SCI Identification (SCIDNT) program user's guide. [maximum likelihood method for linear rotorcraft models

NASA Technical Reports Server (NTRS)

1979-01-01

The computer program Linear SCIDNT which evaluates rotorcraft stability and control coefficients from flight or wind tunnel test data is described. It implements the maximum likelihood method to maximize the likelihood function of the parameters based on measured input/output time histories. Linear SCIDNT may be applied to systems modeled by linear constant-coefficient differential equations. This restriction in scope allows the application of several analytical results which simplify the computation and improve its efficiency over the general nonlinear case.

Predicting oropharyngeal tumor volume throughout the course of radiation therapy from pretreatment computed tomography data using general linear models.

PubMed

Yock, Adam D; Rao, Arvind; Dong, Lei; Beadle, Beth M; Garden, Adam S; Kudchadker, Rajat J; Court, Laurence E

2014-05-01

The purpose of this work was to develop and evaluate the accuracy of several predictive models of variation in tumor volume throughout the course of radiation therapy. Nineteen patients with oropharyngeal cancers were imaged daily with CT-on-rails for image-guided alignment per an institutional protocol. The daily volumes of 35 tumors in these 19 patients were determined and used to generate (1) a linear model in which tumor volume changed at a constant rate, (2) a general linear model that utilized the power fit relationship between the daily and initial tumor volumes, and (3) a functional general linear model that identified and exploited the primary modes of variation between time series describing the changing tumor volumes. Primary and nodal tumor volumes were examined separately. The accuracy of these models in predicting daily tumor volumes were compared with those of static and linear reference models using leave-one-out cross-validation. In predicting the daily volume of primary tumors, the general linear model and the functional general linear model were more accurate than the static reference model by 9.9% (range: -11.6%-23.8%) and 14.6% (range: -7.3%-27.5%), respectively, and were more accurate than the linear reference model by 14.2% (range: -6.8%-40.3%) and 13.1% (range: -1.5%-52.5%), respectively. In predicting the daily volume of nodal tumors, only the 14.4% (range: -11.1%-20.5%) improvement in accuracy of the functional general linear model compared to the static reference model was statistically significant. A general linear model and a functional general linear model trained on data from a small population of patients can predict the primary tumor volume throughout the course of radiation therapy with greater accuracy than standard reference models. These more accurate models may increase the prognostic value of information about the tumor garnered from pretreatment computed tomography images and facilitate improved treatment management.

Machine Learning-based discovery of closures for reduced models of dynamical systems

NASA Astrophysics Data System (ADS)

Pan, Shaowu; Duraisamy, Karthik

2017-11-01

Despite the successful application of machine learning (ML) in fields such as image processing and speech recognition, only a few attempts has been made toward employing ML to represent the dynamics of complex physical systems. Previous attempts mostly focus on parameter calibration or data-driven augmentation of existing models. In this work we present a ML framework to discover closure terms in reduced models of dynamical systems and provide insights into potential problems associated with data-driven modeling. Based on exact closure models for linear system, we propose a general linear closure framework from viewpoint of optimization. The framework is based on trapezoidal approximation of convolution term. Hyperparameters that need to be determined include temporal length of memory effect, number of sampling points, and dimensions of hidden states. To circumvent the explicit specification of memory effect, a general framework inspired from neural networks is also proposed. We conduct both a priori and posteriori evaluations of the resulting model on a number of non-linear dynamical systems. This work was supported in part by AFOSR under the project ``LES Modeling of Non-local effects using Statistical Coarse-graining'' with Dr. Jean-Luc Cambier as the technical monitor.

Detecting treatment-subgroup interactions in clustered data with generalized linear mixed-effects model trees.

PubMed

Fokkema, M; Smits, N; Zeileis, A; Hothorn, T; Kelderman, H

2017-10-25

Identification of subgroups of patients for whom treatment A is more effective than treatment B, and vice versa, is of key importance to the development of personalized medicine. Tree-based algorithms are helpful tools for the detection of such interactions, but none of the available algorithms allow for taking into account clustered or nested dataset structures, which are particularly common in psychological research. Therefore, we propose the generalized linear mixed-effects model tree (GLMM tree) algorithm, which allows for the detection of treatment-subgroup interactions, while accounting for the clustered structure of a dataset. The algorithm uses model-based recursive partitioning to detect treatment-subgroup interactions, and a GLMM to estimate the random-effects parameters. In a simulation study, GLMM trees show higher accuracy in recovering treatment-subgroup interactions, higher predictive accuracy, and lower type II error rates than linear-model-based recursive partitioning and mixed-effects regression trees. Also, GLMM trees show somewhat higher predictive accuracy than linear mixed-effects models with pre-specified interaction effects, on average. We illustrate the application of GLMM trees on an individual patient-level data meta-analysis on treatments for depression. We conclude that GLMM trees are a promising exploratory tool for the detection of treatment-subgroup interactions in clustered datasets.

Sensitivity-based virtual fields for the non-linear virtual fields method

NASA Astrophysics Data System (ADS)

Marek, Aleksander; Davis, Frances M.; Pierron, Fabrice

2017-09-01

The virtual fields method is an approach to inversely identify material parameters using full-field deformation data. In this manuscript, a new set of automatically-defined virtual fields for non-linear constitutive models has been proposed. These new sensitivity-based virtual fields reduce the influence of noise on the parameter identification. The sensitivity-based virtual fields were applied to a numerical example involving small strain plasticity; however, the general formulation derived for these virtual fields is applicable to any non-linear constitutive model. To quantify the improvement offered by these new virtual fields, they were compared with stiffness-based and manually defined virtual fields. The proposed sensitivity-based virtual fields were consistently able to identify plastic model parameters and outperform the stiffness-based and manually defined virtual fields when the data was corrupted by noise.

Generalized Multilevel Structural Equation Modeling

ERIC Educational Resources Information Center

Rabe-Hesketh, Sophia; Skrondal, Anders; Pickles, Andrew

2004-01-01

A unifying framework for generalized multilevel structural equation modeling is introduced. The models in the framework, called generalized linear latent and mixed models (GLLAMM), combine features of generalized linear mixed models (GLMM) and structural equation models (SEM) and consist of a response model and a structural model for the latent…

Conditional Monte Carlo randomization tests for regression models.

PubMed

Parhat, Parwen; Rosenberger, William F; Diao, Guoqing

2014-08-15

We discuss the computation of randomization tests for clinical trials of two treatments when the primary outcome is based on a regression model. We begin by revisiting the seminal paper of Gail, Tan, and Piantadosi (1988), and then describe a method based on Monte Carlo generation of randomization sequences. The tests based on this Monte Carlo procedure are design based, in that they incorporate the particular randomization procedure used. We discuss permuted block designs, complete randomization, and biased coin designs. We also use a new technique by Plamadeala and Rosenberger (2012) for simple computation of conditional randomization tests. Like Gail, Tan, and Piantadosi, we focus on residuals from generalized linear models and martingale residuals from survival models. Such techniques do not apply to longitudinal data analysis, and we introduce a method for computation of randomization tests based on the predicted rate of change from a generalized linear mixed model when outcomes are longitudinal. We show, by simulation, that these randomization tests preserve the size and power well under model misspecification. Copyright © 2014 John Wiley & Sons, Ltd.

Artificial Neural Network versus Linear Models Forecasting Doha Stock Market

NASA Astrophysics Data System (ADS)

Yousif, Adil; Elfaki, Faiz

2017-12-01

The purpose of this study is to determine the instability of Doha stock market and develop forecasting models. Linear time series models are used and compared with a nonlinear Artificial Neural Network (ANN) namely Multilayer Perceptron (MLP) Technique. It aims to establish the best useful model based on daily and monthly data which are collected from Qatar exchange for the period starting from January 2007 to January 2015. Proposed models are for the general index of Qatar stock exchange and also for the usages in other several sectors. With the help of these models, Doha stock market index and other various sectors were predicted. The study was conducted by using various time series techniques to study and analyze data trend in producing appropriate results. After applying several models, such as: Quadratic trend model, double exponential smoothing model, and ARIMA, it was concluded that ARIMA (2,2) was the most suitable linear model for the daily general index. However, ANN model was found to be more accurate than time series models.

A general science-based framework for dynamical spatio-temporal models

USGS Publications Warehouse

Wikle, C.K.; Hooten, M.B.

2010-01-01

Spatio-temporal statistical models are increasingly being used across a wide variety of scientific disciplines to describe and predict spatially-explicit processes that evolve over time. Correspondingly, in recent years there has been a significant amount of research on new statistical methodology for such models. Although descriptive models that approach the problem from the second-order (covariance) perspective are important, and innovative work is being done in this regard, many real-world processes are dynamic, and it can be more efficient in some cases to characterize the associated spatio-temporal dependence by the use of dynamical models. The chief challenge with the specification of such dynamical models has been related to the curse of dimensionality. Even in fairly simple linear, first-order Markovian, Gaussian error settings, statistical models are often over parameterized. Hierarchical models have proven invaluable in their ability to deal to some extent with this issue by allowing dependency among groups of parameters. In addition, this framework has allowed for the specification of science based parameterizations (and associated prior distributions) in which classes of deterministic dynamical models (e. g., partial differential equations (PDEs), integro-difference equations (IDEs), matrix models, and agent-based models) are used to guide specific parameterizations. Most of the focus for the application of such models in statistics has been in the linear case. The problems mentioned above with linear dynamic models are compounded in the case of nonlinear models. In this sense, the need for coherent and sensible model parameterizations is not only helpful, it is essential. Here, we present an overview of a framework for incorporating scientific information to motivate dynamical spatio-temporal models. First, we illustrate the methodology with the linear case. We then develop a general nonlinear spatio-temporal framework that we call general quadratic nonlinearity and demonstrate that it accommodates many different classes of scientific-based parameterizations as special cases. The model is presented in a hierarchical Bayesian framework and is illustrated with examples from ecology and oceanography. ?? 2010 Sociedad de Estad??stica e Investigaci??n Operativa.

Rhombic micro-displacement amplifier for piezoelectric actuator and its linear and hybrid model

NASA Astrophysics Data System (ADS)

Chen, Jinglong; Zhang, Chunlin; Xu, Minglong; Zi, Yanyang; Zhang, Xinong

2015-01-01

This paper proposes rhombic micro-displacement amplifier (RMDA) for piezoelectric actuator (PA). First, the geometric amplification relations are analyzed and linear model is built to analyze the mechanical and electrical properties of this amplifier. Next, the accurate modeling method of amplifier is studied for important application of precise servo control. The classical Preisach model (CPM) is generally implemented using a numerical technique based on the first-order reversal curves (FORCs). The accuracy of CPM mainly depends on the number of FORCs. However, it is generally difficult to achieve enough number of FORCs in practice. So, Support Vector Machine (SVM) is employed in the work to circumvent the deficiency of the CPM. Then the hybrid model, which is based on discrete CPM and SVM is developed to account for hysteresis and dynamic effects. Finally, experimental validation is carried out. The analyzed result shows that this amplifier with the hybrid model is suitable for control application.

Perfect commuting-operator strategies for linear system games

NASA Astrophysics Data System (ADS)

Cleve, Richard; Liu, Li; Slofstra, William

2017-01-01

Linear system games are a generalization of Mermin's magic square game introduced by Cleve and Mittal. They show that perfect strategies for linear system games in the tensor-product model of entanglement correspond to finite-dimensional operator solutions of a certain set of non-commutative equations. We investigate linear system games in the commuting-operator model of entanglement, where Alice and Bob's measurement operators act on a joint Hilbert space, and Alice's operators must commute with Bob's operators. We show that perfect strategies in this model correspond to possibly infinite-dimensional operator solutions of the non-commutative equations. The proof is based around a finitely presented group associated with the linear system which arises from the non-commutative equations.

Real-time Adaptive Control Using Neural Generalized Predictive Control

NASA Technical Reports Server (NTRS)

Haley, Pam; Soloway, Don; Gold, Brian

1999-01-01

The objective of this paper is to demonstrate the feasibility of a Nonlinear Generalized Predictive Control algorithm by showing real-time adaptive control on a plant with relatively fast time-constants. Generalized Predictive Control has classically been used in process control where linear control laws were formulated for plants with relatively slow time-constants. The plant of interest for this paper is a magnetic levitation device that is nonlinear and open-loop unstable. In this application, the reference model of the plant is a neural network that has an embedded nominal linear model in the network weights. The control based on the linear model provides initial stability at the beginning of network training. In using a neural network the control laws are nonlinear and online adaptation of the model is possible to capture unmodeled or time-varying dynamics. Newton-Raphson is the minimization algorithm. Newton-Raphson requires the calculation of the Hessian, but even with this computational expense the low iteration rate make this a viable algorithm for real-time control.

Genetic parameters for racing records in trotters using linear and generalized linear models.

PubMed

Suontama, M; van der Werf, J H J; Juga, J; Ojala, M

2012-09-01

Heritability and repeatability and genetic and phenotypic correlations were estimated for trotting race records with linear and generalized linear models using 510,519 records on 17,792 Finnhorses and 513,161 records on 25,536 Standardbred trotters. Heritability and repeatability were estimated for single racing time and earnings traits with linear models, and logarithmic scale was used for racing time and fourth-root scale for earnings to correct for nonnormality. Generalized linear models with a gamma distribution were applied for single racing time and with a multinomial distribution for single earnings traits. In addition, genetic parameters for annual earnings were estimated with linear models on the observed and fourth-root scales. Racing success traits of single placings, winnings, breaking stride, and disqualifications were analyzed using generalized linear models with a binomial distribution. Estimates of heritability were greatest for racing time, which ranged from 0.32 to 0.34. Estimates of heritability were low for single earnings with all distributions, ranging from 0.01 to 0.09. Annual earnings were closer to normal distribution than single earnings. Heritability estimates were moderate for annual earnings on the fourth-root scale, 0.19 for Finnhorses and 0.27 for Standardbred trotters. Heritability estimates for binomial racing success variables ranged from 0.04 to 0.12, being greatest for winnings and least for breaking stride. Genetic correlations among racing traits were high, whereas phenotypic correlations were mainly low to moderate, except correlations between racing time and earnings were high. On the basis of a moderate heritability and moderate to high repeatability for racing time and annual earnings, selection of horses for these traits is effective when based on a few repeated records. Because of high genetic correlations, direct selection for racing time and annual earnings would also result in good genetic response in racing success.

Item Purification in Differential Item Functioning Using Generalized Linear Mixed Models

ERIC Educational Resources Information Center

Liu, Qian

2011-01-01

For this dissertation, four item purification procedures were implemented onto the generalized linear mixed model for differential item functioning (DIF) analysis, and the performance of these item purification procedures was investigated through a series of simulations. Among the four procedures, forward and generalized linear mixed model (GLMM)…

Smoothed Residual Plots for Generalized Linear Models. Technical Report #450.

ERIC Educational Resources Information Center

Brant, Rollin

Methods for examining the viability of assumptions underlying generalized linear models are considered. By appealing to the likelihood, a natural generalization of the raw residual plot for normal theory models is derived and is applied to investigating potential misspecification of the linear predictor. A smooth version of the plot is also…

Meta-analysis of studies with bivariate binary outcomes: a marginal beta-binomial model approach

PubMed Central

Chen, Yong; Hong, Chuan; Ning, Yang; Su, Xiao

2018-01-01

When conducting a meta-analysis of studies with bivariate binary outcomes, challenges arise when the within-study correlation and between-study heterogeneity should be taken into account. In this paper, we propose a marginal beta-binomial model for the meta-analysis of studies with binary outcomes. This model is based on the composite likelihood approach, and has several attractive features compared to the existing models such as bivariate generalized linear mixed model (Chu and Cole, 2006) and Sarmanov beta-binomial model (Chen et al., 2012). The advantages of the proposed marginal model include modeling the probabilities in the original scale, not requiring any transformation of probabilities or any link function, having closed-form expression of likelihood function, and no constraints on the correlation parameter. More importantly, since the marginal beta-binomial model is only based on the marginal distributions, it does not suffer from potential misspecification of the joint distribution of bivariate study-specific probabilities. Such misspecification is difficult to detect and can lead to biased inference using currents methods. We compare the performance of the marginal beta-binomial model with the bivariate generalized linear mixed model and the Sarmanov beta-binomial model by simulation studies. Interestingly, the results show that the marginal beta-binomial model performs better than the Sarmanov beta-binomial model, whether or not the true model is Sarmanov beta-binomial, and the marginal beta-binomial model is more robust than the bivariate generalized linear mixed model under model misspecifications. Two meta-analyses of diagnostic accuracy studies and a meta-analysis of case-control studies are conducted for illustration. PMID:26303591

Feature Extraction of Event-Related Potentials Using Wavelets: An Application to Human Performance Monitoring

NASA Technical Reports Server (NTRS)

Trejo, Leonard J.; Shensa, Mark J.; Remington, Roger W. (Technical Monitor)

1998-01-01

This report describes the development and evaluation of mathematical models for predicting human performance from discrete wavelet transforms (DWT) of event-related potentials (ERP) elicited by task-relevant stimuli. The DWT was compared to principal components analysis (PCA) for representation of ERPs in linear regression and neural network models developed to predict a composite measure of human signal detection performance. Linear regression models based on coefficients of the decimated DWT predicted signal detection performance with half as many f ree parameters as comparable models based on PCA scores. In addition, the DWT-based models were more resistant to model degradation due to over-fitting than PCA-based models. Feed-forward neural networks were trained using the backpropagation,-, algorithm to predict signal detection performance based on raw ERPs, PCA scores, or high-power coefficients of the DWT. Neural networks based on high-power DWT coefficients trained with fewer iterations, generalized to new data better, and were more resistant to overfitting than networks based on raw ERPs. Networks based on PCA scores did not generalize to new data as well as either the DWT network or the raw ERP network. The results show that wavelet expansions represent the ERP efficiently and extract behaviorally important features for use in linear regression or neural network models of human performance. The efficiency of the DWT is discussed in terms of its decorrelation and energy compaction properties. In addition, the DWT models provided evidence that a pattern of low-frequency activity (1 to 3.5 Hz) occurring at specific times and scalp locations is a reliable correlate of human signal detection performance.

Feature extraction of event-related potentials using wavelets: an application to human performance monitoring

NASA Technical Reports Server (NTRS)

Trejo, L. J.; Shensa, M. J.

1999-01-01

This report describes the development and evaluation of mathematical models for predicting human performance from discrete wavelet transforms (DWT) of event-related potentials (ERP) elicited by task-relevant stimuli. The DWT was compared to principal components analysis (PCA) for representation of ERPs in linear regression and neural network models developed to predict a composite measure of human signal detection performance. Linear regression models based on coefficients of the decimated DWT predicted signal detection performance with half as many free parameters as comparable models based on PCA scores. In addition, the DWT-based models were more resistant to model degradation due to over-fitting than PCA-based models. Feed-forward neural networks were trained using the backpropagation algorithm to predict signal detection performance based on raw ERPs, PCA scores, or high-power coefficients of the DWT. Neural networks based on high-power DWT coefficients trained with fewer iterations, generalized to new data better, and were more resistant to overfitting than networks based on raw ERPs. Networks based on PCA scores did not generalize to new data as well as either the DWT network or the raw ERP network. The results show that wavelet expansions represent the ERP efficiently and extract behaviorally important features for use in linear regression or neural network models of human performance. The efficiency of the DWT is discussed in terms of its decorrelation and energy compaction properties. In addition, the DWT models provided evidence that a pattern of low-frequency activity (1 to 3.5 Hz) occurring at specific times and scalp locations is a reliable correlate of human signal detection performance. Copyright 1999 Academic Press.

Generalized linear mixed models with varying coefficients for longitudinal data.

PubMed

Zhang, Daowen

2004-03-01

The routinely assumed parametric functional form in the linear predictor of a generalized linear mixed model for longitudinal data may be too restrictive to represent true underlying covariate effects. We relax this assumption by representing these covariate effects by smooth but otherwise arbitrary functions of time, with random effects used to model the correlation induced by among-subject and within-subject variation. Due to the usually intractable integration involved in evaluating the quasi-likelihood function, the double penalized quasi-likelihood (DPQL) approach of Lin and Zhang (1999, Journal of the Royal Statistical Society, Series B61, 381-400) is used to estimate the varying coefficients and the variance components simultaneously by representing a nonparametric function by a linear combination of fixed effects and random effects. A scaled chi-squared test based on the mixed model representation of the proposed model is developed to test whether an underlying varying coefficient is a polynomial of certain degree. We evaluate the performance of the procedures through simulation studies and illustrate their application with Indonesian children infectious disease data.

Beta Regression Finite Mixture Models of Polarization and Priming

ERIC Educational Resources Information Center

Smithson, Michael; Merkle, Edgar C.; Verkuilen, Jay

2011-01-01

This paper describes the application of finite-mixture general linear models based on the beta distribution to modeling response styles, polarization, anchoring, and priming effects in probability judgments. These models, in turn, enhance our capacity for explicitly testing models and theories regarding the aforementioned phenomena. The mixture…

Minimal agent based model for financial markets II. Statistical properties of the linear and multiplicative dynamics

NASA Astrophysics Data System (ADS)

Alfi, V.; Cristelli, M.; Pietronero, L.; Zaccaria, A.

2009-02-01

We present a detailed study of the statistical properties of the Agent Based Model introduced in paper I [Eur. Phys. J. B, DOI: 10.1140/epjb/e2009-00028-4] and of its generalization to the multiplicative dynamics. The aim of the model is to consider the minimal elements for the understanding of the origin of the stylized facts and their self-organization. The key elements are fundamentalist agents, chartist agents, herding dynamics and price behavior. The first two elements correspond to the competition between stability and instability tendencies in the market. The herding behavior governs the possibility of the agents to change strategy and it is a crucial element of this class of models. We consider a linear approximation for the price dynamics which permits a simple interpretation of the model dynamics and, for many properties, it is possible to derive analytical results. The generalized non linear dynamics results to be extremely more sensible to the parameter space and much more difficult to analyze and control. The main results for the nature and self-organization of the stylized facts are, however, very similar in the two cases. The main peculiarity of the non linear dynamics is an enhancement of the fluctuations and a more marked evidence of the stylized facts. We will also discuss some modifications of the model to introduce more realistic elements with respect to the real markets.

Economic policy optimization based on both one stochastic model and the parametric control theory

NASA Astrophysics Data System (ADS)

Ashimov, Abdykappar; Borovskiy, Yuriy; Onalbekov, Mukhit

2016-06-01

A nonlinear dynamic stochastic general equilibrium model with financial frictions is developed to describe two interacting national economies in the environment of the rest of the world. Parameters of nonlinear model are estimated based on its log-linearization by the Bayesian approach. The nonlinear model is verified by retroprognosis, estimation of stability indicators of mappings specified by the model, and estimation the degree of coincidence for results of internal and external shocks' effects on macroeconomic indicators on the basis of the estimated nonlinear model and its log-linearization. On the base of the nonlinear model, the parametric control problems of economic growth and volatility of macroeconomic indicators of Kazakhstan are formulated and solved for two exchange rate regimes (free floating and managed floating exchange rates)

Generalized Predictive and Neural Generalized Predictive Control of Aerospace Systems

NASA Technical Reports Server (NTRS)

Kelkar, Atul G.

2000-01-01

The research work presented in this thesis addresses the problem of robust control of uncertain linear and nonlinear systems using Neural network-based Generalized Predictive Control (NGPC) methodology. A brief overview of predictive control and its comparison with Linear Quadratic (LQ) control is given to emphasize advantages and drawbacks of predictive control methods. It is shown that the Generalized Predictive Control (GPC) methodology overcomes the drawbacks associated with traditional LQ control as well as conventional predictive control methods. It is shown that in spite of the model-based nature of GPC it has good robustness properties being special case of receding horizon control. The conditions for choosing tuning parameters for GPC to ensure closed-loop stability are derived. A neural network-based GPC architecture is proposed for the control of linear and nonlinear uncertain systems. A methodology to account for parametric uncertainty in the system is proposed using on-line training capability of multi-layer neural network. Several simulation examples and results from real-time experiments are given to demonstrate the effectiveness of the proposed methodology.

Real-time imaging of human brain function by near-infrared spectroscopy using an adaptive general linear model

PubMed Central

Abdelnour, A. Farras; Huppert, Theodore

2009-01-01

Near-infrared spectroscopy is a non-invasive neuroimaging method which uses light to measure changes in cerebral blood oxygenation associated with brain activity. In this work, we demonstrate the ability to record and analyze images of brain activity in real-time using a 16-channel continuous wave optical NIRS system. We propose a novel real-time analysis framework using an adaptive Kalman filter and a state–space model based on a canonical general linear model of brain activity. We show that our adaptive model has the ability to estimate single-trial brain activity events as we apply this method to track and classify experimental data acquired during an alternating bilateral self-paced finger tapping task. PMID:19457389

Learning quadratic receptive fields from neural responses to natural stimuli.

PubMed

Rajan, Kanaka; Marre, Olivier; Tkačik, Gašper

2013-07-01

Models of neural responses to stimuli with complex spatiotemporal correlation structure often assume that neurons are selective for only a small number of linear projections of a potentially high-dimensional input. In this review, we explore recent modeling approaches where the neural response depends on the quadratic form of the input rather than on its linear projection, that is, the neuron is sensitive to the local covariance structure of the signal preceding the spike. To infer this quadratic dependence in the presence of arbitrary (e.g., naturalistic) stimulus distribution, we review several inference methods, focusing in particular on two information theory-based approaches (maximization of stimulus energy and of noise entropy) and two likelihood-based approaches (Bayesian spike-triggered covariance and extensions of generalized linear models). We analyze the formal relationship between the likelihood-based and information-based approaches to demonstrate how they lead to consistent inference. We demonstrate the practical feasibility of these procedures by using model neurons responding to a flickering variance stimulus.

Fractional Gaussian model in global optimization

NASA Astrophysics Data System (ADS)

Dimri, V. P.; Srivastava, R. P.

2009-12-01

Earth system is inherently non-linear and it can be characterized well if we incorporate no-linearity in the formulation and solution of the problem. General tool often used for characterization of the earth system is inversion. Traditionally inverse problems are solved using least-square based inversion by linearizing the formulation. The initial model in such inversion schemes is often assumed to follow posterior Gaussian probability distribution. It is now well established that most of the physical properties of the earth follow power law (fractal distribution). Thus, the selection of initial model based on power law probability distribution will provide more realistic solution. We present a new method which can draw samples of posterior probability density function very efficiently using fractal based statistics. The application of the method has been demonstrated to invert band limited seismic data with well control. We used fractal based probability density function which uses mean, variance and Hurst coefficient of the model space to draw initial model. Further this initial model is used in global optimization inversion scheme. Inversion results using initial models generated by our method gives high resolution estimates of the model parameters than the hitherto used gradient based liner inversion method.

Meta-analysis of studies with bivariate binary outcomes: a marginal beta-binomial model approach.

PubMed

Chen, Yong; Hong, Chuan; Ning, Yang; Su, Xiao

2016-01-15

When conducting a meta-analysis of studies with bivariate binary outcomes, challenges arise when the within-study correlation and between-study heterogeneity should be taken into account. In this paper, we propose a marginal beta-binomial model for the meta-analysis of studies with binary outcomes. This model is based on the composite likelihood approach and has several attractive features compared with the existing models such as bivariate generalized linear mixed model (Chu and Cole, 2006) and Sarmanov beta-binomial model (Chen et al., 2012). The advantages of the proposed marginal model include modeling the probabilities in the original scale, not requiring any transformation of probabilities or any link function, having closed-form expression of likelihood function, and no constraints on the correlation parameter. More importantly, because the marginal beta-binomial model is only based on the marginal distributions, it does not suffer from potential misspecification of the joint distribution of bivariate study-specific probabilities. Such misspecification is difficult to detect and can lead to biased inference using currents methods. We compare the performance of the marginal beta-binomial model with the bivariate generalized linear mixed model and the Sarmanov beta-binomial model by simulation studies. Interestingly, the results show that the marginal beta-binomial model performs better than the Sarmanov beta-binomial model, whether or not the true model is Sarmanov beta-binomial, and the marginal beta-binomial model is more robust than the bivariate generalized linear mixed model under model misspecifications. Two meta-analyses of diagnostic accuracy studies and a meta-analysis of case-control studies are conducted for illustration. Copyright © 2015 John Wiley & Sons, Ltd.

Genomic prediction based on data from three layer lines using non-linear regression models.

PubMed

Huang, Heyun; Windig, Jack J; Vereijken, Addie; Calus, Mario P L

2014-11-06

Most studies on genomic prediction with reference populations that include multiple lines or breeds have used linear models. Data heterogeneity due to using multiple populations may conflict with model assumptions used in linear regression methods. In an attempt to alleviate potential discrepancies between assumptions of linear models and multi-population data, two types of alternative models were used: (1) a multi-trait genomic best linear unbiased prediction (GBLUP) model that modelled trait by line combinations as separate but correlated traits and (2) non-linear models based on kernel learning. These models were compared to conventional linear models for genomic prediction for two lines of brown layer hens (B1 and B2) and one line of white hens (W1). The three lines each had 1004 to 1023 training and 238 to 240 validation animals. Prediction accuracy was evaluated by estimating the correlation between observed phenotypes and predicted breeding values. When the training dataset included only data from the evaluated line, non-linear models yielded at best a similar accuracy as linear models. In some cases, when adding a distantly related line, the linear models showed a slight decrease in performance, while non-linear models generally showed no change in accuracy. When only information from a closely related line was used for training, linear models and non-linear radial basis function (RBF) kernel models performed similarly. The multi-trait GBLUP model took advantage of the estimated genetic correlations between the lines. Combining linear and non-linear models improved the accuracy of multi-line genomic prediction. Linear models and non-linear RBF models performed very similarly for genomic prediction, despite the expectation that non-linear models could deal better with the heterogeneous multi-population data. This heterogeneity of the data can be overcome by modelling trait by line combinations as separate but correlated traits, which avoids the occasional occurrence of large negative accuracies when the evaluated line was not included in the training dataset. Furthermore, when using a multi-line training dataset, non-linear models provided information on the genotype data that was complementary to the linear models, which indicates that the underlying data distributions of the three studied lines were indeed heterogeneous.

Comparing Multiple-Group Multinomial Log-Linear Models for Multidimensional Skill Distributions in the General Diagnostic Model. Research Report. ETS RR-08-35

ERIC Educational Resources Information Center

Xu, Xueli; von Davier, Matthias

2008-01-01

The general diagnostic model (GDM) utilizes located latent classes for modeling a multidimensional proficiency variable. In this paper, the GDM is extended by employing a log-linear model for multiple populations that assumes constraints on parameters across multiple groups. This constrained model is compared to log-linear models that assume…

Right-Sizing Statistical Models for Longitudinal Data

PubMed Central

Wood, Phillip K.; Steinley, Douglas; Jackson, Kristina M.

2015-01-01

Arguments are proposed that researchers using longitudinal data should consider more and less complex statistical model alternatives to their initially chosen techniques in an effort to “right-size” the model to the data at hand. Such model comparisons may alert researchers who use poorly fitting overly parsimonious models to more complex better fitting alternatives, and, alternatively, may identify more parsimonious alternatives to overly complex (and perhaps empirically under-identified and/or less powerful) statistical models. A general framework is proposed for considering (often nested) relationships between a variety of psychometric and growth curve models. A three-step approach is proposed in which models are evaluated based on the number and patterning of variance components prior to selection of better-fitting growth models that explain both mean and variation/covariation patterns. The orthogonal, free-curve slope-intercept (FCSI) growth model is considered as a general model which includes, as special cases, many models including the Factor Mean model (FM, McArdle & Epstein, 1987), McDonald's (1967) linearly constrained factor model, Hierarchical Linear Models (HLM), Repeated Measures MANOVA, and the Linear Slope Intercept (LinearSI) Growth Model. The FCSI model, in turn, is nested within the Tuckerized factor model. The approach is illustrated by comparing alternative models in a longitudinal study of children's vocabulary and by comparison of several candidate parametric growth and chronometric models in a Monte Carlo study. PMID:26237507

Right-sizing statistical models for longitudinal data.

PubMed

Wood, Phillip K; Steinley, Douglas; Jackson, Kristina M

2015-12-01

Arguments are proposed that researchers using longitudinal data should consider more and less complex statistical model alternatives to their initially chosen techniques in an effort to "right-size" the model to the data at hand. Such model comparisons may alert researchers who use poorly fitting, overly parsimonious models to more complex, better-fitting alternatives and, alternatively, may identify more parsimonious alternatives to overly complex (and perhaps empirically underidentified and/or less powerful) statistical models. A general framework is proposed for considering (often nested) relationships between a variety of psychometric and growth curve models. A 3-step approach is proposed in which models are evaluated based on the number and patterning of variance components prior to selection of better-fitting growth models that explain both mean and variation-covariation patterns. The orthogonal free curve slope intercept (FCSI) growth model is considered a general model that includes, as special cases, many models, including the factor mean (FM) model (McArdle & Epstein, 1987), McDonald's (1967) linearly constrained factor model, hierarchical linear models (HLMs), repeated-measures multivariate analysis of variance (MANOVA), and the linear slope intercept (linearSI) growth model. The FCSI model, in turn, is nested within the Tuckerized factor model. The approach is illustrated by comparing alternative models in a longitudinal study of children's vocabulary and by comparing several candidate parametric growth and chronometric models in a Monte Carlo study. (c) 2015 APA, all rights reserved).

Use of instrumental variables in the analysis of generalized linear models in the presence of unmeasured confounding with applications to epidemiological research.

PubMed

Johnston, K M; Gustafson, P; Levy, A R; Grootendorst, P

2008-04-30

A major, often unstated, concern of researchers carrying out epidemiological studies of medical therapy is the potential impact on validity if estimates of treatment are biased due to unmeasured confounders. One technique for obtaining consistent estimates of treatment effects in the presence of unmeasured confounders is instrumental variables analysis (IVA). This technique has been well developed in the econometrics literature and is being increasingly used in epidemiological studies. However, the approach to IVA that is most commonly used in such studies is based on linear models, while many epidemiological applications make use of non-linear models, specifically generalized linear models (GLMs) such as logistic or Poisson regression. Here we present a simple method for applying IVA within the class of GLMs using the generalized method of moments approach. We explore some of the theoretical properties of the method and illustrate its use within both a simulation example and an epidemiological study where unmeasured confounding is suspected to be present. We estimate the effects of beta-blocker therapy on one-year all-cause mortality after an incident hospitalization for heart failure, in the absence of data describing disease severity, which is believed to be a confounder. 2008 John Wiley & Sons, Ltd

A single-degree-of-freedom model for non-linear soil amplification

USGS Publications Warehouse

Erdik, Mustafa Ozder

1979-01-01

For proper understanding of soil behavior during earthquakes and assessment of a realistic surface motion, studies of the large-strain dynamic response of non-linear hysteretic soil systems are indispensable. Most of the presently available studies are based on the assumption that the response of a soil deposit is mainly due to the upward propagation of horizontally polarized shear waves from the underlying bedrock. Equivalent-linear procedures, currently in common use in non-linear soil response analysis, provide a simple approach and have been favorably compared with the actual recorded motions in some particular cases. Strain compatibility in these equivalent-linear approaches is maintained by selecting values of shear moduli and damping ratios in accordance with the average soil strains, in an iterative manner. Truly non-linear constitutive models with complete strain compatibility have also been employed. The equivalent-linear approaches often raise some doubt as to the reliability of their results concerning the system response in high frequency regions. In these frequency regions the equivalent-linear methods may underestimate the surface motion by as much as a factor of two or more. Although studies are complete in their methods of analysis, they inevitably provide applications pertaining only to a few specific soil systems, and do not lead to general conclusions about soil behavior. This report attempts to provide a general picture of the soil response through the use of a single-degree-of-freedom non-linear-hysteretic model. Although the investigation is based on a specific type of nonlinearity and a set of dynamic soil properties, the method described does not limit itself to these assumptions and is equally applicable to other types of nonlinearity and soil parameters.

Linear discrete systems with memory: a generalization of the Langmuir model

NASA Astrophysics Data System (ADS)

Băleanu, Dumitru; Nigmatullin, Raoul R.

2013-10-01

In this manuscript we analyzed a general solution of the linear nonlocal Langmuir model within time scale calculus. Several generalizations of the Langmuir model are presented together with their exact corresponding solutions. The physical meaning of the proposed models are investigated and their corresponding geometries are reported.

Center for Parallel Optimization.

DTIC Science & Technology

1996-03-19

A NEW OPTIMIZATION BASED APPROACH TO IMPROVING GENERALIZATION IN MACHINE LEARNING HAS BEEN PROPOSED AND COMPUTATIONALLY VALIDATED ON SIMPLE LINEAR MODELS AS WELL AS ON HIGHLY NONLINEAR SYSTEMS SUCH AS NEURAL NETWORKS.

hi-class: Horndeski in the Cosmic Linear Anisotropy Solving System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zumalacárregui, Miguel; Bellini, Emilio; Sawicki, Ignacy

We present the public version of hi-class (www.hiclass-code.net), an extension of the Boltzmann code CLASS to a broad ensemble of modifications to general relativity. In particular, hi-class can calculate predictions for models based on Horndeski's theory, which is the most general scalar-tensor theory described by second-order equations of motion and encompasses any perfect-fluid dark energy, quintessence, Brans-Dicke, f ( R ) and covariant Galileon models. hi-class has been thoroughly tested and can be readily used to understand the impact of alternative theories of gravity on linear structure formation as well as for cosmological parameter extraction.

Doubly robust estimation of generalized partial linear models for longitudinal data with dropouts.

PubMed

Lin, Huiming; Fu, Bo; Qin, Guoyou; Zhu, Zhongyi

2017-12-01

We develop a doubly robust estimation of generalized partial linear models for longitudinal data with dropouts. Our method extends the highly efficient aggregate unbiased estimating function approach proposed in Qu et al. (2010) to a doubly robust one in the sense that under missing at random (MAR), our estimator is consistent when either the linear conditional mean condition is satisfied or a model for the dropout process is correctly specified. We begin with a generalized linear model for the marginal mean, and then move forward to a generalized partial linear model, allowing for nonparametric covariate effect by using the regression spline smoothing approximation. We establish the asymptotic theory for the proposed method and use simulation studies to compare its finite sample performance with that of Qu's method, the complete-case generalized estimating equation (GEE) and the inverse-probability weighted GEE. The proposed method is finally illustrated using data from a longitudinal cohort study. © 2017, The International Biometric Society.

An approximate generalized linear model with random effects for informative missing data.

PubMed

Follmann, D; Wu, M

1995-03-01

This paper develops a class of models to deal with missing data from longitudinal studies. We assume that separate models for the primary response and missingness (e.g., number of missed visits) are linked by a common random parameter. Such models have been developed in the econometrics (Heckman, 1979, Econometrica 47, 153-161) and biostatistics (Wu and Carroll, 1988, Biometrics 44, 175-188) literature for a Gaussian primary response. We allow the primary response, conditional on the random parameter, to follow a generalized linear model and approximate the generalized linear model by conditioning on the data that describes missingness. The resultant approximation is a mixed generalized linear model with possibly heterogeneous random effects. An example is given to illustrate the approximate approach, and simulations are performed to critique the adequacy of the approximation for repeated binary data.

Integration of system identification and finite element modelling of nonlinear vibrating structures

NASA Astrophysics Data System (ADS)

Cooper, Samson B.; DiMaio, Dario; Ewins, David J.

2018-03-01

The Finite Element Method (FEM), Experimental modal analysis (EMA) and other linear analysis techniques have been established as reliable tools for the dynamic analysis of engineering structures. They are often used to provide solutions to small and large structures and other variety of cases in structural dynamics, even those exhibiting a certain degree of nonlinearity. Unfortunately, when the nonlinear effects are substantial or the accuracy of the predicted response is of vital importance, a linear finite element model will generally prove to be unsatisfactory. As a result, the validated linear FE model requires further enhancement so that it can represent and predict the nonlinear behaviour exhibited by the structure. In this paper, a pragmatic approach to integrating test-based system identification and FE modelling of a nonlinear structure is presented. This integration is based on three different phases: the first phase involves the derivation of an Underlying Linear Model (ULM) of the structure, the second phase includes experiment-based nonlinear identification using measured time series and the third phase covers augmenting the linear FE model and experimental validation of the nonlinear FE model. The proposed case study is demonstrated on a twin cantilever beam assembly coupled with a flexible arch shaped beam. In this case, polynomial-type nonlinearities are identified and validated with force-controlled stepped-sine test data at several excitation levels.

GVE-Based Dynamics and Control for Formation Flying Spacecraft

NASA Technical Reports Server (NTRS)

Breger, Louis; How, Jonathan P.

2004-01-01

Formation flying is an enabling technology for many future space missions. This paper presents extensions to the equations of relative motion expressed in Keplerian orbital elements, including new initialization techniques for general formation configurations. A new linear time-varying form of the equations of relative motion is developed from Gauss Variational Equations and used in a model predictive controller. The linearizing assumptions for these equations are shown to be consistent with typical formation flying scenarios. Several linear, convex initialization techniques are presented, as well as a general, decentralized method for coordinating a tetrahedral formation using differential orbital elements. Control methods are validated using a commercial numerical propagator.

Neural-Based Compensation of Nonlinearities in an Airplane Longitudinal Model with Dynamic-Inversion Control

PubMed Central

Li, YuHui; Jin, FeiTeng

2017-01-01

The inversion design approach is a very useful tool for the complex multiple-input-multiple-output nonlinear systems to implement the decoupling control goal, such as the airplane model and spacecraft model. In this work, the flight control law is proposed using the neural-based inversion design method associated with the nonlinear compensation for a general longitudinal model of the airplane. First, the nonlinear mathematic model is converted to the equivalent linear model based on the feedback linearization theory. Then, the flight control law integrated with this inversion model is developed to stabilize the nonlinear system and relieve the coupling effect. Afterwards, the inversion control combined with the neural network and nonlinear portion is presented to improve the transient performance and attenuate the uncertain effects on both external disturbances and model errors. Finally, the simulation results demonstrate the effectiveness of this controller. PMID:29410680

Anomaly General Circulation Models.

NASA Astrophysics Data System (ADS)

Navarra, Antonio

The feasibility of the anomaly model is assessed using barotropic and baroclinic models. In the barotropic case, both a stationary and a time-dependent model has been formulated and constructed, whereas only the stationary, linear case is considered in the baroclinic case. Results from the barotropic model indicate that a relation between the stationary solution and the time-averaged non-linear solution exists. The stationary linear baroclinic solution can therefore be considered with some confidence. The linear baroclinic anomaly model poses a formidable mathematical problem because it is necessary to solve a gigantic linear system to obtain the solution. A new method to find solution of large linear system, based on a projection on the Krylov subspace is shown to be successful when applied to the linearized baroclinic anomaly model. The scheme consists of projecting the original linear system on the Krylov subspace, thereby reducing the dimensionality of the matrix to be inverted to obtain the solution. With an appropriate setting of the damping parameters, the iterative Krylov method reaches a solution even using a Krylov subspace ten times smaller than the original space of the problem. This generality allows the treatment of the important problem of linear waves in the atmosphere. A larger class (nonzonally symmetric) of basic states can now be treated for the baroclinic primitive equations. These problem leads to large unsymmetrical linear systems of order 10000 and more which can now be successfully tackled by the Krylov method. The (R7) linear anomaly model is used to investigate extensively the linear response to equatorial and mid-latitude prescribed heating. The results indicate that the solution is deeply affected by the presence of the stationary waves in the basic state. The instability of the asymmetric flows, first pointed out by Simmons et al. (1983), is active also in the baroclinic case. However, the presence of baroclinic processes modifies the dominant response. The most sensitive areas are identified; they correspond to north Japan, the Pole and Greenland regions. A limited set of higher resolution (R15) experiments indicate that this situation is still present and enhanced at higher resolution. The linear anomaly model is also applied to a realistic case. (Abstract shortened with permission of author.).

A Bivariate Generalized Linear Item Response Theory Modeling Framework to the Analysis of Responses and Response Times.

PubMed

Molenaar, Dylan; Tuerlinckx, Francis; van der Maas, Han L J

2015-01-01

A generalized linear modeling framework to the analysis of responses and response times is outlined. In this framework, referred to as bivariate generalized linear item response theory (B-GLIRT), separate generalized linear measurement models are specified for the responses and the response times that are subsequently linked by cross-relations. The cross-relations can take various forms. Here, we focus on cross-relations with a linear or interaction term for ability tests, and cross-relations with a curvilinear term for personality tests. In addition, we discuss how popular existing models from the psychometric literature are special cases in the B-GLIRT framework depending on restrictions in the cross-relation. This allows us to compare existing models conceptually and empirically. We discuss various extensions of the traditional models motivated by practical problems. We also illustrate the applicability of our approach using various real data examples, including data on personality and cognitive ability.

Linear mixed model for heritability estimation that explicitly addresses environmental variation.

PubMed

Heckerman, David; Gurdasani, Deepti; Kadie, Carl; Pomilla, Cristina; Carstensen, Tommy; Martin, Hilary; Ekoru, Kenneth; Nsubuga, Rebecca N; Ssenyomo, Gerald; Kamali, Anatoli; Kaleebu, Pontiano; Widmer, Christian; Sandhu, Manjinder S

2016-07-05

The linear mixed model (LMM) is now routinely used to estimate heritability. Unfortunately, as we demonstrate, LMM estimates of heritability can be inflated when using a standard model. To help reduce this inflation, we used a more general LMM with two random effects-one based on genomic variants and one based on easily measured spatial location as a proxy for environmental effects. We investigated this approach with simulated data and with data from a Uganda cohort of 4,778 individuals for 34 phenotypes including anthropometric indices, blood factors, glycemic control, blood pressure, lipid tests, and liver function tests. For the genomic random effect, we used identity-by-descent estimates from accurately phased genome-wide data. For the environmental random effect, we constructed a covariance matrix based on a Gaussian radial basis function. Across the simulated and Ugandan data, narrow-sense heritability estimates were lower using the more general model. Thus, our approach addresses, in part, the issue of "missing heritability" in the sense that much of the heritability previously thought to be missing was fictional. Software is available at https://github.com/MicrosoftGenomics/FaST-LMM.

Finite-time H∞ filtering for non-linear stochastic systems

NASA Astrophysics Data System (ADS)

Hou, Mingzhe; Deng, Zongquan; Duan, Guangren

2016-09-01

This paper describes the robust H∞ filtering analysis and the synthesis of general non-linear stochastic systems with finite settling time. We assume that the system dynamic is modelled by Itô-type stochastic differential equations of which the state and the measurement are corrupted by state-dependent noises and exogenous disturbances. A sufficient condition for non-linear stochastic systems to have the finite-time H∞ performance with gain less than or equal to a prescribed positive number is established in terms of a certain Hamilton-Jacobi inequality. Based on this result, the existence of a finite-time H∞ filter is given for the general non-linear stochastic system by a second-order non-linear partial differential inequality, and the filter can be obtained by solving this inequality. The effectiveness of the obtained result is illustrated by a numerical example.

PDE-based geophysical modelling using finite elements: examples from 3D resistivity and 2D magnetotellurics

NASA Astrophysics Data System (ADS)

Schaa, R.; Gross, L.; du Plessis, J.

2016-04-01

We present a general finite-element solver, escript, tailored to solve geophysical forward and inverse modeling problems in terms of partial differential equations (PDEs) with suitable boundary conditions. Escript’s abstract interface allows geoscientists to focus on solving the actual problem without being experts in numerical modeling. General-purpose finite element solvers have found wide use especially in engineering fields and find increasing application in the geophysical disciplines as these offer a single interface to tackle different geophysical problems. These solvers are useful for data interpretation and for research, but can also be a useful tool in educational settings. This paper serves as an introduction into PDE-based modeling with escript where we demonstrate in detail how escript is used to solve two different forward modeling problems from applied geophysics (3D DC resistivity and 2D magnetotellurics). Based on these two different cases, other geophysical modeling work can easily be realized. The escript package is implemented as a Python library and allows the solution of coupled, linear or non-linear, time-dependent PDEs. Parallel execution for both shared and distributed memory architectures is supported and can be used without modifications to the scripts.

Transfer matrix method for dynamics modeling and independent modal space vibration control design of linear hybrid multibody system

NASA Astrophysics Data System (ADS)

Rong, Bao; Rui, Xiaoting; Lu, Kun; Tao, Ling; Wang, Guoping; Ni, Xiaojun

2018-05-01

In this paper, an efficient method of dynamics modeling and vibration control design of a linear hybrid multibody system (MS) is studied based on the transfer matrix method. The natural vibration characteristics of a linear hybrid MS are solved by using low-order transfer equations. Then, by constructing the brand-new body dynamics equation, augmented operator and augmented eigenvector, the orthogonality of augmented eigenvector of a linear hybrid MS is satisfied, and its state space model expressed in each independent model space is obtained easily. According to this dynamics model, a robust independent modal space-fuzzy controller is designed for vibration control of a general MS, and the genetic optimization of some critical control parameters of fuzzy tuners is also presented. Two illustrative examples are performed, which results show that this method is computationally efficient and with perfect control performance.

Orthonormal vector general polynomials derived from the Cartesian gradient of the orthonormal Zernike-based polynomials.

PubMed

Mafusire, Cosmas; Krüger, Tjaart P J

2018-06-01

The concept of orthonormal vector circle polynomials is revisited by deriving a set from the Cartesian gradient of Zernike polynomials in a unit circle using a matrix-based approach. The heart of this model is a closed-form matrix equation of the gradient of Zernike circle polynomials expressed as a linear combination of lower-order Zernike circle polynomials related through a gradient matrix. This is a sparse matrix whose elements are two-dimensional standard basis transverse Euclidean vectors. Using the outer product form of the Cholesky decomposition, the gradient matrix is used to calculate a new matrix, which we used to express the Cartesian gradient of the Zernike circle polynomials as a linear combination of orthonormal vector circle polynomials. Since this new matrix is singular, the orthonormal vector polynomials are recovered by reducing the matrix to its row echelon form using the Gauss-Jordan elimination method. We extend the model to derive orthonormal vector general polynomials, which are orthonormal in a general pupil by performing a similarity transformation on the gradient matrix to give its equivalent in the general pupil. The outer form of the Gram-Schmidt procedure and the Gauss-Jordan elimination method are then applied to the general pupil to generate the orthonormal vector general polynomials from the gradient of the orthonormal Zernike-based polynomials. The performance of the model is demonstrated with a simulated wavefront in a square pupil inscribed in a unit circle.

A General Multidimensional Model for the Measurement of Cultural Differences.

ERIC Educational Resources Information Center

Olmedo, Esteban L.; Martinez, Sergio R.

A multidimensional model for measuring cultural differences (MCD) based on factor analytic theory and techniques is proposed. The model assumes that a cultural space may be defined by means of a relatively small number of orthogonal dimensions which are linear combinations of a much larger number of cultural variables. Once a suitable,…

Firing-rate response of linear and nonlinear integrate-and-fire neurons to modulated current-based and conductance-based synaptic drive.

PubMed

Richardson, Magnus J E

2007-08-01

Integrate-and-fire models are mainstays of the study of single-neuron response properties and emergent states of recurrent networks of spiking neurons. They also provide an analytical base for perturbative approaches that treat important biological details, such as synaptic filtering, synaptic conductance increase, and voltage-activated currents. Steady-state firing rates of both linear and nonlinear integrate-and-fire models, receiving fluctuating synaptic drive, can be calculated from the time-independent Fokker-Planck equation. The dynamic firing-rate response is less easy to extract, even at the first-order level of a weak modulation of the model parameters, but is an important determinant of neuronal response and network stability. For the linear integrate-and-fire model the response to modulations of current-based synaptic drive can be written in terms of hypergeometric functions. For the nonlinear exponential and quadratic models no such analytical forms for the response are available. Here it is demonstrated that a rather simple numerical method can be used to obtain the steady-state and dynamic response for both linear and nonlinear models to parameter modulation in the presence of current-based or conductance-based synaptic fluctuations. To complement the full numerical solution, generalized analytical forms for the high-frequency response are provided. A special case is also identified--time-constant modulation--for which the response to an arbitrarily strong modulation can be calculated exactly.

Novel forecasting approaches using combination of machine learning and statistical models for flood susceptibility mapping.

PubMed

Shafizadeh-Moghadam, Hossein; Valavi, Roozbeh; Shahabi, Himan; Chapi, Kamran; Shirzadi, Ataollah

2018-07-01

In this research, eight individual machine learning and statistical models are implemented and compared, and based on their results, seven ensemble models for flood susceptibility assessment are introduced. The individual models included artificial neural networks, classification and regression trees, flexible discriminant analysis, generalized linear model, generalized additive model, boosted regression trees, multivariate adaptive regression splines, and maximum entropy, and the ensemble models were Ensemble Model committee averaging (EMca), Ensemble Model confidence interval Inferior (EMciInf), Ensemble Model confidence interval Superior (EMciSup), Ensemble Model to estimate the coefficient of variation (EMcv), Ensemble Model to estimate the mean (EMmean), Ensemble Model to estimate the median (EMmedian), and Ensemble Model based on weighted mean (EMwmean). The data set covered 201 flood events in the Haraz watershed (Mazandaran province in Iran) and 10,000 randomly selected non-occurrence points. Among the individual models, the Area Under the Receiver Operating Characteristic (AUROC), which showed the highest value, belonged to boosted regression trees (0.975) and the lowest value was recorded for generalized linear model (0.642). On the other hand, the proposed EMmedian resulted in the highest accuracy (0.976) among all models. In spite of the outstanding performance of some models, nevertheless, variability among the prediction of individual models was considerable. Therefore, to reduce uncertainty, creating more generalizable, more stable, and less sensitive models, ensemble forecasting approaches and in particular the EMmedian is recommended for flood susceptibility assessment. Copyright © 2018 Elsevier Ltd. All rights reserved.

A study of the linear free energy model for DNA structures using the generalized Hamiltonian formalism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yavari, M., E-mail: yavari@iaukashan.ac.ir

2016-06-15

We generalize the results of Nesterenko [13, 14] and Gogilidze and Surovtsev [15] for DNA structures. Using the generalized Hamiltonian formalism, we investigate solutions of the equilibrium shape equations for the linear free energy model.

A general U-block model-based design procedure for nonlinear polynomial control systems

NASA Astrophysics Data System (ADS)

Zhu, Q. M.; Zhao, D. Y.; Zhang, Jianhua

2016-10-01

The proposition of U-model concept (in terms of 'providing concise and applicable solutions for complex problems') and a corresponding basic U-control design algorithm was originated in the first author's PhD thesis. The term of U-model appeared (not rigorously defined) for the first time in the first author's other journal paper, which established a framework for using linear polynomial control system design approaches to design nonlinear polynomial control systems (in brief, linear polynomial approaches → nonlinear polynomial plants). This paper represents the next milestone work - using linear state-space approaches to design nonlinear polynomial control systems (in brief, linear state-space approaches → nonlinear polynomial plants). The overall aim of the study is to establish a framework, defined as the U-block model, which provides a generic prototype for using linear state-space-based approaches to design the control systems with smooth nonlinear plants/processes described by polynomial models. For analysing the feasibility and effectiveness, sliding mode control design approach is selected as an exemplary case study. Numerical simulation studies provide a user-friendly step-by-step procedure for the readers/users with interest in their ad hoc applications. In formality, this is the first paper to present the U-model-oriented control system design in a formal way and to study the associated properties and theorems. The previous publications, in the main, have been algorithm-based studies and simulation demonstrations. In some sense, this paper can be treated as a landmark for the U-model-based research from intuitive/heuristic stage to rigour/formal/comprehensive studies.

Modeling exposure–lag–response associations with distributed lag non-linear models

PubMed Central

Gasparrini, Antonio

2014-01-01

In biomedical research, a health effect is frequently associated with protracted exposures of varying intensity sustained in the past. The main complexity of modeling and interpreting such phenomena lies in the additional temporal dimension needed to express the association, as the risk depends on both intensity and timing of past exposures. This type of dependency is defined here as exposure–lag–response association. In this contribution, I illustrate a general statistical framework for such associations, established through the extension of distributed lag non-linear models, originally developed in time series analysis. This modeling class is based on the definition of a cross-basis, obtained by the combination of two functions to flexibly model linear or nonlinear exposure-responses and the lag structure of the relationship, respectively. The methodology is illustrated with an example application to cohort data and validated through a simulation study. This modeling framework generalizes to various study designs and regression models, and can be applied to study the health effects of protracted exposures to environmental factors, drugs or carcinogenic agents, among others. © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons, Ltd. PMID:24027094

A generalized fuzzy linear programming approach for environmental management problem under uncertainty.

PubMed

Fan, Yurui; Huang, Guohe; Veawab, Amornvadee

2012-01-01

In this study, a generalized fuzzy linear programming (GFLP) method was developed to deal with uncertainties expressed as fuzzy sets that exist in the constraints and objective function. A stepwise interactive algorithm (SIA) was advanced to solve GFLP model and generate solutions expressed as fuzzy sets. To demonstrate its application, the developed GFLP method was applied to a regional sulfur dioxide (SO2) control planning model to identify effective SO2 mitigation polices with a minimized system performance cost under uncertainty. The results were obtained to represent the amount of SO2 allocated to different control measures from different sources. Compared with the conventional interval-parameter linear programming (ILP) approach, the solutions obtained through GFLP were expressed as fuzzy sets, which can provide intervals for the decision variables and objective function, as well as related possibilities. Therefore, the decision makers can make a tradeoff between model stability and the plausibility based on solutions obtained through GFLP and then identify desired policies for SO2-emission control under uncertainty.

Reduced-order modeling of soft robots

PubMed Central

Chenevier, Jean; González, David; Aguado, J. Vicente; Chinesta, Francisco

2018-01-01

We present a general strategy for the modeling and simulation-based control of soft robots. Although the presented methodology is completely general, we restrict ourselves to the analysis of a model robot made of hyperelastic materials and actuated by cables or tendons. To comply with the stringent real-time constraints imposed by control algorithms, a reduced-order modeling strategy is proposed that allows to minimize the amount of online CPU cost. Instead, an offline training procedure is proposed that allows to determine a sort of response surface that characterizes the response of the robot. Contrarily to existing strategies, the proposed methodology allows for a fully non-linear modeling of the soft material in a hyperelastic setting as well as a fully non-linear kinematic description of the movement without any restriction nor simplifying assumption. Examples of different configurations of the robot were analyzed that show the appeal of the method. PMID:29470496

Stability margin of linear systems with parameters described by fuzzy numbers.

PubMed

Husek, Petr

2011-10-01

This paper deals with the linear systems with uncertain parameters described by fuzzy numbers. The problem of determining the stability margin of those systems with linear affine dependence of the coefficients of a characteristic polynomial on system parameters is studied. Fuzzy numbers describing the system parameters are allowed to be characterized by arbitrary nonsymmetric membership functions. An elegant solution, graphical in nature, based on generalization of the Tsypkin-Polyak plot is presented. The advantage of the presented approach over the classical robust concept is demonstrated on a control of the Fiat Dedra engine model and a control of the quarter car suspension model.

The evaluation of the OSGLR algorithm for restructurable controls

NASA Technical Reports Server (NTRS)

Bonnice, W. F.; Wagner, E.; Hall, S. R.; Motyka, P.

1986-01-01

The detection and isolation of commercial aircraft control surface and actuator failures using the orthogonal series generalized likelihood ratio (OSGLR) test was evaluated. The OSGLR algorithm was chosen as the most promising algorithm based on a preliminary evaluation of three failure detection and isolation (FDI) algorithms (the detection filter, the generalized likelihood ratio test, and the OSGLR test) and a survey of the literature. One difficulty of analytic FDI techniques and the OSGLR algorithm in particular is their sensitivity to modeling errors. Therefore, methods of improving the robustness of the algorithm were examined with the incorporation of age-weighting into the algorithm being the most effective approach, significantly reducing the sensitivity of the algorithm to modeling errors. The steady-state implementation of the algorithm based on a single cruise linear model was evaluated using a nonlinear simulation of a C-130 aircraft. A number of off-nominal no-failure flight conditions including maneuvers, nonzero flap deflections, different turbulence levels and steady winds were tested. Based on the no-failure decision functions produced by off-nominal flight conditions, the failure detection performance at the nominal flight condition was determined. The extension of the algorithm to a wider flight envelope by scheduling the linear models used by the algorithm on dynamic pressure and flap deflection was also considered. Since simply scheduling the linear models over the entire flight envelope is unlikely to be adequate, scheduling of the steady-state implentation of the algorithm was briefly investigated.

SOCR Analyses - an Instructional Java Web-based Statistical Analysis Toolkit.

PubMed

Chu, Annie; Cui, Jenny; Dinov, Ivo D

2009-03-01

The Statistical Online Computational Resource (SOCR) designs web-based tools for educational use in a variety of undergraduate courses (Dinov 2006). Several studies have demonstrated that these resources significantly improve students' motivation and learning experiences (Dinov et al. 2008). SOCR Analyses is a new component that concentrates on data modeling and analysis using parametric and non-parametric techniques supported with graphical model diagnostics. Currently implemented analyses include commonly used models in undergraduate statistics courses like linear models (Simple Linear Regression, Multiple Linear Regression, One-Way and Two-Way ANOVA). In addition, we implemented tests for sample comparisons, such as t-test in the parametric category; and Wilcoxon rank sum test, Kruskal-Wallis test, Friedman's test, in the non-parametric category. SOCR Analyses also include several hypothesis test models, such as Contingency tables, Friedman's test and Fisher's exact test.The code itself is open source (http://socr.googlecode.com/), hoping to contribute to the efforts of the statistical computing community. The code includes functionality for each specific analysis model and it has general utilities that can be applied in various statistical computing tasks. For example, concrete methods with API (Application Programming Interface) have been implemented in statistical summary, least square solutions of general linear models, rank calculations, etc. HTML interfaces, tutorials, source code, activities, and data are freely available via the web (www.SOCR.ucla.edu). Code examples for developers and demos for educators are provided on the SOCR Wiki website.In this article, the pedagogical utilization of the SOCR Analyses is discussed, as well as the underlying design framework. As the SOCR project is on-going and more functions and tools are being added to it, these resources are constantly improved. The reader is strongly encouraged to check the SOCR site for most updated information and newly added models.

EVALUATING PREDICTIVE ERRORS OF A COMPLEX ENVIRONMENTAL MODEL USING A GENERAL LINEAR MODEL AND LEAST SQUARE MEANS

EPA Science Inventory

A General Linear Model (GLM) was used to evaluate the deviation of predicted values from expected values for a complex environmental model. For this demonstration, we used the default level interface of the Regional Mercury Cycling Model (R-MCM) to simulate epilimnetic total mer...

Modeling containment of large wildfires using generalized linear mixed-model analysis

Treesearch

Mark Finney; Isaac C. Grenfell; Charles W. McHugh

2009-01-01

Billions of dollars are spent annually in the United States to contain large wildland fires, but the factors contributing to suppression success remain poorly understood. We used a regression model (generalized linear mixed-model) to model containment probability of individual fires, assuming that containment was a repeated-measures problem (fixed effect) and...

The Convergence Model of Communication. Papers of the East-West Communication Institute, No. 18.

ERIC Educational Resources Information Center

Kincaid, D. Lawrence

Expressing the need for a description of communication that is equally applicable to all the social sciences, this report develops a general model of the communication process based upon the principle of convergence as derived from basic information theory and cybernetics. It criticizes the linear, one-way models of communication that have…

Flexible Learning Itineraries Based on Conceptual Maps

ERIC Educational Resources Information Center

Agudelo, Olga Lucía; Salinas, Jesús

2015-01-01

The use of learning itineraries based on conceptual maps is studied in order to propose a more flexible instructional design that strengthens the learning process focused on the student, generating non-linear processes, characterising its elements, setting up relationships between them and shaping a general model with specifications for each…

Quantum description of light propagation in generalized media

NASA Astrophysics Data System (ADS)

Häyrynen, Teppo; Oksanen, Jani

2016-02-01

Linear quantum input-output relation based models are widely applied to describe the light propagation in a lossy medium. The details of the interaction and the associated added noise depend on whether the device is configured to operate as an amplifier or an attenuator. Using the traveling wave (TW) approach, we generalize the linear material model to simultaneously account for both the emission and absorption processes and to have point-wise defined noise field statistics and intensity dependent interaction strengths. Thus, our approach describes the quantum input-output relations of linear media with net attenuation, amplification or transparency without pre-selection of the operation point. The TW approach is then applied to investigate materials at thermal equilibrium, inverted materials, the transparency limit where losses are compensated, and the saturating amplifiers. We also apply the approach to investigate media in nonuniform states which can be e.g. consequences of a temperature gradient over the medium or a position dependent inversion of the amplifier. Furthermore, by using the generalized model we investigate devices with intensity dependent interactions and show how an initial thermal field transforms to a field having coherent statistics due to gain saturation.

Electricity Consumption in the Industrial Sector of Jordan: Application of Multivariate Linear Regression and Adaptive Neuro-Fuzzy Techniques

NASA Astrophysics Data System (ADS)

Samhouri, M.; Al-Ghandoor, A.; Fouad, R. H.

2009-08-01

In this study two techniques, for modeling electricity consumption of the Jordanian industrial sector, are presented: (i) multivariate linear regression and (ii) neuro-fuzzy models. Electricity consumption is modeled as function of different variables such as number of establishments, number of employees, electricity tariff, prevailing fuel prices, production outputs, capacity utilizations, and structural effects. It was found that industrial production and capacity utilization are the most important variables that have significant effect on future electrical power demand. The results showed that both the multivariate linear regression and neuro-fuzzy models are generally comparable and can be used adequately to simulate industrial electricity consumption. However, comparison that is based on the square root average squared error of data suggests that the neuro-fuzzy model performs slightly better for future prediction of electricity consumption than the multivariate linear regression model. Such results are in full agreement with similar work, using different methods, for other countries.

Comparison of modeling methods to predict the spatial distribution of deep-sea coral and sponge in the Gulf of Alaska

NASA Astrophysics Data System (ADS)

Rooper, Christopher N.; Zimmermann, Mark; Prescott, Megan M.

2017-08-01

Deep-sea coral and sponge ecosystems are widespread throughout most of Alaska's marine waters, and are associated with many different species of fishes and invertebrates. These ecosystems are vulnerable to the effects of commercial fishing activities and climate change. We compared four commonly used species distribution models (general linear models, generalized additive models, boosted regression trees and random forest models) and an ensemble model to predict the presence or absence and abundance of six groups of benthic invertebrate taxa in the Gulf of Alaska. All four model types performed adequately on training data for predicting presence and absence, with regression forest models having the best overall performance measured by the area under the receiver-operating-curve (AUC). The models also performed well on the test data for presence and absence with average AUCs ranging from 0.66 to 0.82. For the test data, ensemble models performed the best. For abundance data, there was an obvious demarcation in performance between the two regression-based methods (general linear models and generalized additive models), and the tree-based models. The boosted regression tree and random forest models out-performed the other models by a wide margin on both the training and testing data. However, there was a significant drop-off in performance for all models of invertebrate abundance ( 50%) when moving from the training data to the testing data. Ensemble model performance was between the tree-based and regression-based methods. The maps of predictions from the models for both presence and abundance agreed very well across model types, with an increase in variability in predictions for the abundance data. We conclude that where data conforms well to the modeled distribution (such as the presence-absence data and binomial distribution in this study), the four types of models will provide similar results, although the regression-type models may be more consistent with biological theory. For data with highly zero-inflated distributions and non-normal distributions such as the abundance data from this study, the tree-based methods performed better. Ensemble models that averaged predictions across the four model types, performed better than the GLM or GAM models but slightly poorer than the tree-based methods, suggesting ensemble models might be more robust to overfitting than tree methods, while mitigating some of the disadvantages in predictive performance of regression methods.

Multilayer neural networks for reduced-rank approximation.

PubMed

Diamantaras, K I; Kung, S Y

1994-01-01

This paper is developed in two parts. First, the authors formulate the solution to the general reduced-rank linear approximation problem relaxing the invertibility assumption of the input autocorrelation matrix used by previous authors. The authors' treatment unifies linear regression, Wiener filtering, full rank approximation, auto-association networks, SVD and principal component analysis (PCA) as special cases. The authors' analysis also shows that two-layer linear neural networks with reduced number of hidden units, trained with the least-squares error criterion, produce weights that correspond to the generalized singular value decomposition of the input-teacher cross-correlation matrix and the input data matrix. As a corollary the linear two-layer backpropagation model with reduced hidden layer extracts an arbitrary linear combination of the generalized singular vector components. Second, the authors investigate artificial neural network models for the solution of the related generalized eigenvalue problem. By introducing and utilizing the extended concept of deflation (originally proposed for the standard eigenvalue problem) the authors are able to find that a sequential version of linear BP can extract the exact generalized eigenvector components. The advantage of this approach is that it's easier to update the model structure by adding one more unit or pruning one or more units when the application requires it. An alternative approach for extracting the exact components is to use a set of lateral connections among the hidden units trained in such a way as to enforce orthogonality among the upper- and lower-layer weights. The authors call this the lateral orthogonalization network (LON) and show via theoretical analysis-and verify via simulation-that the network extracts the desired components. The advantage of the LON-based model is that it can be applied in a parallel fashion so that the components are extracted concurrently. Finally, the authors show the application of their results to the solution of the identification problem of systems whose excitation has a non-invertible autocorrelation matrix. Previous identification methods usually rely on the invertibility assumption of the input autocorrelation, therefore they can not be applied to this case.

Wavelet regression model in forecasting crude oil price

NASA Astrophysics Data System (ADS)

Hamid, Mohd Helmie; Shabri, Ani

2017-05-01

This study presents the performance of wavelet multiple linear regression (WMLR) technique in daily crude oil forecasting. WMLR model was developed by integrating the discrete wavelet transform (DWT) and multiple linear regression (MLR) model. The original time series was decomposed to sub-time series with different scales by wavelet theory. Correlation analysis was conducted to assist in the selection of optimal decomposed components as inputs for the WMLR model. The daily WTI crude oil price series has been used in this study to test the prediction capability of the proposed model. The forecasting performance of WMLR model were also compared with regular multiple linear regression (MLR), Autoregressive Moving Average (ARIMA) and Generalized Autoregressive Conditional Heteroscedasticity (GARCH) using root mean square errors (RMSE) and mean absolute errors (MAE). Based on the experimental results, it appears that the WMLR model performs better than the other forecasting technique tested in this study.

Shear-flexible finite-element models of laminated composite plates and shells

NASA Technical Reports Server (NTRS)

Noor, A. K.; Mathers, M. D.

1975-01-01

Several finite-element models are applied to the linear static, stability, and vibration analysis of laminated composite plates and shells. The study is based on linear shallow-shell theory, with the effects of shear deformation, anisotropic material behavior, and bending-extensional coupling included. Both stiffness (displacement) and mixed finite-element models are considered. Discussion is focused on the effects of shear deformation and anisotropic material behavior on the accuracy and convergence of different finite-element models. Numerical studies are presented which show the effects of increasing the order of the approximating polynomials, adding internal degrees of freedom, and using derivatives of generalized displacements as nodal parameters.

LQR-Based Optimal Distributed Cooperative Design for Linear Discrete-Time Multiagent Systems.

PubMed

Zhang, Huaguang; Feng, Tao; Liang, Hongjing; Luo, Yanhong

2017-03-01

In this paper, a novel linear quadratic regulator (LQR)-based optimal distributed cooperative design method is developed for synchronization control of general linear discrete-time multiagent systems on a fixed, directed graph. Sufficient conditions are derived for synchronization, which restrict the graph eigenvalues into a bounded circular region in the complex plane. The synchronizing speed issue is also considered, and it turns out that the synchronizing region reduces as the synchronizing speed becomes faster. To obtain more desirable synchronizing capacity, the weighting matrices are selected by sufficiently utilizing the guaranteed gain margin of the optimal regulators. Based on the developed LQR-based cooperative design framework, an approximate dynamic programming technique is successfully introduced to overcome the (partially or completely) model-free cooperative design for linear multiagent systems. Finally, two numerical examples are given to illustrate the effectiveness of the proposed design methods.

Steady-state global optimization of metabolic non-linear dynamic models through recasting into power-law canonical models

PubMed Central

2011-01-01

Background Design of newly engineered microbial strains for biotechnological purposes would greatly benefit from the development of realistic mathematical models for the processes to be optimized. Such models can then be analyzed and, with the development and application of appropriate optimization techniques, one could identify the modifications that need to be made to the organism in order to achieve the desired biotechnological goal. As appropriate models to perform such an analysis are necessarily non-linear and typically non-convex, finding their global optimum is a challenging task. Canonical modeling techniques, such as Generalized Mass Action (GMA) models based on the power-law formalism, offer a possible solution to this problem because they have a mathematical structure that enables the development of specific algorithms for global optimization. Results Based on the GMA canonical representation, we have developed in previous works a highly efficient optimization algorithm and a set of related strategies for understanding the evolution of adaptive responses in cellular metabolism. Here, we explore the possibility of recasting kinetic non-linear models into an equivalent GMA model, so that global optimization on the recast GMA model can be performed. With this technique, optimization is greatly facilitated and the results are transposable to the original non-linear problem. This procedure is straightforward for a particular class of non-linear models known as Saturable and Cooperative (SC) models that extend the power-law formalism to deal with saturation and cooperativity. Conclusions Our results show that recasting non-linear kinetic models into GMA models is indeed an appropriate strategy that helps overcoming some of the numerical difficulties that arise during the global optimization task. PMID:21867520

Bayesian inference on risk differences: an application to multivariate meta-analysis of adverse events in clinical trials.

PubMed

Chen, Yong; Luo, Sheng; Chu, Haitao; Wei, Peng

2013-05-01

Multivariate meta-analysis is useful in combining evidence from independent studies which involve several comparisons among groups based on a single outcome. For binary outcomes, the commonly used statistical models for multivariate meta-analysis are multivariate generalized linear mixed effects models which assume risks, after some transformation, follow a multivariate normal distribution with possible correlations. In this article, we consider an alternative model for multivariate meta-analysis where the risks are modeled by the multivariate beta distribution proposed by Sarmanov (1966). This model have several attractive features compared to the conventional multivariate generalized linear mixed effects models, including simplicity of likelihood function, no need to specify a link function, and has a closed-form expression of distribution functions for study-specific risk differences. We investigate the finite sample performance of this model by simulation studies and illustrate its use with an application to multivariate meta-analysis of adverse events of tricyclic antidepressants treatment in clinical trials.

A Permutation Approach for Selecting the Penalty Parameter in Penalized Model Selection

PubMed Central

Sabourin, Jeremy A; Valdar, William; Nobel, Andrew B

2015-01-01

Summary We describe a simple, computationally effcient, permutation-based procedure for selecting the penalty parameter in LASSO penalized regression. The procedure, permutation selection, is intended for applications where variable selection is the primary focus, and can be applied in a variety of structural settings, including that of generalized linear models. We briefly discuss connections between permutation selection and existing theory for the LASSO. In addition, we present a simulation study and an analysis of real biomedical data sets in which permutation selection is compared with selection based on the following: cross-validation (CV), the Bayesian information criterion (BIC), Scaled Sparse Linear Regression, and a selection method based on recently developed testing procedures for the LASSO. PMID:26243050

Parameter Recovery for the 1-P HGLLM with Non-Normally Distributed Level-3 Residuals

ERIC Educational Resources Information Center

Kara, Yusuf; Kamata, Akihito

2017-01-01

A multilevel Rasch model using a hierarchical generalized linear model is one approach to multilevel item response theory (IRT) modeling and is referred to as a one-parameter hierarchical generalized linear logistic model (1-P HGLLM). Although it has the flexibility to model nested structure of data with covariates, the model assumes the normality…

Predictive IP controller for robust position control of linear servo system.

PubMed

Lu, Shaowu; Zhou, Fengxing; Ma, Yajie; Tang, Xiaoqi

2016-07-01

Position control is a typical application of linear servo system. In this paper, to reduce the system overshoot, an integral plus proportional (IP) controller is used in the position control implementation. To further improve the control performance, a gain-tuning IP controller based on a generalized predictive control (GPC) law is proposed. Firstly, to represent the dynamics of the position loop, a second-order linear model is used and its model parameters are estimated on-line by using a recursive least squares method. Secondly, based on the GPC law, an optimal control sequence is obtained by using receding horizon, then directly supplies the IP controller with the corresponding control parameters in the real operations. Finally, simulation and experimental results are presented to show the efficiency of proposed scheme. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

Tracking Electroencephalographic Changes Using Distributions of Linear Models: Application to Propofol-Based Depth of Anesthesia Monitoring.

PubMed

Kuhlmann, Levin; Manton, Jonathan H; Heyse, Bjorn; Vereecke, Hugo E M; Lipping, Tarmo; Struys, Michel M R F; Liley, David T J

2017-04-01

Tracking brain states with electrophysiological measurements often relies on short-term averages of extracted features and this may not adequately capture the variability of brain dynamics. The objective is to assess the hypotheses that this can be overcome by tracking distributions of linear models using anesthesia data, and that anesthetic brain state tracking performance of linear models is comparable to that of a high performing depth of anesthesia monitoring feature. Individuals' brain states are classified by comparing the distribution of linear (auto-regressive moving average-ARMA) model parameters estimated from electroencephalographic (EEG) data obtained with a sliding window to distributions of linear model parameters for each brain state. The method is applied to frontal EEG data from 15 subjects undergoing propofol anesthesia and classified by the observers assessment of alertness/sedation (OAA/S) scale. Classification of the OAA/S score was performed using distributions of either ARMA parameters or the benchmark feature, Higuchi fractal dimension. The highest average testing sensitivity of 59% (chance sensitivity: 17%) was found for ARMA (2,1) models and Higuchi fractal dimension achieved 52%, however, no statistical difference was observed. For the same ARMA case, there was no statistical difference if medians are used instead of distributions (sensitivity: 56%). The model-based distribution approach is not necessarily more effective than a median/short-term average approach, however, it performs well compared with a distribution approach based on a high performing anesthesia monitoring measure. These techniques hold potential for anesthesia monitoring and may be generally applicable for tracking brain states.

Control of Distributed Parameter Systems

DTIC Science & Technology

1990-08-01

vari- ant of the general Lotka - Volterra model for interspecific competition. The variant described the emergence of one subpopulation from another as a...distribut ion unlimited. I&. ARSTRACT (MAUMUnw2O1 A unified arioroximation framework for Parameter estimation In general linear POE models has been completed...unified approximation framework for parameter estimation in general linear PDE models. This framework has provided the theoretical basis for a number of

The Use of Shrinkage Techniques in the Estimation of Attrition Rates for Large Scale Manpower Models

DTIC Science & Technology

1988-07-27

auto regressive model combined with a linear program that solves for the coefficients using MAD. But this success has diminished with time (Rowe...8217Harrison-Stevens Forcasting and the Multiprocess Dy- namic Linear Model ", The American Statistician, v.40, pp. 12 9 - 1 3 5 . 1986. 8. Box, G. E. P. and...1950. 40. McCullagh, P. and Nelder, J., Generalized Linear Models , Chapman and Hall. 1983. 41. McKenzie, E. General Exponential Smoothing and the

Order-constrained linear optimization.

PubMed

Tidwell, Joe W; Dougherty, Michael R; Chrabaszcz, Jeffrey S; Thomas, Rick P

2017-11-01

Despite the fact that data and theories in the social, behavioural, and health sciences are often represented on an ordinal scale, there has been relatively little emphasis on modelling ordinal properties. The most common analytic framework used in psychological science is the general linear model, whose variants include ANOVA, MANOVA, and ordinary linear regression. While these methods are designed to provide the best fit to the metric properties of the data, they are not designed to maximally model ordinal properties. In this paper, we develop an order-constrained linear least-squares (OCLO) optimization algorithm that maximizes the linear least-squares fit to the data conditional on maximizing the ordinal fit based on Kendall's τ. The algorithm builds on the maximum rank correlation estimator (Han, 1987, Journal of Econometrics, 35, 303) and the general monotone model (Dougherty & Thomas, 2012, Psychological Review, 119, 321). Analyses of simulated data indicate that when modelling data that adhere to the assumptions of ordinary least squares, OCLO shows minimal bias, little increase in variance, and almost no loss in out-of-sample predictive accuracy. In contrast, under conditions in which data include a small number of extreme scores (fat-tailed distributions), OCLO shows less bias and variance, and substantially better out-of-sample predictive accuracy, even when the outliers are removed. We show that the advantages of OCLO over ordinary least squares in predicting new observations hold across a variety of scenarios in which researchers must decide to retain or eliminate extreme scores when fitting data. © 2017 The British Psychological Society.

The microcomputer scientific software series 2: general linear model--regression.

Treesearch

Harold M. Rauscher

1983-01-01

The general linear model regression (GLMR) program provides the microcomputer user with a sophisticated regression analysis capability. The output provides a regression ANOVA table, estimators of the regression model coefficients, their confidence intervals, confidence intervals around the predicted Y-values, residuals for plotting, a check for multicollinearity, a...

State variable modeling of the integrated engine and aircraft dynamics

NASA Astrophysics Data System (ADS)

Rotaru, Constantin; Sprinţu, Iuliana

2014-12-01

This study explores the dynamic characteristics of the combined aircraft-engine system, based on the general theory of the state variables for linear and nonlinear systems, with details leading first to the separate formulation of the longitudinal and the lateral directional state variable models, followed by the merging of the aircraft and engine models into a single state variable model. The linearized equations were expressed in a matrix form and the engine dynamics was included in terms of variation of thrust following a deflection of the throttle. The linear model of the shaft dynamics for a two-spool jet engine was derived by extending the one-spool model. The results include the discussion of the thrust effect upon the aircraft response when the thrust force associated with the engine has a sizable moment arm with respect to the aircraft center of gravity for creating a compensating moment.

Thermospheric dynamics - A system theory approach

NASA Technical Reports Server (NTRS)

Codrescu, M.; Forbes, J. M.; Roble, R. G.

1990-01-01

A system theory approach to thermospheric modeling is developed, based upon a linearization method which is capable of preserving nonlinear features of a dynamical system. The method is tested using a large, nonlinear, time-varying system, namely the thermospheric general circulation model (TGCM) of the National Center for Atmospheric Research. In the linearized version an equivalent system, defined for one of the desired TGCM output variables, is characterized by a set of response functions that is constructed from corresponding quasi-steady state and unit sample response functions. The linearized version of the system runs on a personal computer and produces an approximation of the desired TGCM output field height profile at a given geographic location.

Ancestral haplotype-based association mapping with generalized linear mixed models accounting for stratification.

PubMed

Zhang, Z; Guillaume, F; Sartelet, A; Charlier, C; Georges, M; Farnir, F; Druet, T

2012-10-01

In many situations, genome-wide association studies are performed in populations presenting stratification. Mixed models including a kinship matrix accounting for genetic relatedness among individuals have been shown to correct for population and/or family structure. Here we extend this methodology to generalized linear mixed models which properly model data under various distributions. In addition we perform association with ancestral haplotypes inferred using a hidden Markov model. The method was shown to properly account for stratification under various simulated scenari presenting population and/or family structure. Use of ancestral haplotypes resulted in higher power than SNPs on simulated datasets. Application to real data demonstrates the usefulness of the developed model. Full analysis of a dataset with 4600 individuals and 500 000 SNPs was performed in 2 h 36 min and required 2.28 Gb of RAM. The software GLASCOW can be freely downloaded from www.giga.ulg.ac.be/jcms/prod_381171/software. francois.guillaume@jouy.inra.fr Supplementary data are available at Bioinformatics online.

Solving large mixed linear models using preconditioned conjugate gradient iteration.

PubMed

Strandén, I; Lidauer, M

1999-12-01

Continuous evaluation of dairy cattle with a random regression test-day model requires a fast solving method and algorithm. A new computing technique feasible in Jacobi and conjugate gradient based iterative methods using iteration on data is presented. In the new computing technique, the calculations in multiplication of a vector by a matrix were recorded to three steps instead of the commonly used two steps. The three-step method was implemented in a general mixed linear model program that used preconditioned conjugate gradient iteration. Performance of this program in comparison to other general solving programs was assessed via estimation of breeding values using univariate, multivariate, and random regression test-day models. Central processing unit time per iteration with the new three-step technique was, at best, one-third that needed with the old technique. Performance was best with the test-day model, which was the largest and most complex model used. The new program did well in comparison to other general software. Programs keeping the mixed model equations in random access memory required at least 20 and 435% more time to solve the univariate and multivariate animal models, respectively. Computations of the second best iteration on data took approximately three and five times longer for the animal and test-day models, respectively, than did the new program. Good performance was due to fast computing time per iteration and quick convergence to the final solutions. Use of preconditioned conjugate gradient based methods in solving large breeding value problems is supported by our findings.

An algorithm for control system design via parameter optimization. M.S. Thesis

NASA Technical Reports Server (NTRS)

Sinha, P. K.

1972-01-01

An algorithm for design via parameter optimization has been developed for linear-time-invariant control systems based on the model reference adaptive control concept. A cost functional is defined to evaluate the system response relative to nominal, which involves in general the error between the system and nominal response, its derivatives and the control signals. A program for the practical implementation of this algorithm has been developed, with the computational scheme for the evaluation of the performance index based on Lyapunov's theorem for stability of linear invariant systems.

A high speed model-based approach for wavefront sensorless adaptive optics systems

NASA Astrophysics Data System (ADS)

Lianghua, Wen; Yang, Ping; Shuai, Wang; Wenjing, Liu; Shanqiu, Chen; Xu, Bing

2018-02-01

To improve temporal-frequency property of wavefront sensorless adaptive optics (AO) systems, a fast general model-based aberration correction algorithm is presented. The fast general model-based approach is based on the approximately linear relation between the mean square of the aberration gradients and the second moment of far-field intensity distribution. The presented model-based method is capable of completing a mode aberration effective correction just applying one disturbing onto the deformable mirror(one correction by one disturbing), which is reconstructed by the singular value decomposing the correlation matrix of the Zernike functions' gradients. Numerical simulations of AO corrections under the various random and dynamic aberrations are implemented. The simulation results indicate that the equivalent control bandwidth is 2-3 times than that of the previous method with one aberration correction after applying N times disturbing onto the deformable mirror (one correction by N disturbing).

An Efficient Test for Gene-Environment Interaction in Generalized Linear Mixed Models with Family Data.

PubMed

Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza

2017-09-27

Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.

Comparison of classification methods for voxel-based prediction of acute ischemic stroke outcome following intra-arterial intervention

NASA Astrophysics Data System (ADS)

Winder, Anthony J.; Siemonsen, Susanne; Flottmann, Fabian; Fiehler, Jens; Forkert, Nils D.

2017-03-01

Voxel-based tissue outcome prediction in acute ischemic stroke patients is highly relevant for both clinical routine and research. Previous research has shown that features extracted from baseline multi-parametric MRI datasets have a high predictive value and can be used for the training of classifiers, which can generate tissue outcome predictions for both intravenous and conservative treatments. However, with the recent advent and popularization of intra-arterial thrombectomy treatment, novel research specifically addressing the utility of predictive classi- fiers for thrombectomy intervention is necessary for a holistic understanding of current stroke treatment options. The aim of this work was to develop three clinically viable tissue outcome prediction models using approximate nearest-neighbor, generalized linear model, and random decision forest approaches and to evaluate the accuracy of predicting tissue outcome after intra-arterial treatment. Therefore, the three machine learning models were trained, evaluated, and compared using datasets of 42 acute ischemic stroke patients treated with intra-arterial thrombectomy. Classifier training utilized eight voxel-based features extracted from baseline MRI datasets and five global features. Evaluation of classifier-based predictions was performed via comparison to the known tissue outcome, which was determined in follow-up imaging, using the Dice coefficient and leave-on-patient-out cross validation. The random decision forest prediction model led to the best tissue outcome predictions with a mean Dice coefficient of 0.37. The approximate nearest-neighbor and generalized linear model performed equally suboptimally with average Dice coefficients of 0.28 and 0.27 respectively, suggesting that both non-linearity and machine learning are desirable properties of a classifier well-suited to the intra-arterial tissue outcome prediction problem.

An Index and Test of Linear Moderated Mediation.

PubMed

Hayes, Andrew F

2015-01-01

I describe a test of linear moderated mediation in path analysis based on an interval estimate of the parameter of a function linking the indirect effect to values of a moderator-a parameter that I call the index of moderated mediation. This test can be used for models that integrate moderation and mediation in which the relationship between the indirect effect and the moderator is estimated as linear, including many of the models described by Edwards and Lambert ( 2007 ) and Preacher, Rucker, and Hayes ( 2007 ) as well as extensions of these models to processes involving multiple mediators operating in parallel or in serial. Generalization of the method to latent variable models is straightforward. Three empirical examples describe the computation of the index and the test, and its implementation is illustrated using Mplus and the PROCESS macro for SPSS and SAS.

Linearized Programming of Memristors for Artificial Neuro-Sensor Signal Processing

PubMed Central

Yang, Changju; Kim, Hyongsuk

2016-01-01

A linearized programming method of memristor-based neural weights is proposed. Memristor is known as an ideal element to implement a neural synapse due to its embedded functions of analog memory and analog multiplication. Its resistance variation with a voltage input is generally a nonlinear function of time. Linearization of memristance variation about time is very important for the easiness of memristor programming. In this paper, a method utilizing an anti-serial architecture for linear programming is proposed. The anti-serial architecture is composed of two memristors with opposite polarities. It linearizes the variation of memristance due to complimentary actions of two memristors. For programming a memristor, additional memristor with opposite polarity is employed. The linearization effect of weight programming of an anti-serial architecture is investigated and memristor bridge synapse which is built with two sets of anti-serial memristor architecture is taken as an application example of the proposed method. Simulations are performed with memristors of both linear drift model and nonlinear model. PMID:27548186

Linearized Programming of Memristors for Artificial Neuro-Sensor Signal Processing.

PubMed

Yang, Changju; Kim, Hyongsuk

2016-08-19

A linearized programming method of memristor-based neural weights is proposed. Memristor is known as an ideal element to implement a neural synapse due to its embedded functions of analog memory and analog multiplication. Its resistance variation with a voltage input is generally a nonlinear function of time. Linearization of memristance variation about time is very important for the easiness of memristor programming. In this paper, a method utilizing an anti-serial architecture for linear programming is proposed. The anti-serial architecture is composed of two memristors with opposite polarities. It linearizes the variation of memristance due to complimentary actions of two memristors. For programming a memristor, additional memristor with opposite polarity is employed. The linearization effect of weight programming of an anti-serial architecture is investigated and memristor bridge synapse which is built with two sets of anti-serial memristor architecture is taken as an application example of the proposed method. Simulations are performed with memristors of both linear drift model and nonlinear model.

A Constrained Linear Estimator for Multiple Regression

ERIC Educational Resources Information Center

Davis-Stober, Clintin P.; Dana, Jason; Budescu, David V.

2010-01-01

"Improper linear models" (see Dawes, Am. Psychol. 34:571-582, "1979"), such as equal weighting, have garnered interest as alternatives to standard regression models. We analyze the general circumstances under which these models perform well by recasting a class of "improper" linear models as "proper" statistical models with a single predictor. We…

Simple, Efficient Estimators of Treatment Effects in Randomized Trials Using Generalized Linear Models to Leverage Baseline Variables

PubMed Central

Rosenblum, Michael; van der Laan, Mark J.

2010-01-01

Models, such as logistic regression and Poisson regression models, are often used to estimate treatment effects in randomized trials. These models leverage information in variables collected before randomization, in order to obtain more precise estimates of treatment effects. However, there is the danger that model misspecification will lead to bias. We show that certain easy to compute, model-based estimators are asymptotically unbiased even when the working model used is arbitrarily misspecified. Furthermore, these estimators are locally efficient. As a special case of our main result, we consider a simple Poisson working model containing only main terms; in this case, we prove the maximum likelihood estimate of the coefficient corresponding to the treatment variable is an asymptotically unbiased estimator of the marginal log rate ratio, even when the working model is arbitrarily misspecified. This is the log-linear analog of ANCOVA for linear models. Our results demonstrate one application of targeted maximum likelihood estimation. PMID:20628636

Convex set and linear mixing model

NASA Technical Reports Server (NTRS)

Xu, P.; Greeley, R.

1993-01-01

A major goal of optical remote sensing is to determine surface compositions of the earth and other planetary objects. For assessment of composition, single pixels in multi-spectral images usually record a mixture of the signals from various materials within the corresponding surface area. In this report, we introduce a closed and bounded convex set as a mathematical model for linear mixing. This model has a clear geometric implication because the closed and bounded convex set is a natural generalization of a triangle in n-space. The endmembers are extreme points of the convex set. Every point in the convex closure of the endmembers is a linear mixture of those endmembers, which is exactly how linear mixing is defined. With this model, some general criteria for selecting endmembers could be described. This model can lead to a better understanding of linear mixing models.

Inference regarding multiple structural changes in linear models with endogenous regressors☆

PubMed Central

Hall, Alastair R.; Han, Sanggohn; Boldea, Otilia

2012-01-01

This paper considers the linear model with endogenous regressors and multiple changes in the parameters at unknown times. It is shown that minimization of a Generalized Method of Moments criterion yields inconsistent estimators of the break fractions, but minimization of the Two Stage Least Squares (2SLS) criterion yields consistent estimators of these parameters. We develop a methodology for estimation and inference of the parameters of the model based on 2SLS. The analysis covers the cases where the reduced form is either stable or unstable. The methodology is illustrated via an application to the New Keynesian Phillips Curve for the US. PMID:23805021

Bivariate categorical data analysis using normal linear conditional multinomial probability model.

PubMed

Sun, Bingrui; Sutradhar, Brajendra

2015-02-10

Bivariate multinomial data such as the left and right eyes retinopathy status data are analyzed either by using a joint bivariate probability model or by exploiting certain odds ratio-based association models. However, the joint bivariate probability model yields marginal probabilities, which are complicated functions of marginal and association parameters for both variables, and the odds ratio-based association model treats the odds ratios involved in the joint probabilities as 'working' parameters, which are consequently estimated through certain arbitrary 'working' regression models. Also, this later odds ratio-based model does not provide any easy interpretations of the correlations between two categorical variables. On the basis of pre-specified marginal probabilities, in this paper, we develop a bivariate normal type linear conditional multinomial probability model to understand the correlations between two categorical variables. The parameters involved in the model are consistently estimated using the optimal likelihood and generalized quasi-likelihood approaches. The proposed model and the inferences are illustrated through an intensive simulation study as well as an analysis of the well-known Wisconsin Diabetic Retinopathy status data. Copyright © 2014 John Wiley & Sons, Ltd.

Practical robustness measures in multivariable control system analysis. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Lehtomaki, N. A.

1981-01-01

The robustness of the stability of multivariable linear time invariant feedback control systems with respect to model uncertainty is considered using frequency domain criteria. Available robustness tests are unified under a common framework based on the nature and structure of model errors. These results are derived using a multivariable version of Nyquist's stability theorem in which the minimum singular value of the return difference transfer matrix is shown to be the multivariable generalization of the distance to the critical point on a single input, single output Nyquist diagram. Using the return difference transfer matrix, a very general robustness theorem is presented from which all of the robustness tests dealing with specific model errors may be derived. The robustness tests that explicitly utilized model error structure are able to guarantee feedback system stability in the face of model errors of larger magnitude than those robustness tests that do not. The robustness of linear quadratic Gaussian control systems are analyzed.

General Multivariate Linear Modeling of Surface Shapes Using SurfStat

PubMed Central

Chung, Moo K.; Worsley, Keith J.; Nacewicz, Brendon, M.; Dalton, Kim M.; Davidson, Richard J.

2010-01-01

Although there are many imaging studies on traditional ROI-based amygdala volumetry, there are very few studies on modeling amygdala shape variations. This paper present a unified computational and statistical framework for modeling amygdala shape variations in a clinical population. The weighted spherical harmonic representation is used as to parameterize, to smooth out, and to normalize amygdala surfaces. The representation is subsequently used as an input for multivariate linear models accounting for nuisance covariates such as age and brain size difference using SurfStat package that completely avoids the complexity of specifying design matrices. The methodology has been applied for quantifying abnormal local amygdala shape variations in 22 high functioning autistic subjects. PMID:20620211

Derivation of the linear-logistic model and Cox's proportional hazard model from a canonical system description.

PubMed

Voit, E O; Knapp, R G

1997-08-15

The linear-logistic regression model and Cox's proportional hazard model are widely used in epidemiology. Their successful application leaves no doubt that they are accurate reflections of observed disease processes and their associated risks or incidence rates. In spite of their prominence, it is not a priori evident why these models work. This article presents a derivation of the two models from the framework of canonical modeling. It begins with a general description of the dynamics between risk sources and disease development, formulates this description in the canonical representation of an S-system, and shows how the linear-logistic model and Cox's proportional hazard model follow naturally from this representation. The article interprets the model parameters in terms of epidemiological concepts as well as in terms of general systems theory and explains the assumptions and limitations generally accepted in the application of these epidemiological models.

Prediction of siRNA potency using sparse logistic regression.

PubMed

Hu, Wei; Hu, John

2014-06-01

RNA interference (RNAi) can modulate gene expression at post-transcriptional as well as transcriptional levels. Short interfering RNA (siRNA) serves as a trigger for the RNAi gene inhibition mechanism, and therefore is a crucial intermediate step in RNAi. There have been extensive studies to identify the sequence characteristics of potent siRNAs. One such study built a linear model using LASSO (Least Absolute Shrinkage and Selection Operator) to measure the contribution of each siRNA sequence feature. This model is simple and interpretable, but it requires a large number of nonzero weights. We have introduced a novel technique, sparse logistic regression, to build a linear model using single-position specific nucleotide compositions which has the same prediction accuracy of the linear model based on LASSO. The weights in our new model share the same general trend as those in the previous model, but have only 25 nonzero weights out of a total 84 weights, a 54% reduction compared to the previous model. Contrary to the linear model based on LASSO, our model suggests that only a few positions are influential on the efficacy of the siRNA, which are the 5' and 3' ends and the seed region of siRNA sequences. We also employed sparse logistic regression to build a linear model using dual-position specific nucleotide compositions, a task LASSO is not able to accomplish well due to its high dimensional nature. Our results demonstrate the superiority of sparse logistic regression as a technique for both feature selection and regression over LASSO in the context of siRNA design.

Linear Logistic Test Modeling with R

ERIC Educational Resources Information Center

Baghaei, Purya; Kubinger, Klaus D.

2015-01-01

The present paper gives a general introduction to the linear logistic test model (Fischer, 1973), an extension of the Rasch model with linear constraints on item parameters, along with eRm (an R package to estimate different types of Rasch models; Mair, Hatzinger, & Mair, 2014) functions to estimate the model and interpret its parameters. The…

Spatial modeling in ecology: the flexibility of eigenfunction spatial analyses.

PubMed

Griffith, Daniel A; Peres-Neto, Pedro R

2006-10-01

Recently, analytical approaches based on the eigenfunctions of spatial configuration matrices have been proposed in order to consider explicitly spatial predictors. The present study demonstrates the usefulness of eigenfunctions in spatial modeling applied to ecological problems and shows equivalencies of and differences between the two current implementations of this methodology. The two approaches in this category are the distance-based (DB) eigenvector maps proposed by P. Legendre and his colleagues, and spatial filtering based upon geographic connectivity matrices (i.e., topology-based; CB) developed by D. A. Griffith and his colleagues. In both cases, the goal is to create spatial predictors that can be easily incorporated into conventional regression models. One important advantage of these two approaches over any other spatial approach is that they provide a flexible tool that allows the full range of general and generalized linear modeling theory to be applied to ecological and geographical problems in the presence of nonzero spatial autocorrelation.

Chemical oscillator as a generalized Rayleigh oscillator.

PubMed

Ghosh, Shyamolina; Ray, Deb Shankar

2013-10-28

We derive the conditions under which a set of arbitrary two dimensional autonomous kinetic equations can be reduced to the form of a generalized Rayleigh oscillator which admits of limit cycle solution. This is based on a linear transformation of field variables which can be found by inspection of the kinetic equations. We illustrate the scheme with the help of several chemical and bio-chemical oscillator models to show how they can be cast as a generalized Rayleigh oscillator.

Defining a Family of Cognitive Diagnosis Models Using Log-Linear Models with Latent Variables

ERIC Educational Resources Information Center

Henson, Robert A.; Templin, Jonathan L.; Willse, John T.

2009-01-01

This paper uses log-linear models with latent variables (Hagenaars, in "Loglinear Models with Latent Variables," 1993) to define a family of cognitive diagnosis models. In doing so, the relationship between many common models is explicitly defined and discussed. In addition, because the log-linear model with latent variables is a general model for…

A modelling approach to assessing the timescale uncertainties in proxy series with chronological errors

NASA Astrophysics Data System (ADS)

Divine, D. V.; Godtliebsen, F.; Rue, H.

2012-01-01

The paper proposes an approach to assessment of timescale errors in proxy-based series with chronological uncertainties. The method relies on approximation of the physical process(es) forming a proxy archive by a random Gamma process. Parameters of the process are partly data-driven and partly determined from prior assumptions. For a particular case of a linear accumulation model and absolutely dated tie points an analytical solution is found suggesting the Beta-distributed probability density on age estimates along the length of a proxy archive. In a general situation of uncertainties in the ages of the tie points the proposed method employs MCMC simulations of age-depth profiles yielding empirical confidence intervals on the constructed piecewise linear best guess timescale. It is suggested that the approach can be further extended to a more general case of a time-varying expected accumulation between the tie points. The approach is illustrated by using two ice and two lake/marine sediment cores representing the typical examples of paleoproxy archives with age models based on tie points of mixed origin.

Detection and Characterization of Exoplanets using Projections on Karhunen-Loeve Eigenimages: Forward Modeling

NASA Astrophysics Data System (ADS)

Pueyo, Laurent

2016-01-01

A new class of high-contrast image analysis algorithms, that empirically fit and subtract systematic noise has lead to recent discoveries of faint exoplanet /substellar companions and scattered light images of circumstellar disks. The consensus emerging in the community is that these methods are extremely efficient at enhancing the detectability of faint astrophysical signal, but do generally create systematic biases in their observed properties. This poster provides a solution this outstanding problem. We present an analytical derivation of a linear expansion that captures the impact of astrophysical over/self-subtraction in current image analysis techniques. We examine the general case for which the reference images of the astrophysical scene moves azimuthally and/or radially across the field of view as a result of the observation strategy. Our new method method is based on perturbing the covariance matrix underlying any least-squares speckles problem and propagating this perturbation through the data analysis algorithm. This work is presented in the framework of Karhunen-Loeve Image Processing (KLIP) but it can be easily generalized to methods relying on linear combination of images (instead of eigen-modes). Based on this linear expansion, obtained in the most general case, we then demonstrate practical applications of this new algorithm. We first consider the case of the spectral extraction of faint point sources in IFS data and illustrate, using public Gemini Planet Imager commissioning data, that our novel perturbation based Forward Modeling (which we named KLIP-FM) can indeed alleviate algorithmic biases. We then apply KLIP-FM to the detection of point sources and show how it decreases the rate of false negatives while keeping the rate of false positives unchanged when compared to classical KLIP. This can potentially have important consequences on the design of follow-up strategies of ongoing direct imaging surveys.

Estimating a graphical intra-class correlation coefficient (GICC) using multivariate probit-linear mixed models.

PubMed

Yue, Chen; Chen, Shaojie; Sair, Haris I; Airan, Raag; Caffo, Brian S

2015-09-01

Data reproducibility is a critical issue in all scientific experiments. In this manuscript, the problem of quantifying the reproducibility of graphical measurements is considered. The image intra-class correlation coefficient (I2C2) is generalized and the graphical intra-class correlation coefficient (GICC) is proposed for such purpose. The concept for GICC is based on multivariate probit-linear mixed effect models. A Markov Chain Monte Carlo EM (mcm-cEM) algorithm is used for estimating the GICC. Simulation results with varied settings are demonstrated and our method is applied to the KIRBY21 test-retest dataset.

Use of generalized linear models and digital data in a forest inventory of Northern Utah

USGS Publications Warehouse

Moisen, Gretchen G.; Edwards, Thomas C.

1999-01-01

Forest inventories, like those conducted by the Forest Service's Forest Inventory and Analysis Program (FIA) in the Rocky Mountain Region, are under increased pressure to produce better information at reduced costs. Here we describe our efforts in Utah to merge satellite-based information with forest inventory data for the purposes of reducing the costs of estimates of forest population totals and providing spatial depiction of forest resources. We illustrate how generalized linear models can be used to construct approximately unbiased and efficient estimates of population totals while providing a mechanism for prediction in space for mapping of forest structure. We model forest type and timber volume of five tree species groups as functions of a variety of predictor variables in the northern Utah mountains. Predictor variables include elevation, aspect, slope, geographic coordinates, as well as vegetation cover types based on satellite data from both the Advanced Very High Resolution Radiometer (AVHRR) and Thematic Mapper (TM) platforms. We examine the relative precision of estimates of area by forest type and mean cubic-foot volumes under six different models, including the traditional double sampling for stratification strategy. Only very small gains in precision were realized through the use of expensive photointerpreted or TM-based data for stratification, while models based on topography and spatial coordinates alone were competitive. We also compare the predictive capability of the models through various map accuracy measures. The models including the TM-based vegetation performed best overall, while topography and spatial coordinates alone provided substantial information at very low cost.

From elementary flux modes to elementary flux vectors: Metabolic pathway analysis with arbitrary linear flux constraints.

PubMed

Klamt, Steffen; Regensburger, Georg; Gerstl, Matthias P; Jungreuthmayer, Christian; Schuster, Stefan; Mahadevan, Radhakrishnan; Zanghellini, Jürgen; Müller, Stefan

2017-04-01

Elementary flux modes (EFMs) emerged as a formal concept to describe metabolic pathways and have become an established tool for constraint-based modeling and metabolic network analysis. EFMs are characteristic (support-minimal) vectors of the flux cone that contains all feasible steady-state flux vectors of a given metabolic network. EFMs account for (homogeneous) linear constraints arising from reaction irreversibilities and the assumption of steady state; however, other (inhomogeneous) linear constraints, such as minimal and maximal reaction rates frequently used by other constraint-based techniques (such as flux balance analysis [FBA]), cannot be directly integrated. These additional constraints further restrict the space of feasible flux vectors and turn the flux cone into a general flux polyhedron in which the concept of EFMs is not directly applicable anymore. For this reason, there has been a conceptual gap between EFM-based (pathway) analysis methods and linear optimization (FBA) techniques, as they operate on different geometric objects. One approach to overcome these limitations was proposed ten years ago and is based on the concept of elementary flux vectors (EFVs). Only recently has the community started to recognize the potential of EFVs for metabolic network analysis. In fact, EFVs exactly represent the conceptual development required to generalize the idea of EFMs from flux cones to flux polyhedra. This work aims to present a concise theoretical and practical introduction to EFVs that is accessible to a broad audience. We highlight the close relationship between EFMs and EFVs and demonstrate that almost all applications of EFMs (in flux cones) are possible for EFVs (in flux polyhedra) as well. In fact, certain properties can only be studied with EFVs. Thus, we conclude that EFVs provide a powerful and unifying framework for constraint-based modeling of metabolic networks.

From elementary flux modes to elementary flux vectors: Metabolic pathway analysis with arbitrary linear flux constraints

PubMed Central

Klamt, Steffen; Gerstl, Matthias P.; Jungreuthmayer, Christian; Mahadevan, Radhakrishnan; Müller, Stefan

2017-01-01

Elementary flux modes (EFMs) emerged as a formal concept to describe metabolic pathways and have become an established tool for constraint-based modeling and metabolic network analysis. EFMs are characteristic (support-minimal) vectors of the flux cone that contains all feasible steady-state flux vectors of a given metabolic network. EFMs account for (homogeneous) linear constraints arising from reaction irreversibilities and the assumption of steady state; however, other (inhomogeneous) linear constraints, such as minimal and maximal reaction rates frequently used by other constraint-based techniques (such as flux balance analysis [FBA]), cannot be directly integrated. These additional constraints further restrict the space of feasible flux vectors and turn the flux cone into a general flux polyhedron in which the concept of EFMs is not directly applicable anymore. For this reason, there has been a conceptual gap between EFM-based (pathway) analysis methods and linear optimization (FBA) techniques, as they operate on different geometric objects. One approach to overcome these limitations was proposed ten years ago and is based on the concept of elementary flux vectors (EFVs). Only recently has the community started to recognize the potential of EFVs for metabolic network analysis. In fact, EFVs exactly represent the conceptual development required to generalize the idea of EFMs from flux cones to flux polyhedra. This work aims to present a concise theoretical and practical introduction to EFVs that is accessible to a broad audience. We highlight the close relationship between EFMs and EFVs and demonstrate that almost all applications of EFMs (in flux cones) are possible for EFVs (in flux polyhedra) as well. In fact, certain properties can only be studied with EFVs. Thus, we conclude that EFVs provide a powerful and unifying framework for constraint-based modeling of metabolic networks. PMID:28406903

Feature extraction with deep neural networks by a generalized discriminant analysis.

PubMed

Stuhlsatz, André; Lippel, Jens; Zielke, Thomas

2012-04-01

We present an approach to feature extraction that is a generalization of the classical linear discriminant analysis (LDA) on the basis of deep neural networks (DNNs). As for LDA, discriminative features generated from independent Gaussian class conditionals are assumed. This modeling has the advantages that the intrinsic dimensionality of the feature space is bounded by the number of classes and that the optimal discriminant function is linear. Unfortunately, linear transformations are insufficient to extract optimal discriminative features from arbitrarily distributed raw measurements. The generalized discriminant analysis (GerDA) proposed in this paper uses nonlinear transformations that are learnt by DNNs in a semisupervised fashion. We show that the feature extraction based on our approach displays excellent performance on real-world recognition and detection tasks, such as handwritten digit recognition and face detection. In a series of experiments, we evaluate GerDA features with respect to dimensionality reduction, visualization, classification, and detection. Moreover, we show that GerDA DNNs can preprocess truly high-dimensional input data to low-dimensional representations that facilitate accurate predictions even if simple linear predictors or measures of similarity are used.

A novel heuristic for optimization aggregate production problem: Evidence from flat panel display in Malaysia

NASA Astrophysics Data System (ADS)

Al-Kuhali, K.; Hussain M., I.; Zain Z., M.; Mullenix, P.

2015-05-01

Aim: This paper contribute to the flat panel display industry it terms of aggregate production planning. Methodology: For the minimization cost of total production of LCD manufacturing, a linear programming was applied. The decision variables are general production costs, additional cost incurred for overtime production, additional cost incurred for subcontracting, inventory carrying cost, backorder costs and adjustments for changes incurred within labour levels. Model has been developed considering a manufacturer having several product types, which the maximum types are N, along a total time period of T. Results: Industrial case study based on Malaysia is presented to test and to validate the developed linear programming model for aggregate production planning. Conclusion: The model development is fit under stable environment conditions. Overall it can be recommended to adapt the proven linear programming model to production planning of Malaysian flat panel display industry.

A Generalized Acoustic Analogy

NASA Technical Reports Server (NTRS)

Goldstein, M. E.

2003-01-01

The purpose of this article is to show that the Navier-Stokes equations can be rewritten as a set of linearized inhomogeneous Euler equations (in convective form) with source terms that are exactly the same as those that would result from externally imposed shear stress and energy flux perturbations. These results are used to develop a mathematical basis for some existing and potential new jet noise models by appropriately choosing the base flow about which the linearization is carried out.

Optimal Artificial Boundary Condition Configurations for Sensitivity-Based Model Updating and Damage Detection

DTIC Science & Technology

2010-09-01

matrix is used in many methods, like Jacobi or Gauss Seidel , for solving linear systems. Also, no partial pivoting is necessary for a strictly column...problems that arise during the procedure, which in general, converges to the solving of a linear system. The most common issue with the solution is the... iterative procedure to find an appropriate subset of parameters that produce an optimal solution commonly known as forward selection. Then, the

A vine copula mixed effect model for trivariate meta-analysis of diagnostic test accuracy studies accounting for disease prevalence.

PubMed

Nikoloulopoulos, Aristidis K

2017-10-01

A bivariate copula mixed model has been recently proposed to synthesize diagnostic test accuracy studies and it has been shown that it is superior to the standard generalized linear mixed model in this context. Here, we call trivariate vine copulas to extend the bivariate meta-analysis of diagnostic test accuracy studies by accounting for disease prevalence. Our vine copula mixed model includes the trivariate generalized linear mixed model as a special case and can also operate on the original scale of sensitivity, specificity, and disease prevalence. Our general methodology is illustrated by re-analyzing the data of two published meta-analyses. Our study suggests that there can be an improvement on trivariate generalized linear mixed model in fit to data and makes the argument for moving to vine copula random effects models especially because of their richness, including reflection asymmetric tail dependence, and computational feasibility despite their three dimensionality.

Prediction of dynamical systems by symbolic regression

NASA Astrophysics Data System (ADS)

Quade, Markus; Abel, Markus; Shafi, Kamran; Niven, Robert K.; Noack, Bernd R.

2016-07-01

We study the modeling and prediction of dynamical systems based on conventional models derived from measurements. Such algorithms are highly desirable in situations where the underlying dynamics are hard to model from physical principles or simplified models need to be found. We focus on symbolic regression methods as a part of machine learning. These algorithms are capable of learning an analytically tractable model from data, a highly valuable property. Symbolic regression methods can be considered as generalized regression methods. We investigate two particular algorithms, the so-called fast function extraction which is a generalized linear regression algorithm, and genetic programming which is a very general method. Both are able to combine functions in a certain way such that a good model for the prediction of the temporal evolution of a dynamical system can be identified. We illustrate the algorithms by finding a prediction for the evolution of a harmonic oscillator based on measurements, by detecting an arriving front in an excitable system, and as a real-world application, the prediction of solar power production based on energy production observations at a given site together with the weather forecast.

Stochastic search, optimization and regression with energy applications

NASA Astrophysics Data System (ADS)

Hannah, Lauren A.

Designing clean energy systems will be an important task over the next few decades. One of the major roadblocks is a lack of mathematical tools to economically evaluate those energy systems. However, solutions to these mathematical problems are also of interest to the operations research and statistical communities in general. This thesis studies three problems that are of interest to the energy community itself or provide support for solution methods: R&D portfolio optimization, nonparametric regression and stochastic search with an observable state variable. First, we consider the one stage R&D portfolio optimization problem to avoid the sequential decision process associated with the multi-stage. The one stage problem is still difficult because of a non-convex, combinatorial decision space and a non-convex objective function. We propose a heuristic solution method that uses marginal project values---which depend on the selected portfolio---to create a linear objective function. In conjunction with the 0-1 decision space, this new problem can be solved as a knapsack linear program. This method scales well to large decision spaces. We also propose an alternate, provably convergent algorithm that does not exploit problem structure. These methods are compared on a solid oxide fuel cell R&D portfolio problem. Next, we propose Dirichlet Process mixtures of Generalized Linear Models (DPGLM), a new method of nonparametric regression that accommodates continuous and categorical inputs, and responses that can be modeled by a generalized linear model. We prove conditions for the asymptotic unbiasedness of the DP-GLM regression mean function estimate. We also give examples for when those conditions hold, including models for compactly supported continuous distributions and a model with continuous covariates and categorical response. We empirically analyze the properties of the DP-GLM and why it provides better results than existing Dirichlet process mixture regression models. We evaluate DP-GLM on several data sets, comparing it to modern methods of nonparametric regression like CART, Bayesian trees and Gaussian processes. Compared to existing techniques, the DP-GLM provides a single model (and corresponding inference algorithms) that performs well in many regression settings. Finally, we study convex stochastic search problems where a noisy objective function value is observed after a decision is made. There are many stochastic search problems whose behavior depends on an exogenous state variable which affects the shape of the objective function. Currently, there is no general purpose algorithm to solve this class of problems. We use nonparametric density estimation to take observations from the joint state-outcome distribution and use them to infer the optimal decision for a given query state. We propose two solution methods that depend on the problem characteristics: function-based and gradient-based optimization. We examine two weighting schemes, kernel-based weights and Dirichlet process-based weights, for use with the solution methods. The weights and solution methods are tested on a synthetic multi-product newsvendor problem and the hour-ahead wind commitment problem. Our results show that in some cases Dirichlet process weights offer substantial benefits over kernel based weights and more generally that nonparametric estimation methods provide good solutions to otherwise intractable problems.

SOCR Analyses – an Instructional Java Web-based Statistical Analysis Toolkit

PubMed Central

Chu, Annie; Cui, Jenny; Dinov, Ivo D.

2011-01-01

The Statistical Online Computational Resource (SOCR) designs web-based tools for educational use in a variety of undergraduate courses (Dinov 2006). Several studies have demonstrated that these resources significantly improve students' motivation and learning experiences (Dinov et al. 2008). SOCR Analyses is a new component that concentrates on data modeling and analysis using parametric and non-parametric techniques supported with graphical model diagnostics. Currently implemented analyses include commonly used models in undergraduate statistics courses like linear models (Simple Linear Regression, Multiple Linear Regression, One-Way and Two-Way ANOVA). In addition, we implemented tests for sample comparisons, such as t-test in the parametric category; and Wilcoxon rank sum test, Kruskal-Wallis test, Friedman's test, in the non-parametric category. SOCR Analyses also include several hypothesis test models, such as Contingency tables, Friedman's test and Fisher's exact test. The code itself is open source (http://socr.googlecode.com/), hoping to contribute to the efforts of the statistical computing community. The code includes functionality for each specific analysis model and it has general utilities that can be applied in various statistical computing tasks. For example, concrete methods with API (Application Programming Interface) have been implemented in statistical summary, least square solutions of general linear models, rank calculations, etc. HTML interfaces, tutorials, source code, activities, and data are freely available via the web (www.SOCR.ucla.edu). Code examples for developers and demos for educators are provided on the SOCR Wiki website. In this article, the pedagogical utilization of the SOCR Analyses is discussed, as well as the underlying design framework. As the SOCR project is on-going and more functions and tools are being added to it, these resources are constantly improved. The reader is strongly encouraged to check the SOCR site for most updated information and newly added models. PMID:21546994

Modelling female fertility traits in beef cattle using linear and non-linear models.

PubMed

Naya, H; Peñagaricano, F; Urioste, J I

2017-06-01

Female fertility traits are key components of the profitability of beef cattle production. However, these traits are difficult and expensive to measure, particularly under extensive pastoral conditions, and consequently, fertility records are in general scarce and somehow incomplete. Moreover, fertility traits are usually dominated by the effects of herd-year environment, and it is generally assumed that relatively small margins are kept for genetic improvement. New ways of modelling genetic variation in these traits are needed. Inspired in the methodological developments made by Prof. Daniel Gianola and co-workers, we assayed linear (Gaussian), Poisson, probit (threshold), censored Poisson and censored Gaussian models to three different kinds of endpoints, namely calving success (CS), number of days from first calving (CD) and number of failed oestrus (FE). For models involving FE and CS, non-linear models overperformed their linear counterparts. For models derived from CD, linear versions displayed better adjustment than the non-linear counterparts. Non-linear models showed consistently higher estimates of heritability and repeatability in all cases (h 2  < 0.08 and r < 0.13, for linear models; h 2  > 0.23 and r > 0.24, for non-linear models). While additive and permanent environment effects showed highly favourable correlations between all models (>0.789), consistency in selecting the 10% best sires showed important differences, mainly amongst the considered endpoints (FE, CS and CD). In consequence, endpoints should be considered as modelling different underlying genetic effects, with linear models more appropriate to describe CD and non-linear models better for FE and CS. © 2017 Blackwell Verlag GmbH.

Regression Is a Univariate General Linear Model Subsuming Other Parametric Methods as Special Cases.

ERIC Educational Resources Information Center

Vidal, Sherry

Although the concept of the general linear model (GLM) has existed since the 1960s, other univariate analyses such as the t-test and the analysis of variance models have remained popular. The GLM produces an equation that minimizes the mean differences of independent variables as they are related to a dependent variable. From a computer printout…

Diagnostics for generalized linear hierarchical models in network meta-analysis.

PubMed

Zhao, Hong; Hodges, James S; Carlin, Bradley P

2017-09-01

Network meta-analysis (NMA) combines direct and indirect evidence comparing more than 2 treatments. Inconsistency arises when these 2 information sources differ. Previous work focuses on inconsistency detection, but little has been done on how to proceed after identifying inconsistency. The key issue is whether inconsistency changes an NMA's substantive conclusions. In this paper, we examine such discrepancies from a diagnostic point of view. Our methods seek to detect influential and outlying observations in NMA at a trial-by-arm level. These observations may have a large effect on the parameter estimates in NMA, or they may deviate markedly from other observations. We develop formal diagnostics for a Bayesian hierarchical model to check the effect of deleting any observation. Diagnostics are specified for generalized linear hierarchical NMA models and investigated for both published and simulated datasets. Results from our example dataset using either contrast- or arm-based models and from the simulated datasets indicate that the sources of inconsistency in NMA tend not to be influential, though results from the example dataset suggest that they are likely to be outliers. This mimics a familiar result from linear model theory, in which outliers with low leverage are not influential. Future extensions include incorporating baseline covariates and individual-level patient data. Copyright © 2017 John Wiley & Sons, Ltd.

Non-Linear Approach in Kinesiology Should Be Preferred to the Linear--A Case of Basketball.

PubMed

Trninić, Marko; Jeličić, Mario; Papić, Vladan

2015-07-01

In kinesiology, medicine, biology and psychology, in which research focus is on dynamical self-organized systems, complex connections exist between variables. Non-linear nature of complex systems has been discussed and explained by the example of non-linear anthropometric predictors of performance in basketball. Previous studies interpreted relations between anthropometric features and measures of effectiveness in basketball by (a) using linear correlation models, and by (b) including all basketball athletes in the same sample of participants regardless of their playing position. In this paper the significance and character of linear and non-linear relations between simple anthropometric predictors (AP) and performance criteria consisting of situation-related measures of effectiveness (SE) in basketball were determined and evaluated. The sample of participants consisted of top-level junior basketball players divided in three groups according to their playing time (8 minutes and more per game) and playing position: guards (N = 42), forwards (N = 26) and centers (N = 40). Linear (general model) and non-linear (general model) regression models were calculated simultaneously and separately for each group. The conclusion is viable: non-linear regressions are frequently superior to linear correlations when interpreting actual association logic among research variables.

Inverse solutions for electrical impedance tomography based on conjugate gradients methods

NASA Astrophysics Data System (ADS)

Wang, M.

2002-01-01

A multistep inverse solution for two-dimensional electric field distribution is developed to deal with the nonlinear inverse problem of electric field distribution in relation to its boundary condition and the problem of divergence due to errors introduced by the ill-conditioned sensitivity matrix and the noise produced by electrode modelling and instruments. This solution is based on a normalized linear approximation method where the change in mutual impedance is derived from the sensitivity theorem and a method of error vector decomposition. This paper presents an algebraic solution of the linear equations at each inverse step, using a generalized conjugate gradients method. Limiting the number of iterations in the generalized conjugate gradients method controls the artificial errors introduced by the assumption of linearity and the ill-conditioned sensitivity matrix. The solution of the nonlinear problem is approached using a multistep inversion. This paper also reviews the mathematical and physical definitions of the sensitivity back-projection algorithm based on the sensitivity theorem. Simulations and discussion based on the multistep algorithm, the sensitivity coefficient back-projection method and the Newton-Raphson method are given. Examples of imaging gas-liquid mixing and a human hand in brine are presented.

Simplified large African carnivore density estimators from track indices.

PubMed

Winterbach, Christiaan W; Ferreira, Sam M; Funston, Paul J; Somers, Michael J

2016-01-01

The range, population size and trend of large carnivores are important parameters to assess their status globally and to plan conservation strategies. One can use linear models to assess population size and trends of large carnivores from track-based surveys on suitable substrates. The conventional approach of a linear model with intercept may not intercept at zero, but may fit the data better than linear model through the origin. We assess whether a linear regression through the origin is more appropriate than a linear regression with intercept to model large African carnivore densities and track indices. We did simple linear regression with intercept analysis and simple linear regression through the origin and used the confidence interval for ß in the linear model y  =  αx  + ß, Standard Error of Estimate, Mean Squares Residual and Akaike Information Criteria to evaluate the models. The Lion on Clay and Low Density on Sand models with intercept were not significant ( P  > 0.05). The other four models with intercept and the six models thorough origin were all significant ( P  < 0.05). The models using linear regression with intercept all included zero in the confidence interval for ß and the null hypothesis that ß = 0 could not be rejected. All models showed that the linear model through the origin provided a better fit than the linear model with intercept, as indicated by the Standard Error of Estimate and Mean Square Residuals. Akaike Information Criteria showed that linear models through the origin were better and that none of the linear models with intercept had substantial support. Our results showed that linear regression through the origin is justified over the more typical linear regression with intercept for all models we tested. A general model can be used to estimate large carnivore densities from track densities across species and study areas. The formula observed track density = 3.26 × carnivore density can be used to estimate densities of large African carnivores using track counts on sandy substrates in areas where carnivore densities are 0.27 carnivores/100 km 2 or higher. To improve the current models, we need independent data to validate the models and data to test for non-linear relationship between track indices and true density at low densities.

Exploring Duopoly Markets with Conjectural Variations

ERIC Educational Resources Information Center

Julien, Ludovic A.; Musy, Olivier; Saïdi, Aurélien W.

2014-01-01

In this article, the authors investigate competitive firm behaviors in a two-firm environment assuming linear cost and demand functions. By introducing conjectural variations, they capture the different market structures as specific configurations of a more general model. Conjectural variations are based on the assumption that each firm believes…

Functional aging in pilots : an examination of a mathematical model based on medical data on general aviation pilots.

DOT National Transportation Integrated Search

1982-06-01

The purpose of this study was to apply mathematical procedures to the Federal Aviation Administration (FAA) pilot medical data to examine the feasibility of devising a linear numbering system such that (1) the cumulative probability distribution func...

Generalized regression neural network (GRNN)-based approach for colored dissolved organic matter (CDOM) retrieval: case study of Connecticut River at Middle Haddam Station, USA.

PubMed

Heddam, Salim

2014-11-01

The prediction of colored dissolved organic matter (CDOM) using artificial neural network approaches has received little attention in the past few decades. In this study, colored dissolved organic matter (CDOM) was modeled using generalized regression neural network (GRNN) and multiple linear regression (MLR) models as a function of Water temperature (TE), pH, specific conductance (SC), and turbidity (TU). Evaluation of the prediction accuracy of the models is based on the root mean square error (RMSE), mean absolute error (MAE), coefficient of correlation (CC), and Willmott's index of agreement (d). The results indicated that GRNN can be applied successfully for prediction of colored dissolved organic matter (CDOM).

Identification of Linear and Nonlinear Sensory Processing Circuits from Spiking Neuron Data.

PubMed

Florescu, Dorian; Coca, Daniel

2018-03-01

Inferring mathematical models of sensory processing systems directly from input-output observations, while making the fewest assumptions about the model equations and the types of measurements available, is still a major issue in computational neuroscience. This letter introduces two new approaches for identifying sensory circuit models consisting of linear and nonlinear filters in series with spiking neuron models, based only on the sampled analog input to the filter and the recorded spike train output of the spiking neuron. For an ideal integrate-and-fire neuron model, the first algorithm can identify the spiking neuron parameters as well as the structure and parameters of an arbitrary nonlinear filter connected to it. The second algorithm can identify the parameters of the more general leaky integrate-and-fire spiking neuron model, as well as the parameters of an arbitrary linear filter connected to it. Numerical studies involving simulated and real experimental recordings are used to demonstrate the applicability and evaluate the performance of the proposed algorithms.

The Linear Bias in the Zeldovich Approximation and a Relation between the Number Density and the Linear Bias of Dark Halos

NASA Astrophysics Data System (ADS)

Fan, Zuhui

2000-01-01

The linear bias of the dark halos from a model under the Zeldovich approximation is derived and compared with the fitting formula of simulation results. While qualitatively similar to the Press-Schechter formula, this model gives a better description for the linear bias around the turnaround point. This advantage, however, may be compromised by the large uncertainty of the actual behavior of the linear bias near the turnaround point. For a broad class of structure formation models in the cold dark matter framework, a general relation exists between the number density and the linear bias of dark halos. This relation can be readily tested by numerical simulations. Thus, instead of laboriously checking these models one by one, numerical simulation studies can falsify a whole category of models. The general validity of this relation is important in identifying key physical processes responsible for the large-scale structure formation in the universe.

Development and validation of a general purpose linearization program for rigid aircraft models

NASA Technical Reports Server (NTRS)

Duke, E. L.; Antoniewicz, R. F.

1985-01-01

A FORTRAN program that provides the user with a powerful and flexible tool for the linearization of aircraft models is discussed. The program LINEAR numerically determines a linear systems model using nonlinear equations of motion and a user-supplied, nonlinear aerodynamic model. The system model determined by LINEAR consists of matrices for both the state and observation equations. The program has been designed to allow easy selection and definition of the state, control, and observation variables to be used in a particular model. Also, included in the report is a comparison of linear and nonlinear models for a high performance aircraft.

Stability and Control of Human Trunk Movement During Walking.

PubMed

Wu, Q.; Sepehri, N.; Thornton-Trump, A. B.; Alexander, M.

1998-01-01

A mathematical model has been developed to study the control mechanisms of human trunk movement during walking. The trunk is modeled as a base-excited inverted pendulum with two-degrees of rotational freedom. The base point, corresponding to the bony landmark of the sacrum, can move in three-dimensional space in a general way. Since the stability of upright posture is essential for human walking, a controller has been designed such that the stability of the pendulum about the upright position is guaranteed. The control laws are developed based on Lyapunov's stability theory and include feedforward and linear feedback components. It is found that the feedforward component plays a critical role in keeping postural stability, and the linear feedback component, (resulting from viscoelastic function of the musculoskeletal system) can effectively duplicate the pattern of trunk movement. The mathematical model is validated by comparing the simulation results with those based on gait measurements performed in the Biomechanics Laboratory at the University of Manitoba.

Do bioclimate variables improve performance of climate envelope models?

USGS Publications Warehouse

Watling, James I.; Romañach, Stephanie S.; Bucklin, David N.; Speroterra, Carolina; Brandt, Laura A.; Pearlstine, Leonard G.; Mazzotti, Frank J.

2012-01-01

Climate envelope models are widely used to forecast potential effects of climate change on species distributions. A key issue in climate envelope modeling is the selection of predictor variables that most directly influence species. To determine whether model performance and spatial predictions were related to the selection of predictor variables, we compared models using bioclimate variables with models constructed from monthly climate data for twelve terrestrial vertebrate species in the southeastern USA using two different algorithms (random forests or generalized linear models), and two model selection techniques (using uncorrelated predictors or a subset of user-defined biologically relevant predictor variables). There were no differences in performance between models created with bioclimate or monthly variables, but one metric of model performance was significantly greater using the random forest algorithm compared with generalized linear models. Spatial predictions between maps using bioclimate and monthly variables were very consistent using the random forest algorithm with uncorrelated predictors, whereas we observed greater variability in predictions using generalized linear models.

Developing a methodology to predict PM10 concentrations in urban areas using generalized linear models.

PubMed

Garcia, J M; Teodoro, F; Cerdeira, R; Coelho, L M R; Kumar, Prashant; Carvalho, M G

2016-09-01

A methodology to predict PM10 concentrations in urban outdoor environments is developed based on the generalized linear models (GLMs). The methodology is based on the relationship developed between atmospheric concentrations of air pollutants (i.e. CO, NO2, NOx, VOCs, SO2) and meteorological variables (i.e. ambient temperature, relative humidity (RH) and wind speed) for a city (Barreiro) of Portugal. The model uses air pollution and meteorological data from the Portuguese monitoring air quality station networks. The developed GLM considers PM10 concentrations as a dependent variable, and both the gaseous pollutants and meteorological variables as explanatory independent variables. A logarithmic link function was considered with a Poisson probability distribution. Particular attention was given to cases with air temperatures both below and above 25°C. The best performance for modelled results against the measured data was achieved for the model with values of air temperature above 25°C compared with the model considering all ranges of air temperatures and with the model considering only temperature below 25°C. The model was also tested with similar data from another Portuguese city, Oporto, and results found to behave similarly. It is concluded that this model and the methodology could be adopted for other cities to predict PM10 concentrations when these data are not available by measurements from air quality monitoring stations or other acquisition means.

A quasi-likelihood approach to non-negative matrix factorization

PubMed Central

Devarajan, Karthik; Cheung, Vincent C.K.

2017-01-01

A unified approach to non-negative matrix factorization based on the theory of generalized linear models is proposed. This approach embeds a variety of statistical models, including the exponential family, within a single theoretical framework and provides a unified view of such factorizations from the perspective of quasi-likelihood. Using this framework, a family of algorithms for handling signal-dependent noise is developed and its convergence proven using the Expectation-Maximization algorithm. In addition, a measure to evaluate the goodness-of-fit of the resulting factorization is described. The proposed methods allow modeling of non-linear effects via appropriate link functions and are illustrated using an application in biomedical signal processing. PMID:27348511

Financial Distress Prediction using Linear Discriminant Analysis and Support Vector Machine

NASA Astrophysics Data System (ADS)

Santoso, Noviyanti; Wibowo, Wahyu

2018-03-01

A financial difficulty is the early stages before the bankruptcy. Bankruptcies caused by the financial distress can be seen from the financial statements of the company. The ability to predict financial distress became an important research topic because it can provide early warning for the company. In addition, predicting financial distress is also beneficial for investors and creditors. This research will be made the prediction model of financial distress at industrial companies in Indonesia by comparing the performance of Linear Discriminant Analysis (LDA) and Support Vector Machine (SVM) combined with variable selection technique. The result of this research is prediction model based on hybrid Stepwise-SVM obtains better balance among fitting ability, generalization ability and model stability than the other models.

Confidence Intervals for Assessing Heterogeneity in Generalized Linear Mixed Models

ERIC Educational Resources Information Center

Wagler, Amy E.

2014-01-01

Generalized linear mixed models are frequently applied to data with clustered categorical outcomes. The effect of clustering on the response is often difficult to practically assess partly because it is reported on a scale on which comparisons with regression parameters are difficult to make. This article proposes confidence intervals for…

Estimation of Complex Generalized Linear Mixed Models for Measurement and Growth

ERIC Educational Resources Information Center

Jeon, Minjeong

2012-01-01

Maximum likelihood (ML) estimation of generalized linear mixed models (GLMMs) is technically challenging because of the intractable likelihoods that involve high dimensional integrations over random effects. The problem is magnified when the random effects have a crossed design and thus the data cannot be reduced to small independent clusters. A…

Large-Scale functional network overlap is a general property of brain functional organization: Reconciling inconsistent fMRI findings from general-linear-model-based analyses

PubMed Central

Xu, Jiansong; Potenza, Marc N.; Calhoun, Vince D.; Zhang, Rubin; Yip, Sarah W.; Wall, John T.; Pearlson, Godfrey D.; Worhunsky, Patrick D.; Garrison, Kathleen A.; Moran, Joseph M.

2016-01-01

Functional magnetic resonance imaging (fMRI) studies regularly use univariate general-linear-model-based analyses (GLM). Their findings are often inconsistent across different studies, perhaps because of several fundamental brain properties including functional heterogeneity, balanced excitation and inhibition (E/I), and sparseness of neuronal activities. These properties stipulate heterogeneous neuronal activities in the same voxels and likely limit the sensitivity and specificity of GLM. This paper selectively reviews findings of histological and electrophysiological studies and fMRI spatial independent component analysis (sICA) and reports new findings by applying sICA to two existing datasets. The extant and new findings consistently demonstrate several novel features of brain functional organization not revealed by GLM. They include overlap of large-scale functional networks (FNs) and their concurrent opposite modulations, and no significant modulations in activity of most FNs across the whole brain during any task conditions. These novel features of brain functional organization are highly consistent with the brain’s properties of functional heterogeneity, balanced E/I, and sparseness of neuronal activity, and may help reconcile inconsistent GLM findings. PMID:27592153

"Shape function + memory mechanism"-based hysteresis modeling of magnetorheological fluid actuators

NASA Astrophysics Data System (ADS)

Qian, Li-Jun; Chen, Peng; Cai, Fei-Long; Bai, Xian-Xu

2018-03-01

A hysteresis model based on "shape function + memory mechanism" is presented and its feasibility is verified through modeling the hysteresis behavior of a magnetorheological (MR) damper. A hysteresis phenomenon in resistor-capacitor (RC) circuit is first presented and analyzed. In the hysteresis model, the "memory mechanism" originating from the charging and discharging processes of the RC circuit is constructed by adopting a virtual displacement variable and updating laws for the reference points. The "shape function" is achieved and generalized from analytical solutions of the simple semi-linear Duhem model. Using the approach, the memory mechanism reveals the essence of specific Duhem model and the general shape function provides a direct and clear means to fit the hysteresis loop. In the frame of the structure of a "Restructured phenomenological model", the original hysteresis operator, i.e., the Bouc-Wen operator, is replaced with the new hysteresis operator. The comparative work with the Bouc-Wen operator based model demonstrates superior performances of high computational efficiency and comparable accuracy of the new hysteresis operator-based model.

Application of the Hyper-Poisson Generalized Linear Model for Analyzing Motor Vehicle Crashes.

PubMed

Khazraee, S Hadi; Sáez-Castillo, Antonio Jose; Geedipally, Srinivas Reddy; Lord, Dominique

2015-05-01

The hyper-Poisson distribution can handle both over- and underdispersion, and its generalized linear model formulation allows the dispersion of the distribution to be observation-specific and dependent on model covariates. This study's objective is to examine the potential applicability of a newly proposed generalized linear model framework for the hyper-Poisson distribution in analyzing motor vehicle crash count data. The hyper-Poisson generalized linear model was first fitted to intersection crash data from Toronto, characterized by overdispersion, and then to crash data from railway-highway crossings in Korea, characterized by underdispersion. The results of this study are promising. When fitted to the Toronto data set, the goodness-of-fit measures indicated that the hyper-Poisson model with a variable dispersion parameter provided a statistical fit as good as the traditional negative binomial model. The hyper-Poisson model was also successful in handling the underdispersed data from Korea; the model performed as well as the gamma probability model and the Conway-Maxwell-Poisson model previously developed for the same data set. The advantages of the hyper-Poisson model studied in this article are noteworthy. Unlike the negative binomial model, which has difficulties in handling underdispersed data, the hyper-Poisson model can handle both over- and underdispersed crash data. Although not a major issue for the Conway-Maxwell-Poisson model, the effect of each variable on the expected mean of crashes is easily interpretable in the case of this new model. © 2014 Society for Risk Analysis.

A methodology for evaluation of parent-mutant competition using a generalized non-linear ecosystem model

Treesearch

Raymond L. Czaplewski

1973-01-01

A generalized, non-linear population dynamics model of an ecosystem is used to investigate the direction of selective pressures upon a mutant by studying the competition between parent and mutant populations. The model has the advantages of considering selection as operating on the phenotype, of retaining the interaction of the mutant population with the ecosystem as a...

Quasi-linear versus potential-based formulations of force-flux relations and the GENERIC for irreversible processes: comparisons and examples

NASA Astrophysics Data System (ADS)

Hütter, Markus; Svendsen, Bob

2013-11-01

An essential part in modeling out-of-equilibrium dynamics is the formulation of irreversible dynamics. In the latter, the major task consists in specifying the relations between thermodynamic forces and fluxes. In the literature, mainly two distinct approaches are used for the specification of force-flux relations. On the one hand, quasi-linear relations are employed, which are based on the physics of transport processes and fluctuation-dissipation theorems (de Groot and Mazur in Non-equilibrium thermodynamics, North Holland, Amsterdam, 1962, Lifshitz and Pitaevskii in Physical kinetics. Volume 10, Landau and Lifshitz series on theoretical physics, Pergamon Press, Oxford, 1981). On the other hand, force-flux relations are also often represented in potential form with the help of a dissipation potential (Šilhavý in The mechanics and thermodynamics of continuous media, Springer, Berlin, 1997). We address the question of how these two approaches are related. The main result of this presentation states that the class of models formulated by quasi-linear relations is larger than what can be described in a potential-based formulation. While the relation between the two methods is shown in general terms, it is demonstrated also with the help of three examples. The finding that quasi-linear force-flux relations are more general than dissipation-based ones also has ramifications for the general equation for non-equilibrium reversible-irreversible coupling (GENERIC: e.g., Grmela and Öttinger in Phys Rev E 56:6620-6632, 6633-6655, 1997, Öttinger in Beyond equilibrium thermodynamics, Wiley Interscience Publishers, Hoboken, 2005). This framework has been formulated and used in two different forms, namely a quasi-linear (Öttinger and Grmela in Phys Rev E 56:6633-6655, 1997, Öttinger in Beyond equilibrium thermodynamics, Wiley Interscience Publishers, Hoboken, 2005) and a dissipation potential-based (Grmela in Adv Chem Eng 39:75-129, 2010, Grmela in J Non-Newton Fluid Mech 165:980-986, 2010, Mielke in Continuum Mech Therm 23:233-256, 2011) form, respectively, relating the irreversible evolution to the entropy gradient. It is found that also in the case of GENERIC, the quasi-linear representation encompasses a wider class of phenomena as compared to the dissipation-based formulation. Furthermore, it is found that a potential exists for the irreversible part of the GENERIC if and only if one does for the underlying force-flux relations.

Low-complexity stochastic modeling of wall-bounded shear flows

NASA Astrophysics Data System (ADS)

Zare, Armin

Turbulent flows are ubiquitous in nature and they appear in many engineering applications. Transition to turbulence, in general, increases skin-friction drag in air/water vehicles compromising their fuel-efficiency and reduces the efficiency and longevity of wind turbines. While traditional flow control techniques combine physical intuition with costly experiments, their effectiveness can be significantly enhanced by control design based on low-complexity models and optimization. In this dissertation, we develop a theoretical and computational framework for the low-complexity stochastic modeling of wall-bounded shear flows. Part I of the dissertation is devoted to the development of a modeling framework which incorporates data-driven techniques to refine physics-based models. We consider the problem of completing partially known sample statistics in a way that is consistent with underlying stochastically driven linear dynamics. Neither the statistics nor the dynamics are precisely known. Thus, our objective is to reconcile the two in a parsimonious manner. To this end, we formulate optimization problems to identify the dynamics and directionality of input excitation in order to explain and complete available covariance data. For problem sizes that general-purpose solvers cannot handle, we develop customized optimization algorithms based on alternating direction methods. The solution to the optimization problem provides information about critical directions that have maximal effect in bringing model and statistics in agreement. In Part II, we employ our modeling framework to account for statistical signatures of turbulent channel flow using low-complexity stochastic dynamical models. We demonstrate that white-in-time stochastic forcing is not sufficient to explain turbulent flow statistics and develop models for colored-in-time forcing of the linearized Navier-Stokes equations. We also examine the efficacy of stochastically forced linearized NS equations and their parabolized equivalents in the receptivity analysis of velocity fluctuations to external sources of excitation as well as capturing the effect of the slowly-varying base flow on streamwise streaks and Tollmien-Schlichting waves. In Part III, we develop a model-based approach to design surface actuation of turbulent channel flow in the form of streamwise traveling waves. This approach is capable of identifying the drag reducing trends of traveling waves in a simulation-free manner. We also use the stochastically forced linearized NS equations to examine the Reynolds number independent effects of spanwise wall oscillations on drag reduction in turbulent channel flows. This allows us to extend the predictive capability of our simulation-free approach to high Reynolds numbers.

ADME evaluation in drug discovery. 1. Applications of genetic algorithms to the prediction of blood-brain partitioning of a large set of drugs.

PubMed

Hou, Tingjun; Xu, Xiaojie

2002-12-01

In this study, the relationships between the brain-blood concentration ratio of 96 structurally diverse compounds with a large number of structurally derived descriptors were investigated. The linear models were based on molecular descriptors that can be calculated for any compound simply from a knowledge of its molecular structure. The linear correlation coefficients of the models were optimized by genetic algorithms (GAs), and the descriptors used in the linear models were automatically selected from 27 structurally derived descriptors. The GA optimizations resulted in a group of linear models with three or four molecular descriptors with good statistical significance. The change of descriptor use as the evolution proceeds demonstrates that the octane/water partition coefficient and the partial negative solvent-accessible surface area multiplied by the negative charge are crucial to brain-blood barrier permeability. Moreover, we found that the predictions using multiple QSPR models from GA optimization gave quite good results in spite of the diversity of structures, which was better than the predictions using the best single model. The predictions for the two external sets with 37 diverse compounds using multiple QSPR models indicate that the best linear models with four descriptors are sufficiently effective for predictive use. Considering the ease of computation of the descriptors, the linear models may be used as general utilities to screen the blood-brain barrier partitioning of drugs in a high-throughput fashion.

Point- and line-based transformation models for high resolution satellite image rectification

NASA Astrophysics Data System (ADS)

Abd Elrahman, Ahmed Mohamed Shaker

Rigorous mathematical models with the aid of satellite ephemeris data can present the relationship between the satellite image space and the object space. With government funded satellites, access to calibration and ephemeris data has allowed the development and use of these models. However, for commercial high-resolution satellites, which have been recently launched, these data are withheld from users, and therefore alternative empirical models should be used. In general, the existing empirical models are based on the use of control points and involve linking points in the image space and the corresponding points in the object space. But the lack of control points in some remote areas and the questionable accuracy of the identified discrete conjugate points provide a catalyst for the development of algorithms based on features other than control points. This research, concerned with image rectification and 3D geo-positioning determination using High-Resolution Satellite Imagery (HRSI), has two major objectives. First, the effects of satellite sensor characteristics, number of ground control points (GCPs), and terrain elevation variations on the performance of several point based empirical models are studied. Second, a new mathematical model, using only linear features as control features, or linear features with a minimum number of GCPs, is developed. To meet the first objective, several experiments for different satellites such as Ikonos, QuickBird, and IRS-1D have been conducted using different point based empirical models. Various data sets covering different terrain types are presented and results from representative sets of the experiments are shown and analyzed. The results demonstrate the effectiveness and the superiority of these models under certain conditions. From the results obtained, several alternatives to circumvent the effects of the satellite sensor characteristics, the number of GCPs, and the terrain elevation variations are introduced. To meet the second objective, a new model named the Line Based Transformation Model (LBTM) is developed for HRSI rectification. The model has the flexibility to either solely use linear features or use linear features and a number of control points to define the image transformation parameters. Unlike point features, which must be explicitly defined, linear features have the advantage that they can be implicitly defined by any segment along the line. (Abstract shortened by UMI.)

A hierarchical model for estimating change in American Woodcock populations

USGS Publications Warehouse

Sauer, J.R.; Link, W.A.; Kendall, W.L.; Kelley, J.R.; Niven, D.K.

2008-01-01

The Singing-Ground Survey (SGS) is a primary source of information on population change for American woodcock (Scolopax minor). We analyzed the SGS using a hierarchical log-linear model and compared the estimates of change and annual indices of abundance to a route regression analysis of SGS data. We also grouped SGS routes into Bird Conservation Regions (BCRs) and estimated population change and annual indices using BCRs within states and provinces as strata. Based on the hierarchical model?based estimates, we concluded that woodcock populations were declining in North America between 1968 and 2006 (trend = -0.9%/yr, 95% credible interval: -1.2, -0.5). Singing-Ground Survey results are generally similar between analytical approaches, but the hierarchical model has several important advantages over the route regression. Hierarchical models better accommodate changes in survey efficiency over time and space by treating strata, years, and observers as random effects in the context of a log-linear model, providing trend estimates that are derived directly from the annual indices. We also conducted a hierarchical model analysis of woodcock data from the Christmas Bird Count and the North American Breeding Bird Survey. All surveys showed general consistency in patterns of population change, but the SGS had the shortest credible intervals. We suggest that population management and conservation planning for woodcock involving interpretation of the SGS use estimates provided by the hierarchical model.

A new formalism for modelling parameters α and β of the linear-quadratic model of cell survival for hadron therapy

NASA Astrophysics Data System (ADS)

Vassiliev, Oleg N.; Grosshans, David R.; Mohan, Radhe

2017-10-01

We propose a new formalism for calculating parameters α and β of the linear-quadratic model of cell survival. This formalism, primarily intended for calculating relative biological effectiveness (RBE) for treatment planning in hadron therapy, is based on a recently proposed microdosimetric revision of the single-target multi-hit model. The main advantage of our formalism is that it reliably produces α and β that have correct general properties with respect to their dependence on physical properties of the beam, including the asymptotic behavior for very low and high linear energy transfer (LET) beams. For example, in the case of monoenergetic beams, our formalism predicts that, as a function of LET, (a) α has a maximum and (b) the α/β ratio increases monotonically with increasing LET. No prior models reviewed in this study predict both properties (a) and (b) correctly, and therefore, these prior models are valid only within a limited LET range. We first present our formalism in a general form, for polyenergetic beams. A significant new result in this general case is that parameter β is represented as an average over the joint distribution of energies E 1 and E 2 of two particles in the beam. This result is consistent with the role of the quadratic term in the linear-quadratic model. It accounts for the two-track mechanism of cell kill, in which two particles, one after another, damage the same site in the cell nucleus. We then present simplified versions of the formalism, and discuss predicted properties of α and β. Finally, to demonstrate consistency of our formalism with experimental data, we apply it to fit two sets of experimental data: (1) α for heavy ions, covering a broad range of LETs, and (2) β for protons. In both cases, good agreement is achieved.

Modelling of Asphalt Concrete Stiffness in the Linear Viscoelastic Region

NASA Astrophysics Data System (ADS)

Mazurek, Grzegorz; Iwański, Marek

2017-10-01

Stiffness modulus is a fundamental parameter used in the modelling of the viscoelastic behaviour of bituminous mixtures. On the basis of the master curve in the linear viscoelasticity range, the mechanical properties of asphalt concrete at different loading times and temperatures can be predicted. This paper discusses the construction of master curves under rheological mathematical models i.e. the sigmoidal function model (MEPDG), the fractional model, and Bahia and co-workers’ model in comparison to the results from mechanistic rheological models i.e. the generalized Huet-Sayegh model, the generalized Maxwell model and the Burgers model. For the purposes of this analysis, the reference asphalt concrete mix (denoted as AC16W) intended for the binder coarse layer and for traffic category KR3 (5×105

Development of the Complex General Linear Model in the Fourier Domain: Application to fMRI Multiple Input-Output Evoked Responses for Single Subjects

PubMed Central

Rio, Daniel E.; Rawlings, Robert R.; Woltz, Lawrence A.; Gilman, Jodi; Hommer, Daniel W.

2013-01-01

A linear time-invariant model based on statistical time series analysis in the Fourier domain for single subjects is further developed and applied to functional MRI (fMRI) blood-oxygen level-dependent (BOLD) multivariate data. This methodology was originally developed to analyze multiple stimulus input evoked response BOLD data. However, to analyze clinical data generated using a repeated measures experimental design, the model has been extended to handle multivariate time series data and demonstrated on control and alcoholic subjects taken from data previously analyzed in the temporal domain. Analysis of BOLD data is typically carried out in the time domain where the data has a high temporal correlation. These analyses generally employ parametric models of the hemodynamic response function (HRF) where prewhitening of the data is attempted using autoregressive (AR) models for the noise. However, this data can be analyzed in the Fourier domain. Here, assumptions made on the noise structure are less restrictive, and hypothesis tests can be constructed based on voxel-specific nonparametric estimates of the hemodynamic transfer function (HRF in the Fourier domain). This is especially important for experimental designs involving multiple states (either stimulus or drug induced) that may alter the form of the response function. PMID:23840281

Development of the complex general linear model in the Fourier domain: application to fMRI multiple input-output evoked responses for single subjects.

PubMed

Rio, Daniel E; Rawlings, Robert R; Woltz, Lawrence A; Gilman, Jodi; Hommer, Daniel W

2013-01-01

A linear time-invariant model based on statistical time series analysis in the Fourier domain for single subjects is further developed and applied to functional MRI (fMRI) blood-oxygen level-dependent (BOLD) multivariate data. This methodology was originally developed to analyze multiple stimulus input evoked response BOLD data. However, to analyze clinical data generated using a repeated measures experimental design, the model has been extended to handle multivariate time series data and demonstrated on control and alcoholic subjects taken from data previously analyzed in the temporal domain. Analysis of BOLD data is typically carried out in the time domain where the data has a high temporal correlation. These analyses generally employ parametric models of the hemodynamic response function (HRF) where prewhitening of the data is attempted using autoregressive (AR) models for the noise. However, this data can be analyzed in the Fourier domain. Here, assumptions made on the noise structure are less restrictive, and hypothesis tests can be constructed based on voxel-specific nonparametric estimates of the hemodynamic transfer function (HRF in the Fourier domain). This is especially important for experimental designs involving multiple states (either stimulus or drug induced) that may alter the form of the response function.

A land use regression model for ambient ultrafine particles in Montreal, Canada: A comparison of linear regression and a machine learning approach.

PubMed

Weichenthal, Scott; Ryswyk, Keith Van; Goldstein, Alon; Bagg, Scott; Shekkarizfard, Maryam; Hatzopoulou, Marianne

2016-04-01

Existing evidence suggests that ambient ultrafine particles (UFPs) (<0.1µm) may contribute to acute cardiorespiratory morbidity. However, few studies have examined the long-term health effects of these pollutants owing in part to a need for exposure surfaces that can be applied in large population-based studies. To address this need, we developed a land use regression model for UFPs in Montreal, Canada using mobile monitoring data collected from 414 road segments during the summer and winter months between 2011 and 2012. Two different approaches were examined for model development including standard multivariable linear regression and a machine learning approach (kernel-based regularized least squares (KRLS)) that learns the functional form of covariate impacts on ambient UFP concentrations from the data. The final models included parameters for population density, ambient temperature and wind speed, land use parameters (park space and open space), length of local roads and rail, and estimated annual average NOx emissions from traffic. The final multivariable linear regression model explained 62% of the spatial variation in ambient UFP concentrations whereas the KRLS model explained 79% of the variance. The KRLS model performed slightly better than the linear regression model when evaluated using an external dataset (R(2)=0.58 vs. 0.55) or a cross-validation procedure (R(2)=0.67 vs. 0.60). In general, our findings suggest that the KRLS approach may offer modest improvements in predictive performance compared to standard multivariable linear regression models used to estimate spatial variations in ambient UFPs. However, differences in predictive performance were not statistically significant when evaluated using the cross-validation procedure. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

Influenza forecasting with Google Flu Trends.

PubMed

Dugas, Andrea Freyer; Jalalpour, Mehdi; Gel, Yulia; Levin, Scott; Torcaso, Fred; Igusa, Takeru; Rothman, Richard E

2013-01-01

We developed a practical influenza forecast model based on real-time, geographically focused, and easy to access data, designed to provide individual medical centers with advanced warning of the expected number of influenza cases, thus allowing for sufficient time to implement interventions. Secondly, we evaluated the effects of incorporating a real-time influenza surveillance system, Google Flu Trends, and meteorological and temporal information on forecast accuracy. Forecast models designed to predict one week in advance were developed from weekly counts of confirmed influenza cases over seven seasons (2004-2011) divided into seven training and out-of-sample verification sets. Forecasting procedures using classical Box-Jenkins, generalized linear models (GLM), and generalized linear autoregressive moving average (GARMA) methods were employed to develop the final model and assess the relative contribution of external variables such as, Google Flu Trends, meteorological data, and temporal information. A GARMA(3,0) forecast model with Negative Binomial distribution integrating Google Flu Trends information provided the most accurate influenza case predictions. The model, on the average, predicts weekly influenza cases during 7 out-of-sample outbreaks within 7 cases for 83% of estimates. Google Flu Trend data was the only source of external information to provide statistically significant forecast improvements over the base model in four of the seven out-of-sample verification sets. Overall, the p-value of adding this external information to the model is 0.0005. The other exogenous variables did not yield a statistically significant improvement in any of the verification sets. Integer-valued autoregression of influenza cases provides a strong base forecast model, which is enhanced by the addition of Google Flu Trends confirming the predictive capabilities of search query based syndromic surveillance. This accessible and flexible forecast model can be used by individual medical centers to provide advanced warning of future influenza cases.

Analysis of high-speed rotating flow inside gas centrifuge casing

NASA Astrophysics Data System (ADS)

Pradhan, Sahadev, , Dr.

2017-10-01

The generalized analytical model for the radial boundary layer inside the gas centrifuge casing in which the inner cylinder is rotating at a constant angular velocity Ω_i while the outer one is stationary, is formulated for studying the secondary gas flow field due to wall thermal forcing, inflow/outflow of light gas along the boundaries, as well as due to the combination of the above two external forcing. The analytical model includes the sixth order differential equation for the radial boundary layer at the cylindrical curved surface in terms of master potential (χ) , which is derived from the equations of motion in an axisymmetric (r - z) plane. The linearization approximation is used, where the equations of motion are truncated at linear order in the velocity and pressure disturbances to the base flow, which is a solid-body rotation. Additional approximations in the analytical model include constant temperature in the base state (isothermal compressible Couette flow), high aspect ratio (length is large compared to the annular gap), high Reynolds number, but there is no limitation on the Mach number. The discrete eigenvalues and eigenfunctions of the linear operators (sixth-order in the radial direction for the generalized analytical equation) are obtained. The solutions for the secondary flow is determined in terms of these eigenvalues and eigenfunctions. These solutions are compared with direct simulation Monte Carlo (DSMC) simulations and found excellent agreement (with a difference of less than 15%) between the predictions of the analytical model and the DSMC simulations, provided the boundary conditions in the analytical model are accurately specified.

Analysis of high-speed rotating flow inside gas centrifuge casing

NASA Astrophysics Data System (ADS)

Pradhan, Sahadev, , Dr.

2017-09-01

The generalized analytical model for the radial boundary layer inside the gas centrifuge casing in which the inner cylinder is rotating at a constant angular velocity Ωi while the outer one is stationary, is formulated for studying the secondary gas flow field due to wall thermal forcing, inflow/outflow of light gas along the boundaries, as well as due to the combination of the above two external forcing. The analytical model includes the sixth order differential equation for the radial boundary layer at the cylindrical curved surface in terms of master potential (χ) , which is derived from the equations of motion in an axisymmetric (r - z) plane. The linearization approximation is used, where the equations of motion are truncated at linear order in the velocity and pressure disturbances to the base flow, which is a solid-body rotation. Additional approximations in the analytical model include constant temperature in the base state (isothermal compressible Couette flow), high aspect ratio (length is large compared to the annular gap), high Reynolds number, but there is no limitation on the Mach number. The discrete eigenvalues and eigenfunctions of the linear operators (sixth-order in the radial direction for the generalized analytical equation) are obtained. The solutions for the secondary flow is determined in terms of these eigenvalues and eigenfunctions. These solutions are compared with direct simulation Monte Carlo (DSMC) simulations and found excellent agreement (with a difference of less than 15%) between the predictions of the analytical model and the DSMC simulations, provided the boundary conditions in the analytical model are accurately specified.

Analysis of high-speed rotating flow inside gas centrifuge casing

NASA Astrophysics Data System (ADS)

Pradhan, Sahadev

2017-11-01

The generalized analytical model for the radial boundary layer inside the gas centrifuge casing in which the inner cylinder is rotating at a constant angular velocity Ωi while the outer one is stationary, is formulated for studying the secondary gas flow field due to wall thermal forcing, inflow/outflow of light gas along the boundaries, as well as due to the combination of the above two external forcing. The analytical model includes the sixth order differential equation for the radial boundary layer at the cylindrical curved surface in terms of master potential (χ) , which is derived from the equations of motion in an axisymmetric (r - z) plane. The linearization approximation is used, where the equations of motion are truncated at linear order in the velocity and pressure disturbances to the base flow, which is a solid-body rotation. Additional approximations in the analytical model include constant temperature in the base state (isothermal compressible Couette flow), high aspect ratio (length is large compared to the annular gap), high Reynolds number, but there is no limitation on the Mach number. The discrete eigenvalues and eigenfunctions of the linear operators (sixth-order in the radial direction for the generalized analytical equation) are obtained. The solutions for the secondary flow is determined in terms of these eigenvalues and eigenfunctions. These solutions are compared with direct simulation Monte Carlo (DSMC) simulations and found excellent agreement (with a difference of less than 15%) between the predictions of the analytical model and the DSMC simulations, provided the boundary conditions in the analytical model are accurately specified.

Towards a unifying theory for the first-, second-, and third-order molecular (non)linear optical response

NASA Astrophysics Data System (ADS)

Pérez-Moreno, Javier; Clays, Koen; Kuzyk, Mark G.

2010-05-01

We present a procedure for the modeling of the dispersion of the nonlinear optical response of complex molecular structures that is based strictly on the results from experimental characterization. We show how under some general conditions, the use of the Thomas-Kuhn sum-rules leads to a successful modeling of the nonlinear response of complex molecular structures.

Comparison of linear and nonlinear models for coherent hemodynamics spectroscopy (CHS)

NASA Astrophysics Data System (ADS)

Sassaroli, Angelo; Kainerstorfer, Jana; Fantini, Sergio

2015-03-01

A recently proposed linear time-invariant hemodynamic model for coherent hemodynamics spectroscopy1 (CHS) relates the tissue concentrations of oxy- and deoxy-hemoglobin (outputs of the system) to given dynamics of the tissue blood volume, blood flow and rate constant of oxygen diffusion (inputs of the system). This linear model was derived in the limit of "small" perturbations in blood flow velocity. We have extended this model to a more general model (which will be referred to as the nonlinear extension to the original model) that yields the time-dependent changes of oxy and deoxy-hemoglobin concentrations in response to arbitrary dynamic changes in capillary blood flow velocity. The nonlinear extension to the model relies on a general solution of the partial differential equation that governs the spatio-temporal behavior of oxygen saturation of hemoglobin in capillaries and venules on the basis of dynamic (or time resolved) blood transit time. We show preliminary results where the CHS spectra obtained from the linear and nonlinear models are compared to quantify the limits of applicability of the linear model.

A formulation of rotor-airframe coupling for design analysis of vibrations of helicopter airframes

NASA Technical Reports Server (NTRS)

Kvaternik, R. G.; Walton, W. C., Jr.

1982-01-01

A linear formulation of rotor airframe coupling intended for vibration analysis in airframe structural design is presented. The airframe is represented by a finite element analysis model; the rotor is represented by a general set of linear differential equations with periodic coefficients; and the connections between the rotor and airframe are specified through general linear equations of constraint. Coupling equations are applied to the rotor and airframe equations to produce one set of linear differential equations governing vibrations of the combined rotor airframe system. These equations are solved by the harmonic balance method for the system steady state vibrations. A feature of the solution process is the representation of the airframe in terms of forced responses calculated at the rotor harmonics of interest. A method based on matrix partitioning is worked out for quick recalculations of vibrations in design studies when only relatively few airframe members are varied. All relations are presented in forms suitable for direct computer implementation.

On the repeated measures designs and sample sizes for randomized controlled trials.

PubMed

Tango, Toshiro

2016-04-01

For the analysis of longitudinal or repeated measures data, generalized linear mixed-effects models provide a flexible and powerful tool to deal with heterogeneity among subject response profiles. However, the typical statistical design adopted in usual randomized controlled trials is an analysis of covariance type analysis using a pre-defined pair of "pre-post" data, in which pre-(baseline) data are used as a covariate for adjustment together with other covariates. Then, the major design issue is to calculate the sample size or the number of subjects allocated to each treatment group. In this paper, we propose a new repeated measures design and sample size calculations combined with generalized linear mixed-effects models that depend not only on the number of subjects but on the number of repeated measures before and after randomization per subject used for the analysis. The main advantages of the proposed design combined with the generalized linear mixed-effects models are (1) it can easily handle missing data by applying the likelihood-based ignorable analyses under the missing at random assumption and (2) it may lead to a reduction in sample size, compared with the simple pre-post design. The proposed designs and the sample size calculations are illustrated with real data arising from randomized controlled trials. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Representing Micro-Macro Linkages by Actor-Based Dynamic Network Models

PubMed Central

Snijders, Tom A.B.; Steglich, Christian E.G.

2014-01-01

Stochastic actor-based models for network dynamics have the primary aim of statistical inference about processes of network change, but may be regarded as a kind of agent-based models. Similar to many other agent-based models, they are based on local rules for actor behavior. Different from many other agent-based models, by including elements of generalized linear statistical models they aim to be realistic detailed representations of network dynamics in empirical data sets. Statistical parallels to micro-macro considerations can be found in the estimation of parameters determining local actor behavior from empirical data, and the assessment of goodness of fit from the correspondence with network-level descriptives. This article studies several network-level consequences of dynamic actor-based models applied to represent cross-sectional network data. Two examples illustrate how network-level characteristics can be obtained as emergent features implied by micro-specifications of actor-based models. PMID:25960578

Adaptive convex combination approach for the identification of improper quaternion processes.

PubMed

Ujang, Bukhari Che; Jahanchahi, Cyrus; Took, Clive Cheong; Mandic, Danilo P

2014-01-01

Data-adaptive optimal modeling and identification of real-world vector sensor data is provided by combining the fractional tap-length (FT) approach with model order selection in the quaternion domain. To account rigorously for the generality of such processes, both second-order circular (proper) and noncircular (improper), the proposed approach in this paper combines the FT length optimization with both the strictly linear quaternion least mean square (QLMS) and widely linear QLMS (WL-QLMS). A collaborative approach based on QLMS and WL-QLMS is shown to both identify the type of processes (proper or improper) and to track their optimal parameters in real time. Analysis shows that monitoring the evolution of the convex mixing parameter within the collaborative approach allows us to track the improperness in real time. Further insight into the properties of those algorithms is provided by establishing a relationship between the steady-state error and optimal model order. The approach is supported by simulations on model order selection and identification of both strictly linear and widely linear quaternion-valued systems, such as those routinely used in renewable energy (wind) and human-centered computing (biomechanics).

A flexible count data regression model for risk analysis.

PubMed

Guikema, Seth D; Coffelt, Jeremy P; Goffelt, Jeremy P

2008-02-01

In many cases, risk and reliability analyses involve estimating the probabilities of discrete events such as hardware failures and occurrences of disease or death. There is often additional information in the form of explanatory variables that can be used to help estimate the likelihood of different numbers of events in the future through the use of an appropriate regression model, such as a generalized linear model. However, existing generalized linear models (GLM) are limited in their ability to handle the types of variance structures often encountered in using count data in risk and reliability analysis. In particular, standard models cannot handle both underdispersed data (variance less than the mean) and overdispersed data (variance greater than the mean) in a single coherent modeling framework. This article presents a new GLM based on a reformulation of the Conway-Maxwell Poisson (COM) distribution that is useful for both underdispersed and overdispersed count data and demonstrates this model by applying it to the assessment of electric power system reliability. The results show that the proposed COM GLM can provide as good of fits to data as the commonly used existing models for overdispered data sets while outperforming these commonly used models for underdispersed data sets.

Simplified model to describe the dissociative recombination of linear polyatomic ions of astrophysical interest

NASA Astrophysics Data System (ADS)

Fonseca Dos Santos, Samantha; Douguet, Nicolas; Kokoouline, Viatcheslav; Orel, Ann

2013-05-01

We will present theoretical results on the dissociative recombination (DR) of the linear polyatomic ions HCNH+, HCO+ and N2H+. Besides their astrophysical importance, they also share the characteristic that at low electronic impact energies their DR process happens via the indirect DR mechanism. We apply a general simplified model successfully implemented to treat the DR process of the highly symmetric non-linear molecules H3+, CH3+, H3O+ and NH4+ to calculated cross sections and DR rates for these ions. The model is based on multichannel quantum defect theory and accounts for all the main ingredients of indirect DR. New perspectives on dissociative recombination of HCO+ will also be discussed, including the possible role of HOC+ in storage ring experimental results. This work is supported by the DOE Office of Basic Energy Science and the National Science Foundation, Grant No's PHY-11-60611 and PHY-10-68785.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bose, Benjamin; Koyama, Kazuya, E-mail: benjamin.bose@port.ac.uk, E-mail: kazuya.koyama@port.ac.uk

We develop a code to produce the power spectrum in redshift space based on standard perturbation theory (SPT) at 1-loop order. The code can be applied to a wide range of modified gravity and dark energy models using a recently proposed numerical method by A.Taruya to find the SPT kernels. This includes Horndeski's theory with a general potential, which accommodates both chameleon and Vainshtein screening mechanisms and provides a non-linear extension of the effective theory of dark energy up to the third order. Focus is on a recent non-linear model of the redshift space power spectrum which has been shownmore » to model the anisotropy very well at relevant scales for the SPT framework, as well as capturing relevant non-linear effects typical of modified gravity theories. We provide consistency checks of the code against established results and elucidate its application within the light of upcoming high precision RSD data.« less

Assessment of bias correction under transient climate change

NASA Astrophysics Data System (ADS)

Van Schaeybroeck, Bert; Vannitsem, Stéphane

2015-04-01

Calibration of climate simulations is necessary since large systematic discrepancies are generally found between the model climate and the observed climate. Recent studies have cast doubt upon the common assumption of the bias being stationary when the climate changes. This led to the development of new methods, mostly based on linear sensitivity of the biases as a function of time or forcing (Kharin et al. 2012). However, recent studies uncovered more fundamental problems using both low-order systems (Vannitsem 2011) and climate models, showing that the biases may display complicated non-linear variations under climate change. This last analysis focused on biases derived from the equilibrium climate sensitivity, thereby ignoring the effect of the transient climate sensitivity. Based on the linear response theory, a general method of bias correction is therefore proposed that can be applied on any climate forcing scenario. The validity of the method is addressed using twin experiments with a climate model of intermediate complexity LOVECLIM (Goosse et al., 2010). We evaluate to what extent the bias change is sensitive to the structure (frequency) of the applied forcing (here greenhouse gases) and whether the linear response theory is valid for global and/or local variables. To answer these question we perform large-ensemble simulations using different 300-year scenarios of forced carbon-dioxide concentrations. Reality and simulations are assumed to differ by a model error emulated as a parametric error in the wind drag or in the radiative scheme. References [1] H. Goosse et al., 2010: Description of the Earth system model of intermediate complexity LOVECLIM version 1.2, Geosci. Model Dev., 3, 603-633. [2] S. Vannitsem, 2011: Bias correction and post-processing under climate change, Nonlin. Processes Geophys., 18, 911-924. [3] V.V. Kharin, G. J. Boer, W. J. Merryfield, J. F. Scinocca, and W.-S. Lee, 2012: Statistical adjustment of decadal predictions in a changing climate, Geophys. Res. Lett., 39, L19705.

Biomechanically based simulation of brain deformations for intraoperative image correction: coupling of elastic and fluid models

NASA Astrophysics Data System (ADS)

Hagemann, Alexander; Rohr, Karl; Stiehl, H. Siegfried

2000-06-01

In order to improve the accuracy of image-guided neurosurgery, different biomechanical models have been developed to correct preoperative images w.r.t. intraoperative changes like brain shift or tumor resection. All existing biomechanical models simulate different anatomical structures by using either appropriate boundary conditions or by spatially varying material parameter values, while assuming the same physical model for all anatomical structures. In general, this leads to physically implausible results, especially in the case of adjacent elastic and fluid structures. Therefore, we propose a new approach which allows to couple different physical models. In our case, we simulate rigid, elastic, and fluid regions by using the appropriate physical description for each material, namely either the Navier equation or the Stokes equation. To solve the resulting differential equations, we derive a linear matrix system for each region by applying the finite element method (FEM). Thereafter, the linear matrix systems are linked together, ending up with one overall linear matrix system. Our approach has been tested using synthetic as well as tomographic images. It turns out from experiments, that the integrated treatment of rigid, elastic, and fluid regions significantly improves the prediction results in comparison to a pure linear elastic model.

Estimating the variance for heterogeneity in arm-based network meta-analysis.

PubMed

Piepho, Hans-Peter; Madden, Laurence V; Roger, James; Payne, Roger; Williams, Emlyn R

2018-04-19

Network meta-analysis can be implemented by using arm-based or contrast-based models. Here we focus on arm-based models and fit them using generalized linear mixed model procedures. Full maximum likelihood (ML) estimation leads to biased trial-by-treatment interaction variance estimates for heterogeneity. Thus, our objective is to investigate alternative approaches to variance estimation that reduce bias compared with full ML. Specifically, we use penalized quasi-likelihood/pseudo-likelihood and hierarchical (h) likelihood approaches. In addition, we consider a novel model modification that yields estimators akin to the residual maximum likelihood estimator for linear mixed models. The proposed methods are compared by simulation, and 2 real datasets are used for illustration. Simulations show that penalized quasi-likelihood/pseudo-likelihood and h-likelihood reduce bias and yield satisfactory coverage rates. Sum-to-zero restriction and baseline contrasts for random trial-by-treatment interaction effects, as well as a residual ML-like adjustment, also reduce bias compared with an unconstrained model when ML is used, but coverage rates are not quite as good. Penalized quasi-likelihood/pseudo-likelihood and h-likelihood are therefore recommended. Copyright © 2018 John Wiley & Sons, Ltd.

A General Linear Model Approach to Adjusting the Cumulative GPA.

ERIC Educational Resources Information Center

Young, John W.

A general linear model (GLM), using least-squares techniques, was used to develop a criterion measure to replace freshman year grade point average (GPA) in college admission predictive validity studies. Problems with the use of GPA include those associated with the combination of grades from different courses and disciplines into a single measure,…

A matlab framework for estimation of NLME models using stochastic differential equations: applications for estimation of insulin secretion rates.

PubMed

Mortensen, Stig B; Klim, Søren; Dammann, Bernd; Kristensen, Niels R; Madsen, Henrik; Overgaard, Rune V

2007-10-01

The non-linear mixed-effects model based on stochastic differential equations (SDEs) provides an attractive residual error model, that is able to handle serially correlated residuals typically arising from structural mis-specification of the true underlying model. The use of SDEs also opens up for new tools for model development and easily allows for tracking of unknown inputs and parameters over time. An algorithm for maximum likelihood estimation of the model has earlier been proposed, and the present paper presents the first general implementation of this algorithm. The implementation is done in Matlab and also demonstrates the use of parallel computing for improved estimation times. The use of the implementation is illustrated by two examples of application which focus on the ability of the model to estimate unknown inputs facilitated by the extension to SDEs. The first application is a deconvolution-type estimation of the insulin secretion rate based on a linear two-compartment model for C-peptide measurements. In the second application the model is extended to also give an estimate of the time varying liver extraction based on both C-peptide and insulin measurements.

Application of a baseflow filter for evaluating model structure suitability of the IHACRES CMD

NASA Astrophysics Data System (ADS)

Kim, H. S.

2015-02-01

The main objective of this study was to assess the predictive uncertainty from the rainfall-runoff model structure coupling a conceptual module (non-linear module) with a metric transfer function module (linear module). The methodology was primarily based on the comparison between the outputs of the rainfall-runoff model and those from an alternative model approach. An alternative model approach was used to minimise uncertainties arising from data and the model structure. A baseflow filter was adopted to better understand deficiencies in the forms of the rainfall-runoff model by avoiding the uncertainties related to data and the model structure. The predictive uncertainty from the model structure was investigated for representative groups of catchments having similar hydrological response characteristics in the upper Murrumbidgee Catchment. In the assessment of model structure suitability, the consistency (or variability) of catchment response over time and space in model performance and parameter values has been investigated to detect problems related to the temporal and spatial variability of the model accuracy. The predictive error caused by model uncertainty was evaluated through analysis of the variability of the model performance and parameters. A graphical comparison of model residuals, effective rainfall estimates and hydrographs was used to determine a model's ability related to systematic model deviation between simulated and observed behaviours and general behavioural differences in the timing and magnitude of peak flows. The model's predictability was very sensitive to catchment response characteristics. The linear module performs reasonably well in the wetter catchments but has considerable difficulties when applied to the drier catchments where a hydrologic response is dominated by quick flow. The non-linear module has a potential limitation in its capacity to capture non-linear processes for converting observed rainfall into effective rainfall in both the wetter and drier catchments. The comparative study based on a better quantification of the accuracy and precision of hydrological modelling predictions yields a better understanding for the potential improvement of model deficiencies.

Application of conditional moment tests to model checking for generalized linear models.

PubMed

Pan, Wei

2002-06-01

Generalized linear models (GLMs) are increasingly being used in daily data analysis. However, model checking for GLMs with correlated discrete response data remains difficult. In this paper, through a case study on marginal logistic regression using a real data set, we illustrate the flexibility and effectiveness of using conditional moment tests (CMTs), along with other graphical methods, to do model checking for generalized estimation equation (GEE) analyses. Although CMTs provide an array of powerful diagnostic tests for model checking, they were originally proposed in the econometrics literature and, to our knowledge, have never been applied to GEE analyses. CMTs cover many existing tests, including the (generalized) score test for an omitted covariate, as special cases. In summary, we believe that CMTs provide a class of useful model checking tools.

Reply by the Authors to C. K. W. Tam

NASA Technical Reports Server (NTRS)

Morris, Philip J.; Farassat, F.

2002-01-01

The prediction of noise generation and radiation by turbulence has been the subject of continuous research for over fifty years. The essential problem is how to model the noise sources when one s knowledge of the detailed space-time properties of the turbulence is limited. We attempted to provide a comparison of models based on acoustic analogies and recent alternative models. Our goal was to demonstrate that the predictive capabilities of any model are based on the choice of the turbulence property that is modeled as a source of noise. Our general definition of an acoustic analogy is a rearrangement of the equations of motion into the form L(u) = Q, where L is a linear operator that reduces to an acoustic propagation operator outside a region upsilon; u is a variable that reduces to acoustic pressure (or a related linear acoustic variable) outside upsilon; and Q is a source term that can be meaningfully estimated without knowing u and tends to zero outside upsilon.

Development of non-linear models predicting daily fine particle concentrations using aerosol optical depth retrievals and ground-based measurements at a municipality in the Brazilian Amazon region

NASA Astrophysics Data System (ADS)

Gonçalves, Karen dos Santos; Winkler, Mirko S.; Benchimol-Barbosa, Paulo Roberto; de Hoogh, Kees; Artaxo, Paulo Eduardo; de Souza Hacon, Sandra; Schindler, Christian; Künzli, Nino

2018-07-01

Epidemiological studies generally use particulate matter measurements with diameter less 2.5 μm (PM2.5) from monitoring networks. Satellite aerosol optical depth (AOD) data has considerable potential in predicting PM2.5 concentrations, and thus provides an alternative method for producing knowledge regarding the level of pollution and its health impact in areas where no ground PM2.5 measurements are available. This is the case in the Brazilian Amazon rainforest region where forest fires are frequent sources of high pollution. In this study, we applied a non-linear model for predicting PM2.5 concentration from AOD retrievals using interaction terms between average temperature, relative humidity, sine, cosine of date in a period of 365,25 days and the square of the lagged relative residual. Regression performance statistics were tested comparing the goodness of fit and R2 based on results from linear regression and non-linear regression for six different models. The regression results for non-linear prediction showed the best performance, explaining on average 82% of the daily PM2.5 concentrations when considering the whole period studied. In the context of Amazonia, it was the first study predicting PM2.5 concentrations using the latest high-resolution AOD products also in combination with the testing of a non-linear model performance. Our results permitted a reliable prediction considering the AOD-PM2.5 relationship and set the basis for further investigations on air pollution impacts in the complex context of Brazilian Amazon Region.

Analysis of Binary Adherence Data in the Setting of Polypharmacy: A Comparison of Different Approaches

PubMed Central

Esserman, Denise A.; Moore, Charity G.; Roth, Mary T.

2009-01-01

Older community dwelling adults often take multiple medications for numerous chronic diseases. Non-adherence to these medications can have a large public health impact. Therefore, the measurement and modeling of medication adherence in the setting of polypharmacy is an important area of research. We apply a variety of different modeling techniques (standard linear regression; weighted linear regression; adjusted linear regression; naïve logistic regression; beta-binomial (BB) regression; generalized estimating equations (GEE)) to binary medication adherence data from a study in a North Carolina based population of older adults, where each medication an individual was taking was classified as adherent or non-adherent. In addition, through simulation we compare these different methods based on Type I error rates, bias, power, empirical 95% coverage, and goodness of fit. We find that estimation and inference using GEE is robust to a wide variety of scenarios and we recommend using this in the setting of polypharmacy when adherence is dichotomously measured for multiple medications per person. PMID:20414358

Linear Equating for the NEAT Design: Parameter Substitution Models and Chained Linear Relationship Models

ERIC Educational Resources Information Center

Kane, Michael T.; Mroch, Andrew A.; Suh, Youngsuk; Ripkey, Douglas R.

2009-01-01

This paper analyzes five linear equating models for the "nonequivalent groups with anchor test" (NEAT) design with internal anchors (i.e., the anchor test is part of the full test). The analysis employs a two-dimensional framework. The first dimension contrasts two general approaches to developing the equating relationship. Under a "parameter…

Latent log-linear models for handwritten digit classification.

PubMed

Deselaers, Thomas; Gass, Tobias; Heigold, Georg; Ney, Hermann

2012-06-01

We present latent log-linear models, an extension of log-linear models incorporating latent variables, and we propose two applications thereof: log-linear mixture models and image deformation-aware log-linear models. The resulting models are fully discriminative, can be trained efficiently, and the model complexity can be controlled. Log-linear mixture models offer additional flexibility within the log-linear modeling framework. Unlike previous approaches, the image deformation-aware model directly considers image deformations and allows for a discriminative training of the deformation parameters. Both are trained using alternating optimization. For certain variants, convergence to a stationary point is guaranteed and, in practice, even variants without this guarantee converge and find models that perform well. We tune the methods on the USPS data set and evaluate on the MNIST data set, demonstrating the generalization capabilities of our proposed models. Our models, although using significantly fewer parameters, are able to obtain competitive results with models proposed in the literature.

Linear and Nonlinear Thinking: A Multidimensional Model and Measure

ERIC Educational Resources Information Center

Groves, Kevin S.; Vance, Charles M.

2015-01-01

Building upon previously developed and more general dual-process models, this paper provides empirical support for a multidimensional thinking style construct comprised of linear thinking and multiple dimensions of nonlinear thinking. A self-report assessment instrument (Linear/Nonlinear Thinking Style Profile; LNTSP) is presented and…

Experimental and analytical investigations of longitudinal combustion instability in a continuously variable resonance combustor (CVRC)

NASA Astrophysics Data System (ADS)

Yu, Yen Ching

An analytical model based on linearized Euler equations (LEE) is developed and used in conjunction with a validating experiment to study combustion instability. The LEE model features mean flow effects, entropy waves, adaptability for more physically-realistic boundary conditions, and is generalized for multiple-domain conditions. The model calculates spatial modes, resonant frequencies and linear growth rates of the overall system. The predicted resonant frequencies and spatially-resolved mode shapes agree with the experimental data from a longitudinally-unstable model rocket combustor to within 7%. Different gaseous fuels (methane, ethylene, and hydrogen) were tested under fixed geometry. Tests with hydrogen were stable, whereas ethylene, methane, and JP-8 were increasingly unstable. A novel method for obtaining large amounts of stability data under variable resonance conditions in a single test was demonstrated. The continuously variable resonance combustor (CVRC) incorporates a traversing choked axial oxidizer inlet to vary the overall combustion system resonance. The CVRC experiment successfully demonstrates different level of instability, transitions between stability levels, and identifies the most stable and unstable geometric combination. Pressure oscillation amplitudes ranged from less than 10% of mean pressure to greater than 60%. At low amplitudes, measured resonant frequency changed with inlet location but at high amplitude the measured resonance frequency matched the frequency of the combustion chamber. As the system transitions from linear to non-linear instability, the higher harmonics of the fundamental resonant mode appear nearly simultaneously. Transient, high-amplitude, broadband noise, at lower frequencies (on the order of 200 Hz) are also observed. Conversely, as the system transitions back to a more linear stability regime, the higher harmonics disappear sequentially, led by the highest order. Good agreements between analytical and experimental results are attained by treating the experiment as quasi-stationary. The stability characteristics from the high frequency measurements are further analyzed using filtered pressure traces, spectrograms, power spectral density plots, and oscillation decrements. Future works recommended include: direct measurements, such as chemiluminescence or high-speed imaging to examine the unsteady combustion processes; three-way comparisons between the acoustic-based, linear Euler-based, and non-linear Euler/RANS model; use the high fidelity computation to investigate the forcing terms modeled in the acoustic-based model.

Variable selection for marginal longitudinal generalized linear models.

PubMed

Cantoni, Eva; Flemming, Joanna Mills; Ronchetti, Elvezio

2005-06-01

Variable selection is an essential part of any statistical analysis and yet has been somewhat neglected in the context of longitudinal data analysis. In this article, we propose a generalized version of Mallows's C(p) (GC(p)) suitable for use with both parametric and nonparametric models. GC(p) provides an estimate of a measure of model's adequacy for prediction. We examine its performance with popular marginal longitudinal models (fitted using GEE) and contrast results with what is typically done in practice: variable selection based on Wald-type or score-type tests. An application to real data further demonstrates the merits of our approach while at the same time emphasizing some important robust features inherent to GC(p).

Assessing the Tangent Linear Behaviour of Common Tracer Transport Schemes and Their Use in a Linearised Atmospheric General Circulation Model

NASA Technical Reports Server (NTRS)

Holdaway, Daniel; Kent, James

2015-01-01

The linearity of a selection of common advection schemes is tested and examined with a view to their use in the tangent linear and adjoint versions of an atmospheric general circulation model. The schemes are tested within a simple offline one-dimensional periodic domain as well as using a simplified and complete configuration of the linearised version of NASA's Goddard Earth Observing System version 5 (GEOS-5). All schemes which prevent the development of negative values and preserve the shape of the solution are confirmed to have nonlinear behaviour. The piecewise parabolic method (PPM) with certain flux limiters, including that used by default in GEOS-5, is found to support linear growth near the shocks. This property can cause the rapid development of unrealistically large perturbations within the tangent linear and adjoint models. It is shown that these schemes with flux limiters should not be used within the linearised version of a transport scheme. The results from tests using GEOS-5 show that the current default scheme (a version of PPM) is not suitable for the tangent linear and adjoint model, and that using a linear third-order scheme for the linearised model produces better behaviour. Using the third-order scheme for the linearised model improves the correlations between the linear and non-linear perturbation trajectories for cloud liquid water and cloud liquid ice in GEOS-5.

A Thermodynamic Theory Of Solid Viscoelasticity. Part 1: Linear Viscoelasticity.

NASA Technical Reports Server (NTRS)

Freed, Alan D.; Leonov, Arkady I.

2002-01-01

The present series of three consecutive papers develops a general theory for linear and finite solid viscoelasticity. Because the most important object for nonlinear studies are rubber-like materials, the general approach is specified in a form convenient for solving problems important for many industries that involve rubber-like materials. General linear and nonlinear theories for non-isothermal deformations of viscoelastic solids are developed based on the quasi-linear approach of non-equilibrium thermodynamics. In this, the first paper of the series, we analyze non-isothermal linear viscoelasticity, which is applicable in a range of small strains not only to all synthetic polymers and bio-polymers but also to some non-polymeric materials. Although the linear case seems to be well developed, there still are some reasons to implement a thermodynamic derivation of constitutive equations for solid-like, non-isothermal, linear viscoelasticity. The most important is the thermodynamic modeling of thermo-rheological complexity , i.e. different temperature dependences of relaxation parameters in various parts of relaxation spectrum. A special structure of interaction matrices is established for different physical mechanisms contributed to the normal relaxation modes. This structure seems to be in accord with observations, and creates a simple mathematical framework for both continuum and molecular theories of the thermo-rheological complex relaxation phenomena. Finally, a unified approach is briefly discussed that, in principle, allows combining both the long time (discrete) and short time (continuous) descriptions of relaxation behaviors for polymers in the rubbery and glassy regions.

General linear methods and friends: Toward efficient solutions of multiphysics problems

NASA Astrophysics Data System (ADS)

Sandu, Adrian

2017-07-01

Time dependent multiphysics partial differential equations are of great practical importance as they model diverse phenomena that appear in mechanical and chemical engineering, aeronautics, astrophysics, meteorology and oceanography, financial modeling, environmental sciences, etc. There is no single best time discretization for the complex multiphysics systems of practical interest. We discuss "multimethod" approaches that combine different time steps and discretizations using the rigourous frameworks provided by Partitioned General Linear Methods and Generalize-structure Additive Runge Kutta Methods..

Linear analysis of a force reflective teleoperator

NASA Technical Reports Server (NTRS)

Biggers, Klaus B.; Jacobsen, Stephen C.; Davis, Clark C.

1989-01-01

Complex force reflective teleoperation systems are often very difficult to analyze due to the large number of components and control loops involved. One mode of a force reflective teleoperator is described. An analysis of the performance of the system based on a linear analysis of the general full order model is presented. Reduced order models are derived and correlated with the full order models. Basic effects of force feedback and position feedback are examined and the effects of time delays between the master and slave are studied. The results show that with symmetrical position-position control of teleoperators, a basic trade off must be made between the intersystem stiffness of the teleoperator, and the impedance felt by the operator in free space.

Simulation of extreme rainfall and projection of future changes using the GLIMCLIM model

NASA Astrophysics Data System (ADS)

Rashid, Md. Mamunur; Beecham, Simon; Chowdhury, Rezaul Kabir

2017-10-01

In this study, the performance of the Generalized LInear Modelling of daily CLImate sequence (GLIMCLIM) statistical downscaling model was assessed to simulate extreme rainfall indices and annual maximum daily rainfall (AMDR) when downscaled daily rainfall from National Centers for Environmental Prediction (NCEP) reanalysis and Coupled Model Intercomparison Project Phase 5 (CMIP5) general circulation models (GCM) (four GCMs and two scenarios) output datasets and then their changes were estimated for the future period 2041-2060. The model was able to reproduce the monthly variations in the extreme rainfall indices reasonably well when forced by the NCEP reanalysis datasets. Frequency Adapted Quantile Mapping (FAQM) was used to remove bias in the simulated daily rainfall when forced by CMIP5 GCMs, which reduced the discrepancy between observed and simulated extreme rainfall indices. Although the observed AMDR were within the 2.5th and 97.5th percentiles of the simulated AMDR, the model consistently under-predicted the inter-annual variability of AMDR. A non-stationary model was developed using the generalized linear model for local, shape and scale to estimate the AMDR with an annual exceedance probability of 0.01. The study shows that in general, AMDR is likely to decrease in the future. The Onkaparinga catchment will also experience drier conditions due to an increase in consecutive dry days coinciding with decreases in heavy (>long term 90th percentile) rainfall days, empirical 90th quantile of rainfall and maximum 5-day consecutive total rainfall for the future period (2041-2060) compared to the base period (1961-2000).

The use of artificial neural networks and multiple linear regression to predict rate of medical waste generation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jahandideh, Sepideh; Jahandideh, Samad; Asadabadi, Ebrahim Barzegari

2009-11-15

Prediction of the amount of hospital waste production will be helpful in the storage, transportation and disposal of hospital waste management. Based on this fact, two predictor models including artificial neural networks (ANNs) and multiple linear regression (MLR) were applied to predict the rate of medical waste generation totally and in different types of sharp, infectious and general. In this study, a 5-fold cross-validation procedure on a database containing total of 50 hospitals of Fars province (Iran) were used to verify the performance of the models. Three performance measures including MAR, RMSE and R{sup 2} were used to evaluate performancemore » of models. The MLR as a conventional model obtained poor prediction performance measure values. However, MLR distinguished hospital capacity and bed occupancy as more significant parameters. On the other hand, ANNs as a more powerful model, which has not been introduced in predicting rate of medical waste generation, showed high performance measure values, especially 0.99 value of R{sup 2} confirming the good fit of the data. Such satisfactory results could be attributed to the non-linear nature of ANNs in problem solving which provides the opportunity for relating independent variables to dependent ones non-linearly. In conclusion, the obtained results showed that our ANN-based model approach is very promising and may play a useful role in developing a better cost-effective strategy for waste management in future.« less

Estimating linear-nonlinear models using Rényi divergences

PubMed Central

Kouh, Minjoon; Sharpee, Tatyana O.

2009-01-01

This paper compares a family of methods for characterizing neural feature selectivity using natural stimuli in the framework of the linear-nonlinear model. In this model, the spike probability depends in a nonlinear way on a small number of stimulus dimensions. The relevant stimulus dimensions can be found by optimizing a Rényi divergence that quantifies a change in the stimulus distribution associated with the arrival of single spikes. Generally, good reconstructions can be obtained based on optimization of Rényi divergence of any order, even in the limit of small numbers of spikes. However, the smallest error is obtained when the Rényi divergence of order 1 is optimized. This type of optimization is equivalent to information maximization, and is shown to saturate the Cramér-Rao bound describing the smallest error allowed for any unbiased method. We also discuss conditions under which information maximization provides a convenient way to perform maximum likelihood estimation of linear-nonlinear models from neural data. PMID:19568981

Estimating linear-nonlinear models using Renyi divergences.

PubMed

Kouh, Minjoon; Sharpee, Tatyana O

2009-01-01

This article compares a family of methods for characterizing neural feature selectivity using natural stimuli in the framework of the linear-nonlinear model. In this model, the spike probability depends in a nonlinear way on a small number of stimulus dimensions. The relevant stimulus dimensions can be found by optimizing a Rényi divergence that quantifies a change in the stimulus distribution associated with the arrival of single spikes. Generally, good reconstructions can be obtained based on optimization of Rényi divergence of any order, even in the limit of small numbers of spikes. However, the smallest error is obtained when the Rényi divergence of order 1 is optimized. This type of optimization is equivalent to information maximization, and is shown to saturate the Cramer-Rao bound describing the smallest error allowed for any unbiased method. We also discuss conditions under which information maximization provides a convenient way to perform maximum likelihood estimation of linear-nonlinear models from neural data.

Escaping the snare of chronological growth and launching a free curve alternative: general deviance as latent growth model.

PubMed

Wood, Phillip Karl; Jackson, Kristina M

2013-08-01

Researchers studying longitudinal relationships among multiple problem behaviors sometimes characterize autoregressive relationships across constructs as indicating "protective" or "launch" factors or as "developmental snares." These terms are used to indicate that initial or intermediary states of one problem behavior subsequently inhibit or promote some other problem behavior. Such models are contrasted with models of "general deviance" over time in which all problem behaviors are viewed as indicators of a common linear trajectory. When fit of the "general deviance" model is poor and fit of one or more autoregressive models is good, this is taken as support for the inhibitory or enhancing effect of one construct on another. In this paper, we argue that researchers consider competing models of growth before comparing deviance and time-bound models. Specifically, we propose use of the free curve slope intercept (FCSI) growth model (Meredith & Tisak, 1990) as a general model to typify change in a construct over time. The FCSI model includes, as nested special cases, several statistical models often used for prospective data, such as linear slope intercept models, repeated measures multivariate analysis of variance, various one-factor models, and hierarchical linear models. When considering models involving multiple constructs, we argue the construct of "general deviance" can be expressed as a single-trait multimethod model, permitting a characterization of the deviance construct over time without requiring restrictive assumptions about the form of growth over time. As an example, prospective assessments of problem behaviors from the Dunedin Multidisciplinary Health and Development Study (Silva & Stanton, 1996) are considered and contrasted with earlier analyses of Hussong, Curran, Moffitt, and Caspi (2008), which supported launch and snare hypotheses. For antisocial behavior, the FCSI model fit better than other models, including the linear chronometric growth curve model used by Hussong et al. For models including multiple constructs, a general deviance model involving a single trait and multimethod factors (or a corresponding hierarchical factor model) fit the data better than either the "snares" alternatives or the general deviance model previously considered by Hussong et al. Taken together, the analyses support the view that linkages and turning points cannot be contrasted with general deviance models absent additional experimental intervention or control.

Escaping the snare of chronological growth and launching a free curve alternative: General deviance as latent growth model

PubMed Central

WOOD, PHILLIP KARL; JACKSON, KRISTINA M.

2014-01-01

Researchers studying longitudinal relationships among multiple problem behaviors sometimes characterize autoregressive relationships across constructs as indicating “protective” or “launch” factors or as “developmental snares.” These terms are used to indicate that initial or intermediary states of one problem behavior subsequently inhibit or promote some other problem behavior. Such models are contrasted with models of “general deviance” over time in which all problem behaviors are viewed as indicators of a common linear trajectory. When fit of the “general deviance” model is poor and fit of one or more autoregressive models is good, this is taken as support for the inhibitory or enhancing effect of one construct on another. In this paper, we argue that researchers consider competing models of growth before comparing deviance and time-bound models. Specifically, we propose use of the free curve slope intercept (FCSI) growth model (Meredith & Tisak, 1990) as a general model to typify change in a construct over time. The FCSI model includes, as nested special cases, several statistical models often used for prospective data, such as linear slope intercept models, repeated measures multivariate analysis of variance, various one-factor models, and hierarchical linear models. When considering models involving multiple constructs, we argue the construct of “general deviance” can be expressed as a single-trait multimethod model, permitting a characterization of the deviance construct over time without requiring restrictive assumptions about the form of growth over time. As an example, prospective assessments of problem behaviors from the Dunedin Multidisciplinary Health and Development Study (Silva & Stanton, 1996) are considered and contrasted with earlier analyses of Hussong, Curran, Moffitt, and Caspi (2008), which supported launch and snare hypotheses. For antisocial behavior, the FCSI model fit better than other models, including the linear chronometric growth curve model used by Hussong et al. For models including multiple constructs, a general deviance model involving a single trait and multimethod factors (or a corresponding hierarchical factor model) fit the data better than either the “snares” alternatives or the general deviance model previously considered by Hussong et al. Taken together, the analyses support the view that linkages and turning points cannot be contrasted with general deviance models absent additional experimental intervention or control. PMID:23880389

Bond-based linear indices of the non-stochastic and stochastic edge-adjacency matrix. 1. Theory and modeling of ChemPhys properties of organic molecules.

PubMed

Marrero-Ponce, Yovani; Martínez-Albelo, Eugenio R; Casañola-Martín, Gerardo M; Castillo-Garit, Juan A; Echevería-Díaz, Yunaimy; Zaldivar, Vicente Romero; Tygat, Jan; Borges, José E Rodriguez; García-Domenech, Ramón; Torrens, Francisco; Pérez-Giménez, Facundo

2010-11-01

Novel bond-level molecular descriptors are proposed, based on linear maps similar to the ones defined in algebra theory. The kth edge-adjacency matrix (E(k)) denotes the matrix of bond linear indices (non-stochastic) with regard to canonical basis set. The kth stochastic edge-adjacency matrix, ES(k), is here proposed as a new molecular representation easily calculated from E(k). Then, the kth stochastic bond linear indices are calculated using ES(k) as operators of linear transformations. In both cases, the bond-type formalism is developed. The kth non-stochastic and stochastic total linear indices are calculated by adding the kth non-stochastic and stochastic bond linear indices, respectively, of all bonds in molecule. First, the new bond-based molecular descriptors (MDs) are tested for suitability, for the QSPRs, by analyzing regressions of novel indices for selected physicochemical properties of octane isomers (first round). General performance of the new descriptors in this QSPR studies is evaluated with regard to the well-known sets of 2D/3D MDs. From the analysis, we can conclude that the non-stochastic and stochastic bond-based linear indices have an overall good modeling capability proving their usefulness in QSPR studies. Later, the novel bond-level MDs are also used for the description and prediction of the boiling point of 28 alkyl-alcohols (second round), and to the modeling of the specific rate constant (log k), partition coefficient (log P), as well as the antibacterial activity of 34 derivatives of 2-furylethylenes (third round). The comparison with other approaches (edge- and vertices-based connectivity indices, total and local spectral moments, and quantum chemical descriptors as well as E-state/biomolecular encounter parameters) exposes a good behavior of our method in this QSPR studies. Finally, the approach described in this study appears to be a very promising structural invariant, useful not only for QSPR studies but also for similarity/diversity analysis and drug discovery protocols.

Molecular surface area based predictive models for the adsorption and diffusion of disperse dyes in polylactic acid matrix.

PubMed

Xu, Suxin; Chen, Jiangang; Wang, Bijia; Yang, Yiqi

2015-11-15

Two predictive models were presented for the adsorption affinities and diffusion coefficients of disperse dyes in polylactic acid matrix. Quantitative structure-sorption behavior relationship would not only provide insights into sorption process, but also enable rational engineering for desired properties. The thermodynamic and kinetic parameters for three disperse dyes were measured. The predictive model for adsorption affinity was based on two linear relationships derived by interpreting the experimental measurements with molecular structural parameters and compensation effect: ΔH° vs. dye size and ΔS° vs. ΔH°. Similarly, the predictive model for diffusion coefficient was based on two derived linear relationships: activation energy of diffusion vs. dye size and logarithm of pre-exponential factor vs. activation energy of diffusion. The only required parameters for both models are temperature and solvent accessible surface area of the dye molecule. These two predictive models were validated by testing the adsorption and diffusion properties of new disperse dyes. The models offer fairly good predictive ability. The linkage between structural parameter of disperse dyes and sorption behaviors might be generalized and extended to other similar polymer-penetrant systems. Copyright © 2015 Elsevier Inc. All rights reserved.

The general linear inverse problem - Implication of surface waves and free oscillations for earth structure.

NASA Technical Reports Server (NTRS)

Wiggins, R. A.

1972-01-01

The discrete general linear inverse problem reduces to a set of m equations in n unknowns. There is generally no unique solution, but we can find k linear combinations of parameters for which restraints are determined. The parameter combinations are given by the eigenvectors of the coefficient matrix. The number k is determined by the ratio of the standard deviations of the observations to the allowable standard deviations in the resulting solution. Various linear combinations of the eigenvectors can be used to determine parameter resolution and information distribution among the observations. Thus we can determine where information comes from among the observations and exactly how it constraints the set of possible models. The application of such analyses to surface-wave and free-oscillation observations indicates that (1) phase, group, and amplitude observations for any particular mode provide basically the same type of information about the model; (2) observations of overtones can enhance the resolution considerably; and (3) the degree of resolution has generally been overestimated for many model determinations made from surface waves.

Estimation and Selection via Absolute Penalized Convex Minimization And Its Multistage Adaptive Applications

PubMed Central

Huang, Jian; Zhang, Cun-Hui

2013-01-01

The ℓ1-penalized method, or the Lasso, has emerged as an important tool for the analysis of large data sets. Many important results have been obtained for the Lasso in linear regression which have led to a deeper understanding of high-dimensional statistical problems. In this article, we consider a class of weighted ℓ1-penalized estimators for convex loss functions of a general form, including the generalized linear models. We study the estimation, prediction, selection and sparsity properties of the weighted ℓ1-penalized estimator in sparse, high-dimensional settings where the number of predictors p can be much larger than the sample size n. Adaptive Lasso is considered as a special case. A multistage method is developed to approximate concave regularized estimation by applying an adaptive Lasso recursively. We provide prediction and estimation oracle inequalities for single- and multi-stage estimators, a general selection consistency theorem, and an upper bound for the dimension of the Lasso estimator. Important models including the linear regression, logistic regression and log-linear models are used throughout to illustrate the applications of the general results. PMID:24348100

Using recurrent neural networks for adaptive communication channel equalization.

PubMed

Kechriotis, G; Zervas, E; Manolakos, E S

1994-01-01

Nonlinear adaptive filters based on a variety of neural network models have been used successfully for system identification and noise-cancellation in a wide class of applications. An important problem in data communications is that of channel equalization, i.e., the removal of interferences introduced by linear or nonlinear message corrupting mechanisms, so that the originally transmitted symbols can be recovered correctly at the receiver. In this paper we introduce an adaptive recurrent neural network (RNN) based equalizer whose small size and high performance makes it suitable for high-speed channel equalization. We propose RNN based structures for both trained adaptation and blind equalization, and we evaluate their performance via extensive simulations for a variety of signal modulations and communication channel models. It is shown that the RNN equalizers have comparable performance with traditional linear filter based equalizers when the channel interferences are relatively mild, and that they outperform them by several orders of magnitude when either the channel's transfer function has spectral nulls or severe nonlinear distortion is present. In addition, the small-size RNN equalizers, being essentially generalized IIR filters, are shown to outperform multilayer perceptron equalizers of larger computational complexity in linear and nonlinear channel equalization cases.

Methodological quality and reporting of generalized linear mixed models in clinical medicine (2000-2012): a systematic review.

PubMed

Casals, Martí; Girabent-Farrés, Montserrat; Carrasco, Josep L

2014-01-01

Modeling count and binary data collected in hierarchical designs have increased the use of Generalized Linear Mixed Models (GLMMs) in medicine. This article presents a systematic review of the application and quality of results and information reported from GLMMs in the field of clinical medicine. A search using the Web of Science database was performed for published original articles in medical journals from 2000 to 2012. The search strategy included the topic "generalized linear mixed models","hierarchical generalized linear models", "multilevel generalized linear model" and as a research domain we refined by science technology. Papers reporting methodological considerations without application, and those that were not involved in clinical medicine or written in English were excluded. A total of 443 articles were detected, with an increase over time in the number of articles. In total, 108 articles fit the inclusion criteria. Of these, 54.6% were declared to be longitudinal studies, whereas 58.3% and 26.9% were defined as repeated measurements and multilevel design, respectively. Twenty-two articles belonged to environmental and occupational public health, 10 articles to clinical neurology, 8 to oncology, and 7 to infectious diseases and pediatrics. The distribution of the response variable was reported in 88% of the articles, predominantly Binomial (n = 64) or Poisson (n = 22). Most of the useful information about GLMMs was not reported in most cases. Variance estimates of random effects were described in only 8 articles (9.2%). The model validation, the method of covariate selection and the method of goodness of fit were only reported in 8.0%, 36.8% and 14.9% of the articles, respectively. During recent years, the use of GLMMs in medical literature has increased to take into account the correlation of data when modeling qualitative data or counts. According to the current recommendations, the quality of reporting has room for improvement regarding the characteristics of the analysis, estimation method, validation, and selection of the model.

A heteroscedastic generalized linear model with a non-normal speed factor for responses and response times.

PubMed

Molenaar, Dylan; Bolsinova, Maria

2017-05-01

In generalized linear modelling of responses and response times, the observed response time variables are commonly transformed to make their distribution approximately normal. A normal distribution for the transformed response times is desirable as it justifies the linearity and homoscedasticity assumptions in the underlying linear model. Past research has, however, shown that the transformed response times are not always normal. Models have been developed to accommodate this violation. In the present study, we propose a modelling approach for responses and response times to test and model non-normality in the transformed response times. Most importantly, we distinguish between non-normality due to heteroscedastic residual variances, and non-normality due to a skewed speed factor. In a simulation study, we establish parameter recovery and the power to separate both effects. In addition, we apply the model to a real data set. © 2017 The Authors. British Journal of Mathematical and Statistical Psychology published by John Wiley & Sons Ltd on behalf of British Psychological Society.

Linear-time reconstruction of zero-recombinant Mendelian inheritance on pedigrees without mating loops.

PubMed

Liu, Lan; Jiang, Tao

2007-01-01

With the launch of the international HapMap project, the haplotype inference problem has attracted a great deal of attention in the computational biology community recently. In this paper, we study the question of how to efficiently infer haplotypes from genotypes of individuals related by a pedigree without mating loops, assuming that the hereditary process was free of mutations (i.e. the Mendelian law of inheritance) and recombinants. We model the haplotype inference problem as a system of linear equations as in [10] and present an (optimal) linear-time (i.e. O(mn) time) algorithm to generate a particular solution (A particular solution of any linear system is an assignment of numerical values to the variables in the system which satisfies the equations in the system.) to the haplotype inference problem, where m is the number of loci (or markers) in a genotype and n is the number of individuals in the pedigree. Moreover, the algorithm also provides a general solution (A general solution of any linear system is denoted by the span of a basis in the solution space to its associated homogeneous system, offset from the origin by a vector, namely by any particular solution. A general solution for ZRHC is very useful in practice because it allows the end user to efficiently enumerate all solutions for ZRHC and performs tasks such as random sampling.) in O(mn2) time, which is optimal because the size of a general solution could be as large as Theta(mn2). The key ingredients of our construction are (i) a fast consistency checking procedure for the system of linear equations introduced in [10] based on a careful investigation of the relationship between the equations (ii) a novel linear-time method for solving linear equations without invoking the Gaussian elimination method. Although such a fast method for solving equations is not known for general systems of linear equations, we take advantage of the underlying loop-free pedigree graph and some special properties of the linear equations.

Quantitative photoacoustic imaging in the acoustic regime using SPIM

NASA Astrophysics Data System (ADS)

Beigl, Alexander; Elbau, Peter; Sadiq, Kamran; Scherzer, Otmar

2018-05-01

While in standard photoacoustic imaging the propagation of sound waves is modeled by the standard wave equation, our approach is based on a generalized wave equation with variable sound speed and material density, respectively. In this paper we present an approach for photoacoustic imaging, which in addition to the recovery of the absorption density parameter, the imaging parameter of standard photoacoustics, also allows us to reconstruct the spatially varying sound speed and density, respectively, of the medium. We provide analytical reconstruction formulas for all three parameters based in a linearized model based on single plane illumination microscopy (SPIM) techniques.

Observations and modeling of ocean-induced melt beneath Petermann Glacier Ice Shelf in northwestern Greenland

NASA Astrophysics Data System (ADS)

Cai, Cilan; Rignot, Eric; Menemenlis, Dimitris; Nakayama, Yoshihiro

2017-08-01

We update observationally based estimates of subaqueous melt, Qm, beneath Petermann Glacier Ice Shelf (PGIS), Greenland, and model its sensitivity to oceanic thermal forcing, TF, and subglacial runoff, Qsg, using the Massachusetts Institute of Technology general circulation model (MITgcm), in a two-dimensional domain, with 20 m vertical and 40 m horizontal resolution at the grounding line. We adjust the drag coefficient to match the observationally based Qm. With the inclusion of Qsg, the maximum melt rate (Qmmax) is 2 times larger in summer and 1/3 larger annually than in winter. Qmmax increases above linear with TF and below linear with Qsg. We estimate that Qmmax increased by 24% (+8.1 m/yr) beneath PGIS from the 1990s to the 2000s from a 0.21°C warming in ocean temperature and a doubling in Qsg, hence contributing to its thinning. If the PGIS is removed, we estimate that the modeled melt rate near the grounding line will increase 13-16 times.

Charge modeling of ionic polymer-metal composites for dynamic curvature sensing

NASA Astrophysics Data System (ADS)

Bahramzadeh, Yousef; Shahinpoor, Mohsen

2011-04-01

A curvature sensor based on Ionic Polymer-Metal Composite (IPMC) is proposed and characterized for sensing of curvature variation in structures such as inflatable space structures in which using low power and flexible curvature sensor is of high importance for dynamic monitoring of shape at desired points. The linearity of output signal of sensor for calibration, effect of deflection rate at low frequencies and the phase delay between the output signal and the input deformation of IPMC curvature sensor is investigated. An analytical chemo-electro-mechanical model for charge dynamic of IPMC sensor is presented based on Nernst-Planck partial differential equation which can be used to explain the phenomena observed in experiments. The rate dependency of output signal and phase delay between the applied deformation and sensor signal is studied using the proposed model. The model provides a background for predicting the general characteristics of IPMC sensor. It is shown that IPMC sensor exhibits good linearity, sensitivity, and repeatability for dynamic curvature sensing of inflatable structures.

Genetic programming based quantitative structure-retention relationships for the prediction of Kovats retention indices.

PubMed

Goel, Purva; Bapat, Sanket; Vyas, Renu; Tambe, Amruta; Tambe, Sanjeev S

2015-11-13

The development of quantitative structure-retention relationships (QSRR) aims at constructing an appropriate linear/nonlinear model for the prediction of the retention behavior (such as Kovats retention index) of a solute on a chromatographic column. Commonly, multi-linear regression and artificial neural networks are used in the QSRR development in the gas chromatography (GC). In this study, an artificial intelligence based data-driven modeling formalism, namely genetic programming (GP), has been introduced for the development of quantitative structure based models predicting Kovats retention indices (KRI). The novelty of the GP formalism is that given an example dataset, it searches and optimizes both the form (structure) and the parameters of an appropriate linear/nonlinear data-fitting model. Thus, it is not necessary to pre-specify the form of the data-fitting model in the GP-based modeling. These models are also less complex, simple to understand, and easy to deploy. The effectiveness of GP in constructing QSRRs has been demonstrated by developing models predicting KRIs of light hydrocarbons (case study-I) and adamantane derivatives (case study-II). In each case study, two-, three- and four-descriptor models have been developed using the KRI data available in the literature. The results of these studies clearly indicate that the GP-based models possess an excellent KRI prediction accuracy and generalization capability. Specifically, the best performing four-descriptor models in both the case studies have yielded high (>0.9) values of the coefficient of determination (R(2)) and low values of root mean squared error (RMSE) and mean absolute percent error (MAPE) for training, test and validation set data. The characteristic feature of this study is that it introduces a practical and an effective GP-based method for developing QSRRs in gas chromatography that can be gainfully utilized for developing other types of data-driven models in chromatography science. Copyright © 2015 Elsevier B.V. All rights reserved.

Susceptible-infected-recovered epidemics in random networks with population awareness

NASA Astrophysics Data System (ADS)

Wu, Qingchu; Chen, Shufang

2017-10-01

The influence of epidemic information-based awareness on the spread of infectious diseases on networks cannot be ignored. Within the effective degree modeling framework, we discuss the susceptible-infected-recovered model in complex networks with general awareness and general degree distribution. By performing the linear stability analysis, the conditions of epidemic outbreak can be deduced and the results of the previous research can be further expanded. Results show that the local awareness can suppress significantly the epidemic spreading on complex networks via raising the epidemic threshold and such effects are closely related to the formulation of awareness functions. In addition, our results suggest that the recovered information-based awareness has no effect on the critical condition of epidemic outbreak.

Quantum criticality of the two-channel pseudogap Anderson model: universal scaling in linear and non-linear conductance.

PubMed

Wu, Tsan-Pei; Wang, Xiao-Qun; Guo, Guang-Yu; Anders, Frithjof; Chung, Chung-Hou

2016-05-05

The quantum criticality of the two-lead two-channel pseudogap Anderson impurity model is studied. Based on the non-crossing approximation (NCA) and numerical renormalization group (NRG) approaches, we calculate both the linear and nonlinear conductance of the model at finite temperatures with a voltage bias and a power-law vanishing conduction electron density of states, ρc(ω) proportional |ω − μF|(r) (0 < r < 1) near the Fermi energy μF. At a fixed lead-impurity hybridization, a quantum phase transition from the two-channel Kondo (2CK) to the local moment (LM) phase is observed with increasing r from r = 0 to r = rc < 1. Surprisingly, in the 2CK phase, different power-law scalings from the well-known [Formula: see text] or [Formula: see text] form is found. Moreover, novel power-law scalings in conductances at the 2CK-LM quantum critical point are identified. Clear distinctions are found on the critical exponents between linear and non-linear conductance at criticality. The implications of these two distinct quantum critical properties for the non-equilibrium quantum criticality in general are discussed.

A simple and exploratory way to determine the mean-variance relationship in generalized linear models.

PubMed

Tsou, Tsung-Shan

2007-03-30

This paper introduces an exploratory way to determine how variance relates to the mean in generalized linear models. This novel method employs the robust likelihood technique introduced by Royall and Tsou.A urinary data set collected by Ginsberg et al. and the fabric data set analysed by Lee and Nelder are considered to demonstrate the applicability and simplicity of the proposed technique. Application of the proposed method could easily reveal a mean-variance relationship that would generally be left unnoticed, or that would require more complex modelling to detect. Copyright (c) 2006 John Wiley & Sons, Ltd.

Symposium on General Linear Model Approach to the Analysis of Experimental Data in Educational Research (Athens, Georgia, June 29-July 1, 1967). Final Report.

ERIC Educational Resources Information Center

Bashaw, W. L., Ed.; Findley, Warren G., Ed.

This volume contains the five major addresses and subsequent discussion from the Symposium on the General Linear Models Approach to the Analysis of Experimental Data in Educational Research, which was held in 1967 in Athens, Georgia. The symposium was designed to produce systematic information, including new methodology, for dissemination to the…

A Java-based fMRI processing pipeline evaluation system for assessment of univariate general linear model and multivariate canonical variate analysis-based pipelines.

PubMed

Zhang, Jing; Liang, Lichen; Anderson, Jon R; Gatewood, Lael; Rottenberg, David A; Strother, Stephen C

2008-01-01

As functional magnetic resonance imaging (fMRI) becomes widely used, the demands for evaluation of fMRI processing pipelines and validation of fMRI analysis results is increasing rapidly. The current NPAIRS package, an IDL-based fMRI processing pipeline evaluation framework, lacks system interoperability and the ability to evaluate general linear model (GLM)-based pipelines using prediction metrics. Thus, it can not fully evaluate fMRI analytical software modules such as FSL.FEAT and NPAIRS.GLM. In order to overcome these limitations, a Java-based fMRI processing pipeline evaluation system was developed. It integrated YALE (a machine learning environment) into Fiswidgets (a fMRI software environment) to obtain system interoperability and applied an algorithm to measure GLM prediction accuracy. The results demonstrated that the system can evaluate fMRI processing pipelines with univariate GLM and multivariate canonical variates analysis (CVA)-based models on real fMRI data based on prediction accuracy (classification accuracy) and statistical parametric image (SPI) reproducibility. In addition, a preliminary study was performed where four fMRI processing pipelines with GLM and CVA modules such as FSL.FEAT and NPAIRS.CVA were evaluated with the system. The results indicated that (1) the system can compare different fMRI processing pipelines with heterogeneous models (NPAIRS.GLM, NPAIRS.CVA and FSL.FEAT) and rank their performance by automatic performance scoring, and (2) the rank of pipeline performance is highly dependent on the preprocessing operations. These results suggest that the system will be of value for the comparison, validation, standardization and optimization of functional neuroimaging software packages and fMRI processing pipelines.

Arginine intake is associated with oxidative stress in a general population.

PubMed

Carvalho, Aline Martins de; Oliveira, Antonio Anax Falcão de; Loureiro, Ana Paula de Melo; Gattás, Gilka Jorge Figaro; Fisberg, Regina Mara; Marchioni, Dirce Maria

2017-01-01

The aim of this study was to assess the association between protein and arginine from meat intake and oxidative stress in a general population. Data came from the Health Survey for Sao Paulo (ISA-Capital), a cross-sectional population-based study in Brazil (N = 549 adults). Food intake was estimated by a 24-h dietary recall. Oxidative stress was estimated by malondialdehyde (MDA) concentration in plasma. Analyses were performed using general linear regression models adjusted for some genetic, lifestyle, and biochemical confounders. MDA levels were associated with meat intake (P for linear trend = 0.031), protein from meat (P for linear trend = 0.006), and arginine from meat (P for linear trend = 0.044) after adjustments for confounders: age, sex, body mass index, smoking, physical activity, intake of fruit and vegetables, energy and heterocyclic amines, C-reactive protein levels, and polymorphisms in GSTM1 (glutathione S-transferase Mu 1) and GSTT1 (glutathione S-transferase theta 1) genes. Results were not significant for total protein and protein from vegetable intake (P > 0.05). High protein and arginine from meat intake were associated with oxidative stress independently of genetic, lifestyle, and biochemical confounders in a population-based study. Our results suggested a novel link between high protein/arginine intake and oxidative stress, which is a major cause of age-related diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

Rank-based methods for modeling dependence between loss triangles.

PubMed

Côté, Marie-Pier; Genest, Christian; Abdallah, Anas

2016-01-01

In order to determine the risk capital for their aggregate portfolio, property and casualty insurance companies must fit a multivariate model to the loss triangle data relating to each of their lines of business. As an inadequate choice of dependence structure may have an undesirable effect on reserve estimation, a two-stage inference strategy is proposed in this paper to assist with model selection and validation. Generalized linear models are first fitted to the margins. Standardized residuals from these models are then linked through a copula selected and validated using rank-based methods. The approach is illustrated with data from six lines of business of a large Canadian insurance company for which two hierarchical dependence models are considered, i.e., a fully nested Archimedean copula structure and a copula-based risk aggregation model.

Derivation and definition of a linear aircraft model

NASA Technical Reports Server (NTRS)

Duke, Eugene L.; Antoniewicz, Robert F.; Krambeer, Keith D.

1988-01-01

A linear aircraft model for a rigid aircraft of constant mass flying over a flat, nonrotating earth is derived and defined. The derivation makes no assumptions of reference trajectory or vehicle symmetry. The linear system equations are derived and evaluated along a general trajectory and include both aircraft dynamics and observation variables.

Mathematical modeling of spinning elastic bodies for modal analysis.

NASA Technical Reports Server (NTRS)

Likins, P. W.; Barbera, F. J.; Baddeley, V.

1973-01-01

The problem of modal analysis of an elastic appendage on a rotating base is examined to establish the relative advantages of various mathematical models of elastic structures and to extract general inferences concerning the magnitude and character of the influence of spin on the natural frequencies and mode shapes of rotating structures. In realization of the first objective, it is concluded that except for a small class of very special cases the elastic continuum model is devoid of useful results, while for constant nominal spin rate the distributed-mass finite-element model is quite generally tractable, since in the latter case the governing equations are always linear, constant-coefficient, ordinary differential equations. Although with both of these alternatives the details of the formulation generally obscure the essence of the problem and permit very little engineering insight to be gained without extensive computation, this difficulty is not encountered when dealing with simple concentrated mass models.

Optimal clinical trial design based on a dichotomous Markov-chain mixed-effect sleep model.

PubMed

Steven Ernest, C; Nyberg, Joakim; Karlsson, Mats O; Hooker, Andrew C

2014-12-01

D-optimal designs for discrete-type responses have been derived using generalized linear mixed models, simulation based methods and analytical approximations for computing the fisher information matrix (FIM) of non-linear mixed effect models with homogeneous probabilities over time. In this work, D-optimal designs using an analytical approximation of the FIM for a dichotomous, non-homogeneous, Markov-chain phase advanced sleep non-linear mixed effect model was investigated. The non-linear mixed effect model consisted of transition probabilities of dichotomous sleep data estimated as logistic functions using piecewise linear functions. Theoretical linear and nonlinear dose effects were added to the transition probabilities to modify the probability of being in either sleep stage. D-optimal designs were computed by determining an analytical approximation the FIM for each Markov component (one where the previous state was awake and another where the previous state was asleep). Each Markov component FIM was weighted either equally or by the average probability of response being awake or asleep over the night and summed to derive the total FIM (FIM(total)). The reference designs were placebo, 0.1, 1-, 6-, 10- and 20-mg dosing for a 2- to 6-way crossover study in six dosing groups. Optimized design variables were dose and number of subjects in each dose group. The designs were validated using stochastic simulation/re-estimation (SSE). Contrary to expectations, the predicted parameter uncertainty obtained via FIM(total) was larger than the uncertainty in parameter estimates computed by SSE. Nevertheless, the D-optimal designs decreased the uncertainty of parameter estimates relative to the reference designs. Additionally, the improvement for the D-optimal designs were more pronounced using SSE than predicted via FIM(total). Through the use of an approximate analytic solution and weighting schemes, the FIM(total) for a non-homogeneous, dichotomous Markov-chain phase advanced sleep model was computed and provided more efficient trial designs and increased nonlinear mixed-effects modeling parameter precision.

Novel hybrid linear stochastic with non-linear extreme learning machine methods for forecasting monthly rainfall a tropical climate.

PubMed

Zeynoddin, Mohammad; Bonakdari, Hossein; Azari, Arash; Ebtehaj, Isa; Gharabaghi, Bahram; Riahi Madavar, Hossein

2018-09-15

A novel hybrid approach is presented that can more accurately predict monthly rainfall in a tropical climate by integrating a linear stochastic model with a powerful non-linear extreme learning machine method. This new hybrid method was then evaluated by considering four general scenarios. In the first scenario, the modeling process is initiated without preprocessing input data as a base case. While in other three scenarios, the one-step and two-step procedures are utilized to make the model predictions more precise. The mentioned scenarios are based on a combination of stationarization techniques (i.e., differencing, seasonal and non-seasonal standardization and spectral analysis), and normality transforms (i.e., Box-Cox, John and Draper, Yeo and Johnson, Johnson, Box-Cox-Mod, log, log standard, and Manly). In scenario 2, which is a one-step scenario, the stationarization methods are employed as preprocessing approaches. In scenario 3 and 4, different combinations of normality transform, and stationarization methods are considered as preprocessing techniques. In total, 61 sub-scenarios are evaluated resulting 11013 models (10785 linear methods, 4 nonlinear models, and 224 hybrid models are evaluated). The uncertainty of the linear, nonlinear and hybrid models are examined by Monte Carlo technique. The best preprocessing technique is the utilization of Johnson normality transform and seasonal standardization (respectively) (R 2  = 0.99; RMSE = 0.6; MAE = 0.38; RMSRE = 0.1, MARE = 0.06, UI = 0.03 &UII = 0.05). The results of uncertainty analysis indicated the good performance of proposed technique (d-factor = 0.27; 95PPU = 83.57). Moreover, the results of the proposed methodology in this study were compared with an evolutionary hybrid of adaptive neuro fuzzy inference system (ANFIS) with firefly algorithm (ANFIS-FFA) demonstrating that the new hybrid methods outperformed ANFIS-FFA method. Copyright © 2018 Elsevier Ltd. All rights reserved.

Towards a General Turbulence Model for Planetary Boundary Layers Based on Direct Statistical Simulation

NASA Astrophysics Data System (ADS)

Skitka, J.; Marston, B.; Fox-Kemper, B.

2016-02-01

Sub-grid turbulence models for planetary boundary layers are typically constructed additively, starting with local flow properties and including non-local (KPP) or higher order (Mellor-Yamada) parameters until a desired level of predictive capacity is achieved or a manageable threshold of complexity is surpassed. Such approaches are necessarily limited in general circumstances, like global circulation models, by their being optimized for particular flow phenomena. By building a model reductively, starting with the infinite hierarchy of turbulence statistics, truncating at a given order, and stripping degrees of freedom from the flow, we offer the prospect a turbulence model and investigative tool that is equally applicable to all flow types and able to take full advantage of the wealth of nonlocal information in any flow. Direct statistical simulation (DSS) that is based upon expansion in equal-time cumulants can be used to compute flow statistics of arbitrary order. We investigate the feasibility of a second-order closure (CE2) by performing simulations of the ocean boundary layer in a quasi-linear approximation for which CE2 is exact. As oceanographic examples, wind-driven Langmuir turbulence and thermal convection are studied by comparison of the quasi-linear and fully nonlinear statistics. We also characterize the computational advantages and physical uncertainties of CE2 defined on a reduced basis determined via proper orthogonal decomposition (POD) of the flow fields.

PRESS-based EFOR algorithm for the dynamic parametrical modeling of nonlinear MDOF systems

NASA Astrophysics Data System (ADS)

Liu, Haopeng; Zhu, Yunpeng; Luo, Zhong; Han, Qingkai

2017-09-01

In response to the identification problem concerning multi-degree of freedom (MDOF) nonlinear systems, this study presents the extended forward orthogonal regression (EFOR) based on predicted residual sums of squares (PRESS) to construct a nonlinear dynamic parametrical model. The proposed parametrical model is based on the non-linear autoregressive with exogenous inputs (NARX) model and aims to explicitly reveal the physical design parameters of the system. The PRESS-based EFOR algorithm is proposed to identify such a model for MDOF systems. By using the algorithm, we built a common-structured model based on the fundamental concept of evaluating its generalization capability through cross-validation. The resulting model aims to prevent over-fitting with poor generalization performance caused by the average error reduction ratio (AERR)-based EFOR algorithm. Then, a functional relationship is established between the coefficients of the terms and the design parameters of the unified model. Moreover, a 5-DOF nonlinear system is taken as a case to illustrate the modeling of the proposed algorithm. Finally, a dynamic parametrical model of a cantilever beam is constructed from experimental data. Results indicate that the dynamic parametrical model of nonlinear systems, which depends on the PRESS-based EFOR, can accurately predict the output response, thus providing a theoretical basis for the optimal design of modeling methods for MDOF nonlinear systems.

Non-linear eigensolver-based alternative to traditional SCF methods

NASA Astrophysics Data System (ADS)

Gavin, B.; Polizzi, E.

2013-05-01

The self-consistent procedure in electronic structure calculations is revisited using a highly efficient and robust algorithm for solving the non-linear eigenvector problem, i.e., H({ψ})ψ = Eψ. This new scheme is derived from a generalization of the FEAST eigenvalue algorithm to account for the non-linearity of the Hamiltonian with the occupied eigenvectors. Using a series of numerical examples and the density functional theory-Kohn/Sham model, it will be shown that our approach can outperform the traditional SCF mixing-scheme techniques by providing a higher converge rate, convergence to the correct solution regardless of the choice of the initial guess, and a significant reduction of the eigenvalue solve time in simulations.

Phylogenetic mixtures and linear invariants for equal input models.

PubMed

Casanellas, Marta; Steel, Mike

2017-04-01

The reconstruction of phylogenetic trees from molecular sequence data relies on modelling site substitutions by a Markov process, or a mixture of such processes. In general, allowing mixed processes can result in different tree topologies becoming indistinguishable from the data, even for infinitely long sequences. However, when the underlying Markov process supports linear phylogenetic invariants, then provided these are sufficiently informative, the identifiability of the tree topology can be restored. In this paper, we investigate a class of processes that support linear invariants once the stationary distribution is fixed, the 'equal input model'. This model generalizes the 'Felsenstein 1981' model (and thereby the Jukes-Cantor model) from four states to an arbitrary number of states (finite or infinite), and it can also be described by a 'random cluster' process. We describe the structure and dimension of the vector spaces of phylogenetic mixtures and of linear invariants for any fixed phylogenetic tree (and for all trees-the so called 'model invariants'), on any number n of leaves. We also provide a precise description of the space of mixtures and linear invariants for the special case of [Formula: see text] leaves. By combining techniques from discrete random processes and (multi-) linear algebra, our results build on a classic result that was first established by James Lake (Mol Biol Evol 4:167-191, 1987).

Node-Splitting Generalized Linear Mixed Models for Evaluation of Inconsistency in Network Meta-Analysis.

PubMed

Yu-Kang, Tu

2016-12-01

Network meta-analysis for multiple treatment comparisons has been a major development in evidence synthesis methodology. The validity of a network meta-analysis, however, can be threatened by inconsistency in evidence within the network. One particular issue of inconsistency is how to directly evaluate the inconsistency between direct and indirect evidence with regard to the effects difference between two treatments. A Bayesian node-splitting model was first proposed and a similar frequentist side-splitting model has been put forward recently. Yet, assigning the inconsistency parameter to one or the other of the two treatments or splitting the parameter symmetrically between the two treatments can yield different results when multi-arm trials are involved in the evaluation. We aimed to show that a side-splitting model can be viewed as a special case of design-by-treatment interaction model, and different parameterizations correspond to different design-by-treatment interactions. We demonstrated how to evaluate the side-splitting model using the arm-based generalized linear mixed model, and an example data set was used to compare results from the arm-based models with those from the contrast-based models. The three parameterizations of side-splitting make slightly different assumptions: the symmetrical method assumes that both treatments in a treatment contrast contribute to inconsistency between direct and indirect evidence, whereas the other two parameterizations assume that only one of the two treatments contributes to this inconsistency. With this understanding in mind, meta-analysts can then make a choice about how to implement the side-splitting method for their analysis. Copyright © 2016 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

MULTIVARIATE LINEAR MIXED MODELS FOR MULTIPLE OUTCOMES. (R824757)

EPA Science Inventory

We propose a multivariate linear mixed (MLMM) for the analysis of multiple outcomes, which generalizes the latent variable model of Sammel and Ryan. The proposed model assumes a flexible correlation structure among the multiple outcomes, and allows a global test of the impact of ...

Consequences of synergy between environmental carcinogens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berenbaum, M.C.

1985-12-01

As it is generally impossible to determine dose-response relationships for carcinogens at the low concentrations in which they occur in the environment, risk-benefit considerations are by consensus based on the linear, no-threshold model, on the assumption that this represents the worst case. However, this assumption does not take into account the possibility of synergistic interactions between carcinogens. It is shown here that, as a result of such interactions, the dose-response curve for added risk due to any individual carcinogen will generally be steeper at lower doses than at higher doses, and consequently the risk at low environmental levels will bemore » higher than would be expected from a linear response. Moreover, this excess risk at low doses is shown to increase as the general level of environmental carcinogens rises and, independently of this effect, it may also increase with the number of carcinogens present.« less

Structure formation in nonlocal MOND

NASA Astrophysics Data System (ADS)

Tan, L.; Woodard, R. P.

2018-05-01

We consider structure formation in a nonlocal, metric-based realization of Milgrom's MOdified Newtonian Dynamics (MOND). We derive the general equations for linearized scalar perturbations about the ΛCDM expansion history. These equations are considerably simplified for sub-horizon modes, and it becomes obvious (in this model) that the MOND enhancement is not sufficient to allow ordinary matter to drive structure formation. We discuss ways in which the model might be changed to correct the problem.

A three operator split-step method covering a larger set of non-linear partial differential equations

NASA Astrophysics Data System (ADS)

Zia, Haider

2017-06-01

This paper describes an updated exponential Fourier based split-step method that can be applied to a greater class of partial differential equations than previous methods would allow. These equations arise in physics and engineering, a notable example being the generalized derivative non-linear Schrödinger equation that arises in non-linear optics with self-steepening terms. These differential equations feature terms that were previously inaccessible to model accurately with low computational resources. The new method maintains a 3rd order error even with these additional terms and models the equation in all three spatial dimensions and time. The class of non-linear differential equations that this method applies to is shown. The method is fully derived and implementation of the method in the split-step architecture is shown. This paper lays the mathematical ground work for an upcoming paper employing this method in white-light generation simulations in bulk material.

Non-linear corrections to the time-covariance function derived from a multi-state chemical master equation.

PubMed

Scott, M

2012-08-01

The time-covariance function captures the dynamics of biochemical fluctuations and contains important information about the underlying kinetic rate parameters. Intrinsic fluctuations in biochemical reaction networks are typically modelled using a master equation formalism. In general, the equation cannot be solved exactly and approximation methods are required. For small fluctuations close to equilibrium, a linearisation of the dynamics provides a very good description of the relaxation of the time-covariance function. As the number of molecules in the system decrease, deviations from the linear theory appear. Carrying out a systematic perturbation expansion of the master equation to capture these effects results in formidable algebra; however, symbolic mathematics packages considerably expedite the computation. The authors demonstrate that non-linear effects can reveal features of the underlying dynamics, such as reaction stoichiometry, not available in linearised theory. Furthermore, in models that exhibit noise-induced oscillations, non-linear corrections result in a shift in the base frequency along with the appearance of a secondary harmonic.

Effective Use of Multimedia Presentations to Maximize Learning within High School Science Classrooms

ERIC Educational Resources Information Center

Rapp, Eric

2013-01-01

This research used an evidenced-based experimental 2 x 2 factorial design General Linear Model with Repeated Measures Analysis of Covariance (RMANCOVA). For this analysis, time served as the within-subjects factor while treatment group (i.e., static and signaling, dynamic and signaling, static without signaling, and dynamic without signaling)…

Circuit-based versus full-wave modelling of active microwave circuits

NASA Astrophysics Data System (ADS)

Bukvić, Branko; Ilić, Andjelija Ž.; Ilić, Milan M.

2018-03-01

Modern full-wave computational tools enable rigorous simulations of linear parts of complex microwave circuits within minutes, taking into account all physical electromagnetic (EM) phenomena. Non-linear components and other discrete elements of the hybrid microwave circuit are then easily added within the circuit simulator. This combined full-wave and circuit-based analysis is a must in the final stages of the circuit design, although initial designs and optimisations are still faster and more comfortably done completely in the circuit-based environment, which offers real-time solutions at the expense of accuracy. However, due to insufficient information and general lack of specific case studies, practitioners still struggle when choosing an appropriate analysis method, or a component model, because different choices lead to different solutions, often with uncertain accuracy and unexplained discrepancies arising between the simulations and measurements. We here design a reconfigurable power amplifier, as a case study, using both circuit-based solver and a full-wave EM solver. We compare numerical simulations with measurements on the manufactured prototypes, discussing the obtained differences, pointing out the importance of measured parameters de-embedding, appropriate modelling of discrete components and giving specific recipes for good modelling practices.

Estimation of median growth curves for children up two years old based on biresponse local linear estimator

NASA Astrophysics Data System (ADS)

Chamidah, Nur; Rifada, Marisa

2016-03-01

There is significant of the coeficient correlation between weight and height of the children. Therefore, the simultaneous model estimation is better than partial single response approach. In this study we investigate the pattern of sex difference in growth curve of children from birth up to two years of age in Surabaya, Indonesia based on biresponse model. The data was collected in a longitudinal representative sample of the Surabaya population of healthy children that consists of two response variables i.e. weight (kg) and height (cm). While a predictor variable is age (month). Based on generalized cross validation criterion, the modeling result based on biresponse model by using local linear estimator for boy and girl growth curve gives optimal bandwidth i.e 1.41 and 1.56 and the determination coefficient (R2) i.e. 99.99% and 99.98%,.respectively. Both boy and girl curves satisfy the goodness of fit criterion i.e..the determination coefficient tends to one. Also, there is difference pattern of growth curve between boy and girl. The boy median growth curves is higher than those of girl curve.

Linear-time general decoding algorithm for the surface code

NASA Astrophysics Data System (ADS)

Darmawan, Andrew S.; Poulin, David

2018-05-01

A quantum error correcting protocol can be substantially improved by taking into account features of the physical noise process. We present an efficient decoder for the surface code which can account for general noise features, including coherences and correlations. We demonstrate that the decoder significantly outperforms the conventional matching algorithm on a variety of noise models, including non-Pauli noise and spatially correlated noise. The algorithm is based on an approximate calculation of the logical channel using a tensor-network description of the noisy state.

Analytical modelling of Halbach linear generator incorporating pole shifting and piece-wise spring for ocean wave energy harvesting

NASA Astrophysics Data System (ADS)

Tan, Yimin; Lin, Kejian; Zu, Jean W.

2018-05-01

Halbach permanent magnet (PM) array has attracted tremendous research attention in the development of electromagnetic generators for its unique properties. This paper has proposed a generalized analytical model for linear generators. The slotted stator pole-shifting and implementation of Halbach array have been combined for the first time. Initially, the magnetization components of the Halbach array have been determined using Fourier decomposition. Then, based on the magnetic scalar potential method, the magnetic field distribution has been derived employing specially treated boundary conditions. FEM analysis has been conducted to verify the analytical model. A slotted linear PM generator with Halbach PM has been constructed to validate the model and further improved using piece-wise springs to trigger full range reciprocating motion. A dynamic model has been developed to characterize the dynamic behavior of the slider. This analytical method provides an effective tool in development and optimization of Halbach PM generator. The experimental results indicate that piece-wise springs can be employed to improve generator performance under low excitation frequency.

Validating the applicability of the GUM procedure

NASA Astrophysics Data System (ADS)

Cox, Maurice G.; Harris, Peter M.

2014-08-01

This paper is directed at practitioners seeking a degree of assurance in the quality of the results of an uncertainty evaluation when using the procedure in the Guide to the Expression of Uncertainty in Measurement (GUM) (JCGM 100 : 2008). Such assurance is required in adhering to general standards such as International Standard ISO/IEC 17025 or other sector-specific standards. We investigate the extent to which such assurance can be given. For many practical cases, a measurement result incorporating an evaluated uncertainty that is correct to one significant decimal digit would be acceptable. Any quantification of the numerical precision of an uncertainty statement is naturally relative to the adequacy of the measurement model and the knowledge used of the quantities in that model. For general univariate and multivariate measurement models, we emphasize the use of a Monte Carlo method, as recommended in GUM Supplements 1 and 2. One use of this method is as a benchmark in terms of which measurement results provided by the GUM can be assessed in any particular instance. We mainly consider measurement models that are linear in the input quantities, or have been linearized and the linearization process is deemed to be adequate. When the probability distributions for those quantities are independent, we indicate the use of other approaches such as convolution methods based on the fast Fourier transform and, particularly, Chebyshev polynomials as benchmarks.

Estimation of Quasi-Stiffness of the Human Hip in the Stance Phase of Walking

PubMed Central

Shamaei, Kamran; Sawicki, Gregory S.; Dollar, Aaron M.

2013-01-01

This work presents a framework for selection of subject-specific quasi-stiffness of hip orthoses and exoskeletons, and other devices that are intended to emulate the biological performance of this joint during walking. The hip joint exhibits linear moment-angular excursion behavior in both the extension and flexion stages of the resilient loading-unloading phase that consists of terminal stance and initial swing phases. Here, we establish statistical models that can closely estimate the slope of linear fits to the moment-angle graph of the hip in this phase, termed as the quasi-stiffness of the hip. Employing an inverse dynamics analysis, we identify a series of parameters that can capture the nearly linear hip quasi-stiffnesses in the resilient loading phase. We then employ regression analysis on experimental moment-angle data of 216 gait trials across 26 human adults walking over a wide range of gait speeds (0.75–2.63 m/s) to obtain a set of general-form statistical models that estimate the hip quasi-stiffnesses using body weight and height, gait speed, and hip excursion. We show that the general-form models can closely estimate the hip quasi-stiffness in the extension (R2 = 92%) and flexion portions (R2 = 89%) of the resilient loading phase of the gait. We further simplify the general-form models and present a set of stature-based models that can estimate the hip quasi-stiffness for the preferred gait speed using only body weight and height with an average error of 27% for the extension stage and 37% for the flexion stage. PMID:24349136

Online Statistical Modeling (Regression Analysis) for Independent Responses

NASA Astrophysics Data System (ADS)

Made Tirta, I.; Anggraeni, Dian; Pandutama, Martinus

2017-06-01

Regression analysis (statistical analmodelling) are among statistical methods which are frequently needed in analyzing quantitative data, especially to model relationship between response and explanatory variables. Nowadays, statistical models have been developed into various directions to model various type and complex relationship of data. Rich varieties of advanced and recent statistical modelling are mostly available on open source software (one of them is R). However, these advanced statistical modelling, are not very friendly to novice R users, since they are based on programming script or command line interface. Our research aims to developed web interface (based on R and shiny), so that most recent and advanced statistical modelling are readily available, accessible and applicable on web. We have previously made interface in the form of e-tutorial for several modern and advanced statistical modelling on R especially for independent responses (including linear models/LM, generalized linier models/GLM, generalized additive model/GAM and generalized additive model for location scale and shape/GAMLSS). In this research we unified them in the form of data analysis, including model using Computer Intensive Statistics (Bootstrap and Markov Chain Monte Carlo/ MCMC). All are readily accessible on our online Virtual Statistics Laboratory. The web (interface) make the statistical modeling becomes easier to apply and easier to compare them in order to find the most appropriate model for the data.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grenon, Cedric; Lake, Kayll

We generalize the Swiss-cheese cosmologies so as to include nonzero linear momenta of the associated boundary surfaces. The evolution of mass scales in these generalized cosmologies is studied for a variety of models for the background without having to specify any details within the local inhomogeneities. We find that the final effective gravitational mass and size of the evolving inhomogeneities depends on their linear momenta but these properties are essentially unaffected by the details of the background model.

Kernel-imbedded Gaussian processes for disease classification using microarray gene expression data

PubMed Central

Zhao, Xin; Cheung, Leo Wang-Kit

2007-01-01

Background Designing appropriate machine learning methods for identifying genes that have a significant discriminating power for disease outcomes has become more and more important for our understanding of diseases at genomic level. Although many machine learning methods have been developed and applied to the area of microarray gene expression data analysis, the majority of them are based on linear models, which however are not necessarily appropriate for the underlying connection between the target disease and its associated explanatory genes. Linear model based methods usually also bring in false positive significant features more easily. Furthermore, linear model based algorithms often involve calculating the inverse of a matrix that is possibly singular when the number of potentially important genes is relatively large. This leads to problems of numerical instability. To overcome these limitations, a few non-linear methods have recently been introduced to the area. Many of the existing non-linear methods have a couple of critical problems, the model selection problem and the model parameter tuning problem, that remain unsolved or even untouched. In general, a unified framework that allows model parameters of both linear and non-linear models to be easily tuned is always preferred in real-world applications. Kernel-induced learning methods form a class of approaches that show promising potentials to achieve this goal. Results A hierarchical statistical model named kernel-imbedded Gaussian process (KIGP) is developed under a unified Bayesian framework for binary disease classification problems using microarray gene expression data. In particular, based on a probit regression setting, an adaptive algorithm with a cascading structure is designed to find the appropriate kernel, to discover the potentially significant genes, and to make the optimal class prediction accordingly. A Gibbs sampler is built as the core of the algorithm to make Bayesian inferences. Simulation studies showed that, even without any knowledge of the underlying generative model, the KIGP performed very close to the theoretical Bayesian bound not only in the case with a linear Bayesian classifier but also in the case with a very non-linear Bayesian classifier. This sheds light on its broader usability to microarray data analysis problems, especially to those that linear methods work awkwardly. The KIGP was also applied to four published microarray datasets, and the results showed that the KIGP performed better than or at least as well as any of the referred state-of-the-art methods did in all of these cases. Conclusion Mathematically built on the kernel-induced feature space concept under a Bayesian framework, the KIGP method presented in this paper provides a unified machine learning approach to explore both the linear and the possibly non-linear underlying relationship between the target features of a given binary disease classification problem and the related explanatory gene expression data. More importantly, it incorporates the model parameter tuning into the framework. The model selection problem is addressed in the form of selecting a proper kernel type. The KIGP method also gives Bayesian probabilistic predictions for disease classification. These properties and features are beneficial to most real-world applications. The algorithm is naturally robust in numerical computation. The simulation studies and the published data studies demonstrated that the proposed KIGP performs satisfactorily and consistently. PMID:17328811

Couple stress theory of curved rods. 2-D, high order, Timoshenko's and Euler-Bernoulli models

NASA Astrophysics Data System (ADS)

Zozulya, V. V.

2017-01-01

New models for plane curved rods based on linear couple stress theory of elasticity have been developed.2-D theory is developed from general 2-D equations of linear couple stress elasticity using a special curvilinear system of coordinates related to the middle line of the rod as well as special hypothesis based on assumptions that take into account the fact that the rod is thin. High order theory is based on the expansion of the equations of the theory of elasticity into Fourier series in terms of Legendre polynomials. First, stress and strain tensors, vectors of displacements and rotation along with body forces have been expanded into Fourier series in terms of Legendre polynomials with respect to a thickness coordinate.Thereby, all equations of elasticity including Hooke's law have been transformed to the corresponding equations for Fourier coefficients. Then, in the same way as in the theory of elasticity, a system of differential equations in terms of displacements and boundary conditions for Fourier coefficients have been obtained. Timoshenko's and Euler-Bernoulli theories are based on the classical hypothesis and the 2-D equations of linear couple stress theory of elasticity in a special curvilinear system. The obtained equations can be used to calculate stress-strain and to model thin walled structures in macro, micro and nano scales when taking into account couple stress and rotation effects.

Statistical downscaling of precipitation using long short-term memory recurrent neural networks

NASA Astrophysics Data System (ADS)

Misra, Saptarshi; Sarkar, Sudeshna; Mitra, Pabitra

2017-11-01

Hydrological impacts of global climate change on regional scale are generally assessed by downscaling large-scale climatic variables, simulated by General Circulation Models (GCMs), to regional, small-scale hydrometeorological variables like precipitation, temperature, etc. In this study, we propose a new statistical downscaling model based on Recurrent Neural Network with Long Short-Term Memory which captures the spatio-temporal dependencies in local rainfall. The previous studies have used several other methods such as linear regression, quantile regression, kernel regression, beta regression, and artificial neural networks. Deep neural networks and recurrent neural networks have been shown to be highly promising in modeling complex and highly non-linear relationships between input and output variables in different domains and hence we investigated their performance in the task of statistical downscaling. We have tested this model on two datasets—one on precipitation in Mahanadi basin in India and the second on precipitation in Campbell River basin in Canada. Our autoencoder coupled long short-term memory recurrent neural network model performs the best compared to other existing methods on both the datasets with respect to temporal cross-correlation, mean squared error, and capturing the extremes.

Modeling the frequency of opposing left-turn conflicts at signalized intersections using generalized linear regression models.

PubMed

Zhang, Xin; Liu, Pan; Chen, Yuguang; Bai, Lu; Wang, Wei

2014-01-01

The primary objective of this study was to identify whether the frequency of traffic conflicts at signalized intersections can be modeled. The opposing left-turn conflicts were selected for the development of conflict predictive models. Using data collected at 30 approaches at 20 signalized intersections, the underlying distributions of the conflicts under different traffic conditions were examined. Different conflict-predictive models were developed to relate the frequency of opposing left-turn conflicts to various explanatory variables. The models considered include a linear regression model, a negative binomial model, and separate models developed for four traffic scenarios. The prediction performance of different models was compared. The frequency of traffic conflicts follows a negative binominal distribution. The linear regression model is not appropriate for the conflict frequency data. In addition, drivers behaved differently under different traffic conditions. Accordingly, the effects of conflicting traffic volumes on conflict frequency vary across different traffic conditions. The occurrences of traffic conflicts at signalized intersections can be modeled using generalized linear regression models. The use of conflict predictive models has potential to expand the uses of surrogate safety measures in safety estimation and evaluation.

Leveraging prognostic baseline variables to gain precision in randomized trials

PubMed Central

Colantuoni, Elizabeth; Rosenblum, Michael

2015-01-01

We focus on estimating the average treatment effect in a randomized trial. If baseline variables are correlated with the outcome, then appropriately adjusting for these variables can improve precision. An example is the analysis of covariance (ANCOVA) estimator, which applies when the outcome is continuous, the quantity of interest is the difference in mean outcomes comparing treatment versus control, and a linear model with only main effects is used. ANCOVA is guaranteed to be at least as precise as the standard unadjusted estimator, asymptotically, under no parametric model assumptions and also is locally semiparametric efficient. Recently, several estimators have been developed that extend these desirable properties to more general settings that allow any real-valued outcome (e.g., binary or count), contrasts other than the difference in mean outcomes (such as the relative risk), and estimators based on a large class of generalized linear models (including logistic regression). To the best of our knowledge, we give the first simulation study in the context of randomized trials that compares these estimators. Furthermore, our simulations are not based on parametric models; instead, our simulations are based on resampling data from completed randomized trials in stroke and HIV in order to assess estimator performance in realistic scenarios. We provide practical guidance on when these estimators are likely to provide substantial precision gains and describe a quick assessment method that allows clinical investigators to determine whether these estimators could be useful in their specific trial contexts. PMID:25872751

Response statistics of rotating shaft with non-linear elastic restoring forces by path integration

NASA Astrophysics Data System (ADS)

Gaidai, Oleg; Naess, Arvid; Dimentberg, Michael

2017-07-01

Extreme statistics of random vibrations is studied for a Jeffcott rotor under uniaxial white noise excitation. Restoring force is modelled as elastic non-linear; comparison is done with linearized restoring force to see the force non-linearity effect on the response statistics. While for the linear model analytical solutions and stability conditions are available, it is not generally the case for non-linear system except for some special cases. The statistics of non-linear case is studied by applying path integration (PI) method, which is based on the Markov property of the coupled dynamic system. The Jeffcott rotor response statistics can be obtained by solving the Fokker-Planck (FP) equation of the 4D dynamic system. An efficient implementation of PI algorithm is applied, namely fast Fourier transform (FFT) is used to simulate dynamic system additive noise. The latter allows significantly reduce computational time, compared to the classical PI. Excitation is modelled as Gaussian white noise, however any kind distributed white noise can be implemented with the same PI technique. Also multidirectional Markov noise can be modelled with PI in the same way as unidirectional. PI is accelerated by using Monte Carlo (MC) estimated joint probability density function (PDF) as initial input. Symmetry of dynamic system was utilized to afford higher mesh resolution. Both internal (rotating) and external damping are included in mechanical model of the rotor. The main advantage of using PI rather than MC is that PI offers high accuracy in the probability distribution tail. The latter is of critical importance for e.g. extreme value statistics, system reliability, and first passage probability.

A tensor approach to modeling of nonhomogeneous nonlinear systems

NASA Technical Reports Server (NTRS)

Yurkovich, S.; Sain, M.

1980-01-01

Model following control methodology plays a key role in numerous application areas. Cases in point include flight control systems and gas turbine engine control systems. Typical uses of such a design strategy involve the determination of nonlinear models which generate requested control and response trajectories for various commands. Linear multivariable techniques provide trim about these motions; and protection logic is added to secure the hardware from excursions beyond the specification range. This paper reports upon experience in developing a general class of such nonlinear models based upon the idea of the algebraic tensor product.

Theoretical foundations of apparent-damping phenomena and nearly irreversible energy exchange in linear conservative systems.

PubMed

Carcaterra, A; Akay, A

2007-04-01

This paper discusses a class of unexpected irreversible phenomena that can develop in linear conservative systems and provides a theoretical foundation that explains the underlying principles. Recent studies have shown that energy can be introduced to a linear system with near irreversibility, or energy within a system can migrate to a subsystem nearly irreversibly, even in the absence of dissipation, provided that the system has a particular natural frequency distribution. The present work introduces a general theory that provides a mathematical foundation and a physical explanation for the near irreversibility phenomena observed and reported in previous publications. Inspired by the properties of probability distribution functions, the general formulation developed here is based on particular properties of harmonic series, which form the common basis of linear dynamic system models. The results demonstrate the existence of a special class of linear nondissipative dynamic systems that exhibit nearly irreversible energy exchange and possess a decaying impulse response. In addition to uncovering a new class of dynamic system properties, the results have far-reaching implications in engineering applications where classical vibration damping or absorption techniques may not be effective. Furthermore, the results also support the notion of nearly irreversible energy transfer in conservative linear systems, which until now has been a concept associated exclusively with nonlinear systems.

A Linear Variable-[theta] Model for Measuring Individual Differences in Response Precision

ERIC Educational Resources Information Center

Ferrando, Pere J.

2011-01-01

Models for measuring individual response precision have been proposed for binary and graded responses. However, more continuous formats are quite common in personality measurement and are usually analyzed with the linear factor analysis model. This study extends the general Gaussian person-fluctuation model to the continuous-response case and…

A parabolic model of drag coefficient for storm surge simulation in the South China Sea

PubMed Central

Peng, Shiqiu; Li, Yineng

2015-01-01

Drag coefficient (Cd) is an essential metric in the calculation of momentum exchange over the air-sea interface and thus has large impacts on the simulation or forecast of the upper ocean state associated with sea surface winds such as storm surges. Generally, Cd is a function of wind speed. However, the exact relationship between Cd and wind speed is still in dispute, and the widely-used formula that is a linear function of wind speed in an ocean model could lead to large bias at high wind speed. Here we establish a parabolic model of Cd based on storm surge observations and simulation in the South China Sea (SCS) through a number of tropical cyclone cases. Simulation of storm surges for independent Tropical cyclones (TCs) cases indicates that the new parabolic model of Cd outperforms traditional linear models. PMID:26499262

A parabolic model of drag coefficient for storm surge simulation in the South China Sea.

PubMed

Peng, Shiqiu; Li, Yineng

2015-10-26

Drag coefficient (Cd) is an essential metric in the calculation of momentum exchange over the air-sea interface and thus has large impacts on the simulation or forecast of the upper ocean state associated with sea surface winds such as storm surges. Generally, Cd is a function of wind speed. However, the exact relationship between Cd and wind speed is still in dispute, and the widely-used formula that is a linear function of wind speed in an ocean model could lead to large bias at high wind speed. Here we establish a parabolic model of Cd based on storm surge observations and simulation in the South China Sea (SCS) through a number of tropical cyclone cases. Simulation of storm surges for independent Tropical cyclones (TCs) cases indicates that the new parabolic model of Cd outperforms traditional linear models.

A parabolic model of drag coefficient for storm surge simulation in the South China Sea

NASA Astrophysics Data System (ADS)

Peng, Shiqiu; Li, Yineng

2015-10-01

Drag coefficient (Cd) is an essential metric in the calculation of momentum exchange over the air-sea interface and thus has large impacts on the simulation or forecast of the upper ocean state associated with sea surface winds such as storm surges. Generally, Cd is a function of wind speed. However, the exact relationship between Cd and wind speed is still in dispute, and the widely-used formula that is a linear function of wind speed in an ocean model could lead to large bias at high wind speed. Here we establish a parabolic model of Cd based on storm surge observations and simulation in the South China Sea (SCS) through a number of tropical cyclone cases. Simulation of storm surges for independent Tropical cyclones (TCs) cases indicates that the new parabolic model of Cd outperforms traditional linear models.

Generalized Path Analysis and Generalized Simultaneous Equations Model for Recursive Systems with Responses of Mixed Types

ERIC Educational Resources Information Center

Tsai, Tien-Lung; Shau, Wen-Yi; Hu, Fu-Chang

2006-01-01

This article generalizes linear path analysis (PA) and simultaneous equations models (SiEM) to deal with mixed responses of different types in a recursive or triangular system. An efficient instrumental variable (IV) method for estimating the structural coefficients of a 2-equation partially recursive generalized path analysis (GPA) model and…

Statistical inference for template aging

NASA Astrophysics Data System (ADS)

Schuckers, Michael E.

2006-04-01

A change in classification error rates for a biometric device is often referred to as template aging. Here we offer two methods for determining whether the effect of time is statistically significant. The first of these is the use of a generalized linear model to determine if these error rates change linearly over time. This approach generalizes previous work assessing the impact of covariates using generalized linear models. The second approach uses of likelihood ratio tests methodology. The focus here is on statistical methods for estimation not the underlying cause of the change in error rates over time. These methodologies are applied to data from the National Institutes of Standards and Technology Biometric Score Set Release 1. The results of these applications are discussed.

A differential equation for the Generalized Born radii.

PubMed

Fogolari, Federico; Corazza, Alessandra; Esposito, Gennaro

2013-06-28

The Generalized Born (GB) model offers a convenient way of representing electrostatics in complex macromolecules like proteins or nucleic acids. The computation of atomic GB radii is currently performed by different non-local approaches involving volume or surface integrals. Here we obtain a non-linear second-order partial differential equation for the Generalized Born radius, which may be solved using local iterative algorithms. The equation is derived under the assumption that the usual GB approximation to the reaction field obeys Laplace's equation. The equation admits as particular solutions the correct GB radii for the sphere and the plane. The tests performed on a set of 55 different proteins show an overall agreement with other reference GB models and "perfect" Poisson-Boltzmann based values.

New nonlinear control algorithms for multiple robot arms

NASA Technical Reports Server (NTRS)

Tarn, T. J.; Bejczy, A. K.; Yun, X.

1988-01-01

Multiple coordinated robot arms are modeled by considering the arms as closed kinematic chains and as a force-constrained mechanical system working on the same object simultaneously. In both formulations, a novel dynamic control method is discussed. It is based on feedback linearization and simultaneous output decoupling technique. By applying a nonlinear feedback and a nonlinear coordinate transformation, the complicated model of the multiple robot arms in either formulation is converted into a linear and output decoupled system. The linear system control theory and optimal control theory are used to design robust controllers in the task space. The first formulation has the advantage of automatically handling the coordination and load distribution among the robot arms. In the second formulation, it was found that by choosing a general output equation it became possible simultaneously to superimpose the position and velocity error feedback with the force-torque error feedback in the task space.

Viscoelastic Properties of Human Tracheal Tissues.

PubMed

Safshekan, Farzaneh; Tafazzoli-Shadpour, Mohammad; Abdouss, Majid; Shadmehr, Mohammad B

2017-01-01

The physiological performance of trachea is highly dependent on its mechanical behavior, and therefore, the mechanical properties of its components. Mechanical characterization of trachea is key to succeed in new treatments such as tissue engineering, which requires the utilization of scaffolds which are mechanically compatible with the native human trachea. In this study, after isolating human trachea samples from brain-dead cases and proper storage, we assessed the viscoelastic properties of tracheal cartilage, smooth muscle, and connective tissue based on stress relaxation tests (at 5% and 10% strains for cartilage and 20%, 30%, and 40% for smooth muscle and connective tissue). After investigation of viscoelastic linearity, constitutive models including Prony series for linear viscoelasticity and quasi-linear viscoelastic, modified superposition, and Schapery models for nonlinear viscoelasticity were fitted to the experimental data to find the best model for each tissue. We also investigated the effect of age on the viscoelastic behavior of tracheal tissues. Based on the results, all three tissues exhibited a (nonsignificant) decrease in relaxation rate with increasing the strain, indicating viscoelastic nonlinearity which was most evident for cartilage and with the least effect for connective tissue. The three-term Prony model was selected for describing the linear viscoelasticity. Among different models, the modified superposition model was best able to capture the relaxation behavior of the three tracheal components. We observed a general (but not significant) stiffening of tracheal cartilage and connective tissue with aging. No change in the stress relaxation percentage with aging was observed. The results of this study may be useful in the design and fabrication of tracheal tissue engineering scaffolds.

Generalized Kapchinskij-Vladimirskij Distribution and Beam Matrix for Phase-Space Manipulations of High-Intensity Beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chung, Moses; Qin, Hong; Davidson, Ronald C.

In an uncoupled linear lattice system, the Kapchinskij-Vladimirskij (KV) distribution formulated on the basis of the single-particle Courant-Snyder invariants has served as a fundamental theoretical basis for the analyses of the equilibrium, stability, and transport properties of high-intensity beams for the past several decades. Recent applications of high-intensity beams, however, require beam phase-space manipulations by intentionally introducing strong coupling. Here in this Letter, we report the full generalization of the KV model by including all of the linear (both external and space-charge) coupling forces, beam energy variations, and arbitrary emittance partition, which all form essential elements for phase-space manipulations. Themore » new generalized KV model yields spatially uniform density profiles and corresponding linear self-field forces as desired. Finally, the corresponding matrix envelope equations and beam matrix for the generalized KV model provide important new theoretical tools for the detailed design and analysis of high-intensity beam manipulations, for which previous theoretical models are not easily applicable.« less

Generalized Kapchinskij-Vladimirskij Distribution and Beam Matrix for Phase-Space Manipulations of High-Intensity Beams

DOE PAGES

Chung, Moses; Qin, Hong; Davidson, Ronald C.; ...

2016-11-23

In an uncoupled linear lattice system, the Kapchinskij-Vladimirskij (KV) distribution formulated on the basis of the single-particle Courant-Snyder invariants has served as a fundamental theoretical basis for the analyses of the equilibrium, stability, and transport properties of high-intensity beams for the past several decades. Recent applications of high-intensity beams, however, require beam phase-space manipulations by intentionally introducing strong coupling. Here in this Letter, we report the full generalization of the KV model by including all of the linear (both external and space-charge) coupling forces, beam energy variations, and arbitrary emittance partition, which all form essential elements for phase-space manipulations. Themore » new generalized KV model yields spatially uniform density profiles and corresponding linear self-field forces as desired. Finally, the corresponding matrix envelope equations and beam matrix for the generalized KV model provide important new theoretical tools for the detailed design and analysis of high-intensity beam manipulations, for which previous theoretical models are not easily applicable.« less

High profile students’ growth of mathematical understanding in solving linier programing problems

NASA Astrophysics Data System (ADS)

Utomo; Kusmayadi, TA; Pramudya, I.

2018-04-01

Linear program has an important role in human’s life. This linear program is learned in senior high school and college levels. This material is applied in economy, transportation, military and others. Therefore, mastering linear program is useful for provision of life. This research describes a growth of mathematical understanding in solving linear programming problems based on the growth of understanding by the Piere-Kieren model. Thus, this research used qualitative approach. The subjects were students of grade XI in Salatiga city. The subjects of this study were two students who had high profiles. The researcher generally chose the subjects based on the growth of understanding from a test result in the classroom; the mark from the prerequisite material was ≥ 75. Both of the subjects were interviewed by the researcher to know the students’ growth of mathematical understanding in solving linear programming problems. The finding of this research showed that the subjects often folding back to the primitive knowing level to go forward to the next level. It happened because the subjects’ primitive understanding was not comprehensive.

Aircraft Airframe Cost Estimation Using a Random Coefficients Model

DTIC Science & Technology

1979-12-01

approach will also be used here. 2 Model Formulation Several different types of equations could be used for the basic form of the CER, such as linear ...5) Marcotte developed several CER’s for fighter aircraft airframes using the log- linear model . A plot of the residuals from the CER for recurring...of the natural logarithm. Ordinary Least Squares The ordinary least squares procedure starts with the equation for the general linear model . The

Modeling and Density Estimation of an Urban Freeway Network Based on Dynamic Graph Hybrid Automata

PubMed Central

Chen, Yangzhou; Guo, Yuqi; Wang, Ying

2017-01-01

In this paper, in order to describe complex network systems, we firstly propose a general modeling framework by combining a dynamic graph with hybrid automata and thus name it Dynamic Graph Hybrid Automata (DGHA). Then we apply this framework to model traffic flow over an urban freeway network by embedding the Cell Transmission Model (CTM) into the DGHA. With a modeling procedure, we adopt a dual digraph of road network structure to describe the road topology, use linear hybrid automata to describe multi-modes of dynamic densities in road segments and transform the nonlinear expressions of the transmitted traffic flow between two road segments into piecewise linear functions in terms of multi-mode switchings. This modeling procedure is modularized and rule-based, and thus is easily-extensible with the help of a combination algorithm for the dynamics of traffic flow. It can describe the dynamics of traffic flow over an urban freeway network with arbitrary topology structures and sizes. Next we analyze mode types and number in the model of the whole freeway network, and deduce a Piecewise Affine Linear System (PWALS) model. Furthermore, based on the PWALS model, a multi-mode switched state observer is designed to estimate the traffic densities of the freeway network, where a set of observer gain matrices are computed by using the Lyapunov function approach. As an example, we utilize the PWALS model and the corresponding switched state observer to traffic flow over Beijing third ring road. In order to clearly interpret the principle of the proposed method and avoid computational complexity, we adopt a simplified version of Beijing third ring road. Practical application for a large-scale road network will be implemented by decentralized modeling approach and distributed observer designing in the future research. PMID:28353664

Modeling and Density Estimation of an Urban Freeway Network Based on Dynamic Graph Hybrid Automata.

PubMed

Chen, Yangzhou; Guo, Yuqi; Wang, Ying

2017-03-29

In this paper, in order to describe complex network systems, we firstly propose a general modeling framework by combining a dynamic graph with hybrid automata and thus name it Dynamic Graph Hybrid Automata (DGHA). Then we apply this framework to model traffic flow over an urban freeway network by embedding the Cell Transmission Model (CTM) into the DGHA. With a modeling procedure, we adopt a dual digraph of road network structure to describe the road topology, use linear hybrid automata to describe multi-modes of dynamic densities in road segments and transform the nonlinear expressions of the transmitted traffic flow between two road segments into piecewise linear functions in terms of multi-mode switchings. This modeling procedure is modularized and rule-based, and thus is easily-extensible with the help of a combination algorithm for the dynamics of traffic flow. It can describe the dynamics of traffic flow over an urban freeway network with arbitrary topology structures and sizes. Next we analyze mode types and number in the model of the whole freeway network, and deduce a Piecewise Affine Linear System (PWALS) model. Furthermore, based on the PWALS model, a multi-mode switched state observer is designed to estimate the traffic densities of the freeway network, where a set of observer gain matrices are computed by using the Lyapunov function approach. As an example, we utilize the PWALS model and the corresponding switched state observer to traffic flow over Beijing third ring road. In order to clearly interpret the principle of the proposed method and avoid computational complexity, we adopt a simplified version of Beijing third ring road. Practical application for a large-scale road network will be implemented by decentralized modeling approach and distributed observer designing in the future research.

Optical linear algebra processors: noise and error-source modeling.

PubMed

Casasent, D; Ghosh, A

1985-06-01

The modeling of system and component noise and error sources in optical linear algebra processors (OLAP's) are considered, with attention to the frequency-multiplexed OLAP. General expressions are obtained for the output produced as a function of various component errors and noise. A digital simulator for this model is discussed.

Optical linear algebra processors - Noise and error-source modeling

NASA Technical Reports Server (NTRS)

Casasent, D.; Ghosh, A.

1985-01-01

The modeling of system and component noise and error sources in optical linear algebra processors (OLAPs) are considered, with attention to the frequency-multiplexed OLAP. General expressions are obtained for the output produced as a function of various component errors and noise. A digital simulator for this model is discussed.

On the performance of piezoelectric harvesters loaded by finite width impulses

NASA Astrophysics Data System (ADS)

Doria, A.; Medè, C.; Desideri, D.; Maschio, A.; Codecasa, L.; Moro, F.

2018-02-01

The response of cantilevered piezoelectric harvesters loaded by finite width impulses of base acceleration is studied analytically in the frequency domain in order to identify the parameters that influence the generated voltage. Experimental tests are then performed on harvesters loaded by hammer impacts. The latter are used to confirm analytical results and to validate a linear finite element (FE) model of a unimorph harvester. The FE model is, in turn, used to extend analytical results to more general harvesters (tapered, inverse tapered, triangular) and to more general impulses (heel strike in human gait). From analytical and numerical results design criteria for improving harvester performance are obtained.

A new statistical method for transfer coefficient calculations in the framework of the general multiple-compartment model of transport for radionuclides in biological systems.

PubMed

Garcia, F; Arruda-Neto, J D; Manso, M V; Helene, O M; Vanin, V R; Rodriguez, O; Mesa, J; Likhachev, V P; Filho, J W; Deppman, A; Perez, G; Guzman, F; de Camargo, S P

1999-10-01

A new and simple statistical procedure (STATFLUX) for the calculation of transfer coefficients of radionuclide transport to animals and plants is proposed. The method is based on the general multiple-compartment model, which uses a system of linear equations involving geometrical volume considerations. By using experimentally available curves of radionuclide concentrations versus time, for each animal compartment (organs), flow parameters were estimated by employing a least-squares procedure, whose consistency is tested. Some numerical results are presented in order to compare the STATFLUX transfer coefficients with those from other works and experimental data.

A method for assigning species into groups based on generalized Mahalanobis distance between habitat model coefficients

USGS Publications Warehouse

Williams, C.J.; Heglund, P.J.

2009-01-01

Habitat association models are commonly developed for individual animal species using generalized linear modeling methods such as logistic regression. We considered the issue of grouping species based on their habitat use so that management decisions can be based on sets of species rather than individual species. This research was motivated by a study of western landbirds in northern Idaho forests. The method we examined was to separately fit models to each species and to use a generalized Mahalanobis distance between coefficient vectors to create a distance matrix among species. Clustering methods were used to group species from the distance matrix, and multidimensional scaling methods were used to visualize the relations among species groups. Methods were also discussed for evaluating the sensitivity of the conclusions because of outliers or influential data points. We illustrate these methods with data from the landbird study conducted in northern Idaho. Simulation results are presented to compare the success of this method to alternative methods using Euclidean distance between coefficient vectors and to methods that do not use habitat association models. These simulations demonstrate that our Mahalanobis-distance- based method was nearly always better than Euclidean-distance-based methods or methods not based on habitat association models. The methods used to develop candidate species groups are easily explained to other scientists and resource managers since they mainly rely on classical multivariate statistical methods. ?? 2008 Springer Science+Business Media, LLC.

Particle rejuvenation of Rao-Blackwellized sequential Monte Carlo smoothers for conditionally linear and Gaussian models

NASA Astrophysics Data System (ADS)

Nguyen, Ngoc Minh; Corff, Sylvain Le; Moulines, Éric

2017-12-01

This paper focuses on sequential Monte Carlo approximations of smoothing distributions in conditionally linear and Gaussian state spaces. To reduce Monte Carlo variance of smoothers, it is typical in these models to use Rao-Blackwellization: particle approximation is used to sample sequences of hidden regimes while the Gaussian states are explicitly integrated conditional on the sequence of regimes and observations, using variants of the Kalman filter/smoother. The first successful attempt to use Rao-Blackwellization for smoothing extends the Bryson-Frazier smoother for Gaussian linear state space models using the generalized two-filter formula together with Kalman filters/smoothers. More recently, a forward-backward decomposition of smoothing distributions mimicking the Rauch-Tung-Striebel smoother for the regimes combined with backward Kalman updates has been introduced. This paper investigates the benefit of introducing additional rejuvenation steps in all these algorithms to sample at each time instant new regimes conditional on the forward and backward particles. This defines particle-based approximations of the smoothing distributions whose support is not restricted to the set of particles sampled in the forward or backward filter. These procedures are applied to commodity markets which are described using a two-factor model based on the spot price and a convenience yield for crude oil data.

A nonlinear model for analysis of slug-test data

USGS Publications Warehouse

McElwee, C.D.; Zenner, M.A.

1998-01-01

While doing slug tests in high-permeability aquifers, we have consistently seen deviations from the expected response of linear theoretical models. Normalized curves do not coincide for various initial heads, as would be predicted by linear theories, and are shifted to larger times for higher initial heads. We have developed a general nonlinear model based on the Navier-Stokes equation, nonlinear frictional loss, non-Darcian flow, acceleration effects, radius changes in the well bore, and a Hvorslev model for the aquifer, which explains these data features. The model produces a very good fit for both oscillatory and nonoscillatory field data, using a single set of physical parameters to predict the field data for various initial displacements at a given well. This is in contrast to linear models which have a systematic lack of fit and indicate that hydraulic conductivity varies with the initial displacement. We recommend multiple slug tests with a considerable variation in initial head displacement to evaluate the possible presence of nonlinear effects. Our conclusion is that the nonlinear model presented here is an excellent tool to analyze slug tests, covering the range from the underdamped region to the overdamped region.

Receding horizon online optimization for torque control of gasoline engines.

PubMed

Kang, Mingxin; Shen, Tielong

2016-11-01

This paper proposes a model-based nonlinear receding horizon optimal control scheme for the engine torque tracking problem. The controller design directly employs the nonlinear model exploited based on mean-value modeling principle of engine systems without any linearizing reformation, and the online optimization is achieved by applying the Continuation/GMRES (generalized minimum residual) approach. Several receding horizon control schemes are designed to investigate the effects of the integral action and integral gain selection. Simulation analyses and experimental validations are implemented to demonstrate the real-time optimization performance and control effects of the proposed torque tracking controllers. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

A hierarchy for modeling high speed propulsion systems

NASA Technical Reports Server (NTRS)

Hartley, Tom T.; Deabreu, Alex

1991-01-01

General research efforts on reduced order propulsion models for control systems design are overviewed. Methods for modeling high speed propulsion systems are discussed including internal flow propulsion systems that do not contain rotating machinery, such as inlets, ramjets, and scramjets. The discussion is separated into four areas: (1) computational fluid dynamics models for the entire nonlinear system or high order nonlinear models; (2) high order linearized models derived from fundamental physics; (3) low order linear models obtained from the other high order models; and (4) low order nonlinear models (order here refers to the number of dynamic states). Included in the discussion are any special considerations based on the relevant control system designs. The methods discussed are for the quasi-one-dimensional Euler equations of gasdynamic flow. The essential nonlinear features represented are large amplitude nonlinear waves, including moving normal shocks, hammershocks, simple subsonic combustion via heat addition, temperature dependent gases, detonations, and thermal choking. The report also contains a comprehensive list of papers and theses generated by this grant.

Electromagnetic axial anomaly in a generalized linear sigma model

NASA Astrophysics Data System (ADS)

Fariborz, Amir H.; Jora, Renata

2017-06-01

We construct the electromagnetic anomaly effective term for a generalized linear sigma model with two chiral nonets, one with a quark-antiquark structure, the other one with a four-quark content. We compute in the leading order of this framework the decays into two photons of six pseudoscalars: π0(137 ), π0(1300 ), η (547 ), η (958 ), η (1295 ) and η (1760 ). Our results agree well with the available experimental data.

Efficient polarimetric BRDF model.

PubMed

Renhorn, Ingmar G E; Hallberg, Tomas; Boreman, Glenn D

2015-11-30

The purpose of the present manuscript is to present a polarimetric bidirectional reflectance distribution function (BRDF) model suitable for hyperspectral and polarimetric signature modelling. The model is based on a further development of a previously published four-parameter model that has been generalized in order to account for different types of surface structures (generalized Gaussian distribution). A generalization of the Lambertian diffuse model is presented. The pBRDF-functions are normalized using numerical integration. Using directional-hemispherical reflectance (DHR) measurements, three of the four basic parameters can be determined for any wavelength. This simplifies considerably the development of multispectral polarimetric BRDF applications. The scattering parameter has to be determined from at least one BRDF measurement. The model deals with linear polarized radiation; and in similarity with e.g. the facet model depolarization is not included. The model is very general and can inherently model extreme surfaces such as mirrors and Lambertian surfaces. The complex mixture of sources is described by the sum of two basic models, a generalized Gaussian/Fresnel model and a generalized Lambertian model. Although the physics inspired model has some ad hoc features, the predictive power of the model is impressive over a wide range of angles and scattering magnitudes. The model has been applied successfully to painted surfaces, both dull and glossy and also on metallic bead blasted surfaces. The simple and efficient model should be attractive for polarimetric simulations and polarimetric remote sensing.

Integrable generalizations of non-linear multiple three-wave interaction models

NASA Astrophysics Data System (ADS)

Jurčo, Branislav

1989-07-01

Integrable generalizations of multiple three-wave interaction models in terms of r-matrix formulation are investigated. The Lax representations, complete sets of first integrals in involution are constructed, the quantization leading to Gaudin's models is discussed.

Modeling non-linear growth responses to temperature and hydrology in wetland trees

NASA Astrophysics Data System (ADS)

Keim, R.; Allen, S. T.

2016-12-01

Growth responses of wetland trees to flooding and climate variations are difficult to model because they depend on multiple, apparently interacting factors, but are a critical link in hydrological control of wetland carbon budgets. To more generally understand tree growth to hydrological forcing, we modeled non-linear responses of tree ring growth to flooding and climate at sub-annual time steps, using Vaganov-Shashkin response functions. We calibrated the model to six baldcypress tree-ring chronologies from two hydrologically distinct sites in southern Louisiana, and tested several hypotheses of plasticity in wetlands tree responses to interacting environmental variables. The model outperformed traditional multiple linear regression. More importantly, optimized response parameters were generally similar among sites with varying hydrological conditions, suggesting generality to the functions. Model forms that included interacting responses to multiple forcing factors were more effective than were single response functions, indicating the principle of a single limiting factor is not correct in wetlands and both climatic and hydrological variables must be considered in predicting responses to hydrological or climate change.

Digital Biomass Accumulation Using High-Throughput Plant Phenotype Data Analysis.

PubMed

Rahaman, Md Matiur; Ahsan, Md Asif; Gillani, Zeeshan; Chen, Ming

2017-09-01

Biomass is an important phenotypic trait in functional ecology and growth analysis. The typical methods for measuring biomass are destructive, and they require numerous individuals to be cultivated for repeated measurements. With the advent of image-based high-throughput plant phenotyping facilities, non-destructive biomass measuring methods have attempted to overcome this problem. Thus, the estimation of plant biomass of individual plants from their digital images is becoming more important. In this paper, we propose an approach to biomass estimation based on image derived phenotypic traits. Several image-based biomass studies state that the estimation of plant biomass is only a linear function of the projected plant area in images. However, we modeled the plant volume as a function of plant area, plant compactness, and plant age to generalize the linear biomass model. The obtained results confirm the proposed model and can explain most of the observed variance during image-derived biomass estimation. Moreover, a small difference was observed between actual and estimated digital biomass, which indicates that our proposed approach can be used to estimate digital biomass accurately.

Combining Biomarkers Linearly and Nonlinearly for Classification Using the Area Under the ROC Curve

PubMed Central

Fong, Youyi; Yin, Shuxin; Huang, Ying

2016-01-01

In biomedical studies, it is often of interest to classify/predict a subject’s disease status based on a variety of biomarker measurements. A commonly used classification criterion is based on AUC - Area under the Receiver Operating Characteristic Curve. Many methods have been proposed to optimize approximated empirical AUC criteria, but there are two limitations to the existing methods. First, most methods are only designed to find the best linear combination of biomarkers, which may not perform well when there is strong nonlinearity in the data. Second, many existing linear combination methods use gradient-based algorithms to find the best marker combination, which often result in sub-optimal local solutions. In this paper, we address these two problems by proposing a new kernel-based AUC optimization method called Ramp AUC (RAUC). This method approximates the empirical AUC loss function with a ramp function, and finds the best combination by a difference of convex functions algorithm. We show that as a linear combination method, RAUC leads to a consistent and asymptotically normal estimator of the linear marker combination when the data is generated from a semiparametric generalized linear model, just as the Smoothed AUC method (SAUC). Through simulation studies and real data examples, we demonstrate that RAUC out-performs SAUC in finding the best linear marker combinations, and can successfully capture nonlinear pattern in the data to achieve better classification performance. We illustrate our method with a dataset from a recent HIV vaccine trial. PMID:27058981

Measuring the individual benefit of a medical or behavioral treatment using generalized linear mixed-effects models.

PubMed

Diaz, Francisco J

2016-10-15

We propose statistical definitions of the individual benefit of a medical or behavioral treatment and of the severity of a chronic illness. These definitions are used to develop a graphical method that can be used by statisticians and clinicians in the data analysis of clinical trials from the perspective of personalized medicine. The method focuses on assessing and comparing individual effects of treatments rather than average effects and can be used with continuous and discrete responses, including dichotomous and count responses. The method is based on new developments in generalized linear mixed-effects models, which are introduced in this article. To illustrate, analyses of data from the Sequenced Treatment Alternatives to Relieve Depression clinical trial of sequences of treatments for depression and data from a clinical trial of respiratory treatments are presented. The estimation of individual benefits is also explained. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Nonlinear storage models of unconfined flow through a shallow aquifer on an inclined base and their quasi-steady flow application

NASA Astrophysics Data System (ADS)

Varvaris, Ioannis; Gravanis, Elias; Koussis, Antonis; Akylas, Evangelos

2013-04-01

Hillslope processes involving flow through an inclined shallow aquifer range from subsurface stormflow to stream base flow (drought flow, or groundwater recession flow). In the case of recharge, the infiltrating water moves vertically as unsaturated flow until it reaches the saturated groundwater, where the flow is approximately parallel to the base of the aquifer. Boussinesq used the Dupuit-Forchheimer (D-F) hydraulic theory to formulate unconfined groundwater flow through a soil layer resting on an impervious inclined bed, deriving a nonlinear equation for the flow rate that consists of a linear gravity-driven component and a quadratic pressure-gradient component. Inserting that flow rate equation into the differential storage balance equation (volume conservation) Boussinesq obtained a nonlinear second-order partial differential equation for the depth. So far however, only few special solutions have been advanced for that governing equation. The nonlinearity of the equation of Boussinesq is the major obstacle to deriving a general analytical solution for the depth profile of unconfined flow on a sloping base with recharge (from which the discharges could be then determined). Henderson and Wooding (1964) were able to obtain an exact analytical solution for steady unconfined flow on a sloping base, with recharge, and their work deserves special note in the realm of solutions of the nonlinear equation of Boussinesq. However, the absence of a general solution for the transient case, which is of practical interest to hydrologists, has been the motivation for developing approximate solutions of the non-linear equation of Boussinesq. In this work, we derive the aquifer storage function by integrating analytically over the aquifer base the depth profiles resulting from the complete nonlinear Boussinesq equation for steady flow. This storage function consists of a linear and a nonlinear outflow-dependent term. Then, we use this physics-based storage function in the transient storage balance over the hillslope, obtaining analytical solutions of the outflow and the storage, for recharge and drainage, via a quasi-steady flow calculation. The hydraulically derived storage model is thus embedded in a quasi-steady approximation of transient unconfined flow in sloping aquifers. We generalise this hydrologic model of groundwater flow by modifying the storage function to be the weighted sum of the linear and the nonlinear storage terms, determining the weighting factor objectively from a known integral quantity of the flow (either an initial volume of water stored in the aquifer or a drained water volume). We demonstrate the validity of this model through comparisons with experimental data and simulation results.

A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

NASA Technical Reports Server (NTRS)

Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

2000-01-01

DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to < 0.01 Mbp, is modeled using computer simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

Modeling Linguistic Variables With Regression Models: Addressing Non-Gaussian Distributions, Non-independent Observations, and Non-linear Predictors With Random Effects and Generalized Additive Models for Location, Scale, and Shape

PubMed Central

Coupé, Christophe

2018-01-01

As statistical approaches are getting increasingly used in linguistics, attention must be paid to the choice of methods and algorithms used. This is especially true since they require assumptions to be satisfied to provide valid results, and because scientific articles still often fall short of reporting whether such assumptions are met. Progress is being, however, made in various directions, one of them being the introduction of techniques able to model data that cannot be properly analyzed with simpler linear regression models. We report recent advances in statistical modeling in linguistics. We first describe linear mixed-effects regression models (LMM), which address grouping of observations, and generalized linear mixed-effects models (GLMM), which offer a family of distributions for the dependent variable. Generalized additive models (GAM) are then introduced, which allow modeling non-linear parametric or non-parametric relationships between the dependent variable and the predictors. We then highlight the possibilities offered by generalized additive models for location, scale, and shape (GAMLSS). We explain how they make it possible to go beyond common distributions, such as Gaussian or Poisson, and offer the appropriate inferential framework to account for ‘difficult’ variables such as count data with strong overdispersion. We also demonstrate how they offer interesting perspectives on data when not only the mean of the dependent variable is modeled, but also its variance, skewness, and kurtosis. As an illustration, the case of phonemic inventory size is analyzed throughout the article. For over 1,500 languages, we consider as predictors the number of speakers, the distance from Africa, an estimation of the intensity of language contact, and linguistic relationships. We discuss the use of random effects to account for genealogical relationships, the choice of appropriate distributions to model count data, and non-linear relationships. Relying on GAMLSS, we assess a range of candidate distributions, including the Sichel, Delaporte, Box-Cox Green and Cole, and Box-Cox t distributions. We find that the Box-Cox t distribution, with appropriate modeling of its parameters, best fits the conditional distribution of phonemic inventory size. We finally discuss the specificities of phoneme counts, weak effects, and how GAMLSS should be considered for other linguistic variables. PMID:29713298

Modeling Linguistic Variables With Regression Models: Addressing Non-Gaussian Distributions, Non-independent Observations, and Non-linear Predictors With Random Effects and Generalized Additive Models for Location, Scale, and Shape.

PubMed

Coupé, Christophe

2018-01-01

As statistical approaches are getting increasingly used in linguistics, attention must be paid to the choice of methods and algorithms used. This is especially true since they require assumptions to be satisfied to provide valid results, and because scientific articles still often fall short of reporting whether such assumptions are met. Progress is being, however, made in various directions, one of them being the introduction of techniques able to model data that cannot be properly analyzed with simpler linear regression models. We report recent advances in statistical modeling in linguistics. We first describe linear mixed-effects regression models (LMM), which address grouping of observations, and generalized linear mixed-effects models (GLMM), which offer a family of distributions for the dependent variable. Generalized additive models (GAM) are then introduced, which allow modeling non-linear parametric or non-parametric relationships between the dependent variable and the predictors. We then highlight the possibilities offered by generalized additive models for location, scale, and shape (GAMLSS). We explain how they make it possible to go beyond common distributions, such as Gaussian or Poisson, and offer the appropriate inferential framework to account for 'difficult' variables such as count data with strong overdispersion. We also demonstrate how they offer interesting perspectives on data when not only the mean of the dependent variable is modeled, but also its variance, skewness, and kurtosis. As an illustration, the case of phonemic inventory size is analyzed throughout the article. For over 1,500 languages, we consider as predictors the number of speakers, the distance from Africa, an estimation of the intensity of language contact, and linguistic relationships. We discuss the use of random effects to account for genealogical relationships, the choice of appropriate distributions to model count data, and non-linear relationships. Relying on GAMLSS, we assess a range of candidate distributions, including the Sichel, Delaporte, Box-Cox Green and Cole, and Box-Cox t distributions. We find that the Box-Cox t distribution, with appropriate modeling of its parameters, best fits the conditional distribution of phonemic inventory size. We finally discuss the specificities of phoneme counts, weak effects, and how GAMLSS should be considered for other linguistic variables.

Comparing Regression Coefficients between Nested Linear Models for Clustered Data with Generalized Estimating Equations

ERIC Educational Resources Information Center

Yan, Jun; Aseltine, Robert H., Jr.; Harel, Ofer

2013-01-01

Comparing regression coefficients between models when one model is nested within another is of great practical interest when two explanations of a given phenomenon are specified as linear models. The statistical problem is whether the coefficients associated with a given set of covariates change significantly when other covariates are added into…

Effects of residential development and landscape composition on the breeding birds of Placer county's foothill oak woodlands

Treesearch

Diana Stralberg; Brian Williams

2002-01-01

This study examines the effect of rural residential development and landscape composition on breeding birds in Placer County’s foothill oak woodlands. Point count survey data were used to construct generalized linear models for individual species' abundance or probability of occurrence, based on two sets of variables: GIS-derived landscape characteristics,...

A Comparison of Two Approaches for Measuring Educational Growth from CTBS and P-ACT+ Scores.

ERIC Educational Resources Information Center

Noble, Julie; Sawyer, Richard

The purpose of the study was to compare two regression-based approaches for measuring educational effectiveness in Tennessee high schools: the mean residual approach (MR), and a more general linear models (LM) approach. Data were obtained from a sample of 1,011 students who were enrolled in 48 high schools, and who had taken the Comprehensive…

Cocaine Dependence Treatment Data: Methods for Measurement Error Problems With Predictors Derived From Stationary Stochastic Processes

PubMed Central

Guan, Yongtao; Li, Yehua; Sinha, Rajita

2011-01-01

In a cocaine dependence treatment study, we use linear and nonlinear regression models to model posttreatment cocaine craving scores and first cocaine relapse time. A subset of the covariates are summary statistics derived from baseline daily cocaine use trajectories, such as baseline cocaine use frequency and average daily use amount. These summary statistics are subject to estimation error and can therefore cause biased estimators for the regression coefficients. Unlike classical measurement error problems, the error we encounter here is heteroscedastic with an unknown distribution, and there are no replicates for the error-prone variables or instrumental variables. We propose two robust methods to correct for the bias: a computationally efficient method-of-moments-based method for linear regression models and a subsampling extrapolation method that is generally applicable to both linear and nonlinear regression models. Simulations and an application to the cocaine dependence treatment data are used to illustrate the efficacy of the proposed methods. Asymptotic theory and variance estimation for the proposed subsampling extrapolation method and some additional simulation results are described in the online supplementary material. PMID:21984854

Variable Selection with Prior Information for Generalized Linear Models via the Prior LASSO Method.

PubMed

Jiang, Yuan; He, Yunxiao; Zhang, Heping

LASSO is a popular statistical tool often used in conjunction with generalized linear models that can simultaneously select variables and estimate parameters. When there are many variables of interest, as in current biological and biomedical studies, the power of LASSO can be limited. Fortunately, so much biological and biomedical data have been collected and they may contain useful information about the importance of certain variables. This paper proposes an extension of LASSO, namely, prior LASSO (pLASSO), to incorporate that prior information into penalized generalized linear models. The goal is achieved by adding in the LASSO criterion function an additional measure of the discrepancy between the prior information and the model. For linear regression, the whole solution path of the pLASSO estimator can be found with a procedure similar to the Least Angle Regression (LARS). Asymptotic theories and simulation results show that pLASSO provides significant improvement over LASSO when the prior information is relatively accurate. When the prior information is less reliable, pLASSO shows great robustness to the misspecification. We illustrate the application of pLASSO using a real data set from a genome-wide association study.

Distributed Leader-Following Finite-Time Consensus Control for Linear Multiagent Systems under Switching Topology

PubMed Central

Xu, Xiaole; Chen, Shengyong

2014-01-01

This paper investigates the finite-time consensus problem of leader-following multiagent systems. The dynamical models for all following agents and the leader are assumed the same general form of linear system, and the interconnection topology among the agents is assumed to be switching and undirected. We mostly consider the continuous-time case. By assuming that the states of neighbouring agents are known to each agent, a sufficient condition is established for finite-time consensus via a neighbor-based state feedback protocol. While the states of neighbouring agents cannot be available and only the outputs of neighbouring agents can be accessed, the distributed observer-based consensus protocol is proposed for each following agent. A sufficient condition is provided in terms of linear matrix inequalities to design the observer-based consensus protocol, which makes the multiagent systems achieve finite-time consensus under switching topologies. Then, we discuss the counterparts for discrete-time case. Finally, we provide an illustrative example to show the effectiveness of the design approach. PMID:24883367

A comparison of methods for the analysis of binomial clustered outcomes in behavioral research.

PubMed

Ferrari, Alberto; Comelli, Mario

2016-12-01

In behavioral research, data consisting of a per-subject proportion of "successes" and "failures" over a finite number of trials often arise. This clustered binary data are usually non-normally distributed, which can distort inference if the usual general linear model is applied and sample size is small. A number of more advanced methods is available, but they are often technically challenging and a comparative assessment of their performances in behavioral setups has not been performed. We studied the performances of some methods applicable to the analysis of proportions; namely linear regression, Poisson regression, beta-binomial regression and Generalized Linear Mixed Models (GLMMs). We report on a simulation study evaluating power and Type I error rate of these models in hypothetical scenarios met by behavioral researchers; plus, we describe results from the application of these methods on data from real experiments. Our results show that, while GLMMs are powerful instruments for the analysis of clustered binary outcomes, beta-binomial regression can outperform them in a range of scenarios. Linear regression gave results consistent with the nominal level of significance, but was overall less powerful. Poisson regression, instead, mostly led to anticonservative inference. GLMMs and beta-binomial regression are generally more powerful than linear regression; yet linear regression is robust to model misspecification in some conditions, whereas Poisson regression suffers heavily from violations of the assumptions when used to model proportion data. We conclude providing directions to behavioral scientists dealing with clustered binary data and small sample sizes. Copyright © 2016 Elsevier B.V. All rights reserved.

Analyzing longitudinal data with the linear mixed models procedure in SPSS.

PubMed

West, Brady T

2009-09-01

Many applied researchers analyzing longitudinal data share a common misconception: that specialized statistical software is necessary to fit hierarchical linear models (also known as linear mixed models [LMMs], or multilevel models) to longitudinal data sets. Although several specialized statistical software programs of high quality are available that allow researchers to fit these models to longitudinal data sets (e.g., HLM), rapid advances in general purpose statistical software packages have recently enabled analysts to fit these same models when using preferred packages that also enable other more common analyses. One of these general purpose statistical packages is SPSS, which includes a very flexible and powerful procedure for fitting LMMs to longitudinal data sets with continuous outcomes. This article aims to present readers with a practical discussion of how to analyze longitudinal data using the LMMs procedure in the SPSS statistical software package.

Bayesian Correction for Misclassification in Multilevel Count Data Models.

PubMed

Nelson, Tyler; Song, Joon Jin; Chin, Yoo-Mi; Stamey, James D

2018-01-01

Covariate misclassification is well known to yield biased estimates in single level regression models. The impact on hierarchical count models has been less studied. A fully Bayesian approach to modeling both the misclassified covariate and the hierarchical response is proposed. Models with a single diagnostic test and with multiple diagnostic tests are considered. Simulation studies show the ability of the proposed model to appropriately account for the misclassification by reducing bias and improving performance of interval estimators. A real data example further demonstrated the consequences of ignoring the misclassification. Ignoring misclassification yielded a model that indicated there was a significant, positive impact on the number of children of females who observed spousal abuse between their parents. When the misclassification was accounted for, the relationship switched to negative, but not significant. Ignoring misclassification in standard linear and generalized linear models is well known to lead to biased results. We provide an approach to extend misclassification modeling to the important area of hierarchical generalized linear models.

Small area estimation for semicontinuous data.

PubMed

Chandra, Hukum; Chambers, Ray

2016-03-01

Survey data often contain measurements for variables that are semicontinuous in nature, i.e. they either take a single fixed value (we assume this is zero) or they have a continuous, often skewed, distribution on the positive real line. Standard methods for small area estimation (SAE) based on the use of linear mixed models can be inefficient for such variables. We discuss SAE techniques for semicontinuous variables under a two part random effects model that allows for the presence of excess zeros as well as the skewed nature of the nonzero values of the response variable. In particular, we first model the excess zeros via a generalized linear mixed model fitted to the probability of a nonzero, i.e. strictly positive, value being observed, and then model the response, given that it is strictly positive, using a linear mixed model fitted on the logarithmic scale. Empirical results suggest that the proposed method leads to efficient small area estimates for semicontinuous data of this type. We also propose a parametric bootstrap method to estimate the MSE of the proposed small area estimator. These bootstrap estimates of the MSE are compared to the true MSE in a simulation study. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dynamic models for estimating the effect of HAART on CD4 in observational studies: Application to the Aquitaine Cohort and the Swiss HIV Cohort Study.

PubMed

Prague, Mélanie; Commenges, Daniel; Gran, Jon Michael; Ledergerber, Bruno; Young, Jim; Furrer, Hansjakob; Thiébaut, Rodolphe

2017-03-01

Highly active antiretroviral therapy (HAART) has proved efficient in increasing CD4 counts in many randomized clinical trials. Because randomized trials have some limitations (e.g., short duration, highly selected subjects), it is interesting to assess the effect of treatments using observational studies. This is challenging because treatment is started preferentially in subjects with severe conditions. This general problem had been treated using Marginal Structural Models (MSM) relying on the counterfactual formulation. Another approach to causality is based on dynamical models. We present three discrete-time dynamic models based on linear increments models (LIM): the first one based on one difference equation for CD4 counts, the second with an equilibrium point, and the third based on a system of two difference equations, which allows jointly modeling CD4 counts and viral load. We also consider continuous-time models based on ordinary differential equations with non-linear mixed effects (ODE-NLME). These mechanistic models allow incorporating biological knowledge when available, which leads to increased statistical evidence for detecting treatment effect. Because inference in ODE-NLME is numerically challenging and requires specific methods and softwares, LIM are a valuable intermediary option in terms of consistency, precision, and complexity. We compare the different approaches in simulation and in illustration on the ANRS CO3 Aquitaine Cohort and the Swiss HIV Cohort Study. © 2016, The International Biometric Society.

A generalization of the Becker model in linear viscoelasticity: creep, relaxation and internal friction

NASA Astrophysics Data System (ADS)

Mainardi, Francesco; Masina, Enrico; Spada, Giorgio

2018-02-01

We present a new rheological model depending on a real parameter ν \\in [0,1], which reduces to the Maxwell body for ν =0 and to the Becker body for ν =1. The corresponding creep law is expressed in an integral form in which the exponential function of the Becker model is replaced and generalized by a Mittag-Leffler function of order ν . Then the corresponding non-dimensional creep function and its rate are studied as functions of time for different values of ν in order to visualize the transition from the classical Maxwell body to the Becker body. Based on the hereditary theory of linear viscoelasticity, we also approximate the relaxation function by solving numerically a Volterra integral equation of the second kind. In turn, the relaxation function is shown versus time for different values of ν to visualize again the transition from the classical Maxwell body to the Becker body. Furthermore, we provide a full characterization of the new model by computing, in addition to the creep and relaxation functions, the so-called specific dissipation Q^{-1} as a function of frequency, which is of particular relevance for geophysical applications.

Flow assignment model for quantitative analysis of diverting bulk freight from road to railway

PubMed Central

Liu, Chang; Wang, Jiaxi; Xiao, Jie; Liu, Siqi; Wu, Jianping; Li, Jian

2017-01-01

Since railway transport possesses the advantage of high volume and low carbon emissions, diverting some freight from road to railway will help reduce the negative environmental impacts associated with transport. This paper develops a flow assignment model for quantitative analysis of diverting truck freight to railway. First, a general network which considers road transportation, railway transportation, handling and transferring is established according to all the steps in the whole transportation process. Then general functions which embody the factors which the shippers will pay attention to when choosing mode and path are formulated. The general functions contain the congestion cost on road, the capacity constraints of railways and freight stations. Based on the general network and general cost function, a user equilibrium flow assignment model is developed to simulate the flow distribution on the general network under the condition that all shippers choose transportation mode and path independently. Since the model is nonlinear and challenging, we adopt a method that uses tangent lines to constitute envelope curve to linearize it. Finally, a numerical example is presented to test the model and show the method of making quantitative analysis of bulk freight modal shift between road and railway. PMID:28771536

An approximation of herd effect due to vaccinating children against seasonal influenza - a potential solution to the incorporation of indirect effects into static models.

PubMed

Van Vlaenderen, Ilse; Van Bellinghen, Laure-Anne; Meier, Genevieve; Nautrup, Barbara Poulsen

2013-01-22

Indirect herd effect from vaccination of children offers potential for improving the effectiveness of influenza prevention in the remaining unvaccinated population. Static models used in cost-effectiveness analyses cannot dynamically capture herd effects. The objective of this study was to develop a methodology to allow herd effect associated with vaccinating children against seasonal influenza to be incorporated into static models evaluating the cost-effectiveness of influenza vaccination. Two previously published linear equations for approximation of herd effects in general were compared with the results of a structured literature review undertaken using PubMed searches to identify data on herd effects specific to influenza vaccination. A linear function was fitted to point estimates from the literature using the sum of squared residuals. The literature review identified 21 publications on 20 studies for inclusion. Six studies provided data on a mathematical relationship between effective vaccine coverage in subgroups and reduction of influenza infection in a larger unvaccinated population. These supported a linear relationship when effective vaccine coverage in a subgroup population was between 20% and 80%. Three studies evaluating herd effect at a community level, specifically induced by vaccinating children, provided point estimates for fitting linear equations. The fitted linear equation for herd protection in the target population for vaccination (children) was slightly less conservative than a previously published equation for herd effects in general. The fitted linear equation for herd protection in the non-target population was considerably less conservative than the previously published equation. This method of approximating herd effect requires simple adjustments to the annual baseline risk of influenza in static models: (1) for the age group targeted by the childhood vaccination strategy (i.e. children); and (2) for other age groups not targeted (e.g. adults and/or elderly). Two approximations provide a linear relationship between effective coverage and reduction in the risk of infection. The first is a conservative approximation, recommended as a base-case for cost-effectiveness evaluations. The second, fitted to data extracted from a structured literature review, provides a less conservative estimate of herd effect, recommended for sensitivity analyses.

Frequency Response of Synthetic Vocal Fold Models with Linear and Nonlinear Material Properties

PubMed Central

Shaw, Stephanie M.; Thomson, Scott L.; Dromey, Christopher; Smith, Simeon

2014-01-01

Purpose The purpose of this study was to create synthetic vocal fold models with nonlinear stress-strain properties and to investigate the effect of linear versus nonlinear material properties on fundamental frequency during anterior-posterior stretching. Method Three materially linear and three materially nonlinear models were created and stretched up to 10 mm in 1 mm increments. Phonation onset pressure (Pon) and fundamental frequency (F0) at Pon were recorded for each length. Measurements were repeated as the models were relaxed in 1 mm increments back to their resting lengths, and tensile tests were conducted to determine the stress-strain responses of linear versus nonlinear models. Results Nonlinear models demonstrated a more substantial frequency response than did linear models and a more predictable pattern of F0 increase with respect to increasing length (although range was inconsistent across models). Pon generally increased with increasing vocal fold length for nonlinear models, whereas for linear models, Pon decreased with increasing length. Conclusions Nonlinear synthetic models appear to more accurately represent the human vocal folds than linear models, especially with respect to F0 response. PMID:22271874

Frequency response of synthetic vocal fold models with linear and nonlinear material properties.

PubMed

Shaw, Stephanie M; Thomson, Scott L; Dromey, Christopher; Smith, Simeon

2012-10-01

The purpose of this study was to create synthetic vocal fold models with nonlinear stress-strain properties and to investigate the effect of linear versus nonlinear material properties on fundamental frequency (F0) during anterior-posterior stretching. Three materially linear and 3 materially nonlinear models were created and stretched up to 10 mm in 1-mm increments. Phonation onset pressure (Pon) and F0 at Pon were recorded for each length. Measurements were repeated as the models were relaxed in 1-mm increments back to their resting lengths, and tensile tests were conducted to determine the stress-strain responses of linear versus nonlinear models. Nonlinear models demonstrated a more substantial frequency response than did linear models and a more predictable pattern of F0 increase with respect to increasing length (although range was inconsistent across models). Pon generally increased with increasing vocal fold length for nonlinear models, whereas for linear models, Pon decreased with increasing length. Nonlinear synthetic models appear to more accurately represent the human vocal folds than do linear models, especially with respect to F0 response.

Observation Impacts for Longer Forecast Lead-Times

NASA Astrophysics Data System (ADS)

Mahajan, R.; Gelaro, R.; Todling, R.

2013-12-01

Observation impact on forecasts evaluated using adjoint-based techniques (e.g. Langland and Baker, 2004) are limited by the validity of the assumptions underlying the forecasting model adjoint. Most applications of this approach have focused on deriving observation impacts on short-range forecasts (e.g. 24-hour) in part to stay well within linearization assumptions. The most widely used measure of observation impact relies on the availability of the analysis for verifying the forecasts. As pointed out by Gelaro et al. (2007), and more recently by Todling (2013), this introduces undesirable correlations in the measure that are likely to affect the resulting assessment of the observing system. Stappers and Barkmeijer (2012) introduced a technique that, in principle, allows extending the validity of tangent linear and corresponding adjoint models to longer lead-times, thereby reducing the correlations in the measures used for observation impact assessments. The methodology provides the means to better represent linearized models by making use of Gaussian quadrature relations to handle various underlying non-linear model trajectories. The formulation is exact for particular bi-linear dynamics; it corresponds to an approximation for general-type nonlinearities and must be tested for large atmospheric models. The present work investigates the approach of Stappers and Barkmeijer (2012)in the context of NASA's Goddard Earth Observing System Version 5 (GEOS-5) atmospheric data assimilation system (ADAS). The goal is to calculate observation impacts in the GEOS-5 ADAS for forecast lead-times of at least 48 hours in order to reduce the potential for undesirable correlations that occur at shorter forecast lead times. References [1]Langland, R. H., and N. L. Baker, 2004: Estimation of observation impact using the NRL atmospheric variational data assimilation adjoint system. Tellus, 56A, 189-201. [2] Gelaro, R., Y. Zhu, and R. M. Errico, 2007: Examination of various-order adjoint-based approximations of observation impact. Meteoroloische Zeitschrift, 16, 685-692. [3]Stappers, R. J. J., and J. Barkmeijer, 2012: Optimal linearization trajectories for tangent linear models. Q. J. R. Meteorol. Soc., 138, 170-184. [4] Todling, R. 2013: Comparing two approaches for assessing observation impact. Mon. Wea. Rev., 141, 1484-1505.

Ordinal probability effect measures for group comparisons in multinomial cumulative link models.

PubMed

Agresti, Alan; Kateri, Maria

2017-03-01

We consider simple ordinal model-based probability effect measures for comparing distributions of two groups, adjusted for explanatory variables. An "ordinal superiority" measure summarizes the probability that an observation from one distribution falls above an independent observation from the other distribution, adjusted for explanatory variables in a model. The measure applies directly to normal linear models and to a normal latent variable model for ordinal response variables. It equals Φ(β/2) for the corresponding ordinal model that applies a probit link function to cumulative multinomial probabilities, for standard normal cdf Φ and effect β that is the coefficient of the group indicator variable. For the more general latent variable model for ordinal responses that corresponds to a linear model with other possible error distributions and corresponding link functions for cumulative multinomial probabilities, the ordinal superiority measure equals exp(β)/[1+exp(β)] with the log-log link and equals approximately exp(β/2)/[1+exp(β/2)] with the logit link, where β is the group effect. Another ordinal superiority measure generalizes the difference of proportions from binary to ordinal responses. We also present related measures directly for ordinal models for the observed response that need not assume corresponding latent response models. We present confidence intervals for the measures and illustrate with an example. © 2016, The International Biometric Society.

Local polynomial estimation of heteroscedasticity in a multivariate linear regression model and its applications in economics.

PubMed

Su, Liyun; Zhao, Yanyong; Yan, Tianshun; Li, Fenglan

2012-01-01

Multivariate local polynomial fitting is applied to the multivariate linear heteroscedastic regression model. Firstly, the local polynomial fitting is applied to estimate heteroscedastic function, then the coefficients of regression model are obtained by using generalized least squares method. One noteworthy feature of our approach is that we avoid the testing for heteroscedasticity by improving the traditional two-stage method. Due to non-parametric technique of local polynomial estimation, it is unnecessary to know the form of heteroscedastic function. Therefore, we can improve the estimation precision, when the heteroscedastic function is unknown. Furthermore, we verify that the regression coefficients is asymptotic normal based on numerical simulations and normal Q-Q plots of residuals. Finally, the simulation results and the local polynomial estimation of real data indicate that our approach is surely effective in finite-sample situations.

Credibility analysis of risk classes by generalized linear model

NASA Astrophysics Data System (ADS)

Erdemir, Ovgucan Karadag; Sucu, Meral

2016-06-01

In this paper generalized linear model (GLM) and credibility theory which are frequently used in nonlife insurance pricing are combined for reliability analysis. Using full credibility standard, GLM is associated with limited fluctuation credibility approach. Comparison criteria such as asymptotic variance and credibility probability are used to analyze the credibility of risk classes. An application is performed by using one-year claim frequency data of a Turkish insurance company and results of credible risk classes are interpreted.

Evaluation of airborne lidar data to predict vegetation Presence/Absence

USGS Publications Warehouse

Palaseanu-Lovejoy, M.; Nayegandhi, A.; Brock, J.; Woodman, R.; Wright, C.W.

2009-01-01

This study evaluates the capabilities of the Experimental Advanced Airborne Research Lidar (EAARL) in delineating vegetation assemblages in Jean Lafitte National Park, Louisiana. Five-meter-resolution grids of bare earth, canopy height, canopy-reflection ratio, and height of median energy were derived from EAARL data acquired in September 2006. Ground-truth data were collected along transects to assess species composition, canopy cover, and ground cover. To decide which model is more accurate, comparisons of general linear models and generalized additive models were conducted using conventional evaluation methods (i.e., sensitivity, specificity, Kappa statistics, and area under the curve) and two new indexes, net reclassification improvement and integrated discrimination improvement. Generalized additive models were superior to general linear models in modeling presence/absence in training vegetation categories, but no statistically significant differences between the two models were achieved in determining the classification accuracy at validation locations using conventional evaluation methods, although statistically significant improvements in net reclassifications were observed. ?? 2009 Coastal Education and Research Foundation.

A Framework for Linear and Non-Linear Registration of Diffusion-Weighted MRIs Using Angular Interpolation

PubMed Central

Duarte-Carvajalino, Julio M.; Sapiro, Guillermo; Harel, Noam; Lenglet, Christophe

2013-01-01

Registration of diffusion-weighted magnetic resonance images (DW-MRIs) is a key step for population studies, or construction of brain atlases, among other important tasks. Given the high dimensionality of the data, registration is usually performed by relying on scalar representative images, such as the fractional anisotropy (FA) and non-diffusion-weighted (b0) images, thereby ignoring much of the directional information conveyed by DW-MR datasets itself. Alternatively, model-based registration algorithms have been proposed to exploit information on the preferred fiber orientation(s) at each voxel. Models such as the diffusion tensor or orientation distribution function (ODF) have been used for this purpose. Tensor-based registration methods rely on a model that does not completely capture the information contained in DW-MRIs, and largely depends on the accurate estimation of tensors. ODF-based approaches are more recent and computationally challenging, but also better describe complex fiber configurations thereby potentially improving the accuracy of DW-MRI registration. A new algorithm based on angular interpolation of the diffusion-weighted volumes was proposed for affine registration, and does not rely on any specific local diffusion model. In this work, we first extensively compare the performance of registration algorithms based on (i) angular interpolation, (ii) non-diffusion-weighted scalar volume (b0), and (iii) diffusion tensor image (DTI). Moreover, we generalize the concept of angular interpolation (AI) to non-linear image registration, and implement it in the FMRIB Software Library (FSL). We demonstrate that AI registration of DW-MRIs is a powerful alternative to volume and tensor-based approaches. In particular, we show that AI improves the registration accuracy in many cases over existing state-of-the-art algorithms, while providing registered raw DW-MRI data, which can be used for any subsequent analysis. PMID:23596381

A Framework for Linear and Non-Linear Registration of Diffusion-Weighted MRIs Using Angular Interpolation.

PubMed

Duarte-Carvajalino, Julio M; Sapiro, Guillermo; Harel, Noam; Lenglet, Christophe

2013-01-01

Registration of diffusion-weighted magnetic resonance images (DW-MRIs) is a key step for population studies, or construction of brain atlases, among other important tasks. Given the high dimensionality of the data, registration is usually performed by relying on scalar representative images, such as the fractional anisotropy (FA) and non-diffusion-weighted (b0) images, thereby ignoring much of the directional information conveyed by DW-MR datasets itself. Alternatively, model-based registration algorithms have been proposed to exploit information on the preferred fiber orientation(s) at each voxel. Models such as the diffusion tensor or orientation distribution function (ODF) have been used for this purpose. Tensor-based registration methods rely on a model that does not completely capture the information contained in DW-MRIs, and largely depends on the accurate estimation of tensors. ODF-based approaches are more recent and computationally challenging, but also better describe complex fiber configurations thereby potentially improving the accuracy of DW-MRI registration. A new algorithm based on angular interpolation of the diffusion-weighted volumes was proposed for affine registration, and does not rely on any specific local diffusion model. In this work, we first extensively compare the performance of registration algorithms based on (i) angular interpolation, (ii) non-diffusion-weighted scalar volume (b0), and (iii) diffusion tensor image (DTI). Moreover, we generalize the concept of angular interpolation (AI) to non-linear image registration, and implement it in the FMRIB Software Library (FSL). We demonstrate that AI registration of DW-MRIs is a powerful alternative to volume and tensor-based approaches. In particular, we show that AI improves the registration accuracy in many cases over existing state-of-the-art algorithms, while providing registered raw DW-MRI data, which can be used for any subsequent analysis.

Plant uptake of elements in soil and pore water: field observations versus model assumptions.

PubMed

Raguž, Veronika; Jarsjö, Jerker; Grolander, Sara; Lindborg, Regina; Avila, Rodolfo

2013-09-15

Contaminant concentrations in various edible plant parts transfer hazardous substances from polluted areas to animals and humans. Thus, the accurate prediction of plant uptake of elements is of significant importance. The processes involved contain many interacting factors and are, as such, complex. In contrast, the most common way to currently quantify element transfer from soils into plants is relatively simple, using an empirical soil-to-plant transfer factor (TF). This practice is based on theoretical assumptions that have been previously shown to not generally be valid. Using field data on concentrations of 61 basic elements in spring barley, soil and pore water at four agricultural sites in mid-eastern Sweden, we quantify element-specific TFs. Our aim is to investigate to which extent observed element-specific uptake is consistent with TF model assumptions and to which extent TF's can be used to predict observed differences in concentrations between different plant parts (root, stem and ear). Results show that for most elements, plant-ear concentrations are not linearly related to bulk soil concentrations, which is congruent with previous studies. This behaviour violates a basic TF model assumption of linearity. However, substantially better linear correlations are found when weighted average element concentrations in whole plants are used for TF estimation. The highest number of linearly-behaving elements was found when relating average plant concentrations to soil pore-water concentrations. In contrast to other elements, essential elements (micronutrients and macronutrients) exhibited relatively small differences in concentration between different plant parts. Generally, the TF model was shown to work reasonably well for micronutrients, whereas it did not for macronutrients. The results also suggest that plant uptake of elements from sources other than the soil compartment (e.g. from air) may be non-negligible. Copyright © 2013 Elsevier Ltd. All rights reserved.

Numerically pricing American options under the generalized mixed fractional Brownian motion model

NASA Astrophysics Data System (ADS)

Chen, Wenting; Yan, Bowen; Lian, Guanghua; Zhang, Ying

2016-06-01

In this paper, we introduce a robust numerical method, based on the upwind scheme, for the pricing of American puts under the generalized mixed fractional Brownian motion (GMFBM) model. By using portfolio analysis and applying the Wick-Itô formula, a partial differential equation (PDE) governing the prices of vanilla options under the GMFBM is successfully derived for the first time. Based on this, we formulate the pricing of American puts under the current model as a linear complementarity problem (LCP). Unlike the classical Black-Scholes (B-S) model or the generalized B-S model discussed in Cen and Le (2011), the newly obtained LCP under the GMFBM model is difficult to be solved accurately because of the numerical instability which results from the degeneration of the governing PDE as time approaches zero. To overcome this difficulty, a numerical approach based on the upwind scheme is adopted. It is shown that the coefficient matrix of the current method is an M-matrix, which ensures its stability in the maximum-norm sense. Remarkably, we have managed to provide a sharp theoretic error estimate for the current method, which is further verified numerically. The results of various numerical experiments also suggest that this new approach is quite accurate, and can be easily extended to price other types of financial derivatives with an American-style exercise feature under the GMFBM model.

Resource Allocation Modelling in Vocational Rehabilitation: A Prototype Developed with the Michigan and Rhode Island VR Agencies.

ERIC Educational Resources Information Center

Leff, H. Stephen; Turner, Ralph R.

This report focuses on the use of linear programming models to address the issues of how vocational rehabilitation (VR) resources should be allocated in order to maximize program efficiency within given resource constraints. A general introduction to linear programming models is first presented that describes the major types of models available,…

Treatment of systematic errors in land data assimilation systems

NASA Astrophysics Data System (ADS)

Crow, W. T.; Yilmaz, M.

2012-12-01

Data assimilation systems are generally designed to minimize the influence of random error on the estimation of system states. Yet, experience with land data assimilation systems has also revealed the presence of large systematic differences between model-derived and remotely-sensed estimates of land surface states. Such differences are commonly resolved prior to data assimilation through implementation of a pre-processing rescaling step whereby observations are scaled (or non-linearly transformed) to somehow "match" comparable predictions made by an assimilation model. While the rationale for removing systematic differences in means (i.e., bias) between models and observations is well-established, relatively little theoretical guidance is currently available to determine the appropriate treatment of higher-order moments during rescaling. This talk presents a simple analytical argument to define an optimal linear-rescaling strategy for observations prior to their assimilation into a land surface model. While a technique based on triple collocation theory is shown to replicate this optimal strategy, commonly-applied rescaling techniques (e.g., so called "least-squares regression" and "variance matching" approaches) are shown to represent only sub-optimal approximations to it. Since the triple collocation approach is likely infeasible in many real-world circumstances, general advice for deciding between various feasible (yet sub-optimal) rescaling approaches will be presented with an emphasis of the implications of this work for the case of directly assimilating satellite radiances. While the bulk of the analysis will deal with linear rescaling techniques, its extension to nonlinear cases will also be discussed.

A state-based probabilistic model for tumor respiratory motion prediction

NASA Astrophysics Data System (ADS)

Kalet, Alan; Sandison, George; Wu, Huanmei; Schmitz, Ruth

2010-12-01

This work proposes a new probabilistic mathematical model for predicting tumor motion and position based on a finite state representation using the natural breathing states of exhale, inhale and end of exhale. Tumor motion was broken down into linear breathing states and sequences of states. Breathing state sequences and the observables representing those sequences were analyzed using a hidden Markov model (HMM) to predict the future sequences and new observables. Velocities and other parameters were clustered using a k-means clustering algorithm to associate each state with a set of observables such that a prediction of state also enables a prediction of tumor velocity. A time average model with predictions based on average past state lengths was also computed. State sequences which are known a priori to fit the data were fed into the HMM algorithm to set a theoretical limit of the predictive power of the model. The effectiveness of the presented probabilistic model has been evaluated for gated radiation therapy based on previously tracked tumor motion in four lung cancer patients. Positional prediction accuracy is compared with actual position in terms of the overall RMS errors. Various system delays, ranging from 33 to 1000 ms, were tested. Previous studies have shown duty cycles for latencies of 33 and 200 ms at around 90% and 80%, respectively, for linear, no prediction, Kalman filter and ANN methods as averaged over multiple patients. At 1000 ms, the previously reported duty cycles range from approximately 62% (ANN) down to 34% (no prediction). Average duty cycle for the HMM method was found to be 100% and 91 ± 3% for 33 and 200 ms latency and around 40% for 1000 ms latency in three out of four breathing motion traces. RMS errors were found to be lower than linear and no prediction methods at latencies of 1000 ms. The results show that for system latencies longer than 400 ms, the time average HMM prediction outperforms linear, no prediction, and the more general HMM-type predictive models. RMS errors for the time average model approach the theoretical limit of the HMM, and predicted state sequences are well correlated with sequences known to fit the data.

Baryonic Force for Accelerated Cosmic Expansion and Generalized U1b Gauge Symmetry in Particle-Cosmology

NASA Astrophysics Data System (ADS)

Khan, Mehbub; Hao, Yun; Hsu, Jong-Ping

2018-01-01

Based on baryon charge conservation and a generalized Yang-Mills symmetry for Abelian (and non-Abelian) groups, we discuss a new baryonic gauge field and its linear potential for two point-like baryon charges. The force between two point-like baryons is repulsive, extremely weak and independent of distance. However, for two extended baryonic systems, we have a dominant linear force α r. Thus, only in the later stage of the cosmic evolution, when two baryonic galaxies are separated by an extremely large distance, the new repulsive baryonic force can overcome the gravitational attractive force. Such a model provides a gauge-field-theoretic understanding of the late-time accelerated cosmic expansion. The baryonic force can be tested by measuring the accelerated Wu-Doppler frequency shifts of supernovae at different distances.

On Generalizations of Cochran’s Theorem and Projection Matrices.

DTIC Science & Technology

1980-08-01

Definiteness of the Estimated Dispersion Matrix in a Multivariate Linear Model ," F. Pukelsheim and George P.H. Styan, May 1978. TECHNICAL REPORTS...with applications to the analysis of covariance," Proc. Cambridge Philos. Soc., 30, pp. 178-191. Graybill , F. A. and Marsaglia, G. (1957...34Idempotent matrices and quad- ratic forms in the general linear hypothesis," Ann. Math. Statist., 28, pp. 678-686. Greub, W. (1975). Linear Algebra (4th ed

Two-dimensional statistical linear discriminant analysis for real-time robust vehicle-type recognition

NASA Astrophysics Data System (ADS)

Zafar, I.; Edirisinghe, E. A.; Acar, S.; Bez, H. E.

2007-02-01

Automatic vehicle Make and Model Recognition (MMR) systems provide useful performance enhancements to vehicle recognitions systems that are solely based on Automatic License Plate Recognition (ALPR) systems. Several car MMR systems have been proposed in literature. However these approaches are based on feature detection algorithms that can perform sub-optimally under adverse lighting and/or occlusion conditions. In this paper we propose a real time, appearance based, car MMR approach using Two Dimensional Linear Discriminant Analysis that is capable of addressing this limitation. We provide experimental results to analyse the proposed algorithm's robustness under varying illumination and occlusions conditions. We have shown that the best performance with the proposed 2D-LDA based car MMR approach is obtained when the eigenvectors of lower significance are ignored. For the given database of 200 car images of 25 different make-model classifications, a best accuracy of 91% was obtained with the 2D-LDA approach. We use a direct Principle Component Analysis (PCA) based approach as a benchmark to compare and contrast the performance of the proposed 2D-LDA approach to car MMR. We conclude that in general the 2D-LDA based algorithm supersedes the performance of the PCA based approach.

Nonlocal theory of curved rods. 2-D, high order, Timoshenko's and Euler-Bernoulli models

NASA Astrophysics Data System (ADS)

Zozulya, V. V.

2017-09-01

New models for plane curved rods based on linear nonlocal theory of elasticity have been developed. The 2-D theory is developed from general 2-D equations of linear nonlocal elasticity using a special curvilinear system of coordinates related to the middle line of the rod along with special hypothesis based on assumptions that take into account the fact that the rod is thin. High order theory is based on the expansion of the equations of the theory of elasticity into Fourier series in terms of Legendre polynomials. First, stress and strain tensors, vectors of displacements and body forces have been expanded into Fourier series in terms of Legendre polynomials with respect to a thickness coordinate. Thereby, all equations of elasticity including nonlocal constitutive relations have been transformed to the corresponding equations for Fourier coefficients. Then, in the same way as in the theory of local elasticity, a system of differential equations in terms of displacements for Fourier coefficients has been obtained. First and second order approximations have been considered in detail. Timoshenko's and Euler-Bernoulli theories are based on the classical hypothesis and the 2-D equations of linear nonlocal theory of elasticity which are considered in a special curvilinear system of coordinates related to the middle line of the rod. The obtained equations can be used to calculate stress-strain and to model thin walled structures in micro- and nanoscales when taking into account size dependent and nonlocal effects.

From point process observations to collective neural dynamics: Nonlinear Hawkes process GLMs, low-dimensional dynamics and coarse graining

PubMed Central

Truccolo, Wilson

2017-01-01

This review presents a perspective on capturing collective dynamics in recorded neuronal ensembles based on multivariate point process models, inference of low-dimensional dynamics and coarse graining of spatiotemporal measurements. A general probabilistic framework for continuous time point processes reviewed, with an emphasis on multivariate nonlinear Hawkes processes with exogenous inputs. A point process generalized linear model (PP-GLM) framework for the estimation of discrete time multivariate nonlinear Hawkes processes is described. The approach is illustrated with the modeling of collective dynamics in neocortical neuronal ensembles recorded in human and non-human primates, and prediction of single-neuron spiking. A complementary approach to capture collective dynamics based on low-dimensional dynamics (“order parameters”) inferred via latent state-space models with point process observations is presented. The approach is illustrated by inferring and decoding low-dimensional dynamics in primate motor cortex during naturalistic reach and grasp movements. Finally, we briefly review hypothesis tests based on conditional inference and spatiotemporal coarse graining for assessing collective dynamics in recorded neuronal ensembles. PMID:28336305

From point process observations to collective neural dynamics: Nonlinear Hawkes process GLMs, low-dimensional dynamics and coarse graining.

PubMed

Truccolo, Wilson

2016-11-01

This review presents a perspective on capturing collective dynamics in recorded neuronal ensembles based on multivariate point process models, inference of low-dimensional dynamics and coarse graining of spatiotemporal measurements. A general probabilistic framework for continuous time point processes reviewed, with an emphasis on multivariate nonlinear Hawkes processes with exogenous inputs. A point process generalized linear model (PP-GLM) framework for the estimation of discrete time multivariate nonlinear Hawkes processes is described. The approach is illustrated with the modeling of collective dynamics in neocortical neuronal ensembles recorded in human and non-human primates, and prediction of single-neuron spiking. A complementary approach to capture collective dynamics based on low-dimensional dynamics ("order parameters") inferred via latent state-space models with point process observations is presented. The approach is illustrated by inferring and decoding low-dimensional dynamics in primate motor cortex during naturalistic reach and grasp movements. Finally, we briefly review hypothesis tests based on conditional inference and spatiotemporal coarse graining for assessing collective dynamics in recorded neuronal ensembles. Published by Elsevier Ltd.

A two-phase micromorphic model for compressible granular materials

NASA Astrophysics Data System (ADS)

Paolucci, Samuel; Li, Weiming; Powers, Joseph

2009-11-01

We introduce a new two-phase continuum model for compressible granular material based on micromorphic theory and treat it as a two-phase mixture with inner structure. By taking an appropriate number of moments of the local micro scale balance equations, the average phase balance equations result from a systematic averaging procedure. In addition to equations for mass, momentum and energy, the balance equations also include evolution equations for microinertia and microspin tensors. The latter equations combine to yield a general form of a compaction equation when the material is assumed to be isotropic. When non-linear and inertial effects are neglected, the generalized compaction equation reduces to that originally proposed by Bear and Nunziato. We use the generalized compaction equation to numerically model a mixture of granular high explosive and interstitial gas. One-dimensional shock tube and piston-driven solutions are presented and compared with experimental results and other known solutions.

Low dose radiation risks for women surviving the a-bombs in Japan: generalized additive model.

PubMed

Dropkin, Greg

2016-11-24

Analyses of cancer mortality and incidence in Japanese A-bomb survivors have been used to estimate radiation risks, which are generally higher for women. Relative Risk (RR) is usually modelled as a linear function of dose. Extrapolation from data including high doses predicts small risks at low doses. Generalized Additive Models (GAMs) are flexible methods for modelling non-linear behaviour. GAMs are applied to cancer incidence in female low dose subcohorts, using anonymous public data for the 1958 - 1998 Life Span Study, to test for linearity, explore interactions, adjust for the skewed dose distribution, examine significance below 100 mGy, and estimate risks at 10 mGy. For all solid cancer incidence, RR estimated from 0 - 100 mGy and 0 - 20 mGy subcohorts is significantly raised. The response tapers above 150 mGy. At low doses, RR increases with age-at-exposure and decreases with time-since-exposure, the preferred covariate. Using the empirical cumulative distribution of dose improves model fit, and capacity to detect non-linear responses. RR is elevated over wide ranges of covariate values. Results are stable under simulation, or when removing exceptional data cells, or adjusting neutron RBE. Estimates of Excess RR at 10 mGy using the cumulative dose distribution are 10 - 45 times higher than extrapolations from a linear model fitted to the full cohort. Below 100 mGy, quasipoisson models find significant effects for all solid, squamous, uterus, corpus, and thyroid cancers, and for respiratory cancers when age-at-exposure > 35 yrs. Results for the thyroid are compatible with studies of children treated for tinea capitis, and Chernobyl survivors. Results for the uterus are compatible with studies of UK nuclear workers and the Techa River cohort. Non-linear models find large, significant cancer risks for Japanese women exposed to low dose radiation from the atomic bombings. The risks should be reflected in protection standards.

A spectral analysis of the domain decomposed Monte Carlo method for linear systems

DOE PAGES

Slattery, Stuart R.; Evans, Thomas M.; Wilson, Paul P. H.

2015-09-08

The domain decomposed behavior of the adjoint Neumann-Ulam Monte Carlo method for solving linear systems is analyzed using the spectral properties of the linear oper- ator. Relationships for the average length of the adjoint random walks, a measure of convergence speed and serial performance, are made with respect to the eigenvalues of the linear operator. In addition, relationships for the effective optical thickness of a domain in the decomposition are presented based on the spectral analysis and diffusion theory. Using the effective optical thickness, the Wigner rational approxi- mation and the mean chord approximation are applied to estimate the leakagemore » frac- tion of random walks from a domain in the decomposition as a measure of parallel performance and potential communication costs. The one-speed, two-dimensional neutron diffusion equation is used as a model problem in numerical experiments to test the models for symmetric operators with spectral qualities similar to light water reactor problems. We find, in general, the derived approximations show good agreement with random walk lengths and leakage fractions computed by the numerical experiments.« less

Robust Combining of Disparate Classifiers Through Order Statistics

NASA Technical Reports Server (NTRS)

Tumer, Kagan; Ghosh, Joydeep

2001-01-01

Integrating the outputs of multiple classifiers via combiners or meta-learners has led to substantial improvements in several difficult pattern recognition problems. In this article we investigate a family of combiners based on order statistics, for robust handling of situations where there are large discrepancies in performance of individual classifiers. Based on a mathematical modeling of how the decision boundaries are affected by order statistic combiners, we derive expressions for the reductions in error expected when simple output combination methods based on the the median, the maximum and in general, the ith order statistic, are used. Furthermore, we analyze the trim and spread combiners, both based on linear combinations of the ordered classifier outputs, and show that in the presence of uneven classifier performance, they often provide substantial gains over both linear and simple order statistics combiners. Experimental results on both real world data and standard public domain data sets corroborate these findings.

Restricted DCJ-indel model: sorting linear genomes with DCJ and indels

PubMed Central

2012-01-01

Background The double-cut-and-join (DCJ) is a model that is able to efficiently sort a genome into another, generalizing the typical mutations (inversions, fusions, fissions, translocations) to which genomes are subject, but allowing the existence of circular chromosomes at the intermediate steps. In the general model many circular chromosomes can coexist in some intermediate step. However, when the compared genomes are linear, it is more plausible to use the so-called restricted DCJ model, in which we proceed the reincorporation of a circular chromosome immediately after its creation. These two consecutive DCJ operations, which create and reincorporate a circular chromosome, mimic a transposition or a block-interchange. When the compared genomes have the same content, it is known that the genomic distance for the restricted DCJ model is the same as the distance for the general model. If the genomes have unequal contents, in addition to DCJ it is necessary to consider indels, which are insertions and deletions of DNA segments. Linear time algorithms were proposed to compute the distance and to find a sorting scenario in a general, unrestricted DCJ-indel model that considers DCJ and indels. Results In the present work we consider the restricted DCJ-indel model for sorting linear genomes with unequal contents. We allow DCJ operations and indels with the following constraint: if a circular chromosome is created by a DCJ, it has to be reincorporated in the next step (no other DCJ or indel can be applied between the creation and the reincorporation of a circular chromosome). We then develop a sorting algorithm and give a tight upper bound for the restricted DCJ-indel distance. Conclusions We have given a tight upper bound for the restricted DCJ-indel distance. The question whether this bound can be reduced so that both the general and the restricted DCJ-indel distances are equal remains open. PMID:23281630

KMgene: a unified R package for gene-based association analysis for complex traits.

PubMed

Yan, Qi; Fang, Zhou; Chen, Wei; Stegle, Oliver

2018-02-09

In this report, we introduce an R package KMgene for performing gene-based association tests for familial, multivariate or longitudinal traits using kernel machine (KM) regression under a generalized linear mixed model (GLMM) framework. Extensive simulations were performed to evaluate the validity of the approaches implemented in KMgene. http://cran.r-project.org/web/packages/KMgene. qi.yan@chp.edu or wei.chen@chp.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press.

Hybrid fusion of linear, non-linear and spectral models for the dynamic modeling of sEMG and skeletal muscle force: an application to upper extremity amputation.

PubMed

Potluri, Chandrasekhar; Anugolu, Madhavi; Schoen, Marco P; Subbaram Naidu, D; Urfer, Alex; Chiu, Steve

2013-11-01

Estimating skeletal muscle (finger) forces using surface Electromyography (sEMG) signals poses many challenges. In general, the sEMG measurements are based on single sensor data. In this paper, two novel hybrid fusion techniques for estimating the skeletal muscle force from the sEMG array sensors are proposed. The sEMG signals are pre-processed using five different filters: Butterworth, Chebychev Type II, Exponential, Half-Gaussian and Wavelet transforms. Dynamic models are extracted from the acquired data using Nonlinear Wiener Hammerstein (NLWH) models and Spectral Analysis Frequency Dependent Resolution (SPAFDR) models based system identification techniques. A detailed comparison is provided for the proposed filters and models using 18 healthy subjects. Wavelet transforms give higher mean correlation of 72.6 ± 1.7 (mean ± SD) and 70.4 ± 1.5 (mean ± SD) for NLWH and SPAFDR models, respectively, when compared to the other filters used in this work. Experimental verification of the fusion based hybrid models with wavelet transform shows a 96% mean correlation and 3.9% mean relative error with a standard deviation of ± 1.3 and ± 0.9 respectively between the overall hybrid fusion algorithm estimated and the actual force for 18 test subjects' k-fold cross validation data. © 2013 Elsevier Ltd. All rights reserved.

Comparison of stream invertebrate response models for bioassessment metric

USGS Publications Warehouse

Waite, Ian R.; Kennen, Jonathan G.; May, Jason T.; Brown, Larry R.; Cuffney, Thomas F.; Jones, Kimberly A.; Orlando, James L.

2012-01-01

We aggregated invertebrate data from various sources to assemble data for modeling in two ecoregions in Oregon and one in California. Our goal was to compare the performance of models developed using multiple linear regression (MLR) techniques with models developed using three relatively new techniques: classification and regression trees (CART), random forest (RF), and boosted regression trees (BRT). We used tolerance of taxa based on richness (RICHTOL) and ratio of observed to expected taxa (O/E) as response variables and land use/land cover as explanatory variables. Responses were generally linear; therefore, there was little improvement to the MLR models when compared to models using CART and RF. In general, the four modeling techniques (MLR, CART, RF, and BRT) consistently selected the same primary explanatory variables for each region. However, results from the BRT models showed significant improvement over the MLR models for each region; increases in R2 from 0.09 to 0.20. The O/E metric that was derived from models specifically calibrated for Oregon consistently had lower R2 values than RICHTOL for the two regions tested. Modeled O/E R2 values were between 0.06 and 0.10 lower for each of the four modeling methods applied in the Willamette Valley and were between 0.19 and 0.36 points lower for the Blue Mountains. As a result, BRT models may indeed represent a good alternative to MLR for modeling species distribution relative to environmental variables.

Models of collective cell spreading with variable cell aspect ratio: a motivation for degenerate diffusion models.

PubMed

Simpson, Matthew J; Baker, Ruth E; McCue, Scott W

2011-02-01

Continuum diffusion models are often used to represent the collective motion of cell populations. Most previous studies have simply used linear diffusion to represent collective cell spreading, while others found that degenerate nonlinear diffusion provides a better match to experimental cell density profiles. In the cell modeling literature there is no guidance available with regard to which approach is more appropriate for representing the spreading of cell populations. Furthermore, there is no knowledge of particular experimental measurements that can be made to distinguish between situations where these two models are appropriate. Here we provide a link between individual-based and continuum models using a multiscale approach in which we analyze the collective motion of a population of interacting agents in a generalized lattice-based exclusion process. For round agents that occupy a single lattice site, we find that the relevant continuum description of the system is a linear diffusion equation, whereas for elongated rod-shaped agents that occupy L adjacent lattice sites we find that the relevant continuum description is connected to the porous media equation (PME). The exponent in the nonlinear diffusivity function is related to the aspect ratio of the agents. Our work provides a physical connection between modeling collective cell spreading and the use of either the linear diffusion equation or the PME to represent cell density profiles. Results suggest that when using continuum models to represent cell population spreading, we should take care to account for variations in the cell aspect ratio because different aspect ratios lead to different continuum models.

A Comparison of Two-Stage Approaches for Fitting Nonlinear Ordinary Differential Equation (ODE) Models with Mixed Effects

PubMed Central

Chow, Sy-Miin; Bendezú, Jason J.; Cole, Pamela M.; Ram, Nilam

2016-01-01

Several approaches currently exist for estimating the derivatives of observed data for model exploration purposes, including functional data analysis (FDA), generalized local linear approximation (GLLA), and generalized orthogonal local derivative approximation (GOLD). These derivative estimation procedures can be used in a two-stage process to fit mixed effects ordinary differential equation (ODE) models. While the performance and utility of these routines for estimating linear ODEs have been established, they have not yet been evaluated in the context of nonlinear ODEs with mixed effects. We compared properties of the GLLA and GOLD to an FDA-based two-stage approach denoted herein as functional ordinary differential equation with mixed effects (FODEmixed) in a Monte Carlo study using a nonlinear coupled oscillators model with mixed effects. Simulation results showed that overall, the FODEmixed outperformed both the GLLA and GOLD across all the embedding dimensions considered, but a novel use of a fourth-order GLLA approach combined with very high embedding dimensions yielded estimation results that almost paralleled those from the FODEmixed. We discuss the strengths and limitations of each approach and demonstrate how output from each stage of FODEmixed may be used to inform empirical modeling of young children’s self-regulation. PMID:27391255

A Comparison of Two-Stage Approaches for Fitting Nonlinear Ordinary Differential Equation Models with Mixed Effects.

PubMed

Chow, Sy-Miin; Bendezú, Jason J; Cole, Pamela M; Ram, Nilam

2016-01-01

Several approaches exist for estimating the derivatives of observed data for model exploration purposes, including functional data analysis (FDA; Ramsay & Silverman, 2005 ), generalized local linear approximation (GLLA; Boker, Deboeck, Edler, & Peel, 2010 ), and generalized orthogonal local derivative approximation (GOLD; Deboeck, 2010 ). These derivative estimation procedures can be used in a two-stage process to fit mixed effects ordinary differential equation (ODE) models. While the performance and utility of these routines for estimating linear ODEs have been established, they have not yet been evaluated in the context of nonlinear ODEs with mixed effects. We compared properties of the GLLA and GOLD to an FDA-based two-stage approach denoted herein as functional ordinary differential equation with mixed effects (FODEmixed) in a Monte Carlo (MC) study using a nonlinear coupled oscillators model with mixed effects. Simulation results showed that overall, the FODEmixed outperformed both the GLLA and GOLD across all the embedding dimensions considered, but a novel use of a fourth-order GLLA approach combined with very high embedding dimensions yielded estimation results that almost paralleled those from the FODEmixed. We discuss the strengths and limitations of each approach and demonstrate how output from each stage of FODEmixed may be used to inform empirical modeling of young children's self-regulation.

A Refined Model for Radar Homing Intercepts.

DTIC Science & Technology

1983-10-27

Helge Toutenburq, Prior Information in Linear Models ,(Wiley, NY, 1982). 7. F. A. Graybill , Introduction to Matrices with Applications in StatisticF... linear target trajectory model z i = 0 + 1 r i + wi () where w i i=I,..., N is a sequence of uncorrelated zero-mean A noise, the general formula for...z i (i=l,..., N) at r. and a linear regression model 1 z i = a0 + a1 r i + w i =(Al) where wi is the corruption noise; the problem is to estimate a0

Using generalized linear models to estimate selectivity from short-term recoveries of tagged red drum Sciaenops ocellatus: Effects of gear, fate, and regulation period

USGS Publications Warehouse

Bacheler, N.M.; Hightower, J.E.; Burdick, S.M.; Paramore, L.M.; Buckel, J.A.; Pollock, K.H.

2010-01-01

Estimating the selectivity patterns of various fishing gears is a critical component of fisheries stock assessment due to the difficulty in obtaining representative samples from most gears. We used short-term recoveries (n = 3587) of tagged red drum Sciaenops ocellatus to directly estimate age- and length-based selectivity patterns using generalized linear models. The most parsimonious models were selected using AIC, and standard deviations were estimated using simulations. Selectivity of red drum was dependent upon the regulation period in which the fish was caught, the gear used to catch the fish (i.e., hook-and-line, gill nets, pound nets), and the fate of the fish upon recovery (i.e., harvested or released); models including all first-order interactions between main effects outperformed models without interactions. Selectivity of harvested fish was generally dome-shaped and shifted toward larger, older fish in response to regulation changes. Selectivity of caught-and-released red drum was highest on the youngest and smallest fish in the early and middle regulation periods, but increased on larger, legal-sized fish in the late regulation period. These results suggest that catch-and-release mortality has consistently been high for small, young red drum, but has recently become more common in larger, older fish. This method of estimating selectivity from short-term tag recoveries is valuable because it is simpler than full tag-return models, and may be more robust because yearly fishing and natural mortality rates do not need to be modeled and estimated. ?? 2009 Elsevier B.V.

Using generalized linear models to estimate selectivity from short-term recoveries of tagged red drum Sciaenops ocellatus: Effects of gear, fate, and regulation period

USGS Publications Warehouse

Burdick, Summer M.; Hightower, Joseph E.; Bacheler, Nathan M.; Paramore, Lee M.; Buckel, Jeffrey A.; Pollock, Kenneth H.

2010-01-01

Estimating the selectivity patterns of various fishing gears is a critical component of fisheries stock assessment due to the difficulty in obtaining representative samples from most gears. We used short-term recoveries (n = 3587) of tagged red drum Sciaenops ocellatus to directly estimate age- and length-based selectivity patterns using generalized linear models. The most parsimonious models were selected using AIC, and standard deviations were estimated using simulations. Selectivity of red drum was dependent upon the regulation period in which the fish was caught, the gear used to catch the fish (i.e., hook-and-line, gill nets, pound nets), and the fate of the fish upon recovery (i.e., harvested or released); models including all first-order interactions between main effects outperformed models without interactions. Selectivity of harvested fish was generally dome-shaped and shifted toward larger, older fish in response to regulation changes. Selectivity of caught-and-released red drum was highest on the youngest and smallest fish in the early and middle regulation periods, but increased on larger, legal-sized fish in the late regulation period. These results suggest that catch-and-release mortality has consistently been high for small, young red drum, but has recently become more common in larger, older fish. This method of estimating selectivity from short-term tag recoveries is valuable because it is simpler than full tag-return models, and may be more robust because yearly fishing and natural mortality rates do not need to be modeled and estimated.

Modeling Learning in Doubly Multilevel Binary Longitudinal Data Using Generalized Linear Mixed Models: An Application to Measuring and Explaining Word Learning.

PubMed

Cho, Sun-Joo; Goodwin, Amanda P

2016-04-01

When word learning is supported by instruction in experimental studies for adolescents, word knowledge outcomes tend to be collected from complex data structure, such as multiple aspects of word knowledge, multilevel reader data, multilevel item data, longitudinal design, and multiple groups. This study illustrates how generalized linear mixed models can be used to measure and explain word learning for data having such complexity. Results from this application provide deeper understanding of word knowledge than could be attained from simpler models and show that word knowledge is multidimensional and depends on word characteristics and instructional contexts.

Documenting Differences between Early Stone Age Flake Production Systems: An Experimental Model and Archaeological Verification.

PubMed

Presnyakova, Darya; Archer, Will; Braun, David R; Flear, Wesley

2015-01-01

This study investigates morphological differences between flakes produced via "core and flake" technologies and those resulting from bifacial shaping strategies. We investigate systematic variation between two technological groups of flakes using experimentally produced assemblages, and then apply the experimental model to the Cutting 10 Mid -Pleistocene archaeological collection from Elandsfontein, South Africa. We argue that a specific set of independent variables--and their interactions--including external platform angle, platform depth, measures of thickness variance and flake curvature should distinguish between these two technological groups. The role of these variables in technological group separation was further investigated using the Generalized Linear Model as well as Linear Discriminant Analysis. The Discriminant model was used to classify archaeological flakes from the Cutting 10 locality in terms of their probability of association, within either experimentally developed technological group. The results indicate that the selected independent variables play a central role in separating core and flake from bifacial technologies. Thickness evenness and curvature had the greatest effect sizes in both the Generalized Linear and Discriminant models. Interestingly the interaction between thickness evenness and platform depth was significant and played an important role in influencing technological group membership. The identified interaction emphasizes the complexity in attempting to distinguish flake production strategies based on flake morphological attributes. The results of the discriminant function analysis demonstrate that the majority of flakes at the Cutting 10 locality were not associated with the production of the numerous Large Cutting Tools found at the site, which corresponds with previous suggestions regarding technological behaviors reflected in this assemblage.

Documenting Differences between Early Stone Age Flake Production Systems: An Experimental Model and Archaeological Verification

PubMed Central

Presnyakova, Darya; Archer, Will; Braun, David R.; Flear, Wesley

2015-01-01

This study investigates morphological differences between flakes produced via “core and flake” technologies and those resulting from bifacial shaping strategies. We investigate systematic variation between two technological groups of flakes using experimentally produced assemblages, and then apply the experimental model to the Cutting 10 Mid -Pleistocene archaeological collection from Elandsfontein, South Africa. We argue that a specific set of independent variables—and their interactions—including external platform angle, platform depth, measures of thickness variance and flake curvature should distinguish between these two technological groups. The role of these variables in technological group separation was further investigated using the Generalized Linear Model as well as Linear Discriminant Analysis. The Discriminant model was used to classify archaeological flakes from the Cutting 10 locality in terms of their probability of association, within either experimentally developed technological group. The results indicate that the selected independent variables play a central role in separating core and flake from bifacial technologies. Thickness evenness and curvature had the greatest effect sizes in both the Generalized Linear and Discriminant models. Interestingly the interaction between thickness evenness and platform depth was significant and played an important role in influencing technological group membership. The identified interaction emphasizes the complexity in attempting to distinguish flake production strategies based on flake morphological attributes. The results of the discriminant function analysis demonstrate that the majority of flakes at the Cutting 10 locality were not associated with the production of the numerous Large Cutting Tools found at the site, which corresponds with previous suggestions regarding technological behaviors reflected in this assemblage. PMID:26111251

Bayes factors for the linear ballistic accumulator model of decision-making.

PubMed

Evans, Nathan J; Brown, Scott D

2018-04-01

Evidence accumulation models of decision-making have led to advances in several different areas of psychology. These models provide a way to integrate response time and accuracy data, and to describe performance in terms of latent cognitive processes. Testing important psychological hypotheses using cognitive models requires a method to make inferences about different versions of the models which assume different parameters to cause observed effects. The task of model-based inference using noisy data is difficult, and has proven especially problematic with current model selection methods based on parameter estimation. We provide a method for computing Bayes factors through Monte-Carlo integration for the linear ballistic accumulator (LBA; Brown and Heathcote, 2008), a widely used evidence accumulation model. Bayes factors are used frequently for inference with simpler statistical models, and they do not require parameter estimation. In order to overcome the computational burden of estimating Bayes factors via brute force integration, we exploit general purpose graphical processing units; we provide free code for this. This approach allows estimation of Bayes factors via Monte-Carlo integration within a practical time frame. We demonstrate the method using both simulated and real data. We investigate the stability of the Monte-Carlo approximation, and the LBA's inferential properties, in simulation studies.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, X; Petrongolo, M; Wang, T

Purpose: A general problem of dual-energy CT (DECT) is that the decomposition is sensitive to noise in the two sets of dual-energy projection data, resulting in severely degraded qualities of decomposed images. We have previously proposed an iterative denoising method for DECT. Using a linear decomposition function, the method does not gain the full benefits of DECT on beam-hardening correction. In this work, we expand the framework of our iterative method to include non-linear decomposition models for noise suppression in DECT. Methods: We first obtain decomposed projections, which are free of beam-hardening artifacts, using a lookup table pre-measured on amore » calibration phantom. First-pass material images with high noise are reconstructed from the decomposed projections using standard filter-backprojection reconstruction. Noise on the decomposed images is then suppressed by an iterative method, which is formulated in the form of least-square estimation with smoothness regularization. Based on the design principles of a best linear unbiased estimator, we include the inverse of the estimated variance-covariance matrix of the decomposed images as the penalty weight in the least-square term. Analytical formulae are derived to compute the variance-covariance matrix from the measured decomposition lookup table. Results: We have evaluated the proposed method via phantom studies. Using non-linear decomposition, our method effectively suppresses the streaking artifacts of beam-hardening and obtains more uniform images than our previous approach based on a linear model. The proposed method reduces the average noise standard deviation of two basis materials by one order of magnitude without sacrificing the spatial resolution. Conclusion: We propose a general framework of iterative denoising for material decomposition of DECT. Preliminary phantom studies have shown the proposed method improves the image uniformity and reduces noise level without resolution loss. In the future, we will perform more phantom studies to further validate the performance of the purposed method. This work is supported by a Varian MRA grant.« less

Bayesian reconstruction of projection reconstruction NMR (PR-NMR).

PubMed

Yoon, Ji Won

2014-11-01

Projection reconstruction nuclear magnetic resonance (PR-NMR) is a technique for generating multidimensional NMR spectra. A small number of projections from lower-dimensional NMR spectra are used to reconstruct the multidimensional NMR spectra. In our previous work, it was shown that multidimensional NMR spectra are efficiently reconstructed using peak-by-peak based reversible jump Markov chain Monte Carlo (RJMCMC) algorithm. We propose an extended and generalized RJMCMC algorithm replacing a simple linear model with a linear mixed model to reconstruct close NMR spectra into true spectra. This statistical method generates samples in a Bayesian scheme. Our proposed algorithm is tested on a set of six projections derived from the three-dimensional 700 MHz HNCO spectrum of a protein HasA. Copyright © 2014 Elsevier Ltd. All rights reserved.

Feature-space-based FMRI analysis using the optimal linear transformation.

PubMed

Sun, Fengrong; Morris, Drew; Lee, Wayne; Taylor, Margot J; Mills, Travis; Babyn, Paul S

2010-09-01

The optimal linear transformation (OLT), an image analysis technique of feature space, was first presented in the field of MRI. This paper proposes a method of extending OLT from MRI to functional MRI (fMRI) to improve the activation-detection performance over conventional approaches of fMRI analysis. In this method, first, ideal hemodynamic response time series for different stimuli were generated by convolving the theoretical hemodynamic response model with the stimulus timing. Second, constructing hypothetical signature vectors for different activity patterns of interest by virtue of the ideal hemodynamic responses, OLT was used to extract features of fMRI data. The resultant feature space had particular geometric clustering properties. It was then classified into different groups, each pertaining to an activity pattern of interest; the applied signature vector for each group was obtained by averaging. Third, using the applied signature vectors, OLT was applied again to generate fMRI composite images with high SNRs for the desired activity patterns. Simulations and a blocked fMRI experiment were employed for the method to be verified and compared with the general linear model (GLM)-based analysis. The simulation studies and the experimental results indicated the superiority of the proposed method over the GLM-based analysis in detecting brain activities.

Vibrational spectroscopy via the Caldeira-Leggett model with anharmonic system potentials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gottwald, Fabian; Ivanov, Sergei D., E-mail: sergei.ivanov@uni-rostock.de; Kühn, Oliver

2016-04-28

The Caldeira-Leggett (CL) model, which describes a system bi-linearly coupled to a harmonic bath, has enjoyed popularity in condensed phase spectroscopy owing to its utmost simplicity. However, the applicability of the model to cases with anharmonic system potentials, as it is required for the description of realistic systems in solution, is questionable due to the presence of the invertibility problem [F. Gottwald et al., J. Phys. Chem. Lett. 6, 2722 (2015)] unless the system itself resembles the CL model form. This might well be the case at surfaces or in the solid regime, which we here confirm for a particularmore » example of an iodine molecule in the atomic argon environment under high pressure. For this purpose we extend the recently proposed Fourier method for parameterizing linear generalized Langevin dynamics [F. Gottwald et al., J. Chem. Phys. 142, 244110 (2015)] to the non-linear case based on the CL model and perform an extensive error analysis. In order to judge on the applicability of this model in advance, we give practical empirical criteria and discuss the effect of the potential renormalization term. The obtained results provide evidence that the CL model can be used for describing a potentially broad class of systems.« less

IPA (v1): a framework for agent-based modelling of soil water movement

NASA Astrophysics Data System (ADS)

Mewes, Benjamin; Schumann, Andreas H.

2018-06-01

In the last decade, agent-based modelling (ABM) became a popular modelling technique in social sciences, medicine, biology, and ecology. ABM was designed to simulate systems that are highly dynamic and sensitive to small variations in their composition and their state. As hydrological systems, and natural systems in general, often show dynamic and non-linear behaviour, ABM can be an appropriate way to model these systems. Nevertheless, only a few studies have utilized the ABM method for process-based modelling in hydrology. The percolation of water through the unsaturated soil is highly responsive to the current state of the soil system; small variations in composition lead to major changes in the transport system. Hence, we present a new approach for modelling the movement of water through a soil column: autonomous water agents that transport water through the soil while interacting with their environment as well as with other agents under physical laws.

Description of a computer program and numerical techniques for developing linear perturbation models from nonlinear systems simulations

NASA Technical Reports Server (NTRS)

Dieudonne, J. E.

1978-01-01

A numerical technique was developed which generates linear perturbation models from nonlinear aircraft vehicle simulations. The technique is very general and can be applied to simulations of any system that is described by nonlinear differential equations. The computer program used to generate these models is discussed, with emphasis placed on generation of the Jacobian matrices, calculation of the coefficients needed for solving the perturbation model, and generation of the solution of the linear differential equations. An example application of the technique to a nonlinear model of the NASA terminal configured vehicle is included.

Generalized linear and generalized additive models in studies of species distributions: Setting the scene

USGS Publications Warehouse

Guisan, Antoine; Edwards, T.C.; Hastie, T.

2002-01-01

An important statistical development of the last 30 years has been the advance in regression analysis provided by generalized linear models (GLMs) and generalized additive models (GAMs). Here we introduce a series of papers prepared within the framework of an international workshop entitled: Advances in GLMs/GAMs modeling: from species distribution to environmental management, held in Riederalp, Switzerland, 6-11 August 2001. We first discuss some general uses of statistical models in ecology, as well as provide a short review of several key examples of the use of GLMs and GAMs in ecological modeling efforts. We next present an overview of GLMs and GAMs, and discuss some of their related statistics used for predictor selection, model diagnostics, and evaluation. Included is a discussion of several new approaches applicable to GLMs and GAMs, such as ridge regression, an alternative to stepwise selection of predictors, and methods for the identification of interactions by a combined use of regression trees and several other approaches. We close with an overview of the papers and how we feel they advance our understanding of their application to ecological modeling. ?? 2002 Elsevier Science B.V. All rights reserved.

Hydrodynamic representation of the Klein-Gordon-Einstein equations in the weak field limit: General formalism and perturbations analysis

NASA Astrophysics Data System (ADS)

Suárez, Abril; Chavanis, Pierre-Henri

2015-07-01

Using a generalization of the Madelung transformation, we derive the hydrodynamic representation of the Klein-Gordon-Einstein equations in the weak field limit. We consider a complex self-interacting scalar field with a λ |φ |4 potential. We study the evolution of the spatially homogeneous background in the fluid representation and derive the linearized equations describing the evolution of small perturbations in a static and in an expanding Universe. We compare the results with simplified models in which the gravitational potential is introduced by hand in the Klein-Gordon equation, and assumed to satisfy a (generalized) Poisson equation. Nonrelativistic hydrodynamic equations based on the Schrödinger-Poisson equations or on the Gross-Pitaevskii-Poisson equations are recovered in the limit c →+∞. We study the evolution of the perturbations in the matter era using the nonrelativistic limit of our formalism. Perturbations whose wavelength is below the Jeans length oscillate in time while perturbations whose wavelength is above the Jeans length grow linearly with the scale factor as in the cold dark matter model. The growth of perturbations in the scalar field model is substantially faster than in the cold dark matter model. When the wavelength of the perturbations approaches the cosmological horizon (Hubble length), a relativistic treatment is mandatory. In that case, we find that relativistic effects attenuate or even prevent the growth of perturbations. This paper exposes the general formalism and provides illustrations in simple cases. Other applications of our formalism will be considered in companion papers.

DOE Office of Scientific and Technical Information (OSTI.GOV)

van Rij, Jennifer A; Yu, Yi-Hsiang; Guo, Yi

This study explores and verifies the generalized body-modes method for evaluating the structural loads on a wave energy converter (WEC). Historically, WEC design methodologies have focused primarily on accurately evaluating hydrodynamic loads, while methodologies for evaluating structural loads have yet to be fully considered and incorporated into the WEC design process. As wave energy technologies continue to advance, however, it has become increasingly evident that an accurate evaluation of the structural loads will enable an optimized structural design, as well as the potential utilization of composites and flexible materials, and hence reduce WEC costs. Although there are many computational fluidmore » dynamics, structural analyses and fluid-structure-interaction (FSI) codes available, the application of these codes is typically too computationally intensive to be practical in the early stages of the WEC design process. The generalized body-modes method, however, is a reduced order, linearized, frequency-domain FSI approach, performed in conjunction with the linear hydrodynamic analysis, with computation times that could realistically be incorporated into the WEC design process. The objective of this study is to verify the generalized body-modes approach in comparison to high-fidelity FSI simulations to accurately predict structural deflections and stress loads in a WEC. Two verification cases are considered, a free-floating barge and a fixed-bottom column. Details for both the generalized body-modes models and FSI models are first provided. Results for each of the models are then compared and discussed. Finally, based on the verification results obtained, future plans for incorporating the generalized body-modes method into the WEC simulation tool, WEC-Sim, and the overall WEC design process are discussed.« less

Effect of linear and non-linear blade modelling techniques on simulated fatigue and extreme loads using Bladed

NASA Astrophysics Data System (ADS)

Beardsell, Alec; Collier, William; Han, Tao

2016-09-01

There is a trend in the wind industry towards ever larger and more flexible turbine blades. Blade tip deflections in modern blades now commonly exceed 10% of blade length. Historically, the dynamic response of wind turbine blades has been analysed using linear models of blade deflection which include the assumption of small deflections. For modern flexible blades, this assumption is becoming less valid. In order to continue to simulate dynamic turbine performance accurately, routine use of non-linear models of blade deflection may be required. This can be achieved by representing the blade as a connected series of individual flexible linear bodies - referred to in this paper as the multi-part approach. In this paper, Bladed is used to compare load predictions using single-part and multi-part blade models for several turbines. The study examines the impact on fatigue and extreme loads and blade deflection through reduced sets of load calculations based on IEC 61400-1 ed. 3. Damage equivalent load changes of up to 16% and extreme load changes of up to 29% are observed at some turbine load locations. It is found that there is no general pattern in the loading differences observed between single-part and multi-part blade models. Rather, changes in fatigue and extreme loads with a multi-part blade model depend on the characteristics of the individual turbine and blade. Key underlying causes of damage equivalent load change are identified as differences in edgewise- torsional coupling between the multi-part and single-part models, and increased edgewise rotor mode damping in the multi-part model. Similarly, a causal link is identified between torsional blade dynamics and changes in ultimate load results.

A meshless EFG-based algorithm for 3D deformable modeling of soft tissue in real-time.

PubMed

Abdi, Elahe; Farahmand, Farzam; Durali, Mohammad

2012-01-01

The meshless element-free Galerkin method was generalized and an algorithm was developed for 3D dynamic modeling of deformable bodies in real time. The efficacy of the algorithm was investigated in a 3D linear viscoelastic model of human spleen subjected to a time-varying compressive force exerted by a surgical grasper. The model remained stable in spite of the considerably large deformations occurred. There was a good agreement between the results and those of an equivalent finite element model. The computational cost, however, was much lower, enabling the proposed algorithm to be effectively used in real-time applications.

A road map for multi-way calibration models.

PubMed

Escandar, Graciela M; Olivieri, Alejandro C

2017-08-07

A large number of experimental applications of multi-way calibration are known, and a variety of chemometric models are available for the processing of multi-way data. While the main focus has been directed towards three-way data, due to the availability of various instrumental matrix measurements, a growing number of reports are being produced on order signals of increasing complexity. The purpose of this review is to present a general scheme for selecting the appropriate data processing model, according to the properties exhibited by the multi-way data. In spite of the complexity of the multi-way instrumental measurements, simple criteria can be proposed for model selection, based on the presence and number of the so-called multi-linearity breaking modes (instrumental modes that break the low-rank multi-linearity of the multi-way arrays), and also on the existence of mutually dependent instrumental modes. Recent literature reports on multi-way calibration are reviewed, with emphasis on the models that were selected for data processing.

Genetic mixed linear models for twin survival data.

PubMed

Ha, Il Do; Lee, Youngjo; Pawitan, Yudi

2007-07-01

Twin studies are useful for assessing the relative importance of genetic or heritable component from the environmental component. In this paper we develop a methodology to study the heritability of age-at-onset or lifespan traits, with application to analysis of twin survival data. Due to limited period of observation, the data can be left truncated and right censored (LTRC). Under the LTRC setting we propose a genetic mixed linear model, which allows general fixed predictors and random components to capture genetic and environmental effects. Inferences are based upon the hierarchical-likelihood (h-likelihood), which provides a statistically efficient and unified framework for various mixed-effect models. We also propose a simple and fast computation method for dealing with large data sets. The method is illustrated by the survival data from the Swedish Twin Registry. Finally, a simulation study is carried out to evaluate its performance.

Linear Mixed Models: Gum and Beyond

NASA Astrophysics Data System (ADS)

Arendacká, Barbora; Täubner, Angelika; Eichstädt, Sascha; Bruns, Thomas; Elster, Clemens

2014-04-01

In Annex H.5, the Guide to the Evaluation of Uncertainty in Measurement (GUM) [1] recognizes the necessity to analyze certain types of experiments by applying random effects ANOVA models. These belong to the more general family of linear mixed models that we focus on in the current paper. Extending the short introduction provided by the GUM, our aim is to show that the more general, linear mixed models cover a wider range of situations occurring in practice and can be beneficial when employed in data analysis of long-term repeated experiments. Namely, we point out their potential as an aid in establishing an uncertainty budget and as means for gaining more insight into the measurement process. We also comment on computational issues and to make the explanations less abstract, we illustrate all the concepts with the help of a measurement campaign conducted in order to challenge the uncertainty budget in calibration of accelerometers.

Explicit criteria for prioritization of cataract surgery

PubMed Central

Ma Quintana, José; Escobar, Antonio; Bilbao, Amaia

2006-01-01

Background Consensus techniques have been used previously to create explicit criteria to prioritize cataract extraction; however, the appropriateness of the intervention was not included explicitly in previous studies. We developed a prioritization tool for cataract extraction according to the RAND method. Methods Criteria were developed using a modified Delphi panel judgment process. A panel of 11 ophthalmologists was assembled. Ratings were analyzed regarding the level of agreement among panelists. We studied the effect of all variables on the final panel score using general linear and logistic regression models. Priority scoring systems were developed by means of optimal scaling and general linear models. The explicit criteria developed were summarized by means of regression tree analysis. Results Eight variables were considered to create the indications. Of the 310 indications that the panel evaluated, 22.6% were considered high priority, 52.3% intermediate priority, and 25.2% low priority. Agreement was reached for 31.9% of the indications and disagreement for 0.3%. Logistic regression and general linear models showed that the preoperative visual acuity of the cataractous eye, visual function, and anticipated visual acuity postoperatively were the most influential variables. Alternative and simple scoring systems were obtained by optimal scaling and general linear models where the previous variables were also the most important. The decision tree also shows the importance of the previous variables and the appropriateness of the intervention. Conclusion Our results showed acceptable validity as an evaluation and management tool for prioritizing cataract extraction. It also provides easy algorithms for use in clinical practice. PMID:16512893

Review of Statistical Methods for Analysing Healthcare Resources and Costs

PubMed Central

Mihaylova, Borislava; Briggs, Andrew; O'Hagan, Anthony; Thompson, Simon G

2011-01-01

We review statistical methods for analysing healthcare resource use and costs, their ability to address skewness, excess zeros, multimodality and heavy right tails, and their ease for general use. We aim to provide guidance on analysing resource use and costs focusing on randomised trials, although methods often have wider applicability. Twelve broad categories of methods were identified: (I) methods based on the normal distribution, (II) methods following transformation of data, (III) single-distribution generalized linear models (GLMs), (IV) parametric models based on skewed distributions outside the GLM family, (V) models based on mixtures of parametric distributions, (VI) two (or multi)-part and Tobit models, (VII) survival methods, (VIII) non-parametric methods, (IX) methods based on truncation or trimming of data, (X) data components models, (XI) methods based on averaging across models, and (XII) Markov chain methods. Based on this review, our recommendations are that, first, simple methods are preferred in large samples where the near-normality of sample means is assured. Second, in somewhat smaller samples, relatively simple methods, able to deal with one or two of above data characteristics, may be preferable but checking sensitivity to assumptions is necessary. Finally, some more complex methods hold promise, but are relatively untried; their implementation requires substantial expertise and they are not currently recommended for wider applied work. Copyright © 2010 John Wiley & Sons, Ltd. PMID:20799344

Product unit neural network models for predicting the growth limits of Listeria monocytogenes.

PubMed

Valero, A; Hervás, C; García-Gimeno, R M; Zurera, G

2007-08-01

A new approach to predict the growth/no growth interface of Listeria monocytogenes as a function of storage temperature, pH, citric acid (CA) and ascorbic acid (AA) is presented. A linear logistic regression procedure was performed and a non-linear model was obtained by adding new variables by means of a Neural Network model based on Product Units (PUNN). The classification efficiency of the training data set and the generalization data of the new Logistic Regression PUNN model (LRPU) were compared with Linear Logistic Regression (LLR) and Polynomial Logistic Regression (PLR) models. 92% of the total cases from the LRPU model were correctly classified, an improvement on the percentage obtained using the PLR model (90%) and significantly higher than the results obtained with the LLR model, 80%. On the other hand predictions of LRPU were closer to data observed which permits to design proper formulations in minimally processed foods. This novel methodology can be applied to predictive microbiology for describing growth/no growth interface of food-borne microorganisms such as L. monocytogenes. The optimal balance is trying to find models with an acceptable interpretation capacity and with good ability to fit the data on the boundaries of variable range. The results obtained conclude that these kinds of models might well be very a valuable tool for mathematical modeling.

Commensurate Priors for Incorporating Historical Information in Clinical Trials Using General and Generalized Linear Models

PubMed Central

Hobbs, Brian P.; Sargent, Daniel J.; Carlin, Bradley P.

2014-01-01

Assessing between-study variability in the context of conventional random-effects meta-analysis is notoriously difficult when incorporating data from only a small number of historical studies. In order to borrow strength, historical and current data are often assumed to be fully homogeneous, but this can have drastic consequences for power and Type I error if the historical information is biased. In this paper, we propose empirical and fully Bayesian modifications of the commensurate prior model (Hobbs et al., 2011) extending Pocock (1976), and evaluate their frequentist and Bayesian properties for incorporating patient-level historical data using general and generalized linear mixed regression models. Our proposed commensurate prior models lead to preposterior admissible estimators that facilitate alternative bias-variance trade-offs than those offered by pre-existing methodologies for incorporating historical data from a small number of historical studies. We also provide a sample analysis of a colon cancer trial comparing time-to-disease progression using a Weibull regression model. PMID:24795786

A comparison of methods to handle skew distributed cost variables in the analysis of the resource consumption in schizophrenia treatment.

PubMed

Kilian, Reinhold; Matschinger, Herbert; Löeffler, Walter; Roick, Christiane; Angermeyer, Matthias C

2002-03-01

Transformation of the dependent cost variable is often used to solve the problems of heteroscedasticity and skewness in linear ordinary least square regression of health service cost data. However, transformation may cause difficulties in the interpretation of regression coefficients and the retransformation of predicted values. The study compares the advantages and disadvantages of different methods to estimate regression based cost functions using data on the annual costs of schizophrenia treatment. Annual costs of psychiatric service use and clinical and socio-demographic characteristics of the patients were assessed for a sample of 254 patients with a diagnosis of schizophrenia (ICD-10 F 20.0) living in Leipzig. The clinical characteristics of the participants were assessed by means of the BPRS 4.0, the GAF, and the CAN for service needs. Quality of life was measured by WHOQOL-BREF. A linear OLS regression model with non-parametric standard errors, a log-transformed OLS model and a generalized linear model with a log-link and a gamma distribution were used to estimate service costs. For the estimation of robust non-parametric standard errors, the variance estimator by White and a bootstrap estimator based on 2000 replications were employed. Models were evaluated by the comparison of the R2 and the root mean squared error (RMSE). RMSE of the log-transformed OLS model was computed with three different methods of bias-correction. The 95% confidence intervals for the differences between the RMSE were computed by means of bootstrapping. A split-sample-cross-validation procedure was used to forecast the costs for the one half of the sample on the basis of a regression equation computed for the other half of the sample. All three methods showed significant positive influences of psychiatric symptoms and met psychiatric service needs on service costs. Only the log- transformed OLS model showed a significant negative impact of age, and only the GLM shows a significant negative influences of employment status and partnership on costs. All three models provided a R2 of about.31. The Residuals of the linear OLS model revealed significant deviances from normality and homoscedasticity. The residuals of the log-transformed model are normally distributed but still heteroscedastic. The linear OLS model provided the lowest prediction error and the best forecast of the dependent cost variable. The log-transformed model provided the lowest RMSE if the heteroscedastic bias correction was used. The RMSE of the GLM with a log link and a gamma distribution was higher than those of the linear OLS model and the log-transformed OLS model. The difference between the RMSE of the linear OLS model and that of the log-transformed OLS model without bias correction was significant at the 95% level. As result of the cross-validation procedure, the linear OLS model provided the lowest RMSE followed by the log-transformed OLS model with a heteroscedastic bias correction. The GLM showed the weakest model fit again. None of the differences between the RMSE resulting form the cross- validation procedure were found to be significant. The comparison of the fit indices of the different regression models revealed that the linear OLS model provided a better fit than the log-transformed model and the GLM, but the differences between the models RMSE were not significant. Due to the small number of cases in the study the lack of significance does not sufficiently proof that the differences between the RSME for the different models are zero and the superiority of the linear OLS model can not be generalized. The lack of significant differences among the alternative estimators may reflect a lack of sample size adequate to detect important differences among the estimators employed. Further studies with larger case number are necessary to confirm the results. Specification of an adequate regression models requires a careful examination of the characteristics of the data. Estimation of standard errors and confidence intervals by nonparametric methods which are robust against deviations from the normal distribution and the homoscedasticity of residuals are suitable alternatives to the transformation of the skew distributed dependent variable. Further studies with more adequate case numbers are needed to confirm the results.

Theoretical and experimental investigations on the dynamic and thermodynamic characteristics of the linear compressor for the pulse tube cryocooler

NASA Astrophysics Data System (ADS)

Zhang, L.; Dang, H. Z.; Tan, J.; Bao, D.; Zhao, Y. B.; Qian, G. Z.

2015-12-01

Theoretical and experimental investigations on the dynamic and thermodynamic characteristics of a linear compressor incorporating the thermodynamic characteristics of the inertance tube pulse tube cold finger have been made. Both the compressor and cold finger are assumed as a one-dimensional thermodynamic model. The governing equations of the thermodynamic characteristics of the working gas are summarized, and the effects of the cooling performance on the working gas in the compression space are discussed. Based on the analysis of the working gas, the governing equations of the dynamic and thermodynamic characteristics of the compressor are deduced, and then the principles of achieving the optimal performance of the compressor are discussed in detail. Systematic experimental investigations are conducted on a developed moving-coil linear compressor which drives a pulse tube cold finger, which indicate the general agreement with the simulated results, and thus verify the rationality of the theoretical model and analyses.

A general computation model based on inverse analysis principle used for rheological analysis of W/O rapeseed and soybean oil emulsions

NASA Astrophysics Data System (ADS)

Vintila, Iuliana; Gavrus, Adinel

2017-10-01

The present research paper proposes the validation of a rigorous computation model used as a numerical tool to identify rheological behavior of complex emulsions W/O. Considering a three-dimensional description of a general viscoplastic flow it is detailed the thermo-mechanical equations used to identify fluid or soft material's rheological laws starting from global experimental measurements. Analyses are conducted for complex emulsions W/O having generally a Bingham behavior using the shear stress - strain rate dependency based on a power law and using an improved analytical model. Experimental results are investigated in case of rheological behavior for crude and refined rapeseed/soybean oils and four types of corresponding W/O emulsions using different physical-chemical composition. The rheological behavior model was correlated with the thermo-mechanical analysis of a plane-plane rheometer, oil content, chemical composition, particle size and emulsifier's concentration. The parameters of rheological laws describing the industrial oils and the W/O concentrated emulsions behavior were computed from estimated shear stresses using a non-linear regression technique and from experimental torques using the inverse analysis tool designed by A. Gavrus (1992-2000).

A class of non-linear exposure-response models suitable for health impact assessment applicable to large cohort studies of ambient air pollution.

PubMed

Nasari, Masoud M; Szyszkowicz, Mieczysław; Chen, Hong; Crouse, Daniel; Turner, Michelle C; Jerrett, Michael; Pope, C Arden; Hubbell, Bryan; Fann, Neal; Cohen, Aaron; Gapstur, Susan M; Diver, W Ryan; Stieb, David; Forouzanfar, Mohammad H; Kim, Sun-Young; Olives, Casey; Krewski, Daniel; Burnett, Richard T

2016-01-01

The effectiveness of regulatory actions designed to improve air quality is often assessed by predicting changes in public health resulting from their implementation. Risk of premature mortality from long-term exposure to ambient air pollution is the single most important contributor to such assessments and is estimated from observational studies generally assuming a log-linear, no-threshold association between ambient concentrations and death. There has been only limited assessment of this assumption in part because of a lack of methods to estimate the shape of the exposure-response function in very large study populations. In this paper, we propose a new class of variable coefficient risk functions capable of capturing a variety of potentially non-linear associations which are suitable for health impact assessment. We construct the class by defining transformations of concentration as the product of either a linear or log-linear function of concentration multiplied by a logistic weighting function. These risk functions can be estimated using hazard regression survival models with currently available computer software and can accommodate large population-based cohorts which are increasingly being used for this purpose. We illustrate our modeling approach with two large cohort studies of long-term concentrations of ambient air pollution and mortality: the American Cancer Society Cancer Prevention Study II (CPS II) cohort and the Canadian Census Health and Environment Cohort (CanCHEC). We then estimate the number of deaths attributable to changes in fine particulate matter concentrations over the 2000 to 2010 time period in both Canada and the USA using both linear and non-linear hazard function models.

A DGTD method for the numerical modeling of the interaction of light with nanometer scale metallic structures taking into account non-local dispersion effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schmitt, Nikolai; Technische Universitaet Darmstadt, Institut fuer Theorie Elektromagnetischer Felder; Scheid, Claire

2016-07-01

The interaction of light with metallic nanostructures is increasingly attracting interest because of numerous potential applications. Sub-wavelength metallic structures, when illuminated with a frequency close to the plasma frequency of the metal, present resonances that cause extreme local field enhancements. Exploiting the latter in applications of interest requires a detailed knowledge about the occurring fields which can actually not be obtained analytically. For the latter mentioned reason, numerical tools are thus an absolute necessity. The insight they provide is very often the only way to get a deep enough understanding of the very rich physics at play. For the numericalmore » modeling of light-structure interaction on the nanoscale, the choice of an appropriate material model is a crucial point. Approaches that are adopted in a first instance are based on local (i.e. with no interaction between electrons) dispersive models, e.g. Drude or Drude–Lorentz models. From the mathematical point of view, when a time-domain modeling is considered, these models lead to an additional system of ordinary differential equations coupled to Maxwell's equations. However, recent experiments have shown that the repulsive interaction between electrons inside the metal makes the response of metals intrinsically non-local and that this effect cannot generally be overlooked. Technological achievements have enabled the consideration of metallic structures in a regime where such non-localities have a significant influence on the structures' optical response. This leads to an additional, in general non-linear, system of partial differential equations which is, when coupled to Maxwell's equations, significantly more difficult to treat. Nevertheless, dealing with a linearized non-local dispersion model already opens the route to numerous practical applications of plasmonics. In this work, we present a Discontinuous Galerkin Time-Domain (DGTD) method able to solve the system of Maxwell's equations coupled to a linearized non-local dispersion model relevant to plasmonics. While the method is presented in the general 3D case, numerical results are given for 2D simulation settings.« less

Generalized prolate spheroidal wave functions for optical finite fractional Fourier and linear canonical transforms.

PubMed

Pei, Soo-Chang; Ding, Jian-Jiun

2005-03-01

Prolate spheroidal wave functions (PSWFs) are known to be useful for analyzing the properties of the finite-extension Fourier transform (fi-FT). We extend the theory of PSWFs for the finite-extension fractional Fourier transform, the finite-extension linear canonical transform, and the finite-extension offset linear canonical transform. These finite transforms are more flexible than the fi-FT and can model much more generalized optical systems. We also illustrate how to use the generalized prolate spheroidal functions we derive to analyze the energy-preservation ratio, the self-imaging phenomenon, and the resonance phenomenon of the finite-sized one-stage or multiple-stage optical systems.

A Block Preconditioned Conjugate Gradient-type Iterative Solver for Linear Systems in Thermal Reservoir Simulation

NASA Astrophysics Data System (ADS)

Betté, Srinivas; Diaz, Julio C.; Jines, William R.; Steihaug, Trond

1986-11-01

A preconditioned residual-norm-reducing iterative solver is described. Based on a truncated form of the generalized-conjugate-gradient method for nonsymmetric systems of linear equations, the iterative scheme is very effective for linear systems generated in reservoir simulation of thermal oil recovery processes. As a consequence of employing an adaptive implicit finite-difference scheme to solve the model equations, the number of variables per cell-block varies dynamically over the grid. The data structure allows for 5- and 9-point operators in the areal model, 5-point in the cross-sectional model, and 7- and 11-point operators in the three-dimensional model. Block-diagonal-scaling of the linear system, done prior to iteration, is found to have a significant effect on the rate of convergence. Block-incomplete-LU-decomposition (BILU) and block-symmetric-Gauss-Seidel (BSGS) methods, which result in no fill-in, are used as preconditioning procedures. A full factorization is done on the well terms, and the cells are ordered in a manner which minimizes the fill-in in the well-column due to this factorization. The convergence criterion for the linear (inner) iteration is linked to that of the nonlinear (Newton) iteration, thereby enhancing the efficiency of the computation. The algorithm, with both BILU and BSGS preconditioners, is evaluated in the context of a variety of thermal simulation problems. The solver is robust and can be used with little or no user intervention.

Minimal subspace rotation on the Stiefel manifold for stabilization and enhancement of projection-based reduced order models for the compressible Navier–Stokes equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balajewicz, Maciej; Tezaur, Irina; Dowell, Earl

For a projection-based reduced order model (ROM) of a fluid flow to be stable and accurate, the dynamics of the truncated subspace must be taken into account. This paper proposes an approach for stabilizing and enhancing projection-based fluid ROMs in which truncated modes are accounted for a priori via a minimal rotation of the projection subspace. Attention is focused on the full non-linear compressible Navier–Stokes equations in specific volume form as a step toward a more general formulation for problems with generic non-linearities. Unlike traditional approaches, no empirical turbulence modeling terms are required, and consistency between the ROM and themore » Navier–Stokes equation from which the ROM is derived is maintained. Mathematically, the approach is formulated as a trace minimization problem on the Stiefel manifold. As a result, the reproductive as well as predictive capabilities of the method are evaluated on several compressible flow problems, including a problem involving laminar flow over an airfoil with a high angle of attack, and a channel-driven cavity flow problem.« less

Minimal subspace rotation on the Stiefel manifold for stabilization and enhancement of projection-based reduced order models for the compressible Navier–Stokes equations

DOE PAGES

Balajewicz, Maciej; Tezaur, Irina; Dowell, Earl

2016-05-25

For a projection-based reduced order model (ROM) of a fluid flow to be stable and accurate, the dynamics of the truncated subspace must be taken into account. This paper proposes an approach for stabilizing and enhancing projection-based fluid ROMs in which truncated modes are accounted for a priori via a minimal rotation of the projection subspace. Attention is focused on the full non-linear compressible Navier–Stokes equations in specific volume form as a step toward a more general formulation for problems with generic non-linearities. Unlike traditional approaches, no empirical turbulence modeling terms are required, and consistency between the ROM and themore » Navier–Stokes equation from which the ROM is derived is maintained. Mathematically, the approach is formulated as a trace minimization problem on the Stiefel manifold. As a result, the reproductive as well as predictive capabilities of the method are evaluated on several compressible flow problems, including a problem involving laminar flow over an airfoil with a high angle of attack, and a channel-driven cavity flow problem.« less

A composites-based hyperelastic constitutive model for soft tissue with application to the human annulus fibrosus

NASA Astrophysics Data System (ADS)

Guo, Z. Y.; Peng, X. Q.; Moran, B.

2006-09-01

This paper presents a composites-based hyperelastic constitutive model for soft tissue. Well organized soft tissue is treated as a composite in which the matrix material is embedded with a single family of aligned fibers. The fiber is modeled as a generalized neo-Hookean material in which the stiffness depends on fiber stretch. The deformation gradient is decomposed multiplicatively into two parts: a uniaxial deformation along the fiber direction and a subsequent shear deformation. This permits the fiber-matrix interaction caused by inhomogeneous deformation to be estimated by using effective properties from conventional composites theory based on small strain linear elasticity and suitably generalized to the present large deformation case. A transversely isotropic hyperelastic model is proposed to describe the mechanical behavior of fiber-reinforced soft tissue. This model is then applied to the human annulus fibrosus. Because of the layered anatomical structure of the annulus fibrosus, an orthotropic hyperelastic model of the annulus fibrosus is developed. Simulations show that the model reproduces the stress-strain response of the human annulus fibrosus accurately. We also show that the expression for the fiber-matrix shear interaction energy used in a previous phenomenological model is compatible with that derived in the present paper.

A comparative study of generalized linear mixed modelling and artificial neural network approach for the joint modelling of survival and incidence of Dengue patients in Sri Lanka

NASA Astrophysics Data System (ADS)

Hapugoda, J. C.; Sooriyarachchi, M. R.

2017-09-01

Survival time of patients with a disease and the incidence of that particular disease (count) is frequently observed in medical studies with the data of a clustered nature. In many cases, though, the survival times and the count can be correlated in a way that, diseases that occur rarely could have shorter survival times or vice versa. Due to this fact, joint modelling of these two variables will provide interesting and certainly improved results than modelling these separately. Authors have previously proposed a methodology using Generalized Linear Mixed Models (GLMM) by joining the Discrete Time Hazard model with the Poisson Regression model to jointly model survival and count model. As Aritificial Neural Network (ANN) has become a most powerful computational tool to model complex non-linear systems, it was proposed to develop a new joint model of survival and count of Dengue patients of Sri Lanka by using that approach. Thus, the objective of this study is to develop a model using ANN approach and compare the results with the previously developed GLMM model. As the response variables are continuous in nature, Generalized Regression Neural Network (GRNN) approach was adopted to model the data. To compare the model fit, measures such as root mean square error (RMSE), absolute mean error (AME) and correlation coefficient (R) were used. The measures indicate the GRNN model fits the data better than the GLMM model.

A modal aeroelastic analysis scheme for turbomachinery blading. M.S. Thesis - Case Western Reserve Univ. Final Report

NASA Technical Reports Server (NTRS)

Smith, Todd E.

1991-01-01

An aeroelastic analysis is developed which has general application to all types of axial-flow turbomachinery blades. The approach is based on linear modal analysis, where the blade's dynamic response is represented as a linear combination of contributions from each of its in-vacuum free vibrational modes. A compressible linearized unsteady potential theory is used to model the flow over the oscillating blades. The two-dimensional unsteady flow is evaluated along several stacked axisymmetric strips along the span of the airfoil. The unsteady pressures at the blade surface are integrated to result in the generalized force acting on the blade due to simple harmonic motions. The unsteady aerodynamic forces are coupled to the blade normal modes in the frequency domain using modal analysis. An iterative eigenvalue problem is solved to determine the stability of the blade when the unsteady aerodynamic forces are included in the analysis. The approach is demonstrated by applying it to a high-energy subsonic turbine blade from a rocket engine turbopump power turbine. The results indicate that this turbine could undergo flutter in an edgewise mode of vibration.

Local influence for generalized linear models with missing covariates.

PubMed

Shi, Xiaoyan; Zhu, Hongtu; Ibrahim, Joseph G

2009-12-01

In the analysis of missing data, sensitivity analyses are commonly used to check the sensitivity of the parameters of interest with respect to the missing data mechanism and other distributional and modeling assumptions. In this article, we formally develop a general local influence method to carry out sensitivity analyses of minor perturbations to generalized linear models in the presence of missing covariate data. We examine two types of perturbation schemes (the single-case and global perturbation schemes) for perturbing various assumptions in this setting. We show that the metric tensor of a perturbation manifold provides useful information for selecting an appropriate perturbation. We also develop several local influence measures to identify influential points and test model misspecification. Simulation studies are conducted to evaluate our methods, and real datasets are analyzed to illustrate the use of our local influence measures.

Increasing Teachers' Workloads in the Form of Quantitative Expansion in Extracurricular Activities: Aggregated Data Analysis of Past Working Hours Using a General Linear Model

ERIC Educational Resources Information Center

Kanbayashi, Toshiyuki

2016-01-01

In recent years, teachers' increased workloads have become an issue for policy, and have been multiply pointed out, deriving as they do from peripheral duties such as paperwork, in academic research as well. However, these mentions have not been based on sufficiently solid proof. Here, this paper compares teacher working hours surveys extant from…

On approaches to analyze the sensitivity of simulated hydrologic fluxes to model parameters in the community land model

DOE PAGES

Bao, Jie; Hou, Zhangshuan; Huang, Maoyi; ...

2015-12-04

Here, effective sensitivity analysis approaches are needed to identify important parameters or factors and their uncertainties in complex Earth system models composed of multi-phase multi-component phenomena and multiple biogeophysical-biogeochemical processes. In this study, the impacts of 10 hydrologic parameters in the Community Land Model on simulations of runoff and latent heat flux are evaluated using data from a watershed. Different metrics, including residual statistics, the Nash-Sutcliffe coefficient, and log mean square error, are used as alternative measures of the deviations between the simulated and field observed values. Four sensitivity analysis (SA) approaches, including analysis of variance based on the generalizedmore » linear model, generalized cross validation based on the multivariate adaptive regression splines model, standardized regression coefficients based on a linear regression model, and analysis of variance based on support vector machine, are investigated. Results suggest that these approaches show consistent measurement of the impacts of major hydrologic parameters on response variables, but with differences in the relative contributions, particularly for the secondary parameters. The convergence behaviors of the SA with respect to the number of sampling points are also examined with different combinations of input parameter sets and output response variables and their alternative metrics. This study helps identify the optimal SA approach, provides guidance for the calibration of the Community Land Model parameters to improve the model simulations of land surface fluxes, and approximates the magnitudes to be adjusted in the parameter values during parametric model optimization.« less

The optimal hormonal replacement modality selection for multiple organ procurement from brain-dead organ donors

PubMed Central

Mi, Zhibao; Novitzky, Dimitri; Collins, Joseph F; Cooper, David KC

2015-01-01

The management of brain-dead organ donors is complex. The use of inotropic agents and replacement of depleted hormones (hormonal replacement therapy) is crucial for successful multiple organ procurement, yet the optimal hormonal replacement has not been identified, and the statistical adjustment to determine the best selection is not trivial. Traditional pair-wise comparisons between every pair of treatments, and multiple comparisons to all (MCA), are statistically conservative. Hsu’s multiple comparisons with the best (MCB) – adapted from the Dunnett’s multiple comparisons with control (MCC) – has been used for selecting the best treatment based on continuous variables. We selected the best hormonal replacement modality for successful multiple organ procurement using a two-step approach. First, we estimated the predicted margins by constructing generalized linear models (GLM) or generalized linear mixed models (GLMM), and then we applied the multiple comparison methods to identify the best hormonal replacement modality given that the testing of hormonal replacement modalities is independent. Based on 10-year data from the United Network for Organ Sharing (UNOS), among 16 hormonal replacement modalities, and using the 95% simultaneous confidence intervals, we found that the combination of thyroid hormone, a corticosteroid, antidiuretic hormone, and insulin was the best modality for multiple organ procurement for transplantation. PMID:25565890

A Case Study on a Combination NDVI Forecasting Model Based on the Entropy Weight Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shengzhi; Ming, Bo; Huang, Qiang

It is critically meaningful to accurately predict NDVI (Normalized Difference Vegetation Index), which helps guide regional ecological remediation and environmental managements. In this study, a combination forecasting model (CFM) was proposed to improve the performance of NDVI predictions in the Yellow River Basin (YRB) based on three individual forecasting models, i.e., the Multiple Linear Regression (MLR), Artificial Neural Network (ANN), and Support Vector Machine (SVM) models. The entropy weight method was employed to determine the weight coefficient for each individual model depending on its predictive performance. Results showed that: (1) ANN exhibits the highest fitting capability among the four orecastingmore » models in the calibration period, whilst its generalization ability becomes weak in the validation period; MLR has a poor performance in both calibration and validation periods; the predicted results of CFM in the calibration period have the highest stability; (2) CFM generally outperforms all individual models in the validation period, and can improve the reliability and stability of predicted results through combining the strengths while reducing the weaknesses of individual models; (3) the performances of all forecasting models are better in dense vegetation areas than in sparse vegetation areas.« less

Generalized Onsager's reciprocal relations for the master and Fokker-Planck equations

NASA Astrophysics Data System (ADS)

Peng, Liangrong; Zhu, Yi; Hong, Liu

2018-06-01

The Onsager's reciprocal relation plays a fundamental role in the nonequilibrium thermodynamics. However, unfortunately, its classical version is valid only within a narrow region near equilibrium due to the linear regression hypothesis, which largely restricts its usage. In this paper, based on the conservation-dissipation formalism, a generalized version of Onsager's relations for the master equations and Fokker-Planck equations was derived. Nonlinear constitutive relations with nonsymmetric and positively stable operators, which become symmetric under the detailed balance condition, constitute key features of this new generalization. Similar conclusions also hold for many other classical models in physics and chemistry, which in turn make the current study as a benchmark for the application of generalized Onsager's relations in nonequilibrium thermodynamics.

A quantitative quantum chemical model of the Dewar-Knott color rule for cationic diarylmethanes

NASA Astrophysics Data System (ADS)

Olsen, Seth

2012-04-01

We document the quantitative manifestation of the Dewar-Knott color rule in a four-electron, three-orbital state-averaged complete active space self-consistent field (SA-CASSCF) model of a series of bridge-substituted cationic diarylmethanes. We show that the lowest excitation energies calculated using multireference perturbation theory based on the model are linearly correlated with the development of hole density in an orbital localized on the bridge, and the depletion of pair density in the same orbital. We quantitatively express the correlation in the form of a generalized Hammett equation.

Using structural equation modeling for network meta-analysis.

PubMed

Tu, Yu-Kang; Wu, Yun-Chun

2017-07-14

Network meta-analysis overcomes the limitations of traditional pair-wise meta-analysis by incorporating all available evidence into a general statistical framework for simultaneous comparisons of several treatments. Currently, network meta-analyses are undertaken either within the Bayesian hierarchical linear models or frequentist generalized linear mixed models. Structural equation modeling (SEM) is a statistical method originally developed for modeling causal relations among observed and latent variables. As random effect is explicitly modeled as a latent variable in SEM, it is very flexible for analysts to specify complex random effect structure and to make linear and nonlinear constraints on parameters. The aim of this article is to show how to undertake a network meta-analysis within the statistical framework of SEM. We used an example dataset to demonstrate the standard fixed and random effect network meta-analysis models can be easily implemented in SEM. It contains results of 26 studies that directly compared three treatment groups A, B and C for prevention of first bleeding in patients with liver cirrhosis. We also showed that a new approach to network meta-analysis based on the technique of unrestricted weighted least squares (UWLS) method can also be undertaken using SEM. For both the fixed and random effect network meta-analysis, SEM yielded similar coefficients and confidence intervals to those reported in the previous literature. The point estimates of two UWLS models were identical to those in the fixed effect model but the confidence intervals were greater. This is consistent with results from the traditional pairwise meta-analyses. Comparing to UWLS model with common variance adjusted factor, UWLS model with unique variance adjusted factor has greater confidence intervals when the heterogeneity was larger in the pairwise comparison. The UWLS model with unique variance adjusted factor reflects the difference in heterogeneity within each comparison. SEM provides a very flexible framework for univariate and multivariate meta-analysis, and its potential as a powerful tool for advanced meta-analysis is still to be explored.

A computer tool for a minimax criterion in binary response and heteroscedastic simple linear regression models.

PubMed

Casero-Alonso, V; López-Fidalgo, J; Torsney, B

2017-01-01

Binary response models are used in many real applications. For these models the Fisher information matrix (FIM) is proportional to the FIM of a weighted simple linear regression model. The same is also true when the weight function has a finite integral. Thus, optimal designs for one binary model are also optimal for the corresponding weighted linear regression model. The main objective of this paper is to provide a tool for the construction of MV-optimal designs, minimizing the maximum of the variances of the estimates, for a general design space. MV-optimality is a potentially difficult criterion because of its nondifferentiability at equal variance designs. A methodology for obtaining MV-optimal designs where the design space is a compact interval [a, b] will be given for several standard weight functions. The methodology will allow us to build a user-friendly computer tool based on Mathematica to compute MV-optimal designs. Some illustrative examples will show a representation of MV-optimal designs in the Euclidean plane, taking a and b as the axes. The applet will be explained using two relevant models. In the first one the case of a weighted linear regression model is considered, where the weight function is directly chosen from a typical family. In the second example a binary response model is assumed, where the probability of the outcome is given by a typical probability distribution. Practitioners can use the provided applet to identify the solution and to know the exact support points and design weights. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

A Bayesian model averaging method for improving SMT phrase table

NASA Astrophysics Data System (ADS)

Duan, Nan

2013-03-01

Previous methods on improving translation quality by employing multiple SMT models usually carry out as a second-pass decision procedure on hypotheses from multiple systems using extra features instead of using features in existing models in more depth. In this paper, we propose translation model generalization (TMG), an approach that updates probability feature values for the translation model being used based on the model itself and a set of auxiliary models, aiming to alleviate the over-estimation problem and enhance translation quality in the first-pass decoding phase. We validate our approach for translation models based on auxiliary models built by two different ways. We also introduce novel probability variance features into the log-linear models for further improvements. We conclude our approach can be developed independently and integrated into current SMT pipeline directly. We demonstrate BLEU improvements on the NIST Chinese-to-English MT tasks for single-system decodings.

Generalized topology for resonators having N commensurate harmonics

NASA Astrophysics Data System (ADS)

Danzi, Francesco; Gibert, James M.; Frulla, Giacomo; Cestino, Enrico

2018-04-01

Despite the ubiquity of both linear and nonlinear multimember resonators in MEMS and kinetic energy harvesting devices very few research efforts examine the orientation of members in the resonator on its dynamic behavior. Previous efforts to design this type of resonator constrains the members to have relative orientations that are 0○ or 90○ to each other, i.e., the elements are connected inline with adjoining members or are perpendicular to adjoining members. The work expands upon the existing body of research by considering the effect of the relative orientation between members on the dynamic behavior of the system. In this manuscript, we derive a generalized reduced-order model for the design of a multi-member planar resonator that has integer multiple modal frequencies. The model is based on a Rayleigh Ritz approximation where the number of degrees of freedom equals the number of structural members in the resonator. The analysis allows the generation of design curves, representing all the possible solutions for modal frequencies that are commensurate. The generalized model, valid for an N-DOF structure, is then restricted for a 2- and 3-DOF system/member resonator, where the linear dynamic behavior of the resonator is investigated in depth. Furthermore, this analysis demonstrates a rule of thumb; relaxing restrictions on the relative orientation of members in a planar structure, allows the structure to exhibit exactly N commensurable frequencies if it contains N members.

Risk prediction for myocardial infarction via generalized functional regression models.

PubMed

Ieva, Francesca; Paganoni, Anna M

2016-08-01

In this paper, we propose a generalized functional linear regression model for a binary outcome indicating the presence/absence of a cardiac disease with multivariate functional data among the relevant predictors. In particular, the motivating aim is the analysis of electrocardiographic traces of patients whose pre-hospital electrocardiogram (ECG) has been sent to 118 Dispatch Center of Milan (the Italian free-toll number for emergencies) by life support personnel of the basic rescue units. The statistical analysis starts with a preprocessing of ECGs treated as multivariate functional data. The signals are reconstructed from noisy observations. The biological variability is then removed by a nonlinear registration procedure based on landmarks. Thus, in order to perform a data-driven dimensional reduction, a multivariate functional principal component analysis is carried out on the variance-covariance matrix of the reconstructed and registered ECGs and their first derivatives. We use the scores of the Principal Components decomposition as covariates in a generalized linear model to predict the presence of the disease in a new patient. Hence, a new semi-automatic diagnostic procedure is proposed to estimate the risk of infarction (in the case of interest, the probability of being affected by Left Bundle Brunch Block). The performance of this classification method is evaluated and compared with other methods proposed in literature. Finally, the robustness of the procedure is checked via leave-j-out techniques. © The Author(s) 2013.

Output Containment Control of Linear Heterogeneous Multi-Agent Systems Using Internal Model Principle.

PubMed

Zuo, Shan; Song, Yongduan; Lewis, Frank L; Davoudi, Ali

2017-01-04

This paper studies the output containment control of linear heterogeneous multi-agent systems, where the system dynamics and even the state dimensions can generally be different. Since the states can have different dimensions, standard results from state containment control do not apply. Therefore, the control objective is to guarantee the convergence of the output of each follower to the dynamic convex hull spanned by the outputs of leaders. This can be achieved by making certain output containment errors go to zero asymptotically. Based on this formulation, two different control protocols, namely, full-state feedback and static output-feedback, are designed based on internal model principles. Sufficient local conditions for the existence of the proposed control protocols are developed in terms of stabilizing the local followers' dynamics and satisfying a certain H∞ criterion. Unified design procedures to solve the proposed two control protocols are presented by formulation and solution of certain local state-feedback and static output-feedback problems, respectively. Numerical simulations are given to validate the proposed control protocols.

T-matrix modeling of linear depolarization by morphologically complex soot and soot-containing aerosols

NASA Astrophysics Data System (ADS)

Mishchenko, Michael I.; Liu, Li; Mackowski, Daniel W.

2013-07-01

We use state-of-the-art public-domain Fortran codes based on the T-matrix method to calculate orientation and ensemble averaged scattering matrix elements for a variety of morphologically complex black carbon (BC) and BC-containing aerosol particles, with a special emphasis on the linear depolarization ratio (LDR). We explain theoretically the quasi-Rayleigh LDR peak at side-scattering angles typical of low-density soot fractals and conclude that the measurement of this feature enables one to evaluate the compactness state of BC clusters and trace the evolution of low-density fluffy fractals into densely packed aggregates. We show that small backscattering LDRs measured with ground-based, airborne, and spaceborne lidars for fresh smoke generally agree with the values predicted theoretically for fluffy BC fractals and densely packed near-spheroidal BC aggregates. To reproduce higher lidar LDRs observed for aged smoke, one needs alternative particle models such as shape mixtures of BC spheroids or cylinders.

A phenomenological biological dose model for proton therapy based on linear energy transfer spectra.

PubMed

Rørvik, Eivind; Thörnqvist, Sara; Stokkevåg, Camilla H; Dahle, Tordis J; Fjaera, Lars Fredrik; Ytre-Hauge, Kristian S

2017-06-01

The relative biological effectiveness (RBE) of protons varies with the radiation quality, quantified by the linear energy transfer (LET). Most phenomenological models employ a linear dependency of the dose-averaged LET (LET d ) to calculate the biological dose. However, several experiments have indicated a possible non-linear trend. Our aim was to investigate if biological dose models including non-linear LET dependencies should be considered, by introducing a LET spectrum based dose model. The RBE-LET relationship was investigated by fitting of polynomials from 1st to 5th degree to a database of 85 data points from aerobic in vitro experiments. We included both unweighted and weighted regression, the latter taking into account experimental uncertainties. Statistical testing was performed to decide whether higher degree polynomials provided better fits to the data as compared to lower degrees. The newly developed models were compared to three published LET d based models for a simulated spread out Bragg peak (SOBP) scenario. The statistical analysis of the weighted regression analysis favored a non-linear RBE-LET relationship, with the quartic polynomial found to best represent the experimental data (P = 0.010). The results of the unweighted regression analysis were on the borderline of statistical significance for non-linear functions (P = 0.053), and with the current database a linear dependency could not be rejected. For the SOBP scenario, the weighted non-linear model estimated a similar mean RBE value (1.14) compared to the three established models (1.13-1.17). The unweighted model calculated a considerably higher RBE value (1.22). The analysis indicated that non-linear models could give a better representation of the RBE-LET relationship. However, this is not decisive, as inclusion of the experimental uncertainties in the regression analysis had a significant impact on the determination and ranking of the models. As differences between the models were observed for the SOBP scenario, both non-linear LET spectrum- and linear LET d based models should be further evaluated in clinically realistic scenarios. © 2017 American Association of Physicists in Medicine.

Dimensional Reduction for the General Markov Model on Phylogenetic Trees.

PubMed

Sumner, Jeremy G

2017-03-01

We present a method of dimensional reduction for the general Markov model of sequence evolution on a phylogenetic tree. We show that taking certain linear combinations of the associated random variables (site pattern counts) reduces the dimensionality of the model from exponential in the number of extant taxa, to quadratic in the number of taxa, while retaining the ability to statistically identify phylogenetic divergence events. A key feature is the identification of an invariant subspace which depends only bilinearly on the model parameters, in contrast to the usual multi-linear dependence in the full space. We discuss potential applications including the computation of split (edge) weights on phylogenetic trees from observed sequence data.

Reliability of environmental sampling culture results using the negative binomial intraclass correlation coefficient.

PubMed

Aly, Sharif S; Zhao, Jianyang; Li, Ben; Jiang, Jiming

2014-01-01

The Intraclass Correlation Coefficient (ICC) is commonly used to estimate the similarity between quantitative measures obtained from different sources. Overdispersed data is traditionally transformed so that linear mixed model (LMM) based ICC can be estimated. A common transformation used is the natural logarithm. The reliability of environmental sampling of fecal slurry on freestall pens has been estimated for Mycobacterium avium subsp. paratuberculosis using the natural logarithm transformed culture results. Recently, the negative binomial ICC was defined based on a generalized linear mixed model for negative binomial distributed data. The current study reports on the negative binomial ICC estimate which includes fixed effects using culture results of environmental samples. Simulations using a wide variety of inputs and negative binomial distribution parameters (r; p) showed better performance of the new negative binomial ICC compared to the ICC based on LMM even when negative binomial data was logarithm, and square root transformed. A second comparison that targeted a wider range of ICC values showed that the mean of estimated ICC closely approximated the true ICC.

Reproducing the nonlinear dynamic behavior of a structured beam with a generalized continuum model

NASA Astrophysics Data System (ADS)

Vila, J.; Fernández-Sáez, J.; Zaera, R.

2018-04-01

In this paper we study the coupled axial-transverse nonlinear vibrations of a kind of one dimensional structured solids by application of the so called Inertia Gradient Nonlinear continuum model. To show the accuracy of this axiomatic model, previously proposed by the authors, its predictions are compared with numeric results from a previously defined finite discrete chain of lumped masses and springs, for several number of particles. A continualization of the discrete model equations based on Taylor series allowed us to set equivalent values of the mechanical properties in both discrete and axiomatic continuum models. Contrary to the classical continuum model, the inertia gradient nonlinear continuum model used herein is able to capture scale effects, which arise for modes in which the wavelength is comparable to the characteristic distance of the structured solid. The main conclusion of the work is that the proposed generalized continuum model captures the scale effects in both linear and nonlinear regimes, reproducing the behavior of the 1D nonlinear discrete model adequately.

Linear approximations of nonlinear systems

NASA Technical Reports Server (NTRS)

Hunt, L. R.; Su, R.

1983-01-01

The development of a method for designing an automatic flight controller for short and vertical take off aircraft is discussed. This technique involves transformations of nonlinear systems to controllable linear systems and takes into account the nonlinearities of the aircraft. In general, the transformations cannot always be given in closed form. Using partial differential equations, an approximate linear system called the modified tangent model was introduced. A linear transformation of this tangent model to Brunovsky canonical form can be constructed, and from this the linear part (about a state space point x sub 0) of an exact transformation for the nonlinear system can be found. It is shown that a canonical expansion in Lie brackets about the point x sub 0 yields the same modified tangent model.

Modification of 2-D Time-Domain Shallow Water Wave Equation using Asymptotic Expansion Method

NASA Astrophysics Data System (ADS)

Khairuman, Teuku; Nasruddin, MN; Tulus; Ramli, Marwan

2018-01-01

Generally, research on the tsunami wave propagation model can be conducted by using a linear model of shallow water theory, where a non-linear side on high order is ignored. In line with research on the investigation of the tsunami waves, the Boussinesq equation model underwent a change aimed to obtain an improved quality of the dispersion relation and non-linearity by increasing the order to be higher. To solve non-linear sides at high order is used a asymptotic expansion method. This method can be used to solve non linear partial differential equations. In the present work, we found that this method needs much computational time and memory with the increase of the number of elements.

Mathematical Modeling of Intestinal Iron Absorption Using Genetic Programming

PubMed Central

Colins, Andrea; Gerdtzen, Ziomara P.; Nuñez, Marco T.; Salgado, J. Cristian

2017-01-01

Iron is a trace metal, key for the development of living organisms. Its absorption process is complex and highly regulated at the transcriptional, translational and systemic levels. Recently, the internalization of the DMT1 transporter has been proposed as an additional regulatory mechanism at the intestinal level, associated to the mucosal block phenomenon. The short-term effect of iron exposure in apical uptake and initial absorption rates was studied in Caco-2 cells at different apical iron concentrations, using both an experimental approach and a mathematical modeling framework. This is the first report of short-term studies for this system. A non-linear behavior in the apical uptake dynamics was observed, which does not follow the classic saturation dynamics of traditional biochemical models. We propose a method for developing mathematical models for complex systems, based on a genetic programming algorithm. The algorithm is aimed at obtaining models with a high predictive capacity, and considers an additional parameter fitting stage and an additional Jackknife stage for estimating the generalization error. We developed a model for the iron uptake system with a higher predictive capacity than classic biochemical models. This was observed both with the apical uptake dataset used for generating the model and with an independent initial rates dataset used to test the predictive capacity of the model. The model obtained is a function of time and the initial apical iron concentration, with a linear component that captures the global tendency of the system, and a non-linear component that can be associated to the movement of DMT1 transporters. The model presented in this paper allows the detailed analysis, interpretation of experimental data, and identification of key relevant components for this complex biological process. This general method holds great potential for application to the elucidation of biological mechanisms and their key components in other complex systems. PMID:28072870

Estimation of transformation parameters for microarray data.

PubMed

Durbin, Blythe; Rocke, David M

2003-07-22

Durbin et al. (2002), Huber et al. (2002) and Munson (2001) independently introduced a family of transformations (the generalized-log family) which stabilizes the variance of microarray data up to the first order. We introduce a method for estimating the transformation parameter in tandem with a linear model based on the procedure outlined in Box and Cox (1964). We also discuss means of finding transformations within the generalized-log family which are optimal under other criteria, such as minimum residual skewness and minimum mean-variance dependency. R and Matlab code and test data are available from the authors on request.

A trajectory generation framework for modeling spacecraft entry in MDAO

NASA Astrophysics Data System (ADS)

D`Souza, Sarah N.; Sarigul-Klijn, Nesrin

2016-04-01

In this paper a novel trajectory generation framework was developed that optimizes trajectory event conditions for use in a Generalized Entry Guidance algorithm. The framework was developed to be adaptable via the use of high fidelity equations of motion and drag based analytical bank profiles. Within this framework, a novel technique was implemented that resolved the sensitivity of the bank profile to atmospheric non-linearities. The framework's adaptability was established by running two different entry bank conditions. Each case yielded a reference trajectory and set of transition event conditions that are flight feasible and implementable in a Generalized Entry Guidance algorithm.

Experimental and numerical investigations of sedimentation of porous wastewater sludge flocs.

PubMed

Hriberšek, M; Zajdela, B; Hribernik, A; Zadravec, M

2011-02-01

The paper studies the properties and sedimentation characteristics of sludge flocs, as they appear in biological wastewater treatment (BWT) plants. The flocs are described as porous and permeable bodies, with their properties defined based on conducted experimental study. The derivation is based on established geometrical properties, high-speed camera data on settling velocities and non-linear numerical model, linking settling velocity with physical properties of porous flocs. The numerical model for derivation is based on generalized Stokes model, with permeability of the floc described by the Brinkman model. As a result, correlation for flocs porosity is obtained as a function of floc diameter. This data is used in establishing a CFD numerical model of sedimentation of flocs in test conditions, as recorded during experimental investigation. The CFD model is based on Euler-Lagrange formulation, where the Lagrange formulation is chosen for computation of flocs trajectories during sedimentation. The results of numerical simulations are compared with experimental results and very good agreement is observed. © 2010 Elsevier Ltd. All rights reserved.

Pros, Cons, and Alternatives to Weight Based Cost Estimating

NASA Technical Reports Server (NTRS)

Joyner, Claude R.; Lauriem, Jonathan R.; Levack, Daniel H.; Zapata, Edgar

2011-01-01

Many cost estimating tools use weight as a major parameter in projecting the cost. This is often combined with modifying factors such as complexity, technical maturity of design, environment of operation, etc. to increase the fidelity of the estimate. For a set of conceptual designs, all meeting the same requirements, increased weight can be a major driver in increased cost. However, once a design is fixed, increased weight generally decreases cost, while decreased weight generally increases cost - and the relationship is not linear. Alternative approaches to estimating cost without using weight (except perhaps for materials costs) have been attempted to try to produce a tool usable throughout the design process - from concept studies through development. This paper will address the pros and cons of using weight based models for cost estimating, using liquid rocket engines as the example. It will then examine approaches that minimize the impct of weight based cost estimating. The Rocket Engine- Cost Model (RECM) is an attribute based model developed internally by Pratt & Whitney Rocketdyne for NASA. RECM will be presented primarily to show a successful method to use design and programmatic parameters instead of weight to estimate both design and development costs and production costs. An operations model developed by KSC, the Launch and Landing Effects Ground Operations model (LLEGO), will also be discussed.

Structural Equation Modeling: A Framework for Ocular and Other Medical Sciences Research

PubMed Central

Christ, Sharon L.; Lee, David J.; Lam, Byron L.; Diane, Zheng D.

2017-01-01

Structural equation modeling (SEM) is a modeling framework that encompasses many types of statistical models and can accommodate a variety of estimation and testing methods. SEM has been used primarily in social sciences but is increasingly used in epidemiology, public health, and the medical sciences. SEM provides many advantages for the analysis of survey and clinical data, including the ability to model latent constructs that may not be directly observable. Another major feature is simultaneous estimation of parameters in systems of equations that may include mediated relationships, correlated dependent variables, and in some instances feedback relationships. SEM allows for the specification of theoretically holistic models because multiple and varied relationships may be estimated together in the same model. SEM has recently expanded by adding generalized linear modeling capabilities that include the simultaneous estimation of parameters of different functional form for outcomes with different distributions in the same model. Therefore, mortality modeling and other relevant health outcomes may be evaluated. Random effects estimation using latent variables has been advanced in the SEM literature and software. In addition, SEM software has increased estimation options. Therefore, modern SEM is quite general and includes model types frequently used by health researchers, including generalized linear modeling, mixed effects linear modeling, and population average modeling. This article does not present any new information. It is meant as an introduction to SEM and its uses in ocular and other health research. PMID:24467557

Deformation-Aware Log-Linear Models

NASA Astrophysics Data System (ADS)

Gass, Tobias; Deselaers, Thomas; Ney, Hermann

In this paper, we present a novel deformation-aware discriminative model for handwritten digit recognition. Unlike previous approaches our model directly considers image deformations and allows discriminative training of all parameters, including those accounting for non-linear transformations of the image. This is achieved by extending a log-linear framework to incorporate a latent deformation variable. The resulting model has an order of magnitude less parameters than competing approaches to handling image deformations. We tune and evaluate our approach on the USPS task and show its generalization capabilities by applying the tuned model to the MNIST task. We gain interesting insights and achieve highly competitive results on both tasks.

Automated real time constant-specificity surveillance for disease outbreaks.

PubMed

Wieland, Shannon C; Brownstein, John S; Berger, Bonnie; Mandl, Kenneth D

2007-06-13

For real time surveillance, detection of abnormal disease patterns is based on a difference between patterns observed, and those predicted by models of historical data. The usefulness of outbreak detection strategies depends on their specificity; the false alarm rate affects the interpretation of alarms. We evaluate the specificity of five traditional models: autoregressive, Serfling, trimmed seasonal, wavelet-based, and generalized linear. We apply each to 12 years of emergency department visits for respiratory infection syndromes at a pediatric hospital, finding that the specificity of the five models was almost always a non-constant function of the day of the week, month, and year of the study (p < 0.05). We develop an outbreak detection method, called the expectation-variance model, based on generalized additive modeling to achieve a constant specificity by accounting for not only the expected number of visits, but also the variance of the number of visits. The expectation-variance model achieves constant specificity on all three time scales, as well as earlier detection and improved sensitivity compared to traditional methods in most circumstances. Modeling the variance of visit patterns enables real-time detection with known, constant specificity at all times. With constant specificity, public health practitioners can better interpret the alarms and better evaluate the cost-effectiveness of surveillance systems.

Further advances in predicting species distributions

Treesearch

Gretchen G. Moisen; Thomas C. Edwards; Patrick E. Osborne

2006-01-01

In 2001, a workshop focused on the use of generalized linear models (GLM: McCullagh and Nelder, 1989) and generalized additive models (GAM: Hastie and Tibshirani, 1986, 1990) for predicting species distributions was held in Riederalp, Switzerland. This topic led to the publication of special issues in Ecological Modelling (Guisan et al., 2002) and Biodiversity and...

Detailed emission profiles for on-road vehicles derived from ambient measurements during a windless traffic episode in Baltimore using a multi-model approach

NASA Astrophysics Data System (ADS)

Ke, Haohao; Ondov, John M.; Rogge, Wolfgang F.

2013-12-01

Composite chemical profiles of motor vehicle emissions were extracted from ambient measurements at a near-road site in Baltimore during a windless traffic episode in November, 2002, using four independent approaches, i.e., simple peak analysis, windless model-based linear regression, PMF, and UNMIX. Although the profiles are in general agreement, the windless-model-based profile treatment more effectively removes interference from non-traffic sources and is deemed to be more accurate for many species. In addition to abundances of routine pollutants (e.g., NOx, CO, PM2.5, EC, OC, sulfate, and nitrate), 11 particle-bound metals and 51 individual traffic-related organic compounds (including n-alkanes, PAHs, oxy-PAHs, hopanes, alkylcyclohexanes, and others) were included in the modeling.

Estimating Causal Effects with Ancestral Graph Markov Models

PubMed Central

Malinsky, Daniel; Spirtes, Peter

2017-01-01

We present an algorithm for estimating bounds on causal effects from observational data which combines graphical model search with simple linear regression. We assume that the underlying system can be represented by a linear structural equation model with no feedback, and we allow for the possibility of latent variables. Under assumptions standard in the causal search literature, we use conditional independence constraints to search for an equivalence class of ancestral graphs. Then, for each model in the equivalence class, we perform the appropriate regression (using causal structure information to determine which covariates to include in the regression) to estimate a set of possible causal effects. Our approach is based on the “IDA” procedure of Maathuis et al. (2009), which assumes that all relevant variables have been measured (i.e., no unmeasured confounders). We generalize their work by relaxing this assumption, which is often violated in applied contexts. We validate the performance of our algorithm on simulated data and demonstrate improved precision over IDA when latent variables are present. PMID:28217244

Copula-based model for rainfall and El- Niño in Banyuwangi Indonesia

NASA Astrophysics Data System (ADS)

Caraka, R. E.; Supari; Tahmid, M.

2018-04-01

Modelling, describing and measuring the structure dependences between different random events is at the very heart of statistics. Therefore, a broad variety of varying dependence concepts has been developed in the past. Most often, practitioners rely only on the linear correlation to describe the degree of dependence between two or more variables; an approach that can lead to quite misleading conclusions as this measure is only capable of capturing linear relationships. Copulas go beyond dependence measures and provide a sound framework for general dependence modelling. This paper will introduce an application of Copula to estimate, understand, and interpret the dependence structure in a given set of data El-Niño in Banyuwangi, Indonesia. In a nutshell, we proved the flexibility of Copulas Archimedean in rainfall modelling and catching phenomena of El Niño in Banyuwangi, East Java, Indonesia. Also, it was found that SST of nino3, nino4, and nino3.4 are most appropriate ENSO indicators in identifying the relationship of El Nino and rainfall.

Non-linear regime of the Generalized Minimal Massive Gravity in critical points

NASA Astrophysics Data System (ADS)

Setare, M. R.; Adami, H.

2016-03-01

The Generalized Minimal Massive Gravity (GMMG) theory is realized by adding the CS deformation term, the higher derivative deformation term, and an extra term to pure Einstein gravity with a negative cosmological constant. In the present paper we obtain exact solutions to the GMMG field equations in the non-linear regime of the model. GMMG model about AdS_3 space is conjectured to be dual to a 2-dimensional CFT. We study the theory in critical points corresponding to the central charges c_-=0 or c_+=0, in the non-linear regime. We show that AdS_3 wave solutions are present, and have logarithmic form in critical points. Then we study the AdS_3 non-linear deformation solution. Furthermore we obtain logarithmic deformation of extremal BTZ black hole. After that using Abbott-Deser-Tekin method we calculate the energy and angular momentum of these types of black hole solutions.

Testing concordance of instrumental variable effects in generalized linear models with application to Mendelian randomization

PubMed Central

Dai, James Y.; Chan, Kwun Chuen Gary; Hsu, Li

2014-01-01

Instrumental variable regression is one way to overcome unmeasured confounding and estimate causal effect in observational studies. Built on structural mean models, there has been considerale work recently developed for consistent estimation of causal relative risk and causal odds ratio. Such models can sometimes suffer from identification issues for weak instruments. This hampered the applicability of Mendelian randomization analysis in genetic epidemiology. When there are multiple genetic variants available as instrumental variables, and causal effect is defined in a generalized linear model in the presence of unmeasured confounders, we propose to test concordance between instrumental variable effects on the intermediate exposure and instrumental variable effects on the disease outcome, as a means to test the causal effect. We show that a class of generalized least squares estimators provide valid and consistent tests of causality. For causal effect of a continuous exposure on a dichotomous outcome in logistic models, the proposed estimators are shown to be asymptotically conservative. When the disease outcome is rare, such estimators are consistent due to the log-linear approximation of the logistic function. Optimality of such estimators relative to the well-known two-stage least squares estimator and the double-logistic structural mean model is further discussed. PMID:24863158

An approximation of herd effect due to vaccinating children against seasonal influenza – a potential solution to the incorporation of indirect effects into static models

PubMed Central

2013-01-01

Background Indirect herd effect from vaccination of children offers potential for improving the effectiveness of influenza prevention in the remaining unvaccinated population. Static models used in cost-effectiveness analyses cannot dynamically capture herd effects. The objective of this study was to develop a methodology to allow herd effect associated with vaccinating children against seasonal influenza to be incorporated into static models evaluating the cost-effectiveness of influenza vaccination. Methods Two previously published linear equations for approximation of herd effects in general were compared with the results of a structured literature review undertaken using PubMed searches to identify data on herd effects specific to influenza vaccination. A linear function was fitted to point estimates from the literature using the sum of squared residuals. Results The literature review identified 21 publications on 20 studies for inclusion. Six studies provided data on a mathematical relationship between effective vaccine coverage in subgroups and reduction of influenza infection in a larger unvaccinated population. These supported a linear relationship when effective vaccine coverage in a subgroup population was between 20% and 80%. Three studies evaluating herd effect at a community level, specifically induced by vaccinating children, provided point estimates for fitting linear equations. The fitted linear equation for herd protection in the target population for vaccination (children) was slightly less conservative than a previously published equation for herd effects in general. The fitted linear equation for herd protection in the non-target population was considerably less conservative than the previously published equation. Conclusions This method of approximating herd effect requires simple adjustments to the annual baseline risk of influenza in static models: (1) for the age group targeted by the childhood vaccination strategy (i.e. children); and (2) for other age groups not targeted (e.g. adults and/or elderly). Two approximations provide a linear relationship between effective coverage and reduction in the risk of infection. The first is a conservative approximation, recommended as a base-case for cost-effectiveness evaluations. The second, fitted to data extracted from a structured literature review, provides a less conservative estimate of herd effect, recommended for sensitivity analyses. PMID:23339290

Bounding the electrostatic free energies associated with linear continuum models of molecular solvation.

PubMed

Bardhan, Jaydeep P; Knepley, Matthew G; Anitescu, Mihai

2009-03-14

The importance of electrostatic interactions in molecular biology has driven extensive research toward the development of accurate and efficient theoretical and computational models. Linear continuum electrostatic theory has been surprisingly successful, but the computational costs associated with solving the associated partial differential equations (PDEs) preclude the theory's use in most dynamical simulations. Modern generalized-Born models for electrostatics can reproduce PDE-based calculations to within a few percent and are extremely computationally efficient but do not always faithfully reproduce interactions between chemical groups. Recent work has shown that a boundary-integral-equation formulation of the PDE problem leads naturally to a new approach called boundary-integral-based electrostatics estimation (BIBEE) to approximate electrostatic interactions. In the present paper, we prove that the BIBEE method can be used to rigorously bound the actual continuum-theory electrostatic free energy. The bounds are validated using a set of more than 600 proteins. Detailed numerical results are presented for structures of the peptide met-enkephalin taken from a molecular-dynamics simulation. These bounds, in combination with our demonstration that the BIBEE methods accurately reproduce pairwise interactions, suggest a new approach toward building a highly accurate yet computationally tractable electrostatic model.

Disturbance rejection control for vibration suppression of piezoelectric laminated thin-walled structures

NASA Astrophysics Data System (ADS)

Zhang, S. Q.; Li, H. N.; Schmidt, R.; Müller, P. C.

2014-02-01

Thin-walled piezoelectric integrated smart structures are easily excited to vibrate by unknown disturbances. In order to design and simulate a control strategy, firstly, an electro-mechanically coupled dynamic finite element (FE) model of smart structures is developed based on first-order shear deformation (FOSD) hypothesis. Linear piezoelectric constitutive equations and the assumption of constant electric field through the thickness are considered. Based on the dynamic FE model, a disturbance rejection (DR) control with proportional-integral (PI) observer using step functions as the fictitious model of disturbances is developed for vibration suppression of smart structures. In order to achieve a better dynamic behavior of the fictitious model of disturbances, the PI observer is extended to generalized proportional-integral (GPI) observer, in which sine or polynomial functions can be used to represent disturbances resulting in better dynamics. Therefore the disturbances can be estimated either by PI or GPI observer, and then the estimated signals are fed back to the controller. The DR control is validated by various kinds of unknown disturbances, and compared with linear-quadratic regulator (LQR) control. The results illustrate that the vibrations are better suppressed by the proposed DR control.

Bounding the electrostatic free energies associated with linear continuum models of molecular solvation

NASA Astrophysics Data System (ADS)

Bardhan, Jaydeep P.; Knepley, Matthew G.; Anitescu, Mihai

2009-03-01

The importance of electrostatic interactions in molecular biology has driven extensive research toward the development of accurate and efficient theoretical and computational models. Linear continuum electrostatic theory has been surprisingly successful, but the computational costs associated with solving the associated partial differential equations (PDEs) preclude the theory's use in most dynamical simulations. Modern generalized-Born models for electrostatics can reproduce PDE-based calculations to within a few percent and are extremely computationally efficient but do not always faithfully reproduce interactions between chemical groups. Recent work has shown that a boundary-integral-equation formulation of the PDE problem leads naturally to a new approach called boundary-integral-based electrostatics estimation (BIBEE) to approximate electrostatic interactions. In the present paper, we prove that the BIBEE method can be used to rigorously bound the actual continuum-theory electrostatic free energy. The bounds are validated using a set of more than 600 proteins. Detailed numerical results are presented for structures of the peptide met-enkephalin taken from a molecular-dynamics simulation. These bounds, in combination with our demonstration that the BIBEE methods accurately reproduce pairwise interactions, suggest a new approach toward building a highly accurate yet computationally tractable electrostatic model.

Genomic similarity and kernel methods I: advancements by building on mathematical and statistical foundations.

PubMed

Schaid, Daniel J

2010-01-01

Measures of genomic similarity are the basis of many statistical analytic methods. We review the mathematical and statistical basis of similarity methods, particularly based on kernel methods. A kernel function converts information for a pair of subjects to a quantitative value representing either similarity (larger values meaning more similar) or distance (smaller values meaning more similar), with the requirement that it must create a positive semidefinite matrix when applied to all pairs of subjects. This review emphasizes the wide range of statistical methods and software that can be used when similarity is based on kernel methods, such as nonparametric regression, linear mixed models and generalized linear mixed models, hierarchical models, score statistics, and support vector machines. The mathematical rigor for these methods is summarized, as is the mathematical framework for making kernels. This review provides a framework to move from intuitive and heuristic approaches to define genomic similarities to more rigorous methods that can take advantage of powerful statistical modeling and existing software. A companion paper reviews novel approaches to creating kernels that might be useful for genomic analyses, providing insights with examples [1]. Copyright © 2010 S. Karger AG, Basel.

Modeling of Soft Poroelastic Tissue in Time-Harmonic MR Elastography

PubMed Central

Perriñez, Phillip R.; Kennedy, Francis E.; Van Houten, Elijah E. W.; Weaver, John B.; Paulsen, Keith D.

2010-01-01

Elastography is an emerging imaging technique that focuses on assessing the resistance to deformation of soft biological tissues in vivo. Magnetic resonance elastography (MRE) uses measured displacement fields resulting from low-amplitude, low-frequency (10 Hz–1 kHz) time-harmonic vibration to recover images of the elastic property distribution of tissues including breast, liver, muscle, prostate, and brain. While many soft tissues display complex time-dependent behavior not described by linear elasticity, the models most commonly employed in MRE parameter reconstructions are based on elastic assumptions. Further, elasticity models fail to include the interstitial fluid phase present in vivo. Alternative continuum models, such as consolidation theory, are able to represent tissue and other materials comprising two distinct phases, generally consisting of a porous elastic solid and penetrating fluid. MRE reconstructions of simulated elastic and poroelastic phantoms were performed to investigate the limitations of current-elasticity-based methods in producing accurate elastic parameter estimates in poroelastic media. The results indicate that linearly elastic reconstructions of fluid-saturated porous media at amplitudes and frequencies relevant to steady-state MRE can yield misleading effective property distributions resulting from the complex interaction between their solid and fluid phases. PMID:19272864

Treecode-based generalized Born method

NASA Astrophysics Data System (ADS)

Xu, Zhenli; Cheng, Xiaolin; Yang, Haizhao

2011-02-01

We have developed a treecode-based O(Nlog N) algorithm for the generalized Born (GB) implicit solvation model. Our treecode-based GB (tGB) is based on the GBr6 [J. Phys. Chem. B 111, 3055 (2007)], an analytical GB method with a pairwise descreening approximation for the R6 volume integral expression. The algorithm is composed of a cutoff scheme for the effective Born radii calculation, and a treecode implementation of the GB charge-charge pair interactions. Test results demonstrate that the tGB algorithm can reproduce the vdW surface based Poisson solvation energy with an average relative error less than 0.6% while providing an almost linear-scaling calculation for a representative set of 25 proteins with different sizes (from 2815 atoms to 65456 atoms). For a typical system of 10k atoms, the tGB calculation is three times faster than the direct summation as implemented in the original GBr6 model. Thus, our tGB method provides an efficient way for performing implicit solvent GB simulations of larger biomolecular systems at longer time scales.

Quality tracing in meat supply chains

PubMed Central

Mack, Miriam; Dittmer, Patrick; Veigt, Marius; Kus, Mehmet; Nehmiz, Ulfert; Kreyenschmidt, Judith

2014-01-01

The aim of this study was the development of a quality tracing model for vacuum-packed lamb that is applicable in different meat supply chains. Based on the development of relevant sensory parameters, the predictive model was developed by combining a linear primary model and the Arrhenius model as the secondary model. Then a process analysis was conducted to define general requirements for the implementation of the temperature-based model into a meat supply chain. The required hardware and software for continuous temperature monitoring were developed in order to use the model under practical conditions. Further on a decision support tool was elaborated in order to use the model as an effective tool in combination with the temperature monitoring equipment for the improvement of quality and storage management within the meat logistics network. Over the long term, this overall procedure will support the reduction of food waste and will improve the resources efficiency of food production. PMID:24797136

Quality tracing in meat supply chains.

PubMed

Mack, Miriam; Dittmer, Patrick; Veigt, Marius; Kus, Mehmet; Nehmiz, Ulfert; Kreyenschmidt, Judith

2014-06-13

The aim of this study was the development of a quality tracing model for vacuum-packed lamb that is applicable in different meat supply chains. Based on the development of relevant sensory parameters, the predictive model was developed by combining a linear primary model and the Arrhenius model as the secondary model. Then a process analysis was conducted to define general requirements for the implementation of the temperature-based model into a meat supply chain. The required hardware and software for continuous temperature monitoring were developed in order to use the model under practical conditions. Further on a decision support tool was elaborated in order to use the model as an effective tool in combination with the temperature monitoring equipment for the improvement of quality and storage management within the meat logistics network. Over the long term, this overall procedure will support the reduction of food waste and will improve the resources efficiency of food production.

Plasma amino acid profile associated with fatty liver disease and co-occurrence of metabolic risk factors.

PubMed

Yamakado, Minoru; Tanaka, Takayuki; Nagao, Kenji; Imaizumi, Akira; Komatsu, Michiharu; Daimon, Takashi; Miyano, Hiroshi; Tani, Mizuki; Toda, Akiko; Yamamoto, Hiroshi; Horimoto, Katsuhisa; Ishizaka, Yuko

2017-11-03

Fatty liver disease (FLD) increases the risk of diabetes, cardiovascular disease, and steatohepatitis, which leads to fibrosis, cirrhosis, and hepatocellular carcinoma. Thus, the early detection of FLD is necessary. We aimed to find a quantitative and feasible model for discriminating the FLD, based on plasma free amino acid (PFAA) profiles. We constructed models of the relationship between PFAA levels in 2,000 generally healthy Japanese subjects and the diagnosis of FLD by abdominal ultrasound scan by multiple logistic regression analysis with variable selection. The performance of these models for FLD discrimination was validated using an independent data set of 2,160 subjects. The generated PFAA-based model was able to identify FLD patients. The area under the receiver operating characteristic curve for the model was 0.83, which was higher than those of other existing liver function-associated markers ranging from 0.53 to 0.80. The value of the linear discriminant in the model yielded the adjusted odds ratio (with 95% confidence intervals) for a 1 standard deviation increase of 2.63 (2.14-3.25) in the multiple logistic regression analysis with known liver function-associated covariates. Interestingly, the linear discriminant values were significantly associated with the progression of FLD, and patients with nonalcoholic steatohepatitis also exhibited higher values.

High-resolution observations of low-luminosity gigahertz-peaked spectrum and compact steep-spectrum sources

NASA Astrophysics Data System (ADS)

Collier, J. D.; Tingay, S. J.; Callingham, J. R.; Norris, R. P.; Filipović, M. D.; Galvin, T. J.; Huynh, M. T.; Intema, H. T.; Marvil, J.; O'Brien, A. N.; Roper, Q.; Sirothia, S.; Tothill, N. F. H.; Bell, M. E.; For, B.-Q.; Gaensler, B. M.; Hancock, P. J.; Hindson, L.; Hurley-Walker, N.; Johnston-Hollitt, M.; Kapińska, A. D.; Lenc, E.; Morgan, J.; Procopio, P.; Staveley-Smith, L.; Wayth, R. B.; Wu, C.; Zheng, Q.; Heywood, I.; Popping, A.

2018-06-01

We present very long baseline interferometry observations of a faint and low-luminosity (L1.4 GHz < 1027 W Hz-1) gigahertz-peaked spectrum (GPS) and compact steep-spectrum (CSS) sample. We select eight sources from deep radio observations that have radio spectra characteristic of a GPS or CSS source and an angular size of θ ≲ 2 arcsec, and detect six of them with the Australian Long Baseline Array. We determine their linear sizes, and model their radio spectra using synchrotron self-absorption (SSA) and free-free absorption (FFA) models. We derive statistical model ages, based on a fitted scaling relation, and spectral ages, based on the radio spectrum, which are generally consistent with the hypothesis that GPS and CSS sources are young and evolving. We resolve the morphology of one CSS source with a radio luminosity of 10^{25} W Hz^{-1}, and find what appear to be two hotspots spanning 1.7 kpc. We find that our sources follow the turnover-linear size relation, and that both homogeneous SSA and an inhomogeneous FFA model can account for the spectra with observable turnovers. All but one of the FFA models do not require a spectral break to account for the radio spectrum, while all but one of the alternative SSA and power-law models do require a spectral break to account for the radio spectrum. We conclude that our low-luminosity sample is similar to brighter samples in terms of their spectral shape, turnover frequencies, linear sizes, and ages, but cannot test for a difference in morphology.

A Comparison between Linear IRT Observed-Score Equating and Levine Observed-Score Equating under the Generalized Kernel Equating Framework

ERIC Educational Resources Information Center

Chen, Haiwen

2012-01-01

In this article, linear item response theory (IRT) observed-score equating is compared under a generalized kernel equating framework with Levine observed-score equating for nonequivalent groups with anchor test design. Interestingly, these two equating methods are closely related despite being based on different methodologies. Specifically, when…

A generalized linear factor model approach to the hierarchical framework for responses and response times.

PubMed

Molenaar, Dylan; Tuerlinckx, Francis; van der Maas, Han L J

2015-05-01

We show how the hierarchical model for responses and response times as developed by van der Linden (2007), Fox, Klein Entink, and van der Linden (2007), Klein Entink, Fox, and van der Linden (2009), and Glas and van der Linden (2010) can be simplified to a generalized linear factor model with only the mild restriction that there is no hierarchical model at the item side. This result is valuable as it enables all well-developed modelling tools and extensions that come with these methods. We show that the restriction we impose on the hierarchical model does not influence parameter recovery under realistic circumstances. In addition, we present two illustrative real data analyses to demonstrate the practical benefits of our approach. © 2014 The British Psychological Society.

Exact and near backscattering measurements of the linear depolarisation ratio of various ice crystal habits generated in a laboratory cloud chamber

NASA Astrophysics Data System (ADS)

Smith, Helen R.; Connolly, Paul J.; Webb, Ann R.; Baran, Anthony J.

2016-07-01

Ice clouds were generated in the Manchester Ice Cloud Chamber (MICC), and the backscattering linear depolarisation ratio, δ, was measured for a variety of habits. To create an assortment of particle morphologies, the humidity in the chamber was varied throughout each experiment, resulting in a range of habits from the pristine to the complex. This technique was repeated at three temperatures: -7 °C, -15 °C and -30 °C, in order to produce both solid and hollow columns, plates, sectored plates and dendrites. A linearly polarised 532 nm continuous wave diode laser was directed through a section of the cloud using a non-polarising 50:50 beam splitter. Measurements of the scattered light were taken at 178°, 179° and 180°, using a Glan-Taylor prism to separate the co- and cross-polarised components. The intensities of these components were measured using two amplified photodetectors and the ratio of the cross- to co-polarised intensities was measured to find the linear depolarisation ratio. In general, it was found that Ray Tracing over-predicts the linear depolarisation ratio. However, by creating more accurate particle models which better represent the internal structure of ice particles, discrepancies between measured and modelled results (based on Ray Tracing) were reduced.

Characterizing the performance of the Conway-Maxwell Poisson generalized linear model.

PubMed

Francis, Royce A; Geedipally, Srinivas Reddy; Guikema, Seth D; Dhavala, Soma Sekhar; Lord, Dominique; LaRocca, Sarah

2012-01-01

Count data are pervasive in many areas of risk analysis; deaths, adverse health outcomes, infrastructure system failures, and traffic accidents are all recorded as count events, for example. Risk analysts often wish to estimate the probability distribution for the number of discrete events as part of doing a risk assessment. Traditional count data regression models of the type often used in risk assessment for this problem suffer from limitations due to the assumed variance structure. A more flexible model based on the Conway-Maxwell Poisson (COM-Poisson) distribution was recently proposed, a model that has the potential to overcome the limitations of the traditional model. However, the statistical performance of this new model has not yet been fully characterized. This article assesses the performance of a maximum likelihood estimation method for fitting the COM-Poisson generalized linear model (GLM). The objectives of this article are to (1) characterize the parameter estimation accuracy of the MLE implementation of the COM-Poisson GLM, and (2) estimate the prediction accuracy of the COM-Poisson GLM using simulated data sets. The results of the study indicate that the COM-Poisson GLM is flexible enough to model under-, equi-, and overdispersed data sets with different sample mean values. The results also show that the COM-Poisson GLM yields accurate parameter estimates. The COM-Poisson GLM provides a promising and flexible approach for performing count data regression. © 2011 Society for Risk Analysis.

Modeling meniscus rise in capillary tubes using fluid in rigid-body motion approach

NASA Astrophysics Data System (ADS)

Hamdan, Mohammad O.; Abu-Nabah, Bassam A.

2018-04-01

In this study, a new term representing net flux rate of linear momentum is introduced to Lucas-Washburn equation. Following a fluid in rigid-body motion in modeling the meniscus rise in vertical capillary tubes transforms the nonlinear Lucas-Washburn equation to a linear mass-spring-damper system. The linear nature of mass-spring-damper system with constant coefficients offers a nondimensional analytical solution where meniscus dynamics are dictated by two parameters, namely the system damping ratio and its natural frequency. This connects the numerous fluid-surface interaction physical and geometrical properties to rather two nondimensional parameters, which capture the underlying physics of meniscus dynamics in three distinct cases, namely overdamped, critically damped, and underdamped systems. Based on experimental data available in the literature and the understanding meniscus dynamics, the proposed model brings a new approach of understanding the system initial conditions. Accordingly, a closed form relation is produced for the imbibition velocity, which equals half of the Bosanquet velocity divided by the damping ratio. The proposed general analytical model is ideal for overdamped and critically damped systems. While for underdamped systems, the solution shows fair agreement with experimental measurements once the effective viscosity is determined. Moreover, the presented model shows meniscus oscillations around equilibrium height occur if the damping ratio is less than one.

Optimal exploitation strategies for an animal population in a Markovian environment: A theory and an example

USGS Publications Warehouse

Anderson, D.R.

1975-01-01

Optimal exploitation strategies were studied for an animal population in a Markovian (stochastic, serially correlated) environment. This is a general case and encompasses a number of important special cases as simplifications. Extensive empirical data on the Mallard (Anas platyrhynchos) were used as an example of general theory. The number of small ponds on the central breeding grounds was used as an index to the state of the environment. A general mathematical model was formulated to provide a synthesis of the existing literature, estimates of parameters developed from an analysis of data, and hypotheses regarding the specific effect of exploitation on total survival. The literature and analysis of data were inconclusive concerning the effect of exploitation on survival. Therefore, two hypotheses were explored: (1) exploitation mortality represents a largely additive form of mortality, and (2) exploitation mortality is compensatory with other forms of mortality, at least to some threshold level. Models incorporating these two hypotheses were formulated as stochastic dynamic programming models and optimal exploitation strategies were derived numerically on a digital computer. Optimal exploitation strategies were found to exist under the rather general conditions. Direct feedback control was an integral component in the optimal decision-making process. Optimal exploitation was found to be substantially different depending upon the hypothesis regarding the effect of exploitation on the population. If we assume that exploitation is largely an additive force of mortality in Mallards, then optimal exploitation decisions are a convex function of the size of the breeding population and a linear or slight concave function of the environmental conditions. Under the hypothesis of compensatory mortality forces, optimal exploitation decisions are approximately linearly related to the size of the Mallard breeding population. Dynamic programming is suggested as a very general formulation for realistic solutions to the general optimal exploitation problem. The concepts of state vectors and stage transformations are completely general. Populations can be modeled stochastically and the objective function can include extra-biological factors. The optimal level of exploitation in year t must be based on the observed size of the population and the state of the environment in year t unless the dynamics of the population, the state of the environment, and the result of the exploitation decisions are completely deterministic. Exploitation based on an average harvest, or harvest rate, or designed to maintain a constant breeding population size is inefficient.

Tip-tilt disturbance model identification based on non-linear least squares fitting for Linear Quadratic Gaussian control

NASA Astrophysics Data System (ADS)

Yang, Kangjian; Yang, Ping; Wang, Shuai; Dong, Lizhi; Xu, Bing

2018-05-01

We propose a method to identify tip-tilt disturbance model for Linear Quadratic Gaussian control. This identification method based on Levenberg-Marquardt method conducts with a little prior information and no auxiliary system and it is convenient to identify the tip-tilt disturbance model on-line for real-time control. This identification method makes it easy that Linear Quadratic Gaussian control runs efficiently in different adaptive optics systems for vibration mitigation. The validity of the Linear Quadratic Gaussian control associated with this tip-tilt disturbance model identification method is verified by experimental data, which is conducted in replay mode by simulation.

Normality of raw data in general linear models: The most widespread myth in statistics

USGS Publications Warehouse

Kery, Marc; Hatfield, Jeff S.

2003-01-01

In years of statistical consulting for ecologists and wildlife biologists, by far the most common misconception we have come across has been the one about normality in general linear models. These comprise a very large part of the statistical models used in ecology and include t tests, simple and multiple linear regression, polynomial regression, and analysis of variance (ANOVA) and covariance (ANCOVA). There is a widely held belief that the normality assumption pertains to the raw data rather than to the model residuals. We suspect that this error may also occur in countless published studies, whenever the normality assumption is tested prior to analysis. This may lead to the use of nonparametric alternatives (if there are any), when parametric tests would indeed be appropriate, or to use of transformations of raw data, which may introduce hidden assumptions such as multiplicative effects on the natural scale in the case of log-transformed data. Our aim here is to dispel this myth. We very briefly describe relevant theory for two cases of general linear models to show that the residuals need to be normally distributed if tests requiring normality are to be used, such as t and F tests. We then give two examples demonstrating that the distribution of the response variable may be nonnormal, and yet the residuals are well behaved. We do not go into the issue of how to test normality; instead we display the distributions of response variables and residuals graphically.

Portfolio optimization by using linear programing models based on genetic algorithm

NASA Astrophysics Data System (ADS)

Sukono; Hidayat, Y.; Lesmana, E.; Putra, A. S.; Napitupulu, H.; Supian, S.

2018-01-01

In this paper, we discussed the investment portfolio optimization using linear programming model based on genetic algorithms. It is assumed that the portfolio risk is measured by absolute standard deviation, and each investor has a risk tolerance on the investment portfolio. To complete the investment portfolio optimization problem, the issue is arranged into a linear programming model. Furthermore, determination of the optimum solution for linear programming is done by using a genetic algorithm. As a numerical illustration, we analyze some of the stocks traded on the capital market in Indonesia. Based on the analysis, it is shown that the portfolio optimization performed by genetic algorithm approach produces more optimal efficient portfolio, compared to the portfolio optimization performed by a linear programming algorithm approach. Therefore, genetic algorithms can be considered as an alternative on determining the investment portfolio optimization, particularly using linear programming models.

A quasi-chemical model for the growth and death of microorganisms in foods by non-thermal and high-pressure processing.

PubMed

Doona, Christopher J; Feeherry, Florence E; Ross, Edward W

2005-04-15

Predictive microbial models generally rely on the growth of bacteria in laboratory broth to approximate the microbial growth kinetics expected to take place in actual foods under identical environmental conditions. Sigmoidal functions such as the Gompertz or logistics equation accurately model the typical microbial growth curve from the lag to the stationary phase and provide the mathematical basis for estimating parameters such as the maximum growth rate (MGR). Stationary phase data can begin to show a decline and make it difficult to discern which data to include in the analysis of the growth curve, a factor that influences the calculated values of the growth parameters. In contradistinction, the quasi-chemical kinetics model provides additional capabilities in microbial modelling and fits growth-death kinetics (all four phases of the microbial lifecycle continuously) for a general set of microorganisms in a variety of actual food substrates. The quasi-chemical model is differential equations (ODEs) that derives from a hypothetical four-step chemical mechanism involving an antagonistic metabolite (quorum sensing) and successfully fits the kinetics of pathogens (Staphylococcus aureus, Escherichia coli and Listeria monocytogenes) in various foods (bread, turkey meat, ham and cheese) as functions of different hurdles (a(w), pH, temperature and anti-microbial lactate). The calculated value of the MGR depends on whether growth-death data or only growth data are used in the fitting procedure. The quasi-chemical kinetics model is also exploited for use with the novel food processing technology of high-pressure processing. The high-pressure inactivation kinetics of E. coli are explored in a model food system over the pressure (P) range of 207-345 MPa (30,000-50,000 psi) and the temperature (T) range of 30-50 degrees C. In relatively low combinations of P and T, the inactivation curves are non-linear and exhibit a shoulder prior to a more rapid rate of microbial destruction. In the higher P, T regime, the inactivation plots tend to be linear. In all cases, the quasi-chemical model successfully fit the linear and curvi-linear inactivation plots for E. coli in model food systems. The experimental data and the quasi-chemical mathematical model described herein are candidates for inclusion in ComBase, the developing database that combines data and models from the USDA Pathogen Modeling Program and the UK Food MicroModel.

An experimentally based nonlinear viscoelastic model of joint passive moment.

PubMed

Esteki, A; Mansour, J M

1996-04-01

Previous investigations have not converged on a generally accepted model of the dissipative part of joint passive moment. To provide a basis for developing a model, a series of measurements were performed to characterize the passive moment at the metacarpophalangeal joint of the index finger. Two measurement procedures were used, one in moment relaxation over a range of fixed joint angles and the other at a series of constant joint velocities. Fung's quasi-linear viscoelastic theory motivated the development of the passive moment model. Using this approach, it was not necessary to make restrictive assumptions regarding the viscoelastic behavior of the passive moment. The generality of the formulation allowed specific functions to be chosen based on experimental data rather than finding coefficients which attempted to fit a preselected model of the data. It was shown that a nonlinear viscoelastic model described the passive stiffness. No significant frictional effects were found. Of particular importance was the nonlinear behavior of the dissipative part of the passive moment which was modeled by joint speed raised to a power less than one. This result could explain the differing findings among previous investigations, and may have important implications for control of limb movement.

Penalized nonparametric scalar-on-function regression via principal coordinates

PubMed Central

Reiss, Philip T.; Miller, David L.; Wu, Pei-Shien; Hua, Wen-Yu

2016-01-01

A number of classical approaches to nonparametric regression have recently been extended to the case of functional predictors. This paper introduces a new method of this type, which extends intermediate-rank penalized smoothing to scalar-on-function regression. In the proposed method, which we call principal coordinate ridge regression, one regresses the response on leading principal coordinates defined by a relevant distance among the functional predictors, while applying a ridge penalty. Our publicly available implementation, based on generalized additive modeling software, allows for fast optimal tuning parameter selection and for extensions to multiple functional predictors, exponential family-valued responses, and mixed-effects models. In an application to signature verification data, principal coordinate ridge regression, with dynamic time warping distance used to define the principal coordinates, is shown to outperform a functional generalized linear model. PMID:29217963

Development of orientation tuning in simple cells of primary visual cortex

PubMed Central

Moore, Bartlett D.

2012-01-01

Orientation selectivity and its development are basic features of visual cortex. The original model of orientation selectivity proposes that elongated simple cell receptive fields are constructed from convergent input of an array of lateral geniculate nucleus neurons. However, orientation selectivity of simple cells in the visual cortex is generally greater than the linear contributions based on projections from spatial receptive field profiles. This implies that additional selectivity may arise from intracortical mechanisms. The hierarchical processing idea implies mainly linear connections, whereas cortical contributions are generally considered to be nonlinear. We have explored development of orientation selectivity in visual cortex with a focus on linear and nonlinear factors in a population of anesthetized 4-wk postnatal kittens and adult cats. Linear contributions are estimated from receptive field maps by which orientation tuning curves are generated and bandwidth is quantified. Nonlinear components are estimated as the magnitude of the power function relationship between responses measured from drifting sinusoidal gratings and those predicted from the spatial receptive field. Measured bandwidths for kittens are slightly larger than those in adults, whereas predicted bandwidths are substantially broader. These results suggest that relatively strong nonlinearities in early postnatal stages are substantially involved in the development of orientation tuning in visual cortex. PMID:22323631

Three-dimensional modeling of flexible pavements : research implementation plan.

DOT National Transportation Integrated Search

2006-02-14

Many of the asphalt pavement analysis programs are based on linear elastic models. A linear viscoelastic models : would be superior to linear elastic models for analyzing the response of asphalt concrete pavements to loads. There : is a need to devel...

Charge and pairing dynamics in the attractive Hubbard model: Mode coupling and the validity of linear-response theory

NASA Astrophysics Data System (ADS)

Bünemann, Jörg; Seibold, Götz

2017-12-01

Pump-probe experiments have turned out as a powerful tool in order to study the dynamics of competing orders in a large variety of materials. The corresponding analysis of the data often relies on standard linear-response theory generalized to nonequilibrium situations. Here we examine the validity of such an approach for the charge and pairing response of systems with charge-density wave and (or) superconducting (SC) order. Our investigations are based on the attractive Hubbard model which we study within the time-dependent Hartree-Fock approximation. In particular, we calculate the quench and pump-probe dynamics for SC and charge order parameters in order to analyze the frequency spectra and the coupling of the probe field to the specific excitations. Our calculations reveal that the "linear-response assumption" is justified for small to moderate nonequilibrium situations (i.e., pump pulses) in the case of a purely charge-ordered ground state. However, the pump-probe dynamics on top of a superconducting ground state is determined by phase and amplitude modes which get coupled far from the equilibrium state indicating the failure of the linear-response assumption.

Enhanced simulation software for rocket turbopump, turbulent, annular liquid seals

NASA Technical Reports Server (NTRS)

Padavala, Satya; Palazzolo, Alan

1994-01-01

One of the main objectives of this work is to develop a new dynamic analysis for liquid annular seals with arbitrary profile and to analyze a general distorted interstage seal of the space shuttle main engine high pressure oxygen turbopump (SSME-ATD-HPOTP). The dynamic analysis developed is based on a method originally proposed by Nelson and Nguyen. A simpler scheme based on cubic splines is found to be computationally more efficient and has better convergence properties at higher eccentricities. The first order solution of the original analysis is modified by including a more exact solution that takes into account the variation of perturbed variables along the circumference. A new set of equations for dynamic analysis are derived based on this more general model. A unified solution procedure that is valid for both Moody's and Hirs' friction models is presented. Dynamic analysis is developed for three different models: constant properties, variable properties, and thermal effects with variable properties. Arbitrarily varying seal profiles in both axial and circumferential directions are considered. An example case of an elliptical seal with varying degrees of axial curvature is analyzed in detail. A case study based on predicted clearances of an interstage seal of the SSME-ATD-HPOTP is presented. Dynamic coefficients based on external specified load are introduced to analyze seals that support a preload. The other objective of this work is to study the effect of large rotor displacements of SSME-ATD-HPOTP on the dynamics of the annular seal and the resulting transient motion. One task is to identify the magnitude of motion of the rotor about the centered position and establish limits of effectiveness of using current linear models. This task is accomplished by solving the bulk flow model seal governing equations directly for transient seal forces for any given type of motion, including motion with large eccentricities. Based on the above study, an equivalence is established between linearized coefficients based transient motion and the same motion as predicted by the original governing equations. An innovative method is developed to model nonlinearities in an annular seal based on dynamic coefficients computed at various static eccentricities. This method is thoroughly tested for various types of transient motion using bulk flow model results as a benchmark.

A study on nonlinear estimation of submaximal effort tolerance based on the generalized MET concept and the 6MWT in pulmonary rehabilitation

PubMed Central

Szczegielniak, Jan; Łuniewski, Jacek; Stanisławski, Rafał; Bogacz, Katarzyna; Krajczy, Marcin; Rydel, Marek

2018-01-01

Background The six-minute walk test (6MWT) is considered to be a simple and inexpensive tool for the assessment of functional tolerance of submaximal effort. The aim of this work was 1) to background the nonlinear nature of the energy expenditure process due to physical activity, 2) to compare the results/scores of the submaximal treadmill exercise test and those of 6MWT in pulmonary patients and 3) to develop nonlinear mathematical models relating the two. Methods The study group included patients with the COPD. All patients were subjected to a submaximal exercise test and a 6MWT. To develop an optimal mathematical solution and compare the results of the exercise test and the 6MWT, the least squares and genetic algorithms were employed to estimate parameters of polynomial expansion and piecewise linear models. Results Mathematical analysis enabled to construct nonlinear models for estimating the MET result of submaximal exercise test based on average walk velocity (or distance) in the 6MWT. Conclusions Submaximal effort tolerance in COPD patients can be effectively estimated from new, rehabilitation-oriented, nonlinear models based on the generalized MET concept and the 6MWT. PMID:29425213

Optimal Estimation of Clock Values and Trends from Finite Data

NASA Technical Reports Server (NTRS)

Greenhall, Charles

2005-01-01

We show how to solve two problems of optimal linear estimation from a finite set of phase data. Clock noise is modeled as a stochastic process with stationary dth increments. The covariance properties of such a process are contained in the generalized autocovariance function (GACV). We set up two principles for optimal estimation: with the help of the GACV, these principles lead to a set of linear equations for the regression coefficients and some auxiliary parameters. The mean square errors of the estimators are easily calculated. The method can be used to check the results of other methods and to find good suboptimal estimators based on a small subset of the available data.

Neonatal MRI is associated with future cognition and academic achievement in preterm children

PubMed Central

Spencer-Smith, Megan; Thompson, Deanne K.; Doyle, Lex W.; Inder, Terrie E.; Anderson, Peter J.; Klingberg, Torkel

2015-01-01

School-age children born preterm are particularly at risk for low mathematical achievement, associated with reduced working memory and number skills. Early identification of preterm children at risk for future impairments using brain markers might assist in referral for early intervention. This study aimed to examine the use of neonatal magnetic resonance imaging measures derived from automated methods (Jacobian maps from deformation-based morphometry; fractional anisotropy maps from diffusion tensor images) to predict skills important for mathematical achievement (working memory, early mathematical skills) at 5 and 7 years in a cohort of preterm children using both univariable (general linear model) and multivariable models (support vector regression). Participants were preterm children born <30 weeks’ gestational age and healthy control children born ≥37 weeks’ gestational age at the Royal Women’s Hospital in Melbourne, Australia between July 2001 and December 2003 and recruited into a prospective longitudinal cohort study. At term-equivalent age ( ±2 weeks) 224 preterm and 46 control infants were recruited for magnetic resonance imaging. Working memory and early mathematics skills were assessed at 5 years (n = 195 preterm; n = 40 controls) and 7 years (n = 197 preterm; n = 43 controls). In the preterm group, results identified localized regions around the insula and putamen in the neonatal Jacobian map that were positively associated with early mathematics at 5 and 7 years (both P < 0.05), even after covarying for important perinatal clinical factors using general linear model but not support vector regression. The neonatal Jacobian map showed the same trend for association with working memory at 7 years (models ranging from P = 0.07 to P = 0.05). Neonatal fractional anisotropy was positively associated with working memory and early mathematics at 5 years (both P < 0.001) even after covarying for clinical factors using support vector regression but not general linear model. These significant relationships were not observed in the control group. In summary, we identified, in the preterm brain, regions around the insula and putamen using neonatal deformation-based morphometry, and brain microstructural organization using neonatal diffusion tensor imaging, associated with skills important for childhood mathematical achievement. Results contribute to the growing evidence for the clinical utility of neonatal magnetic resonance imaging for early identification of preterm infants at risk for childhood cognitive and academic impairment. PMID:26329284

Fuzzy branching temporal logic.

PubMed

Moon, Seong-ick; Lee, Kwang H; Lee, Doheon

2004-04-01

Intelligent systems require a systematic way to represent and handle temporal information containing uncertainty. In particular, a logical framework is needed that can represent uncertain temporal information and its relationships with logical formulae. Fuzzy linear temporal logic (FLTL), a generalization of propositional linear temporal logic (PLTL) with fuzzy temporal events and fuzzy temporal states defined on a linear time model, was previously proposed for this purpose. However, many systems are best represented by branching time models in which each state can have more than one possible future path. In this paper, fuzzy branching temporal logic (FBTL) is proposed to address this problem. FBTL adopts and generalizes concurrent tree logic (CTL*), which is a classical branching temporal logic. The temporal model of FBTL is capable of representing fuzzy temporal events and fuzzy temporal states, and the order relation among them is represented as a directed graph. The utility of FBTL is demonstrated using a fuzzy job shop scheduling problem as an example.

Real-tiem Adaptive Control Scheme for Superior Plasma Confinement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexander Trunov, Ph.D.

2001-06-01

During this Phase I project, IOS, in collaboration with our subcontractors at General Atomics, Inc., acquired and analyzed measurement data on various plasma equilibrium modes. We developed a Matlab-based toolbox consisting of linear and neural network approximators that are capable of learning and predicting, with accuracy, the behavior of plasma parameters. We also began development of the control algorithm capable of using the model of the plasma obtained by the neural network approximator.

UAV Swarm Tactics: An Agent-Based Simulation and Markov Process Analysis

DTIC Science & Technology

2013-06-01

CRN Common Random Numbers CSV Comma Separated Values DoE Design of Experiment GLM Generalized Linear Model HVT High Value Target JAR Java ARchive JMF... Java Media Framework JRE Java runtime environment Mason Multi-Agent Simulator Of Networks MOE Measure Of Effectiveness MOP Measures Of Performance...with every set several times, and to write a CSV file with the results. Rather than scripting the agent behavior deterministically, the agents should

Exact solutions of the Navier-Stokes equations generalized for flow in porous media

NASA Astrophysics Data System (ADS)

Daly, Edoardo; Basser, Hossein; Rudman, Murray

2018-05-01

Flow of Newtonian fluids in porous media is often modelled using a generalized version of the full non-linear Navier-Stokes equations that include additional terms describing the resistance to flow due to the porous matrix. Because this formulation is becoming increasingly popular in numerical models, exact solutions are required as a benchmark of numerical codes. The contribution of this study is to provide a number of non-trivial exact solutions of the generalized form of the Navier-Stokes equations for parallel flow in porous media. Steady-state solutions are derived in the case of flows in a medium with constant permeability along the main direction of flow and a constant cross-stream velocity in the case of both linear and non-linear drag. Solutions are also presented for cases in which the permeability changes in the direction normal to the main flow. An unsteady solution for a flow with velocity driven by a time-periodic pressure gradient is also derived. These solutions form a basis for validating computational models across a wide range of Reynolds and Darcy numbers.

A Bayesian hierarchical model with spatial variable selection: the effect of weather on insurance claims

PubMed Central

Scheel, Ida; Ferkingstad, Egil; Frigessi, Arnoldo; Haug, Ola; Hinnerichsen, Mikkel; Meze-Hausken, Elisabeth

2013-01-01

Climate change will affect the insurance industry. We develop a Bayesian hierarchical statistical approach to explain and predict insurance losses due to weather events at a local geographic scale. The number of weather-related insurance claims is modelled by combining generalized linear models with spatially smoothed variable selection. Using Gibbs sampling and reversible jump Markov chain Monte Carlo methods, this model is fitted on daily weather and insurance data from each of the 319 municipalities which constitute southern and central Norway for the period 1997–2006. Precise out-of-sample predictions validate the model. Our results show interesting regional patterns in the effect of different weather covariates. In addition to being useful for insurance pricing, our model can be used for short-term predictions based on weather forecasts and for long-term predictions based on downscaled climate models. PMID:23396890

Gstat: a program for geostatistical modelling, prediction and simulation

NASA Astrophysics Data System (ADS)

Pebesma, Edzer J.; Wesseling, Cees G.

1998-01-01

Gstat is a computer program for variogram modelling, and geostatistical prediction and simulation. It provides a generic implementation of the multivariable linear model with trends modelled as a linear function of coordinate polynomials or of user-defined base functions, and independent or dependent, geostatistically modelled, residuals. Simulation in gstat comprises conditional or unconditional (multi-) Gaussian sequential simulation of point values or block averages, or (multi-) indicator sequential simulation. Besides many of the popular options found in other geostatistical software packages, gstat offers the unique combination of (i) an interactive user interface for modelling variograms and generalized covariances (residual variograms), that uses the device-independent plotting program gnuplot for graphical display, (ii) support for several ascii and binary data and map file formats for input and output, (iii) a concise, intuitive and flexible command language, (iv) user customization of program defaults, (v) no built-in limits, and (vi) free, portable ANSI-C source code. This paper describes the class of problems gstat can solve, and addresses aspects of efficiency and implementation, managing geostatistical projects, and relevant technical details.

Generalizing a Categorization of Students' Interpretations of Linear Kinematics Graphs

ERIC Educational Resources Information Center

Bollen, Laurens; De Cock, Mieke; Zuza, Kristina; Guisasola, Jenaro; van Kampen, Paul

2016-01-01

We have investigated whether and how a categorization of responses to questions on linear distance-time graphs, based on a study of Irish students enrolled in an algebra-based course, could be adopted and adapted to responses from students enrolled in calculus-based physics courses at universities in Flanders, Belgium (KU Leuven) and the Basque…

On Deployment of Multiple Base Stations for Energy-Efficient Communication in Wireless Sensor Networks

DOE PAGES

Lin, Yunyue; Wu, Qishi; Cai, Xiaoshan; ...

2010-01-01

Data transmission from sensor nodes to a base station or a sink node often incurs significant energy consumption, which critically affects network lifetime. We generalize and solve the problem of deploying multiple base stations to maximize network lifetime in terms of two different metrics under one-hop and multihop communication models. In the one-hop communication model, the sensors far away from base stations always deplete their energy much faster than others. We propose an optimal solution and a heuristic approach based on the minimal enclosing circle algorithm to deploy a base station at the geometric center of each cluster. In themore » multihop communication model, both base station location and data routing mechanism need to be considered in maximizing network lifetime. We propose an iterative algorithm based on rigorous mathematical derivations and use linear programming to compute the optimal routing paths for data transmission. Simulation results show the distinguished performance of the proposed deployment algorithms in maximizing network lifetime.« less

Creep and creep rupture of laminated graphite/epoxy composites. Ph.D. Thesis. Final Report, 1 Oct. 1979 - 30 Sep. 1980

NASA Technical Reports Server (NTRS)

Dillard, D. A.; Morris, D. H.; Brinson, H. F.

1981-01-01

An incremental numerical procedure based on lamination theory is developed to predict creep and creep rupture of general laminates. Existing unidirectional creep compliance and delayed failure data is used to develop analytical models for lamina response. The compliance model is based on a procedure proposed by Findley which incorporates the power law for creep into a nonlinear constitutive relationship. The matrix octahedral shear stress is assumed to control the stress interaction effect. A modified superposition principle is used to account for the varying stress level effect on the creep strain. The lamina failure model is based on a modification of the Tsai-Hill theory which includes the time dependent creep rupture strength. A linear cumulative damage law is used to monitor the remaining lifetime in each ply.

Differences in Connection Strength between Mental Symptoms Might Be Explained by Differences in Variance: Reanalysis of Network Data Did Not Confirm Staging.

PubMed

Terluin, Berend; de Boer, Michiel R; de Vet, Henrica C W

2016-01-01

The network approach to psychopathology conceives mental disorders as sets of symptoms causally impacting on each other. The strengths of the connections between symptoms are key elements in the description of those symptom networks. Typically, the connections are analysed as linear associations (i.e., correlations or regression coefficients). However, there is insufficient awareness of the fact that differences in variance may account for differences in connection strength. Differences in variance frequently occur when subgroups are based on skewed data. An illustrative example is a study published in PLoS One (2013;8(3):e59559) that aimed to test the hypothesis that the development of psychopathology through "staging" was characterized by increasing connection strength between mental states. Three mental states (negative affect, positive affect, and paranoia) were studied in severity subgroups of a general population sample. The connection strength was found to increase with increasing severity in six of nine models. However, the method used (linear mixed modelling) is not suitable for skewed data. We reanalysed the data using inverse Gaussian generalized linear mixed modelling, a method suited for positively skewed data (such as symptoms in the general population). The distribution of positive affect was normal, but the distributions of negative affect and paranoia were heavily skewed. The variance of the skewed variables increased with increasing severity. Reanalysis of the data did not confirm increasing connection strength, except for one of nine models. Reanalysis of the data did not provide convincing evidence in support of staging as characterized by increasing connection strength between mental states. Network researchers should be aware that differences in connection strength between symptoms may be caused by differences in variances, in which case they should not be interpreted as differences in impact of one symptom on another symptom.

Global identifiability of linear compartmental models--a computer algebra algorithm.

PubMed

Audoly, S; D'Angiò, L; Saccomani, M P; Cobelli, C

1998-01-01

A priori global identifiability deals with the uniqueness of the solution for the unknown parameters of a model and is, thus, a prerequisite for parameter estimation of biological dynamic models. Global identifiability is however difficult to test, since it requires solving a system of algebraic nonlinear equations which increases both in nonlinearity degree and number of terms and unknowns with increasing model order. In this paper, a computer algebra tool, GLOBI (GLOBal Identifiability) is presented, which combines the topological transfer function method with the Buchberger algorithm, to test global identifiability of linear compartmental models. GLOBI allows for the automatic testing of a priori global identifiability of general structure compartmental models from general multi input-multi output experiments. Examples of usage of GLOBI to analyze a priori global identifiability of some complex biological compartmental models are provided.

Flexible Approaches to Computing Mediated Effects in Generalized Linear Models: Generalized Estimating Equations and Bootstrapping

ERIC Educational Resources Information Center

Schluchter, Mark D.

2008-01-01

In behavioral research, interest is often in examining the degree to which the effect of an independent variable X on an outcome Y is mediated by an intermediary or mediator variable M. This article illustrates how generalized estimating equations (GEE) modeling can be used to estimate the indirect or mediated effect, defined as the amount by…

A modelling approach to assessing the timescale uncertainties in proxy series with chronological errors

NASA Astrophysics Data System (ADS)

Divine, D.; Godtliebsen, F.; Rue, H.

2012-04-01

Detailed knowledge of past climate variations is of high importance for gaining a better insight into the possible future climate scenarios. The relative shortness of available high quality instrumental climate data conditions the use of various climate proxy archives in making inference about past climate evolution. It, however, requires an accurate assessment of timescale errors in proxy-based paleoclimatic reconstructions. We here propose an approach to assessment of timescale errors in proxy-based series with chronological uncertainties. The method relies on approximation of the physical process(es) forming a proxy archive by a random Gamma process. Parameters of the process are partly data-driven and partly determined from prior assumptions. For a particular case of a linear accumulation model and absolutely dated tie points an analytical solution is found suggesting the Beta-distributed probability density on age estimates along the length of a proxy archive. In a general situation of uncertainties in the ages of the tie points the proposed method employs MCMC simulations of age-depth profiles yielding empirical confidence intervals on the constructed piecewise linear best guess timescale. It is suggested that the approach can be further extended to a more general case of a time-varying expected accumulation between the tie points. The approach is illustrated by using two ice and two lake/marine sediment cores representing the typical examples of paleoproxy archives with age models constructed using tie points of mixed origin.

Robust small area prediction for counts.

PubMed

Tzavidis, Nikos; Ranalli, M Giovanna; Salvati, Nicola; Dreassi, Emanuela; Chambers, Ray

2015-06-01

A new semiparametric approach to model-based small area prediction for counts is proposed and used for estimating the average number of visits to physicians for Health Districts in Central Italy. The proposed small area predictor can be viewed as an outlier robust alternative to the more commonly used empirical plug-in predictor that is based on a Poisson generalized linear mixed model with Gaussian random effects. Results from the real data application and from a simulation experiment confirm that the proposed small area predictor has good robustness properties and in some cases can be more efficient than alternative small area approaches. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

On Fitting Generalized Linear Mixed-effects Models for Binary Responses using Different Statistical Packages

PubMed Central

Zhang, Hui; Lu, Naiji; Feng, Changyong; Thurston, Sally W.; Xia, Yinglin; Tu, Xin M.

2011-01-01

Summary The generalized linear mixed-effects model (GLMM) is a popular paradigm to extend models for cross-sectional data to a longitudinal setting. When applied to modeling binary responses, different software packages and even different procedures within a package may give quite different results. In this report, we describe the statistical approaches that underlie these different procedures and discuss their strengths and weaknesses when applied to fit correlated binary responses. We then illustrate these considerations by applying these procedures implemented in some popular software packages to simulated and real study data. Our simulation results indicate a lack of reliability for most of the procedures considered, which carries significant implications for applying such popular software packages in practice. PMID:21671252

Flavor non-universal gauge interactions and anomalies in B-meson decays

NASA Astrophysics Data System (ADS)

Tang, Yong; Wu, Yue-Liang

2018-02-01

Motivated by flavor non-universality and anomalies in semi-leptonic B-meson decays, we present a general and systematic discussion about how to construct anomaly-free U(1)‧ gauge theories based on an extended standard model with only three right-handed neutrinos. If all standard model fermions are vector-like under this new gauge symmetry, the most general family non-universal charge assignments, (a,b,c) for three-generation quarks and (d,e,f) for leptons, need satisfy just one condition to be anomaly-free, 3(a+b+c) = - (d+e+f). Any assignment can be linear combinations of five independent anomaly-free solutions. We also illustrate how such models can generally lead to flavor-changing interactions and easily resolve the anomalies in B-meson decays. Probes with {{B}}{s} - {{\\bar B}}{s} mixing, decay into τ ±, dilepton and dijet searches at colliders are also discussed. Supported by the Grant-in-Aid for Innovative Areas (16H06490)

Uncertainty quantification for environmental models

USGS Publications Warehouse

Hill, Mary C.; Lu, Dan; Kavetski, Dmitri; Clark, Martyn P.; Ye, Ming

2012-01-01

Environmental models are used to evaluate the fate of fertilizers in agricultural settings (including soil denitrification), the degradation of hydrocarbons at spill sites, and water supply for people and ecosystems in small to large basins and cities—to mention but a few applications of these models. They also play a role in understanding and diagnosing potential environmental impacts of global climate change. The models are typically mildly to extremely nonlinear. The persistent demand for enhanced dynamics and resolution to improve model realism [17] means that lengthy individual model execution times will remain common, notwithstanding continued enhancements in computer power. In addition, high-dimensional parameter spaces are often defined, which increases the number of model runs required to quantify uncertainty [2]. Some environmental modeling projects have access to extensive funding and computational resources; many do not. The many recent studies of uncertainty quantification in environmental model predictions have focused on uncertainties related to data error and sparsity of data, expert judgment expressed mathematically through prior information, poorly known parameter values, and model structure (see, for example, [1,7,9,10,13,18]). Approaches for quantifying uncertainty include frequentist (potentially with prior information [7,9]), Bayesian [13,18,19], and likelihood-based. A few of the numerous methods, including some sensitivity and inverse methods with consequences for understanding and quantifying uncertainty, are as follows: Bayesian hierarchical modeling and Bayesian model averaging; single-objective optimization with error-based weighting [7] and multi-objective optimization [3]; methods based on local derivatives [2,7,10]; screening methods like OAT (one at a time) and the method of Morris [14]; FAST (Fourier amplitude sensitivity testing) [14]; the Sobol' method [14]; randomized maximum likelihood [10]; Markov chain Monte Carlo (MCMC) [10]. There are also bootstrapping and cross-validation approaches.Sometimes analyses are conducted using surrogate models [12]. The availability of so many options can be confusing. Categorizing methods based on fundamental questions assists in communicating the essential results of uncertainty analyses to stakeholders. Such questions can focus on model adequacy (e.g., How well does the model reproduce observed system characteristics and dynamics?) and sensitivity analysis (e.g., What parameters can be estimated with available data? What observations are important to parameters and predictions? What parameters are important to predictions?), as well as on the uncertainty quantification (e.g., How accurate and precise are the predictions?). The methods can also be classified by the number of model runs required: few (10s to 1000s) or many (10,000s to 1,000,000s). Of the methods listed above, the most computationally frugal are generally those based on local derivatives; MCMC methods tend to be among the most computationally demanding. Surrogate models (emulators)do not necessarily produce computational frugality because many runs of the full model are generally needed to create a meaningful surrogate model. With this categorization, we can, in general, address all the fundamental questions mentioned above using either computationally frugal or demanding methods. Model development and analysis can thus be conducted consistently using either computation-ally frugal or demanding methods; alternatively, different fundamental questions can be addressed using methods that require different levels of effort. Based on this perspective, we pose the question: Can computationally frugal methods be useful companions to computationally demanding meth-ods? The reliability of computationally frugal methods generally depends on the model being reasonably linear, which usually means smooth nonlin-earities and the assumption of Gaussian errors; both tend to be more valid with more linear

Electrokinetic transport of rigid macroions in the thin double layer limit: a boundary element approach.

PubMed

Allison, Stuart A; Xin, Yao

2005-08-15

A boundary element (BE) procedure is developed to numerically calculate the electrophoretic mobility of highly charged, rigid model macroions in the thin double layer regime based on the continuum primitive model. The procedure is based on that of O'Brien (R.W. O'Brien, J. Colloid Interface Sci. 92 (1983) 204). The advantage of the present procedure over existing BE methodologies that are applicable to rigid model macroions in general (S. Allison, Macromolecules 29 (1996) 7391) is that computationally time consuming integrations over a large number of volume elements that surround the model particle are completely avoided. The procedure is tested by comparing the mobilities derived from it with independent theory of the mobility of spheres of radius a in a salt solution with Debye-Huckel screening parameter, kappa. The procedure is shown to yield accurate mobilities provided (kappa)a exceeds approximately 50. The methodology is most relevant to model macroions of mean linear dimension, L, with 1000>(kappa)L>100 and reduced absolute zeta potential (q|zeta|/k(B)T) greater than 1.0. The procedure is then applied to the compact form of high molecular weight, duplex DNA that is formed in the presence of the trivalent counterion, spermidine, under low salt conditions. For T4 DNA (166,000 base pairs), the compact form is modeled as a sphere (diameter=600 nm) and as a toroid (largest linear dimension=600 nm). In order to reconcile experimental and model mobilities, approximately 95% of the DNA phosphates must be neutralized by bound counterions. This interpretation, based on electrokinetics, is consistent with independent studies.

Gain optimization with non-linear controls

NASA Technical Reports Server (NTRS)

Slater, G. L.; Kandadai, R. D.

1984-01-01

An algorithm has been developed for the analysis and design of controls for non-linear systems. The technical approach is to use statistical linearization to model the non-linear dynamics of a system by a quasi-Gaussian model. A covariance analysis is performed to determine the behavior of the dynamical system and a quadratic cost function. Expressions for the cost function and its derivatives are determined so that numerical optimization techniques can be applied to determine optimal feedback laws. The primary application for this paper is centered about the design of controls for nominally linear systems but where the controls are saturated or limited by fixed constraints. The analysis is general, however, and numerical computation requires only that the specific non-linearity be considered in the analysis.

Pilots Rate Augmented Generalized Predictive Control for Reconfiguration

NASA Technical Reports Server (NTRS)

Soloway, Don; Haley, Pam

2004-01-01

The objective of this paper is to report the results from the research being conducted in reconfigurable fight controls at NASA Ames. A study was conducted with three NASA Dryden test pilots to evaluate two approaches of reconfiguring an aircraft's control system when failures occur in the control surfaces and engine. NASA Ames is investigating both a Neural Generalized Predictive Control scheme and a Neural Network based Dynamic Inverse controller. This paper highlights the Predictive Control scheme where a simple augmentation to reduce zero steady-state error led to the neural network predictor model becoming redundant for the task. Instead of using a neural network predictor model, a nominal single point linear model was used and then augmented with an error corrector. This paper shows that the Generalized Predictive Controller and the Dynamic Inverse Neural Network controller perform equally well at reconfiguration, but with less rate requirements from the actuators. Also presented are the pilot ratings for each controller for various failure scenarios and two samples of the required control actuation during reconfiguration. Finally, the paper concludes by stepping through the Generalized Predictive Control's reconfiguration process for an elevator failure.

Statistical Methodology for the Analysis of Repeated Duration Data in Behavioral Studies.

PubMed

Letué, Frédérique; Martinez, Marie-José; Samson, Adeline; Vilain, Anne; Vilain, Coriandre

2018-03-15

Repeated duration data are frequently used in behavioral studies. Classical linear or log-linear mixed models are often inadequate to analyze such data, because they usually consist of nonnegative and skew-distributed variables. Therefore, we recommend use of a statistical methodology specific to duration data. We propose a methodology based on Cox mixed models and written under the R language. This semiparametric model is indeed flexible enough to fit duration data. To compare log-linear and Cox mixed models in terms of goodness-of-fit on real data sets, we also provide a procedure based on simulations and quantile-quantile plots. We present two examples from a data set of speech and gesture interactions, which illustrate the limitations of linear and log-linear mixed models, as compared to Cox models. The linear models are not validated on our data, whereas Cox models are. Moreover, in the second example, the Cox model exhibits a significant effect that the linear model does not. We provide methods to select the best-fitting models for repeated duration data and to compare statistical methodologies. In this study, we show that Cox models are best suited to the analysis of our data set.

Gadolinium deposition in the brain: association with various GBCAs using a generalized additive model.

PubMed

Bae, Sohi; Lee, Ho-Joon; Han, Kyunghwa; Park, Yae-Won; Choi, Yoon Seong; Ahn, Sung Soo; Kim, Jinna; Lee, Seung-Koo

2017-08-01

To determine the relationship between the number of administrations of various gadolinium-based contrast agents (GBCAs) and increased T1 signal intensity in the globus pallidus (GP) and dentate nucleus (DN). This retrospective study included 122 patients who underwent double-dose GBCA-enhanced magnetic resonance imaging. Two radiologists calculated GP-to-thalamus (TH) signal intensity ratio, DN-to-pons signal intensity ratio and relative change (R change ) between the baseline and final examinations. Interobserver agreement was evaluated. The relationships between R change and several factors, including number of each GBCA administrations, were analysed using a generalized additive model. Six patients (4.9%) received linear GBCAs (mean 20.8 number of administration; range 15-30), 44 patients (36.1%) received macrocyclic GBCAs (mean 26.1; range 14-51) and 72 patients (59.0%) received both types of GBCAs (mean 31.5; range 12-65). Interobserver agreement was almost perfect (0.99; 95% CI: 0.99-0.99). R change (DN:pons) was associated with gadodiamide (p = 0.006) and gadopentetate dimeglumine (p < 0.001), but not with other GBCAs. R change (GP:TH) was not associated with GBCA administration. Previous administration of linear agents gadoiamide and gadopentetate dimeglumine is associated with increased T1 signal intensity in the DN, whereas macrocyclic GBCAs do not show an association. • Certain linear GBCAs are associated with T1 signal change in the dentate nucleus. • The signal change is related to the administration number of certain linear GBCAs. • Difference in signal change may reflect differences in stability of agents.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Qichun; Zhang, Xuesong; Xu, Xingya

Riverine carbon cycling is an important, but insufficiently investigated component of the global carbon cycle. Analyses of environmental controls on riverine carbon cycling are critical for improved understanding of mechanisms regulating carbon processing and storage along the terrestrial-aquatic continuum. Here, we compile and analyze riverine dissolved organic carbon (DOC) concentration data from 1402 United States Geological Survey (USGS) gauge stations to examine the spatial variability and environmental controls of DOC concentrations in the United States (U.S.) surface waters. DOC concentrations exhibit high spatial variability, with an average of 6.42 ± 6.47 mg C/ L (Mean ± Standard Deviation). In general,more » high DOC concentrations occur in the Upper Mississippi River basin and the Southeastern U.S., while low concentrations are mainly distributed in the Western U.S. Single-factor analysis indicates that slope of drainage areas, wetlands, forests, percentage of first-order streams, and instream nutrients (such as nitrogen and phosphorus) pronouncedly influence DOC concentrations, but the explanatory power of each bivariate model is lower than 35%. Analyses based on the general multi-linear regression models suggest DOC concentrations are jointly impacted by multiple factors. Soil properties mainly show positive correlations with DOC concentrations; forest and shrub lands have positive correlations with DOC concentrations, but urban area and croplands demonstrate negative impacts; total instream phosphorus and dam density correlate positively with DOC concentrations. Notably, the relative importance of these environmental controls varies substantially across major U.S. water resource regions. In addition, DOC concentrations and environmental controls also show significant variability from small streams to large rivers, which may be caused by changing carbon sources and removal rates by river orders. In sum, our results reveal that general multi-linear regression analysis of twenty one terrestrial and aquatic environmental factors can partially explain (56%) the DOC concentration variation. In conclusion, this study highlights the complexity of the interactions among these environmental factors in determining DOC concentrations, thus calls for processes-based, non-linear methodologies to constrain uncertainties in riverine DOC cycling.« less

A General Approach to Causal Mediation Analysis

ERIC Educational Resources Information Center

Imai, Kosuke; Keele, Luke; Tingley, Dustin

2010-01-01

Traditionally in the social sciences, causal mediation analysis has been formulated, understood, and implemented within the framework of linear structural equation models. We argue and demonstrate that this is problematic for 3 reasons: the lack of a general definition of causal mediation effects independent of a particular statistical model, the…

Discounting of reward sequences: a test of competing formal models of hyperbolic discounting

PubMed Central

Zarr, Noah; Alexander, William H.; Brown, Joshua W.

2014-01-01

Humans are known to discount future rewards hyperbolically in time. Nevertheless, a formal recursive model of hyperbolic discounting has been elusive until recently, with the introduction of the hyperbolically discounted temporal difference (HDTD) model. Prior to that, models of learning (especially reinforcement learning) have relied on exponential discounting, which generally provides poorer fits to behavioral data. Recently, it has been shown that hyperbolic discounting can also be approximated by a summed distribution of exponentially discounted values, instantiated in the μAgents model. The HDTD model and the μAgents model differ in one key respect, namely how they treat sequences of rewards. The μAgents model is a particular implementation of a Parallel discounting model, which values sequences based on the summed value of the individual rewards whereas the HDTD model contains a non-linear interaction. To discriminate among these models, we observed how subjects discounted a sequence of three rewards, and then we tested how well each candidate model fit the subject data. The results show that the Parallel model generally provides a better fit to the human data. PMID:24639662

Rank-based estimation in the {ell}1-regularized partly linear model for censored outcomes with application to integrated analyses of clinical predictors and gene expression data.

PubMed

Johnson, Brent A

2009-10-01

We consider estimation and variable selection in the partial linear model for censored data. The partial linear model for censored data is a direct extension of the accelerated failure time model, the latter of which is a very important alternative model to the proportional hazards model. We extend rank-based lasso-type estimators to a model that may contain nonlinear effects. Variable selection in such partial linear model has direct application to high-dimensional survival analyses that attempt to adjust for clinical predictors. In the microarray setting, previous methods can adjust for other clinical predictors by assuming that clinical and gene expression data enter the model linearly in the same fashion. Here, we select important variables after adjusting for prognostic clinical variables but the clinical effects are assumed nonlinear. Our estimator is based on stratification and can be extended naturally to account for multiple nonlinear effects. We illustrate the utility of our method through simulation studies and application to the Wisconsin prognostic breast cancer data set.

High Fidelity Modeling of Field Reversed Configuration (FRC) Thrusters

DTIC Science & Technology

2017-04-22

signatures which can be used for direct, non -invasive, comparison with experimental diagnostics can be produced. This research will be directly... experimental campaign is critical to developing general design philosophies for low-power plasmoid formation, the complexity of non -linear plasma processes...advanced space propulsion. The work consists of numerical method development, physical model development, and systematic studies of the non -linear

The role of building models in the evaluation of heat-related risks

NASA Astrophysics Data System (ADS)

Buchin, Oliver; Jänicke, Britta; Meier, Fred; Scherer, Dieter; Ziegler, Felix

2016-04-01

Hazard-risk relationships in epidemiological studies are generally based on the outdoor climate, despite the fact that most of humans' lifetime is spent indoors. By coupling indoor and outdoor climates with a building model, the risk concept developed can still be based on the outdoor conditions but also includes exposure to the indoor climate. The influence of non-linear building physics and the impact of air conditioning on heat-related risks can be assessed in a plausible manner using this risk concept. For proof of concept, the proposed risk concept is compared to a traditional risk analysis. As an example, daily and city-wide mortality data of the age group 65 and older in Berlin, Germany, for the years 2001-2010 are used. Four building models with differing complexity are applied in a time-series regression analysis. This study shows that indoor hazard better explains the variability in the risk data compared to outdoor hazard, depending on the kind of building model. Simplified parameter models include the main non-linear effects and are proposed for the time-series analysis. The concept shows that the definitions of heat events, lag days, and acclimatization in a traditional hazard-risk relationship are influenced by the characteristics of the prevailing building stock.

Non-Condon nonequilibrium Fermi’s golden rule rates from the linearized semiclassical method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Xiang; Geva, Eitan

2016-08-14

The nonequilibrium Fermi’s golden rule describes the transition between a photoexcited bright donor electronic state and a dark acceptor electronic state, when the nuclear degrees of freedom start out in a nonequilibrium state. In a previous paper [X. Sun and E. Geva, J. Chem. Theory Comput. 12, 2926 (2016)], we proposed a new expression for the nonequilibrium Fermi’s golden rule within the framework of the linearized semiclassical approximation and based on the Condon approximation, according to which the electronic coupling between donor and acceptor is assumed constant. In this paper we propose a more general expression, which is applicable tomore » the case of non-Condon electronic coupling. We test the accuracy of the new non-Condon nonequilibrium Fermi’s golden rule linearized semiclassical expression on a model where the donor and acceptor potential energy surfaces are parabolic and identical except for shifts in the equilibrium energy and geometry, and the coupling between them is linear in the nuclear coordinates. Since non-Condon effects may or may not give rise to conical intersections, both possibilities are examined by considering the following: (1) A modified Garg-Onuchic-Ambegaokar model for charge transfer in the condensed phase, where the donor-acceptor coupling is linear in the primary-mode coordinate, and for which non-Condon effects do not give rise to a conical intersection; (2) the linear vibronic coupling model for electronic transitions in gas phase molecules, where non-Condon effects give rise to conical intersections. We also present a comprehensive comparison between the linearized semiclassical expression and a progression of more approximate expressions, in both normal and inverted regions, and over a wide range of initial nonequilibrium states, temperatures, and frictions.« less

Linear parameter varying representations for nonlinear control design

NASA Astrophysics Data System (ADS)

Carter, Lance Huntington

Linear parameter varying (LPV) systems are investigated as a framework for gain-scheduled control design and optimal hybrid control. An LPV system is defined as a linear system whose dynamics depend upon an a priori unknown but measurable exogenous parameter. A gain-scheduled autopilot design is presented for a bank-to-turn (BTT) missile. The method is novel in that the gain-scheduled design does not involve linearizations about operating points. Instead, the missile dynamics are brought to LPV form via a state transformation. This idea is applied to the design of a coupled longitudinal/lateral BTT missile autopilot. The pitch and yaw/roll dynamics are separately transformed to LPV form, where the cross axis states are treated as "exogenous" parameters. These are actually endogenous variables, so such a plant is called "quasi-LPV." Once in quasi-LPV form, a family of robust controllers using mu synthesis is designed for both the pitch and yaw/roll channels, using angle-of-attack and roll rate as the scheduling variables. The closed-loop time response is simulated using the original nonlinear model and also using perturbed aerodynamic coefficients. Modeling and control of engine idle speed is investigated using LPV methods. It is shown how generalized discrete nonlinear systems may be transformed into quasi-LPV form. A discrete nonlinear engine model is developed and expressed in quasi-LPV form with engine speed as the scheduling variable. An example control design is presented using linear quadratic methods. Simulations are shown comparing the LPV based controller performance to that using PID control. LPV representations are also shown to provide a setting for hybrid systems. A hybrid system is characterized by control inputs consisting of both analog signals and discrete actions. A solution is derived for the optimal control of hybrid systems with generalized cost functions. This is shown to be computationally intensive, so a suboptimal strategy is proposed that neglects a subset of possible parameter trajectories. A computational algorithm is constructed for this suboptimal solution applied to a class of linear non-quadratic cost functions.

A simple model for electrical charge in globular macromolecules and linear polyelectrolytes in solution

NASA Astrophysics Data System (ADS)

Krishnan, M.

2017-05-01

We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or rapid, reliable predictions are desired.

Spatially resolved regression analysis of pre-treatment FDG, FLT and Cu-ATSM PET from post-treatment FDG PET: an exploratory study

PubMed Central

Bowen, Stephen R; Chappell, Richard J; Bentzen, Søren M; Deveau, Michael A; Forrest, Lisa J; Jeraj, Robert

2012-01-01

Purpose To quantify associations between pre-radiotherapy and post-radiotherapy PET parameters via spatially resolved regression. Materials and methods Ten canine sinonasal cancer patients underwent PET/CT scans of [18F]FDG (FDGpre), [18F]FLT (FLTpre), and [61Cu]Cu-ATSM (Cu-ATSMpre). Following radiotherapy regimens of 50 Gy in 10 fractions, veterinary patients underwent FDG PET/CT scans at three months (FDGpost). Regression of standardized uptake values in baseline FDGpre, FLTpre and Cu-ATSMpre tumour voxels to those in FDGpost images was performed for linear, log-linear, generalized-linear and mixed-fit linear models. Goodness-of-fit in regression coefficients was assessed by R2. Hypothesis testing of coefficients over the patient population was performed. Results Multivariate linear model fits of FDGpre to FDGpost were significantly positive over the population (FDGpost~0.17 FDGpre, p=0.03), and classified slopes of RECIST non-responders and responders to be different (0.37 vs. 0.07, p=0.01). Generalized-linear model fits related FDGpre to FDGpost by a linear power law (FDGpost~FDGpre0.93, p<0.001). Univariate mixture model fits of FDGpre improved R2 from 0.17 to 0.52. Neither baseline FLT PET nor Cu-ATSM PET uptake contributed statistically significant multivariate regression coefficients. Conclusions Spatially resolved regression analysis indicates that pre-treatment FDG PET uptake is most strongly associated with three-month post-treatment FDG PET uptake in this patient population, though associations are histopathology-dependent. PMID:22682748

Are We Predicting the Actual or Apparent Distribution of Temperate Marine Fishes?

PubMed Central

Monk, Jacquomo; Ierodiaconou, Daniel; Harvey, Euan; Rattray, Alex; Versace, Vincent L.

2012-01-01

Planning for resilience is the focus of many marine conservation programs and initiatives. These efforts aim to inform conservation strategies for marine regions to ensure they have inbuilt capacity to retain biological diversity and ecological function in the face of global environmental change – particularly changes in climate and resource exploitation. In the absence of direct biological and ecological information for many marine species, scientists are increasingly using spatially-explicit, predictive-modeling approaches. Through the improved access to multibeam sonar and underwater video technology these models provide spatial predictions of the most suitable regions for an organism at resolutions previously not possible. However, sensible-looking, well-performing models can provide very different predictions of distribution depending on which occurrence dataset is used. To examine this, we construct species distribution models for nine temperate marine sedentary fishes for a 25.7 km2 study region off the coast of southeastern Australia. We use generalized linear model (GLM), generalized additive model (GAM) and maximum entropy (MAXENT) to build models based on co-located occurrence datasets derived from two underwater video methods (i.e. baited and towed video) and fine-scale multibeam sonar based seafloor habitat variables. Overall, this study found that the choice of modeling approach did not considerably influence the prediction of distributions based on the same occurrence dataset. However, greater dissimilarity between model predictions was observed across the nine fish taxa when the two occurrence datasets were compared (relative to models based on the same dataset). Based on these results it is difficult to draw any general trends in regards to which video method provides more reliable occurrence datasets. Nonetheless, we suggest predictions reflecting the species apparent distribution (i.e. a combination of species distribution and the probability of detecting it). Consequently, we also encourage researchers and marine managers to carefully interpret model predictions. PMID:22536325

Picosecond time-resolved measurements of dense plasma line shifts

DOE PAGES

Stillman, C. R.; Nilson, P. M.; Ivancic, S. T.; ...

2017-06-13

Picosecond time-resolved x-ray spectroscopy is used to measure the spectral line shift of the 1s2p–1s 2 transition in He-like Al ions as a function of the instantaneous plasma conditions. The plasma temperature and density are inferred from the Al He α complex using a nonlocal-thermodynamic-equilibrium atomic physics model. The experimental spectra show a linearly increasing red shift for electron densities of 1 to 5 × 10 23 cm –3. Furthermore, the measured line shifts are broadly consistent with a generalized analytic line-shift model based on calculations of a self-consistent field ion sphere model.

Abstract probabilistic CNOT gate model based on double encoding: study of the errors and physical realizability

NASA Astrophysics Data System (ADS)

Gueddana, Amor; Attia, Moez; Chatta, Rihab

2015-03-01

In this work, we study the error sources standing behind the non-perfect linear optical quantum components composing a non-deterministic quantum CNOT gate model, which performs the CNOT function with a success probability of 4/27 and uses a double encoding technique to represent photonic qubits at the control and the target. We generalize this model to an abstract probabilistic CNOT version and determine the realizability limits depending on a realistic range of the errors. Finally, we discuss physical constraints allowing the implementation of the Asymmetric Partially Polarizing Beam Splitter (APPBS), which is at the heart of correctly realizing the CNOT function.

Research on On-Line Modeling of Fed-Batch Fermentation Process Based on v-SVR

NASA Astrophysics Data System (ADS)

Ma, Yongjun

The fermentation process is very complex and non-linear, many parameters are not easy to measure directly on line, soft sensor modeling is a good solution. This paper introduces v-support vector regression (v-SVR) for soft sensor modeling of fed-batch fermentation process. v-SVR is a novel type of learning machine. It can control the accuracy of fitness and prediction error by adjusting the parameter v. An on-line training algorithm is discussed in detail to reduce the training complexity of v-SVR. The experimental results show that v-SVR has low error rate and better generalization with appropriate v.

Picosecond time-resolved measurements of dense plasma line shifts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stillman, C. R.; Nilson, P. M.; Ivancic, S. T.

Picosecond time-resolved x-ray spectroscopy is used to measure the spectral line shift of the 1s2p–1s 2 transition in He-like Al ions as a function of the instantaneous plasma conditions. The plasma temperature and density are inferred from the Al He α complex using a nonlocal-thermodynamic-equilibrium atomic physics model. The experimental spectra show a linearly increasing red shift for electron densities of 1 to 5 × 10 23 cm –3. Furthermore, the measured line shifts are broadly consistent with a generalized analytic line-shift model based on calculations of a self-consistent field ion sphere model.

Models for electricity market efficiency and bidding strategy analysis

NASA Astrophysics Data System (ADS)

Niu, Hui

This dissertation studies models for the analysis of market efficiency and bidding behaviors of market participants in electricity markets. Simulation models are developed to estimate how transmission and operational constraints affect the competitive benchmark and market prices based on submitted bids. This research contributes to the literature in three aspects. First, transmission and operational constraints, which have been neglected in most empirical literature, are considered in the competitive benchmark estimation model. Second, the effects of operational and transmission constraints on market prices are estimated through two models based on the submitted bids of market participants. Third, these models are applied to analyze the efficiency of the Electric Reliability Council Of Texas (ERCOT) real-time energy market by simulating its operations for the time period from January 2002 to April 2003. The characteristics and available information for the ERCOT market are considered. In electricity markets, electric firms compete through both spot market bidding and bilateral contract trading. A linear asymmetric supply function equilibrium (SFE) model with transmission constraints is proposed in this dissertation to analyze the bidding strategies with forward contracts. The research contributes to the literature in several aspects. First, we combine forward contracts, transmission constraints, and multi-period strategy (an obligation for firms to bid consistently over an extended time horizon such as a day or an hour) into the linear asymmetric supply function equilibrium framework. As an ex-ante model, it can provide qualitative insights into firms' behaviors. Second, the bidding strategies related to Transmission Congestion Rights (TCRs) are discussed by interpreting TCRs as linear combination of forwards. Third, the model is a general one in the sense that there is no limitation on the number of firms and scale of the transmission network, which can have asymmetric linear marginal cost structures. In addition to theoretical analysis, we apply our model to simulate the ERCOT real-time market from January 2002 to April 2003. The effects of forward contracts on the ERCOT market are evaluated through the results. It is shown that the model is able to capture features of bidding behavior in the market.

Examining the influence of link function misspecification in conventional regression models for developing crash modification factors.

PubMed

Wu, Lingtao; Lord, Dominique

2017-05-01

This study further examined the use of regression models for developing crash modification factors (CMFs), specifically focusing on the misspecification in the link function. The primary objectives were to validate the accuracy of CMFs derived from the commonly used regression models (i.e., generalized linear models or GLMs with additive linear link functions) when some of the variables have nonlinear relationships and quantify the amount of bias as a function of the nonlinearity. Using the concept of artificial realistic data, various linear and nonlinear crash modification functions (CM-Functions) were assumed for three variables. Crash counts were randomly generated based on these CM-Functions. CMFs were then derived from regression models for three different scenarios. The results were compared with the assumed true values. The main findings are summarized as follows: (1) when some variables have nonlinear relationships with crash risk, the CMFs for these variables derived from the commonly used GLMs are all biased, especially around areas away from the baseline conditions (e.g., boundary areas); (2) with the increase in nonlinearity (i.e., nonlinear relationship becomes stronger), the bias becomes more significant; (3) the quality of CMFs for other variables having linear relationships can be influenced when mixed with those having nonlinear relationships, but the accuracy may still be acceptable; and (4) the misuse of the link function for one or more variables can also lead to biased estimates for other parameters. This study raised the importance of the link function when using regression models for developing CMFs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Threshold and Beyond: Modeling The Intensity Dependence of Auditory Responses

PubMed Central

2007-01-01

In many studies of auditory-evoked responses to low-intensity sounds, the response amplitude appears to increase roughly linearly with the sound level in decibels (dB), corresponding to a logarithmic intensity dependence. But the auditory system is assumed to be linear in the low-intensity limit. The goal of this study was to resolve the seeming contradiction. Based on assumptions about the rate-intensity functions of single auditory-nerve fibers and the pattern of cochlear excitation caused by a tone, a model for the gross response of the population of auditory nerve fibers was developed. In accordance with signal detection theory, the model denies the existence of a threshold. This implies that regarding the detection of a significant stimulus-related effect, a reduction in sound intensity can always be compensated for by increasing the measurement time, at least in theory. The model suggests that the gross response is proportional to intensity when the latter is low (range I), and a linear function of sound level at higher intensities (range III). For intensities in between, it is concluded that noisy experimental data may provide seemingly irrefutable evidence of a linear dependence on sound pressure (range II). In view of the small response amplitudes that are to be expected for intensity range I, direct observation of the predicted proportionality with intensity will generally be a challenging task for an experimenter. Although the model was developed for the auditory nerve, the basic conclusions are probably valid for higher levels of the auditory system, too, and might help to improve models for loudness at threshold. PMID:18008105

A generalized linear integrate-and-fire neural model produces diverse spiking behaviors.

PubMed

Mihalaş, Stefan; Niebur, Ernst

2009-03-01

For simulations of neural networks, there is a trade-off between the size of the network that can be simulated and the complexity of the model used for individual neurons. In this study, we describe a generalization of the leaky integrate-and-fire model that produces a wide variety of spiking behaviors while still being analytically solvable between firings. For different parameter values, the model produces spiking or bursting, tonic, phasic or adapting responses, depolarizing or hyperpolarizing after potentials and so forth. The model consists of a diagonalizable set of linear differential equations describing the time evolution of membrane potential, a variable threshold, and an arbitrary number of firing-induced currents. Each of these variables is modified by an update rule when the potential reaches threshold. The variables used are intuitive and have biological significance. The model's rich behavior does not come from the differential equations, which are linear, but rather from complex update rules. This single-neuron model can be implemented using algorithms similar to the standard integrate-and-fire model. It is a natural match with event-driven algorithms for which the firing times are obtained as a solution of a polynomial equation.

Generalization of mixed multiscale finite element methods with applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, C S

Many science and engineering problems exhibit scale disparity and high contrast. The small scale features cannot be omitted in the physical models because they can affect the macroscopic behavior of the problems. However, resolving all the scales in these problems can be prohibitively expensive. As a consequence, some types of model reduction techniques are required to design efficient solution algorithms. For practical purpose, we are interested in mixed finite element problems as they produce solutions with certain conservative properties. Existing multiscale methods for such problems include the mixed multiscale finite element methods. We show that for complicated problems, the mixedmore » multiscale finite element methods may not be able to produce reliable approximations. This motivates the need of enrichment for coarse spaces. Two enrichment approaches are proposed, one is based on generalized multiscale finte element metthods (GMsFEM), while the other is based on spectral element-based algebraic multigrid (rAMGe). The former one, which is called mixed GMsFEM, is developed for both Darcy’s flow and linear elasticity. Application of the algorithm in two-phase flow simulations are demonstrated. For linear elasticity, the algorithm is subtly modified due to the symmetry requirement of the stress tensor. The latter enrichment approach is based on rAMGe. The algorithm differs from GMsFEM in that both of the velocity and pressure spaces are coarsened. Due the multigrid nature of the algorithm, recursive application is available, which results in an efficient multilevel construction of the coarse spaces. Stability, convergence analysis, and exhaustive numerical experiments are carried out to validate the proposed enrichment approaches. iii« less

Design of Linear Control System for Wind Turbine Blade Fatigue Testing

NASA Astrophysics Data System (ADS)

Toft, Anders; Roe-Poulsen, Bjarke; Christiansen, Rasmus; Knudsen, Torben

2016-09-01

This paper proposes a linear method for wind turbine blade fatigue testing at Siemens Wind Power. The setup consists of a blade, an actuator (motor and load mass) that acts on the blade with a sinusoidal moment, and a distribution of strain gauges to measure the blade flexure. Based on the frequency of the sinusoidal input, the blade will start oscillating with a given gain, hence the objective of the fatigue test is to make the blade oscillate with a controlled amplitude. The system currently in use is based on frequency control, which involves some non-linearities that make the system difficult to control. To make a linear controller, a different approach has been chosen, namely making a controller which is not regulating on the input frequency, but on the input amplitude. A non-linear mechanical model for the blade and the motor has been constructed. This model has been simplified based on the desired output, namely the amplitude of the blade. Furthermore, the model has been linearised to make it suitable for linear analysis and control design methods. The controller is designed based on a simplified and linearised model, and its gain parameter determined using pole placement. The model variants have been simulated in the MATLAB toolbox Simulink, which shows that the controller design based on the simple model performs adequately with the non-linear model. Moreover, the developed controller solves the robustness issue found in the existent solution and also reduces the needed energy for actuation as it always operates at the blade eigenfrequency.

Sub-optimal control of fuzzy linear dynamical systems under granular differentiability concept.

PubMed

Mazandarani, Mehran; Pariz, Naser

2018-05-01

This paper deals with sub-optimal control of a fuzzy linear dynamical system. The aim is to keep the state variables of the fuzzy linear dynamical system close to zero in an optimal manner. In the fuzzy dynamical system, the fuzzy derivative is considered as the granular derivative; and all the coefficients and initial conditions can be uncertain. The criterion for assessing the optimality is regarded as a granular integral whose integrand is a quadratic function of the state variables and control inputs. Using the relative-distance-measure (RDM) fuzzy interval arithmetic and calculus of variations, the optimal control law is presented as the fuzzy state variables feedback. Since the optimal feedback gains are obtained as fuzzy functions, they need to be defuzzified. This will result in the sub-optimal control law. This paper also sheds light on the restrictions imposed by the approaches which are based on fuzzy standard interval arithmetic (FSIA), and use strongly generalized Hukuhara and generalized Hukuhara differentiability concepts for obtaining the optimal control law. The granular eigenvalues notion is also defined. Using an RLC circuit mathematical model, it is shown that, due to their unnatural behavior in the modeling phenomenon, the FSIA-based approaches may obtain some eigenvalues sets that might be different from the inherent eigenvalues set of the fuzzy dynamical system. This is, however, not the case with the approach proposed in this study. The notions of granular controllability and granular stabilizability of the fuzzy linear dynamical system are also presented in this paper. Moreover, a sub-optimal control for regulating a Boeing 747 in longitudinal direction with uncertain initial conditions and parameters is gained. In addition, an uncertain suspension system of one of the four wheels of a bus is regulated using the sub-optimal control introduced in this paper. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

Evaluating a linearized Euler equations model for strong turbulence effects on sound propagation.

PubMed

Ehrhardt, Loïc; Cheinet, Sylvain; Juvé, Daniel; Blanc-Benon, Philippe

2013-04-01

Sound propagation outdoors is strongly affected by atmospheric turbulence. Under strongly perturbed conditions or long propagation paths, the sound fluctuations reach their asymptotic behavior, e.g., the intensity variance progressively saturates. The present study evaluates the ability of a numerical propagation model based on the finite-difference time-domain solving of the linearized Euler equations in quantitatively reproducing the wave statistics under strong and saturated intensity fluctuations. It is the continuation of a previous study where weak intensity fluctuations were considered. The numerical propagation model is presented and tested with two-dimensional harmonic sound propagation over long paths and strong atmospheric perturbations. The results are compared to quantitative theoretical or numerical predictions available on the wave statistics, including the log-amplitude variance and the probability density functions of the complex acoustic pressure. The match is excellent for the evaluated source frequencies and all sound fluctuations strengths. Hence, this model captures these many aspects of strong atmospheric turbulence effects on sound propagation. Finally, the model results for the intensity probability density function are compared with a standard fit by a generalized gamma function.

Optimization-Based Robust Nonlinear Control

DTIC Science & Technology

2006-08-01

ABSTRACT New control algorithms were developed for robust stabilization of nonlinear dynamical systems . Novel, linear matrix inequality-based synthesis...was to further advance optimization-based robust nonlinear control design, for general nonlinear systems (especially in discrete time ), for linear...Teel, IEEE Transactions on Control Systems Technology, vol. 14, no. 3, p. 398-407, May 2006. 3. "A unified framework for input-to-state stability in

Equivalence between a generalized dendritic network and a set of one-dimensional networks as a ground of linear dynamics.

PubMed

Koda, Shin-ichi

2015-05-28

It has been shown by some existing studies that some linear dynamical systems defined on a dendritic network are equivalent to those defined on a set of one-dimensional networks in special cases and this transformation to the simple picture, which we call linear chain (LC) decomposition, has a significant advantage in understanding properties of dendrimers. In this paper, we expand the class of LC decomposable system with some generalizations. In addition, we propose two general sufficient conditions for LC decomposability with a procedure to systematically realize the LC decomposition. Some examples of LC decomposable linear dynamical systems are also presented with their graphs. The generalization of the LC decomposition is implemented in the following three aspects: (i) the type of linear operators; (ii) the shape of dendritic networks on which linear operators are defined; and (iii) the type of symmetry operations representing the symmetry of the systems. In the generalization (iii), symmetry groups that represent the symmetry of dendritic systems are defined. The LC decomposition is realized by changing the basis of a linear operator defined on a dendritic network into bases of irreducible representations of the symmetry group. The achievement of this paper makes it easier to utilize the LC decomposition in various cases. This may lead to a further understanding of the relation between structure and functions of dendrimers in future studies.

Stationary and non-stationary extreme value modeling of extreme temperature in Malaysia

NASA Astrophysics Data System (ADS)

Hasan, Husna; Salleh, Nur Hanim Mohd; Kassim, Suraiya

2014-09-01

Extreme annual temperature of eighteen stations in Malaysia is fitted to the Generalized Extreme Value distribution. Stationary and non-stationary models with trend are considered for each station and the Likelihood Ratio test is used to determine the best-fitting model. Results show that three out of eighteen stations i.e. Bayan Lepas, Labuan and Subang favor a model which is linear in the location parameter. A hierarchical cluster analysis is employed to investigate the existence of similar behavior among the stations. Three distinct clusters are found in which one of them consists of the stations that favor the non-stationary model. T-year estimated return levels of the extreme temperature are provided based on the chosen models.

Micropolar curved rods. 2-D, high order, Timoshenko's and Euler-Bernoulli models

NASA Astrophysics Data System (ADS)

Zozulya, V. V.

2017-01-01

New models for micropolar plane curved rods have been developed. 2-D theory is developed from general 2-D equations of linear micropolar elasticity using a special curvilinear system of coordinates related to the middle line of the rod and special hypothesis based on assumptions that take into account the fact that the rod is thin.High order theory is based on the expansion of the equations of the theory of elasticity into Fourier series in terms of Legendre polynomials. First stress and strain tensors,vectors of displacements and rotation and body force shave been expanded into Fourier series in terms of Legendre polynomials with respect to a thickness coordinate.Thereby all equations of elasticity including Hooke's law have been transformed to the corresponding equations for Fourier coefficients. Then in the same way as in the theory of elasticity, system of differential equations in term of displacements and boundary conditions for Fourier coefficients have been obtained. The Timoshenko's and Euler-Bernoulli theories are based on the classical hypothesis and 2-D equations of linear micropolar elasticity in a special curvilinear system. The obtained equations can be used to calculate stress-strain and to model thin walled structures in macro, micro and nano scale when taking in to account micropolar couple stress and rotation effects.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Nonlinear dynamics of laser systems with elements of a chaos: Advanced computational code

NASA Astrophysics Data System (ADS)

Buyadzhi, V. V.; Glushkov, A. V.; Khetselius, O. Yu; Kuznetsova, A. A.; Buyadzhi, A. A.; Prepelitsa, G. P.; Ternovsky, V. B.

2017-10-01

A general, uniform chaos-geometric computational approach to analysis, modelling and prediction of the non-linear dynamics of quantum and laser systems (laser and quantum generators system etc) with elements of the deterministic chaos is briefly presented. The approach is based on using the advanced generalized techniques such as the wavelet analysis, multi-fractal formalism, mutual information approach, correlation integral analysis, false nearest neighbour algorithm, the Lyapunov’s exponents analysis, and surrogate data method, prediction models etc There are firstly presented the numerical data on the topological and dynamical invariants (in particular, the correlation, embedding, Kaplan-York dimensions, the Lyapunov’s exponents, Kolmogorov’s entropy and other parameters) for laser system (the semiconductor GaAs/GaAlAs laser with a retarded feedback) dynamics in a chaotic and hyperchaotic regimes.

Finite element modelling of non-linear magnetic circuits using Cosmic NASTRAN

NASA Technical Reports Server (NTRS)

Sheerer, T. J.

1986-01-01

The general purpose Finite Element Program COSMIC NASTRAN currently has the ability to model magnetic circuits with constant permeablilities. An approach was developed which, through small modifications to the program, allows modelling of non-linear magnetic devices including soft magnetic materials, permanent magnets and coils. Use of the NASTRAN code resulted in output which can be used for subsequent mechanical analysis using a variation of the same computer model. Test problems were found to produce theoretically verifiable results.

An Application of the H-Function to Curve-Fitting and Density Estimation.

DTIC Science & Technology

1983-12-01

equations into a model that is linear in its coefficients. Nonlinear least squares estimation is a relatively new area developed to accomodate models which...to converge on a solution (10:9-10). For the simple linear model and when general assump- tions are made, the Gauss-Markov theorem states that the...distribution. For example, if the analyst wants to model the time between arrivals to a queue for a computer simulation, he infers the true probability

Generalized Bezout's Theorem and its applications in coding theory

NASA Technical Reports Server (NTRS)

Berg, Gene A.; Feng, Gui-Liang; Rao, T. R. N.

1996-01-01

This paper presents a generalized Bezout theorem which can be used to determine a tighter lower bound of the number of distinct points of intersection of two or more curves for a large class of plane curves. A new approach to determine a lower bound on the minimum distance (and also the generalized Hamming weights) for algebraic-geometric codes defined from a class of plane curves is introduced, based on the generalized Bezout theorem. Examples of more efficient linear codes are constructed using the generalized Bezout theorem and the new approach. For d = 4, the linear codes constructed by the new construction are better than or equal to the known linear codes. For d greater than 5, these new codes are better than the known codes. The Klein code over GF(2(sup 3)) is also constructed.

Orthogonal series generalized likelihood ratio test for failure detection and isolation. [for aircraft control

NASA Technical Reports Server (NTRS)

Hall, Steven R.; Walker, Bruce K.

1990-01-01

A new failure detection and isolation algorithm for linear dynamic systems is presented. This algorithm, the Orthogonal Series Generalized Likelihood Ratio (OSGLR) test, is based on the assumption that the failure modes of interest can be represented by truncated series expansions. This assumption leads to a failure detection algorithm with several desirable properties. Computer simulation results are presented for the detection of the failures of actuators and sensors of a C-130 aircraft. The results show that the OSGLR test generally performs as well as the GLR test in terms of time to detect a failure and is more robust to failure mode uncertainty. However, the OSGLR test is also somewhat more sensitive to modeling errors than the GLR test.

Progressive Aerodynamic Model Identification From Dynamic Water Tunnel Test of the F-16XL Aircraft

NASA Technical Reports Server (NTRS)

Murphy, Patrick C.; Klein, Vladislav; Szyba, Nathan M.

2004-01-01

Development of a general aerodynamic model that is adequate for predicting the forces and moments in the nonlinear and unsteady portions of the flight envelope has not been accomplished to a satisfactory degree. Predicting aerodynamic response during arbitrary motion of an aircraft over the complete flight envelope requires further development of the mathematical model and the associated methods for ground-based testing in order to allow identification of the model. In this study, a general nonlinear unsteady aerodynamic model is presented, followed by a summary of a linear modeling methodology that includes test and identification methods, and then a progressive series of steps suggesting a roadmap to develop a general nonlinear methodology that defines modeling, testing, and identification methods. Initial steps of the general methodology were applied to static and oscillatory test data to identify rolling-moment coefficient. Static measurements uncovered complicated dependencies of the aerodynamic coefficient on angle of attack and sideslip in the stall region making it difficult to find a simple analytical expression for the measurement data. In order to assess the effect of sideslip on the damping and unsteady terms, oscillatory tests in roll were conducted at different values of an initial offset in sideslip. Candidate runs for analyses were selected where higher order harmonics were required for the model and where in-phase and out-of-phase components varied with frequency. From these results it was found that only data in the angle-of-attack range of 35 degrees to 37.5 degrees met these requirements. From the limited results it was observed that the identified models fit the data well and both the damping-in-roll and the unsteady term gain are decreasing with increasing sideslip and motion amplitude. Limited similarity between parameter values in the nonlinear model and the linear model suggest that identifiability of parameters in both terms may be a problem. However, the proposed methodology can still be used with careful experiment design and carefully selected values of angle of attack, sideslip, amplitude, and frequency of the oscillatory data.

Dynamical localization of coupled relativistic kicked rotors

NASA Astrophysics Data System (ADS)

Rozenbaum, Efim B.; Galitski, Victor

2017-02-01

A periodically driven rotor is a prototypical model that exhibits a transition to chaos in the classical regime and dynamical localization (related to Anderson localization) in the quantum regime. In a recent work [Phys. Rev. B 94, 085120 (2016), 10.1103/PhysRevB.94.085120], A. C. Keser et al. considered a many-body generalization of coupled quantum kicked rotors, and showed that in the special integrable linear case, dynamical localization survives interactions. By analogy with many-body localization, the phenomenon was dubbed dynamical many-body localization. In the present work, we study nonintegrable models of single and coupled quantum relativistic kicked rotors (QRKRs) that bridge the gap between the conventional quadratic rotors and the integrable linear models. For a single QRKR, we supplement the recent analysis of the angular-momentum-space dynamics with a study of the spin dynamics. Our analysis of two and three coupled QRKRs along with the proved localization in the many-body linear model indicate that dynamical localization exists in few-body systems. Moreover, the relation between QRKR and linear rotor models implies that dynamical many-body localization can exist in generic, nonintegrable many-body systems. And localization can generally result from a complicated interplay between Anderson mechanism and limiting integrability, since the many-body linear model is a high-angular-momentum limit of many-body QRKRs. We also analyze the dynamics of two coupled QRKRs in the highly unusual superballistic regime and find that the resonance conditions are relaxed due to interactions. Finally, we propose experimental realizations of the QRKR model in cold atoms in optical lattices.

Waveform Design for Wireless Power Transfer

NASA Astrophysics Data System (ADS)

Clerckx, Bruno; Bayguzina, Ekaterina

2016-12-01

Far-field Wireless Power Transfer (WPT) has attracted significant attention in recent years. Despite the rapid progress, the emphasis of the research community in the last decade has remained largely concentrated on improving the design of energy harvester (so-called rectenna) and has left aside the effect of transmitter design. In this paper, we study the design of transmit waveform so as to enhance the DC power at the output of the rectenna. We derive a tractable model of the non-linearity of the rectenna and compare with a linear model conventionally used in the literature. We then use those models to design novel multisine waveforms that are adaptive to the channel state information (CSI). Interestingly, while the linear model favours narrowband transmission with all the power allocated to a single frequency, the non-linear model favours a power allocation over multiple frequencies. Through realistic simulations, waveforms designed based on the non-linear model are shown to provide significant gains (in terms of harvested DC power) over those designed based on the linear model and over non-adaptive waveforms. We also compute analytically the theoretical scaling laws of the harvested energy for various waveforms as a function of the number of sinewaves and transmit antennas. Those scaling laws highlight the benefits of CSI knowledge at the transmitter in WPT and of a WPT design based on a non-linear rectenna model over a linear model. Results also motivate the study of a promising architecture relying on large-scale multisine multi-antenna waveforms for WPT. As a final note, results stress the importance of modeling and accounting for the non-linearity of the rectenna in any system design involving wireless power.

BOOK REVIEW: Heterogeneous Materials I and Heterogeneous Materials II

NASA Astrophysics Data System (ADS)

Knowles, K. M.

2004-02-01

In these two volumes the author provides a comprehensive survey of the various mathematically-based models used in the research literature to predict the mechanical, thermal and electrical properties of hetereogeneous materials, i.e., materials containing two or more phases such as fibre-reinforced polymers, cast iron and porous ceramic kiln furniture. Volume I covers linear properties such as linear dielectric constant, effective electrical conductivity and elastic moduli, while Volume II covers nonlinear properties, fracture and atomistic and multiscale modelling. Where appropriate, particular attention is paid to the use of fractal geometry and percolation theory in describing the structure and properties of these materials. The books are advanced level texts reflecting the research interests of the author which will be of significant interest to research scientists working at the forefront of the areas covered by the books. Others working more generally in the field\

Tuning the control system of a nonlinear inverted pendulum by means of the new method of Lyapunov exponents estimation

NASA Astrophysics Data System (ADS)

Balcerzak, Marek; Dąbrowski, Artur; Pikunov, Danylo

2018-01-01

This paper presents a practical application of a new, simplified method of Lyapunov exponents estimation. The method has been applied to optimization of a real, nonlinear inverted pendulum system. Authors presented how the algorithm of the Largest Lyapunov Exponent (LLE) estimation can be applied to evaluate control systems performance. The new LLE-based control performance index has been proposed. Equations of the inverted pendulum system of the fourth order have been found. The nonlinear friction of the regulation object has been identified by means of the nonlinear least squares method. Three different friction models have been tested: linear, cubic and Coulomb model. The Differential Evolution (DE) algorithm has been used to search for the best set of parameters of the general linear regulator. This work proves that proposed method is efficient and results in faster perturbation rejection, especially when disturbances are significant.