence and a RR-site known to be a proteolytic processing site. Thus, proteolytic processing of the multipeptide precursor may generate several mature AMPs leading to an amplification of the immune response. Bioinformatical analyses revealed the presence of hymenoptaecin genes with similar multipeptide precursor structure in genomes of other ant species suggesting an evolutionary conserved important role of this gene in ant immunity. PMID:22912782

  8. HPMA-oligolysine copolymers for gene delivery: optimization of peptide length and polymer molecular weight.

    PubMed

    Johnson, Russell N; Chu, David S H; Shi, Julie; Schellinger, Joan G; Carlson, Peter M; Pun, Suzie H

    2011-10-30

    Polycations are one of the most frequently used classes of materials for non-viral gene transfer in vivo. Several studies have demonstrated a sensitive relationship between polymer structure and delivery activity. In this work, we used reverse addition-fragmentation chain transfer (RAFT) polymerization to build a panel of N-(2-hydroxypropyl)methacrylamide (HPMA)-oligolysine copolymers with varying peptide length and polymer molecular weight. The panel was screened for optimal DNA-binding, colloidal stability in salt, high transfection efficiency, and low cytotoxicity. Increasing polyplex stability in PBS correlated with increasing polymer molecular weight and decreasing peptide length. Copolymers containing K(5) and K(10) oligocations transfected cultured cells with significantly higher efficiencies than copolymers of K(15). Four HPMA-oligolysine copolymers were identified that met the desired criteria. Polyplexes formed with these copolymers demonstrated both salt stability and transfection efficiencies on-par with poly(ethylenimine) PEI in cultured cells.

  9. Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake.

    PubMed

    Zhang, Jian V; Ren, Pei-Gen; Avsian-Kretchmer, Orna; Luo, Ching-Wei; Rauch, Rami; Klein, Cynthia; Hsueh, Aaron J W

    2005-11-11

    Ghrelin, a circulating appetite-inducing hormone, is derived from a prohormone by posttranslational processing. On the basis of the bioinformatic prediction that another peptide also derived from proghrelin exists, we isolated a hormone from rat stomach and named it obestatin-a contraction of obese, from the Latin "obedere," meaning to devour, and "statin," denoting suppression. Contrary to the appetite-stimulating effects of ghrelin, treatment of rats with obestatin suppressed food intake, inhibited jejunal contraction, and decreased body-weight gain. Obestatin bound to the orphan G protein-coupled receptor GPR39. Thus, two peptide hormones with opposing action in weight regulation are derived from the same ghrelin gene. After differential modification, these hormones activate distinct receptors.

  10. Characterization of Treefoil Peptide Genes in Iron-Ion or X-Irradiated Human Cells

    NASA Technical Reports Server (NTRS)

    Balcer-Kubiczek, E. K.; Harrison, G. H.; Xu, J. F.; Zhou, X. F.

    1999-01-01

    The gastrointestinal (GI) tract is especially sensitive to ionizing radiation, probably because of its high rate of cell turn over. Most of the data in the literature concerns the histological/anatomical description of damage rather than functional studies. In fact, previous reports in humans have shown that, at doses of 2 Gy or more, functional abnormalities appear indicating that in radiation sensitive tissues the effects of radiation are not limited to cell death. GI functions are controlled in particular by GI peptides. One hypothesis is that ionizing radiation may modulate the synthesis and release of these peptides and consequently may contribute largely to abnormalities in GI function. However, no previous studies have been concerned with GI-specific gene expression in irradiated GI tissues. The family of human trefoil peptides comprises three members thus far, all of which are expressed in specific regions of the GI tract. In addition, two trefoil peptides, pS2 (TFFI) and HITF (TFF2) are expressed in breast tissue. Their exact function in GI and breast tissues is unclear but mucosal integrity, repair, mucin secretion and responsiveness to hormones have been shown. We recently isolated and characterized pS2 as a novel p53- and estrogen receptor-independent gene whose MRNA expression in several cells lines was found to be delayed 4 to 7 days after irradiation with X-rays, fission neutrons or 1 GeV/n Fe-ions. The aim of the present study was to determine whether pS2 and HITF have a similar induction kinetics in irradiated gastric and breast cell lines, and whether they have the phorbol ester (TPA) responsive element (TRE).

  11. Diversity of Nonribosomal Peptide Synthetase Genes in the Microbial Metagenomes of Marine Sponges

    PubMed Central

    Pimentel-Elardo, Sheila Marie; Grozdanov, Lubomir; Proksch, Sebastian; Hentschel, Ute

    2012-01-01

    Genomic mining revealed one major nonribosomal peptide synthetase (NRPS) phylogenetic cluster in 12 marine sponge species, one ascidian, an actinobacterial isolate and seawater. Phylogenetic analysis predicts its taxonomic affiliation to the actinomycetes and hydroxy-phenyl-glycine as a likely substrate. Additionally, a phylogenetically distinct NRPS gene cluster was discovered in the microbial metagenome of the sponge Aplysina aerophoba, which shows highest similarities to NRPS genes that were previously assigned, by ways of single cell genomics, to a Chloroflexi sponge symbiont. Genomic mining studies such as the one presented here for NRPS genes, contribute to on-going efforts to characterize the genomic potential of sponge-associated microbiota for secondary metabolite biosynthesis. PMID:22822366

  12. Identification, sequence and expression of a crustacean cardioactive peptide (CCAP) gene in the moth Manduca sexta.

    PubMed

    Loi, P K; Emmal, S A; Park, Y; Tublitz, N J

    2001-08-01

    The crustacean cardioactive peptide (CCAP) gene was isolated from the tobacco hawkmoth Manduca sexta. The gene has an open reading frame of 125 amino acid residues containing a single, complete copy of CCAP. Analysis of the gene structure revealed three introns interrupting the coding region. A comparison of the M. sexta CCAP gene with the Drosophila melanogaster genome database reveals significant similarities in sequence and gene structure. The spatial and temporal expression patterns of the CCAP gene in the M. sexta central nervous system were determined in all major post-embryonic stages using in situ hybridization techniques. The CCAP gene is expressed in a total of 116 neurons in the post-embryonic M. sexta central nervous system. Nine pairs of cells are observed in the brain, 4.5 pairs in the subesophageal ganglion, three pairs in each thoracic ganglion (T1-T3), three pairs in the first abdominal ganglion (A1), five pairs each in the second to sixth abdominal ganglia (A2-A6) and 7.5 pairs in the terminal ganglion. The CCAP gene is expressed in every ganglion in each post-embryonic stage, except in the thoracic ganglia of first- and second-instar larvae. The number of cells expressing the CCAP gene varies during post-embryonic life, starting at 52 cells in the first instar and reaching a maximum of 116 shortly after pupation. One set of thoracic neurons expressing CCAP mRNA shows unusual variability in expression levels immediately prior to larval ecdysis. Using previously published CCAP immunocytochemical data, it was determined that 91 of 95 CCAP-immunopositive neurons in the M. sexta central nervous system also express the M. sexta CCAP gene, indicating that there is likely to be only a single CCAP gene in M. sexta.

  13. A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles.

    PubMed

    Piel, Jörn

    2002-10-29

    Many drug candidates from marine and terrestrial invertebrates are suspected metabolites of uncultured bacterial symbionts. The antitumor polyketides of the pederin family, isolated from beetles and sponges, are an example. Drug development from such sources is commonly hampered by low yields and the difficulty of sustaining invertebrate cultures. To obtain insight into the true producer and find alternative supplies of these rare drug candidates, the putative pederin biosynthesis genes were cloned from total DNA of Paederus fuscipes beetles, which use this compound for chemical defense. Sequence analysis of the gene cluster and adjacent regions revealed the presence of ORFs with typical bacterial architecture and homologies. The ped cluster, which is present only in beetle specimens with high pederin content, is located on a 54-kb region bordered by transposase pseudogenes and encodes a mixed modular polyketide synthase/nonribosomal peptide synthetase. Notably, none of the modules contains regions with homology to acyltransferase domains, but two copies of isolated monodomain acyltransferase genes were found at the upstream end of the cluster. In line with an involvement in pederin biosynthesis, the upstream cluster region perfectly mirrors pederin structure. The unexpected presence of additional polyketide synthase/nonribosomal peptide synthetase modules reveals surprising insights into the evolutionary relationship between pederin-type pathways in beetles and sponges.

  14. Non-ribosomal peptide synthetases: Identifying the cryptic gene clusters and decoding the natural product.

    PubMed

    Singh, Mangal; Chaudhary, Sandeep; Sareen, Dipti

    2017-03-01

    Non-ribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) present in bacteria and fungi are the major multi-modular enzyme complexes which synthesize secondary metabolites like the pharmacologically important antibiotics and siderophores. Each of the multiple modules of an NRPS activates a different amino or aryl acid, followed by their condensation to synthesize a linear or cyclic natural product. The studies on NRPS domains, the knowledge of their gene cluster architecture and tailoring enzymes have helped in the in silico genetic screening of the ever-expanding sequenced microbial genomic data for the identification of novel NRPS/PKS clusters and thus deciphering novel non-ribosomal peptides (NRPs). Adenylation domain is an integral part of the NRPSs and is the substrate selecting unit for the final assembled NRP. In some cases, it also requires a small protein, the MbtH homolog, for its optimum activity. The presence of putative adenylation domain and MbtH homologs in a sequenced genome can help identify the novel secondary metabolite producers. The role of the adenylation domain in the NRPS gene clusters and its characterization as a tool for the discovery of novel cryptic NRPS gene clusters are discussed.

  15. Optimization and internalization mechanisms of PEGylated adenovirus vector with targeting peptide for cancer gene therapy.

    PubMed

    Yao, Xing-Lei; Yoshioka, Yasuo; Ruan, Gui-Xin; Chen, Yu-Zhe; Mizuguchi, Hiroyuki; Mukai, Yohei; Okada, Naoki; Gao, Jian-Qing; Nakagawa, Shinsaku

    2012-08-13

    We have previously developed a novel adenovirus vector (Adv) that targeted tumor tissues/vasculatures after systemic administration. The surface of this Adv is conjugated with CGKRK tumor homing peptide by the cross-linking reaction of polyethyleneglycol (PEG). In this study, we showed that the condition of PEG modification was important to minimize the gene expression in normal tissues after systemic treatment. When Adv was modified only with PEG-linked CGKRK, its luciferase expression was enhanced even in the liver tissue, as well as the tumor tissue. However, in the reaction with the mixture of non-cross-linking PEG and PEG-linked CGKRK, we found out that the best modification could suppress its gene expression in the liver, without losing that in the tumor. We also studied the internalization mechanisms of CGKRK-conjugated Adv. Results suggested that there is a specific interaction of the CGKRK peptide with a receptor at the cell surface enabling efficient internalization of CGKRK-conjugated Adv. The presence of cell-surface heparan sulfate is important receptor for the cellular binding and uptake of CGKRK-conjugated Adv. Moreover, macropinocytosis-mediated endocytosis is also important in endocytosis of CGKRK-conjugated Adv, aside from clathrin-mediated and caveolae-mediated endocytosis. These results could help evaluate the potentiality of CGKRK-conjugated Adv as a prototype vector with suitable efficacy and safety for systemic cancer gene therapy.

  16. A Novel TetR-Regulating Peptide Turns off rtTA-Mediated Activation of Gene Expression

    PubMed Central

    Schmidt, Sebastian; Berens, Christian; Klotzsche, Marcus

    2014-01-01

    Conditional regulation of gene expression is a powerful and indispensable method for analyzing gene function. The “Tet-On” system is a tool widely used for that purpose. Here, the transregulator rtTA mediates expression of a gene of interest after addition of the small molecule effector doxycycline. Although very effective in rapidly turning on gene expression, the system is hampered by the long half-life of doxycycline which makes shutting down gene expression rapidly very difficult to achieve. We isolated an rtTA-binding peptide by in vivo selection that acts as a doxycycline antagonist and leads to rapid and efficient shut down of rtTA-mediated reporter gene expression in a human cell line. This peptide represents the basis for novel effector molecules which complement the “Tet-system” by enabling the investigator to rapidly turn gene expression not just on at will, but now also off. PMID:24810590

  17. An alpha-helical cationic antimicrobial peptide selectively modulates macrophage responses to lipopolysaccharide and directly alters macrophage gene expression.

    PubMed

    Scott, M G; Rosenberger, C M; Gold, M R; Finlay, B B; Hancock, R E

    2000-09-15

    Certain cationic antimicrobial peptides block the binding of LPS to LPS-binding protein and reduce the ability of LPS to induce the production of inflammatory mediators by macrophages. To gain a more complete understanding of how LPS activates macrophages and how cationic peptides influence this process, we have used gene array technology to profile gene expression patterns in macrophages treated with LPS in the presence or the absence of the insect-derived cationic antimicrobial peptide CEMA (cecropin-melittin hybrid). We found that CEMA selectively blocked LPS-induced gene expression in the RAW 264.7 macrophage cell line. The ability of LPS to induce the expression of >40 genes was strongly inhibited by CEMA, while LPS-induced expression of another 16 genes was relatively unaffected. In addition, CEMA itself induced the expression of a distinct set of 35 genes, including genes involved in cell adhesion and apoptosis. Thus, CEMA, a synthetic alpha-helical peptide, selectively modulates the transcriptional response of macrophages to LPS and can alter gene expression in macrophages.

  18. Novel gelatin siloxane nanoparticles decorated by Tat peptide as vectors for gene therapy

    NASA Astrophysics Data System (ADS)

    Wang, Zu-yong; Zhao, Yang; Ren, Lei; Jin, Li-hua; Sun, Li-ping; Yin, Pei; Zhang, Ya-fei; Zhang, Qi-Qing

    2008-11-01

    In principle, the technique of gene delivery involves taking complete or parts of genes that can code specific messages and delivering them to selected cells in the body. Such a transfer of plasmid DNA into mammalian cells has posed major challenges for gene therapy. A series of gelatin-siloxane nanoparticles (GS NPs) with controlled size and surface charge were synthesized through a two-step sol-gel process. In order to increase the efficiency of cellular uptake, HIV-derived Tat peptide was further grafted to GS NPs. In vitro co-location and endocytosis inhibition experiments suggested that the as-synthesized TG NPs may enter HeLa cells via a combined pathway of lipid-raft- and receptor-dependent endocytosis, and only cause little cell damage. Moreover, this study shows the encapsulation of a plasmid DNA in TG NPs to be obtained as a non-viral gene vector. This kind of encapsulation provides complete protection to the plasmid DNA from the external DNase and serum environment, and generates the hope that the resulting formulation can be developed into a potential vector for effective gene delivery. In order to check this potential, the reporter gene pSVβ-gal was encapsulated, and in vitro transfection efficiency of this system was found to be nearly 130% compared to the commercially available transfection reagent Lipofectamine™.

  19. The flow of antimicrobial peptide genes through a genetic barrier between Mytilus edulis and M. galloprovincialis.

    PubMed

    Boon, Eva; Faure, Matthieu F; Bierne, Nicolas

    2009-05-01

    with previous reports of an effect of slight selection on AMP genes evolution in other invertebrates, although selection does not necessarily act on the mature peptides.

  20. Expression of the atrial natriuretic peptide gene in the cardiac muscle of rat extrapulmonary and intrapulmonary veins.

    PubMed Central

    Springall, D R; Bhatnagar, M; Wharton, J; Hamid, Q; Gulbenkian, S; Hedges, M; Meleagros, L; Bloom, S R; Polak, J M

    1988-01-01

    Atrial natriuretic peptide is a peptide regulating salt and water balance, originally isolated from the cardiac atrium, where it is synthesised as part of a precursor molecule in specialised myocardial cells. The myocardium extends into the extrapulmonary part of the pulmonary veins in many species, including man. In some small mammals, however, such as the rat, mouse, and bat, it extends further to veins in the peripheral parts of the lung. Since this myocardial layer is continuous with that in the atrium, we have looked for the possible expression of the atrial natriuretic peptide gene in this tissue in rats. Strong immunoreactivity was seen for both the peptide and the N terminal sequence (cardiodilatin) of its precursor in extrapulmonary veins and in intrapulmonary veins extending into the lung as far as the second branching point, where it was localised in the dense cored granules by electron microscopy; in situ hybridisation showed atrial natriuretic peptide messenger RNA at identical sites. Chromatography and radioimmunoassay of extracts of extrapulmonary and intrapulmonary veins showed most of the atrial natriuretic peptide immunoreactivity to be in the uncleaved (precursor molecule) form. Thus the peptide is synthesised in veins both outside and inside the lung, and these extra-atrial sites may be an important additional source of circulating atrial natriuretic peptide. Images PMID:2965426

  1. Whole rat DNA array survey for candidate genes related to hypertension in kidneys from three spontaneously hypertensive rat substrains at two stages of age and with hypotensive induction caused by hydralazine hydrochloride.

    PubMed

    Kinoshita, Kosho; Ashenagar, Mohammad Said; Tabuchi, Masaki; Higashino, Hideaki

    2011-03-01

    Clarification of the genetic nature and more effective care for hypertension are required, given the high incidences of cardiovascular and cerebrovascular mortality. Thus, we surveyed candidate genes for hypertension with rat whole gene DNA microarrays using three novel methods. Gene expression analyses were conducted as follows: Method 1, three types of spontaneously hypertensive rat (SHR) substrains, SHR, stroke-prone SHR (SHRSP) and malignant type of SHRSP (M-SHRSP) were used and compared to normotensive Wistar Kyoto rats; Method 2, the expressed genes between rats of different ages were compared for different blood pressures; and Method 3, genes that were expressed in rats treated with or without an acute hypotensive stimulus, the antihypertensive hydralazine hydrochloride, were compared. This approach identified dozens of genes, including Dusp15, Cyp8b1, Armc 3, Gtpbp4, Mettl2, Mapk14, Prkar2b, frame 12, Anxa13, Ephx2, Myr8 and Pcdh9 by Method 1; Cyp2C and Atp12a by Method 2; and Kcnc3, Vnn1, TC560558 and Gabrq and a number of unknown genes by Methods 2 and 3, as probable candidate genes for hypertension in SHR substrains. Ephx2 was previously reported as a candidate gene in SHRs; however other genes were identified for the first time in this study. Since it was not always possible to completely demonstrate that these genes are responsible for hypertension in SHRs, further research into true candidate genes that participate in the genesis of hypertension in SHR substrains is warranted.

  2. Peptide portions may hold key to amplifying bone against porosis

    SciTech Connect

    Cotton, P.

    1990-02-02

    Pieces of peptides that are encoded in the calcitonin gene may explain enigmas in treatment of bone disease. Amplification of bone formation by two peptides with similar amino acid sequences was reported at the Third International Conference on the Fundamentals of Bone Growth at the University of California, Los Angeles (UCLA), schools of medicine and dentistry. One treatment enigma is that calcitonin regulates normal bone resorption but does not work as well when administered for the treatment of osteoporosis. While hormone therapy does work, it has wide-ranging effects like the potential for an increased risk of breast cancer. Bone-growth promotion by a better-known peptide, calcitonin gene-related peptide (CGRP), was described. The CGRP is usually processed in the nervous system and has a wide range of activity.

  3. Emerging landscape of cell penetrating peptide in reprogramming and gene editing.

    PubMed

    Liu, Huiting; Zeng, Fanhui; Zhang, Ming; Huang, Fajun; Wang, Jiajun; Guo, Jingjing; Liu, Changbai; Wang, Hu

    2016-03-28

    The plasma membrane remains a major barrier for intracellular drug delivery, to overcome this issue, a variety of approaches have been developed and used to deliver therapeutic cargos. Among these approaches, cell penetrating peptide (CPP) is promising and affords widely used vector for efficient intracellular delivery of cargos. Moreover, the latter findings including iPS reprogramming and direct transdifferentiation as well as gene editing have gradually become hot research topic; because their application in tissue engineering and disease modeling have great potential to advance innovation in precision medicine. Since the beginning, research on these approaches is mainly based on virus transduction system, while, under the consideration for obviating the risk of mutagenic insertion and enables more accurate controlling, CPP-based efficient virus-free delivery strategy has been used recently. In this review, we summarize the existing CPP-based delivery system, emerging landscape of CPP application in stem cell manipulation and reprogramming, along with CPP contributions to gene editing techniques.

  4. Genome mining unearths a hybrid nonribosomal peptide synthetase-like-pteridine synthase biosynthetic gene cluster

    PubMed Central

    Park, Hyun Bong; Perez, Corey E; Barber, Karl W; Rinehart, Jesse; Crawford, Jason M

    2017-01-01

    Nonribosomal peptides represent a large class of metabolites with pharmaceutical relevance. Pteridines, such as pterins, folates, and flavins, are heterocyclic metabolites that often serve as redox-active cofactors. The biosynthetic machineries for construction of these distinct classes of small molecules operate independently in the cell. Here, we discovered an unprecedented nonribosomal peptide synthetase-like-pteridine synthase hybrid biosynthetic gene cluster in Photorhabdus luminescens using genome synteny analysis. P. luminescens is a Gammaproteobacterium that undergoes phenotypic variation and can have both pathogenic and mutualistic roles. Through extensive gene deletion, pathway-targeted molecular networking, quantitative proteomic analysis, and NMR, we show that the genetic locus affects the regulation of quorum sensing and secondary metabolic enzymes and encodes new pteridine metabolites functionalized with cis-amide acyl-side chains, termed pepteridine A (1) and B (2). The pepteridines are produced in the pathogenic phenotypic variant and represent the first reported metabolites to be synthesized by a hybrid NRPS-pteridine pathway. These studies expand our view of the combinatorial biosynthetic potential available in bacteria. DOI: http://dx.doi.org/10.7554/eLife.25229.001

  5. A Gene Encoding Antigenic Peptides of Human Squamous Cell Carcinoma Recognized by Cytotoxic T Lymphocytes

    PubMed Central

    Shichijo, Shigeki; Nakao, Masanobu; Imai, Yasuhisa; Takasu, Hideo; Kawamoto, Mayumi; Niiya, Fumihiko; Yang, Damu; Toh, Yuji; Yamana, Hideaki; Itoh, Kyogo

    1998-01-01

    Except for melanomas, tumor antigens recognized by cytotoxic T lymphocytes (CTLs) are yet unidentified. We have identified a gene encoding antigenic peptides of human squamous cell carcinomas (SCCs) recognized by human histocompatibility leukocyte antigens (HLA)- A2601–restricted CTLs. This gene showed no similarity to known sequences, and encoded two (125- and 43-kilodalton [kD]) proteins. The 125-kD protein with the leucine zipper motif was expressed in the nucleus of the majority of proliferating cells tested, including normal and malignant cells. The 43-kD protein was expressed in the cytosol of most SCCs from various organs and half of lung adenocarcinomas, but was not expressed in other cancers nor in a panel of normal tissues. The three nonapeptides shared by the two proteins were recognized by the KE4 CTLs, and one of the peptides induced in vitro from peripheral blood mononuclear cells (PBMCs) the CTLs restricted to the autologous tumor cells. The 43-kD protein and this nonapeptide (KGSGKMKTE) may be useful for the specific immunotherapy of HLA-A2601+ epithelial cancer patients. PMID:9449708

  6. Peptide-derived Method to Transport Genes and Proteins Across Cellular and Organellar Barriers in Plants

    PubMed Central

    Chuah, Jo-Ann; Horii, Yoko; Numata, Keiji

    2016-01-01

    The capacity to introduce exogenous proteins and express (or down-regulate) specific genes in plants provides a powerful tool for fundamental research as well as new applications in the field of plant biotechnology. Viable methods that currently exist for protein or gene transfer into plant cells, namely Agrobacterium and microprojectile bombardment, have disadvantages of low transformation frequency, limited host range, or a high cost of equipment and microcarriers. The following protocol outlines a simple and versatile method, which employs rationally-designed peptides as delivery agents for a variety of nucleic acid- and protein-based cargoes into plants. Peptides are selected as tools for development of the system due to their biodegradability, reduced size, diverse and tunable properties as well as the ability to gain intracellular/organellar access. The preparation, characterization and application of optimized formulations for each type of the wide range of delivered cargoes (plasmid DNA, double-stranded DNA or RNA, and protein) are described. Critical steps within the protocol, possible modifications and existing limitations of the method are also discussed. PMID:28060264

  7. Contryphan Genes and Mature Peptides in the Venom of Nine Cone Snail Species by Transcriptomic and Mass Spectrometric Analysis.

    PubMed

    Vijayasarathy, Marimuthu; Basheer, Soorej M; Franklin, Jayaseelan Benjamin; Balaram, Padmanabhan

    2017-02-03

    The occurrence of contryphans, a class of single-disulfide-bond-containing peptides, is demonstrated by the analysis of the venom of nine species of cone snails. Ten full gene sequences and two partial gene sequences coding for contryphan precursor proteins have been identified by next-generation sequencing and compared with available sequences. The occurrence of mature peptides in isolated venom has been demonstrated by LC-ESI-MS/MS analysis. De novo sequencing of reduced, alkylated contryphans from C. frigidus and C. araneosus provides evidence of sequence variation and post-translational modification, notably gamma carboxylation of glutamic acid. The characterization of Fr965 (C. frigidus) provides a rare example of a sequence lacking Pro at position 5 in the disulfide loop. The widespread occurrence of contryphan genes and mature peptides in the venom of diverse cone snails is suggestive of their potential biological significance.

  8. Two peptides derived from trout IL-1beta have different stimulatory effects on immune gene expression after intraperitoneal administration.

    PubMed

    Hong, Suhee; Secombes, Chris J

    2009-07-01

    The aim of this study was to examine the biological activities of two IL-1beta derivatives on immune gene expression (i.e. IL-1beta, TNF-alpha, IL-8, MX, lysozyme) in fish using RT-PCR analysis, as a means to establish whether such peptides have value as immunostimulants in vivo. Two functional domains (P1 and P3) of the trout IL-1beta molecule were produced as synthetic peptides and tested for biological effects following intraperitoneal administration into rainbow trout (Oncorhynchus mykiss). P1 and P3 showed different regulatory effects on the examined genes. P1 did not stimulate proinflammatory gene expression but induced rapid expression of the antiviral gene MX. In contrast, P3 showed more widespread stimulatory effects, and increased expression of the proinflammatory genes IL-1beta and IL-8, as well as the antibacterial lysozyme gene. Such data confirm that it is possible to produce bioactive peptide derivatives of cytokine molecules, and in addition that it is possible to engineer the peptides for different stimulatory repertoires, that may have value in enhancing particular types of immune response to enhance disease resistance in fish.

  9. FMRFamide gene and peptide expression during central nervous system development of the cephalopod mollusk, Idiosepius notoides.

    PubMed

    Wollesen, Tim; Cummins, Scott F; Degnan, Bernard M; Wanninger, Andreas

    2010-01-01

    Mollusks are a showcase of brain evolution represented by several classes with a varying degree of nervous system centralization. Cellular and molecular processes involved in the evolution of the highly complex cephalopod brain from a simple, monoplacophoran-like ancestor are still obscure and homologies on the cellular level are poorly established. FMRFamide (Phe-Ile-Arg-Phe-NH(2))-related peptides (FaRPs) constitute an evolutionarily conserved and diverse group of neuropeptides in the central nervous system (CNS) of many metazoans. Herein, we provide a detailed description of the developing FMRFamide-like immunoreactive (Fa-lir) CNS of the pygmy squid Idiosepius notoides using gene expression analyses and immunocytochemistry. The open reading frame of the I. notoides FMRFamide gene InFMRF predicts one copy each of FIRFamide, FLRFamide (Phe-Leu-Arg-Phe-NH(2)), ALSGDAFLRFamide (Ala-Leu-Ser-Gly-Asp-Ala-Phe-Leu-Arg-Phe-NH(2)), and 11 copies of FMRFamide. Applying matrix-assisted laser desorption/ionization time-of-flight (ToF) mass spectrometry-based peptide profiling, we characterized all predicted FaRPs except ALSGDAFLRFamide. Two cell clusters express InFMRF and show FMRFamide-like-immunoreactivity within the palliovisceral ganglia, that is, the future posterior subesophageal mass, during the lobe differentiation phase. They project neurites via ventral axonal tracts, which form the scaffold of the future subesophageal mass. In the supraesophageal mass, InFMRF is first expressed during mid-embryogenesis in the superior and inferior buccal lobes. A neurite of the peduncle commissure represents the first Fa-lir element. Later, the sub- and supraesophageal mass interconnect via Fa-lir neurites and more brain lobes express InFMRF and FMRFamide-like peptides. InFMRF expression was observed in fewer brain lobes than Fa-lir elements. The early expression of InFMRF and FMRFamide-lir peptides in the visceral system and not the remaining CNS of the cephalopod I. notoides

  10. PEG Length and Chemical Linkage Controls Polyacridine Peptide DNA Polyplex Pharmacokinetics, Biodistribution, Metabolic Stability and In Vivo Gene Expression

    PubMed Central

    Khargharia, Sanjib; Kizzire, Koby; Ericson, Mark; Baumhover, Nicholas J.; Rice, Kevin G.

    2014-01-01

    The pharmacokinetics (PK), biodistribution and metabolism of non-viral gene delivery systems administered systemically are directly related to in vivo efficacy. The magnitude of luciferase expression in the liver of mice following a tail vein dose of a polyplex, composed of 1 μg of pGL3 in complex with a polyethylene glycol (PEG) polyacridine peptide, followed by a delayed hydrodynamic (HD) stimulation (1–9 h), depends on the HD stimulation delay time and the structure of the polyacridine peptide. As demonstrated in the present study, the PEG length and the type of chemical linkage joining PEG to the polyacridine peptide dramatically influence the in vivo gene transfer efficiency. To understand how PEG length, linkage and location influence gene transfer efficiency, detailed PK, biodistribution and HD-stimulated gene expression experiments were performed on polyplexes prepared with an optimized polyacridine peptide modified through a single terminal Cys or Pen (penicillamine) with a PEG chain of average length of 2, 5, 10, 20, or 30 kDa. The chemical linkage was examined by attaching PEG5kDa to the polyacridine peptide through a thiol-thiol (SS), thiol-maleimide (SM), thiol-vinylsulfone (SV), thiol-acetamide (SA), penicillamine-thiol-maleimide (PM) or penicillamine-thiol-thiol (PS). The influence of PEG location was analyzed by attaching PEG5kDa to the polyacridine peptide through a C-terminal, N-terminal, or a middle Cys residue. The results established rapid metabolism of polyplexes containing SV and SA chemical linkages leads to a decreased polyplex PK half-life and a complete loss of HD-stimulated gene expression at delay times of 5 hrs. Conversely, polyplexes containing PM, PS, and SM chemical linkages were metabolically stable, allowing robust HD-stimulated expression at delay times up to 5 hrs post polyplex administration. The location of PEG5kDa within the polyacridine peptide exerted only a minor influence on the gene transfer of polyplexes. However

  11. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    PubMed

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  12. Genetic Analysis of the Atrial Natriuretic Peptide Gene Polymorphisms among Essential Hypertensive Patients in Malaysia

    PubMed Central

    Ghodsian, Nooshin; Ismail, Patimah; Ahmadloo, Salma; Eskandarian, Narges; Etemad, Ali

    2016-01-01

    Background. Atrial natriuretic peptide (ANP) considerably influences blood pressure regulation through water and sodium homoeostasis. Several of the studies have utilized anonymous genetic polymorphic markers and made inconsequent claims about the ANP relevant disorders. Thus, we screened Insertion/Deletion (ID) and G191A polymorphisms of ANP to discover sequence variations with potential functional significance and to specify the linkage disequilibrium pattern between polymorphisms. The relationships of detected polymorphisms with EH with or without Type 2 Diabetes Mellitus (T2DM) status were tested subsequently. Method. ANP gene polymorphisms (I/D and A191G) were specified utilizing mutagenically separated Polymerase Chain Reaction (PCR) in 320 subjects including 163 EH case subjects and 157 controls. Result. This case-control study discovered a significant association between I/D polymorphisms of ANP gene in EH patient without T2DM. However, the study determined no association between G191A polymorphisms of ANP in EH with or without T2DM. In addition, sociodemographic factors in the case and healthy subjects exhibited strong differences (P < 0.05). Conclusion. As a risk factor, ANP gene polymorphisms may affect hypertension. Despite the small sample size in this study, it is the first research assessing the ANP gene polymorphisms in both EH and T2DM patients among Malaysian population. PMID:27413750

  13. Enhancing gene delivery of adeno-associated viruses by cell-permeable peptides

    PubMed Central

    Liu, Yarong; Kim, Young Joo; Ji, Man; Fang, Jinxu; Siriwon, Natnaree; Zhang, Li I; Wang, Pin

    2014-01-01

    Adeno-associated virus type 2 (AAV2) is considered a promising gene delivery vector and has been extensively applied in several disease models; however, inefficient transduction in various cells and tissues has limited its widespread application in many areas of gene therapy. In this study, we have developed a general, but efficient, strategy to enhance viral transduction, both in vitro and in vivo, by incubating viral particles with cell-permeable peptides (CPPs). We show that CPPs increase internalization of viral particles into cells by facilitating both energy-independent and energy-dependent endocytosis. Moreover, CPPs can significantly enhance the endosomal escape process of viral particles, thus enhancing viral transduction to those cells that have exhibited very low permissiveness to AAV2 infection as a result of impaired intracellular viral processing. We also demonstrated that this approach could be applicable to other AAV serotypes. Thus, the membrane-penetrating ability of CPPs enables us to generate an efficient method for enhanced gene delivery of AAV vectors, potentially facilitating its applicability to human gene therapy. PMID:26015948

  14. Genetic and molecular analysis of region 88E9;88F2 in Drosophila melanogaster, including the ear gene related to human factors involved in lineage-specific leukemias.

    PubMed Central

    Zraly, Claudia B; Feng, Yun; Dingwall, Andrew K

    2002-01-01

    We identified and characterized the Drosophila gene ear (ENL/AF9-related), which is closely related to mammalian genes that have been implicated in the onset of acute lymphoblastic and myelogenous leukemias when their products are fused as chimeras with those of human HRX, a homolog of Drosophila trithorax. The ear gene product is present in all early embryonic cells, but becomes restricted to specific tissues in late embryogenesis. We mapped the ear gene to cytological region 88E11-13, near easter, and showed that it is deleted by Df(3R)ea(5022rx1), a small, cytologically invisible deletion. Annotation of the completed Drosophila genome sequence suggests that this region might contain as many as 26 genes, most of which, including ear, are not represented by mutant alleles. We carried out a large-scale noncomplementation screen using Df(3R)ea(5022rx1) and chemical (EMS) mutagenesis from which we identified seven novel multi-allele recessive lethal complementation groups in this region. An overlapping deficiency, Df(3R)Po(4), allowed us to map several of these groups to either the proximal or the distal regions of Df(3R)ea(5022rx1). One of these complementation groups likely corresponds to the ear gene as judged by map location, terminal phenotype, and reduction of EAR protein levels. PMID:11901121

  15. Gene therapy based in antimicrobial peptides and proinflammatory cytokine prevents reactivation of experimental latent tuberculosis.

    PubMed

    Ramos-Espinosa, Octavio; Hernández-Bazán, Sujhey; Francisco-Cruz, Alejandro; Mata-Espinosa, Dulce; Barrios-Payán, Jorge; Marquina-Castillo, Brenda; López-Casillas, Fernando; Carretero, Marta; Del Río, Marcela; Hernández-Pando, Rogelio

    2016-10-01

    Mycobacterium tuberculosis (Mtb) latent infection can lead to reactivation. The design of new strategies to prevent it is an important subject. B6D2F1 mice were infected intratracheally with a low dose of Mtb H37Rv to induce chronic infection. After 7 months, mice were treated with one dose of recombinant adenoviruses encoding TNFα, β defensin-3 and LL37. Immunosupression was induced 1 month later with corticosterone. In comparison with the control group, mice treated with adenoviruses showed significantly less bacterial load and pneumonia, the adenoviruses encoding TNFα and LL37 being the most efficient. Gene therapy based in a proinflammatory cytokine or antimicrobial peptides is a potentially useful system to prevent reactivation of latent tuberculosis.

  16. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    PubMed Central

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.; Song, Albert S.; Boomsma, Wouter; Bandyopadhyay, Pradip K.; Gruber, Christian W.; Purcell, Anthony W.; Yandell, Mark; Olivera, Baldomero M.

    2016-01-01

    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed conotoxin-specific PDIs, significantly and differentially accelerate the kinetics of disulfide-bond formation of several conotoxins. Our results are consistent with a unique biological scenario associated with protein folding: The diversification of a family of foldases can be correlated with the rapid evolution of an unprecedented diversity of disulfide-rich structural domains expressed by venomous marine snails in the superfamily Conoidea. PMID:26957604

  17. Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

    PubMed Central

    Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

    2016-01-01

    To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

  18. Gene for the rat atrial natriuretic peptide is regulated by glucocorticoids in vitro.

    PubMed Central

    Gardner, D G; Gertz, B J; Deschepper, C F; Kim, D Y

    1988-01-01

    Glucocorticoids regulate the expression of the gene for atrial natriuretic peptide (ANP) in neonatal cardiocytes. Dexamethasone (Dex) increased cytoplasmic ANP mRNA levels and media ANP immunoreactivity in a dose-dependent fashion. These effects were not shared by the other classes of steroid hormones and were reversed by the glucocorticoid antagonist RU 38486. The effect on ANP mRNA levels resulted, at least in part, from enhanced transcription of the gene. Dex effected a two-fold increase in ANP gene activity assessed using a run-on transcription assay. The turnover of the ANP transcript was approximated using a standard pulse-chase technique. The half-life of the ANP mRNA was 18 h in hormone-free media. In the presence of Dex this half-life increased modestly to 30 h, although the increase relative to the control did not reach statistical significance. The effect of Dex at the level of the individual myocardial cell was assessed by in situ hybridization analysis using a specific [3H]cRNA probe. These studies demonstrated a significant level of ANP expression within a subpopulation of cells in the cultures. Exposure of the cells to Dex for 24 h did not recruit additional cells into the expressing pool (27.3% cells/high power field vs. 31.3% for the control) but did increase the level of expression (i.e., grain density) within individual cells. These findings indicate that glucocorticoids stimulate expression of the ANP gene directly at the level of the myocardial cell. This results predominantly from transcriptional activation in cells already expressing the gene rather than through recruitment of previously quiescent cells. Images PMID:2971674

  19. The effect of peptidoglycan enriched diets on antimicrobial peptide gene expression in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Casadei, Elisa; Bird, Steve; Vecino, Jose L González; Wadsworth, Simon; Secombes, Christopher J

    2013-02-01

    The aim of this study was to investigate the effect of feeding rainbow trout (Oncorhynchus mykiss) peptidoglycan (PG) enriched diets on antimicrobial peptide (AMP) gene expression. Fish were divided into 5 groups and fed diets containing 0, 5, 10, 50 and 100 mg PG/Kg, and sampled 1, 7 and 14 days later. The expression of eight AMP genes (four defensins, two cathelicidins and two liver expressed AMPs) was determined in skin, gill, gut and liver, tissues important for first lines of defence or production of acute phase proteins. Up-regulation of many AMPs was found after feeding the PG enriched diets, with sequential expression seen over the time course studied, where defensins were typically expressed early and cathelicidins and LEAPs later on. A number of clear differences in AMP responsiveness between the tissues examined were also apparent. Of the four PG concentrations used, 5 mg PG/Kg did not always elicit AMP gene induction or to the same degree as seen with the other diets. The three higher dose groups generally showed similar trends although differences in fold change were more pronounced in the 50 and 100 mg PG/Kg groups. Curiously several AMPs were down-regulated after 14 days of feeding in gills, gut and liver. Nevertheless, overall the PG enriched diets had a positive effect on AMP expression. Further investigations now need to be undertaken to confirm whether this higher AMP gene expression correlates with protection against common bacterial diseases and if PG enriched diets have value as a means to temporarily boost the piscine immune system.

  20. Synchronised expressions of LPXRFamide peptide and its receptor genes: seasonal, diurnal and circadian changes during spawning period in grass puffer.

    PubMed

    Shahjahan, M; Ikegami, T; Osugi, T; Ukena, K; Doi, H; Hattori, A; Tsutsui, K; Ando, H

    2011-01-01

    Among the RFamide peptide family, the LPXRFamide peptide (LPXRFa) group regulates the release of various pituitary hormones and, recently, LPXRFa genes were found to be regulated by photoperiod via melatonin. As a first step towards investigating the role of LPXRFa on reproductive function in grass puffer (Takifugu niphobles), which spawns in semilunar cycles, genes encoding LPXRFa and its receptor (LPXRFa-R) were cloned, and seasonal, diurnal and circadian changes in their absolute amounts of mRNAs in the brain and pituitary were examined by quantitative real-time polymerase chain reaction. The grass puffer LPXRFa precursor contains two putative RFamide peptides and one possible RYamide peptide. LPXRFa and LPXRFa-R genes were extensively expressed in the diencephalon and pituitary. The expression levels of both genes were significantly elevated during the spawning periods in both sexes in the brain and pituitary, although they were low in the spawning fish just after releasing eggs and sperm. The treatment of primary pituitary cultures with goldfish LPXRFa increased the amounts of follicle-stimulating hormone β- and luteinising hormone β-subunit mRNAs. In the diencephalon, LPXRFa and LPXRFa-R genes showed synchronised diurnal and circadian variations with one peak at zeitgeber time 3 and circadian time 15, respectively. The correlated expression patterns of LPXRFa and LPXRFa-R genes in the diencephalon and pituitary and the possible stimulatory effects of LPXRFa on gonadotrophin subunit gene expression suggest the functional significance of the LPXRFa and LPXRFa-R system in the regulation of lunar-synchronised spawning of grass puffer.

  1. Characterisation of Reproduction-Associated Genes and Peptides in the Pest Land Snail, Theba pisana

    PubMed Central

    Stewart, Michael J.; Wang, Tianfang; Harding, Bradley I.; Bose, U.; Wyeth, Russell C.; Storey, Kenneth B.; Cummins, Scott F.

    2016-01-01

    Increased understanding of the molecular components involved in reproduction may assist in understanding the evolutionary adaptations used by animals, including hermaphrodites, to produce offspring and retain a continuation of their lineage. In this study, we focus on the Mediterranean snail, Theba pisana, a hermaphroditic land snail that has become a highly invasive pest species within agricultural areas throughout the world. Our analysis of T. pisana CNS tissue has revealed gene transcripts encoding molluscan reproduction-associated proteins including APGWamide, gonadotropin-releasing hormone (GnRH) and an egg-laying hormone (ELH). ELH isoform 1 (ELH1) is known to be a potent reproductive peptide hormone involved in ovulation and egg-laying in some aquatic molluscs. Two other non-CNS ELH isoforms were also present in T. pisana (Tpi-ELH2 and Tpi-ELH3) within the snail dart sac and mucous glands. Bioactivity of a synthetic ELH1 on sexually mature T. pisana was confirmed through bioassay, with snails showing ELH1-induced egg-laying behaviours, including soil burrowing and oviposition. In summary, this study presents a detailed molecular analysis of reproductive neuropeptide genes in a land snail and provides a foundation for understanding ELH function. PMID:27706146

  2. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    PubMed

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way.

  3. Hepatoma targeting peptide conjugated bio-reducible polymer complexed with oncolytic adenovirus for cancer gene therapy.

    PubMed

    Choi, Joung-Woo; Kim, Hyun Ah; Nam, Kihoon; Na, Youjin; Yun, Chae-Ok; Kim, SungWan

    2015-12-28

    Despite adenovirus (Ad) vector's numerous advantages for cancer gene therapy, such as high ability of endosomal escape, efficient nuclear entry mechanism, and high transduction, and therapeutic efficacy, tumor specific targeting and antiviral immune response still remain as a critical challenge in clinical setting. To overcome these obstacles and achieve cancer-specific targeting, we constructed tumor targeting bioreducible polymer, an arginine grafted bio-reducible polymer (ABP)-PEG-HCBP1, by conjugating PEGylated ABP with HCBP1 peptides which has high affinity and selectivity towards hepatoma. The ABP-PEG-HCBP1-conjugated replication incompetent GFP-expressing ad, (Ad/GFP)-ABP-PEG-HCBP1, showed a hepatoma cancer specific uptake and transduction compared to either naked Ad/GFP or Ad/GFP-ABP. Competition assays demonstrated that Ad/GFP-ABP-PEG-HCBP1-mediated transduction was specifically inhibited by HCBP1 peptide rather than coxsackie and adenovirus receptor specific antibody. In addition, ABP-PEG-HCBP1 can protect biological activity of Ad against serum, and considerably reduced both innate and adaptive immune response against Ad. shMet-expressing oncolytic Ad (oAd; RdB/shMet) complexed with ABP-PEG-HCBP1 delivered oAd efficiently into hepatoma cancer cells. The oAd/ABP-PEG-HCBP1 demonstrated enhanced cancer cell killing efficacy in comparison to oAd/ABP complex. Furthermore, Huh7 and HT1080 cancer cells treated with oAd/shMet-ABP-PEG-HCBP1 complex had significantly decreased Met and VEGF expression in hepatoma cancer, but not in non-hepatoma cancer. In sum, these results suggest that HCBP1-conjugated bioreducible polymer could be used to deliver oncolytic Ad safely and efficiently to treat hepatoma.

  4. Direct comparison between genomic constitution and flavonoid contents in Allium multiple alien addition lines reveals chromosomal locations of genes related to biosynthesis from dihydrokaempferol to quercetin glucosides in scaly leaf of shallot (Allium cepa L.).

    PubMed

    Masuzaki, S; Shigyo, M; Yamauchi, N

    2006-02-01

    The extrachromosome 5A of shallot (Allium cepa L., genomes AA) has an important role in flavonoid biosynthesis in the scaly leaf of Allium fistulosum-shallot monosomic addition lines (FF+nA). This study deals with the production and biochemical characterisation of A. fistulosum-shallot multiple alien addition lines carrying at least 5A to determine the chromosomal locations of genes for quercetin formation. The multiple alien additions were selected from the crossing between allotriploid FFA (female symbol) and A. fistulosum (male symbol). The 113 plants obtained from this cross were analysed by a chromosome 5A-specific PGI isozyme marker of shallot. Thirty plants were preliminarily selected for an alien addition carrying 5A. The chromosome numbers of the 30 plants varied from 18 to 23. The other extrachromosomes in 19 plants were completely identified by using seven other chromosome markers of shallot. High-performance liquid chromatography analyses of the 19 multiple additions were conducted to identify the flavonoid compounds produced in the scaly leaves. Direct comparisons between the chromosomal constitution and the flavonoid contents of the multiple alien additions revealed that a flavonoid 3'-hydroxylase (F3'H) gene for the synthesis of quercetin from kaempferol was located on 7A and that an anonymous gene involved in the glucosidation of quercetin was on 3A or 4A. As a result of supplemental SCAR analyses by using genomic DNAs from two complete sets of A. fistulosum-shallot monosomic additions, we have assigned F3'H to 7A and flavonol synthase to 4A.

  5. De-novo assembly and characterization of Chlorella minutissima UTEX2341 transcriptome by paired-end sequencing and the identification of genes related to the biosynthesis of lipids for biodiesel.

    PubMed

    Yu, Mingjia; Yang, Shanjun; Lin, Xiangzhi

    2016-02-01

    Chlorella minutissima is considered to be one of the promising feedstocks for biofuels in the future. In this study, the transcriptome from the oil-rich strain UTEX2341 of C. minutissima was generated based on Illumina paired-end sequencing. Through de-novo assembly, a total of 14,905 isogenes were obtained and compacted into 6216 unigenes. A total of 80% of the unigenes were assigned with GO terms and were further subdivided into 55 sub-categories. KEGG analysis demonstrated that 37.2% of the unigenes could be accessed and mapped into 278 pathways. Interestingly, the genes that encoded key enzymes that are involved in the biosynthesis, elongation, and metabolism of fatty acids were identified, including malonyl-CoA-ACP transacylase, 3-ketoacyl-ACP synthase, 3-ketoacyl-ACP reductase, and others. Moreover, the genes that are involved in triacylglycerol (TAG) biosynthesis and metabolism were also observed. Therefore, the transcriptome analysis of C. minutissima UTEX2341 not only supplies comprehensive insight into the molecular pathway that is involved in the biosynthesis of biofuel precursors but also provides substantial valuable genomic resources to accelerate the further development and utilization of biofuels.

  6. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP) Which Is Overexpressed in Highly Proliferating Tissues

    PubMed Central

    Szafron, Lukasz Michal; Balcerak, Anna; Grzybowska, Ewa Anna; Pienkowska-Grela, Barbara; Felisiak-Golabek, Anna; Podgorska, Agnieszka; Kulesza, Magdalena; Nowak, Natalia; Pomorski, Pawel; Wysocki, Juliusz; Rubel, Tymon; Dansonka-Mieszkowska, Agnieszka; Konopka, Bozena; Lukasik, Martyna; Kupryjanczyk, Jolanta

    2015-01-01

    CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like