Science.gov

Sample records for genes accompanies differentiation

  1. NGF induction of the gene encoding the protease transin accompanies neuronal differentiation in PC12 cells.

    PubMed

    Machida, C M; Rodland, K D; Matrisian, L; Magun, B E; Ciment, G

    1989-06-01

    Various proteases have been found to be released by the growth cones of developing neurons in culture and have been hypothesized to play a role in the process of axon elongation. We report here that nerve growth factor (NGF) induced the gene encoding the metalloprotease transin in PC12 cells with a time course coincident with the initial appearance of neurites by these cells. Acidic and basic fibroblast growth factors also stimulated transin mRNA expression and neurite outgrowth, whereas various other agents had no effects on either of these phenomena. In contrast, dexamethasone was found to inhibit the induction of transin mRNA when added with, or following, NGF treatment. Finally, we show that sequences contained within 750 bp of the 5' untranscribed region of the transin gene confer responsiveness to NGF and dexamethasone.

  2. Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by cell differentiation defects.

    PubMed

    Henriques, Rossana; Jásik, Ján; Klein, Markus; Martinoia, Enrico; Feller, Urs; Schell, Jeff; Pais, Maria S; Koncz, Csaba

    2002-11-01

    IRT1 and IRT2 are members of the Arabidopsis ZIP metal transporter family that are specifically induced by iron deprivation in roots and act as heterologous suppressors of yeast mutations inhibiting iron and zinc uptake. Although IRT1 and IRT2 are thought to perform redundant functions as root-specific metal transporters, insertional inactivation of the IRT1 gene alone results in typical symptoms of iron deficiency causing severe leaf chlorosis and lethality in soil. The irt1 mutation is characterized by specific developmental defects, including a drastic reduction of chloroplast thylakoid stacking into grana and lack of palisade parenchyma differentiation in leaves, reduced number of vascular bundles in stems, and irregular patterns of enlarged endodermal and cortex cells in roots. Pulse labeling with 59Fe through the root system shows that the irt1 mutation reduces iron accumulation in the shoots. Short-term labeling with 65Zn reveals no alteration in spatial distribution of zinc, but indicates a lower level of zinc accumulation. In comparison to wild-type, the irt1 mutant responds to iron and zinc deprivation by altered expression of certain zinc and iron transporter genes, which results in the activation of ZIP1 in shoots, reduction of ZIP2 transcript levels in roots, and enhanced expression of IRT2 in roots. These data support the conclusion that IRT1 is an essential metal transporter required for proper development and regulation of iron and zinc homeostasis in Arabidopsis.

  3. Differential stress response in rats subjected to chronic mild stress is accompanied by changes in CRH-family gene expression at the pituitary level.

    PubMed

    Kolasa, Magdalena; Faron-Górecka, Agata; Kuśmider, Maciej; Szafran-Pilch, Kinga; Solich, Joanna; Żurawek, Dariusz; Gruca, Piotr; Papp, Mariusz; Dziedzicka-Wasylewska, Marta

    2014-11-01

    The purpose of this study was to examine molecular markers of the stress response at the pituitary and peripheral levels in animals that responded differently to chronic mild stress (CMS). Rats were subjected to 2-weeks CMS and symptoms of anhedonia was measured by the consumption of 1% sucrose solution. mRNA levels of CRH-family neuropeptides (Crh-corticotropin-releasing hormone, Ucn1-urocortin 1, Ucn2-urocortin 2, Ucn3-urocortin 3), CRH receptors (Crhr1-corticotropin-releasing hormone receptor 1, Crhr2-corticotropin-releasing hormone receptor 2) and Crhbp (corticotropin-releasing factor binding protein) in the pituitaries of rats were determined with real-time PCR. Plasma levels of ACTH (adrenocorticotropin), CRH and urocortins were measured with ELISA assays. CMS procedure led to the development of anhedonia manifested by the decreased sucrose consumption (stress-reactive, SR, stress-susceptible group). Additionally, the group of animals not exhibiting any signs of anhedonia (stress non-reactive, SNR, stress-resilient group) and the group characterized by the increased sucrose consumption (stress invert-reactive group SIR) were selected. The significant increases in ACTH plasma level accompanied by the decreases in the pituitary gene expression of the Crh, Ucn2 and Ucn3 in both stress non-reactive and stress invert-reactive groups were observed. The only molecular change observed in stress-reactive group was the increase in UCN2 plasma level. The differentiated behavioral stress responses were reflected by gene expression changes in the pituitary. Alterations in the mRNA levels of Crh, Ucn2 and Ucn3 in the pituitary might confirm the paracrine and/or autocrine effects of these peptides in stress response. The opposite behavioral effect between SNR vs. SIR groups and the surprising similarity at gene expression and plasma ACTH levels in these two groups may suggest the discrepancy between molecular and behavioral stress responses; however, there results might

  4. Histone acetylation accompanied with promoter sequences displaying differential expression profiles of B-class MADS-box genes for phalaenopsis floral morphogenesis.

    PubMed

    Hsu, Chia-Chi; Wu, Pei-Shan; Chen, Tien-Chih; Yu, Chun-Wei; Tsai, Wen-Chieh; Wu, Keqiang; Wu, Wen-Luan; Chen, Wen-Huei; Chen, Hong-Hwa

    2014-01-01

    Five B-class MADS-box genes, including four APETALA3 (AP3)-like PeMADS2∼5 and one PISTILLATA (PI)-like PeMADS6, specify the spectacular flower morphology in orchids. The PI-like PeMADS6 ubiquitously expresses in all floral organs. The four AP3-like genes, resulted from two duplication events, express ubiquitously at floral primordia and early floral organ stages, but show distinct expression profiles at late floral organ primordia and floral bud stages. Here, we isolated the upstream sequences of PeMADS2∼6 and studied the regulatory mechanism for their distinct gene expression. Phylogenetic footprinting analysis of the 1.3-kb upstream sequences of AP3-like PeMADS2∼5 showed that their promoter regions have sufficiently diverged and contributed to their subfunctionalization. The amplified promoter sequences of PeMADS2∼6 could drive beta-glucuronidase (GUS) gene expression in all floral organs, similar to their expression at the floral primordia stage. The promoter sequence of PeMADS4, exclusively expressed in lip and column, showed a 1.6∼3-fold higher expression in lip/column than in sepal/petal. Furthermore, we noted a 4.9-fold increase in histone acetylation (H3K9K14ac) in the translation start region of PeMADS4 in lip as compared in petal. All these results suggest that the regulation via the upstream sequences and increased H3K9K14ac level may act synergistically to display distinct expression profiles of the AP3-like genes at late floral organ primordia stage for Phalaenopsis floral morphogenesis.

  5. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation.

    PubMed

    Chidgey, M; Brakebusch, C; Gustafsson, E; Cruchley, A; Hail, C; Kirk, S; Merritt, A; North, A; Tselepis, C; Hewitt, J; Byrne, C; Fassler, R; Garrod, D

    2001-11-26

    The desmosomal cadherin desmocollin (Dsc)1 is expressed in upper epidermis where strong adhesion is required. To investigate its role in vivo, we have genetically engineered mice with a targeted disruption in the Dsc1 gene. Soon after birth, null mice exhibit flaky skin and a striking punctate epidermal barrier defect. The epidermis is fragile, and acantholysis in the granular layer generates localized lesions, compromising skin barrier function. Neutrophils accumulate in the lesions and further degrade the tissue, causing sloughing (flaking) of lesional epidermis, but rapid wound healing prevents the formation of overt lesions. Null epidermis is hyperproliferative and overexpresses keratins 6 and 16, indicating abnormal differentiation. From 6 wk, null mice develop ulcerating lesions resembling chronic dermatitis. We speculate that ulceration occurs after acantholysis in the fragile epidermis because environmental insults are more stringent and wound healing is less rapid than in neonatal mice. This dermatitis is accompanied by localized hair loss associated with formation of utriculi and dermal cysts, denoting hair follicle degeneration. Possible resemblance of the lesions to human blistering diseases is discussed. These results show that Dsc1 is required for strong adhesion and barrier maintenance in epidermis and contributes to epidermal differentiation.

  6. Cell differentiation along multiple pathways accompanied by changes in histone acetylation status.

    PubMed

    Legartová, Soňa; Kozubek, Stanislav; Franek, Michal; Zdráhal, Zbyněk; Lochmanová, Gabriela; Martinet, Nadine; Bártová, Eva

    2014-04-01

    Post-translational modification of histones is fundamental to the regulation of basic nuclear processes and subsequent cellular events, including differentiation. In this study, we analyzed acetylated forms of histones H2A, H2B, and H4 during induced differentiation in mouse (mESCs) and human (hESCs) embryonic stem cells and during induced enterocytic differentiation of colon cancer cells in vitro. Endoderm-like differentiation of mESCs induced by retinoic acid and enterocytic differentiation induced by histone deacetylase inhibitor sodium butyrate were accompanied by increased mono-, di-, and tri-acetylation of histone H2B and a pronounced increase in di- and tri-acetylation of histone H4. In enterocytes, mono-acetylation of histone H2A also increased and tetra-acetylation of histone H4 appeared only after induction of this differentiation pathway. During differentiation of hESCs, we observed increased mono-acetylation and decreased tri-acetylation of H2B. Mono-, di-, and tri-acetylation of H4 were reduced, manifested by a significant increase in nonacetylated H4 histones. Levels of acetylated histones increased during induced differentiation in mESCs and during histone deacetylase (HDAC) inhibitor-induced enterocytic differentiation, whereas differentiation of human ESCs was associated with reduced acetylation of histones H2B and H4.

  7. Gene Expression Dynamics Accompanying the Sponge Thermal Stress Response

    PubMed Central

    Guzman, Christine; Conaco, Cecilia

    2016-01-01

    Marine sponges are important members of coral reef ecosystems. Thus, their responses to changes in ocean chemistry and environmental conditions, particularly to higher seawater temperatures, will have potential impacts on the future of these reefs. To better understand the sponge thermal stress response, we investigated gene expression dynamics in the shallow water sponge, Haliclona tubifera (order Haplosclerida, class Demospongiae), subjected to elevated temperature. Using high-throughput transcriptome sequencing, we show that these conditions result in the activation of various processes that interact to maintain cellular homeostasis. Short-term thermal stress resulted in the induction of heat shock proteins, antioxidants, and genes involved in signal transduction and innate immunity pathways. Prolonged exposure to thermal stress affected the expression of genes involved in cellular damage repair, apoptosis, signaling and transcription. Interestingly, exposure to sublethal temperatures may improve the ability of the sponge to mitigate cellular damage under more extreme stress conditions. These insights into the potential mechanisms of adaptation and resilience of sponges contribute to a better understanding of sponge conservation status and the prediction of ecosystem trajectories under future climate conditions. PMID:27788197

  8. Poorly differentiated hepatocellular carcinoma accompanied by anti-Hu antibody-positive paraneoplastic peripheral neuropathy.

    PubMed

    Matsui, Takahiro; Hori, Yumiko; Nagano, Hiroaki; Eguchi, Hidetoshi; Marubashi, Shigeru; Wada, Hiroshi; Wada, Naoki; Ikeda, Jun-Ichiro; Sakamoto, Michiie; Morii, Eiichi

    2015-07-01

    The anti-Hu antibody is one of the most famous onco-neural antibodies related to paraneoplastic neurological syndrome, and is associated with small cell lung carcinoma in most cases. Here, we report a case of poorly differentiated hepatocellular carcinoma accompanied by paraneoplastic peripheral neuropathy positive for the anti-Hu antibody. Image inspection before operation revealed that no tumors were found in organs other than the liver, including lung, and that the liver tumor had no metastatic lesion. The liver tumor showed histological appearance of poorly differentiated carcinoma with cartilaginous metaplasia and partial blastoid cell appearance. Most tumor cells presented trabecular-like structure lined by sinusoidal vessels. Immunohistochemically, the tumor cells were positive for low molecular weight cytokeratin and vimentin, partially positive for cytokeratin 19 and CD56, but negative for synaptophysin, chromogranin A and alpha-fetoprotein. Based on the trabecular-like morphology and the results of immunohistochemical staining, we concluded that the tumor was diagnosed as poorly differentiated hepatocellular carcinoma. Anti-Hu antibody-positive paraneoplastic peripheral neuropathy accompanied with liver tumor is extremely rare as far as is known. The presented case indicates that poorly differentiated carcinoma has the potential to be the responsible lesion of anti-Hu antibody-positive paraneoplastic neurological syndrome and systemic work-up is important for the management of this neurological disorder.

  9. Biochemical and Cytological Changes Accompanying Growth and Differentiation in the Roots of Zea mays

    PubMed Central

    Lund, H. A.; Vatter, A. E.; Hanson, J. B.

    1958-01-01

    The apical meristem of the root affords an excellent material with which to study changes in cellular components accompanying growth and differentiation. The ontogeny of cytoplasmic particles can be followed, since the younger cells are constantly dividing and reforming new cytoplasm. Electron microscope pictures of these newly formed cells reveal a dense background of microsomal granules and small, thin walled vesicles of the endoplasmic reticulum. Two types of mitochondria are noted and, as the cells enlarge, mitochondria regarded as immature can no longer be seen, but only mitochondria with well developed cristae. The development of these cristae was found to be associated with an increase in respiration of the tissue as well as with increased rates of oxidation and phosphorylation of isolated mitochondria. As the cells grow and mature, the mitochondria make up an increasing percentage of the total cytoplasmic protein, and this increase probably accounts to a great extent for the increase in tissue respiration. Concomitantly, there is a decrease in microsomal granules. All these changes have been verified by electron microscope pictures of cells in situ, chemical analysis of isolated particulates, and metabolic studies of tissue and isolated fractions. PMID:13502433

  10. Transient Pairing of Homologous Oct4 Alleles Accompanies the Onset of Embryonic Stem Cell Differentiation

    PubMed Central

    Hogan, Megan S.; Parfitt, David-Emlyn; Zepeda-Mendoza, Cinthya J.; Shen, Michael M.; Spector, David L.

    2015-01-01

    SUMMARY The relationship between chromatin organization and transcriptional regulation is an area of intense investigation. We have characterized the spatial relationships between alleles of the Oct4, Sox2, and Nanog genes in single cells during the earliest stages of mouse embryonic stem cell (ESC) differentiation and during embryonic development. We describe homologous pairing of the Oct4 alleles during ESC differentiation and embryogenesis, and present evidence that pairing is correlated with the kinetics of ESC differentiation. Importantly, we identify critical DNA elements within the Oct4 promoter/enhancer region that mediate pairing of Oct4 alleles. Finally, we show that mutation of OCT4/SOX2 binding sites within this region abolishes inter-chromosomal interactions and affects accumulation of the repressive H3K9me2 modification at the Oct4 enhancer. Our findings demonstrate that chromatin organization and transcriptional programs are intimately connected in ESCs, and that the dynamic positioning of the Oct4 alleles is associated with the transition from pluripotency to lineage specification. PMID:25748933

  11. Extensive Epigenetic Changes Accompany Terminal Differentiation of Mouse Hepatocytes After Birth

    PubMed Central

    Cannon, Matthew V.; Pilarowski, Genay; Liu, Xiuli; Serre, David

    2016-01-01

    DNA methylation is traditionally thought to be established during early development and to remain mostly unchanged thereafter in healthy tissues, although recent studies have shown that this epigenetic mark can be more dynamic. Epigenetic changes occur in the liver after birth, but the timing and underlying biological processes leading to DNA methylation changes are not well understood. We hypothesized that this epigenetic reprogramming was the result of terminal differentiation of hepatocyte precursors. Using genomic approaches, we characterized the DNA methylation patterns in mouse liver from E18.5 until adulthood to determine if the timing of the DNA methylation change overlaps with hepatocyte terminal differentiation, and to examine the genomic context of these changes and identify the regulatory elements involved. Out of 271,325 CpGs analyzed throughout the genome, 214,709 CpGs changed DNA methylation by more than 5% (e.g., from 5 to 10% methylation) between E18.5 and 9 wk of age, and 18,863 CpGs changed DNA methylation by more than 30%. Genome-scale data from six time points between E18.5 and P20 show that DNA methylation changes coincided with the terminal differentiation of hepatoblasts into hepatocytes. We also showed that epigenetic reprogramming occurred primarily in intergenic enhancer regions while gene promoters were less affected. Our data suggest that normal postnatal hepatic development and maturation involves extensive epigenetic remodeling of the genome, and that enhancers play a key role in controlling the transition from hepatoblasts to fully differentiated hepatocytes. Our study provides a solid foundation to support future research aimed at further revealing the role of epigenetics in stem cell biology. PMID:27652892

  12. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  13. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  14. Differentially Coexpressed Disease Gene Identification Based on Gene Coexpression Network.

    PubMed

    Jiang, Xue; Zhang, Han; Quan, Xiongwen

    2016-01-01

    Screening disease-related genes by analyzing gene expression data has become a popular theme. Traditional disease-related gene selection methods always focus on identifying differentially expressed gene between case samples and a control group. These traditional methods may not fully consider the changes of interactions between genes at different cell states and the dynamic processes of gene expression levels during the disease progression. However, in order to understand the mechanism of disease, it is important to explore the dynamic changes of interactions between genes in biological networks at different cell states. In this study, we designed a novel framework to identify disease-related genes and developed a differentially coexpressed disease-related gene identification method based on gene coexpression network (DCGN) to screen differentially coexpressed genes. We firstly constructed phase-specific gene coexpression network using time-series gene expression data and defined the conception of differential coexpression of genes in coexpression network. Then, we designed two metrics to measure the value of gene differential coexpression according to the change of local topological structures between different phase-specific networks. Finally, we conducted meta-analysis of gene differential coexpression based on the rank-product method. Experimental results demonstrated the feasibility and effectiveness of DCGN and the superior performance of DCGN over other popular disease-related gene selection methods through real-world gene expression data sets.

  15. Differentially Coexpressed Disease Gene Identification Based on Gene Coexpression Network

    PubMed Central

    Quan, Xiongwen

    2016-01-01

    Screening disease-related genes by analyzing gene expression data has become a popular theme. Traditional disease-related gene selection methods always focus on identifying differentially expressed gene between case samples and a control group. These traditional methods may not fully consider the changes of interactions between genes at different cell states and the dynamic processes of gene expression levels during the disease progression. However, in order to understand the mechanism of disease, it is important to explore the dynamic changes of interactions between genes in biological networks at different cell states. In this study, we designed a novel framework to identify disease-related genes and developed a differentially coexpressed disease-related gene identification method based on gene coexpression network (DCGN) to screen differentially coexpressed genes. We firstly constructed phase-specific gene coexpression network using time-series gene expression data and defined the conception of differential coexpression of genes in coexpression network. Then, we designed two metrics to measure the value of gene differential coexpression according to the change of local topological structures between different phase-specific networks. Finally, we conducted meta-analysis of gene differential coexpression based on the rank-product method. Experimental results demonstrated the feasibility and effectiveness of DCGN and the superior performance of DCGN over other popular disease-related gene selection methods through real-world gene expression data sets. PMID:28042568

  16. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  17. A multilocus perspective on colonization accompanied by selection and gene flow.

    PubMed

    Rosenblum, Erica Bree; Hickerson, Michael J; Moritz, Craig

    2007-12-01

    initial bottleneck. Both ABC analyses and measures of mtDNA sequence diversity also suggested that population reductions were more severe in the black lava compared to the white sands habitat. Differences observed between habitats may be explained by differences in colonization time, habitat geometry, and strength or response to natural selection for substrate matching. Finally, effective population size reductions in this system appear to be more dramatic when colonization is accompanied by a change in selection regime. Our analyses are consistent with a demographic cost of adaptation to novel environments and show that it is possible to infer aspects of the historical demography of local adaptation even in the presence of ongoing gene flow.

  18. Increased expression of differentiation markers can accompany laminin-induced attachment of small cell lung cancer cells.

    PubMed Central

    Giaccone, G.; Broers, J.; Jensen, S.; Fridman, R. I.; Linnoila, R.; Gazdar, A. F.

    1992-01-01

    We investigated the interaction between human lung cancer cells, laminin, and several differentiating agents. When grown on laminin coated substrate eight out of 11 small cell lung cancer (SCLC) cell lines exhibited attachment to laminin and three had extensive outgrowth of long neurite-like processes. Of seven non-small cell lung cancer cell lines, selected for their in vitro anchorage-independent growth, attachment was observed in only three cell lines, and process formation was far less extensive than in SCLC cell lines. Among several differentiating agents, only dcAMP, which alone induced attachment and some process formation, increased laminin-mediated attachment and process formation of two SCLC cell lines, NCI-N417 a variant cell line, and NCI-H345, a classic cell line. The expression of several neuroendocrine and neuronal markers was investigated in these two SCLC cell lines. The expression of the light subunit of neurofilaments increased in NCI-N417 within 3 to 4 days of seeding, while NCI-H345 exhibited approximately 5 fold increase in expression of the GRP gene and a 3 fold increase expression of the beta-actin gene. The expression of a number of other neuroendocrine and neuronal markers did not change following growth on laminin. The doubling times remained unchanged independent of the presence of and attachment to laminin while topoisomerase II gene expression levels in NCI-N417 cells decreased approximately 5 fold when cells were growing on laminin. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:1325826

  19. Dissecting Gene Expression Changes Accompanying a Ploidy-Based Phenotypic Switch

    PubMed Central

    Cromie, Gareth A.; Tan, Zhihao; Hays, Michelle; Jeffery, Eric W.; Dudley, Aimée M.

    2016-01-01

    Aneuploidy, a state in which the chromosome number deviates from a multiple of the haploid count, significantly impacts human health. The phenotypic consequences of aneuploidy are believed to arise from gene expression changes associated with the altered copy number of genes on the aneuploid chromosomes. To dissect the mechanisms underlying altered gene expression in aneuploids, we used RNA-seq to measure transcript abundance in colonies of the haploid Saccharomyces cerevisiae strain F45 and two aneuploid derivatives harboring disomies of chromosomes XV and XVI. F45 colonies display complex “fluffy” morphologies, while the disomic colonies are smooth, resembling laboratory strains. Our two disomes displayed similar transcriptional profiles, a phenomenon not driven by their shared smooth colony morphology nor simply by their karyotype. Surprisingly, the environmental stress response (ESR) was induced in F45, relative to the two disomes. We also identified genes whose expression reflected a nonlinear interaction between the copy number of a transcriptional regulatory gene on chromosome XVI, DIG1, and the copy number of other chromosome XVI genes. DIG1 and the remaining chromosome XVI genes also demonstrated distinct contributions to the effect of the chromosome XVI disome on ESR gene expression. Expression changes in aneuploids appear to reflect a mixture of effects shared between different aneuploidies and effects unique to perturbing the copy number of particular chromosomes, including nonlinear copy number interactions between genes. The balance between these two phenomena is likely to be genotype- and environment-specific. PMID:27836908

  20. Quantum changes in Helicobacter pylori gene expression accompany host-adaptation

    PubMed Central

    Wise, Michael J.; Khosravi, Yalda; Seow, Shih-Wee; Amoyo, Arlaine A.; Pettersson, Sven; Peters, Fanny; Tay, Chin-Yen; Perkins, Timothy T.; Loke, Mun-Fai; Marshall, Barry J.; Vadivelu, Jamuna

    2017-01-01

    Abstract Helicobacter pylori is a highly successful gastric pathogen. High genomic plasticity allows its adaptation to changing host environments. Complete genomes of H. pylori clinical isolate UM032 and its mice-adapted serial derivatives 298 and 299, generated using both PacBio RS and Illumina MiSeq sequencing technologies, were compared to identify novel elements responsible for host-adaptation. The acquisition of a jhp0562-like allele, which encodes for a galactosyltransferase, was identified in the mice-adapted strains. Our analysis implies a new β-1,4-galactosyltransferase role for this enzyme, essential for Ley antigen expression. Intragenomic recombination between babA and babB genes was also observed. Further, we expanded on the list of candidate genes whose expression patterns have been mediated by upstream homopolymer-length alterations to facilitate host adaption. Importantly, greater than four-fold reduction of mRNA levels was demonstrated in five genes. Among the down-regulated genes, three encode for outer membrane proteins, including BabA, BabB and HopD. As expected, a substantial reduction in BabA protein abundance was detected in mice-adapted strains 298 and 299 via Western analysis. Our results suggest that the expression of Ley antigen and reduced outer membrane protein expressions may facilitate H. pylori colonisation of mouse gastric epithelium. PMID:27803027

  1. DNA methylation changes in plasticity genes accompany the formation and maintenance of memory.

    PubMed

    Halder, Rashi; Hennion, Magali; Vidal, Ramon O; Shomroni, Orr; Rahman, Raza-Ur; Rajput, Ashish; Centeno, Tonatiuh Pena; van Bebber, Frauke; Capece, Vincenzo; Garcia Vizcaino, Julio C; Schuetz, Anna-Lena; Burkhardt, Susanne; Benito, Eva; Navarro Sala, Magdalena; Javan, Sanaz Bahari; Haass, Christian; Schmid, Bettina; Fischer, Andre; Bonn, Stefan

    2016-01-01

    The ability to form memories is a prerequisite for an organism's behavioral adaptation to environmental changes. At the molecular level, the acquisition and maintenance of memory requires changes in chromatin modifications. In an effort to unravel the epigenetic network underlying both short- and long-term memory, we examined chromatin modification changes in two distinct mouse brain regions, two cell types and three time points before and after contextual learning. We found that histone modifications predominantly changed during memory acquisition and correlated surprisingly little with changes in gene expression. Although long-lasting changes were almost exclusive to neurons, learning-related histone modification and DNA methylation changes also occurred in non-neuronal cell types, suggesting a functional role for non-neuronal cells in epigenetic learning. Finally, our data provide evidence for a molecular framework of memory acquisition and maintenance, wherein DNA methylation could alter the expression and splicing of genes involved in functional plasticity and synaptic wiring.

  2. Variation and selection at the CAULIFLOWER floral homeotic gene accompanying the evolution of domesticated Brassica oleracea.

    PubMed Central

    Purugganan, M D; Boyles, A L; Suddith, J I

    2000-01-01

    The evolution of plant morphologies during domestication events provides clues to the origin of crop species and the evolutionary genetics of structural diversification. The CAULIFLOWER gene, a floral regulatory locus, has been implicated in the cauliflower phenotype in both Arabidopsis thaliana and Brassica oleracea. Molecular population genetic analysis indicates that alleles carrying a nonsense mutation in exon 5 of the B. oleracea CAULIFLOWER (BoCAL) gene are segregating in both wild and domesticated B. oleracea subspecies. Alleles carrying this nonsense mutation are nearly fixed in B. oleracea ssp. botrytis (domestic cauliflower) and B. oleracea ssp. italica (broccoli), both of which show evolutionary modifications of inflorescence structures. Tests for selection indicate that the pattern of variation at this locus is consistent with positive selection at BoCAL in these two subspecies. This nonsense polymorphism, however, is also present in both B. oleracea ssp. acephala (kale) and B. oleracea ssp. oleracea (wild cabbage). These results indicate that specific alleles of BoCAL were selected by early farmers during the domestication of modified inflorescence structures in B. oleracea. PMID:10835404

  3. Gene regulatory logic of dopaminergic neuron differentiation

    PubMed Central

    Flames, Nuria; Hobert, Oliver

    2009-01-01

    Dopamine signaling regulates a variety of complex behaviors and defects in dopaminergic neuron function or survival result in severe human pathologies, such as Parkinson's disease 1. The common denominator of all dopaminergic neurons is the expression of dopamine pathway genes, which code for a set of phylogenetically conserved proteins involved in dopamine synthesis and transport. Gene regulatory mechanisms that result in the activation of dopamine pathway genes and thereby ultimately determine the identity of dopaminergic neurons are poorly understood in any system studied to date 2. We show here that a simple cis-regulatory element, the DA motif, controls the expression of all dopamine pathway genes in all dopaminergic cell types in C. elegans. The DA motif is activated by the ETS transcription factor, AST-1. Loss of ast-1 results in the failure of all distinct dopaminergic neuronal subtypes to terminally differentiate. Ectopic expression of ast-1 is sufficient to activate the dopamine production pathway in some cellular contexts. Vertebrate dopaminergic pathway genes also contain phylogenetically conserved DA motifs that can be activated by the mouse ETS transcription factor Etv1/ER81 and a specific class of dopaminergic neurons fails to differentiate in mice lacking Etv1/ER81. Moreover, ectopic Etv1/ER81 expression induces dopaminergic fate marker expression in neuronal primary cultures. Mouse Etv1/ER81 can also functionally substitute for ast-1 in C.elegans. Our studies reveal an astoundingly simple and apparently conserved regulatory logic of dopaminergic neuron terminal differentiation and may provide new entry points into the diagnosis or therapy of conditions in which dopamine neurons are defective. PMID:19287374

  4. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  5. The PLETHORA Gene Regulatory Network Guides Growth and Cell Differentiation in Arabidopsis Roots[OPEN

    PubMed Central

    Sanchez-Perez, Gabino F.; Rutjens, Bas; Gorte, Maartje; Prasad, Kalika; Bao, Dongping; Timmermans-Hereijgers, Johanna L.P.M.; Maeo, Kenichiro; Nakamura, Kenzo; Shimotohno, Akie; Pencik, Ales; van Heesch, Sebastiaan; de Bruijn, Ewart; Cuppen, Edwin; Willemsen, Viola

    2016-01-01

    Organ formation in animals and plants relies on precise control of cell state transitions to turn stem cell daughters into fully differentiated cells. In plants, cells cannot rearrange due to shared cell walls. Thus, differentiation progression and the accompanying cell expansion must be tightly coordinated across tissues. PLETHORA (PLT) transcription factor gradients are unique in their ability to guide the progression of cell differentiation at different positions in the growing Arabidopsis thaliana root, which contrasts with well-described transcription factor gradients in animals specifying distinct cell fates within an essentially static context. To understand the output of the PLT gradient, we studied the gene set transcriptionally controlled by PLTs. Our work reveals how the PLT gradient can regulate cell state by region-specific induction of cell proliferation genes and repression of differentiation. Moreover, PLT targets include major patterning genes and autoregulatory feedback components, enforcing their role as master regulators of organ development. PMID:27920338

  6. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  7. MYCN gene expression is required for the onset of the differentiation programme in neuroblastoma cells

    PubMed Central

    Guglielmi, L; Cinnella, C; Nardella, M; Maresca, G; Valentini, A; Mercanti, D; Felsani, A; D'Agnano, I

    2014-01-01

    Neuroblastoma is an embryonic tumour of the sympathetic nervous system and is one of the most common cancers in childhood. A high differentiation stage has been associated with a favourable outcome; however, the mechanisms governing neuroblastoma cell differentiation are not completely understood. The MYCN gene is considered the hallmark of neuroblastoma. Even though it has been reported that MYCN has a role during embryonic development, it is needed its decrease so that differentiation can be completed. We aimed to better define the role of MYCN in the differentiation processes, particularly during the early stages. Considering the ability of MYCN to regulate non-coding RNAs, our hypothesis was that N-Myc protein might be necessary to activate differentiation (mimicking embryonic development events) by regulating miRNAs critical for this process. We show that MYCN expression increased in embryonic cortical neural precursor cells at an early stage after differentiation induction. To investigate our hypothesis, we used human neuroblastoma cell lines. In LAN-5 neuroblastoma cells, MYCN was upregulated after 2 days of differentiation induction before its expected downregulation. Positive modulation of various differentiation markers was associated with the increased MYCN expression. Similarly, MYCN silencing inhibited such differentiation, leading to negative modulation of various differentiation markers. Furthermore, MYCN gene overexpression in the poorly differentiating neuroblastoma cell line SK-N-AS restored the ability of such cells to differentiate. We identified three key miRNAs, which could regulate the onset of differentiation programme in the neuroblastoma cells in which we modulated MYCN. Interestingly, these effects were accompanied by changes in the apoptotic compartment evaluated both as expression of apoptosis-related genes and as fraction of apoptotic cells. Therefore, our idea is that MYCN is necessary during the activation of neuroblastoma

  8. Differentiation to adipocytes in accompanied by an increase in the amounts of Gi- and Go-proteins in 3T3-L1 cells

    SciTech Connect

    Watkins, D.C.; Northup, J.K.; Malbon, C.C.

    1986-05-01

    Treatment of cultures of 3T3-L1 cells with methylisobutyl-xanthine and dexamethasone has been shown to result in accumulation of lipid and conversion to the morphology of adipocytes in more than 90% of the cells. The status of the stimulatory (Gs), inhibitory (Gi) and Go-proteins during the course of 3T3-L1 differentiation was examined. The amount of alpha subunit of Gs (..cap alpha..Gs), assayed by radiolabeling in the presence of cholera toxin and (/sup 32/P)NAD/sup +/, increased upon differentiation as previously described by others. The amounts of ..cap alpha..Gi and ..cap alpha..Go assayed by radiolabeling in the presence of pertussis toxin and (/sup 32/P)NAD/sup +/ increased 3-fold upon differentiation. Immunoblots of cell membranes subjected to gel electrophoresis in sodium dodecyl sulfate were probed with two rabbit antisera raised against bovine brain ..cap alpha..Go and with one raised against the..beta..-subunit of the bovine rod-outer-segment G-protein, referred to as transducin. The immunoblotting data confirm the increase upon differentiation of ..cap alpha..Go and also demonstrate an increase in the amount of the ..beta..-subunit. Thus differentiation of 3T3-L1 cells is accompanied by dramatic changes in the complexion of G-proteins in the membranes.

  9. Neural Differentiation in HDAC1-Depleted Cells Is Accompanied by Coilin Downregulation and the Accumulation of Cajal Bodies in Nucleoli

    PubMed Central

    Krejčí, Jana; Legartová, Soňa

    2017-01-01

    Cajal bodies (CBs) are important compartments containing accumulated proteins that preferentially regulate RNA-related nuclear events, including splicing. Here, we studied the nuclear distribution pattern of CBs in neurogenesis. In adult brains, coilin was present at a high density, but CB formation was absent in the nuclei of the choroid plexus of the lateral ventricles. Cells of the adult hippocampus were characterized by a crescent-like morphology of coilin protein. We additionally observed a 70 kDa splice variant of coilin in adult mouse brains, which was different to embryonic brains and mouse pluripotent embryonic stem cells (mESCs), characterized by the 80 kDa standard variant of coilin. Here, we also showed that depletion of coilin is induced during neural differentiation and HDAC1 deficiency in mESCs caused coilin accumulation inside the fibrillarin-positive region of the nucleoli. A similar distribution pattern was observed in adult brain hippocampi, characterized by lower levels of both coilin and HDAC1. In summary, we observed that neural differentiation and HDAC1 deficiency lead to coilin depletion and coilin accumulation in body-like structures inside the nucleoli. PMID:28337219

  10. Neural Differentiation in HDAC1-Depleted Cells Is Accompanied by Coilin Downregulation and the Accumulation of Cajal Bodies in Nucleoli.

    PubMed

    Krejčí, Jana; Legartová, Soňa; Bártová, Eva

    2017-01-01

    Cajal bodies (CBs) are important compartments containing accumulated proteins that preferentially regulate RNA-related nuclear events, including splicing. Here, we studied the nuclear distribution pattern of CBs in neurogenesis. In adult brains, coilin was present at a high density, but CB formation was absent in the nuclei of the choroid plexus of the lateral ventricles. Cells of the adult hippocampus were characterized by a crescent-like morphology of coilin protein. We additionally observed a 70 kDa splice variant of coilin in adult mouse brains, which was different to embryonic brains and mouse pluripotent embryonic stem cells (mESCs), characterized by the 80 kDa standard variant of coilin. Here, we also showed that depletion of coilin is induced during neural differentiation and HDAC1 deficiency in mESCs caused coilin accumulation inside the fibrillarin-positive region of the nucleoli. A similar distribution pattern was observed in adult brain hippocampi, characterized by lower levels of both coilin and HDAC1. In summary, we observed that neural differentiation and HDAC1 deficiency lead to coilin depletion and coilin accumulation in body-like structures inside the nucleoli.

  11. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    DTIC Science & Technology

    2015-08-01

    AWARD NUMBER: W81XWH-14-1-0292 TITLE: Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters PRINCIPAL...30 Jul 2014 - 29 Jul 2015 4. TITLE AND SUBTITLE Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters 5a...differ in androgen response elements (AREs), with genes driving proliferation relying on consensus inverted repeats (cARE) and genes promoting

  12. Epigenetic Modifications Unlock the Milk Protein Gene Loci during Mouse Mammary Gland Development and Differentiation

    PubMed Central

    Rijnkels, Monique; Freeman-Zadrowski, Courtneay; Hernandez, Joseph; Potluri, Vani; Wang, Liguo; Li, Wei; Lemay, Danielle G.

    2013-01-01

    Background Unlike other tissues, development and differentiation of the mammary gland occur mostly after birth. The roles of systemic hormones and local growth factors important for this development and functional differentiation are well-studied. In other tissues, it has been shown that chromatin organization plays a key role in transcriptional regulation and underlies epigenetic regulation during development and differentiation. However, the role of chromatin organization in mammary gland development and differentiation is less well-defined. Here, we have studied the changes in chromatin organization at the milk protein gene loci (casein, whey acidic protein, and others) in the mouse mammary gland before and after functional differentiation. Methodology/Principal Findings Distal regulatory elements within the casein gene cluster and whey acidic protein gene region have an open chromatin organization after pubertal development, while proximal promoters only gain open-chromatin marks during pregnancy in conjunction with the major induction of their expression. In contrast, other milk protein genes, such as alpha-lactalbumin, already have an open chromatin organization in the mature virgin gland. Changes in chromatin organization in the casein gene cluster region that are present after puberty persisted after lactation has ceased, while the changes which occurred during pregnancy at the gene promoters were not maintained. In general, mammary gland expressed genes and their regulatory elements exhibit developmental stage- and tissue-specific chromatin organization. Conclusions/Significance A progressive gain of epigenetic marks indicative of open/active chromatin on genes marking functional differentiation accompanies the development of the mammary gland. These results support a model in which a chromatin organization is established during pubertal development that is then poised to respond to the systemic hormonal signals of pregnancy and lactation to achieve the

  13. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  14. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  15. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  16. Sex determining genes and sexual differentiation in a marsupial.

    PubMed

    Pask, A; Renfree, M B

    2001-11-01

    The role of genes in the differentiation of the testis and ovary has been extensively studied in the human and the mouse. Despite over a decade of investigations, the precise roles of genes and their interactions in the pathway of sex determination are still unclear. We have chosen to take a comparative look at sex determination and differentiation to gain insights into the evolution and the conserved functions of these genes. To achieve this, we have examined a wide variety of eutherian sex determining genes in a marsupial, the tammar wallaby, to determine which genes have a conserved and fundamental mammalian sex determining role. These investigations have provided many unique insights. Here, we review the recent molecular and endocrine investigations into sexual development in marsupials, and highlight how these studies have shed light on the roles of genes and hormones in mammalian sex determination and differentiation.

  17. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.

    PubMed

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan

    2017-02-01

    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  18. Evolution and organization of the fibrinogen locus on chromosome 4: gene duplication accompanied by transposition and inversion.

    PubMed Central

    Kant, J A; Fornace, A J; Saxe, D; Simon, M I; McBride, O W; Crabtree, G R

    1985-01-01

    Human fibrinogen cDNA probes for the alpha-, beta-, and gamma-polypeptide chains have been used to isolate the corresponding genes from human genomic libraries. There is a single copy of each gene. Restriction endonuclease analysis of isolated genomic clones and human genomic DNA indicates that the human alpha-, beta-, and gamma-fibrinogen genes are closely linked in a 50-kilobase region of a single human chromosome: the alpha-gene in the middle flanked by the beta-gene on one side and the gamma-gene on the other. The alpha- and gamma-chain genes are oriented in tandem and transcribed toward the beta-chain gene. The beta-chain gene is transcribed from the opposite DNA strand toward the gamma- and alpha-chain genes. The three genes have been localized to the distal third of the long arm of chromosome 4, bands q23-q32, by in situ hybridization with fibrinogen cDNAs and by examination of DNA from multiple rodent-human somatic cell hybrids. Alternative explanations for the present arrangement of the three fibrinogen genes involve either a three-step mechanism with inversion of the alpha/gamma-region or a two-step mechanism involving remote transposition and inversion. The second more simple mechanism has a precedent in the origin of repeated regions of the fibrinogen and immunoglobulin genes. Images PMID:2986113

  19. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  20. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  1. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  2. Role of Hox genes in stem cell differentiation.

    PubMed

    Seifert, Anne; Werheid, David F; Knapp, Silvana M; Tobiasch, Edda

    2015-04-26

    Hox genes are an evolutionary highly conserved gene family. They determine the anterior-posterior body axis in bilateral organisms and influence the developmental fate of cells. Embryonic stem cells are usually devoid of any Hox gene expression, but these transcription factors are activated in varying spatial and temporal patterns defining the development of various body regions. In the adult body, Hox genes are among others responsible for driving the differentiation of tissue stem cells towards their respective lineages in order to repair and maintain the correct function of tissues and organs. Due to their involvement in the embryonic and adult body, they have been suggested to be useable for improving stem cell differentiations in vitro and in vivo. In many studies Hox genes have been found as driving factors in stem cell differentiation towards adipogenesis, in lineages involved in bone and joint formation, mainly chondrogenesis and osteogenesis, in cardiovascular lineages including endothelial and smooth muscle cell differentiations, and in neurogenesis. As life expectancy is rising, the demand for tissue reconstruction continues to increase. Stem cells have become an increasingly popular choice for creating therapies in regenerative medicine due to their self-renewal and differentiation potential. Especially mesenchymal stem cells are used more and more frequently due to their easy handling and accessibility, combined with a low tumorgenicity and little ethical concerns. This review therefore intends to summarize to date known correlations between natural Hox gene expression patterns in body tissues and during the differentiation of various stem cells towards their respective lineages with a major focus on mesenchymal stem cell differentiations. This overview shall help to understand the complex interactions of Hox genes and differentiation processes all over the body as well as in vitro for further improvement of stem cell treatments in future regenerative

  3. Role of Hox genes in stem cell differentiation

    PubMed Central

    Seifert, Anne; Werheid, David F; Knapp, Silvana M; Tobiasch, Edda

    2015-01-01

    Hox genes are an evolutionary highly conserved gene family. They determine the anterior-posterior body axis in bilateral organisms and influence the developmental fate of cells. Embryonic stem cells are usually devoid of any Hox gene expression, but these transcription factors are activated in varying spatial and temporal patterns defining the development of various body regions. In the adult body, Hox genes are among others responsible for driving the differentiation of tissue stem cells towards their respective lineages in order to repair and maintain the correct function of tissues and organs. Due to their involvement in the embryonic and adult body, they have been suggested to be useable for improving stem cell differentiations in vitro and in vivo. In many studies Hox genes have been found as driving factors in stem cell differentiation towards adipogenesis, in lineages involved in bone and joint formation, mainly chondrogenesis and osteogenesis, in cardiovascular lineages including endothelial and smooth muscle cell differentiations, and in neurogenesis. As life expectancy is rising, the demand for tissue reconstruction continues to increase. Stem cells have become an increasingly popular choice for creating therapies in regenerative medicine due to their self-renewal and differentiation potential. Especially mesenchymal stem cells are used more and more frequently due to their easy handling and accessibility, combined with a low tumorgenicity and little ethical concerns. This review therefore intends to summarize to date known correlations between natural Hox gene expression patterns in body tissues and during the differentiation of various stem cells towards their respective lineages with a major focus on mesenchymal stem cell differentiations. This overview shall help to understand the complex interactions of Hox genes and differentiation processes all over the body as well as in vitro for further improvement of stem cell treatments in future regenerative

  4. Melatonin and nitric oxide regulate sunflower seedling growth under salt stress accompanying differential expression of Cu/Zn SOD and Mn SOD.

    PubMed

    Arora, Dhara; Bhatla, Satish C

    2017-02-28

    Salinity results in significant reduction in sunflower (Helianthus annuus L.) seedling growth and excessive generation of reactive oxygen species (ROS). Present work highlights the possible role of melatonin as an antioxidant through its interaction with nitric oxide (NO), and as an early and long distance NaCl-stress sensing signaling molecule in seedling cotyledons. Exogenous melatonin (15µM)±NaCl (120mM) inhibit seedling growth, which is also correlated with NO availability, accumulation of potential superoxide anion (O2(•-)) and peroxynitrite anion (ONOO(-)), extent of tyrosine-nitration of proteins, spatial localization and activity of superoxide dismutase (SOD) isoforms. NO acts as a positive modulator of melatonin accumulation in seedling cotyledons as a long-distance signaling response. Modulation of superoxide anion and peroxynitrite anion content by melatonin highlights its crucial role in combating deleterious effects of ROS and reactive nitrogen species (RNS). Present findings provide evidence for an interaction between melatonin and NO in their effect on seedling growth under salt stress accompanying differential modulation of two SOD isoforms, i.e. Cu/Zn SOD and Mn SOD.

  5. Changes in alternative splicing of human and mouse genes are accompanied by faster evolution of constitutive exons.

    PubMed

    Cusack, Brian P; Wolfe, Kenneth H

    2005-11-01

    Alternative splicing is known to be an important source of protein sequence variation, but its evolutionary impact has not been explored in detail. Studying alternative splicing requires extensive sampling of the transcriptome, but new data sets based on expressed sequence tags aligned to chromosomes make it possible to study alternative splicing on a genome-wide scale. Although genes showing alternative splicing by exon skipping are conserved as compared to the genome as a whole, we find that genes where structural differences between human and mouse result in genome-specific alternatively spliced exons in one species show almost 60% greater nonsynonymous divergence in constitutive exons than genes where exon skipping is conserved. This effect is also seen for genes showing species-specific patterns of alternative splicing where gene structure is conserved. Our observations are not attributable to an inherent difference in rate of evolution between these two sets of proteins or to differences with respect to predictors of evolutionary rate such as expression level, tissue specificity, or genetic redundancy. Where genome-specific alternatively spliced exons are seen in mammals, the vast majority of skipped exons appear to be recent additions to gene structures. Furthermore, among genes with genome-specific alternatively spliced exons, the degree of nonsynonymous divergence in constitutive sequence is a function of the frequency of incorporation of these alternative exons into transcripts. These results suggest that alterations in alternative splicing pattern can have knock-on effects in terms of accelerated sequence evolution in constant regions of the protein.

  6. Repression of genes involved in melanocyte differentiation in uveal melanoma

    PubMed Central

    Bergeron, Marjorie-Allison; Champagne, Sophie; Gaudreault, Manon; Deschambeault, Alexandre

    2012-01-01

    Purpose Uveal melanoma (UM) has been the subject of intense interest due to its distinctive metastatic pattern, which involves hematogenous dissemination of cancerous cells toward the liver in 50% of patients. To search for new UM prognostic markers, the Suppressive Subtractive Hybridization (SSH) technique was used to isolate genes that are differentially expressed between UM primary tumors and normal uveal melanocytes (UVM). Methods A subtracted cDNA library was prepared using cDNA from uncultured UM primary tumors and UVM. The expression level of selected genes was further validated by cDNA microarray, semi-quantitative reverse transcription polymerase chain reaction (RT-PCR), and immunofluorescence analyses. Results One hundred-fifteen genes were identified using the SSH technique. Microarray analyses comparing the gene expression profiles of UM primary tumors to UVM validated a significant differential expression for 48% of these genes. The expression pattern of selected genes was then analyzed by semi-quantitative RT–PCR and was found to be consistent with the SSH and cDNA microarray findings. A down-regulation of genes associated with melanocyte differentiation was confirmed in UM primary tumors. Presence of undifferentiated cells in the UM was demonstrated by the expression of stem cell markers ATP-binding cassette sub-family G member 2 (ABCG2) and octamer-binding protein 4 (OCT4). Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes between UM and UVM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. In addition, deregulation of the melanocyte differentiation pathway revealed the presence of UM cells exhibiting a stem cell-like phenotype. PMID:22815634

  7. Clustering of Tissue-Specific Sub-TADs Accompanies the Regulation of HoxA Genes in Developing Limbs

    PubMed Central

    Berlivet, Soizik; Paquette, Denis; Dumouchel, Annie; Langlais, David; Dostie, Josée; Kmita, Marie

    2013-01-01

    HoxA genes exhibit central roles during development and causal mutations have been found in several human syndromes including limb malformation. Despite their importance, information on how these genes are regulated is lacking. Here, we report on the first identification of bona fide transcriptional enhancers controlling HoxA genes in developing limbs and show that these enhancers are grouped into distinct topological domains at the sub-megabase scale (sub-TADs). We provide evidence that target genes and regulatory elements physically interact with each other through contacts between sub-TADs rather than by the formation of discreet “DNA loops”. Interestingly, there is no obvious relationship between the functional domains of the enhancers within the limb and how they are partitioned among the topological domains, suggesting that sub-TAD formation does not rely on enhancer activity. Moreover, we show that suppressing the transcriptional activity of enhancers does not abrogate their contacts with HoxA genes. Based on these data, we propose a model whereby chromatin architecture defines the functional landscapes of enhancers. From an evolutionary standpoint, our data points to the convergent evolution of HoxA and HoxD regulation in the fin-to-limb transition, one of the major morphological innovations in vertebrates. PMID:24385922

  8. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  9. Identifying gene regulatory network rewiring using latent differential graphical models

    PubMed Central

    Tian, Dechao; Gu, Quanquan; Ma, Jian

    2016-01-01

    Gene regulatory networks (GRNs) are highly dynamic among different tissue types. Identifying tissue-specific gene regulation is critically important to understand gene function in a particular cellular context. Graphical models have been used to estimate GRN from gene expression data to distinguish direct interactions from indirect associations. However, most existing methods estimate GRN for a specific cell/tissue type or in a tissue-naive way, or do not specifically focus on network rewiring between different tissues. Here, we describe a new method called Latent Differential Graphical Model (LDGM). The motivation of our method is to estimate the differential network between two tissue types directly without inferring the network for individual tissues, which has the advantage of utilizing much smaller sample size to achieve reliable differential network estimation. Our simulation results demonstrated that LDGM consistently outperforms other Gaussian graphical model based methods. We further evaluated LDGM by applying to the brain and blood gene expression data from the GTEx consortium. We also applied LDGM to identify network rewiring between cancer subtypes using the TCGA breast cancer samples. Our results suggest that LDGM is an effective method to infer differential network using high-throughput gene expression data to identify GRN dynamics among different cellular conditions. PMID:27378774

  10. Integration of amplified differential gene expression (ADGE) and DNA microarray.

    PubMed

    Chen, Zhijian J; Gaté, Laurent; Davis, Warren; Ile, Kristina E; Tew, Kenneth D

    2002-12-01

    Amplified Differential Gene Expression (ADGE) provides a new concept that the ratios of differentially expressed genes are magnified before detection in order to improve both sensitivity and accuracy. This technology is now implemented with integration of DNA reassociation and PCR. The ADGE technique can be used either as a stand-alone method or in series with DNA microarray. ADGE is used in sample preprocessing and DNA microarray is used as a displaying system in the series combination. These two techniques are mutually synergistic: the quadratic magnification of ratios of differential gene expression achieved by ADGE improves the detection sensitivity and accuracy; the PCR amplification of templates enhances the signal intensity and reduces the requirement for large amounts of starting material; the high throughput for DNA microarray is maintained.

  11. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.

    PubMed

    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata

    2015-04-01

    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  12. Intermediate filament genes as differentiation markers in the leech Helobdella.

    PubMed

    Kuo, Dian-Han; Weisblat, David A

    2011-10-01

    The intermediate filament (IF) cytoskeleton is a general feature of differentiated cells. Its molecular components, IF proteins, constitute a large family including the evolutionarily conserved nuclear lamins and the more diverse collection of cytoplasmic intermediate filament (CIF) proteins. In vertebrates, genes encoding CIFs exhibit cell/tissue type-specific expression profiles and are thus useful as differentiation markers. The expression of invertebrate CIFs, however, is not well documented. Here, we report a whole-genome survey of IF genes and their developmental expression patterns in the leech Helobdella, a lophotrochozoan model for developmental biology research. We found that, as in vertebrates, each of the leech CIF genes is expressed in a specific set of cell/tissue types. This allows us to detect earliest points of differentiation for multiple cell types in leech development and to use CIFs as molecular markers for studying cell fate specification in leech embryos. In addition, to determine the feasibility of using CIFs as universal metazoan differentiation markers, we examined phylogenetic relationships of IF genes from various species. Our results suggest that CIFs, and thus their cell/tissue-specific expression patterns, have expanded several times independently during metazoan evolution. Moreover, comparing the expression patterns of CIF orthologs between two leech species suggests that rapid evolutionary changes in the cell or tissue specificity of CIFs have occurred among leeches. Hence, CIFs are not suitable for identifying cell or tissue homology except among very closely related species, but they are nevertheless useful species-specific differentiation markers.

  13. Dynamic Gene Regulatory Networks of Human Myeloid Differentiation.

    PubMed

    Ramirez, Ricardo N; El-Ali, Nicole C; Mager, Mikayla Anne; Wyman, Dana; Conesa, Ana; Mortazavi, Ali

    2017-03-27

    The reconstruction of gene regulatory networks underlying cell differentiation from high-throughput gene expression and chromatin data remains a challenge. Here, we derive dynamic gene regulatory networks for human myeloid differentiation using a 5-day time series of RNA-seq and ATAC-seq data. We profile HL-60 promyelocytes differentiating into macrophages, neutrophils, monocytes, and monocyte-derived macrophages. We find a rapid response in the expression of key transcription factors and lineage markers that only regulate a subset of their targets at a given time, which is followed by chromatin accessibility changes that occur later along with further gene expression changes. We observe differences between promyelocyte- and monocyte-derived macrophages at both the transcriptional and chromatin landscape level, despite using the same differentiation stimulus, which suggest that the path taken by cells in the differentiation landscape defines their end cell state. More generally, our approach of combining neighboring time points and replicates to achieve greater sequencing depth can efficiently infer footprint-based regulatory networks from long series data.

  14. Endosymbiotic origin and differential loss of eukaryotic genes.

    PubMed

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Sousa, Filipa L; Lockhart, Peter J; Bryant, David; Hazkani-Covo, Einat; McInerney, James O; Landan, Giddy; Martin, William F

    2015-08-27

    Chloroplasts arose from cyanobacteria, mitochondria arose from proteobacteria. Both organelles have conserved their prokaryotic biochemistry, but their genomes are reduced, and most organelle proteins are encoded in the nucleus. Endosymbiotic theory posits that bacterial genes in eukaryotic genomes entered the eukaryotic lineage via organelle ancestors. It predicts episodic influx of prokaryotic genes into the eukaryotic lineage, with acquisition corresponding to endosymbiotic events. Eukaryotic genome sequences, however, increasingly implicate lateral gene transfer, both from prokaryotes to eukaryotes and among eukaryotes, as a source of gene content variation in eukaryotic genomes, which predicts continuous, lineage-specific acquisition of prokaryotic genes in divergent eukaryotic groups. Here we discriminate between these two alternatives by clustering and phylogenetic analysis of eukaryotic gene families having prokaryotic homologues. Our results indicate (1) that gene transfer from bacteria to eukaryotes is episodic, as revealed by gene distributions, and coincides with major evolutionary transitions at the origin of chloroplasts and mitochondria; (2) that gene inheritance in eukaryotes is vertical, as revealed by extensive topological comparison, sparse gene distributions stemming from differential loss; and (3) that continuous, lineage-specific lateral gene transfer, although it sometimes occurs, does not contribute to long-term gene content evolution in eukaryotic genomes.

  15. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  16. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  17. The gene road to royalty--differential expression of hydroxylating genes in the mandibular glands of the honeybee.

    PubMed

    Malka, Osnat; Karunker, Iris; Yeheskel, Adva; Morin, Shai; Hefetz, Abraham

    2009-10-01

    The advances in honeybee sociogenomics have paved the way for the study of social communication processes at the gene level, in particular the expression of caste-specific pheromones. The queen honeybee mandibular pheromone provides an excellent model system, in that biosynthesis of the hydroxylating fatty acid caste-specific pheromone appears to be reduced to a single chemical hydroxylation step of stearic acid. Queens are typified by omega-1-hydroxylation, as opposed to the worker-typical omega-hydroxylation. We hypothesized that this bifurcation is the consequence of differential expression of caste-specific genes that code for fatty acid-hydroxylating enzymes from the cytochrome P450 (CYP) family. Bioinformatics studies disclosed two candidate proteins CYP4AA1 and CYP18A1. We thus investigated the expression of these genes in the mandibular glands of queens, and of queenright (QR) and queenless (QL) workers. The real-time PCR results revealed that CYP4AA1 (omega-hydroxylation) was expressed at high levels in both QR and QL workers, whereas in queens its expression was negligible. The expression of CYP18A1 (omega-1-hydroxylation), on the other hand, was high in the queen's glands and negligible in those of QR workers. In QL workers, however, the expression of CYP18A1 was considerably elevated and significantly greater than in QR workers. Three-dimensional structural models constructed for these enzymes demonstrate differences in the active site between CYP18A1 and CYP4AA1, in line with their differential catalytic specificity. The fact that queen pheromone plasticity can be tracked all the way to gene expression provides a new insight into the process of caste differentiation and the accompanying social communication.

  18. LSOSS: Detection of Cancer Outlier Differential Gene Expression.

    PubMed

    Wang, Yupeng; Rekaya, Romdhane

    2010-08-05

    Detection of differential gene expression using microarray technology has received considerable interest in cancer research studies. Recently, many researchers discovered that oncogenes may be activated in some but not all samples in a given disease group. The existing statistical tools for detecting differentially expressed genes in a subset of the disease group mainly include cancer outlier profile analysis (COPA), outlier sum (OS), outlier robust t-statistic (ORT) and maximum ordered subset t-statistics (MOST). In this study, another approach named Least Sum of Ordered Subset Square t-statistic (LSOSS) is proposed. The results of our simulation studies indicated that LSOSS often has more power than previous statistical methods. When applied to real human breast and prostate cancer data sets, LSOSS was competitive in terms of the biological relevance of top ranked genes. Furthermore, a modified hierarchical clustering method was developed to classify the heterogeneous gene activation patterns of human breast cancer samples based on the significant genes detected by LSOSS. Three classes of gene activation patterns, which correspond to estrogen receptor (ER)+, ER- and a mixture of ER+ and ER-, were detected and each class was assigned a different gene signature.

  19. Differential methylation of genes and repeats in land plants.

    PubMed

    Rabinowicz, Pablo D; Citek, Robert; Budiman, Muhammad A; Nunberg, Andrew; Bedell, Joseph A; Lakey, Nathan; O'Shaughnessy, Andrew L; Nascimento, Lidia U; McCombie, W Richard; Martienssen, Robert A

    2005-10-01

    The hypomethylated fraction of plant genomes is usually enriched in genes and can be selectively cloned using methylation filtration (MF). Therefore, MF has been used as a gene enrichment technology in sorghum and maize, where gene enrichment was proportional to genome size. Here we apply MF to a broad variety of plant species spanning a wide range of genome sizes. Differential methylation of genic and non-genic sequences was observed in all species tested, from non-vascular to vascular plants, but in some cases, such as wheat and pine, a lower than expected level of enrichment was observed. Remarkably, hexaploid wheat and pine show a dramatically large number of gene-like sequences relative to other plants. In hexaploid wheat, this apparent excess of genes may reflect an abundance of methylated pseudogenes, which may thus be more prevalent in recent polyploids.

  20. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  1. Epigenetic control of skin differentiation genes by phytocannabinoids

    PubMed Central

    Pucci, Mariangela; Rapino, Cinzia; Di Francesco, Andrea; Dainese, Enrico; D'Addario, Claudio; Maccarrone, Mauro

    2013-01-01

    BACKGROUND AND PURPOSE Endocannabinoid signalling has been shown to have a role in the control of epidermal physiology, whereby anandamide is able to regulate the expression of skin differentiation genes through DNA methylation. Here, we investigated the possible epigenetic regulation of these genes by several phytocannabinoids, plant-derived cannabinoids that have the potential to be novel therapeutics for various human diseases. EXPERIMENTAL APPROACH The effects of cannabidiol, cannabigerol and cannabidivarin on the expression of skin differentiation genes keratins 1 and 10, involucrin and transglutaminase 5, as well as on DNA methylation of keratin 10 gene, were investigated in human keratinocytes (HaCaT cells). The effects of these phytocannabinoids on global DNA methylation and the activity and expression of four major DNA methyltransferases (DNMT1, 3a, 3b and 3L) were also examined. KEY RESULTS Cannabidiol and cannabigerol significantly reduced the expression of all the genes tested in differentiated HaCaT cells, by increasing DNA methylation of keratin 10 gene, but cannabidivarin was ineffective. Remarkably, cannabidiol reduced keratin 10 mRNA through a type-1 cannabinoid (CB1) receptor-dependent mechanism, whereas cannabigerol did not affect either CB1 or CB2 receptors of HaCaT cells. In addition, cannabidiol, but not cannabigerol, increased global DNA methylation levels by selectively enhancing DNMT1 expression, without affecting DNMT 3a, 3b or 3L. CONCLUSIONS AND IMPLICATIONS These findings show that the phytocannabinoids cannabidiol and cannabigerol are transcriptional repressors that can control cell proliferation and differentiation. This indicates that they (especially cannabidiol) have the potential to be lead compounds for the development of novel therapeutics for skin diseases. PMID:23869687

  2. Differentially expressed genes in giant cell tumor of bone.

    PubMed

    Babeto, Erica; Conceição, André Luis Giacometti; Valsechi, Marina Curado; Peitl Junior, Paulo; de Campos Zuccari, Débora Aparecida Pires; de Lima, Luiz Guilherme Cernaglia Aureliano; Bonilha, Jane Lopes; de Freitas Calmon, Marília; Cordeiro, José Antônio; Rahal, Paula

    2011-04-01

    Giant cells tumors of bone (GCTB) are benign in nature but cause osteolytic destruction with a number of particular characteristics. These tumors can have uncertain biological behavior often contain a significant proportion of highly multinucleated cells, and may show aggressive behavior. We have studied differential gene expression in GCTB that may give a better understanding of their physiopathology, and might be helpful in prognosis and treatment. Rapid subtractive hybridization (RaSH) was used to identify and measure novel genes that appear to be differentially expressed, including KTN1, NEB, ROCK1, and ZAK using quantitative real-time polymerase chain reaction (qRT-PCR) and immunohistochemistry in the samples of GCTBs compared to normal bone tissue. Normal bone was used in the methodology RaSH for comparison with the GCTB in identification of differentially expressed genes. Functional annotation indicated that these genes are involved in cellular processes related to their tumor phenotype. The differential expression of KTN1, ROCK1, and ZAK was independently confirmed by qRT-PCR and immunohistochemistry. The expression of the KTN1 and ROCK1 genes were increased in samples by qRT-PCR and immunohistochemistry, and ZAK had reduced expression. Since ZAK have CpG islands in their promoter region and low expression in tumor tissue, their methylation pattern was analyzed by MSP-PCR. The genes identified KTN1, ROCK1, and ZAK may be responsible for loss of cellular homeostasis in GCTB since they are responsible for various functions related to tumorigenesis such as cell migration, cytoskeletal organization, apoptosis, and cell cycle control and thus may contribute at some stage in the process of formation and development of GCTB.

  3. Differential expression of genes identified by suppression subtractive hybridization in petals of opening carnation flowers.

    PubMed

    Harada, Taro; Torii, Yuka; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru

    2010-05-01

    Flower opening is an event accompanied by morphological changes in petals which include elongation, expansion, and outward-curving. Petal cell growth is a fundamental process that underlies such phenomena, but its molecular mechanism remains largely unknown. Suppression subtractive hybridization was performed between petals during the early elongation period (stage 1) and during the opening period (stage 5) in carnation flowers and a pair of subtraction libraries abundant in differentially expressed genes was constructed at each stage. 393 cDNA clones picked up by differential screening out of 1728 clones were sequenced and 235 different cDNA fragments were identified, among which 211 did not match any known nucleotide sequence of carnation genes in the databases. BLASTX search of nucleotide sequences revealed that putative functions of the translational products can be classified into several categories including transcription, signalling, cell wall modification, lipid metabolism, and transport. Open reading frames of 15 selected genes were successfully determined by rapid amplification of cDNA ends (RACE). Time-course analysis of these genes by real-time RT-PCR showed that transcript levels of several genes correlatively fluctuate in petals of opening carnation flowers, suggesting an association with the morphological changes by elongation or curving. Based on the results, it is suggested that the growth of carnation petals is controlled by co-ordinated gene expression during the progress of flower opening. In addition, the possible roles of some key genes in the initiation of cell growth, the construction of the cell wall and cuticle, and transport across membranes were discussed.

  4. Increased expression of prion protein gene is accompanied by demethylation of CpG sites in a mouse embryonal carcinoma cell line, P19C6

    PubMed Central

    DALAI, Wuyun; MATSUO, Eiko; TAKEYAMA, Natsumi; KAWANO, Junichi; SAEKI, Keiichi

    2017-01-01

    Elucidation of the processes regulating the prion protein gene (Prnp) is an important key to understanding the development of prion disorders. In this study, we explored the involvement of DNA methylation in Prnp transcriptional regulation during neuronal differentiation of embryonic carcinoma P19C6 cells. When P19C6 cells were differentiated into neuronal cells, the expression of Prnp was markedly increased, while CpG methylation was significantly demethylated at the nucleotide region between −599 and −238 from the transcription start site. In addition, when P19C6 cells were applied in a DNA methyltransferase inhibitor, RG108, Prnp transcripts were also significantly increased in relation to the decreased methylation statuses. These findings helped to elucidate the DNA methylation-mediated regulation of Prnp expression during neuronal differentiation. PMID:28132962

  5. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  6. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  7. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo

    2009-01-01

    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  8. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  9. Age-related changes in cerebellar and hypothalamic function accompany non-microglial immune gene expression, altered synapse organization, and excitatory amino acid neurotransmission deficits

    PubMed Central

    Bonasera, Stephen J.; Arikkath, Jyothi; Boska, Michael D.; Chaudoin, Tammy R.; DeKorver, Nicholas W.; Goulding, Evan H.; Hoke, Traci A.; Mojtahedzedah, Vahid; Reyelts, Crystal D.; Sajja, Balasrinivasa; Schenk, A. Katrin; Tecott, Laurence H.; Volden, Tiffany A.

    2016-01-01

    We describe age-related molecular and neuronal changes that disrupt mobility or energy balance based on brain region and genetic background. Compared to young mice, aged C57BL/6 mice exhibit marked locomotor (but not energy balance) impairments. In contrast, aged BALB mice exhibit marked energy balance (but not locomotor) impairments. Age-related changes in cerebellar or hypothalamic gene expression accompany these phenotypes. Aging evokes upregulation of immune pattern recognition receptors and cell adhesion molecules. However, these changes do not localize to microglia, the major CNS immunocyte. Consistent with a neuronal role, there is a marked age-related increase in excitatory synapses over the cerebellum and hypothalamus. Functional imaging of these regions is consistent with age-related synaptic impairments. These studies suggest that aging reactivates a developmental program employed during embryogenesis where immune molecules guide synapse formation and pruning. Renewed activity in this program may disrupt excitatory neurotransmission, causing significant behavioral deficits. PMID:27689748

  10. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  11. Gene Sets Net Correlations Analysis (GSNCA): a multivariate differential coexpression test for gene sets

    PubMed Central

    Rahmatallah, Yasir; Emmert-Streib, Frank; Glazko, Galina

    2014-01-01

    Motivation: To date, gene set analysis approaches primarily focus on identifying differentially expressed gene sets (pathways). Methods for identifying differentially coexpressed pathways also exist but are mostly based on aggregated pairwise correlations or other pairwise measures of coexpression. Instead, we propose Gene Sets Net Correlations Analysis (GSNCA), a multivariate differential coexpression test that accounts for the complete correlation structure between genes. Results: In GSNCA, weight factors are assigned to genes in proportion to the genes’ cross-correlations (intergene correlations). The problem of finding the weight vectors is formulated as an eigenvector problem with a unique solution. GSNCA tests the null hypothesis that for a gene set there is no difference in the weight vectors of the genes between two conditions. In simulation studies and the analyses of experimental data, we demonstrate that GSNCA captures changes in the structure of genes’ cross-correlations rather than differences in the averaged pairwise correlations. Thus, GSNCA infers differences in coexpression networks, however, bypassing method-dependent steps of network inference. As an additional result from GSNCA, we define hub genes as genes with the largest weights and show that these genes correspond frequently to major and specific pathway regulators, as well as to genes that are most affected by the biological difference between two conditions. In summary, GSNCA is a new approach for the analysis of differentially coexpressed pathways that also evaluates the importance of the genes in the pathways, thus providing unique information that may result in the generation of novel biological hypotheses. Availability and implementation: Implementation of the GSNCA test in R is available upon request from the authors. Contact: YRahmatallah@uams.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24292935

  12. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  13. Characterization of DNA methylation change in stem cell marker genes during differentiation of human embryonic stem cells.

    PubMed

    Yeo, Seungeun; Jeong, Sangkyun; Kim, Janghwan; Han, Jee-Soo; Han, Yong-Mahn; Kang, Yong-Kook

    2007-08-03

    Pluripotent human embryonic stem cells (hESCs) have the distinguishing feature of innate capacity to allow indefinite self-renewal. This attribute continues until specific constraints or restrictions, such as DNA methylation, are imposed on the genome, usually accompanied by differentiation. With the aim of utilizing DNA methylation as a sign of early differentiation, we probed the genomic regions of hESCs, particularly focusing on stem cell marker (SCM) genes to identify regulatory sequences that display differentiation-sensitive alterations in DNA methylation. We show that the promoter regions of OCT4 and NANOG, but not SOX2, REX1 and FOXD3, undergo significant methylation during hESCs differentiation in which SCM genes are substantially repressed. Thus, following exposure to differentiation stimuli, OCT4 and NANOG gene loci are modified relatively rapidly by DNA methylation. Accordingly, we propose that the DNA methylation states of OCT4 and NANOG sequences may be utilized as barometers to determine the extent of hESC differentiation.

  14. Random forests-based differential analysis of gene sets for gene expression data.

    PubMed

    Hsueh, Huey-Miin; Zhou, Da-Wei; Tsai, Chen-An

    2013-04-10

    In DNA microarray studies, gene-set analysis (GSA) has become the focus of gene expression data analysis. GSA utilizes the gene expression profiles of functionally related gene sets in Gene Ontology (GO) categories or priori-defined biological classes to assess the significance of gene sets associated with clinical outcomes or phenotypes. Many statistical approaches have been proposed to determine whether such functionally related gene sets express differentially (enrichment and/or deletion) in variations of phenotypes. However, little attention has been given to the discriminatory power of gene sets and classification of patients. In this study, we propose a method of gene set analysis, in which gene sets are used to develop classifications of patients based on the Random Forest (RF) algorithm. The corresponding empirical p-value of an observed out-of-bag (OOB) error rate of the classifier is introduced to identify differentially expressed gene sets using an adequate resampling method. In addition, we discuss the impacts and correlations of genes within each gene set based on the measures of variable importance in the RF algorithm. Significant classifications are reported and visualized together with the underlying gene sets and their contribution to the phenotypes of interest. Numerical studies using both synthesized data and a series of publicly available gene expression data sets are conducted to evaluate the performance of the proposed methods. Compared with other hypothesis testing approaches, our proposed methods are reliable and successful in identifying enriched gene sets and in discovering the contributions of genes within a gene set. The classification results of identified gene sets can provide an valuable alternative to gene set testing to reveal the unknown, biologically relevant classes of samples or patients. In summary, our proposed method allows one to simultaneously assess the discriminatory ability of gene sets and the importance of genes for

  15. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-03-16

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  16. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  17. Cytokine-induced macrophage differentiation: a tale of 2 genes.

    PubMed

    Winston, B W; Krein, P M; Mowat, C; Huang, Y

    1999-12-01

    Macrophages are versatile cells found in every tissue in the body. They must perform a number of diverse cellular functions that allow them to kill invading micro-organisms and neoplastic cells as well as produce growth factors involved in wound healing. Macrophages that develop these diverse functions arise from a common precursor. By a process of selective adaptation, the common precursor monocyte/macrophage differentiates into a distinctive macrophage with a different and specific phenotype, characterized by the expression of a specific set of gene products. The local environment plays a critical role in shaping or directing the pattern or pathway of macrophage differentiation. The authors have focused on 2 specific macrophage differentiation pathways in a murine bone marrow-derived macrophage model. One pathway is believed to play a role in wound repair and is characterized by the induction of insulin-like growth factor-1 (IGF-I). The second pathway is involved in macrophage cytocidal activation and is characterized by the induction of the inducible form of nitric oxide synthase (iNOS). The pleotropic cytokine tumour necrosis factor-alpha (TNF-alpha) appears to mediate macrophage differentiation along both of these pathways. Interferon-gamma (IFN-gamma), however, appears to act as a molecular switch. In the presence of IFN-gamma, stimulation of macrophages with TNF-alpha results in macrophage differentiation along a pathway in which iNOS is expressed, whereas, in the absence of IFN-gamma, stimulation of macrophages with TNF-alpha results in differentiation along a pathway in which IGF-I is expressed. The authors focus on some of the molecular events involved in TNF-alpha and IFN-gamma signal transduction and the regulation of iNOS and IGF-I genes in macrophages.

  18. Differential gene expression of mammalian SPO11/TOP6A homologs during meiosis.

    PubMed

    Shannon, M; Richardson, L; Christian, A; Handel, M A; Thelen, M P

    1999-12-03

    As the initiator of DNA double-strand breaks during meiosis in Saccharomyces cerevisiae, the SPO11 protein is essential for recombination. Similarity between SPO11 and archaebacterial TOP6A proteins points to evolutionary specialization of a DNA cleavage function for meiotic recombination. To determine whether this extends to mammals, we isolated and characterized mouse and human SPO11 cDNAs. Mammalian SPO11 genes were found to be expressed at high levels only in testis, wherein mouse Spo11 transcript is restricted primarily to meiotic germ cells and is maximally expressed at midpachynema. Mouse Spo11 is located near the distal end of chromosome 2, while human SPO11 is found in the homologous position of chromosome 20q13.2-13.3, a region that is amplified in some breast cancers. Sequence homology and differential expression together support a highly conserved role for SPO11 in the enzymatic cleavage of DNA that accompanies meiotic recombination.

  19. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  20. Altered patterns of gene duplication and differential gene gain and loss in fungal pathogens

    PubMed Central

    Powell, Amy J; Conant, Gavin C; Brown, Douglas E; Carbone, Ignazio; Dean, Ralph A

    2008-01-01

    Background Duplication, followed by fixation or random loss of novel genes, contributes to genome evolution. Particular outcomes of duplication events are possibly associated with pathogenic life histories in fungi. To date, differential gene gain and loss have not been studied at genomic scales in fungal pathogens, despite this phenomenon's known importance in virulence in bacteria and viruses. Results To determine if patterns of gene duplication differed between pathogens and non-pathogens, we identified gene families across nine euascomycete and two basidiomycete species. Gene family size distributions were fit to power laws to compare gene duplication trends in pathogens versus non-pathogens. Fungal phytopathogens showed globally altered patterns of gene duplication, as indicated by differences in gene family size distribution. We also identified sixteen examples of gene family expansion and five instances of gene family contraction in pathogenic lineages. Expanded gene families included those predicted to be important in melanin biosynthesis, host cell wall degradation and transport functions. Contracted families included those encoding genes involved in toxin production, genes with oxidoreductase activity, as well as subunits of the vacuolar ATPase complex. Surveys of the functional distribution of gene duplicates indicated that pathogens show enrichment for gene duplicates associated with receptor and hydrolase activities, while euascomycete pathogens appeared to have not only these differences, but also significantly more duplicates associated with regulatory and carbohydrate binding functions. Conclusion Differences in the overall levels of gene duplication in phytopathogenic species versus non-pathogenic relatives implicate gene inventory flux as an important virulence-associated process in fungi. We hypothesize that the observed patterns of gene duplicate enrichment, gene family expansion and contraction reflect adaptation within pathogenic life

  1. Improved detection of differentially expressed genes through incorporation of gene locations.

    PubMed

    Xiao, Guanghua; Reilly, Cavan; Khodursky, Arkady B

    2009-09-01

    In determining differential expression in cDNA microarray experiments, the expression level of an individual gene is usually assumed to be independent of the expression levels of other genes, but many recent studies have shown that a gene's expression level tends to be similar to that of its neighbors on a chromosome, and differentially expressed (DE) genes are likely to form clusters of similar transcriptional activity along the chromosome. When modeled as a one-dimensional spatial series, the expression level of genes on the same chromosome frequently exhibit significant spatial correlation, reflecting spatial patterns in transcription. By modeling these spatial correlations, we can obtain improved estimates of transcript levels. Here, we demonstrate the existence of spatial correlations in transcriptional activity in the Escherichia coli (E. coli) chromosome across more than 50 experimental conditions. Based on this finding, we propose a hierarchical Bayesian model that borrows information from neighboring genes to improve the estimation of the expression level of a given gene and hence the detection of DE genes. Furthermore, we extend the model to account for the circular structure of E. coli chromosome and the intergenetic distance between gene neighbors. The simulation studies and analysis of real data examples in E. coli and yeast Saccharomyces cerevisiae show that the proposed method outperforms the commonly used significant analysis of microarray (SAM) t-statistic in detecting DE genes.

  2. Gene turnover and differential retention in the relaxin/insulin-like gene family in primates.

    PubMed

    Arroyo, José Ignacio; Hoffmann, Federico G; Opazo, Juan C

    2012-06-01

    The relaxin/insulin-like gene family is related to the insulin gene family, and includes two separate types of peptides: relaxins (RLNs) and insulin-like peptides (INSLs) that perform a variety of physiological roles including testicular descent, growth and differentiation of the mammary glands, trophoblast development, and cell differentiation. In vertebrates, these genes are found on three separate genomic loci, and in mammals, variation in the number and nature of genes in this family is mostly restricted to the Relaxin Family Locus B. For example, this locus contains a single copy of RLN in platypus and opossum, whereas it contains copies of the INSL6, INSL4, RLN2 and RLN1 genes in human and chimp. The main objective of this research is to characterize changes in the size and membership composition of the RLN/INSL gene family in primates, reconstruct the history of the RLN/INSL genes of primates, and test competing evolutionary scenarios regarding the origin of INSL4 and of the duplicated copies of the RLN gene of apes. Our results show that the relaxin/INSL-like gene family of primates has had a more dynamic evolutionary history than previously thought, including several examples of gene duplications and losses which are consistent with the predictions of the birth-and-death model of gene family evolution. In particular, we found that the differential retention of relatively old paralogs played a key role in shaping the gene complement of this family in primates. Two examples of this phenomenon are the origin of the INSL4 gene of catarrhines (the group that includes Old World monkeys and apes), and of the duplicate RLN1 and RLN2 paralogs of apes. In the case of INSL4, comparative genomics and phylogenetic analyses indicate that the origin of this gene, which was thought to represent a catarrhine-specific evolutionary innovation, is as old as the split between carnivores and primates, which took place approximately 97 million years ago. In addition, in the case

  3. Characteristic Changes in Cell Surface Glycosylation Accompany Intestinal Epithelial Cell (IEC) Differentiation: High Mannose Structures Dominate the Cell Surface Glycome of Undifferentiated Enterocytes.

    PubMed

    Park, Dayoung; Brune, Kristin A; Mitra, Anupam; Marusina, Alina I; Maverakis, Emanual; Lebrilla, Carlito B

    2015-11-01

    Changes in cell surface glycosylation occur during the development and differentiation of cells and have been widely correlated with the progression of several diseases. Because of their structural diversity and sensitivity to intra- and extracellular conditions, glycans are an indispensable tool for analyzing cellular transformations. Glycans present on the surface of intestinal epithelial cells (IEC) mediate interactions with billions of native microorganisms, which continuously populate the mammalian gut. A distinct feature of IECs is that they differentiate as they migrate upwards from the crypt base to the villus tip. In this study, nano-LC/ESI QTOF MS profiling was used to characterize the changes in glycosylation that correspond to Caco-2 cell differentiation. As Caco-2 cells differentiate to form a brush border membrane, a decrease in high mannose type glycans and a concurrent increase in fucosylated and sialylated complex/hybrid type glycans were observed. At day 21, when cells appear to be completely differentiated, remodeling of the cell surface glycome ceases. Differential expression of glycans during IEC maturation appears to play a key functional role in regulating the membrane-associated hydrolases and contributes to the mucosal surface innate defense mechanisms. Developing methodologies to rapidly identify changes in IEC surface glycans may lead to a rapid screening approach for a variety of disease states affecting the GI tract.

  4. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  5. Pheromone-regulated genes required for yeast mating differentiation.

    PubMed

    Erdman, S; Lin, L; Malczynski, M; Snyder, M

    1998-02-09

    Yeast cells mate by an inducible pathway that involves agglutination, mating projection formation, cell fusion, and nuclear fusion. To obtain insight into the mating differentiation of Saccharomyces cerevisiae, we carried out a large-scale transposon tagging screen to identify genes whose expression is regulated by mating pheromone. 91,200 transformants containing random lacZ insertions were screened for beta-galactosidase (beta-gal) expression in the presence and absence of alpha factor, and 189 strains containing pheromone-regulated lacZ insertions were identified. Transposon insertion alleles corresponding to 20 genes that are novel or had not previously been known to be pheromone regulated were examined for effects on the mating process. Mutations in four novel genes, FIG1, FIG2, KAR5/ FIG3, and FIG4 were found to cause mating defects. Three of the proteins encoded by these genes, Fig1p, Fig2p, and Fig4p, are dispensible for cell polarization in uniform concentrations of mating pheromone, but are required for normal cell polarization in mating mixtures, conditions that involve cell-cell communication. Fig1p and Fig2p are also important for cell fusion and conjugation bridge shape, respectively. The fourth protein, Kar5p/Fig3p, is required for nuclear fusion. Fig1p and Fig2p are likely to act at the cell surface as Fig1:: beta-gal and Fig2::beta-gal fusion proteins localize to the periphery of mating cells. Fig4p is a member of a family of eukaryotic proteins that contain a domain homologous to the yeast Sac1p. Our results indicate that a variety of novel genes are expressed specifically during mating differentiation to mediate proper cell morphogenesis, cell fusion, and other steps of the mating process.

  6. Hybrid weakness in a rice interspecific hybrid is nitrogen-dependent, and accompanied by changes in gene expression at both total transcript level and parental allele partitioning

    PubMed Central

    Lin, Xiuyun; Wang, Jie; Yu, Jiamiao; Sun, Yue; Miao, Yiling; Li, Qiuping; Sanguinet, Karen A.; Liu, Bao

    2017-01-01

    Background Hybrid weakness, a phenomenon opposite to heterosis, refers to inferior growth and development in a hybrid relative to its pure-line parents. Little attention has been paid to the phenomenological or mechanistic aspect of hybrid weakness, probably due to its rare occurrence. Methodology/Principal findings Here, using a set of interspecific triploid F1 hybrids between Oryza sativa, ssp. japonica (genome AA) and a tetraploid wild rice species, O. alta (genome, CCDD), we investigated the phenotypic and physiological differences between the F1 hybrids and their parents under normal and nitrogen-limiting conditions. We quantified the expression levels of 21 key genes involved in three important pathways pertinent to the assayed phenotypic and physiological traits by real-time qRT-PCR. Further, we assayed expression partitioning of parental alleles for eight genes in the F1 hybrids relative to the in silico “hybrids” (parental cDNA mixture) under both normal and N-limiting conditions by using locus-specific cDNA pyrosequencing. Conclusions/Significance We report that the F1 hybrids showed weakness in several phenotypic traits at the final seedling-stage compared with their corresponding mid-parent values (MPVs). Nine of the 21 studied genes showed contrasted expression levels between hybrids and parents (MPVs) under normal vs. N-limiting conditions. Interestingly, under N-limiting conditions, the overtly enhanced partitioning of maternal allele expression in the hybrids for eight assayed genes echo their attenuated hybrid weakness in phenotypes, an observation further bolstered by more resemblance of hybrids to the maternal parent under N-limiting conditions compared to normal conditions in a suite of measured physiological traits. Our observations suggest that both overall expression level and differential partitioning of parental alleles of critical genes contribute to condition-specific hybrid weakness. PMID:28248994

  7. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  8. Profiling of differentially expressed genes in haemophilia A with inhibitor.

    PubMed

    Hwang, S H; Lim, J A; Kim, M J; Kim, H C; Lee, H W; Yoo, K Y; You, C W; Lee, K S; Kim, H S

    2012-05-01

    Inhibitor development is the most significant complication in the therapy of haemophilia A (HA) patients. In spite of many studies, not much is known regarding the mechanism underlying inhibitor development. To understand the mechanism, we analysed profiles of differentially expressed genes (DEGs) between inhibitor and non-inhibitor HA via a microarray technique. Twenty unrelated Korean HAs were studied: 11 were non-inhibitor and nine were HA with inhibitor (≥5 BU mL(-1)). Microarray analysis was conducted using a Human Ref-8 expression Beadchip system (Illumina) and the data were analysed using Beadstudio software. We identified 545 DEGs in inhibitor HA as compared with the non-inhibitor patients; 384 genes were up-regulated and 161 genes were down-regulated. Among them, 75 genes whose expressions were altered by at least two-fold (>+2 or <-2) were selected and classified via the PANTHER classification method. The expressions of signal transduction and immunity-related genes differed significantly in the two groups. For validation of the DEGs, semi-quantitative RT-PCR (semi-qRT-PCR) was conducted with the six selected DEGs. The results corresponded to the microarray data, with the exception of one gene. We also examined the expression of the genes associated with the antigen presentation process via real-time PCR. The average levels of IL10, CTLA4 and TNFα slightly reduced, whereas that of IFNγ increased in the inhibitor HA group. We are currently unable to explain whether this phenomenon is a function of the inhibitor-inducing factor or is an epiphenomenon of antibody production. Nevertheless, our results provide a possible explanation for inhibitor development.

  9. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  10. Density based pruning for identification of differentially expressed genes from microarray data

    PubMed Central

    2010-01-01

    Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning) is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO) with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website http://mleg.cse.sc.edu/degprune PMID:21047384

  11. Molecular cloning and characterization of the obg gene of Streptomyces griseus in relation to the onset of morphological differentiation.

    PubMed Central

    Okamoto, S; Itoh, M; Ochi, K

    1997-01-01

    Morphological differentiation in microorganisms is usually accompanied by a decrease in intracellular GTP pool size, as has been demonstrated in bacillaceae, streptomycetaceae, and yeasts. The obg gene, which codes for a GTP-binding protein belonging to the GTPase superfamily of proteins, was cloned from Streptomyces griseus IFO13189. The gene is located just downstream of the genes for ribosomal proteins L21 and L27, encoded a protein of 478 amino acids (51 kDa), and possessed three consensus motifs which confer GTP-binding ability; Obg protein expressed in Escherichia coli bound GTP, as demonstrated using a UV cross-linking method. Introduction of multiple copies of obg into wild-type S. griseus suppressed aerial mycelium development in cells on solid media. However, no effect on streptomycin production was detected, indicating that Obg is involved in the regulation of the onset of morphological but not physiological differentiation. Multiple copies of obg also suppressed submerged spore formation in liquid culture. Southern hybridization studies indicated that genes homologous to obg exist widely in streptomycetes, and an obg homolog was successfully cloned from S. coelicolor A3(2). We propose that by monitoring the intracellular GTP pool size, the Obg protein is involved in sensing changes in the nutritional environment leading ultimately to morphological differentiation. PMID:8981995

  12. Integrated analysis of differentially expressed genes in breast cancer pathogenesis

    PubMed Central

    CHEN, DAOBAO; YANG, HONGJIAN

    2015-01-01

    The present study aimed to detect the differences between breast cancer cells and normal breast cells, and investigate the potential pathogenetic mechanisms of breast cancer. The sample GSE9574 series was downloaded, and the microarray data was analyzed to identify differentially expressed genes (DEGs). Gene Ontology (GO) cluster analysis using the GO Enrichment Analysis Software Toolkit platform and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for DEGs was conducted using the Gene Set Analysis Toolkit V2. In addition, a protein-protein interaction (PPI) network was constructed, and target sites of potential transcription factors and potential microRNA (miRNA) molecules were screened. A total of 106 DEGs were identified in the current study. Based on these DEGs, a number of bio-pathways appear to be altered in breast cancer, including a number of signaling pathways and other disease-associated pathways, as indicated by KEGG pathway clustering analysis. ATF3, JUND, FOSB and JUNB were detected in the PPI network. Finally, the most significant potential target sites of transcription factors and miRNAs in breast cancer, which are important in the regulation of gene expression, were identified. The results indicated that miR-93, miR-302A, miR-302B, miR-302C, miR-302D, miR-372, miR-373, miR-520E and miR-520A were closely associated with the occurrence and development of breast cancer. Therefore, changes in the expression of these miRNAs may alter cell metabolism and trigger the development of breast cancer and its complications. PMID:26137106

  13. Inhibition of LINE-1 retrotransposon-encoded reverse transcriptase modulates the expression of cell differentiation genes in breast cancer cells.

    PubMed

    Patnala, Radhika; Lee, Sung-Hun; Dahlstrom, Jane E; Ohms, Stephen; Chen, Long; Dheen, S Thameem; Rangasamy, Danny

    2014-01-01

    Long Interspersed Elements (L1 elements) are biologically active retrotransposons that are capable of autonomous replication using their own reverse transcriptase (RT) enzyme. Expression of the normally repressed RT has been implicated in cancer cell growth. However, at present, little is known about the expression of L1-encoded RT activity or the molecular changes that are associated with RT activity in the development of breast cancer. Here, we report that RT activity is widespread in breast cancer cells. The expression of RT protein decreased markedly in breast cancer cells after treatment with the antiretroviral drug, efavirenz. While the majority of cells showed a significant reduction in proliferation, inhibition of RT was also accompanied by cell-specific differences in morphology. MCF7 cells displayed elongated microtubule extensions that adhered tightly to their substrate, while a large fraction of the T47D cells that we studied formed long filopodia projections. These morphological changes were reversible upon cessation of RT inhibition, confirming their dependence on RT activity. We also carried out gene expression profiling with microarrays and determined the genes that were differentially expressed during the process of cellular differentiation. Genes involved in proliferation, cell migration, and invasive activity were repressed in RT-inhibited cells. Concomitantly, genes involved in cell projection, formation of vacuolar membranes, and cell-to-cell junctions were significantly upregulated in RT-inhibited cells. qRT-PCR examination of the mRNA expression of these genes in additional cell lines yielded close correlation between their differential expression and the degree of cellular differentiation. Our study demonstrates that the inhibition of L1-encoded RT can reduce the rate of proliferation and promote differentiation of breast cancer cells. Together, these results provide a direct functional link between the expression of L1 retrotransposons and

  14. Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

    SciTech Connect

    Sternberg, E.A.; Spizz, G.; Perry, W.M.; Vizard, D.; Weil, T.; Olson, E.N.

    1988-07-01

    Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

  15. Population differentiation and behavioural association of the two 'personality' genes DRD4 and SERT in dunnocks (Prunella modularis).

    PubMed

    Holtmann, B; Grosser, S; Lagisz, M; Johnson, S L; Santos, E S A; Lara, C E; Robertson, B C; Nakagawa, S

    2016-02-01

    Quantifying the variation in behaviour-related genes within and between populations provides insight into how evolutionary processes shape consistent behavioural traits (i.e. personality). Deliberate introductions of non-native species offer opportunities to investigate how such genes differ between native and introduced populations and how polymorphisms in the genes are related to variation in behaviour. Here, we compared the genetic variation of the two 'personality' genes, DRD4 and SERT, between a native (United Kingdom, UK) and an introduced (New Zealand, NZ) population of dunnocks, Prunella modularis. The NZ population showed a significantly lower number of single nucleotide polymorphisms (SNPs) compared to the UK population. Standardized F'st estimates of the personality genes and neutral microsatellites indicate that selection (anthropogenic and natural) probably occurred during and post the introduction event. Notably, the largest genetic differentiation was found in the intronic regions of the genes. In the NZ population, we also examined the association between polymorphisms in DRD4 and SERT and two highly repeatable behavioural traits: flight-initiation distance and mating status (promiscuous females and cobreeding males). We found 38 significant associations (for different allele effect models) between the two behavioural traits and the studied genes. Further, 22 of the tested associations showed antagonistic allele effects for males and females. Our findings illustrate how introduction events and accompanying ecological changes could influence the genetic diversity of behaviour-related genes.

  16. Identification of suitable reference genes for quantitative gene expression analysis in rat adipose stromal cells induced to trilineage differentiation.

    PubMed

    Santos, Bruno Paiva Dos; da Costa Diesel, Luciana Fraga; da Silva Meirelles, Lindolfo; Nardi, Nance Beyer; Camassola, Melissa

    2016-12-15

    This study was designed to (i) identify stable reference genes for the analysis of gene expression during in vitro differentiation of rat adipose stromal cells (rASCs), (ii) recommend stable genes for individual treatment conditions, and (iii) validate these genes by comparison with normalization results from stable and unstable reference genes. On the basis of a literature review, eight genes were selected: Actb, B2m, Hprt1, Ppia, Rplp0, Rpl13a, Rpl5, and Ywhaz. Genes were ranked according to their stability under different culture conditions as assessed using GenNorm, NormFinder, and RefFinder algorithms. Although the employed algorithms returned different rankings, the most frequently top-ranked genes were: B2m and/or Ppia for all 28day treatments (ALL28); Ppia and Hprt1 (adipogenic differentiation; A28), B2m (chondrogenic differentiation; C28), Rpl5 (controls maintained in complete culture medium; CCM), Rplp0 (osteogenic differentiation for 3days; O3), Rpl13a and Actb (osteogenic differentiation for 7days; O7), Rplp0 and Ppia (osteogenic differentiation for 14days; O14), Hprt1 and Ppia (osteogenic differentiation for 28days; O28), as well as Actb (all osteogenesis time points combined; ALLOSTEO). The obtained results indicate that the performance of reference genes depends on the differentiation protocol and on the analysis time, thus providing valuable information for the design of RT-PCR experiments.

  17. Differentially expressed genes and gene networks involved in pig ovarian follicular atresia.

    PubMed

    Terenina, Elena; Fabre, Stephane; Bonnet, Agnès; Monniaux, Danielle; Robert-Granié, Christèle; SanCristobal, Magali; Sarry, Julien; Vignoles, Florence; Gondret, Florence; Monget, Philippe; Tosser-Klopp, Gwenola

    2017-02-01

    Ovarian folliculogenesis corresponds to the development of follicles leading to either ovulation or degeneration, this latter process being called atresia. Even if atresia involves apoptosis, its mechanism is not well understood. The objective of this study was to analyze global gene expression in pig granulosa cells of ovarian follicles during atresia. The transcriptome analysis was performed on a 9,216 cDNA microarray to identify gene networks and candidate genes involved in pig ovarian follicular atresia. We found 1,684 significantly regulated genes to be differentially regulated between small healthy follicles and small atretic follicles. Among them, 287 genes had a fold-change higher than two between the two follicle groups. Eleven genes (DKK3, GADD45A, CAMTA2, CCDC80, DAPK2, ECSIT, MSMB, NUPR1, RUNX2, SAMD4A, and ZNF628) having a fold-change higher than five between groups could likely serve as markers of follicular atresia. Moreover, automatic confrontation of deregulated genes with literature data highlighted 93 genes as regulatory candidates of pig granulosa cell atresia. Among these genes known to be inhibitors of apoptosis, stimulators of apoptosis, or tumor suppressors INHBB, HNF4, CLU, different interleukins (IL5, IL24), TNF-associated receptor (TNFR1), and cytochrome-c oxidase (COX) were suggested as playing an important role in porcine atresia. The present study also enlists key upstream regulators in follicle atresia based on our results and on a literature review. The novel gene candidates and gene networks identified in the current study lead to a better understanding of the molecular regulation of ovarian follicular atresia.

  18. Differential transformation of mammary epithelial cells by Wnt genes.

    PubMed Central

    Wong, G T; Gavin, B J; McMahon, A P

    1994-01-01

    The mouse Wnt family includes at least 10 genes that encode structurally related secreted glycoproteins. Wnt-1 and Wnt-3 were originally identified as oncogenes activated by the insertion of mouse mammary tumor virus in virus-induced mammary adenocarcinomas, although they are not expressed in the normal mammary gland. However, five other Wnt genes are differentially expressed during development of adult mammary tissue, suggesting that they may play distinct roles in various phases of mammary gland growth and development. Induction of transformation by Wnt-1 and Wnt-3 may be due to interference with these normal regulatory events; however, there is no direct evidence for this hypothesis. We have tested Wnt family members for the ability to induce transformation of cultured mammary cells. The results demonstrate that the Wnt gene family can be divided into three groups depending on their ability to induce morphological transformation and altered growth characteristics of the C57MG mammary epithelial cell line. Wnt-1, Wnt-3A, and Wnt-7A were highly transforming and induced colonies which formed and shed balls of cells. Wnt-2, Wnt-5B, and Wnt-7B also induced transformation but with a lower frequency and an apparent decrease in saturation density. In contrast, Wnt-6 and two other family members which are normally expressed in C57MG cells, Wnt-4 and Wnt-5A, failed to induce transformation. These data demonstrate that the Wnt genes have distinct effects on cell growth and should not be regarded as functionally equivalent. Images PMID:8065359

  19. Differential hormonal and gene expression dynamics in two inbred sunflower lines with contrasting dormancy level.

    PubMed

    Roselló, Paula L; Vigliocco, Ana E; Andrade, Andrea M; Riera, Natalí V; Calafat, Mario; Molas, María L; Alemano, Sergio G

    2016-05-01

    Seed germination and dormancy are tightly regulated by hormone metabolism and signaling pathway. We investigated the endogenous content of abscisic acid (ABA), its catabolites, and gibberellins (GAs), as well as the expression level of certain ABA and GAs metabolic and signaling genes in embryo of dry and imbibed cypselas of inbred sunflower (Helianthus annuus L., Asteraceae) lines: B123 (dormant) and B91 (non-dormant). Under our experimental conditions, the expression of RGL2 gene might be related to the ABA peak in B123 line at 3 h of imbibition. Indeed, RGL2 transcripts are absent in dry and early embedded cypselas of the non-dormant line B91. ABA increase was accompanied by a significant ABA-Glucosyl ester (ABA-GE) and phaseic acid (PA) (two ABA catabolites) decrease in B123 line (3 h) which indicates that ABA metabolism seems to be more active in this line, and that it would be involved in the imposition and maintenance of sunflower seed dormancy, as it has been reported for many species. Finally, an increase of bioactive GAs (GA1 and GA3) occurs at 12 h of imbibition in both lines after a decrease in ABA content. This study shows the first report about the RGL2 tissue-specific gene expression in sunflower inbred lines with contrasting dormancy level. Furthermore, our results provide evidence that ABA and GAs content and differential expression of metabolism and signaling genes would be interacting in seed dormancy regulation through a mechanism of action related to embryo itself.

  20. CT gene modulate differential expression of chitinase gene under variant habitats in Vibrio cholerae

    PubMed Central

    Verma, Yogendra Kumar; Verma, Mahendra Kumar

    2013-01-01

    Objective To investigate the interrelation of cholera toxin gene (CT gene) in expression of chitinase gene under different pH conditions among pathogenic and Non-pathogenic strains of Vibrio cholera (V. cholera). Methods The chitinase assay well diffusion method and calorimetric chitinase assay were performed. Further, time depended chitinase activity among pathogenic and nonpathogenic strain was evaluated with control as Escherichia coli. The expressed protein in variant environment was purified by cascade of chromatographic techniques. The partially purified protein was analyzed by SDS-PAGE in both the strain of V. cholera. Results The results have shown differential expression of chitinase gene among vibrio in time depended chitinase activity, purification of expressed protein and SDS-PAGE analysis. Conclusions From the current study, two conclusions came in picture, habitat is prime factor that regulation of chitin gene expression among many bacterial strains, second, moreover among the vibrio pathogenic strains (CT+) expression of chitinase gene is more precisely regulated by CT gene rather than external environments while in non-pathogenic strain ( CT-) completely absent.

  1. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  2. Identification of differentially expressed protective genes in liver of two rainbow trout strains.

    PubMed

    Rebl, Alexander; Verleih, Marieke; Korytář, Thomáš; Kühn, Carsten; Wimmers, Klaus; Köllner, Bernd; Goldammer, Tom

    2012-01-15

    Since 1975, the rainbow trout strain BORN (Germany) has been bred in brackish water from a coastal form imported from Denmark. Accompanying phenotypic monitoring of the adapted BORN trout until now revealed that this selection strain manifested a generally elevated resistance towards high stress and pathogenic challenge including lower susceptibility towards Aeromonas salmonicida infections in comparison to other trout strains in local aqua farms. We focus on the elucidation of both, genetic background and immunological basis for the increased survivorship to infections. A first comparison of gene expression profiles in liver tissue of healthy rainbow trout from the local selection strain BORN and imported trout using a GRASP 16K cDNA microarray revealed six differentially expressed genes evoking pathogen and wounding responses, LEAP2A (encoding for liver-expressed antimicrobial peptide), SERPINA1 (alpha-1 antitrypsin), FTH1 (middle subunit of ferritin), FGL2 (fibroleukin), CLEC4E (macrophage-inducible C-type lectin), and SERPINF2 (alpha-2 antiplasmin). Since the latter gene is not described in salmonid species so far, our first aim was to characterize the respective sequence in rainbow trout. Two trout SERPINF2 genes were identified, which share only 48% identical amino acid residues and a characteristic SERPIN domain. Second, we aimed to analyse the expression of those genes after temperature challenge (8 °C and 23 °C). Only FTH1 was upregulated in BORN and import trout after increase of temperature, while SERPINA1 and FGL2 were only elevated in import trout. Third, the expression of all named genes was analyzed after pathogen challenge with A. salmonicida subsp. salmonicida. As a main finding, we detected a comparably faster regeneration of LEAP2A mRNA abundance in BORN trout following bacterial infection. Ingenuity Pathways Analysis suggested a functional interplay among the mentioned factors and the pro-inflammatory cytokine TNF, whose stronger expression

  3. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia.

    PubMed

    Ge, Yubin; Dombkowski, Alan A; LaFiura, Katherine M; Tatman, Dana; Yedidi, Ravikiran S; Stout, Mark L; Buck, Steven A; Massey, Gita; Becton, David L; Weinstein, Howard J; Ravindranath, Yaddanapudi; Matherly, Larry H; Taub, Jeffrey W

    2006-02-15

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins.

  4. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae).

    PubMed

    Behringer, David; Zimmermann, Heike; Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings.

  5. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae)

    PubMed Central

    Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings. PMID:25924061

  6. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia

    PubMed Central

    Ge, Yubin; Dombkowski, Alan A.; LaFiura, Katherine M.; Tatman, Dana; Yedidi, Ravikiran S.; Stout, Mark L.; Buck, Steven A.; Massey, Gita; Becton, David L.; Weinstein, Howard J.; Ravindranath, Yaddanapudi; Matherly, Larry H.; Taub, Jeffrey W.

    2006-01-01

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins. PMID:16249385

  7. Gene duplication, population genomics, and species-level differentiation within a tropical mountain shrub.

    PubMed

    Mastretta-Yanes, Alicia; Zamudio, Sergio; Jorgensen, Tove H; Arrigo, Nils; Alvarez, Nadir; Piñero, Daniel; Emerson, Brent C

    2014-09-14

    Gene duplication leads to paralogy, which complicates the de novo assembly of genotyping-by-sequencing (GBS) data. The issue of paralogous genes is exacerbated in plants, because they are particularly prone to gene duplication events. Paralogs are normally filtered from GBS data before undertaking population genomics or phylogenetic analyses. However, gene duplication plays an important role in the functional diversification of genes and it can also lead to the formation of postzygotic barriers. Using populations and closely related species of a tropical mountain shrub, we examine 1) the genomic differentiation produced by putative orthologs, and 2) the distribution of recent gene duplication among lineages and geography. We find high differentiation among populations from isolated mountain peaks and species-level differentiation within what is morphologically described as a single species. The inferred distribution of paralogs among populations is congruent with taxonomy and shows that GBS could be used to examine recent gene duplication as a source of genomic differentiation of nonmodel species.

  8. DiGeorge syndrome gene tbx1 functions through wnt11r to regulate heart looping and differentiation.

    PubMed

    Choudhry, Priya; Trede, Nikolaus S

    2013-01-01

    DiGeorge syndrome (DGS) is the most common microdeletion syndrome, and is characterized by congenital cardiac, craniofacial and immune system abnormalities. The cardiac defects in DGS patients include conotruncal and ventricular septal defects. Although the etiology of DGS is critically regulated by TBX1 gene, the molecular pathways underpinning TBX1's role in heart development are not fully understood. In this study, we characterized heart defects and downstream signaling in the zebrafish tbx1(-/-) mutant, which has craniofacial and immune defects similar to DGS patients. We show that tbx1(-/-) mutants have defective heart looping, morphology and function. Defective heart looping is accompanied by failure of cardiomyocytes to differentiate normally and failure to change shape from isotropic to anisotropic morphology in the outer curvatures of the heart. This is the first demonstration of tbx1's role in regulating heart looping, cardiomyocyte shape and differentiation, and may explain how Tbx1 regulates conotruncal development in humans. Next we elucidated tbx1's molecular signaling pathway guided by the cardiac phenotype of tbx1(-/-) mutants. We show for the first time that wnt11r (wnt11 related), a member of the non-canonical Wnt pathway, and its downstream effector gene alcama (activated leukocyte cell adhesion molecule a) regulate heart looping and differentiation similarly to tbx1. Expression of both wnt11r and alcama are downregulated in tbx1(-/-) mutants. In addition, both wnt11r (-/-) mutants and alcama morphants have heart looping and differentiation defects similar to tbx1(-/-) mutants. Strikingly, heart looping and differentiation in tbx1(-/-) mutants can be partially rescued by ectopic expression of wnt11r or alcama, supporting a model whereby heart looping and differentiation are regulated by tbx1 in a linear pathway through wnt11r and alcama. This is the first study linking tbx1 and non-canonical Wnt signaling and extends our understanding of DGS and

  9. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells

    PubMed Central

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji

    2016-01-01

    Abstract Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines. PMID:27733097

  10. Validation and Interrogation of Differentially Expressed and Alternatively Spliced Genes in African-American Prostate Cancer

    DTIC Science & Technology

    2015-10-01

    RNA and annotated. In addition, we have developed SSOs to manipulate PIK3CD alternative splicing, to correct aberrant splicing leading to production...molecular mechanisms, differential gene expression, alternative RNA splicing, epigenetic alterations, clinical tumor aggressiveness 16. SECURITY...words): Prostate cancer, health disparities among racial groups, molecular mechanisms, differential gene expression, alternative RNA splicing

  11. Widespread DNA hypomethylation and differential gene expression in Turner syndrome

    PubMed Central

    Trolle, Christian; Nielsen, Morten Muhlig; Skakkebæk, Anne; Lamy, Philippe; Vang, Søren; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Pedersen, Jakob Skou; Gravholt, Claus Højbjerg

    2016-01-01

    Adults with 45,X monosomy (Turner syndrome) reflect a surviving minority since more than 99% of fetuses with 45,X monosomy die in utero. In adulthood 45,X monosomy is associated with increased morbidity and mortality, although strikingly heterogeneous with some individuals left untouched while others suffer from cardiovascular disease, autoimmune disease and infertility. The present study investigates the leukocyte DNAmethylation profile by using the 450K-Illumina Infinium assay and the leukocyte RNA-expression profile in 45,X monosomy compared with karyotypically normal female and male controls. We present results illustrating that genome wide X-chromosome RNA-expression profile, autosomal DNA-methylation profile, and the X-chromosome methylation profile clearly distinguish Turner syndrome from controls. Our results reveal genome wide hypomethylation with most differentially methylated positions showing a medium level of methylation. Contrary to previous studies, applying a single loci specific analysis at well-defined DNA loci, our results indicate that the hypomethylation extend to repetitive elements. We describe novel candidate genes that could be involved in comorbidity in TS and explain congenital urinary malformations (PRKX), premature ovarian failure (KDM6A), and aortic aneurysm formation (ZFYVE9 and TIMP1). PMID:27687697

  12. Local differentiation in the presence of gene flow in the citril finch Serinus citrinella

    PubMed Central

    Senar, Juan Carlos; Borras, Antoni; Cabrera, Josep; Cabrera, Toni; Björklund, Mats

    2005-01-01

    It is well known theoretically that gene flow can impede genetic differentiation between populations. In this study, we show that in a highly mobile bird species, where dispersal is well documented, there is a strong genetic and morphological differentiation over a very short geographical scale (less than 5 km). Allocation tests revealed that birds caught in one area were assigned genetically to the same area with a very high probability, in spite of current gene flow. Populations were also morphologically differentiated. The results suggest that the relationship between gene flow and differentiation can be rather complicated and non-intuitive. PMID:17148333

  13. Characterization of Differentially Expressed Genes Involved in Pathways Associated with Gastric Cancer

    PubMed Central

    Li, Hao; Yu, Beiqin; Li, Jianfang; Su, Liping; Yan, Min; Zhang, Jun; Li, Chen; Zhu, Zhenggang; Liu, Bingya

    2015-01-01

    To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR) value was < 0.01, P-value was <0.01 and the fold change (FC) was >2. Subsequently, Gene Ontology (GO) categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease. PMID:25928635

  14. Gene expression kinetics in individual plasmodial cells reveal alternative programs of differential regulation during commitment and differentiation.

    PubMed

    Rätzel, Viktoria; Marwan, Wolfgang

    2015-05-26

    During its life cycle, the amoebozoon Physarum polycephalum forms multinucleate plasmodial cells that can grow to macroscopic size while maintaining a naturally synchronous population of nuclei. Sporulation-competent plasmodia were stimulated through photoactivation of the phytochrome photoreceptor and the expression of sporulation marker genes was analyzed quantitatively by repeatedly taking samples of the same plasmodial cell at successive time points after the stimulus pulse. Principal component analysis of the gene expression data revealed that plasmodial cells take different trajectories leading to cell fate decision and differentiation and suggested that averaging over individual cells is inappropriate. Queries for genes with pairwise correlated expression kinetics revealed qualitatively different patterns of co-regulation, indicating that alternative programs of differential regulation are operational in individual plasmodial cells. At the single cell level, the response to stimulation of a non-sporulating mutant was qualitatively different as compared to the wild type with respect to the differentially regulated genes and their patterns of co-regulation. The observation of individual differences during commitment and differentiation supports the concept of a Waddington-type quasipotential landscape for the regulatory control of cell differentiation. Comparison of wild type and sporulation mutant data further supports the idea that mutations may impact the topology of this landscape.

  15. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  16. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

    PubMed Central

    Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

  17. A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

    PubMed

    Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

  18. Fat accumulation in differentiated brown adipocytes is linked with expression of Hox genes.

    PubMed

    Singh, Smita; Rajput, Yudhishthir S; Barui, Amit K; Sharma, Rajan; Datta, Tirtha K

    2016-03-01

    Homeobox (Hox) genes are involved in body plan of embryo along the anterior-posterior axis. Presence of several Hox genes in white adipose tissue (WAT) and brown adipose tissue (BAT) is indicative of involvement of Hox genes in adipogenesis. We propose that differentiation inducing agents viz. isobutyl-methyl-xanthine (IBMX), indomethacin, dexamethasone (DEX), triiodothyronine (T3) and insulin may regulate differentiation in brown adipose tissue through Hox genes. In vitro culture of brown fat stromalvascular fraction (SVF) in presence or absence of differentiation inducing agents was used for establishing relationship between fat accumulation in differentiated adipocytes and expression of Hox genes. Relative expression of Pref1, UCP1 and Hox genes was determined in different stages of adipogenesis. Presence or absence of IBMX, indomethacin and DEX during differentiation of proliferated pre-adipocytes resulted in marked differences in expression of Hox genes and lipid accumulation. In presence of these inducing agents, lipid accumulation as well as expression of HoxA1, HoxA5, HoxC4 &HoxC8 markedly enhanced. Irrespective of presence or absence of T3, insulin down regulates HoxA10. T3 results in over expression of HoxA5, HoxC4 and HoxC8 genes, whereas insulin up regulates expression of only HoxC8. Findings suggest that accumulation of fat in differentiated adipocytes is linked with expression of Hox genes.

  19. Genomic Determinants of Gene Regulation by 1,25-Dihydroxyvitamin D3 during Osteoblast-lineage Cell Differentiation*♦

    PubMed Central

    Meyer, Mark B.; Benkusky, Nancy A.; Lee, Chang-Hun; Pike, J. Wesley

    2014-01-01

    The biological effects of 1α,25-dihydroxyvitamin D3 (1,25 (OH)2D3) on osteoblast differentiation and function differ significantly depending upon the cellular state of maturation. To explore this phenomenon mechanistically, we examined the impact of 1,25(OH)2D3 on the transcriptomes of both pre-osteoblastic (POBs) and differentiated osteoblastic (OBs) MC3T3-E1 cells, and assessed localization of the vitamin D receptor (VDR) at sites of action on a genome-scale using ChIP sequence analysis. We observed that the 1,25(OH)2D3-induced transcriptomes of POBs and OBs were quantitatively and qualitatively different, supporting not only the altered biology observed but the potential for a change in VDR interaction at the genome as well. This idea was confirmed through discovery that VDR cistromes in POBs and OBs were also strikingly different. Depletion of VDR-binding sites in OBs, due in part to reduced VDR expression, was the likely cause of the loss of VDR-target gene interaction. Continued novel regulation by 1,25(OH)2D3, however, suggested that factors in addition to the VDR might also be involved. Accordingly, we show that transcriptomic modifications are also accompanied by changes in genome binding of the master osteoblast regulator RUNX2 and the chromatin remodeler CCAAT/enhancer-binding protein β. Importantly, genome occupancy was also highlighted by the presence of epigenetic enhancer signatures that were selectively changed in response to both differentiation and 1,25(OH)2D3. The impact of VDR, RUNX2, and C/EBPβ on osteoblast differentiation is exemplified by their actions at the Runx2 and Sp7 gene loci. We conclude that each of these mechanisms may contribute to the diverse actions of 1,25(OH)2D3 on differentiating osteoblasts. PMID:24891508

  20. A Model-Based Joint Identification of Differentially Expressed Genes and Phenotype-Associated Genes

    PubMed Central

    Seo, Minseok; Shin, Su-kyung; Kwon, Eun-Young; Kim, Sung-Eun; Bae, Yun-Jung; Lee, Seungyeoun; Sung, Mi-Kyung; Choi, Myung-Sook; Park, Taesung

    2016-01-01

    Over the last decade, many analytical methods and tools have been developed for microarray data. The detection of differentially expressed genes (DEGs) among different treatment groups is often a primary purpose of microarray data analysis. In addition, association studies investigating the relationship between genes and a phenotype of interest such as survival time are also popular in microarray data analysis. Phenotype association analysis provides a list of phenotype-associated genes (PAGs). However, it is sometimes necessary to identify genes that are both DEGs and PAGs. We consider the joint identification of DEGs and PAGs in microarray data analyses. The first approach we used was a naïve approach that detects DEGs and PAGs separately and then identifies the genes in an intersection of the list of PAGs and DEGs. The second approach we considered was a hierarchical approach that detects DEGs first and then chooses PAGs from among the DEGs or vice versa. In this study, we propose a new model-based approach for the joint identification of DEGs and PAGs. Unlike the previous two-step approaches, the proposed method identifies genes simultaneously that are DEGs and PAGs. This method uses standard regression models but adopts different null hypothesis from ordinary regression models, which allows us to perform joint identification in one-step. The proposed model-based methods were evaluated using experimental data and simulation studies. The proposed methods were used to analyze a microarray experiment in which the main interest lies in detecting genes that are both DEGs and PAGs, where DEGs are identified between two diet groups and PAGs are associated with four phenotypes reflecting the expression of leptin, adiponectin, insulin-like growth factor 1, and insulin. Model-based approaches provided a larger number of genes, which are both DEGs and PAGs, than other methods. Simulation studies showed that they have more power than other methods. Through analysis of

  1. Identification of differentially expressed genes induced by beet curly top virus infection in sugarbeet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to beet curly top virus (BCTV) trait is crucial in Western USA. There is sparse public knowledge of genes regulating resistance. This research focused on gene expression profiling of resistance to the three BCTV strains: Cal/Logan (Cal), Worland (Wor), and severe. Differential gene exp...

  2. Differential expression of genes related to gain and intake in the liver of beef cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: To better understand which genes play a role in cattle feed intake and gain, we evaluated differential expression of genes related to gain and intake in the liver of crossbred beef steers. Based on past transcriptomics studies on cattle liver, we hypothesized that genes related to metabo...

  3. Melanoma differentiation associated gene-7 (mda-7): a novel anti-tumor gene for cancer gene therapy.

    PubMed Central

    Mhashilkar, A. M.; Schrock, R. D.; Hindi, M.; Liao, J.; Sieger, K.; Kourouma, F.; Zou-Yang, X. H.; Onishi, E.; Takh, O.; Vedvick, T. S.; Fanger, G.; Stewart, L.; Watson, G. J.; Snary, D.; Fisher, P. B.; Saeki, T.; Roth, J. A.; Ramesh, R.; Chada, S.

    2001-01-01

    BACKGROUND: The mda-7 gene (melanoma differentiation associated gene-7) is a novel tumor suppressor gene. The anti-proliferative activity of MDA-7 has been previously reported. In this report, we analyze the anti-tumor efficacy of Ad-mda7 in a broad spectrum of cancer lines. MATERIALS AND METHODS: Ad-mda7-transduced cancer or normal cell lines were assayed for cell proliferation (tritiated thymidine incorporation assay, Alamar blue assay, and trypan-blue exclusion assay), apoptosis (TUNEL, and Annexin V staining visualized by fluorescent microscopy or FACs analysis), and cell cycle regulation (Propidium Iodide staining and FACs analysis). RESULTS: Ad-mda7 treatment of tumor cells resulted in growth inhibition and apoptosis in a temporal and dose-dependent manner. The anti-tumor effects were independent of the genomic status of p53, RB, p16, ras, bax, and caspase 3 in these cells. In addition, normal cell lines did not show inhibition of proliferation or apoptotic response to Ad-mda7. Moreover, Ad-mda7-transduced cancer cells secreted a soluble form of MDA-7 protein. Thus, Ad-mda7 may represent a novel gene-therapeutic agent for the treatment of a variety of cancers. CONCLUSIONS: The potent and selective killing activity of Ad-mda7 in cancer cells but not in normal cells makes this vector a potential candidate for cancer gene therapy. PMID:11471572

  4. Comprehensive Gene Expression Analysis of Human Embryonic Stem Cells during Differentiation into Neural Cells

    PubMed Central

    Fathi, Ali; Hatami, Maryam; Hajihosseini, Vahid; Fattahi, Faranak; Kiani, Sahar; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

    2011-01-01

    Global gene expression analysis of human embryonic stem cells (hESCs) that differentiate into neural cells would help to further define the molecular mechanisms involved in neurogenesis in humans. We performed a comprehensive transcripteome analysis of hESC differentiation at three different stages: early neural differentiation, neural ectoderm, and differentiated neurons. We identified and validated time-dependent gene expression patterns and showed that the gene expression patterns reflect early ESC differentiation. Sets of genes are induced in primary ectodermal lineages and then in differentiated neurons, constituting consecutive waves of known and novel genes. Pathway analysis revealed dynamic expression patterns of members of several signaling pathways, including NOTCH, mTOR and Toll like receptors (TLR), during neural differentiation. An interaction network analysis revealed that the TGFβ family of genes, including LEFTY1, ID1 and ID2, are possible key players in the proliferation and maintenance of neural ectoderm. Collectively, these results enhance our understanding of the molecular dynamics underlying neural commitment and differentiation. PMID:21829537

  5. Differentially correlated genes in co-expression networks control phenotype transitions

    PubMed Central

    Thomas, Lina D.; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Background: Co-expression networks are a tool widely used for analysis of “Big Data” in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as “bottlenecks” rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we

  6. Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes

    PubMed Central

    Premzl, Marko

    2015-01-01

    Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed. PMID:25941635

  7. Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes.

    PubMed

    Premzl, Marko

    2015-06-01

    Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed.

  8. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  9. Differential replication dynamics for large and small Vibrio chromosomes affect gene dosage, expression and location

    PubMed Central

    Dryselius, Rikard; Izutsu, Kaori; Honda, Takeshi; Iida, Tetsuya

    2008-01-01

    Background Replication of bacterial chromosomes increases copy numbers of genes located near origins of replication relative to genes located near termini. Such differential gene dosage depends on replication rate, doubling time and chromosome size. Although little explored, differential gene dosage may influence both gene expression and location. For vibrios, a diverse family of fast growing gammaproteobacteria, gene dosage may be particularly important as they harbor two chromosomes of different size. Results Here we examined replication dynamics and gene dosage effects for the separate chromosomes of three Vibrio species. We also investigated locations for specific gene types within the genome. The results showed consistently larger gene dosage differences for the large chromosome which also initiated replication long before the small. Accordingly, large chromosome gene expression levels were generally higher and showed an influence from gene dosage. This was reflected by a higher abundance of growth essential and growth contributing genes of which many locate near the origin of replication. In contrast, small chromosome gene expression levels were low and appeared independent of gene dosage. Also, species specific genes are highly abundant and an over-representation of genes involved in transcription could explain its gene dosage independent expression. Conclusion Here we establish a link between replication dynamics and differential gene dosage on one hand and gene expression levels and the location of specific gene types on the other. For vibrios, this relationship appears connected to a polarisation of genetic content between its chromosomes, which may both contribute to and be enhanced by an improved adaptive capacity. PMID:19032792

  10. Comparative Transcriptomic Analyses of Differentially Expressed Genes in Transgenic Melatonin Biosynthesis Ovine HIOMT Gene in Switchgrass

    PubMed Central

    Yuan, Shan; Guan, Cong; Liu, Sijia; Huang, Yanhua; Tian, Danyang; Cui, Xin; Zhang, Yunwei; Yang, Fuyu

    2016-01-01

    Melatonin serves pleiotropic functions in prompting plant growth and resistance to various stresses. The accurate biosynthetic pathway of melatonin remains elusive in plant species, while the N-acetyltransferase and O-methyltransferase were considered to be the last two key enzymes during its biosynthesis. To investigate the biosynthesis and metabolic pathway of melatonin in plants, the RNA-seq profile of overexpression of the ovine HIOMT was analyzed and compared with the previous transcriptome of transgenic oAANAT gene in switchgrass, a model plant for cellulosic ethanol production. A total of 946, 405, and 807 differentially expressed unigenes were observed in AANAT vs. control, HIOMT vs. control, and AANAT vs. HIOMT, respectively. Two hundred and seventy-five upregulated and 130 downregulated unigenes were detected in transgenic oHIOMT line comparing with control, including the significantly upregulated (F-box/kelch-repeat protein, zinc finger BED domain-containing protein-3) genes, which were potentially correlated with enhanced phenotypes of shoot, stem and root growth in transgenic oHIOMT switchgrass. Several stress resistant related genes (SPX domain-containing membrane protein, copper transporter 1, late blight resistance protein homolog R1A-6 OS etc.) were specifically and significantly upregulated in transgenic oHIOMT only, while metabolism-related genes (phenylalanine-4-hydroxylase, tyrosine decarboxylase 1, protein disulfide-isomerase and galactinol synthase 2 etc.) were significantly upregulated in transgenic oAANAT only. These results provide new sights into the biosynthetic and physiological functional networks of melatonin in plants. PMID:27877177

  11. Viral oncogenes, proto-oncogenes and homoeotic genes related to cell proliferation and differentiation.

    PubMed

    Antohi, S; Antohi-Talle, O

    1987-01-01

    Molecular studies on viral oncogenes and their products have led to the discovery of physiological proto-oncogenes, involved in the control of cell proliferation and gene activation. Other genetic and molecular investigations, initiated in Drosophila melanogaster and continued in different multicellular eukaryotes, have made evident the homoeotic genes, which are directly correlated with cell specialization, in the complex processes of differentiation and morphogenesis. Both gene classes are conserved to a high extent during evolution. They are involved in the eukaryotic mechanisms of differentiation control and proto-oncogenes, in particular, are related to malignant transformation. Some available data suggest a certain extent of relatedness between the gene products of both gene classes. A differentiation trigger model, including retroviral transposition, homoeotic genes and proto-oncogenes is discussed.

  12. A role for the Drosophila neurogenic genes in mesoderm differentiation.

    PubMed

    Corbin, V; Michelson, A M; Abmayr, S M; Neel, V; Alcamo, E; Maniatis, T; Young, M W

    1991-10-18

    The neurogenic genes of Drosophila have long been known to regulate cell fate decisions in the developing ectoderm. In this paper we show that these genes also control mesoderm development. Embryonic cells that express the muscle-specific gene nautilus are overproduced in each of seven neurogenic mutants (Notch, Delta, Enhancer of split, big brain, mastermind, neuralized, and almondex), at the apparent expense of neighboring, nonexpressing mesodermal cells. The mesodermal defect does not appear to be a simple consequence of associated neural hypertrophy, suggesting that the neurogenic genes may function similarly and independently in establishing cell fates in both ectoderm and mesoderm. Altered patterns of beta 3-tubulin and myosin heavy chain gene expression in the mutants indicate a role for the neurogenic genes in development of most visceral and somatic muscles. We propose that the signal produced by the neurogenic genes is a general one, effective in both ectoderm and mesoderm.

  13. Six family genes control the proliferation and differentiation of muscle satellite cells

    SciTech Connect

    Yajima, Hiroshi; Motohashi, Norio; Ono, Yusuke; Sato, Shigeru; Ikeda, Keiko; Masuda, Satoru; Yada, Erica; Kanesaki, Hironori; Miyagoe-Suzuki, Yuko; Takeda, Shin'ichi; Kawakami, Kiyoshi

    2010-10-15

    Muscle satellite cells are essential for muscle growth and regeneration and their morphology, behavior and gene expression have been extensively studied. However, the mechanisms involved in their proliferation and differentiation remain elusive. Six1 and Six4 proteins were expressed in the nuclei of myofibers of adult mice and the numbers of myoblasts positive for Six1 and Six4 increased during regeneration of skeletal muscles. Six1 and Six4 were expressed in quiescent, activated and differentiated muscle satellite cells isolated from adult skeletal muscle. Overexpression of Six4 and Six5 repressed the proliferation and differentiation of satellite cells. Conversely, knockdown of Six5 resulted in augmented proliferation, and that of Six4 inhibited differentiation. Muscle satellite cells isolated from Six4{sup +/-}Six5{sup -/-} mice proliferated to higher cell density though their differentiation was not altered. Meanwhile, overproduction of Six1 repressed proliferation and promoted differentiation of satellite cells. In addition, Six4 and Six5 repressed, while Six1 activated myogenin expression, suggesting that the differential regulation of myogenin expression is responsible for the differential effects of Six genes. The results indicated the involvement of Six genes in the behavior of satellite cells and identified Six genes as potential target for manipulation of proliferation and differentiation of muscle satellite cells for therapeutic applications.

  14. Reconstructing differentially co-expressed gene modules and regulatory networks of soybean cells

    PubMed Central

    2012-01-01

    Background Current experimental evidence indicates that functionally related genes show coordinated expression in order to perform their cellular functions. In this way, the cell transcriptional machinery can respond optimally to internal or external stimuli. This provides a research opportunity to identify and study co-expressed gene modules whose transcription is controlled by shared gene regulatory networks. Results We developed and integrated a set of computational methods of differential gene expression analysis, gene clustering, gene network inference, gene function prediction, and DNA motif identification to automatically identify differentially co-expressed gene modules, reconstruct their regulatory networks, and validate their correctness. We tested the methods using microarray data derived from soybean cells grown under various stress conditions. Our methods were able to identify 42 coherent gene modules within which average gene expression correlation coefficients are greater than 0.8 and reconstruct their putative regulatory networks. A total of 32 modules and their regulatory networks were further validated by the coherence of predicted gene functions and the consistency of putative transcription factor binding motifs. Approximately half of the 32 modules were partially supported by the literature, which demonstrates that the bioinformatic methods used can help elucidate the molecular responses of soybean cells upon various environmental stresses. Conclusions The bioinformatics methods and genome-wide data sources for gene expression, clustering, regulation, and function analysis were integrated seamlessly into one modular protocol to systematically analyze and infer modules and networks from only differential expression genes in soybean cells grown under stress conditions. Our approach appears to effectively reduce the complexity of the problem, and is sufficiently robust and accurate to generate a rather complete and detailed view of putative soybean

  15. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central

    2010-01-01

    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  16. Blue genes: An integrative laboratory to differentiate genetic transformation from gene mutation for underclassmen.

    PubMed

    Militello, Kevin T; Chang, Ming-Mei; Simon, Robert D; Lazatin, Justine C

    2016-01-01

    The ability of students to understand the relationship between genotype and phenotype, and the mechanisms by which genotypes and phenotypes can change is essential for students studying genetics. To this end, we have developed a four-week laboratory called Blue Genes, which is designed to help novice students discriminate between two mechanisms by which the genetic material can be altered: genetic transformation and gene mutation. In the first week of the laboratory, students incubate a plasmid DNA with calcium chloride-treated Escherichia coli JM109 cells and observe a phenotype change from ampicillin sensitive to ampicillin resistant and from white color to blue color on plates containing 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) and isopropyl β-D-thiogalactopyranoside (IPTG). Over the course of the next three weeks, students use a battery of approaches including plasmid DNA isolation experiments, restriction maps, and PCR to differentiate between mutation and transformation. The students ultimately come to the conclusion that the changes in phenotypes are due to genetic transformation and not mutation based on the evidence generated over the four-week period. Pre-laboratory tests and post-laboratory tests indicate that this set of exercises is successful in helping students differentiate between transformation and mutation. The laboratory is designed for underclassmen and is a good prerequisite for an apprentice-based research opportunity, although it is not designed as a class based research experience. Potential modifications and future directions of the laboratory based upon student experiences and assessment are presented.

  17. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon.

    PubMed

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation.

  18. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon

    PubMed Central

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S.

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation. PMID:26950546

  19. Differential extra-renal expression of the mouse renin genes.

    PubMed Central

    Miller, C C; Carter, A T; Brooks, J I; Lovell-Badge, R H; Brammar, W J

    1989-01-01

    We have used RNase-protection analyses to study renin gene expression in one- and two-gene mouse strains. The RNase-protection assay is capable of discriminating between the transcripts from the different renin genes. In a two-gene strain containing Ren-1D and Ren-2, we demonstrate transcriptional activity from Ren-1D in kidney, submandibular gland (SMG), testes, liver, brain and heart. Ren-2 is clearly expressed in kidney, SMG and testes. Similar analyses of one gene strains (containing Ren-1C only) show expression in kidney, SMG, testes, brain and heart. We cannot detect renin mRNA in the liver of these mice. Ren-1C and Ren-1D thus display quite different tissue-specificities. In order to determine whether the different tissue-specificities of the highly homologous Ren-1C and Ren-1D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-1D transgene (Ren-1*) into a background strain containing only the Ren-1C gene. The transgene exhibits the same tissue-specificity as the Ren-1D gene of two-gene strains suggesting the presence of different cis-acting DNA elements in Ren-1C and Ren-1D. Images PMID:2657654

  20. Induction of differentiation of the human myeloid cell line, ML3, by tumour necrosis factor and interferon-gamma is accompanied by enhanced expression of the CD4 protein and messenger RNA.

    PubMed

    Cassatella, M A; Trinchieri, G; Hassan, N F; Hartman, L; Sorio, C; Berton, G

    1992-05-01

    Tumour necrosis factor (TNF) and interferon-gamma (IFN-gamma) induce differentiation of human myeloid cell lines along the monocytic lineage. In this study we investigated the effects of TNF and IFN-gamma on the expression of the CD4 protein and messenger RNA (mRNA) in the two myeloid cell lines, ML3 and HL-60. We observed that CD4 antigen expression on ML3 cells is almost undetectable and that TNF and IFN-gamma induced CD4 antigen expression on these cells. HL-60 cells express surface CD4 antigen at high density and treatment with TNF and IFN-gamma caused a decrease of CD4 expression. We also investigated the expression of CD4 mRNA in ML3 and HL-60 cells. ML3 constitutively express, albeit at low levels, CD4 mRNA. TNF induced CD4 mRNA in ML3 cells and IFN-gamma synergistically potentiated the effect of TNF, thus indicating that the enhanced expression of the CD4 protein on ML3 cells is due, at least in part, to an enhanced accumulation of the CD4 mRNA. CD4 mRNA is constitutively expressed in HL-60 cells at high levels. TNF and IFN-gamma, alone or in combination, did not cause any significant change of CD4 mRNA expression in HL-60 cells, thus indicating that decrease of surface CD4, which accompanies differentiation with these cytokines, is likely due to alterations of the CD4 protein synthesis and/or transport to the plasma membrane. These results provide evidence that myeloid cell lines are heterogeneous in expression of CD4, and that in ML3 cells, which constitutively express low levels of CD4 mRNA and undetectable amounts of surface CD4, the predominant effect of the two cytokines is to induce both CD4 mRNA and protein.

  1. Characterizing differential gene expression in polyploid grasses lacking a reference transcriptome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Basal transcriptome characterization and differential gene expression in response to varying conditions are often addressed through next generation sequencing (NGS) and data analysis techniques. While these strategies are commonly used, there are countless tools, pipelines, data analysis methods an...

  2. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression.

    PubMed

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree.

  3. Identification and expression profiling analysis of goose melanoma differentiation associated gene 5 (MDA5) gene.

    PubMed

    Wei, L M; Jiao, P R; Song, Y F; Han, F; Cao, L; Yang, F; Ren, T; Liao, M

    2013-10-01

    Melanoma differentiation associated gene 5 (MDA5) is an important cytoplasmic receptor that recognizes long molecules of viral double-stranded RNA and single-stranded RNA with 5' triphosphate and mediates type I interferon secretion. In this study, the full-length MDA5 gene in the goose was identified and characterized. The cDNA of goose MDA5 was 3,306 bp in length with an open reading frame of 3,018 bp, which encoded a polypeptide of 1,005 amino acids. The deduced amino acid sequence contained 6 main structure domains including 2 caspase activation and recruitment domains, one DExD/H-box helicase domain, one type III restriction enzyme domain, one helicase conserved C-terminal domain, and one RIG-I C-terminal domain. Quantitative real-time PCR analysis indicated that goose MDA5 mRNA was constitutively expressed in all sampled tissues. It was highly expressed in the jejunum, trachea, ileum, colon, and kidney, and lowly expressed in the muscular stomach, glandular stomach, and muscle. A significant increase in the transcription of MDA5 was detected in the brain, spleen, and lungs of geese after infection with H5N1 highly pathogenic avian influenza virus compared with uninfected tissues. These findings indicated that goose MDA5 was an important receptor, involved in the antiviral innate immune defense to H5N1 highly pathogenic avian influenza virus in geese.

  4. Differential gene expression and bioinformatics analysis of copper resistance gene afe_1073 in Acidithiobacillus ferrooxidans.

    PubMed

    Hu, Qi; Wu, Xueling; Jiang, Ying; Liu, Yuandong; Liang, Yili; Liu, Xueduan; Yin, Huaqun; Baba, Ngom

    2013-04-01

    Copper resistance of acidophilic bacteria is very significant in bioleaching of copper ore since high concentration of copper are harmful to the growth of organisms. Copper resistance gene afe_1073 was putatively considered to be involved in copper homeostasis in Acidithiobacillus ferrooxidans ATCC23270. In the present study, differential expression of afe_1073 in A. ferrooxidans strain DY26 and DC was assessed with quantitative reverse transcription polymerase chain reaction. The results showed the expression of afe_1073 in two strains increased with the increment of copper concentrations. The expression of DY26 was lower than that of DC at the same copper concentration although A. ferrooxidans strain DY26 possessed higher copper resistance than strain DC. In addition, bioinformatics analysis showed AFE_1073 was a typical transmembrane protein P1b1-ATPase, which could reduce the harm of Cu(+) by pumping it out from the cell. There were two mutation sites in AFE_1073 between DY26 and DC and one may change the hydrophobicity of AFE_1073, which could enhance the ability of DY26 to pump out Cu(+). Therefore, DY26 needed less gene expression of afe_1073 for resisting copper toxicity than that of DC at the same copper stress. Our study will be beneficial to understanding the copper resistance mechanism of A. ferrooxidans.

  5. The Wilms’ Tumor Suppressor Gene (wt1) Product Regulates Dax-1 Gene Expression during Gonadal Differentiation

    PubMed Central

    Kim, Jungho; Prawitt, Dirk; Bardeesy, Nabeel; Torban, Elena; Vicaner, Caroline; Goodyer, Paul; Zabel, Bernard; Pelletier, Jerry

    1999-01-01

    Gonadal differentiation is dependent upon a molecular cascade responsible for ovarian or testicular development from the bipotential gonadal ridge. Genetic analysis has implicated a number of gene products essential for this process, which include Sry, WT1, SF-1, and DAX-1. We have sought to better define the role of WT1 in this process by identifying downstream targets of WT1 during normal gonadal development. We have noticed that in the developing murine gonadal ridge, wt1 expression precedes expression of Dax-1, a nuclear receptor gene. We document here that the spatial distribution profiles of both proteins in the developing gonad overlap. We also demonstrate that WT1 can activate the Dax-1 promoter. Footprinting analysis, transient transfections, promoter mutagenesis, and mobility shift assays suggest that WT1 regulates Dax-1 via GC-rich binding sites found upstream of the Dax-1 TATA box. We show that two WT1-interacting proteins, the product of a Denys-Drash syndrome allele of wt1 and prostate apoptosis response-4 protein, inhibit WT1-mediated transactivation of Dax-1. In addition, we demonstrate that WT1 can activate the endogenous Dax-1 promoter. Our results indicate that the WT1–DAX-1 pathway is an early event in the process of mammalian sex determination. PMID:10022915

  6. Identification of differentially expressed genes and signalling pathways in bark of Hevea brasiliensis seedlings associated with secondary laticifer differentiation using gene expression microarray.

    PubMed

    Loh, Swee Cheng; Thottathil, Gincy P; Othman, Ahmad Sofiman

    2016-10-01

    The natural rubber of Para rubber tree, Hevea brasiliensis, is the main crop involved in industrial rubber production due to its superior quality. The Hevea bark is commercially exploited to obtain latex, which is produced from the articulated secondary laticifer. The laticifer is well defined in the aspect of morphology; however, only some genes associated with its development have been reported. We successfully induced secondary laticifer in the jasmonic acid (JA)-treated and linolenic acid (LA)-treated Hevea bark but secondary laticifer is not observed in the ethephon (ET)-treated and untreated Hevea bark. In this study, we analysed 27,195 gene models using NimbleGen microarrays based on the Hevea draft genome. 491 filtered differentially expressed (FDE) transcripts that are common to both JA- and LA-treated bark samples but not ET-treated bark samples were identified. In the Eukaryotic Orthologous Group (KOG) analysis, 491 FDE transcripts belong to different functional categories that reflect the diverse processes and pathways involved in laticifer differentiation. In the Kyoto Encyclopedia of Genes and Genomes (KEGG) and KOG analysis, the profile of the FDE transcripts suggest that JA- and LA-treated bark samples have a sufficient molecular basis for secondary laticifer differentiation, especially regarding secondary metabolites metabolism. FDE genes in this category are from the cytochrome (CYP) P450 family, ATP-binding cassette (ABC) transporter family, short-chain dehydrogenase/reductase (SDR) family, or cinnamyl alcohol dehydrogenase (CAD) family. The data includes many genes involved in cell division, cell wall synthesis, and cell differentiation. The most abundant transcript in FDE list was SDR65C, reflecting its importance in laticifer differentiation. Using the Basic Local Alignment Search Tool (BLAST) as part of annotation and functional prediction, several characterised as well as uncharacterized transcription factors and genes were found in the

  7. Transcriptome Analysis and Identification of Differentially Expressed Transcripts of Immune-Related Genes in Spleen of Gosling and Adult Goose.

    PubMed

    Wang, Anqi; Liu, Fei; Chen, Shun; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Wu, Ying; Chen, Xiaoyue; Cheng, Anchun

    2015-09-22

    The goose (Anser cygnoides), having high nutritional value, high-quality feathers and high economic benefit, is an economically important poultry species. However, the molecular mechanisms underlying the higher susceptibility to pathogens in goslings than in adult geese remains poorly understood. In this study, the histological sections of spleen tissue from a two-week-old gosling and an adult goose, respectively, were subjected to comparative analysis. The spleen of gosling was mainly composed of mesenchyma, accompanied by scattered lymphocytes, whereas the spleen parenchyma was well developed in the adult goose. To investigate goose immune-related genes, we performed deep transcriptome and gene expression analyses of the spleen samples using paired-end sequencing technology (Illumina). In total, 50,390 unigenes were assembled using Trinity software and TGICL software. Moreover, these assembled unigenes were annotated with gene descriptions and gene ontology (GO) analysis was performed. Through Kyoto encyclopedia of genes and genomes (KEGG) analysis, we investigated 558 important immune-relevant unigenes and 23 predicted cytokines. In addition, 22 immune-related genes with differential expression between gosling and adult goose were identified, among which the three genes showing largest differences in expression were immunoglobulin alpha heavy chain (IgH), mannan-binding lectin serine protease 1 isoform X1 (MASP1) and C-X-C chemokine receptor type 4 (CXCR4). Finally, of these 22 differentially expressed immune-related genes, seven genes, including tumor necrosis factor receptor superfamily member 13B (TNFRSF13B), C-C motif chemokine 4-like (CCL4), CXCR4, interleukin 2 receptor alpha (IL2RA), MHC class I heavy chain (MHCIα), transporter of antigen processing 2 (TAP2) IgH, were confirmed by quantitative real-time PCR (qRT-PCR). The expression levels of all the candidate unigenes were up-regulated in adult geese other than that of TNFRSF13B. The comparative

  8. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    PubMed

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  9. Differential gene expression analysis of ovarian cancer in a population isolate.

    PubMed

    Grazio, D; Pichler, I; Fuchsberger, C; Zolezzi, F; Guarnieri, P; Heidegger, H; Scherer, A; Engl, B; Messini, S; Egarter-Vigl, E; Pramstaller, P P

    2008-01-01

    Gene expression products represent candidate biomarkers with the potential for early screening and therapy of patients with ovarian serous carcinoma. The present study, using patients that originate from the population isolate of South Tyrol, Italy, substantiates the feasibility of differential gene expression analysis in a genetically isolated population for the identification of potential markers of ovarian cancer. Gene expression profiles of fresh-frozen ovarian serous papillary carcinoma samples were analyzed and compared to normal ovarian control tissues using oligonucleotide microarrays complementary to 14,500 human genes. Supervised analysis of gene expression profiling data identified 225 genes that are down-regulated and 635 that are up-regulated in malignant compared to normal ovarian tissues. Class-prediction analysis identified 40 differentially expressed genes for further investigation as potential classifiers for ovarian cancer, including 20 novel candidates. Our findings provide a glimpse into the potential of population isolate genomics in oncological research.

  10. [Identification and application of marker genes for differential diagnosis of chronic fatigue syndrome].

    PubMed

    Kawai, Tomoko; Rokutan, Kazuhito

    2007-06-01

    Chronic fatigue syndrome (CFS) is a complex disease and has no laboratory biomarkers, which makes diagnosis of CFS difficult. Several research groups challenged to identify genes specific for CFS; however, there are no overlaps between studies. The U.S. Centers for Disease Control and Prevention reported remarkable gene expression profiles of a large scale cohort study recruited 227 people. Reported genes were mostly different from the previously reported genes, again featuring the complexity of CFS. Separately, we identified 9 genes that were significantly and differentially expressed between CFS patients and healthy subjects using an original microarray. The changes in expression of 9 genes were confirmed by quantitative PCR. We also demonstrated the usefulness of 9 genes for differential diagnosis of CFS.

  11. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad

    2006-01-01

    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  12. Differential Coexpression Analysis Reveals Extensive Rewiring of Arabidopsis Gene Coexpression in Response to Pseudomonas syringae Infection

    PubMed Central

    Jiang, Zhenhong; Dong, Xiaobao; Li, Zhi-Gang; He, Fei; Zhang, Ziding

    2016-01-01

    Plant defense responses to pathogens involve massive transcriptional reprogramming. Recently, differential coexpression analysis has been developed to study the rewiring of gene networks through microarray data, which is becoming an important complement to traditional differential expression analysis. Using time-series microarray data of Arabidopsis thaliana infected with Pseudomonas syringae, we analyzed Arabidopsis defense responses to P. syringae through differential coexpression analysis. Overall, we found that differential coexpression was a common phenomenon of plant immunity. Genes that were frequently involved in differential coexpression tend to be related to plant immune responses. Importantly, many of those genes have similar average expression levels between normal plant growth and pathogen infection but have different coexpression partners. By integrating the Arabidopsis regulatory network into our analysis, we identified several transcription factors that may be regulators of differential coexpression during plant immune responses. We also observed extensive differential coexpression between genes within the same metabolic pathways. Several metabolic pathways, such as photosynthesis light reactions, exhibited significant changes in expression correlation between normal growth and pathogen infection. Taken together, differential coexpression analysis provides a new strategy for analyzing transcriptional data related to plant defense responses and new insights into the understanding of plant-pathogen interactions. PMID:27721457

  13. Analysis of differential gene expression under low-temperature stress in Nile tilapia (Oreochromis niloticus) using digital gene expression.

    PubMed

    Yang, Changgeng; Jiang, Ming; Wen, Hua; Tian, Juan; Liu, Wei; Wu, Fan; Gou, Gengwu

    2015-06-15

    Tilapia (Oreochromis niloticus) do not survive well at low temperatures. Therefore, improvement of the low-temperature resistance has become an important issue for aquaculture development of tilapia. The objective of this study was to construct a digital gene expression tag profile to identify genes potentially related to low temperature in tilapia. In this study, tilapia was treated at 30°C to lethal temperature 10°C in decrement of 1°CD(-1). Digital gene expression analysis was performed using the Illumina technique to investigate differentially expressed genes in tilapia cultured at different temperatures (30°C, 26°C, 20°C, 16°C, and 10°C). A total of 206,861, 188,082, 185,827, 188,067, and 214,171 distinct tags were obtained by sequencing these five libraries, respectively. Compared with the 30°C library, there were 304, 407, 709, and 772 upregulated genes and 342, 793, 771, and 1466 downregulated genes in 26°C, 20°C, 16°C, and 10°C libraries, respectively. Trend analysis of these differentially expressed genes identified six statistically significant trends. Functional annotation analysis of the differentially expressed genes identified various functions associated with the response to low-temperature stress. When tilapia are subjected to low-temperature stress, expression changes were observed in genes associated with nucleic acid synthesis and metabolism, amino acid metabolism and protein synthesis, lipid and carbohydrate content and types, material transport, apoptosis, and immunity. The differentially expressed genes obtained in this study may provide useful insights to help further understand the effects of low temperature on tilapia.

  14. Blue light-promoted rice leaf bending and unrolling are due to up-regulated brassinosteroid biosynthesis genes accompanied by accumulation of castasterone.

    PubMed

    Asahina, Masashi; Tamaki, Yuji; Sakamoto, Tomoaki; Shibata, Kyomi; Nomura, Takahito; Yokota, Takao

    2014-08-01

    In this study the relationship between blue light- and brassinosteroid-enhanced leaf lamina bending and unrolling in rice was investigated. Twenty-four hours (h) irradiation with white or blue light increased endogenous brassinosteroid levels, especially those of typhasterol and castasterone, in aerial tissues of rice seedlings. There was an accompanying up-regulation of transcript levels of CYP85A1/OsDWARF, encoding an enzyme catalyzing C-6 oxidation, after 6h under either white or blue light. These effects were not observed in seedlings placed under far-red or red light regimes. It was concluded that blue light up-regulates the levels of several cytochrome P450 enzymes including CYP85A1, thereby promoting the synthesis of castasterone, a biologically active brassinosteroid in rice. Based on these findings, it is considered that blue light-mediated rice leaf bending and unrolling are consequences of the enhanced biosynthesis of endogenous castasterone. In contrast to aerial tissues, brassinosteroid synthesis in roots appeared to be negatively regulated by white, blue and red light but positively controlled by far-red light.

  15. Transcriptome-Wide Differential Gene Expression in Bicyclus anynana Butterflies: Female Vision-Related Genes Are More Plastic.

    PubMed

    Macias-Muñoz, Aide; Smith, Gilbert; Monteiro, Antónia; Briscoe, Adriana D

    2016-01-01

    Vision is energetically costly to maintain. Consequently, over time many cave-adapted species downregulate the expression of vision genes or even lose their eyes and associated eye genes entirely. Alternatively, organisms that live in fluctuating environments, with different requirements for vision at different times, may evolve phenotypic plasticity for expression of vision genes. Here, we use a global transcriptomic and candidate gene approach to compare gene expression in the heads of a polyphenic butterfly. Bicyclus anynana have two seasonal forms that display sexual dimorphism and plasticity in eye morphology, and female-specific plasticity in opsin gene expression. Nonchoosy dry season females downregulate opsin expression, consistent with the high physiological cost of vision. To identify other genes associated with sexually dimorphic and seasonally plastic differences in vision, we analyzed RNA-sequencing data from whole head tissues. We identified two eye development genes (klarsicht and warts homologs) and an eye pigment biosynthesis gene (henna) differentially expressed between seasonal forms. By comparing sex-specific expression across seasonal forms, we found that klarsicht, warts, henna, and another eye development gene (domeless) were plastic in a female-specific manner. In a male-only analysis, white (w) was differentially expressed between seasonal forms. Reverse transcription polymerase chain reaction confirmed that warts and white are expressed in eyes only, whereas klarsicht, henna and domeless are expressed in both eyes and brain. We find that differential expression of eye development and eye pigment genes is associated with divergent eye phenotypes in B. anynana seasonal forms, and that there is a larger effect of season on female vision-related genes.

  16. Identification of therapeutic targets for Alzheimer's disease via differentially expressed gene and weighted gene co-expression network analyses.

    PubMed

    Jia, Yujie; Nie, Kun; Li, Jing; Liang, Xinyue; Zhang, Xuezhu

    2016-11-01

    In order to investigate the pathogenic targets and associated biological process of Alzheimer's disease in the present study, mRNA expression profiles (GSE28146) and microRNA (miRNA) expression profiles (GSE16759) were downloaded from the Gene Expression Omnibus database. In GSE28146, eight control samples, and Alzheimer's disease samples comprising seven incipient, eight moderate, seven severe Alzheimer's disease samples, were included. The Affy package in R was used for background correction and normalization of the raw microarray data. The differentially expressed genes (DEGs) and differentially expressed miRNAs were identified using the Limma package. In addition, mRNAs were clustered using weighted gene correlation network analysis, and modules found to be significantly associated with the stages of Alzheimer's disease were screened out. The Database for Annotation, Visualization, and Integrated Discovery was used to perform Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses. The target genes of the differentially expressed miRNAs were identified using the miRWalk database. Compared with the control samples, 175,59 genes and 90 DEGs were identified in the incipient, moderate and severe Alzheimer's disease samples, respectively. A module, which contained 1,592 genes was found to be closely associated with the stage of Alzheimer's disease and biological processes. In addition, pathways associated with Alzheimer's disease and other neurological diseases were found to be enriched in those genes. A total of 139 overlapped genes were identified between those genes and the DEGs in the three groups. From the miRNA expression profiles, 189 miRNAs were found differentially expressed in the samples from patients with Alzheimer's disease and 1,647 target genes were obtained. In addition, five overlapped genes were identified between those 1,647 target genes and the 139 genes, and these genes may be important pathogenic targets for Alzheimer

  17. Dynamic changes in the expression of apoptosis-related genes in differentiating gonocytes and in seminomas.

    PubMed

    Manku, Gurpreet; Culty, Martine

    2015-01-01

    Apoptosis is an integral part of the spermatogenic process, necessary to maintain a proper ratio of Sertoli to germ cell numbers and provide an adequate microenvironment to germ cells. Apoptosis may also represent a protective mechanism mediating the elimination of abnormal germ cells. Extensive apoptosis occurs between the first and second postnatal weeks, at the point when gonocytes, precursors of spermatogonial stem cells, should have migrated toward the basement membrane of the tubules and differentiated into spermatogonia. The mechanisms regulating this process are not well-understood. Gonocytes undergo phases of proliferation, migration, and differentiation which occur in a timely and closely regulated manner. Gonocytes failing to migrate and differentiate properly undergo apoptosis. Inadequate gonocyte differentiation has been suggested to lead to testicular germ cell tumor (TGCT) formation. Here, we examined the expression levels of apoptosis-related genes during gonocyte differentiation by quantitative real-time polymerase chain reaction, identifying 48 pro- and anti-apoptotic genes increased by at least two-fold in rat gonocytes induced to differentiate by retinoic acid, when compared to untreated gonocytes. Further analysis of the most highly expressed genes identified the pro-apoptotic genes Gadd45a and Cycs as upregulated in differentiating gonocytes and in spermatogonia compared with gonocytes. These genes were also significantly downregulated in seminomas, the most common type of TGCT, compared with normal human testicular tissues. These results indicate that apoptosis-related genes are actively regulated during gonocyte differentiation. Moreover, the down-regulation of pro-apoptotic genes in seminomas suggests that they could represent new therapeutic targets in the treatment of TGCTs.

  18. Activation of human heat shock genes is accompanied by oligomerization, modification, and rapid translocation of heat shock transcription factor HSF1.

    PubMed Central

    Baler, R; Dahl, G; Voellmy, R

    1993-01-01

    Transcriptional activity of heat shock (hsp) genes is controlled by a heat-activated, group-specific transcription factor(s) recognizing arrays of inverted repeats of the element NGAAN. To date genes for two human factors, HSF1 and HSF2, have been isolated. To define their properties as well as the changes they undergo during heat stress activation, we prepared polyclonal antibodies to these factors. Using these tools, we have shown that human HeLa cells constitutively synthesize HSF1, but we were unable to detect HSF2. In unstressed cells HSF1 is present mainly in complexes with an apparent molecular mass of about 200 kDa, unable to bind to DNA. Heat treatment induces a shift in the apparent molecular mass of HSF1 to about 700 kDa, concomitant with the acquisition of DNA-binding ability. Cross-linking experiments suggest that this change in complex size may reflect the trimerization of monomeric HSF1. Human HSF1 expressed in Xenopus oocytes does not bind DNA, but derepression of DNA-binding activity, as well as oligomerization of HSF1, occurs during heat treatment at the same temperature at which hsp gene expression is induced in this organism, suggesting that a conserved Xenopus protein(s) plays a role in this regulation. Inactive HSF1 resides in the cytoplasm of human cells; on activation it rapidly translocates to a soluble nuclear fraction, and shortly thereafter it becomes associated with the nuclear pellet. On heat shock, activatable HSF1, which might already have been posttranslationally modified in the unstressed cell, undergoes further modification. These different process provide multiple points of regulation of hsp gene expression. Images PMID:8455624

  19. Applying Attractor Dynamics to Infer Gene Regulatory Interactions Involved in Cellular Differentiation.

    PubMed

    Ghaffarizadeh, Ahmadreza; Podgorski, Gregory J; Flann, Nicholas S

    2017-02-27

    The dynamics of gene regulatory networks (GRNs) guide cellular differentiation. Determining the ways regulatory genes control expression of their targets is essential to understand and control cellular differentiation. The way a regulatory gene controls its target can be expressed as a gene regulatory function. Manual derivation of these regulatory functions is slow, error-prone and difficult to update as new information arises. Automating this process is a significant challenge and the subject of intensive effort. This work presents a novel approach to discovering biologically plausible gene regulatory interactions that control cellular differentiation. This method integrates known cell type expression data, genetic interactions, and knowledge of the effects of gene knockouts to determine likely GRN regulatory functions. We employ a genetic algorithm to search for candidate GRNs that use a set of transcription factors that control differentiation within a lineage. Nested canalyzing functions are used to constrain the search space to biologically plausible networks. The method identifies an ensemble of GRNs whose dynamics reproduce the gene expression pattern for each cell type within a particular lineage. The method's effectiveness was tested by inferring consensus GRNs for myeloid and pancreatic cell differentiation and comparing the predicted gene regulatory interactions to manually derived interactions. We identified many regulatory interactions reported in the literature and also found differences from published reports. These discrepancies suggest areas for biological studies of myeloid and pancreatic differentiation. We also performed a study that used defined synthetic networks to evaluate the accuracy of the automated search method and found that the search algorithm was able to discover the regulatory interactions in these defined networks with high accuracy. We suggest that the GRN functions derived from the methods described here can be used to fill

  20. Acquisition of the capsule locus by horizontal gene transfer in Neisseria meningitidis is often accompanied by the loss of UDP-GalNAc synthesis

    PubMed Central

    Bartley, Stephanie N.; Mowlaboccus, Shakeel; Mullally, Christopher A.; Stubbs, Keith A.; Vrielink, Alice; Maiden, Martin C. J.; Harrison, Odile B.; Perkins, Timothy T.; Kahler, Charlene M.

    2017-01-01

    Pathogenic meningococci have acquired a 24 kb capsule synthesis island (cps) by horizontal gene transfer which consists of a synthetic locus and associated capsule transport genes flanked by repetitive Regions D and D’. Regions D and D’ contain an intact gene encoding a UDP-galactose epimerase (galE1) and a truncated remnant (galE2), respectively. In this study, GalE protein alleles were shown to be either mono-functional, synthesising UDP-galactose (UDP-Gal), or bi-functional, synthesising UDP-Gal and UDP-galactosamine (UDP-GalNAc). Meningococci possessing a capsule null locus (cnl) typically possessed a single bi-functional galE. Separation of functionality between galE1 and galE2 alleles in meningococcal isolates was retained for all serogroups except serogroup E which has a synthetic requirement for UDP-GalNAc. The truncated galE2 remnant in Region D’ was also phylogenetically related to the bi-functional galE of the cnl locus suggesting common ancestry. A model is proposed in which the illegitimate recombination of the cps island into the galE allele of the cnl locus results in the formation of Region D’ containing the truncated galE2 locus and the capture of the cps island en bloc. The retention of the duplicated Regions D and D’ enables inversion of the synthetic locus within the cps island during bacterial growth. PMID:28290510

  1. A Microarray Analysis for Differential Gene Expression in the Soybean Genome Using Bioconductor and R

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper describes specific procedures for conducting quality assessment of Affymetrix GeneChip® soybean genome data and performing analyses to determine differential gene expression using the open-source R language and environment in conjunction with the open-source Bioconductor package. Procedu...

  2. Evaluation of new biomarker genes for differentiating Haemophilus influenzae from Haemophilus haemolyticus.

    PubMed

    Theodore, M Jordan; Anderson, Raydel D; Wang, Xin; Katz, Lee S; Vuong, Jeni T; Bell, Melissa E; Juni, Billie A; Lowther, Sara A; Lynfield, Ruth; MacNeil, Jessica R; Mayer, Leonard W

    2012-04-01

    PCR detecting the protein D (hpd) and fuculose kinase (fucK) genes showed high sensitivity and specificity for identifying Haemophilus influenzae and differentiating it from H. haemolyticus. Phylogenetic analysis using the 16S rRNA gene demonstrated two distinct groups for H. influenzae and H. haemolyticus.

  3. Evaluation of New Biomarker Genes for Differentiating Haemophilus influenzae from Haemophilus haemolyticus

    PubMed Central

    Anderson, Raydel D.; Wang, Xin; Katz, Lee S.; Vuong, Jeni T.; Bell, Melissa E.; Juni, Billie A.; Lowther, Sara A.; Lynfield, Ruth; MacNeil, Jessica R.; Mayer, Leonard W.

    2012-01-01

    PCR detecting the protein D (hpd) and fuculose kinase (fucK) genes showed high sensitivity and specificity for identifying Haemophilus influenzae and differentiating it from H. haemolyticus. Phylogenetic analysis using the 16S rRNA gene demonstrated two distinct groups for H. influenzae and H. haemolyticus. PMID:22301020

  4. EVE (external variance estimation) increases statistical power for detecting differentially expressed genes.

    PubMed

    Wille, Anja; Gruissem, Wilhelm; Bühlmann, Peter; Hennig, Lars

    2007-11-01

    Accurately identifying differentially expressed genes from microarray data is not a trivial task, partly because of poor variance estimates of gene expression signals. Here, after analyzing 380 replicated microarray experiments, we found that probesets have typical, distinct variances that can be estimated based on a large number of microarray experiments. These probeset-specific variances depend at least in part on the function of the probed gene: genes for ribosomal or structural proteins often have a small variance, while genes implicated in stress responses often have large variances. We used these variance estimates to develop a statistical test for differentially expressed genes called EVE (external variance estimation). The EVE algorithm performs better than the t-test and LIMMA on some real-world data, where external information from appropriate databases is available. Thus, EVE helps to maximize the information gained from a typical microarray experiment. Nonetheless, only a large number of replicates will guarantee to identify nearly all truly differentially expressed genes. However, our simulation studies suggest that even limited numbers of replicates will usually result in good coverage of strongly differentially expressed genes.

  5. Meta-Analysis of Differential Connectivity in Gene Co-Expression Networks in Multiple Sclerosis

    PubMed Central

    Creanza, Teresa Maria; Liguori, Maria; Liuni, Sabino; Nuzziello, Nicoletta; Ancona, Nicola

    2016-01-01

    Differential gene expression analyses to investigate multiple sclerosis (MS) molecular pathogenesis cannot detect genes harboring genetic and/or epigenetic modifications that change the gene functions without affecting their expression. Differential co-expression network approaches may capture changes in functional interactions resulting from these alterations. We re-analyzed 595 mRNA arrays from publicly available datasets by studying changes in gene co-expression networks in MS and in response to interferon (IFN)-β treatment. Interestingly, MS networks show a reduced connectivity relative to the healthy condition, and the treatment activates the transcription of genes and increases their connectivity in MS patients. Importantly, the analysis of changes in gene connectivity in MS patients provides new evidence of association for genes already implicated in MS by single-nucleotide polymorphism studies and that do not show differential expression. This is the case of amiloride-sensitive cation channel 1 neuronal (ACCN1) that shows a reduced number of interacting partners in MS networks, and it is known for its role in synaptic transmission and central nervous system (CNS) development. Furthermore, our study confirms a deregulation of the vitamin D system: among the transcription factors that potentially regulate the deregulated genes, we find TCF3 and SP1 that are both involved in vitamin D3-induced p27Kip1 expression. Unveiling differential network properties allows us to gain systems-level insights into disease mechanisms and may suggest putative targets for the treatment. PMID:27314336

  6. Improvements in growth performance, bone mineral status and nutrient digestibility in pigs following the dietary inclusion of phytase are accompanied by modifications in intestinal nutrient transporter gene expression.

    PubMed

    Vigors, Stafford; Sweeney, Torres; O'Shea, Cormac J; Browne, John A; O'Doherty, John V

    2014-09-14

    Phytase (PHY) improves growth performance, nutrient digestibility and bone structure in pigs; however, little is known about its effects on intestinal nutrient transporter gene expression. In the present study, a 44 d experiment was carried out using forty-eight pigs (11·76 (sem 0·75) kg) assigned to one of three dietary treatment groups to measure growth performance, coefficient of apparent ileal digestibility (CAID), coefficient of apparent total tract nutrient digestibility (CATTD) and intestinal nutrient transporter gene expression. Dietary treatments during the experimental period were as follows: (1) a high-P (HP) diet containing 3·4 g/kg available P and 7·0 g/kg Ca; (2) a low-P (LP) diet containing 1·9 g/kg available P and 5·9 g/kg Ca; (3) a PHY diet containing LP diet ingredients+1000 phytase units (FTU)/kg of PHY. The PHY diet increased the average daily gain (P< 0·05) and final body weight (P< 0·01) and decreased the feed conversion ratio (P< 0·05) compared with the LP diet. Pigs fed the PHY diet had a higher CAID of gross energy compared with those fed the HP and LP diets (P< 0·001). Pigs fed the PHY diet had increased CAID of P (P< 0·01) and CATTD of Ca and P (P< 0·001) compared with those fed the LP diet. The PHY diet increased the gene expression of the peptide transporter 1 (PEPT1/SLC15A1) (P< 0·05) in the ileum compared with the LP diet. The LP diet decreased the gene expression of the sodium-glucose-linked transporter 1 (SGLT1/SLC5A1) and GLUT2/SLC2A2 (P< 0·05) and increased the expression of membrane Ca channel (TRPV6) and calbindin compared with the HP diet (P< 0·001). In conclusion, feeding a diet supplemented with PHY improves growth performance and nutrient digestibility as well as increases the gene expression of the peptide transporter PEPT1.

  7. Positions of pluripotency genes and hepatocyte-specific genes in the nucleus before and after mouse ES cell differentiation.

    PubMed

    Udagawa, K; Ohyama, T

    2014-03-24

    Spatial positioning of genes in the cell nucleus plays an important role in the regulation of genomic functions. Evidence for changes in gene positioning associated with transcriptional activity has been reported. However, our understanding of this phenomenon is still quite limited. We examined how pluripotency genes and hepatocyte-specific genes behave during the differentiation of mouse embryonic stem (ES) cells into hepatocytes, by targeting the loci of the Klf4, Nanog, Oct4, Sox2, Cyp7α1, Pck1, Tat, and Tdo2 genes, and using three-dimensional fluorescence in situ hybridization analyses. We found that each gene has a distinctly inherent localization profile in the ES cell nucleus. During differentiation, the Klf4, Nanog, Oct4, Cyp7α1, Pck1, and Tat loci shifted toward the nuclear center, while the Sox2 and Tdo2 loci shifted toward the periphery. The Klf4, Nanog, Oct4, and Tdo2 seem to prefer the outer regions, rather than the inner regions, when they are active. We also found that the radial positioning of the focused genes in the hepatocyte cell nucleus was highly correlated with the local GC content and the gene density of the surrounding region, but not with gene activity.

  8. Chromatin signatures in multipotent human hematopoietic stem cells indicate the fate of bivalent genes during differentiation.

    PubMed

    Cui, Kairong; Zang, Chongzhi; Roh, Tae-Young; Schones, Dustin E; Childs, Richard W; Peng, Weiqun; Zhao, Keji

    2009-01-09

    Histone modifications have been implicated in stem cell maintenance and differentiation. We have analyzed genome-wide changes in gene expression and histone modifications during differentiation of multipotent human primary hematopoietic stem cells/progenitor cells (HSCs/HPCs) into erythrocyte precursors. Our data indicate that H3K4me1, H3K9me1, and H3K27me1 associate with enhancers of differentiation genes prior to their activation and correlate with basal expression, suggesting that these monomethylations are involved in the maintenance of activation potential required for differentiation. In addition, although the majority of genes associated with both H3K4me3 and H3K27me3 in HSCs/HPCs become silent and lose H3K4me3 after differentiation, those that lose H3K27me3 and become activated after differentiation are associated with increased levels of H2A.Z, H3K4me1, H3K9me1, H4K20me1, and RNA polymerase II in HSCs/HPCs. Thus, our data suggest that gene expression changes during differentiation are programmed by chromatin modifications present at the HSC/HPC stage and provide a resource for enhancer and promoter identification.

  9. Phenotypic differentiation of Streptococcus pyogenes populations is induced by recombination-driven gene-specific sweeps

    PubMed Central

    Bao, Yun-Juan; Shapiro, B. Jesse; Lee, Shaun W.; Ploplis, Victoria A.; Castellino, Francis J.

    2016-01-01

    Genomic recombination plays an important role in driving adaptive evolution and population differentiation in bacteria. However, controversy exists as to the effects of recombination on population diversity and differentiation, i.e., recombination is frequent enough to sweep through the population at selected gene loci (gene-specific sweeps), or the recombination rate is low without interfering genome-wide selective sweeps. Observations supporting either view are sparse. Pathogenic bacteria causing infectious diseases are promising candidates to provide observations of recombination. However, phenotype-associated differentiations are usually vague among them due to diverse disease manifestations. Here we report a population genomic study of the group A Streptococcus pyogenes (GAS), a human pathogen with highly recombining genomes. By employing a genome-wide association study on single nucleotide polymorphisms (SNPs), we demonstrate a phenotypic differentiation of GAS, represented by separate clustering of two sublineages associated with niche-specific infections, i.e., skin infection and pharyngitis-induced acute rheumatic fever. By quantifying SNPs associated with the differentiation in a statistical and phylogenetic context, we propose that the phenotype-associated differentiation arose through recombination-driven gene-specific sweeps, rather than genome-wide sweeps. Our work provides a novel paradigm of phenotype-associated differentiation induced by gene-specific sweeps in a human pathogen and has implications for understanding of driving forces of bacterial evolution. PMID:27821851

  10. Gene expression analysis of terminal differentiation of human melanoma cells highlights global reductions in cell cycle-associated genes.

    PubMed

    Huynh, Kim Mai; Kim, Gyoungmi; Kim, Dong-Joon; Yang, Suk-Jin; Park, Seong-min; Yeom, Young-Il; Fisher, Paul B; Kang, Dongchul

    2009-03-15

    Defects in differentiation are frequently observed in cancer cells. By appropriate treatment specific tumor cell types can be induced to terminally differentiate. Metastatic HO-1 human melanoma cells treated with IFN-beta plus mezerein (MEZ) undergo irreversible growth arrest and terminal differentiation followed by apoptosis. In order to define the molecular changes associated with this process, changes in gene expression were analyzed by cDNA microarray hybridization and by semi-quantitative and quantitative RT-PCRs of representative 44 genes. The expression of 210 genes was changed more than two-fold at either 8 or 24 h post-treatment (166 up and 44 down). Major biological processes associated with the up-regulated genes were response to endogenous/exogenous stimuli (38%), cell proliferation (13%), cell death (16%) and development (30%). Approximately 34% of the down-regulated genes were associated with cell cycle, 9% in DNA replication and 11% in chromosome organization, respectively. Suppression of cell cycle associated genes appeared to directly correlate with growth arrest observed in the terminal differentiation process. Expression of Calpain 3 (CAPN3) variant 6 was suppressed by the combined treatment and maintained high in various melanoma cell lines. However, over-expression of the CAPN3 did not significantly affect growth kinetics and cell viability, suggesting that up-regulation of CAPN3 alone may not be a causative, but an associated change with melanoma development. This analysis provides further insights into the spectrum of up-regulated and the first detailed investigation of down-regulated gene changes associated with and potentially causative of induction of loss of proliferative capacity and terminal differentiation in human melanoma cells.

  11. Identification of stable reference genes in differentiating human pluripotent stem cells.

    PubMed

    Holmgren, Gustav; Ghosheh, Nidal; Zeng, Xianmin; Bogestål, Yalda; Sartipy, Peter; Synnergren, Jane

    2015-06-01

    Reference genes, often referred to as housekeeping genes (HKGs), are frequently used to normalize gene expression data based on the assumption that they are expressed at a constant level in the cells. However, several studies have shown that there may be a large variability in the gene expression levels of HKGs in various cell types. In a previous study, employing human embryonic stem cells (hESCs) subjected to spontaneous differentiation, we observed that the expression of commonly used HKG varied to a degree that rendered them inappropriate to use as reference genes under those experimental settings. Here we present a substantially extended study of the HKG signature in human pluripotent stem cells (hPSC), including nine global gene expression datasets from both hESC and human induced pluripotent stem cells, obtained during directed differentiation toward endoderm-, mesoderm-, and ectoderm derivatives. Sets of stably expressed genes were compiled, and a handful of genes (e.g., EID2, ZNF324B, CAPN10, and RABEP2) were identified as generally applicable reference genes in hPSCs across all cell lines and experimental conditions. The stability in gene expression profiles was confirmed by reverse transcription quantitative PCR analysis. Taken together, the current results suggest that differentiating hPSCs have a distinct HKG signature, which in some aspects is different from somatic cell types, and underscore the necessity to validate the stability of reference genes under the actual experimental setup used. In addition, the novel putative HKGs identified in this study can preferentially be used for normalization of gene expression data obtained from differentiating hPSCs.

  12. Differential loss of ancestral gene families as a source of genomic divergence in animals.

    PubMed Central

    Hughes, Austin L; Friedman, Robert

    2004-01-01

    A phylogenetic approach was used to reconstruct the pattern of an apparent loss of 2106 ancestral gene families in four animal genomes (Caenorhabditis elegans, Drosophila melanogaster, human and fugu). Substantially higher rates of loss of ancestral gene families were found in the invertebrates than in the vertebrates. These results indicate that the differential loss of ancestral gene families can be a significant factor in the evolutionary diversification of organisms. PMID:15101434

  13. Differential gene expression patterns between smokers and non-smokers: cause or consequence?

    PubMed

    Vink, Jacqueline M; Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H; Penninx, Brenda W; Boomsma, Dorret I

    2017-03-01

    The molecular mechanisms causing smoking-induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome-wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex-smokers were available from two population-based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty-two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10(-6) , Bonferroni correction). The most significant genes were G protein-coupled receptor 15 (P < 1 × 10(-150) ) and leucine-rich repeat neuronal 3 (P < 1 × 10(-44) ). The smoking-related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex-smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis-expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome-wide association meta-analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression.

  14. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    PubMed Central

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.

    2015-01-01

    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10−6, Bonferroni correction). The most significant genes were G protein‐coupled receptor 15 (P < 1 × 10−150) and leucine‐rich repeat neuronal 3 (P < 1 × 10−44). The smoking‐related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex‐smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene

  15. [Alteration of isozyme gene expression during cell differentiation and oncogenesis].

    PubMed

    Yamada, K; Noguchi, T

    1995-05-01

    Rat pyruvate kinase (PK) has four isozymes, called the M1-, M2-, L-, and R-types. The M1- and M2-type isozymes of PK are produced from the PKM gene by alternative splicing, whereas the L- and R-type isozymes of PK are produced from the PKL gene by use of different tissue-specific promoters. In early development, only M2-type PK expresses in all tissues. After late morphogenesis, M1-, L-, and R-type PK express tissue-specifically. In contrast, cell proliferation such as regenerating liver and oncogenesis lead to decrease or cessation of the expression of tissue-specific PK isozymes and to stimulation of the expression of M2-type PK. These phenomena from the point of view transcriptional regulatory apparatus of the PKM and PKL gene are discussed.

  16. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    PubMed

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2016-09-19

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  17. Differential gene expression in Symbiodinium microadriaticum clade B following stress.

    PubMed

    Karako-Lampert, S; Hershkovits, G; Stambler, N; Simon-Blecher, N; Achituv, Y; Dubinsky, Z; Katcoff, D J

    2006-01-01

    Coral bleaching is caused by the loss of symbiont zooxanthellae and/or decrease in their pigments. Since the algal symbionts provide the energy basis for corals and whole reefs, their loss or impairment of function leads to widespread mortality. This phenomenon has been documented numerous times in recent years, and has extensively damaged coral reefs all over the world. Temperature has been found to be the major cause of bleaching, and rising sea temperatures have increased the frequency of these catastrophic episodes. To characterize the response of zooxanthellae to temperature stress at the molecular level, we used the mRNA differential display technique to monitor changes in the abundance of specific mRNA species in the cell under different temperature conditions. Axenically grown zooxanthellae were exposed to a range of temperatures (21.7, 17, 26 degrees C) before extraction of their mRNA. Of numerous differentially expressed sequences, seven mRNA species were amplified by the polymerase chain reaction (PCR) and sequenced. One of those sequences was positively identified as encoding a multifunction cell surface aminopeptidase, dipeptidyl peptidase IV, which is active in cell matrix adhesion. Our work illustrates the power of the differential display technique as a useful tool to study the response of zooxanthellae to stressors.

  18. Gene Duplication, Population Genomics, and Species-Level Differentiation within a Tropical Mountain Shrub

    PubMed Central

    Mastretta-Yanes, Alicia; Zamudio, Sergio; Jorgensen, Tove H.; Arrigo, Nils; Alvarez, Nadir; Piñero, Daniel; Emerson, Brent C.

    2014-01-01

    Gene duplication leads to paralogy, which complicates the de novo assembly of genotyping-by-sequencing (GBS) data. The issue of paralogous genes is exacerbated in plants, because they are particularly prone to gene duplication events. Paralogs are normally filtered from GBS data before undertaking population genomics or phylogenetic analyses. However, gene duplication plays an important role in the functional diversification of genes and it can also lead to the formation of postzygotic barriers. Using populations and closely related species of a tropical mountain shrub, we examine 1) the genomic differentiation produced by putative orthologs, and 2) the distribution of recent gene duplication among lineages and geography. We find high differentiation among populations from isolated mountain peaks and species-level differentiation within what is morphologically described as a single species. The inferred distribution of paralogs among populations is congruent with taxonomy and shows that GBS could be used to examine recent gene duplication as a source of genomic differentiation of nonmodel species. PMID:25223767

  19. Gene differential coexpression analysis based on biweight correlation and maximum clique.

    PubMed

    Zheng, Chun-Hou; Yuan, Lin; Sha, Wen; Sun, Zhan-Li

    2014-01-01

    Differential coexpression analysis usually requires the definition of 'distance' or 'similarity' between measured datasets. Until now, the most common choice is Pearson correlation coefficient. However, Pearson correlation coefficient is sensitive to outliers. Biweight midcorrelation is considered to be a good alternative to Pearson correlation since it is more robust to outliers. In this paper, we introduce to use Biweight Midcorrelation to measure 'similarity' between gene expression profiles, and provide a new approach for gene differential coexpression analysis. Firstly, we calculate the biweight midcorrelation coefficients between all gene pairs. Then, we filter out non-informative correlation pairs using the 'half-thresholding' strategy and calculate the differential coexpression value of gene, The experimental results on simulated data show that the new approach performed better than three previously published differential coexpression analysis (DCEA) methods. Moreover, we use the maximum clique analysis to gene subset included genes identified by our approach and previously reported T2D-related genes, many additional discoveries can be found through our method.

  20. Identification of genes differentially expressed in ectomycorrhizal roots during the Pinus pinaster-Laccaria bicolor interaction.

    PubMed

    Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M

    2013-06-01

    Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.

  1. Identification of differentially expressed genes and their subpathways in recurrent versus primary bone giant cell tumors.

    PubMed

    Chen, Shuxin; Li, Chunquan; Wu, Bingli; Zhang, Chunlong; Liu, Cheng; Lin, Xiaoxu; Wu, Xiangqiao; Sun, Lingling; Liu, Chunpeng; Chen, Bo; Zhong, Zhigang; Xu, Liyan; Li, Enmin

    2014-09-01

    Giant cell tumor (GCT) of the bone is a benign but locally aggressive bone neoplasm with a strong tendency to develop local recurrent and metastatic disease. Thus, it provides a useful model system for the identification of biological mechanisms involved in bone tumor progression and metastasis. This study profiled 24 cases of recurrent versus primary bone GCT tissues using QuantiGene 2.0 Multiplex Arrays that included Human p53 80-Plex Panels and Human Stem Cell 80-Plex Panels. A total of 32 differentially expressed genes were identified, including the 20 most upregulated genes and the 12 most downregulated genes in recurrent GCT. The genes identified are related to cell growth, adhesion, apoptosis, signal transduction and bone formation. Furthermore, iSubpathwayMiner analyses were performed to identify significant biological pathway regions (subpathway) associated with this disease. The pathway analysis identified 11 statistically significant enriched subpathways, including pathways in cancer, p53 signaling pathway, osteoclast differentiation pathway and Wnt signaling pathway. Among these subpathways, four genes (IGF1, MDM2, STAT1 and RAC1) were presumed to play an important role in bone GCT recurrence. The differentially expressed MDM2 protein was immunohistochemically confirmed in the recurrent versus primary bone GCT tissues. This study identified differentially expressed genes and their subpathways in recurrent GCT, which may serve as potential biomarkers for the prediction of GCT recurrence.

  2. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling.

    PubMed

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-03-04

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori.

  3. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling

    PubMed Central

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-01-01

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori. PMID:25736158

  4. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba.

    PubMed

    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong

    2016-09-20

    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  5. Gene expression signatures defining fundamental biological processes in pluripotent, early, and late differentiated embryonic stem cells.

    PubMed

    Gaspar, John Antonydas; Doss, Michael Xavier; Winkler, Johannes; Wagh, Vilas; Hescheler, Jürgen; Kolde, Raivo; Vilo, Jaak; Schulz, Herbert; Sachinidis, Agapios

    2012-09-01

    Investigating the molecular mechanisms controlling the in vivo developmental program postembryogenesis is challenging and time consuming. However, the developmental program can be partly recapitulated in vitro by the use of cultured embryonic stem cells (ESCs). Similar to the totipotent cells of the inner cell mass, gene expression and morphological changes in cultured ESCs occur hierarchically during their differentiation, with epiblast cells developing first, followed by germ layers and finally somatic cells. Combination of high throughput -omics technologies with murine ESCs offers an alternative approach for studying developmental processes toward organ-specific cell phenotypes. We have made an attempt to understand differentiation networks controlling embryogenesis in vivo using a time kinetic, by identifying molecules defining fundamental biological processes in the pluripotent state as well as in early and the late differentiation stages of ESCs. Our microarray data of the differentiation of the ESCs clearly demonstrate that the most critical early differentiation processes occur at days 2 and 3 of differentiation. Besides monitoring well-annotated markers pertinent to both self-renewal and potency (capacity to differentiate to different cell lineage), we have identified candidate molecules for relevant signaling pathways. These molecules can be further investigated in gain and loss-of-function studies to elucidate their role for pluripotency and differentiation. As an example, siRNA knockdown of MageB16, a gene highly expressed in the pluripotent state, has proven its influence in inducing differentiation when its function is repressed.

  6. The Antiaging Gene Klotho Regulates Proliferation and Differentiation of Adipose-Derived Stem Cells

    PubMed Central

    Fan, Jun; Sun, Zhongjie

    2017-01-01

    Klotho was originally discovered as an aging-suppressor gene. The purpose of this study was to investigate whether secreted Klotho (SKL) affects the proliferation and differentiation of adipose-derived stem cells (ADSCs). RT-PCR and Western blot analysis showed that short-form Klotho was expressed in mouse ADSCs. The Klotho gene mutation KL(−/−) significantly decreased proliferation of ADSCs and expression of pluripotent transcription factors (Nanog, Sox-2, and Oct-4) in mice. The adipogenic differentiation of ADSCs was also decreased in KL(−/−) mice. Incubation with Klotho-deficient medium decreased ADSC proliferation, pluripotent transcription factor levels, and adipogenic differentiation, which is similar to what was found in KL(−/−) mice. These results indicate that Klotho deficiency suppresses ADSC proliferation and differentiation. Interestingly, treatment with recombinant SKL protein rescued the Klotho deficiency-induced impairment in ADSC proliferation and adipogenic differentiation. SKL also regulated ADSCs’ differentiation to other cell lineages (osteoblasts, myofibroblasts), indicating that SKL maintains stemness of ADSCs. It is intriguing that overexpression of SKL significantly increased PPAR-γ expression and lipid formation in ADSCs following adipogenic induction, indicating enhanced adipogenic differentiation. Overexpression of SKL inhibited expression of TGFβ1 and its downstream signaling mediator Smad2/3. This study demonstrates, for the first time, that SKL is essential to the maintenance of normal proliferation and differentiation in ADSCs. Klotho regulates adipogenic differentiation in ADSCs, likely via inhibition of TGFβ1 and activation of PPAR-γ. PMID:26865060

  7. MRI reporter genes: applications for imaging of cell survival, proliferation, migration and differentiation.

    PubMed

    Vandsburger, Moriel H; Radoul, Marina; Cohen, Batya; Neeman, Michal

    2013-07-01

    Molecular imaging strives to detect molecular events at the level of the whole organism. In some cases, the molecule of interest can be detected either directly or with targeted contrast media. However many genes and proteins and particularly those located in intracellular compartments are not accessible for targeted agents. The transcriptional regulation of these genes can nevertheless be detected, although indirectly, using reporter gene encoding for readily detectable proteins. Such reporter proteins can be expressed in the tissue of interest by genetically introducing the reporter gene in the target cells. Imaging of reporter genes has become a powerful tool in modern biomedical research. Typically, expression of fluorescent and bioluminescent proteins and the reaction product of expressed enzymes and exogenous substrates were examined using in vitro histological methods and in vivo whole body imaging methods. Recent advances in MRI reporter gene methods raised the possibility that MRI could become a powerful tool for concomitant high-resolution anatomical and functional imaging and for imaging of reporter gene activity. An immediate application of MRI reporter gene methods was by monitoring gene expression patterns in gene therapy and in vivo imaging of the survival, proliferation, migration and differentiation of pluripotent and multipotent cells used in cell-based regenerative therapies for cancer, myocardial infarction and neural degeneration. In this review, we characterized a variety of MRI reporter gene methods based on their applicability to report cell survival/proliferation, migration and differentiation. In particular, we discussed which methods were best suited for translation to clinical use in regenerative therapies.

  8. Differential loss of embryonic globin genes during the radiation of placental mammals

    PubMed Central

    Opazo, Juan C.; Hoffmann, Federico G.; Storz, Jay F.

    2008-01-01

    The differential gain and loss of genes from homologous gene families represents an important source of functional variation among the genomes of different species. Differences in gene content between species are primarily attributable to lineage-specific gene gains via duplication and lineage-specific losses via deletion or inactivation. Here, we use a comparative genomic approach to investigate this process of gene turnover in the β-globin gene family of placental mammals. By analyzing genomic sequence data from representatives of each of the main superordinal clades of placental mammals, we were able to reconstruct pathways of gene family evolution during the basal radiation of this physiologically and morphologically diverse vertebrate group. Our analysis revealed that an initial expansion of the nonadult portion of the β-globin gene cluster in the ancestor of placental mammals was followed by the differential loss and retention of ancestral gene lineages, thereby generating variation in the complement of embryonic globin genes among contemporary species. The sorting of ε-, γ-, and η-globin gene lineages among the basal clades of placental mammals has produced species differences in the functional types of hemoglobin isoforms that can be synthesized during the course of embryonic development. PMID:18755893

  9. Stress response in tardigrades: differential gene expression of molecular chaperones.

    PubMed

    Reuner, Andy; Hengherr, Steffen; Mali, Brahim; Förster, Frank; Arndt, Detlev; Reinhardt, Richard; Dandekar, Thomas; Frohme, Marcus; Brümmer, Franz; Schill, Ralph O

    2010-07-01

    Semi-terrestrial tardigrades exhibit a remarkable tolerance to desiccation by entering a state called anhydrobiosis. In this state, they show a strong resistance against several kinds of physical extremes. Because of the probable importance of stress proteins during the phases of dehydration and rehydration, the relative abundance of transcripts coding for two alpha-crystallin heat-shock proteins (Mt-sHsp17.2 and Mt-sHsp19.5), as well for the heat-shock proteins Mt-sHsp10, Mt-Hsp60, Mt-Hsp70 and Mt-Hsp90, were analysed in active and anhydrobiotic tardigrades of the species Milnesium tardigradum. They were also analysed in the transitional stage (I) of dehydration, the transitional stage (II) of rehydration and in heat-shocked specimens. A variable pattern of expression was detected, with most candidates being downregulated. Gene transcripts of one Mt-hsp70 isoform in the transitional stage I and Mt-hsp90 in the anhydrobiotic stage were significantly upregulated. A high gene expression (778.6-fold) was found for the small alpha-crystallin heat-shock protein gene Mt-sHsp17.2 after heat shock. We discuss the limited role of the stress-gene expression in the transitional stages between the active and anhydrobiotic tardigrades and other mechanisms which allow tardigrades to survive desiccation.

  10. A study on differentially expressed gene screening of Chrysanthemum plants under sound stress.

    PubMed

    Hongbo, Shao; Biao, Li; Bochu, Wang; Kun, Tang; Yilong, Liang

    2008-05-01

    Environmental stress can induce differential expression of genes of flower plants. It had been found that sound stimulation had an obvious effect on the growth and development of flower plants, but it is not reported on the differentially expressed genes and their expressing characteristics under sound stimulation. This is one of the few reports in terms of using the DDRT-PCR technique for screening the differentially expressed cDNA fragments responding to sound-wave stress on Chrysanthemum. Six differentially expressed cDNA fragments were obtained. Molecular weight of fragments was from 200 to 600 bp, respectively. Among differential fragments acquired, three of them (SA3, SG7-1, and CA2) were found to be positive fragments by northern dot hybridization, whose molecular weight are 270, 580 and 370 bp, respectively. SA3 was differentially expressed and SG7-1 was preferably expressed, while CA2 was restrained by the sound wave. These results indicated that expression of some genes was turned on, meanwhile the stress restrained some genes from expression under the mode of sound-stress stimulation.

  11. Gluten affects epithelial differentiation-associated genes in small intestinal mucosa of coeliac patients.

    PubMed

    Juuti-Uusitalo, K; Mäki, M; Kainulainen, H; Isola, J; Kaukinen, K

    2007-11-01

    In coeliac disease gluten induces an immunological reaction in genetically susceptible patients, and influences on epithelial cell proliferation and differentiation in the small-bowel mucosa. Our aim was to find novel genes which operate similarly in epithelial proliferation and differentiation in an epithelial cell differentiation model and in coeliac disease patient small-bowel mucosal biopsy samples. The combination of cDNA microarray data originating from a three-dimensional T84 epithelial cell differentiation model and small-bowel mucosal biopsy samples from untreated and treated coeliac disease patients and healthy controls resulted in 30 genes whose mRNA expression was similarly affected. Nine of 30 were located directly or indirectly in the receptor tyrosine kinase pathway starting from the epithelial growth factor receptor. Removal of gluten from the diet resulted in a reversion in the expression of 29 of the 30 genes in the small-bowel mucosal biopsy samples. Further characterization by blotting and labelling revealed increased epidermal growth factor receptor and beta-catenin protein expression in the small-bowel mucosal epithelium in untreated coeliac disease patients compared to healthy controls and treated coeliac patients. We found 30 genes whose mRNA expression was affected similarly in the epithelial cell differentiation model and in the coeliac disease patient small-bowel mucosal biopsy samples. In particular, those genes involved in the epithelial growth factor-mediated signalling pathways may be involved in epithelial cell differentiation and coeliac disease pathogenesis. The epithelial cell differentiation model is a useful tool for studying gene expression changes in the crypt-villus axis.

  12. Conjugated linoleic acid-induced milk fat depression in lactating ewes is accompanied by reduced expression of mammary genes involved in lipid synthesis.

    PubMed

    Hussein, M; Harvatine, K H; Weerasinghe, W M P B; Sinclair, L A; Bauman, D E

    2013-06-01

    Conjugated linoleic acids (CLA) are produced during rumen biohydrogenation and exert a range of biological effects. The trans-10,cis-12 CLA isomer is a potent inhibitor of milk fat synthesis in lactating dairy cows and some aspects of the mechanism have been established. Conjugated linoleic acid-induced milk fat depression has also been observed in small ruminants and our objective was to examine the molecular mechanism in lactating ewes. Multiparous lactating ewes were fed a basal ration (0.55:0.45 concentrate-to-forage ratio; dry matter basis) and randomly allocated to 2 dietary CLA levels (n=8 ewes/treatment). Treatments were zero CLA (control) or 15 g/d of lipid-encapsulated CLA supplement containing cis-9,trans-11 and trans-10,cis-12 CLA isomers in equal proportions. Treatments were fed for 10 wk and the CLA supplement provided 1.5 g of trans-10,cis-12/d. No treatment effects were observed on milk yield or milk composition for protein or lactose at wk 10 of the study. In contrast, CLA treatment significantly decreased both milk fat percentage and milk fat yield (g/d) by about 23%. The de novo synthesized fatty acids (FA; C16) was increased (10%) for the CLA treatment. In agreement with the reduced de novo FA synthesis, mRNA abundance of acetyl-coenzyme A carboxylase α, FA synthase, stearoyl-CoA desaturase 1, and glycerol-3-phosphate acyltransferase 6 decreased by 25 to 40% in the CLA-treated group. Conjugated linoleic acid treatment did not significantly reduce the mRNA abundance of enzymes involved in NADPH production, but the mRNA abundance for sterol regulatory element-binding factor 1 and insulin-induced gene 1, genes involved in regulation of transcription of lipogenic enzymes, was decreased by almost 30 and 55%, respectively, with CLA treatment. Furthermore, mRNA abundance of lipoprotein lipase decreased by almost 40% due to CLA treatment

  13. Differential modulation of gene expression in the NMDA postsynaptic density of schizophrenic and control smokers.

    PubMed

    Mexal, S; Frank, M; Berger, R; Adams, C E; Ross, R G; Freedman, R; Leonard, S

    2005-10-03

    Nicotine is known to induce the release of multiple neurotransmitters, including glutamate and dopamine, through activation of nicotinic receptors. Gene expression in the N-methyl-d-aspartate postsynaptic density (NMDA-PSD), as well as other functional groups, was compared in postmortem hippocampus of schizophrenic and nonmentally ill smokers and nonsmokers utilizing a microarray and quantitative RT-PCR approach. The expression of 277 genes was significantly changed between all smokers and nonsmokers. Specific gene groups, most notably genes expressed in the NMDA-PSD, were prevalent among these transcripts. Analysis of the interaction between smoking and schizophrenia identified several genes in the NMDA-PSD that were differentially affected by smoking in patients. The present findings suggest that smoking may differentially modulate glutamatergic function in schizophrenic patients and control subjects. The biological mechanisms underlying chronic tobacco use are likely to differ substantially between these two groups.

  14. Parsing parallel evolution: ecological divergence and differential gene expression in the adaptive radiations of thick-lipped Midas cichlid fishes from Nicaragua.

    PubMed

    Manousaki, Tereza; Hull, Pincelli M; Kusche, Henrik; Machado-Schiaffino, Gonzalo; Franchini, Paolo; Harrod, Chris; Elmer, Kathryn R; Meyer, Axel

    2013-02-01

    The study of parallel evolution facilitates the discovery of common rules of diversification. Here, we examine the repeated evolution of thick lips in Midas cichlid fishes (the Amphilophus citrinellus species complex)-from two Great Lakes and two crater lakes in Nicaragua-to assess whether similar changes in ecology, phenotypic trophic traits and gene expression accompany parallel trait evolution. Using next-generation sequencing technology, we characterize transcriptome-wide differential gene expression in the lips of wild-caught sympatric thick- and thin-lipped cichlids from all four instances of repeated thick-lip evolution. Six genes (apolipoprotein D, myelin-associated glycoprotein precursor, four-and-a-half LIM domain protein 2, calpain-9, GTPase IMAP family member 8-like and one hypothetical protein) are significantly underexpressed in the thick-lipped morph across all four lakes. However, other aspects of lips' gene expression in sympatric morphs differ in a lake-specific pattern, including the magnitude of differentially expressed genes (97-510). Generally, fewer genes are differentially expressed among morphs in the younger crater lakes than in those from the older Great Lakes. Body shape, lower pharyngeal jaw size and shape, and stable isotopes (δ(13)C and δ(15)N) differ between all sympatric morphs, with the greatest differentiation in the Great Lake Nicaragua. Some ecological traits evolve in parallel (those related to foraging ecology; e.g. lip size, body and head shape) but others, somewhat surprisingly, do not (those related to diet and food processing; e.g. jaw size and shape, stable isotopes). Taken together, this case of parallelism among thick- and thin-lipped cichlids shows a mosaic pattern of parallel and nonparallel evolution.

  15. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    PubMed Central

    Nindl, Ingo; Dang, Chantip; Forschner, Tobias; Kuban, Ralf J; Meyer, Thomas; Sterry, Wolfram; Stockfleth, Eggert

    2006-01-01

    Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC). Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled), actinic keratosis (AK) (two were pooled), and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p < 0.05). Verification of 13 up- or down-regulated genes was performed by quantitative real-time reverse transcription (RT)-PCR and genes were additionally confirmed by sequencing. Broad coherent patterns in normal skin vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described. PMID:16893473

  16. Identification of differentially expressed genes in uveal melanoma using suppressive subtractive hybridization

    PubMed Central

    Landreville, Solange; Lupien, Caroline B.; Vigneault, Francois; Gaudreault, Manon; Mathieu, Mélissa; Rousseau, Alain P.; Guérin, Sylvain L.

    2011-01-01

    Purpose Uveal melanoma (UM) is the most common primary cancer of the eye, resulting not only in vision loss, but also in metastatic death. This study attempts to identify changes in the patterns of gene expression that lead to malignant transformation and proliferation of normal uveal melanocytes (UVM) using the Suppressive Subtractive Hybridization (SSH) technique. Methods The SSH technique was used to isolate genes that are differentially expressed in the TP31 cell line derived from a primary UM compared to UVM. The expression level of selected genes was further validated by microarray, semi-quantitative RT–PCR and western blot analyses. Results Analysis of the subtracted libraries revealed that 37 and 36 genes were, respectively, up- and downregulated in TP31 cells compared to UVM. Differential expression of the majority of these genes was confirmed by comparing UM cells with UVM by microarray. The expression pattern of selected genes was analyzed by semi-quantitative RT–PCR and western blot, and was found to be consistent with the SSH findings. Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes in UM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. PMID:21647268

  17. Differentiation of Xylella fastidiosa strains via multilocus sequence analysis of environmentally mediated genes (MLSA-E).

    PubMed

    Parker, Jennifer K; Havird, Justin C; De La Fuente, Leonardo

    2012-03-01

    Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though <1 due to high sequence similarity, are significantly greater than housekeeping gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing

  18. The Program of Gene Transcription for a Single Differentiating Cell Type during Sporulation in Bacillus subtilis

    PubMed Central

    Eichenberger, Patrick; Fujita, Masaya; Jensen, Shane T; Conlon, Erin M; Rudner, David Z; Wang, Stephanie T; Ferguson, Caitlin; Haga, Koki; Sato, Tsutomu; Liu, Jun S

    2004-01-01

    Asymmetric division during sporulation by Bacillus subtilis generates a mother cell that undergoes a 5-h program of differentiation. The program is governed by a hierarchical cascade consisting of the transcription factors: σE, σK, GerE, GerR, and SpoIIID. The program consists of the activation and repression of 383 genes. The σE factor turns on 262 genes, including those for GerR and SpoIIID. These DNA-binding proteins downregulate almost half of the genes in the σE regulon. In addition, SpoIIID turns on ten genes, including genes involved in the appearance of σK . Next, σK activates 75 additional genes, including that for GerE. This DNA-binding protein, in turn, represses half of the genes that had been activated by σK while switching on a final set of 36 genes. Evidence is presented that repression and activation contribute to proper morphogenesis. The program of gene expression is driven forward by its hierarchical organization and by the repressive effects of the DNA-binding proteins. The logic of the program is that of a linked series of feed-forward loops, which generate successive pulses of gene transcription. Similar regulatory circuits could be a common feature of other systems of cellular differentiation. PMID:15383836

  19. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION

    PubMed Central

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J.; Alexander, Warren S.; Smyth, Gordon K.

    2017-01-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  20. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION.

    PubMed

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J; Alexander, Warren S; Smyth, Gordon K

    2016-06-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  1. An Orthologous Epigenetic Gene Expression Signature Derived from Differentiating Embryonic Stem Cells Identifies Regulators of Cardiogenesis.

    PubMed

    Busser, Brian W; Lin, Yongshun; Yang, Yanqin; Zhu, Jun; Chen, Guokai; Michelson, Alan M

    2015-01-01

    Here we used predictive gene expression signatures within a multi-species framework to identify the genes that underlie cardiac cell fate decisions in differentiating embryonic stem cells. We show that the overlapping orthologous mouse and human genes are the most accurate candidate cardiogenic genes as these genes identified the most conserved developmental pathways that characterize the cardiac lineage. An RNAi-based screen of the candidate genes in Drosophila uncovered numerous novel cardiogenic genes. shRNA knockdown combined with transcriptome profiling of the newly-identified transcription factors zinc finger protein 503 and zinc finger E-box binding homeobox 2 and the well-known cardiac regulatory factor NK2 homeobox 5 revealed that zinc finger E-box binding homeobox 2 activates terminal differentiation genes required for cardiomyocyte structure and function whereas zinc finger protein 503 and NK2 homeobox 5 are required for specification of the cardiac lineage. We further demonstrated that an essential role of NK2 homeobox 5 and zinc finger protein 503 in specification of the cardiac lineage is the repression of gene expression programs characteristic of alternative cell fates. Collectively, these results show that orthologous gene expression signatures can be used to identify conserved cardiogenic pathways.

  2. DNA Methylation Profiling Reveals Correlation of Differential Methylation Patterns with Gene Expression in Human Epilepsy.

    PubMed

    Wang, Liang; Fu, Xinwei; Peng, Xi; Xiao, Zheng; Li, Zhonggui; Chen, Guojun; Wang, Xuefeng

    2016-05-01

    DNA methylation plays important roles in regulating gene expression and has been reported to be related with epilepsy. This study aimed to define differential DNA methylation patterns in drug-refractory epilepsy patients and to investigate the role of DNA methylation in human epilepsy. We performed DNA methylation profiling in brain tissues from epileptic and control patients via methylated-cytosine DNA immunoprecipitation microarray chip. Differentially methylated loci were validated by bisulfite sequencing PCR, and the messenger RNA (mRNA) levels of candidate genes were evaluated by reverse transcriptase PCR. We found 224 genes that showed differential DNA methylation between epileptic patients and controls. Among the seven candidate genes, three genes (TUBB2B, ATPGD1, and HTR6) showed relative transcriptional regulation by DNA methylation. TUBB2B and ATPGD1 exhibited hypermethylation and decreased mRNA levels, whereas HTR6 displayed hypomethylation and increased mRNA levels in the epileptic samples. Our findings suggest that certain genes become differentially regulated by DNA methylation in human epilepsy.

  3. Umbilical cord mesenchymal stem cells: role of regulatory genes in their differentiation to osteoblasts.

    PubMed

    Ciavarella, Sabino; Dammacco, Franco; De Matteo, Monica; Loverro, Giuseppe; Silvestris, Franco

    2009-10-01

    Umbilical cord (UC) mesenchymal stem cells (MSCs) are being currently investigated as an alternative to bone marrow (BM) MSCs for bone repair and regeneration. Here, we describe the gene regulation of their differentiation to osteogenic, adipogenic, and chondrogenic precursors and demonstrate their tendency to differentiate toward the osteoblast lineage. Fibroblast-like cells from the Warthon's Jelly were cultured with dedicated media to obtain osteogenic-, adipogenic-, and chondrogenic-differentiated cells. After induction, a typical fibroblast-like shape with condensed fibers of F-actin was early noted in osteogenic-induced UC-MSCs, whereas those differentiating to adipocytes were flat with minor cytoskeleton relevance. Real-time PCR measured the transcription of master genes of the three lineages, thus revealing a remarkable up-regulation of Runx2 in osteogenic-induced cells with respect to both PPARg and SOX9 for adipogenic- and chondrogenic-differentiating UC-MSCs. However, TAZ, a coactivator of the nuclear transcription of Runx2 previously detected in BM-MSCs, was expressed in osteogenic- and, at lower magnitude, in adipogenic-induced cells, in keeping with its role in the reciprocal control of the differentiation between osteogenic- and adipogenic-induced cells. Its differential role in these cells was confirmed by its accumulation as protein product in the nuclei to activate Runx2 in osteogenic-differentiating UC-MSCs. These data emphasize the predominant expression by UC-MSCs of genes engaged in the osteogenic differentiation and their tendency to differentiate into osteoblasts, being similar in this respect to BM-MSCs. They may, thus, constitute a promising option for bone remodeling in regenerative medicine.

  4. Gene expression profiling of human neural progenitor cells following the serum-induced astrocyte differentiation.

    PubMed

    Obayashi, Shinya; Tabunoki, Hiroko; Kim, Seung U; Satoh, Jun-ichi

    2009-05-01

    Neural stem cells (NSC) with self-renewal and multipotent properties could provide an ideal cell source for transplantation to treat spinal cord injury, stroke, and neurodegenerative diseases. However, the majority of transplanted NSC and neural progenitor cells (NPC) differentiate into astrocytes in vivo under pathological environments in the central nervous system, which potentially cause reactive gliosis. Because the serum is a potent inducer of astrocyte differentiation of rodent NPC in culture, we studied the effect of the serum on gene expression profile of cultured human NPC to identify the gene signature of astrocyte differentiation of human NPC. Human NPC spheres maintained in the serum-free culture medium were exposed to 10% fetal bovine serum (FBS) for 72 h, and processed for analyzing on a Whole Human Genome Microarray of 41,000 genes, and the microarray data were validated by real-time RT-PCR. The serum elevated the levels of expression of 45 genes, including ID1, ID2, ID3, CTGF, TGFA, METRN, GFAP, CRYAB and CSPG3, whereas it reduced the expression of 23 genes, such as DLL1, DLL3, PDGFRA, SOX4, CSPG4, GAS1 and HES5. Thus, the serum-induced astrocyte differentiation of human NPC is characterized by a counteraction of ID family genes on Delta family genes. Coimmunoprecipitation analysis identified ID1 as a direct binding partner of a proneural basic helix-loop-helix (bHLH) transcription factor MASH1. Luciferase assay indicated that activation of the DLL1 promoter by MASH1 was counteracted by ID1. Bone morphogenetic protein 4 (BMP4) elevated the levels of ID1 and GFAP expression in NPC under the serum-free culture conditions. Because the serum contains BMP4, these results suggest that the serum factor(s), most probably BMP4, induces astrocyte differentiation by upregulating the expression of ID family genes that repress the proneural bHLH protein-mediated Delta expression in human NPC.

  5. Identification of differentially expressed genes in flax (Linum usitatissimum L.) under saline-alkaline stress by digital gene expression.

    PubMed

    Yu, Ying; Huang, Wengong; Chen, Hongyu; Wu, Guangwen; Yuan, Hongmei; Song, Xixia; Kang, Qinghua; Zhao, Dongsheng; Jiang, Weidong; Liu, Yan; Wu, Jianzhong; Cheng, Lili; Yao, Yubo; Guan, Fengzhi

    2014-10-01

    The salinization and alkalization of soil are widespread environmental problems, and alkaline salt stress is more destructive than neutral salt stress. Therefore, understanding the mechanism of plant tolerance to saline-alkaline stress has become a major challenge. However, little attention has been paid to the mechanism of plant alkaline salt tolerance. In this study, gene expression profiling of flax was analyzed under alkaline-salt stress (AS2), neutral salt stress (NSS) and alkaline stress (AS) by digital gene expression. Three-week-old flax seedlings were placed in 25 mM Na2CO3 (pH11.6) (AS2), 50mM NaCl (NSS) and NaOH (pH11.6) (AS) for 18 h. There were 7736, 1566 and 454 differentially expressed genes in AS2, NSS and AS compared to CK, respectively. The GO category gene enrichment analysis revealed that photosynthesis was particularly affected in AS2, carbohydrate metabolism was particularly affected in NSS, and the response to biotic stimulus was particularly affected in AS. We also analyzed the expression pattern of five categories of genes including transcription factors, signaling transduction proteins, phytohormones, reactive oxygen species proteins and transporters under these three stresses. Some key regulatory gene families involved in abiotic stress, such as WRKY, MAPKKK, ABA, PrxR and ion channels, were differentially expressed. Compared with NSS and AS, AS2 triggered more differentially expressed genes and special pathways, indicating that the mechanism of AS2 was more complex than NSS and AS. To the best of our knowledge, this was the first transcriptome analysis of flax in response to saline-alkaline stress. These data indicate that common and diverse features of saline-alkaline stress provide novel insights into the molecular mechanisms of plant saline-alkaline tolerance and offer a number of candidate genes as potential markers of tolerance to saline-alkaline stress.

  6. Differential expression of endocannabinoid system-related genes in the dorsal hippocampus following expression and reinstatement of morphine conditioned place preference in mice.

    PubMed

    Li, Wei; Zhang, Cong-Li; Qiu, Zheng-Guo

    2017-03-16

    The endocannabinoid signaling plays a critical role in mediating rewarding effects to morphine. The relative stability for the expression and reinstatement of morphine conditioned place preference (CPP) suggests the involvement of differential neuroadaptations in learned associations between environmental cues and morphine. Changes in gene expression in hippocampus through the endogenous cannabinoid system (eCB) may accompany and mediate the development of such neuroadaptations to repeated morphine stimulation. To test this possibility, we systematically compared the expression of eCB-related genes in the dorsal hippocampus following the expression, extinction, and reinstatement of morphine CPP using quantitative RT-PCR analyses. We found that expression of morphine CPP was associated with significant increases in mRNA expression for the primary clearance routes for anandamide (AEA) and 2-AG (fatty acid amide hydrolase [FAAH] and monoacylglycerol lipase [MAGL], respectively), but with reductions in cannabinoid 1 receptors (CB1R) and CB2R in dorsal hippocampus following the expression of CPP. However, our results indicated that decreased in MAGL and increased CB1R mRNA levels were accompanied with morphine CPP reinstatement. No significant changes in mRNA expression for enzymes involved in AEA and 2-AG biosynthesis (N-acylphosphatidylethanolamine phospholipase D [NAPEPLD] and diacylglycerol lipase-α/β [DAGLα/β], respectively) were found in all conditions. These results suggest that differential regulation of the synthesis and/or degradation of the eCB system contribute to the expression and reinstatement of morphine CPP.

  7. FOXO1A differentially regulates genes of decidualization.

    PubMed

    Buzzio, Oscar L; Lu, Zhenxiao; Miller, Curt D; Unterman, Terry G; Kim, J Julie

    2006-08-01

    The forkhead box O1A (FOXO1A) has been identified as one gene that is up-regulated early in the decidualization process. To further investigate the role of FOXO1A during this process, six genes, IGFBP1, PRL, TIMP3, LAMB1, CNR1, and DCN, shown to be up-regulated during decidualization, were chosen as potential targets of FOXO1A action. Treatment of human endometrial stromal cells with hormones (estradiol and medroxyprogesterone acetate) plus dibutyryl cAMP (H+dbcAMP) for 48 h increased expression of IGFBP1, PRL, TIMP3, CNR1, and DCN but not LAMB1, as measured by real-time PCR. Silencing of FOXO1A using small interfering RNA oligonucleotides decreased IGFBP1 and DCN levels and increased CNR1, TIMP3, and PRL levels. LAMB1 was not affected. When FOXO1A was overexpressed in human endometrial stromal cells, expression of IGFBP1, DCN, and PRL increased, whereas levels of TIMP3 and CNR1 decreased. Addition of H+dbcAMP caused an increased expression of IGFBP1, PRL, and DCN beyond that of FOXO1A alone. TIMP3 and CNR1 levels decreased even further in response to H+dbcAMP compared with FOXO1A alone. LAMB1, which was unresponsive to FOXO1A, decreased when H+dbcAMP was added. Overexpressing FOXO1A also caused a change in cell shape, in that the stromal fibroblasts acquired a rounded, epithelioid appearance. Finally, reporter studies showed that cotransfection of FOXO1A significantly increased PRL promoter activity but not TIMP3 promoter activity. Addition of H+dbcAMP resulted in a significant increase in PRL promoter activity and a significant decrease in TIMP3 promoter activity. In summary, this study demonstrates the versatile nature of FOXO1A in the regulation of a number of decidualization-specific genes.

  8. Climate niche differentiation between two passerines despite ongoing gene flow.

    PubMed

    Shaner, Pei-Jen L; Tsao, Tzu-Hsuan; Lin, Rong-Chien; Liang, Wei; Yeh, Chia-Fen; Yang, Xiao-Jun; Lei, Fu-Min; Zhou, Fang; Yang, Can-Chao; Hung, Le Manh; Hsu, Yu-Cheng; Li, Shou-Hsien

    2015-05-01

    Niche evolution underpins the generation and maintenance of biological diversity, but niche conservatism, in which niches remain little changed over time in closely related taxa, and the role of ecology in niche evolution are continually debated. To test whether climate niches are conserved in two closely related passerines in East Asia - the vinous-throated (Paradoxornis webbianus) and ashy-throated (P. alphonsianus) parrotbills - we established their potential allopatric and sympatric regions using ecological niche models and compared differences in their climate niches using niche overlap indices in background tests and multivariate statistical analyses. We also used polymorphism data on 44 nuclear genes to infer their divergence demography. We found that these two parrotbills occupy different climate niches, in both their allopatric and potential sympatric regions. Because the potential sympatric region is the area predicted to be suitable for both parrotbills based on the ecological niche models, it can serve as a natural common garden. Therefore, their observed niche differences in this potential sympatry were not simply rendered by phenotypic plasticity and probably had a genetic basis. Our genetic analyses revealed that the two parrotbills are not evolutionarily independent for the most recent part of their divergence history. The two parrotbills diverged c. 856,000 years ago and have had substantial gene flow since a presumed secondary contact c. 290,000 years ago. This study provides an empirical case demonstrating that climate niches may not be homogenized in nascent species in spite of substantial, ongoing gene flow, which in turn suggests a role for ecology in promoting and maintaining diversification among incipient species.

  9. Replicon-dependent differentiation of symbiosis-related genes in Sinorhizobium strains nodulating Glycine max.

    PubMed

    Guo, Hui Juan; Wang, En Tao; Zhang, Xing Xing; Li, Qin Qin; Zhang, Yan Ming; Tian, Chang Fu; Chen, Wen Xin

    2014-02-01

    In order to investigate the genetic differentiation of Sinorhizobium strains nodulating Glycine max and related microevolutionary mechanisms, three housekeeping genes (SMc00019, truA, and thrA) and 16 symbiosis-related genes on the chromosome (7 genes), pSymA (6 genes), and pSymB (3 genes) were analyzed. Five distinct species were identified among the test strains by calculating the average nucleotide identity (ANI) of SMc00019-truA-thrA: Sinorhizobium fredii, Sinorhizobium sojae, Sinorhizobium sp. I, Sinorhizobium sp. II, and Sinorhizobium sp. III. These species assignments were also supported by population genetics and phylogenetic analyses of housekeeping genes and symbiosis-related genes on the chromosome and pSymB. Different levels of genetic differentiation were observed among these species or different replicons. S. sojae was the most divergent from the other test species and was characterized by its low intraspecies diversity and limited geographic distribution. Intergenic recombination dominated the evolution of 19 genes from different replicons. Intraspecies recombination happened frequently in housekeeping genes and symbiosis-related genes on the chromosome and pSymB, whereas pSymA genes showed a clear pattern of lateral-transfer events between different species. Moreover, pSymA genes were characterized by a lower level of polymorphism and recombination than those on the chromosome and pSymB. Taken together, genes from different replicons of rhizobia might be involved in the establishment of symbiosis with legumes, but these symbiosis-related genes might have evolved differently according to their corresponding replicons.

  10. Gene Expression Profiling of H9c2 Myoblast Differentiation towards a Cardiac-Like Phenotype

    PubMed Central

    Branco, Ana F.; Pereira, Susana P.; Gonzalez, Susana; Gusev, Oleg; Rizvanov, Albert A.; Oliveira, Paulo J.

    2015-01-01

    H9c2 myoblasts are a cell model used as an alternative for cardiomyocytes. H9c2 cells have the ability to differentiate towards a cardiac phenotype when the media serum is reduced in the presence of all-trans-retinoic acid (RA), creating multinucleated cells with low proliferative capacity. In the present study, we performed for the first time a transcriptional analysis of the H9c2 cell line in two differentiation states, i.e. embryonic cells and differentiated cardiac-like cells. The results show that RA-induced H9c2 differentiation increased the expression of genes encoding for cardiac sarcomeric proteins such as troponin T, or calcium transporters and associated machinery, including SERCA2, ryanodine receptor and phospholamban as well as genes associated with mitochondrial energy production including respiratory chain complexes subunits, mitochondrial creatine kinase, carnitine palmitoyltransferase I and uncoupling proteins. Undifferentiated myoblasts showed increased gene expression of pro-survival proteins such as Bcl-2 as well as cell cycle-regulating proteins. The results indicate that the differentiation of H9c2 cells lead to an increase of transcripts and protein levels involved in calcium handling, glycolytic and mitochondrial metabolism, confirming that H9c2 cell differentiation induced by RA towards a more cardiac-like phenotype involves remodeled mitochondrial function. PI3K, PDK1 and p-CREB also appear to be involved on H9c2 differentiation. Furthermore, complex analysis of differently expressed transcripts revealed significant up-regulation of gene expression related to cardiac muscle contraction, dilated cardiomyopathy and other pathways specific for the cardiac tissue. Metabolic and gene expression remodeling impacts cell responses to different stimuli and determine how these cells are used for biochemical assays. PMID:26121149

  11. Analysis of differentially expressed genes in human hepatocellular carcinoma using suppression subtractive hybridization

    PubMed Central

    Miyasaka, Y; Enomoto, N; Nagayama, K; Izumi, N; Marumo, F; Watanabe, M; Sato, C

    2001-01-01

    The genetic basis of hepatocellular carcinoma (HCC) has not yet been fully understood. Although various methods have been developed to detect differentially expressed genes in malignant diseases, efficient analysis from clinical specimens is generally difficult to perform due to the requirement of a large amount of samples. In the present study, we analysed differentially expressed genes with a small amount of human HCC samples using suppression subtractive hybridization (SSH). Total RNA were obtained from the hepatitis C virus-associated HCC and adjacent non-HCC liver tissues. cDNA was synthesized using modified RT-PCR, and then tester cDNA was ligated with 2 different kinds of adaptors and hybridized with an excess amount of driver cDNA. Tester specific cDNA was obtained by suppression PCR and the final PCR product was subcloned and sequenced. We identified 7 known genes (focal adhesion kinase, deleted in colon cancer, guanine binding inhibitory protein α, glutamine synthetase, ornithine aminotransferase, M130, and pepsinogen C) and 2 previously unknown genes as being overexpressed in HCC, and 1 gene (decorin) as suppressed in HCC. Quantitative analysis of gene expression using quantitative RT-PCR demonstrated the differential expression of these genes in the original and other HCC samples. These findings demonstrated that it is possible to identify the previously unknown, differential gene expression from a small amount of clinical samples. Information about such alterations in gene expression could be useful for elucidating the genetic events in HCC pathogenesis, developing the new diagnosic markers, or determining novel therapeutic targets. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11461082

  12. Exposure to an organophosphate pesticide, individually or in combination with other Gulf War agents, impairs synaptic integrity and neuronal differentiation, and is accompanied by subtle microvascular injury in a mouse model of Gulf War agent exposure.

    PubMed

    Ojo, Joseph O; Abdullah, Laila; Evans, James; Reed, Jon Mike; Montague, Hannah; Mullan, Michael J; Crawford, Fiona C

    2014-04-01

    Gulf War illness (GWI) is a currently untreatable multi-symptom disorder experienced by 1990-1991 Persian Gulf War (GW) veterans. The characteristic hallmarks of GWI include cognitive dysfunction, tremors, migraine, and psychological disturbances such as depression and anxiety. Meta-analyses of epidemiological studies have consistently linked these symptomatic profiles to the combined exposure of GW agents such as organophosphate-based and pyrethroid-based pesticides (e.g. chlorpyrifos (CPF) and permethrin (PER) respectively) and the prophylactic use of pyridostigmine bromide (PB) as a treatment against neurotoxins. Due to the multi-symptomatic presentation of this illness and the lack of available autopsy tissue from GWI patients, very little is currently known about the distinct early pathological profile implicated in GWI (including its influence on synaptic function and aspects of neurogenesis). In this study, we used preclinical models of GW agent exposure to investigate whether 6-month-old mice exposed to CPF alone, or a combined dose of CPF, PB and PER daily for 10 days, demonstrate any notable pathological changes in hippocampal, cortical (motor, piriform) or amygdalar morphometry. We report that at an acute post-exposure time point (after 3 days), both exposures resulted in the impairment of synaptic integrity (reducing synaptophysin levels) in the CA3 hippocampal region and altered neuronal differentiation in the dentate gyrus (DG), demonstrated by a significant reduction in doublecortin positive cells. Both exposures also significantly increased astrocytic GFAP immunoreactivity in the piriform cortex, motor cortex and the basolateral amygdala and this was accompanied by an increase in (basal) brain acetylcholine (ACh) levels. There was no evidence of microglial activation or structural deterioration of principal neurons in these regions following exposure to CPF alone or in combination with PB and PER. Evidence of subtle microvascular injury was

  13. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  14. Transcriptome profiling identifies differentially expressed genes in postnatal developing pituitary gland of miniature pig.

    PubMed

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development.

  15. Transcriptome Profiling Identifies Differentially Expressed Genes in Postnatal Developing Pituitary Gland of Miniature Pig

    PubMed Central

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development. PMID:24282060

  16. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    PubMed

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  17. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes.

    PubMed

    Gierz, Sarah L; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral's daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions.

  18. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes

    PubMed Central

    Gierz, Sarah L.; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral’s daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions. PMID:28293249

  19. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    SciTech Connect

    Robinson, Claire; Kolb, Andreas F.

    2009-02-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A {beta}-galactosidase reporter gene was inserted in place of the {beta}-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the {beta}-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal {beta}-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the {beta}-casein gene.

  20. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling

    PubMed Central

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  1. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-07-07

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development.

  2. An independent validation of a gene expression signature to differentiate malignant melanoma from benign melanocytic nevi

    PubMed Central

    Flake, Darl D.; Busam, Klaus; Cockerell, Clay; Helm, Klaus; McNiff, Jennifer; Reed, Jon; Tschen, Jaime; Kim, Jinah; Barnhill, Raymond; Elenitsas, Rosalie; Prieto, Victor G.; Nelson, Jonathan; Kimbrell, Hillary; Kolquist, Kathryn A.; Brown, Krystal L.; Warf, M. Bryan; Roa, Benjamin B.; Wenstrup, Richard J.

    2016-01-01

    BACKGROUND Recently, a 23‐gene signature was developed to produce a melanoma diagnostic score capable of differentiating malignant and benign melanocytic lesions. The primary objective of this study was to independently assess the ability of the gene signature to differentiate melanoma from benign nevi in clinically relevant lesions. METHODS A set of 1400 melanocytic lesions was selected from samples prospectively submitted for gene expression testing at a clinical laboratory. Each sample was tested and subjected to an independent histopathologic evaluation by 3 experienced dermatopathologists. A primary diagnosis (benign or malignant) was assigned to each sample, and diagnostic concordance among the 3 dermatopathologists was required for inclusion in analyses. The sensitivity and specificity of the score in differentiating benign and malignant melanocytic lesions were calculated to assess the association between the score and the pathologic diagnosis. RESULTS The gene expression signature differentiated benign nevi from malignant melanoma with a sensitivity of 91.5% and a specificity of 92.5%. CONCLUSIONS These results reflect the performance of the gene signature in a diverse array of samples encountered in routine clinical practice. Cancer 2017;123:617–628. © 2016 American Cancer Society. PMID:27768230

  3. Identification of differentially expressed genes in Chrysanthemum nankingense (Asteraceae) under heat stress by RNA Seq.

    PubMed

    Sun, Jing; Ren, Liping; Cheng, Yue; Gao, Jiaojiao; Dong, Bin; Chen, Sumei; Chen, Fadi; Jiang, Jiafu

    2014-11-15

    The RNA-Seq platform was used to characterize the high-temperature stress response of Chrysanthemum nankingense. A set of 54,668 differentially expressed unigenes was identified. After a threshold of ratio change ≥ 2 and a q-value of <0.05 were applied, the number of differentially transcribed genes was reduced to 3955, of which 765 were up-regulated and 3190 were down-regulated in response to heat stress. The differentially transcribed genes were predicted to participate in 26 biological processes, 4 cellular components, and 13 molecular functions. Among the most differentially expressed genes between the two libraries were well-recognized high-temperature responsive protein families, such as heat shock factors and heat shock proteins, various transcription factor families, and a number of RNA metabolism-related genes. Overall, the RNA-Seq analyses revealed a high degree of transcriptional complexity in early heat stress response. Some of these high-temperature responsive C. nankingense genes may prove useful in efforts to improve thermotolerance of commercial chrysanthemum.

  4. NetDiff - Bayesian model selection for differential gene regulatory network inference.

    PubMed

    Thorne, Thomas

    2016-12-16

    Differential networks allow us to better understand the changes in cellular processes that are exhibited in conditions of interest, identifying variations in gene regulation or protein interaction between, for example, cases and controls, or in response to external stimuli. Here we present a novel methodology for the inference of differential gene regulatory networks from gene expression microarray data. Specifically we apply a Bayesian model selection approach to compare models of conserved and varying network structure, and use Gaussian graphical models to represent the network structures. We apply a variational inference approach to the learning of Gaussian graphical models of gene regulatory networks, that enables us to perform Bayesian model selection that is significantly more computationally efficient than Markov Chain Monte Carlo approaches. Our method is demonstrated to be more robust than independent analysis of data from multiple conditions when applied to synthetic network data, generating fewer false positive predictions of differential edges. We demonstrate the utility of our approach on real world gene expression microarray data by applying it to existing data from amyotrophic lateral sclerosis cases with and without mutations in C9orf72, and controls, where we are able to identify differential network interactions for further investigation.

  5. Differential gene expression profiling of large and small retinal ganglion cells

    PubMed Central

    Ivanov, Dmitry; Dvoriantchikova, Galina; Barakat, David J.; Nathanson, Lubov; Shestopalov, Valery I.

    2014-01-01

    Different sub-populations of retinal ganglion cells (RGCs) vary in their sensitivity to pathological conditions such as retinal ischemia, diabetic retinopathy and glaucoma. Comparative transcriptomic analysis of such groups will likely reveal molecular determinants of differential sensitivity to stress. However, gene expression profiling of primary neuronal sub-populations represent a challenge due to the cellular heterogeneity of retinal tissue. In this manuscript, we report the use of a fluorescent neural tracer to specifically label and selectively isolate RGCs with different soma sizes by fluorescence-activated cell sorting (FACS) for the purpose of differential gene expression profiling. We identified 145 genes that were more active in the large RGCs and 312 genes in the small RGCs. Differential data were validated by quantitative RT-PCR, several corresponding proteins were confirmed by immunohistochemistry. Functional characterization revealed differential activity of genes implicated in synaptic transmission, neurotransmitter secretion, axon guidance, chemotaxis, ion transport and tolerance to stress. An in silico reconstruction of cellular networks suggested that differences in pathway activity between the two sub-populations of RGCs are controlled by networks interconnected by SP-1, Erk2(MAPK1), Egr1, Egr2 and, potentially, regulated via transcription factors C/EBPbeta, HSF1, STAT1- and c-Myc. The results show that FACS-aided purification of retrogradely labeled cells can be effectively utilized for transcriptional profiling of adult retinal neurons. PMID:18640154

  6. NetDiff – Bayesian model selection for differential gene regulatory network inference

    PubMed Central

    Thorne, Thomas

    2016-01-01

    Differential networks allow us to better understand the changes in cellular processes that are exhibited in conditions of interest, identifying variations in gene regulation or protein interaction between, for example, cases and controls, or in response to external stimuli. Here we present a novel methodology for the inference of differential gene regulatory networks from gene expression microarray data. Specifically we apply a Bayesian model selection approach to compare models of conserved and varying network structure, and use Gaussian graphical models to represent the network structures. We apply a variational inference approach to the learning of Gaussian graphical models of gene regulatory networks, that enables us to perform Bayesian model selection that is significantly more computationally efficient than Markov Chain Monte Carlo approaches. Our method is demonstrated to be more robust than independent analysis of data from multiple conditions when applied to synthetic network data, generating fewer false positive predictions of differential edges. We demonstrate the utility of our approach on real world gene expression microarray data by applying it to existing data from amyotrophic lateral sclerosis cases with and without mutations in C9orf72, and controls, where we are able to identify differential network interactions for further investigation. PMID:27982083

  7. Juvenile Hormone Differentially Regulates Two Grp78 Genes Encoding Protein Chaperones Required for Insect Fat Body Cell Homeostasis and Vitellogenesis.

    PubMed

    Luo, Maowu; Li, Dong; Wang, Zhiming; Guo, Wei; Kang, Le; Zhou, Shutang

    2017-03-29

    Juvenile hormone (JH) has a well-known role in stimulating insect vitellogenesis (i.e. yolk deposition) and oocyte maturation, but the molecular mechanisms of JH action in insect reproduction are unclear. Glucose-regulated protein of 78 kDa (Grp78) is a heat shock protein 70 kDa family member and one of the most abundant chaperones in the endoplasmic reticulum (ER) where it helps fold newly synthesized peptides. Because of its prominent role in protein folding and also ER stress, we hypothesized that Grp78 might be involved in fat body cell homeostasis and vitellogenesis and a regulatory target of JH. We report here that the migratory locust Locusta migratoria possesses two Grp78 genes that are differentially regulated by JH. We found that Grp78-1 is regulated by JH through Mcm4/7-dependent DNA replication and polyploidization, whereas Grp78-2 expression is directly activated by the JH-receptor complex comprising Methoprene-tolerant and Taiman proteins. Interestingly, Grp78-2 expression in the fat body is about 10-fold higher than that of Grp78-1 Knockdown of either Grp78-1 or Grp78-2 significantly reduced levels of vitellogenin (Vg) protein, accompanied by retarded maturation of oocytes. Depletion of both Grp78-1 and Grp78-2 resulted in ER stress and apoptosis in the fat body and in severely defective Vg synthesis and oocyte maturation. These results indicate a crucial role of Grp78 in JH-dependent vitellogenesis and egg production. The presence and differential regulation of two Grp78 genes in L. migratoria likely help accelerate the production of this chaperone in the fat body to facilitate folding of massively synthesized Vg and other proteins.

  8. Genome-wide p63-regulated gene expression in differentiating epidermal keratinocytes

    PubMed Central

    Oti, Martin; Kouwenhoven, Evelyn N.; Zhou, Huiqing

    2015-01-01

    The transcription factor p63 is a key regulator in epidermal keratinocyte proliferation and differentiation. However, the role of p63 in gene regulation during these processes is not well understood. To investigate this, we recently generated genome-wide profiles of gene expression, p63 binding sites and active regulatory regions with the H3K27ac histone mark (Kouwenhoven et al., 2015). We showed that only a subset of p63 binding sites are active in keratinocytes, and that differentiation-associated gene expression dynamics correlate with the activity of p63 binding sites rather than with their occurrence per se. Here we describe in detail the generation and processing of the ChIP-seq and RNA-seq datasets used in this study. These data sets are deposited in the Gene Expression Omnibus (GEO) repository under the accession number GSE59827. PMID:26484246

  9. Differentially expressed genes under simulated microgravity in fruiting bodies of the fungus Pleurotus ostreatus.

    PubMed

    Miyazaki, Yasumasa; Sunagawa, Masahide; Higashibata, Akira; Ishioka, Noriaki; Babasaki, Katsuhiko; Yamazaki, Takashi

    2010-06-01

    In response to a change in the direction of gravity, morphogenetic changes of fruiting bodies of fungi are usually observed as gravitropism. Although gravitropism in higher fungi has been studied for over 100 years, there is no convincing evidence regarding the graviperception mechanism in mushrooms. To understand gravitropism in mushrooms, we isolated differentially expressed genes in Pleurotus ostreatus (oyster mushroom) fruiting bodies developed under three-dimensional clinostat-simulated microgravity. Subtractive hybridization, cDNA representational difference analysis was used for gene analysis and resulted in the isolation of 36 individual genes (17 upregulated and 19 downregulated) under clinorotation. The phenotype of fruiting bodies developed under simulated microgravity vividly depicted the gravitropism in mushrooms. Our results suggest that the differentially expressed genes responding to gravitational change are involved in several potential cellular mechanisms during fruiting body formation of P. ostreatus.

  10. Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus

    PubMed Central

    Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

    2016-01-01

    This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus. PMID:27853123

  11. Differential regulation of alpha7 nicotinic receptor gene (CHRNA7) expression in schizophrenic smokers.

    PubMed

    Mexal, Sharon; Berger, Ralph; Logel, Judy; Ross, Randal G; Freedman, Robert; Leonard, Sherry

    2010-01-01

    The alpha7 neuronal nicotinic receptor gene (CHRNA7) has been implicated in the pathophysiology of schizophrenia by genetic and pharmacological studies. Expression of the alpha7* receptor, as measured by [(125)I]alpha-bungarotoxin autoradiography, is decreased in postmortem brain of schizophrenic subjects compared to non-mentally ill controls. Most schizophrenic patients are heavy smokers, with high levels of serum cotinine. Smoking changes the expression of multiple genes and differentially regulates gene expression in schizophrenic hippocampus. We examined the effects of smoking on CHRNA7 expression in the same tissue and find that smoking differentially regulates expression of both mRNA and protein for this gene. CHRNA7 mRNA and protein levels are significantly lower in schizophrenic nonsmokers compared to control nonsmokers and are brought to control levels in schizophrenic smokers. Sufficient protein but low surface expression of the alpha7* receptor, seen in the autoradiographic studies, suggests aberrant assembly or trafficking of the receptor.

  12. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

    PubMed

    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

    2014-11-01

    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

  13. Phorbaketal A inhibits adipogenic differentiation through the suppression of PPARγ-mediated gene transcription by TAZ.

    PubMed

    Byun, Mi Ran; Lee, Cham Han; Hwang, Jun-Ha; Kim, A Rum; Moon, Sung Ah; Sung, Mi Kyung; Roh, Jung-Rae; Hwang, Eun Sook; Hong, Jeong-Ho

    2013-10-15

    Obesity causes several metabolic diseases, including diabetes. Adipogenic differentiation is an important event for fat formation in obesity. Natural compounds that inhibit adipogenic differentiation are frequently screened to develop therapeutic drugs for treating obesity. Here we investigated the effects of phorbaketal A, a natural marine compound, on adipogenic differentiation of mesenchymal stem cells. Phorbaketal A significantly inhibited adipogenic differentiation as indicated by less fat droplets and decreased expression of adipogenic marker genes. The expression of TAZ (transcriptional coactivator with PDZ-binding motif), an inhibitor of adipogenic differentiation, significantly increased during adipogenic differentiation in the presence of phorbaketal A. Phorbaketal A increased the interaction of TAZ and PPARγ to suppress PPARγ (peroxisome proliferator-activated receptor γ) target gene expression. TAZ-depleted cells showed higher adipogenic potential than that of control cells even in the presence of phorbaketal A. During cellular signaling induced by phorbaketal A, ERK (extracellular signal-regulated kinase) played an important role in adipogenic suppression; an inhibitor of ERK blocked phorbaketal A-induced adipogenic suppression. Thus, the results show that phorbaketal A inhibits adipocyte differentiation through TAZ.

  14. Exogenous polyamines promote osteogenic differentiation by reciprocally regulating osteogenic and adipogenic gene expression.

    PubMed

    Lee, Mon-Juan; Chen, Yuhsin; Huang, Yuan-Pin; Hsu, Yi-Chiang; Chiang, Lan-Hsin; Chen, Tzu-Yu; Wang, Gwo-Jaw

    2013-12-01

    Polyamines are naturally occurring organic polycations that are ubiquitous in all organisms, and are essential for cell proliferation and differentiation. Although polyamines are involved in various cellular processes, their roles in stem cell differentiation are relatively unexplored. In this study, we found that exogenous polyamines, putrescine, spermidine, and spermine, promoted osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) without inducing cell death or apoptosis. Alkaline phosphatase (ALP) activity and the mRNA level of osteogenic genes, including Runx2, ALP, osteopontin, and osteocalcin, were up-regulated by exogenous polyamines. When hBMSCs were cultured at high cell density favoring adipocyte formation, exogenous polyamines resulted in down-regulation of adipogenic genes such as PPARγ, aP2, and adipsin. Extracellular matrix mineralization, a marker for osteoblast maturation, was enhanced in the presence of exogenous polyamines, while lipid accumulation, an indication of adipogenic differentiation, was attenuated. Exogenous polyamines increased the mRNA expression of polyamine-modulated factor 1 (PMF-1) and its downstream effector, spermidine/spermine N(1)-acetyltransferase (SSAT), while that of ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis, was suppressed. These results lead to possible connections between polyamine metabolism and osteogenic differentiation pathways. To summarize, this study provides evidence for the involvement of polyamines in osteogenic differentiation of hBMSCs, and is the first to demonstrate that osteogenic and adipogenic differentiation are reciprocally regulated by exogenous polyamines.

  15. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    PubMed Central

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  16. In Vitro Study of Putative Genomic Biomarkers of Nephrotoxicity Through Differential Gene Expression Using Gentamicin.

    PubMed

    Silva, Sarah Cristina Teixeira; de Almeida, Leonardo Augusto; Soares, Stellamaris; Grossi, Marina Felipe; Valente, Anete Maria Santana; Tagliati, Carlos Alberto

    2017-04-03

    Drug-induced nephrotoxicity is one of the most frequently observed effects in long-term pharmacotherapy. The effects of nephrotoxicity are commonly discovered later due to a lack of sensitivity in in vivo methods. Therefore, researchers have tried to develop in vitro alternative methods for early identification of toxicity. In this study, LLC-PK1 cells were exposed to gentamicin through MTT and trypan blue assay. Concentrations of 4 (low), 8 (medium), and 12 (high) mM, were used to evaluate differential gene expression. A panel of genes was selected based on gene expression changes. The search for sequences of mRNA encoding proteins previously associated with kidney damage was conducted in the databases of the National Center for Biotechnology Information (USA). RNA was extracted from the cells, and RT-qPCR was performed to evaluate differential expression profiles of the selected genes. Among the eleven analyzed genes, four proved to be differentially up-regulated in cells exposed to gentamicin: HAVcr1, caspase3, ICAM-1, and EXOC6. According to this study's results, we suggest that these genes play an important role in the mechanism of in vitro neprotoxicity caused by gentamicin and can be used as early in vitro biomarkers to identify nephrotoxicity when developing safer drugs.

  17. Microarray analysis of differentially expressed genes engaged in fruit development between Prunus mume and Prunus armeniaca.

    PubMed

    Li, Xiaoying; Korir, Nicholas Kibet; Liu, Lili; Shangguan, Lingfei; Wang, Yuzhu; Han, Jian; Chen, Ming; Fang, Jinggui

    2012-11-15

    Microarray analysis is a technique that can be employed to provide expression profiles of single genes and new insights to elucidate the biological mechanisms responsible for fruit development. To evaluate expression of genes mostly engaged in fruit development between Prunus mume and Prunus armeniaca, we first identified differentially expressed transcripts along the entire fruit life cycle by using microarrays spotted with 10,641 ESTs collected from P. mume and other Prunus EST sequences. A total of 1418 ESTs were selected after quality control of microarray spots and analysis for differential gene expression patterns during fruit development of P. mume and P. Armeniaca. From these, 707 up-regulated and 711 down-regulated genes showing more than two-fold differences in expression level were annotated by GO based on biological processes, molecular functions and cellular components. These differentially expressed genes were found to be involved in several important pathways of carbohydrate, galactose, and starch and sucrose metabolism as well as in biosynthesis of other secondary metabolites via KEGG. This could provide detailed information on the fruit quality differences during development and ripening of these two species. With the results obtained, we provide a practical database for comprehensive understanding of molecular events during fruit development and also lay a theoretical foundation for the cloning of genes regulating in a series of important rate-limiting enzymes involved in vital metabolic pathways during fruit development.

  18. Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display

    PubMed Central

    Li, Xiang; Bi, Zhenghong; Di, Rong; Liang, Peng; He, Qiguang; Liu, Wenbo; Miao, Weiguo; Zheng, Fucong

    2016-01-01

    Powdery mildew is an important disease of rubber trees caused by Oidium heveae B. A. Steinmann. As far as we know, none of the resistance genes related to powdery mildew have been isolated from the rubber tree. There is little information available at the molecular level regarding how a rubber tree develops defense mechanisms against this pathogen. We have studied rubber tree mRNA transcripts from the resistant RRIC52 cultivar by differential display analysis. Leaves inoculated with the spores of O. heveae were collected from 0 to 120 hpi in order to identify pathogen-regulated genes at different infection stages. We identified 78 rubber tree genes that were differentially expressed during the plant–pathogen interaction. BLAST analysis for these 78 ESTs classified them into seven functional groups: cell wall and membrane pathways, transcription factor and regulatory proteins, transporters, signal transduction, phytoalexin biosynthesis, other metabolism functions, and unknown functions. The gene expression for eight of these genes was validated by qRT-PCR in both RRIC52 and the partially susceptible Reyan 7-33-97 cultivars, revealing the similar or differential changes of gene expressions between these two cultivars. This study has improved our overall understanding of the molecular mechanisms of rubber tree resistance to powdery mildew. PMID:26840302

  19. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.).

    PubMed

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M; Liu, Liwang

    2016-02-23

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish.

  20. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho

    2017-01-01

    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  1. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.)

    PubMed Central

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M.; Liu, Liwang

    2016-01-01

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish. PMID:26902837

  2. Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display.

    PubMed

    Li, Xiang; Bi, Zhenghong; Di, Rong; Liang, Peng; He, Qiguang; Liu, Wenbo; Miao, Weiguo; Zheng, Fucong

    2016-01-29

    Powdery mildew is an important disease of rubber trees caused by Oidium heveae B. A. Steinmann. As far as we know, none of the resistance genes related to powdery mildew have been isolated from the rubber tree. There is little information available at the molecular level regarding how a rubber tree develops defense mechanisms against this pathogen. We have studied rubber tree mRNA transcripts from the resistant RRIC52 cultivar by differential display analysis. Leaves inoculated with the spores of O. heveae were collected from 0 to 120 hpi in order to identify pathogen-regulated genes at different infection stages. We identified 78 rubber tree genes that were differentially expressed during the plant-pathogen interaction. BLAST analysis for these 78 ESTs classified them into seven functional groups: cell wall and membrane pathways, transcription factor and regulatory proteins, transporters, signal transduction, phytoalexin biosynthesis, other metabolism functions, and unknown functions. The gene expression for eight of these genes was validated by qRT-PCR in both RRIC52 and the partially susceptible Reyan 7-33-97 cultivars, revealing the similar or differential changes of gene expressions between these two cultivars. This study has improved our overall understanding of the molecular mechanisms of rubber tree resistance to powdery mildew.

  3. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium.

    PubMed

    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan

    2013-12-01

    The aim of this study was to determine the steady-state expression of 13 selected housekeeping genes in the myometrium of cyclic and pregnant cows. Cells taken from bovine myometrium on days 1-5, 6-10, 11-16 and 17-20 of the oestrous cycle and in weeks 3-5, 6-8 and 9-12 of pregnancy were used. Reverse transcribed RNA was amplified in real-time PCR using designed primers. Reaction efficiency was determined with the Linreg programme. The geNorm and NormFinder programmes were used to select the best housekeeping genes. They calculate the expression stability factor for each used housekeeping gene with the smallest value for most stably expressed genes. According to geNorm, the most stable housekeeping genes in the myometrium were C2orf29, TPB and TUBB2B, while the least stably expressed genes were 18S RNA, HPRT1 and GAPDH. NormFinder identified the best genes in the myometrium as C2orf29, MRPL12 and TBP, while the worst genes were 18S RNA, B2M and SF3A1. Differences in stability factors between the two programmes may also indicate that the physiological status of the female, e.g. pregnancy, affects the stability of expression of housekeeping genes. The different expression stability of housekeeping genes did not affect progesterone receptor expression but it could be important if small differences in gene expression were measured between studies.

  4. Cooperative Stimulation of Megakaryocytic Differentiation by Gfi1b Gene Targets Kindlin3 and Talin1

    PubMed Central

    Singh, Divya; Upadhyay, Ghanshyam; Sengupta, Ananya; Biplob, Mohammed A.; Chakyayil, Shaleen; George, Tiji; Saleque, Shireen

    2016-01-01

    Understanding the production and differentiation of megakaryocytes from progenitors is crucial for realizing the biology and functions of these vital cells. Previous gene ablation studies demonstrated the essential role of the transcriptional repressor Gfi1b (growth factor independence 1b) in the generation of both erythroid and megakaryocytic cells. However, our recent work has demonstrated the down-regulation of this factor during megakaryocytic differentiation. In this study we identify two new gene targets of Gfi1b, the cytoskeletal proteins Kindlin3 and Talin1, and demonstrate the inverse expression and functions of these cytoskeletal targets relative to Gfi1b, during megakaryocytic differentiation. Both kindlin3 and talin1 promoters exhibit dose dependent Gfi1b and LSD1 (lysine specific demethylase 1; a Gfi1b cofactor) enrichment in megakaryocytes and repression in non-hematopoietic cells. Accordingly the expression of these genes is elevated in gfi1b mutant and LSD1 inhibited hematopoietic cells, while during megakaryocytic differentiation, declining Gfi1b levels fostered the reciprocal upregulation of these cytoskeletal factors. Concordantly, manipulation of Kindlin3 and Talin1 expression demonstrated positive correlation with megakaryocytic differentiation with over-expression stimulating, and inhibition diminishing, this process. Co-operativity between these factors and integrins in promoting differentiation was further underscored by physical interactions between them and integrinβ3/CD61 and by stimulation of differentiation by the Talin1 head domain, which is necessary and sufficient for integrin activation. Therefore this study demonstrates the significance of Gfi1b regulated Kindlin3-Talin1 expression in driving megakaryocytic differentiation and highlights the contribution of cytoskeletal agents in the developmental progression of these platelet progenitors. PMID:27768697

  5. Mammalian polycomb-like Pcl2/Mtf2 is a novel regulatory component of PRC2 that can differentially modulate polycomb activity both at the Hox gene cluster and at Cdkn2a genes.

    PubMed

    Li, Xiangzhi; Isono, Kyo-Ichi; Yamada, Daisuke; Endo, Takaho A; Endoh, Mitsuhiro; Shinga, Jun; Mizutani-Koseki, Yoko; Otte, Arie P; Casanova, Miguel; Kitamura, Hiroshi; Kamijo, Takehiko; Sharif, Jafar; Ohara, Osamu; Toyada, Tetsuro; Bernstein, Bradley E; Brockdorff, Neil; Koseki, Haruhiko

    2011-01-01

    The Polycomb group of proteins forms at least two distinct complexes designated the Polycomb repressive complex-1 (PRC1) and PRC2. These complexes cooperate to mediate transcriptional repression of their target genes, including the Hox gene cluster and the Cdkn2a genes. Mammalian Polycomb-like gene Pcl2/Mtf2 is expressed as four different isoforms, and the longest one contains a Tudor domain and two plant homeodomain (PHD) fingers. Pcl2 forms a complex with PRC2 and binds to Hox genes in a PRC2-dependent manner. We show that Pcl2 is a functional component of PRC2 and is required for PRC2-mediated Hox repression. Pcl2, however, exhibits a profound synergistic effect on PRC1-mediated Hox repression, which is not accompanied by major alterations in the local trimethylation of histone H3 at lysine 27 (H3K27me3) or PRC1 deposition. Pcl2 therefore functions in collaboration with both PRC2 and PRC1 to repress Hox gene expression during axial development. Paradoxically, in embryonic fibroblasts, Pcl2 is shown to activate the expression of Cdkn2a and promote cellular senescence, presumably by suppressing the catalytic activity of PRC2 locally. Taken together, we show that Pcl2 differentially regulates Polycomb-mediated repression of Hox and Cdkn2a genes. We therefore propose a novel role for Pcl2 to modify functional engagement of PRC2 and PRC1, which could be modulated by sensing cellular circumstances.

  6. Profile of Inflammation-associated genes during Hepatic Differentiation of Human Pluripotent Stem Cells.

    PubMed

    Ignatius Irudayam, Joseph; Contreras, Deisy; Spurka, Lindsay; Ren, Songyang; Kanagavel, Vidhya; Ramaiah, Arunachalam; Annamalai, Alagappan; French, Samuel W; Klein, Andrew S; Funari, Vincent; Arumugaswami, Vaithilingaraja

    2015-12-01

    Expression of genes associated with inflammation was analyzed during differentiation of human pluripotent stem cells (PSCs) to hepatic cells. Messenger RNA transcript profiles of differentiated endoderm (day 5), hepatoblast (day 15) and hepatocyte-like cells (day 21) were obtained by RNA sequencing analysis. When compared to endoderm cells an immature cell type, the hepatic cells (days 15 and 21) had significantly higher expression of acute phase protein genes including complement factors, coagulation factors, serum amyloid A and serpins. Furthermore, hepatic phase of cells expressed proinflammatory cytokines IL18 and IL32 as well as cytokine receptors IL18R1, IL1R1, IL1RAP, IL2RG, IL6R, IL6ST and IL10RB. These cells also produced CCL14, CCL15, and CXCL- 1, 2, 3, 16 and 17 chemokines. Endoderm cells had higher levels of chemokine receptors, CXCR4 and CXCR7, than that of hepatic cells. Sirtuin family of genes involved in aging, inflammation and metabolism were differentially regulated in endoderm and hepatic phase cells. Ligands and receptors of the tumor necrosis factor (TNF) family as well as downstream signaling factors TRAF2, TRAF4, FADD, NFKB1 and NFKBIB were differentially expressed during hepatic differentiation.

  7. Analysis on differential expressed genes of ovarian tissue between high- and low-yield laying hen.

    PubMed

    Chen, Wei; Song, Ling-Jun; Zeng, Yong-Qing; Yang, Yun; Wang, Hui

    2013-01-01

    In order to elucidate molecular genetic mechanism of laying hen reproduction at the transcriptional level and the structure of significantly differential genes, the mRNA differential display and reverse northern dot-blot were used to detect the differential expression of genes in the ovary tissue of low-yield laying hens and high-yield laying hens in the present study. Sixteen 32-week-old CAU-pink laying hens divided into two groups were used and the laying performance was measured. The results showed that only the egg numbers were significantly different between the two groups; and from 15 primer pairs, a total of 336 bands were displayed of which 59 cDNA bands were found to be differentially expressed in both high-yield and low-yield laying hen. The sequence analysis indicated that the expression of such bands as H-AP5, H-P5, and H-P4 was significantly potentiated in high-yield laying hen using primer pairs AP5/HT11G, P5/HT11G and P4/HT11G and these transcripts had high homology (98%) to HoxDb, HoxCa, and HoxBa, respectively. The differentially expressed gene fragments may be relevant to the progression of the high-yield hens to the egg-laying stage. And further study is required to elucidate the molecular function to improve the productivity of laying hens.

  8. Identification of genes differentially expressed in dorsal and ventral chick midbrain during early Development

    PubMed Central

    Chittka, A; Volff, JN; Wizenmann, A

    2009-01-01

    Background During the development of the central nervous system (CNS), patterning processes along the dorsoventral (DV) axis of the neural tube generate different neuronal subtypes. As development progresses these neurons are arranged into functional units with varying cytoarchitecture, such as laminae or nuclei for efficient relaying of information. Early in development ventral and dorsal regions are similar in size and structure. Different proliferation rates and cell migration patterns are likely to result in the formation of laminae or nuclei, eventually. However, the underlying molecular mechanisms that establish these different structural arrangements are not well understood. We undertook a differential display polymerase chain reaction (DD-PCR) screen to identify genes with distinct expression patterns between dorsal and ventral regions of the chick midbrain in order to identify genes which regulate the sculpturing of such divergent neuronal organisation. We focused on the DV axis of the early chick midbrain since mesencephalic alar plate and basal plate develop into laminae and nuclei, respectively. Results We identified 53 differentially expressed bands in our initial screen. Twenty-six of these could be assigned to specific genes and we could unambiguously show the differential expression of five of the isolated cDNAs in vivo by in situ mRNA expression analysis. Additionally, we verified differential levels of expression of a selected number of genes by using reverse transcriptase (RT) PCR method with gene-specific primers. One of these genes, QR1, has been previously cloned and we present here a detailed study of its early developmental time course and pattern of expression providing some insights into its possible function. Our phylogenetic analysis of QR1 shows that it is the chick orthologue of Sparc-like 1/Hevin/Mast9 gene in mice, rats, dogs and humans, a protein involved in cell adhesion. Conclusion This study reveals some possible networks, which

  9. Differential accumulation of nif structural gene mRNA in Azotobacter vinelandii.

    PubMed

    Hamilton, Trinity L; Jacobson, Marty; Ludwig, Marcus; Boyd, Eric S; Bryant, Donald A; Dean, Dennis R; Peters, John W

    2011-09-01

    Northern analysis was employed to investigate mRNA produced by mutant strains of Azotobacter vinelandii with defined deletions in the nif structural genes and in the intergenic noncoding regions. The results indicate that intergenic RNA secondary structures effect the differential accumulation of transcripts, supporting the high Fe protein-to-MoFe protein ratio required for optimal diazotrophic growth.

  10. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    PubMed

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  11. The GATA transcription factor gene gtaG is required for terminal differentiation in Dictyostelium.

    PubMed

    Katoh-Kurasawa, Mariko; Santhanam, Balaji; Shaulsky, Gad

    2016-03-09

    The GATA transcription factor GtaG is conserved in Dictyostelids and essential for terminal differentiation in Dictyostelium discoideum, but its function is not well understood. Here we show that gtaG is expressed in prestalk cells at the anterior region of fingers and in the extending stalk during culmination. The gtaG(-) phenotype is cell-autonomous in prestalk cells and non-cell-autonomous in prespore cells. Transcriptome analyses reveal that GtaG regulates prestalk gene expression during cell differentiation before culmination and is required for progression into culmination. GtaG-dependent genes include genetic suppressors of the Dd-STATa-defective phenotype as well as Dd-STATa target-genes, including extra cellular matrix genes. We show that GtaG may be involved in the production of two culmination-signaling molecules, cyclic di-GMP and the spore differentiation factor SDF-1 and that addition of c-di-GMP rescues the gtaG(-) culmination and spore formation deficiencies. We propose that GtaG is a regulator of terminal differentiation that functions in concert with Dd-STATa and controls culmination through regulating c-di-GMP and SDF-1 production in prestalk cells.

  12. Leishmania HASP and SHERP Genes Are Required for In Vivo Differentiation, Parasite Transmission and Virulence Attenuation in the Host

    PubMed Central

    Doehl, Johannes S. P.; Sádlová, Jovana; Aslan, Hamide; Pružinová, Kateřina; Votýpka, Jan; Kamhawi, Shaden; Volf, Petr

    2017-01-01

    Differentiation of extracellular Leishmania promastigotes within their sand fly vector, termed metacyclogenesis, is considered to be essential for parasites to regain mammalian host infectivity. Metacyclogenesis is accompanied by changes in the local parasite environment, including secretion of complex glycoconjugates within the promastigote secretory gel and colonization and degradation of the sand fly stomodeal valve. Deletion of the stage-regulated HASP and SHERP genes on chromosome 23 of Leishmania major is known to stall metacyclogenesis in the sand fly but not in in vitro culture. Here, parasite mutants deficient in specific genes within the HASP/SHERP chromosomal region have been used to investigate their role in metacyclogenesis, parasite transmission and establishment of infection. Metacyclogenesis was stalled in HASP/SHERP mutants in vivo and, although still capable of osmotaxis, these mutants failed to secrete promastigote secretory gel, correlating with a lack of parasite accumulation in the thoracic midgut and failure to colonise the stomodeal valve. These defects prevented parasite transmission to a new mammalian host. Sand fly midgut homogenates modulated parasite behaviour in vitro, suggesting a role for molecular interactions between parasite and vector in Leishmania development within the sand fly. For the first time, stage-regulated expression of the small HASPA proteins in Leishmania (Leishmania) has been demonstrated: HASPA2 is expressed only in extracellular promastigotes and HASPA1 only in intracellular amastigotes. Despite its lack of expression in amastigotes, replacement of HASPA2 into the null locus background delays onset of pathology in BALB/c mice. This HASPA2-dependent effect is reversed by HASPA1 gene addition, suggesting that the HASPAs may have a role in host immunomodulation. PMID:28095465

  13. 4-Hydroxynonenal differentially regulates adiponectin gene expression and secretion via activating PPARγ and accelerating ubiquitin–proteasome degradation

    PubMed Central

    Wanga, Zhigang; Dou, Xiaobing; Gu, Dongfang; Shen, Chen; Yao, Tong; Nguyen, Van; Braunschweig, Carol; Song, Zhenyuan

    2011-01-01

    Although well-established, the underlying mechanisms involved in obesity-related plasma adiponectin decline remain elusive. Oxidative stress is associated with obesity and insulin resistance and considered to contribute to the progression toward obesity-related metabolic disorders. In this study, we investigated the effects of 4-hydroxynonenal (4-HNE), the most abundant lipid peroxidation end product, on adiponectin production and its potential implication in obesity-related adiponectin decrease. Long-term high-fat diet feeding led to obesity in mouse, accompanied by decreased plasma adiponectin and increased adipose tissue 4-HNE content. Exposure of adipocytes to exogenous 4-HNE resulted in decreased adiponectin secretion in a dose-dependent manner, which was consistent with significantly decreased intracellular adiponectin protein abundance. In contrast, adiponectin gene expression was significantly elevated by 4-HNE treatment, which was concomitant with increased peroxisome proliferator-activated receptor gamma (PPAR-γ) gene expression and transactivity. The effect was abolished by T0070907, a PPAR-γ antagonist, suggesting that PPAR-γ activation plays a critical role in this process. To gain insight into mechanisms involved in adiponectin protein decrease, we examined the effects of 4-HNE on adiponectin protein degradation. Cycloheximide (CHX)-chase assay revealed that 4-HNE exposure accelerated adiponectin protein degradation, which was prevented by MG132, a potent proteasome inhibitor. Immunoprecipitation assay showed that 4-HNE exposure increased ubiquitinated adiponectin protein levels. These data altogether indicated that 4-HNE enhanced adiponectin protein degradation via ubiquitin–proteasome system. Finally, we demonstrated that supplementation of HF diet with betaine, an antioxidant and methyl donor, alleviated high-fat-induced adipose tissue 4-HNE increase and attenuated plasma adiponectin decline. Taken together, our findings suggest that the lipid

  14. MRI Reporter Genes: Application to Imaging of Cell Survival, Proliferation, Migration, and Differentiation

    PubMed Central

    Vandsburger, Moriel H; Radoul, Marina; Cohen, Batya; Neeman, Michal

    2013-01-01

    Molecular imaging strives to detect molecular events at the level of the whole organism. In some cases, the molecule of interest can be detected either directly, or through the use of targeted contrast media. However many genes and proteins, and particularly those located in intracellular compartments, are not accessible for targeted agents. The transcriptional regulation of these genes can never the less be detected, though indirectly, through the use of reporter genes encoding for readily detectable proteins. Such reporter proteins can be expressed in the tissue of interest by genetically introducing the reporter gene in the target cells. Imaging of reporter genes has become a powerful tool in modern biomedical research. Typically, expression of fluorescent or bioluminescent proteins, or the reaction product of expressed enzymes and exogenous substrates, are examined using in vitro histological methods, or in vivo whole body imaging methods. Recent advances in MRI reporter gene methods raise the possibility that MRI could become a powerful tool for concomitant high resolution anatomical and functional imaging and for imaging of reporter gene activity. An immediate application of MRI reporter gene methods is for monitoring gene expression patterns in gene therapy and for in vivo imaging of the survival, proliferation, migration, and differentiation of pluripotent or multipotent cells used in cell based regenerative therapies for cancer, myocardial infarction, and neural degeneration. In this review, we characterize the variety of MRI reporter gene methods based on their applicability to report cell survival/proliferation, cell migration, and cell differentiation. In particular, we discuss which methods are best suited for translation to clinical use in regenerative therapies. PMID:23225197

  15. KeyGenes, a Tool to Probe Tissue Differentiation Using a Human Fetal Transcriptional Atlas

    PubMed Central

    Roost, Matthias S.; van Iperen, Liesbeth; Ariyurek, Yavuz; Buermans, Henk P.; Arindrarto, Wibowo; Devalla, Harsha D.; Passier, Robert; Mummery, Christine L.; Carlotti, Françoise; de Koning, Eelco J.P.; van Zwet, Erik W.; Goeman, Jelle J.; Chuva de Sousa Lopes, Susana M.

    2015-01-01

    Summary Differentiated derivatives of human pluripotent stem cells in culture are generally phenotypically immature compared to their adult counterparts. Their identity is often difficult to determine with certainty because little is known about their human fetal equivalents in vivo. Cellular identity and signaling pathways directing differentiation are usually determined by extrapolating information from either human adult tissue or model organisms, assuming conservation with humans. To resolve this, we generated a collection of human fetal transcriptional profiles at different developmental stages. Moreover, we developed an algorithm, KeyGenes, which uses this dataset to quantify the extent to which next-generation sequencing or microarray data resemble specific cell or tissue types in the human fetus. Using KeyGenes combined with the human fetal atlas, we identified multiple cell and tissue samples unambiguously on a limited set of features. We thus provide a flexible and expandable platform to monitor and evaluate the efficiency of differentiation in vitro. PMID:26028532

  16. Evidence for regulation of cartilage differentiation by the homeobox gene Hoxc-8

    PubMed Central

    Yueh, Y. Gloria; Gardner, David P.; Kappen, Claudia

    1998-01-01

    Homeobox genes of the Hox class are required for proper patterning of skeletal elements, but how they regulate the differentiation of specific tissues is unclear. We show here that overexpression of a Hoxc-8 transgene causes cartilage defects whose severity depends on transgene dosage. The abnormal cartilage is characterized by an accumulation of proliferating chondrocytes and reduced maturation. Since Hoxc-8 is normally expressed in chondrocytes, these results suggest that Hoxc-8 continues to regulate skeletal development well beyond pattern formation in a tissue-specific manner, presumably by controlling the progression of cells along the chondrocyte differentiation pathway. The comparison to Hoxd-4 and Isl-1 indicates that this role in chondrogenesis is specific to proteins of the Hox class. Their capacity for regulation of cartilage differentiation suggests that Hox genes could also be involved in human chondrodysplasias or other cartilage disorders. PMID:9707582

  17. p38 Mitogen-Activated Protein Kinase Pathway Regulates Genes during Proliferation and Differentiation in Oligodendrocytes

    PubMed Central

    Haines, Jeffery D.; Fulton, Debra L.; Richard, Stephane; Almazan, Guillermina

    2015-01-01

    We have previously shown that p38 mitogen-activated protein kinase (p38 MAPK) is important for oligodendrocyte (OLG) differentiation and myelination. However, the precise cellular mechanisms by which p38 regulates OLG differentiation remain largely unknown. To determine whether p38 functions in part through transcriptional events in regulating OLG identity, we performed microarray analysis on differentiating oligodendrocyte progenitors (OLPs) treated with a p38 inhibitor. Consistent with a role in OLG differentiation, pharmacological inhibition of p38 down-regulated the transcription of genes that are involved in myelin biogenesis, transcriptional control and cell cycle. Proliferation assays showed that OLPs treated with the p38 inhibitor retained a proliferative capacity which could be induced upon application of mitogens demonstrating that after two days of p38-inhibition OLGs remained poised to continue mitosis. Together, our results suggest that the p38 pathway regulates gene transcription which can coordinate OLG differentiation. Our microarray dataset will provide a useful resource for future studies investigating the molecular mechanisms by which p38 regulates oligodendrocyte differentiation and myelination. PMID:26714323

  18. Identification of an IL-4-Inducible Gene Expressed in Differentiating Lymphocytes and Male Germ Cells

    PubMed Central

    Nabavi, Nasrin; Grusby, Michael J.; Finn, Patricia W.; Wolgemuth, Debra J.; Glimcher, Laurie H.

    1990-01-01

    Interleukin 4 (IL-4) is a cytokine that is involved in the differentiation of B and T lymphocytes. In this report, we describe the identification of a novel gene, N.52, which was cloned from the murine pre-B cell line R8205 grown in the presence of IL-4 for 48 hr. Although N.52 expression is detectable at low levels in unstimulated R8205 cells, the level of N.52 dramatically increases after only .4 hr exposure to IL-4 and remains at a high .level up to 48 hr. Although N.52 expression is low or absent in normal spleen B and T cells, its expression can be induced by the differentiation signals delivered by LPS in B cells and by Con A in T-cell hybrids. While N.52 mRNA is absent in all highly differentiated organs, it is detectable in stem cell harboring lymphoid tissues such as bone marrow, fetal liver, and thymus. Furthermore, N.52 mRNA is expressed at strikingly high levels in the testis, specifically in differentiating male germ cells. It is induced by differentiation signals triggered by the combination of cyclic AMP and retinoic acid in teratocarcinoma F9 cells. Taken together, these data suggest that N.52 is a developmentally regulated gene whose expression in cells of the immune and reproductive systems may be controlled by stimuli that induce differentiation. PMID:2136202

  19. Induction of erythroid differentiation and modulation of gene expression by tiazofurin in K-562 leukemia cells.

    PubMed Central

    Olah, E; Natsumeda, Y; Ikegami, T; Kote, Z; Horanyi, M; Szelenyi, J; Paulik, E; Kremmer, T; Hollan, S R; Sugar, J

    1988-01-01

    Tiazofurin (2-beta-D-ribofuranosyl-4-thiazole-carboxamide; NSC 286193), an antitumor carbon-linked nucleoside that inhibits IMP dehydrogenase (IMP:NAD+ oxidoreductase; EC 1.1.1.205) and depletes guanylate levels, can activate the erythroid differentiation program of K-562 human leukemia cells. Tiazofurin-mediated cell differentiation is a multistep process. The inducer initiates early (less than 6 hr) metabolic changes that precede commitment to differentiation; among these early changes are decreases in IMP dehydrogenase activity and in GTP concentration, as well as alterations in the expression of certain protooncogenes (c-Ki-ras). K-562 cells do express commitment-i.e., cells exhibit differentiation without tiazofurin. Guanosine was effective in preventing the action of tiazofurin, thus providing evidence that the guanine nucleotides are critically involved in tiazofurin-initiated differentiation. Activation of transcription of the erythroid-specific gene that encodes A gamma-globin is a late (48 hr) but striking effect of tiazofurin. Down-regulation of the c-ras gene appears to be part of the complex process associated with tiazofurin-induced erythroid differentiation and relates to the perturbations of GTP metabolism. Images PMID:2901100

  20. Exercise training alters DNA methylation patterns in genes related to muscle growth and differentiation in mice.

    PubMed

    Kanzleiter, Timo; Jähnert, Markus; Schulze, Gunnar; Selbig, Joachim; Hallahan, Nicole; Schwenk, Robert Wolfgang; Schürmann, Annette

    2015-05-15

    The adaptive response of skeletal muscle to exercise training is tightly controlled and therefore requires transcriptional regulation. DNA methylation is an epigenetic mechanism known to modulate gene expression, but its contribution to exercise-induced adaptations in skeletal muscle is not well studied. Here, we describe a genome-wide analysis of DNA methylation in muscle of trained mice (n = 3). Compared with sedentary controls, 2,762 genes exhibited differentially methylated CpGs (P < 0.05, meth diff >5%, coverage >10) in their putative promoter regions. Alignment with gene expression data (n = 6) revealed 200 genes with a negative correlation between methylation and expression changes in response to exercise training. The majority of these genes were related to muscle growth and differentiation, and a minor fraction involved in metabolic regulation. Among the candidates were genes that regulate the expression of myogenic regulatory factors (Plexin A2) as well as genes that participate in muscle hypertrophy (Igfbp4) and motor neuron innervation (Dok7). Interestingly, a transcription factor binding site enrichment study discovered significantly enriched occurrence of CpG methylation in the binding sites of the myogenic regulatory factors MyoD and myogenin. These findings suggest that DNA methylation is involved in the regulation of muscle adaptation to regular exercise training.

  1. Oligonucleotide microarray identifies genes differentially expressed during tumorigenesis of DMBA-induced pancreatic cancer in rats.

    PubMed

    Guo, Jun-Chao; Li, Jian; Yang, Ying-Chi; Zhou, Li; Zhang, Tai-Ping; Zhao, Yu-Pei

    2013-01-01

    The extremely dismal prognosis of pancreatic cancer (PC) is attributed, at least in part, to lack of early diagnosis. Therefore, identifying differentially expressed genes in multiple steps of tumorigenesis of PC is of great interest. In the present study, a 7,12-dimethylbenzanthraene (DMBA)-induced PC model was established in male Sprague-Dawley rats. The gene expression profile was screened using an oligonucleotide microarray, followed by real-time quantitative polymerase chain reaction (qRT-PCR) and immunohistochemical staining validation. A total of 661 differentially expressed genes were identified in stages of pancreatic carcinogenesis. According to GO classification, these genes were involved in multiple molecular pathways. Using two-way hierarchical clustering analysis, normal pancreas, acute and chronic pancreatitis, PanIN, early and advanced pancreatic cancer were completely discriminated. Furthermore, 11 upregulated and 142 downregulated genes (probes) were found by Mann-Kendall trend Monotone test, indicating homologous genes of rat and human. The qRT-PCR and immunohistochemistry analysis of CXCR7 and UBe2c, two of the identified genes, confirmed the microarray results. In human PC cell lines, knockdown of CXCR7 resulted in decreased migration and invasion. Collectively, our data identified several promising markers and therapeutic targets of PC based on a comprehensive screening and systemic validation.

  2. Expression patterns of TEL genes in Poaceae suggest a conserved association with cell differentiation.

    PubMed

    Paquet, Nicolas; Bernadet, Marie; Morin, Halima; Traas, Jan; Dron, Michel; Charon, Celine

    2005-06-01

    Poaceae species present a conserved distichous phyllotaxy (leaf position along the stem) and share common properties with respect to leaf initiation. The goal of this work was to determine if these common traits imply common genes. Therefore, homologues of the maize TERMINAL EAR1 gene in Poaceae were studied. This gene encodes an RNA-binding motif (RRM) protein, that is suggested to regulate leaf initiation. Using degenerate primers, one unique tel (terminal ear1-like) gene from seven Poaceae members, covering almost all the phylogenetic tree of the family, was identified by PCR. These genes present a very high degree of similarity, a much conserved exon-intron structure, and the three RRMs and TEL characteristic motifs. The evolution of tel sequences in Poaceae strongly correlates with the known phylogenetic tree of this family. RT-PCR gene expression analyses show conserved tel expression in the shoot apex in all species, suggesting functional orthology between these genes. In addition, in situ hybridization experiments with specific antisense probes show tel transcript accumulation in all differentiating cells of the leaf, from the recruitment of leaf founder cells to leaf margins cells. Tel expression is not restricted to initiating leaves as it is also found in pro-vascular tissues, root meristems, and immature inflorescences. Therefore, these results suggest that TEL is not only associated with leaf initiation but more generally with cell differentiation in Poaceae.

  3. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping

    2001-01-01

    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405

  4. Differential gene expression profiling and biological process analysis in proximal nerve segments after sciatic nerve transection.

    PubMed

    Li, Shiying; Liu, Qianqian; Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong

    2013-01-01

    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h-14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective.

  5. Differential expression of genes and proteins between electric organ and skeletal muscle in the mormyrid electric fish Brienomyrus brachyistius

    PubMed Central

    Gallant, Jason R.; Hopkins, Carl D.; Deitcher, David L.

    2012-01-01

    SUMMARY Electric organs (EOs) have evolved independently in vertebrates six times from skeletal muscle (SM). The transcriptional changes accompanying this developmental transformation are not presently well understood. Mormyrids and gymnotiforms are two highly convergent groups of weakly electric fish that have independently evolved EOs: while much is known about development and gene expression in gymnotiforms, very little is known about development and gene expression in mormyrids. This lack of data limits prospects for comparative work. We report here on the characterization of 28 differentially expressed genes between SM and EO tissues in the mormyrid Brienomyrus brachyistius, which were identified using suppressive subtractive hybridization (SSH). Forward and reverse SSH was performed on tissue samples of EO and SM resulting in one cDNA library enriched with mRNAs expressed in EO, and a second library representing mRNAs unique to SM. Nineteen expressed sequence tags (ESTs) were identified in EO and nine were identified in SM using BLAST searching of Danio rerio sequences available in NCBI databases. We confirmed differential expression of all 28 ESTs using RT-PCR. In EO, these ESTs represent four classes of proteins: (1) ion pumps, including the α- and β-subunits of Na+/K+-ATPase, and a plasma membrane Ca2+-ATPase; (2) Ca2+-binding protein S100, several parvalbumin paralogs, calcyclin-binding protein and neurogranin; (3) sarcomeric proteins troponin I, myosin heavy chain and actin-related protein complex subunit 3 (Arcp3); and (4) the transcription factors enhancer of rudimentary homolog (ERH) and myocyte enhancer factor 2A (MEF2A). Immunohistochemistry and western blotting were used to demonstrate the translation of seven proteins (myosin heavy chain, Na+/K+-ATPase, plasma membrane Ca2+-ATPase, MEF2, troponin and parvalbumin) and their cellular localization in EO and SM. Our findings suggest that mormyrids express several paralogs of muscle-specific genes

  6. Identification of genes encoding critical factors regulating B-cell terminal differentiation in torafugu (Takifugu rubripes).

    PubMed

    Ohtani, Maki; Miyadai, Toshiaki; Hiroishi, Shingo

    2006-03-01

    Many transcription factors, and associated co-factors, are involved in the regulation of B-cell terminal differentiation in mammals. In the teleost and cartilaginous fish, although evidence has strongly suggested the existence of B-cell like lymphocytes, the mechanism of terminal differentiation of B-cells remains to be elucidated. In the present study, we searched for the nucleotide and amino acid sequences similar to the critical regulatory factors facilitating the terminal differentiation of B-cells using the fugu BLAST server. We cloned the following cDNAs from Takifugu rubripes: (1) B-lymphocyte-induced maturation protein-1 (Blimp-1), which plays a major role in promoting plasma cell differentiation by repressing the transcription of many genes that participate in maintaining the differentiation of mature B-cells; (2) Bcl-6, which facilitates germinal center formation and represses Blimp-1 expression; (3) X-box binding protein-1 (XBP-1), which operates Ig secretion by activating transcription of the ER-stress responsible genes; (4) Pax-5, which suppresses XBP-1 and enhances the expression of activation-induced cytidine deaminase (AID), an inducer of somatic hypermutation and class-switch recombination of the immunoglobulin gene; and (5) TLE-3, one of the Groucho family proteins, a co-factor for Blimp-1. We also identified other co-factors and many target genes of Blimp-1 by in silico and/or cDNA cloning. These finding indicates that the basal process of B-cell terminal differentiation in fish is controlled by factors identical to those in mammals.

  7. Melanoma differentiation associated gene-7/interleukin-24 (mda-7/IL-24): Novel gene therapeutic for metastatic melanoma

    SciTech Connect

    Fisher, Paul B. Sarkar, Devanand; Lebedeva, Irina V.; Emdad, Luni; Gupta, Pankaj; Sauane, Moira; Su Zaozhong; Grant, Steven; Dent, Paul; Curiel, David T.; Senzer, Neil; Nemunaitis, John

    2007-11-01

    A potentially less toxic approach for cancer therapy comprises induction of tumor cells to lose growth potential irreversibly and terminally differentiate. Combining this scheme termed 'differentiation therapy of cancer' with subtraction hybridization to human melanoma cells resulted in the cloning of melanoma differentiation associated (mda) genes displaying elevated expression as a consequence of induction of terminal differentiation. One originally novel gene, mda-7, was found to display elevated expression in normal melanocytes and nevi with progressive loss of expression as a consequence of melanoma development and progression to metastasis. Based on structure, biochemical properties and chromosomal location, mda-7 has now been reclassified as interleukin (IL)-24, a member of the expanding IL-10 family of cytokines. In vitro cell culture and in vivo animal studies indicate that mda-7/IL-24 selectively induces programmed cell death (apoptosis) in multiple human cancers (including melanomas), without harming normal cells, and promotes profound anti-tumor activity in nude mice containing human tumor xenografts. Based on these remarkable properties, a Phase I clinical trial was conducted to test the safety of administration of mda-7/IL-24 by a replication incompetent adenovirus (Ad.mda-7; INGN 241) in patients with advanced solid cancers including melanoma. mda-7/IL-24 was found to be safe and to promote significant clinical activity, particularly in the context of patients with metastatic melanoma. These results provide an impetus for further clinical studies and document a central paradigm of cancer therapy, namely translation of basic science from the 'bench to the bedside.'.

  8. Differentiation in neutral genes and a candidate gene in the pied flycatcher: using biological archives to track global climate change.

    PubMed

    Kuhn, Kerstin; Schwenk, Klaus; Both, Christiaan; Canal, David; Johansson, Ulf S; van der Mije, Steven; Töpfer, Till; Päckert, Martin

    2013-11-01

    Global climate change is one of the major driving forces for adaptive shifts in migration and breeding phenology and possibly impacts demographic changes if a species fails to adapt sufficiently. In Western Europe, pied flycatchers (Ficedula hypoleuca) have insufficiently adapted their breeding phenology to the ongoing advance of food peaks within their breeding area and consequently suffered local population declines. We address the question whether this population decline led to a loss of genetic variation, using two neutral marker sets (mitochondrial control region and microsatellites), and one potentially selectively non-neutral marker (avian Clock gene). We report temporal changes in genetic diversity in extant populations and biological archives over more than a century, using samples from sites differing in the extent of climate change. Comparing genetic differentiation over this period revealed that only the recent Dutch population, which underwent population declines, showed slightly lower genetic variation than the historic Dutch population. As that loss of variation was only moderate and not observed in all markers, current gene flow across Western and Central European populations might have compensated local loss of variation over the last decades. A comparison of genetic differentiation in neutral loci versus the Clock gene locus provided evidence for stabilizing selection. Furthermore, in all genetic markers, we found a greater genetic differentiation in space than in time. This pattern suggests that local adaptation or historic processes might have a stronger effect on the population structure and genetic variation in the pied flycatcher than recent global climate changes.

  9. Interpreting Patterns of Gene Expression with Self-Organizing Maps: Methods and Application to Hematopoietic Differentiation

    NASA Astrophysics Data System (ADS)

    Tamayo, Pablo; Slonim, Donna; Mesirov, Jill; Zhu, Qing; Kitareewan, Sutisak; Dmitrovsky, Ethan; Lander, Eric S.; Golub, Todd R.

    1999-03-01

    Array technologies have made it straightforward to monitor simultaneously the expression pattern of thousands of genes. The challenge now is to interpret such massive data sets. The first step is to extract the fundamental patterns of gene expression inherent in the data. This paper describes the application of self-organizing maps, a type of mathematical cluster analysis that is particularly well suited for recognizing and classifying features in complex, multidimensional data. The method has been implemented in a publicly available computer package, GENECLUSTER, that performs the analytical calculations and provides easy data visualization. To illustrate the value of such analysis, the approach is applied to hematopoietic differentiation in four well studied models (HL-60, U937, Jurkat, and NB4 cells). Expression patterns of some 6,000 human genes were assayed, and an online database was created. GENECLUSTER was used to organize the genes into biologically relevant clusters that suggest novel hypotheses about hematopoietic differentiation--for example, highlighting certain genes and pathways involved in "differentiation therapy" used in the treatment of acute promyelocytic leukemia.

  10. Genome-wide assessment of differential effector gene use in embryogenesis.

    PubMed

    Barsi, Julius C; Tu, Qiang; Calestani, Cristina; Davidson, Eric H

    2015-11-15

    Six different populations of cells were isolated by fluorescence-activated cell sorting from disaggregated late blastula- and gastrula-stage sea urchin embryos according to the regulatory states expressed in these cells, as reported by recombineered bacterial artificial chromosomes producing fluorochromes. Transcriptomes recovered from these embryonic cell populations revealed striking, early differential expression of large cohorts of effector genes. The six cell populations were presumptive pigment cells, presumptive neurogenic cells, presumptive skeletogenic cells, cells from the stomodeal region of the oral ectoderm, ciliated band cells and cells from the endoderm/ectoderm boundary that will give rise both to hindgut and to border ectoderm. Transcriptome analysis revealed that each of these domains specifically expressed several hundred effector genes at significant levels. Annotation indicated the qualitative individuality of the functional nature of each cell population, even though they were isolated from embryos only 1-2 days old. In no case was more than a tiny fraction of the transcripts enriched in one population also enriched in any other of the six populations studied. As was particularly clear in the cases of the presumptive pigment, neurogenic and skeletogenic cells, all three of which represent precociously differentiating cell types of this embryo, most specifically expressed genes of given cell types are not significantly expressed at all in the other cell types. Thus, at the effector gene level, a dramatic, cell type-specific pattern of differential gene regulation is established well before any significant embryonic morphogenesis has occurred.

  11. Mutations in Ehrlichia chaffeensis Causing Polar Effects in Gene Expression and Differential Host Specificities.

    PubMed

    Cheng, Chuanmin; Nair, Arathy D S; Jaworski, Deborah C; Ganta, Roman R

    2015-01-01

    Ehrlichia chaffeensis, a tick-borne rickettsial, is responsible for human monocytic ehrlichiosis. In this study, we assessed E. chaffeensis insertion mutations impacting the transcription of genes near the insertion sites. We presented evidence that the mutations within the E. chaffeensis genome at four genomic locations cause polar effects in altering gene expressions. We also reported mutations causing attenuated growth in deer (the pathogen's reservoir host) and in dog (an incidental host), but not in its tick vector, Amblyomma americanum. This is the first study documenting insertion mutations in E. chaffeensis that cause polar effects in altering gene expression from the genes located upstream and downstream to insertion sites and the differential requirements of functionally active genes of the pathogen for its persistence in vertebrate and tick hosts. This study is important in furthering our knowledge on E. chaffeensis pathogenesis.

  12. Identifying differentially expressed genes in cancer patients using a non-parameter Ising model.

    PubMed

    Li, Xumeng; Feltus, Frank A; Sun, Xiaoqian; Wang, James Z; Luo, Feng

    2011-10-01

    Identification of genes and pathways involved in diseases and physiological conditions is a major task in systems biology. In this study, we developed a novel non-parameter Ising model to integrate protein-protein interaction network and microarray data for identifying differentially expressed (DE) genes. We also proposed a simulated annealing algorithm to find the optimal configuration of the Ising model. The Ising model was applied to two breast cancer microarray data sets. The results showed that more cancer-related DE sub-networks and genes were identified by the Ising model than those by the Markov random field model. Furthermore, cross-validation experiments showed that DE genes identified by Ising model can improve classification performance compared with DE genes identified by Markov random field model.

  13. Identification of differentially expressed genes in omental adipose tissues of obese patients by suppression subtractive hybridization.

    PubMed

    Qiu, Jie; Ni, Yu-hui; Gong, Hai-xia; Fei, Li; Pan, Xiao-qin; Guo, Mei; Chen, Rong-hua; Guo, Xi-rong

    2007-01-12

    To identify differentially expressed genes between obese individuals and normal control, we have undertaken suppression subtractive hybridization (SSH). Omental adipose tissues were obtained via abdominal surgery for appendicitis in both 13 obese subjects [BMI (body mass index) >30 kg/m2] and 13 normal subjects (BMI >18 and <25 kg/m2). Following SSH, about one thousand clones were sequenced and found to derive from 426 different genes. These predominately expressed genes included genes involved in lipid metabolism, cytokines, signal transduction, GLUT4 translocation, cell cycle and growth, cytoskeleton, and others. Although more detailed analyses are necessary, it is anticipated that further study of genes identified will provide insights into their specific roles in the etiology of obesity.

  14. Regularized Non-negative Matrix Factorization for Identifying Differential Genes and Clustering Samples: a Survey.

    PubMed

    Liu, Jin-Xing; Wang, Dong; Gao, Ying-Lian; Zheng, Chun-Hou; Xu, Yong; Yu, Jiguo

    2017-02-07

    Non-negative Matrix Factorization (NMF), a classical method for dimensionality reduction, has been applied in many fields. It is based on the idea that negative numbers are physically meaningless in various data-processing tasks. Apart from its contribution to conventional data analysis, the recent overwhelming interest in NMF is due to its newly discovered ability to solve challenging data mining and machine learning problems, especially in relation to gene expression data. This survey paper mainly focuses on research examining the application of NMF to identify differentially expressed genes and to cluster samples, and the main NMF models, properties, principles, and algorithms with its various generalizations, extensions, and modifications are summarized. The experimental results demonstrate the performance of the various NMF algorithms in identifying differentially expressed genes and clustering samples.

  15. Causal structure of oscillations in gene regulatory networks: Boolean analysis of ordinary differential equation attractors.

    PubMed

    Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E S

    2013-06-01

    A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks.

  16. Causal structure of oscillations in gene regulatory networks: Boolean analysis of ordinary differential equation attractors

    PubMed Central

    Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E. S.

    2013-01-01

    A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks. PMID:23822502

  17. Efficiency analysis of competing tests for finding differentially expressed genes in lung adenocarcinoma.

    PubMed

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James

    2008-01-01

    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA (http://bioinformatics2.pitt.edu/GE2/GEDA.html) to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The 'best' test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  18. Efficiency Analysis of Competing Tests for Finding Differentially Expressed Genes in Lung Adenocarcinoma

    PubMed Central

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James

    2008-01-01

    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA (http://bioinformatics2.pitt.edu/GE2/GEDA.html) to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The ‘best’ test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  19. Differential expression profiles and pathways of genes in sugarcane leaf at elongation stage in response to drought stress

    PubMed Central

    Li, Changning; Nong, Qian; Solanki, Manoj Kumar; Liang, Qiang; Xie, Jinlan; Liu, Xiaoyan; Li, Yijie; Wang, Weizan; Yang, Litao; Li, Yangrui

    2016-01-01

    Water stress causes considerable yield losses in sugarcane. To investigate differentially expressed genes under water stress, a pot experiment was performed with the sugarcane variety GT21 at three water-deficit levels (mild, moderate, and severe) during the elongation stage and gene expression was analyzed using microarray technology. Physiological parameters of sugarcane showed significant alterations in response to drought stress. Based on the expression profile of 15,593 sugarcane genes, 1,501 (9.6%) genes were differentially expressed under different water-level treatments; 821 genes were upregulated and 680 genes were downregulated. A gene similarity analysis showed that approximately 62.6% of the differentially expressed genes shared homology with functional proteins. In a Gene Ontology (GO) analysis, 901 differentially expressed genes were assigned to 36 GO categories. Moreover, 325 differentially expressed genes were classified into 101 pathway categories involved in various processes, such as the biosynthesis of secondary metabolites, ribosomes, carbon metabolism, etc. In addition, some unannotated genes were detected; these may provide a basis for studies of water-deficit tolerance. The reliability of the observed expression patterns was confirmed by RT-PCR. The results of this study may help identify useful genes for improving drought tolerance in sugarcane. PMID:27170459

  20. Deletion of Alox5 gene decreases osteogenic differentiation but increases adipogenic differentiation of mouse induced pluripotent stem cells.

    PubMed

    Wu, Yanru; Sun, Hualing; Song, Fangfang; Huang, Cui; Wang, Jiawei

    2014-10-01

    Induced pluripotent stem cells (iPSCs) have great potential in bone tissue engineering to repair large bone defects. Before their clinical application, investigations are needed to discover the genes and osteoconductive scaffolds that influence their differentiation toward an osteogenic lineage. Alox5 plays controversial and complex roles in the regulation of bone and fat metabolism. To detect the effect of Alox5 on osteogenic and adipogenic differentiation of iPSCs, both Alox5 knockout mouse iPSCs (Alox5-KO-iPSCs) and wild-type mouse iPSCs (Wild-iPSCs) were developed. The mRNA levels of many osteogenic markers in Alox5-KO-iPSCs were significantly reduced, while many adipogenic markers were enhanced. Furthermore, when implanted in rat cranial critical-sized defects with collagen/chitosan/hydroxyapatite scaffolds (CCHS), Alox5-KO-iPSCs produced significantly less new bone than Wild-iPSCs and both cell-scaffold groups had no tumor formation. There was a significant difference in the expression of Cox2 during the osteogenic and adipogenic differentiation between the two kinds of iPSCs in vitro. In conclusion, firstly, Alox5 knockout reduced the osteogenic but increased the adipogenic differentiation potential of mouse iPSCs. These disorders might be related to the change of Cox2 expression. Secondly, combined with iPSCs, CCHS can serve as a potential substrate to repair critical-sized bony defects. However, more studies are required to confirm the mechanisms through which Alox5 affects the osteogenic and adipogenic abilities of iPSCs in vivo and the effect of Cox2 inhibition in this system.

  1. Storage Temperature Alters the Expression of Differentiation-Related Genes in Cultured Oral Keratinocytes

    PubMed Central

    Utheim, Tor Paaske; Islam, Rakibul; Fostad, Ida G.; Eidet, Jon R.; Sehic, Amer; Olstad, Ole K.; Dartt, Darlene A.; Messelt, Edward B.; Griffith, May; Pasovic, Lara

    2016-01-01

    Purpose Storage of cultured human oral keratinocytes (HOK) allows for transportation of cultured transplants to eye clinics worldwide. In a previous study, one-week storage of cultured HOK was found to be superior with regard to viability and morphology at 12°C compared to 4°C and 37°C. To understand more of how storage temperature affects cell phenotype, gene expression of HOK before and after storage at 4°C, 12°C, and 37°C was assessed. Materials and Methods Cultured HOK were stored in HEPES- and sodium bicarbonate-buffered Minimum Essential Medium at 4°C, 12°C, and 37°C for one week. Total RNA was isolated and the gene expression profile was determined using DNA microarrays and analyzed with Partek Genomics Suite software and Ingenuity Pathway Analysis. Differentially expressed genes (fold change > 1.5 and P < 0.05) were identified by one-way ANOVA. Key genes were validated using qPCR. Results Gene expression of cultures stored at 4°C and 12°C clustered close to the unstored control cultures. Cultures stored at 37°C displayed substantial change in gene expression compared to the other groups. In comparison with 12°C, 2,981 genes were differentially expressed at 37°C. In contrast, only 67 genes were differentially expressed between the unstored control and the cells stored at 12°C. The 12°C and 37°C culture groups differed most significantly with regard to the expression of differentiation markers. The Hedgehog signaling pathway was significantly downregulated at 37°C compared to 12°C. Conclusion HOK cultures stored at 37°C showed considerably larger changes in gene expression compared to unstored cells than cultured HOK stored at 4°C and 12°C. The changes observed at 37°C consisted of differentiation of the cells towards a squamous epithelium-specific phenotype. Storing cultured ocular surface transplants at 37°C is therefore not recommended. This is particularly interesting as 37°C is the standard incubation temperature used for cell

  2. Induction of the autophagy-associated gene MAP1S via PU.1 supports APL differentiation.

    PubMed

    Haimovici, Aladin; Brigger, Daniel; Torbett, Bruce E; Fey, Martin F; Tschan, Mario P

    2014-09-01

    The PU.1 transcription factor is essential for myeloid development. We investigated if the microtubule-associated protein 1S (MAP1S) is a novel PU.1 target with a link to autophagy, a cellular recycling pathway. Comparable to PU.1, MAP1S expression was significantly repressed in primary AML blasts as compared to mature neutrophils. Accordingly, MAP1S expression was induced during neutrophil differentiation of CD34(+) progenitor and APL cells. Moreover, PU.1 bound to the MAP1S promoter and induced MAP1S expression during APL differentiation. Inhibiting MAP1S resulted in aberrant neutrophil differentiation and autophagy. Taken together, our findings implicate the PU.1-regulated MAP1S gene in neutrophil differentiation and autophagy control.

  3. Exome analysis reveals differentially mutated gene signatures of stage, grade and subtype in breast cancers.

    PubMed

    Li, You; Wang, Xiaosheng; Vural, Suleyman; Mishra, Nitish K; Cowan, Kenneth H; Guda, Chittibabu

    2015-01-01

    Breast cancers exhibit highly heterogeneous molecular profiles. Although gene expression profiles have been used to predict the risks and prognostic outcomes of breast cancers, the high variability of gene expression limits its clinical application. In contrast, genetic mutation profiles would be more advantageous than gene expression profiles because genetic mutations can be stably detected and the mutational heterogeneity widely exists in breast cancer genomes. We analyzed 98 breast cancer whole exome samples that were sorted into three subtypes, two grades and two stages. The sum deleterious effect of all mutations in each gene was scored to identify differentially mutated genes (DMGs) for this case-control study. DMGs were corroborated using extensive published knowledge. Functional consequences of deleterious SNVs on protein structure and function were also investigated. Genes such as ERBB2, ESP8, PPP2R4, KIAA0922, SP4, CENPJ, PRCP and SELP that have been experimentally or clinically verified to be tightly associated with breast cancer prognosis are among the DMGs identified in this study. We also identified some genes such as ARL6IP5, RAET1E, and ANO7 that could be crucial for breast cancer development and prognosis. Further, SNVs such as rs1058808, rs2480452, rs61751507, rs79167802, rs11540666, and rs2229437 that potentially influence protein functions are observed at significantly different frequencies in different comparison groups. Protein structure modeling revealed that many non-synonymous SNVs have a deleterious effect on protein stability, structure and function. Mutational profiling at gene- and SNV-level revealed differential patterns within each breast cancer comparison group, and the gene signatures correlate with expected prognostic characteristics of breast cancer classes. Some of the genes and SNVs identified in this study show high promise and are worthy of further investigation by experimental studies.

  4. Exome Analysis Reveals Differentially Mutated Gene Signatures of Stage, Grade and Subtype in Breast Cancers

    PubMed Central

    Li, You; Wang, Xiaosheng; Vural, Suleyman; Mishra, Nitish K.; Cowan, Kenneth H.; Guda, Chittibabu

    2015-01-01

    Breast cancers exhibit highly heterogeneous molecular profiles. Although gene expression profiles have been used to predict the risks and prognostic outcomes of breast cancers, the high variability of gene expression limits its clinical application. In contrast, genetic mutation profiles would be more advantageous than gene expression profiles because genetic mutations can be stably detected and the mutational heterogeneity widely exists in breast cancer genomes. We analyzed 98 breast cancer whole exome samples that were sorted into three subtypes, two grades and two stages. The sum deleterious effect of all mutations in each gene was scored to identify differentially mutated genes (DMGs) for this case-control study. DMGs were corroborated using extensive published knowledge. Functional consequences of deleterious SNVs on protein structure and function were also investigated. Genes such as ERBB2, ESP8, PPP2R4, KIAA0922, SP4, CENPJ, PRCP and SELP that have been experimentally or clinically verified to be tightly associated with breast cancer prognosis are among the DMGs identified in this study. We also identified some genes such as ARL6IP5, RAET1E, and ANO7 that could be crucial for breast cancer development and prognosis. Further, SNVs such as rs1058808, rs2480452, rs61751507, rs79167802, rs11540666, and rs2229437 that potentially influence protein functions are observed at significantly different frequencies in different comparison groups. Protein structure modeling revealed that many non-synonymous SNVs have a deleterious effect on protein stability, structure and function. Mutational profiling at gene- and SNV-level revealed differential patterns within each breast cancer comparison group, and the gene signatures correlate with expected prognostic characteristics of breast cancer classes. Some of the genes and SNVs identified in this study show high promise and are worthy of further investigation by experimental studies. PMID:25803781

  5. Burkholderia cenocepacia differential gene expression during host-pathogen interactions and adaptation to the host environment.

    PubMed

    O'Grady, Eoin P; Sokol, Pamela A

    2011-01-01

    Members of the Burkholderia cepacia complex (Bcc) are important in medical, biotechnological, and agricultural disciplines. These bacteria naturally occur in soil and water environments and have adapted to survive in association with plants and animals including humans. All Bcc species are opportunistic pathogens including Burkholderia cenocepacia that causes infections in cystic fibrosis and chronic granulomatous disease patients. The adaptation of B. cenocepacia to the host environment was assessed in a rat chronic respiratory infection model and compared to that of high cell-density in vitro grown cultures using transcriptomics. The distribution of genes differentially expressed on chromosomes 1, 2, and 3 was relatively proportional to the size of each genomic element, whereas the proportion of plasmid-encoded genes differentially expressed was much higher relative to its size and most genes were induced in vivo. The majority of genes encoding known virulence factors, components of types II and III secretion systems and chromosome 2-encoded type IV secretion system were similarly expressed between in vitro and in vivo environments. Lower expression in vivo was detected for genes encoding N-acyl-homoserine lactone synthase CepI, orphan LuxR homolog CepR2, zinc metalloproteases ZmpA and ZmpB, LysR-type transcriptional regulator ShvR, nematocidal protein AidA, and genes associated with flagellar motility, Flp type pilus formation, and type VI secretion. Plasmid-encoded type IV secretion genes were markedly induced in vivo. Additional genes induced in vivo included genes predicted to be involved in osmotic stress adaptation or intracellular survival, metal ion, and nutrient transport, as well as those encoding outer membrane proteins. Genes identified in this study are potentially important for virulence during host-pathogen interactions and may be associated with survival and adaptation to the host environment during chronic lung infections.

  6. Transcription in space--environmental vs. genetic effects on differential immune gene expression.

    PubMed

    Lenz, Tobias L

    2015-09-01

    Understanding how organisms adapt to their local environment is one of the key goals in molecular ecology. Adaptation can be achieved through qualitative changes in the coding sequence and/or quantitative changes in gene expression, where the optimal dosage of a gene's product in a given environment is being selected for. Differences in gene expression among populations inhabiting distinct environments can be suggestive of locally adapted gene regulation and have thus been studied in different species (Whitehead & Crawford ; Hodgins-Davis & Townsend ). However, in contrast to a gene's coding sequence, its expression level at a given point in time may depend on various factors, including the current environment. Although critical for understanding the extent of local adaptation, it is usually difficult to disentangle the heritable differences in gene regulation from environmental effects. In this issue of Molecular Ecology, Stutz et al. () describe an experiment in which they reciprocally transplanted three-spined sticklebacks (Gasterosteus aculeatus) between independent pairs of small and large lakes. Their experimental design allows them to attribute differences in gene expression among sticklebacks either to lake of origin or destination lake. Interestingly, they find that translocated sticklebacks show a pattern of gene expression more similar to individuals from the destination lake than to individuals from the lake of origin, suggesting that expression of the targeted genes is more strongly regulated by environmental effects than by genetics. The environmental effect by itself is not entirely surprising; however, the relative extent of it is. Especially when put in the context of local adaptation and population differentiation, as done here, these findings cast a new light onto the heritability of differential gene expression and specifically its relative importance during population divergence and ultimately ecological speciation.

  7. Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.

    PubMed

    Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel

    2014-09-01

    Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms.

  8. Detection of differentially expressed genes in the early developmental stage of the mouse mandible.

    PubMed

    Yamaza, H; Matsuo, K; Kiyoshima, T; Shigemura, N; Kobayashi, I; Wada, H; Akamime, A; Sakai, H

    2001-06-01

    We previously examined the development of the mouse mandible, and demonstrated that odontogenesis occurs between embryonic day 10.5 (E10.5) and E12. Based on the histological findings, we performed cDNA subtraction between the E10.5 and E12 mandibles to detect any differentially expressed genes which might be involved in the initiation of odontogenesis. By sequencing, homology search and semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), we thus found Pgk-1, Ccte, Hsp86, Nucleolin, Hsc73, Frg1, N-ras, Set alpha and Hsj2 from the E10.5 mandible, and E25, ATPase6, Mum2, Thymosin beta4 and L21 from the E12 mandible to be differentially expressed genes. These genes are functionally related to protein transport, signal transduction, transcription, translation and molecular chaperon activity. In situ hybridization analyses of Set alpha and E25 showed that Set alpha was detected in the tooth germ at E12 and E14.5, thus indicating a close relationship of this gene to odontogenesis. Meanwhile, the in situ signal of E25 was found in the muscular layer of the tongue, thus suggesting E25 to be related to the differentiation of muscular tissue. In conclusion, we found 15 differentially expressed genes in the course of the early developmental stage of the mouse mandible using a combination of the cDNA subtraction and semi-quantitative RT-PCR methods, while in addition, two genes were demonstrated to be related to the initiation and the development of both tooth germ and the tongue according to the in situ hybridization technique.

  9. Concentration-dependent gene expression responses to flusilazole in embryonic stem cell differentiation cultures

    SciTech Connect

    Dartel, Dorien A.M. van; Pennings, Jeroen L.A.; Fonteyne, Liset J.J. de la; Brauers, Karen J.J.; Claessen, Sandra; Delft, Joost H. van; Kleinjans, Jos C.S.; Piersma, Aldert H.

    2011-03-01

    The murine embryonic stem cell test (EST) is designed to evaluate developmental toxicity based on compound-induced inhibition of embryonic stem cell (ESC) differentiation into cardiomyocytes. The addition of transcriptomic evaluation within the EST may result in enhanced predictability and improved characterization of the applicability domain, therefore improving usage of the EST for regulatory testing strategies. Transcriptomic analyses assessing factors critical for risk assessment (i.e. dose) are needed to determine the value of transcriptomic evaluation in the EST. Here, using the developmentally toxic compound, flusilazole, we investigated the effect of compound concentration on gene expression regulation and toxicity prediction in ESC differentiation cultures. Cultures were exposed for 24 h to multiple concentrations of flusilazole (0.54-54 {mu}M) and RNA was isolated. In addition, we sampled control cultures 0, 24, and 48 h to evaluate the transcriptomic status of the cultures across differentiation. Transcriptomic profiling identified a higher sensitivity of development-related processes as compared to cell division-related processes in flusilazole-exposed differentiation cultures. Furthermore, the sterol synthesis-related mode of action of flusilazole toxicity was detected. Principal component analysis using gene sets related to normal ESC differentiation was used to describe the dynamics of ESC differentiation, defined as the 'differentiation track'. The concentration-dependent effects on development were reflected in the significance of deviation of flusilazole-exposed cultures from this transcriptomic-based differentiation track. Thus, the detection of developmental toxicity in EST using transcriptomics was shown to be compound concentration-dependent. This study provides further insight into the possible application of transcriptomics in the EST as an improved alternative model system for developmental toxicity testing.

  10. Differential modulation of Bordetella pertussis virulence genes as evidenced by DNA microarray analysis.

    PubMed

    Hot, D; Antoine, R; Renauld-Mongénie, G; Caro, V; Hennuy, B; Levillain, E; Huot, L; Wittmann, G; Poncet, D; Jacob-Dubuisson, F; Guyard, C; Rimlinger, F; Aujame, L; Godfroid, E; Guiso, N; Quentin-Millet, M-J; Lemoine, Y; Locht, C

    2003-07-01

    The production of most factors involved in Bordetella pertussis virulence is controlled by a two-component regulatory system termed BvgA/S. In the Bvg+ phase virulence-activated genes (vags) are expressed, and virulence-repressed genes (vrgs) are down-regulated. The expression of these genes can also be modulated by MgSO(4) or nicotinic acid. In this study we used microarrays to analyse the influence of BvgA/S or modulation on the expression of nearly 200 selected genes. With the exception of one vrg, all previously known vags and vrgs were correctly assigned as such, and the microarray analyses identified several new vags and vrgs, including genes coding for putative autotransporters, two-component systems, extracellular sigma factors, the adenylate cyclase accessory genes cyaBDE, and two genes coding for components of a type III secretion system. For most of the new vrgs and vags the results of the microarray analyses were confirmed by RT-PCR analysis and/or lacZfusions. The degree of regulation and modulation varied between genes, and showed a continuum from strongly BvgA/S-activated genes to strongly BvgA/S-repressed genes. The microarray analyses also led to the identification of a subset of vags and vrgs that are differentially regulated and modulated by MgSO(4) or nicotinic acid, indicating that these genes may be targets for multiple regulatory circuits. For example, the expression of bilA, a gene predicted to encode an intimin-like protein, was found to be activated by BvgA/S and up-modulated by nicotinic acid. Furthermore, surprisingly, in the strain analysed here, which produces only type 2 fimbriae, the fim3 gene was identified as a vrg, while fim2 was confirmed to be a vag.

  11. Identification of Differentially Expressed Gene after Femoral Fracture via Microarray Profiling

    PubMed Central

    Zhong, Donggen

    2014-01-01

    We aimed to investigate differentially expressed genes (DEGs) in different stages after femoral fracture based on rat models, providing the basis for the treatment of sport-related fractures. Gene expression data GSE3298 was downloaded from Gene Expression Omnibus (GEO), including 16 chips. All femoral fracture samples were classified into earlier fracture stage and later fracture stage. Total 87 DEGs simultaneously occurred in two stages, of which 4 genes showed opposite expression tendency. Out of the 4 genes, Rest and Cst8 were hub nodes in protein-protein interaction (PPI) network. The GO (Gene Ontology) function enrichment analysis verified that nutrition supply related genes were enriched in the earlier stage and neuron growth related genes were enriched in the later stage. Calcium signaling pathway was the most significant pathway in earlier stage; in later stage, DEGs were enriched into 2 neurodevelopment-related pathways. Analysis of Pearson's correlation coefficient showed that a total of 3,300 genes were significantly associated with fracture time, none of which was overlapped with identified DEGs. This study suggested that Rest and Cst8 might act as potential indicators for fracture healing. Calcium signaling pathway and neurodevelopment-related pathways might be deeply involved in bone healing after femoral fracture. PMID:25110652

  12. Context Specific and Differential Gene Co-expression Networks via Bayesian Biclustering

    PubMed Central

    McDowell, Ian C.; Zhao, Shiwen; Brown, Christopher D.; Engelhardt, Barbara E.

    2016-01-01

    Identifying latent structure in high-dimensional genomic data is essential for exploring biological processes. Here, we consider recovering gene co-expression networks from gene expression data, where each network encodes relationships between genes that are co-regulated by shared biological mechanisms. To do this, we develop a Bayesian statistical model for biclustering to infer subsets of co-regulated genes that covary in all of the samples or in only a subset of the samples. Our biclustering method, BicMix, allows overcomplete representations of the data, computational tractability, and joint modeling of unknown confounders and biological signals. Compared with related biclustering methods, BicMix recovers latent structure with higher precision across diverse simulation scenarios as compared to state-of-the-art biclustering methods. Further, we develop a principled method to recover context specific gene co-expression networks from the estimated sparse biclustering matrices. We apply BicMix to breast cancer gene expression data and to gene expression data from a cardiovascular study cohort, and we recover gene co-expression networks that are differential across ER+ and ER- samples and across male and female samples. We apply BicMix to the Genotype-Tissue Expression (GTEx) pilot data, and we find tissue specific gene networks. We validate these findings by using our tissue specific networks to identify trans-eQTLs specific to one of four primary tissues. PMID:27467526

  13. Differential Sensitivity of Target Genes to Translational Repression by miR-17~92

    PubMed Central

    Jin, Hyun Yong; Oda, Hiroyo; Chen, Pengda; Kang, Seung Goo; Valentine, Elizabeth; Liao, Lujian; Zhang, Yaoyang; Gonzalez-Martin, Alicia; Shepherd, Jovan; Head, Steven R.; Kim, Pyeung-Hyeun; Fu, Guo; Liu, Wen-Hsien; Han, Jiahuai

    2017-01-01

    MicroRNAs (miRNAs) are thought to exert their functions by modulating the expression of hundreds of target genes and each to a small degree, but it remains unclear how small changes in hundreds of target genes are translated into the specific function of a miRNA. Here, we conducted an integrated analysis of transcriptome and translatome of primary B cells from mutant mice expressing miR-17~92 at three different levels to address this issue. We found that target genes exhibit differential sensitivity to miRNA suppression and that only a small fraction of target genes are actually suppressed by a given concentration of miRNA under physiological conditions. Transgenic expression and deletion of the same miRNA gene regulate largely distinct sets of target genes. miR-17~92 controls target gene expression mainly through translational repression and 5’UTR plays an important role in regulating target gene sensitivity to miRNA suppression. These findings provide molecular insights into a model in which miRNAs exert their specific functions through a small number of key target genes. PMID:28241004

  14. Saturation screening for p53 target genes by digital fluorescent differential display.

    PubMed

    Cho, Yong-jig; Stein, Susanne; Jackson, Roger S; Liang, Peng

    2006-01-01

    Differential display (DD) is one of the most commonly used approaches for identifying differentially expressed genes. Despite the great impact of the method on biomedical research, there has been a lack of automation of DD technology to increase its throughput and accuracy for a systematic gene expression analysis. Most of previous DD work has taken a "shotgun" approach of identifying one gene at a time, with limited polymerase chain reaction (PCR) reactions set up manually, giving DD a low-technology and low-throughput image. With our newly created DD mathematical model, which has been validated by computer simulations, global analysis of gene expression by DD technology is no longer a shot in the dark. After identifying the "rate-limiting" factors that contribute to the "noise" level of DD method, we have optimized the DD process with a new platform that incorporates fluorescent digital readout and automated liquid handling. The resulting streamlined fluorescent DD (FDD) technology offers an unprecedented accuracy, sensitivity, and throughput in comprehensive and quantitative analysis of gene expression. We are using this newly integrated FDD technology to conduct a systematic and comprehensive screening for p53 tumor-suppressor gene targets.

  15. HIVed, a knowledgebase for differentially expressed human genes and proteins during HIV infection, replication and latency

    PubMed Central

    Li, Chen; Ramarathinam, Sri H.; Revote, Jerico; Khoury, Georges; Song, Jiangning; Purcell, Anthony W.

    2017-01-01

    Measuring the altered gene expression level and identifying differentially expressed genes/proteins during HIV infection, replication and latency is fundamental for broadening our understanding of the mechanisms of HIV infection and T-cell dysfunction. Such studies are crucial for developing effective strategies for virus eradication from the body. Inspired by the availability and enrichment of gene expression data during HIV infection, replication and latency, in this study, we proposed a novel compendium termed HIVed (HIV expression database; http://hivlatency.erc.monash.edu/) that harbours comprehensive functional annotations of proteins, whose genes have been shown to be dysregulated during HIV infection, replication and latency using different experimental designs and measurements. We manually curated a variety of third-party databases for structural and functional annotations of the protein entries in HIVed. With the goal of benefiting HIV related research, we collected a number of biological annotations for all the entries in HIVed besides their expression profile, including basic protein information, Gene Ontology terms, secondary structure, HIV-1 interaction and pathway information. We hope this comprehensive protein-centric knowledgebase can bridge the gap between the understanding of differentially expressed genes and the functions of their protein products, facilitating the generation of novel hypotheses and treatment strategies to fight against the HIV pandemic. PMID:28358052

  16. Differential expression of genes and proteins associated with wool follicle cycling.

    PubMed

    Liu, Nan; Li, Hegang; Liu, Kaidong; Yu, Juanjuan; Cheng, Ming; De, Wei; Liu, Jifeng; Shi, Shuyan; He, Yanghua; Zhao, Jinshan

    2014-08-01

    Sheep are valuable resources for the wool industry. Wool growth of Aohan fine wool sheep has cycled during different seasons in 1 year. Therefore, identifying genes that control wool growth cycling might lead to ways for improving the quality and yield of fine wool. In this study, we employed Agilent sheep gene expression microarray and proteomic technology to compare the gene expression patterns of the body side skins at August and December time points in Aohan fine wool sheep (a Chinese indigenous breed). Microarray study revealed that 2,223 transcripts were differentially expressed, including 1,162 up-regulated and 1,061 down-regulated transcripts, comparing body side skin at the August time point to the December one (A/D) in Aohan fine wool sheep. Then seven differentially expressed genes were selected to validated the reliability of the gene chip data. The majority of the genes possibly related to follicle development and wool growth could be assigned into the categories including regulation of receptor binding, extracellular region, protein binding and extracellular space. Proteomic study revealed that 84 protein spots showed significant differences in expression levels. Of the 84, 63 protein spots were upregulated and 21 were downregulated in A/D. Finally, 55 protein points were determined through MALDI-TOF/MS analyses. Furthermore, the regulation mechanism of hair follicle might resemble that of fetation.

  17. Aberrant expression of posterior HOX genes in well differentiated histotypes of thyroid cancers.

    PubMed

    Cantile, Monica; Scognamiglio, Giosuè; La Sala, Lucia; La Mantia, Elvira; Scaramuzza, Veronica; Valentino, Elena; Tatangelo, Fabiana; Losito, Simona; Pezzullo, Luciano; Chiofalo, Maria Grazia; Fulciniti, Franco; Franco, Renato; Botti, Gerardo

    2013-11-01

    Molecular etiology of thyroid cancers has been widely studied, and several molecular alterations have been identified mainly associated with follicular and papillary histotypes. However, the molecular bases of the complex pathogenesis of thyroid carcinomas remain poorly understood. HOX genes regulate normal embryonic development, cell differentiation and other critical processes in eukaryotic cell life. Several studies have shown that HOX genes play a role in neoplastic transformation of several human tissues. In particular, the genes belonging to HOX paralogous group 13 seem to hold a relevant role in both tumor development and progression. We have identified a significant prognostic role of HOX D13 in pancreatic cancer and we have recently showed the strong and progressive over-expression of HOX C13 in melanoma metastases and deregulation of HOX B13 expression in bladder cancers. In this study we have investigated, by immunohistochemisty and quantitative Real Time PCR, the HOX paralogous group 13 genes/proteins expression in thyroid cancer evolution and progression, also evaluating its ability to discriminate between main histotypes. Our results showed an aberrant expression, both at gene and protein level, of all members belonging to paralogous group 13 (HOX A13, HOX B13, HOX C13 and HOX D13) in adenoma, papillary and follicular thyroid cancers samples. The data suggest a potential role of HOX paralogous group 13 genes in pathogenesis and differential diagnosis of thyroid cancers.

  18. Control of patterning, growth, and differentiation by floral organ identity genes.

    PubMed

    Sablowski, Robert

    2015-02-01

    In spite of the different morphologies of sepals, petals, stamens, and carpels, all these floral organs are believed to be modified versions of a ground-state organ similar to the leaf. Modifications of the ground-state developmental programme are orchestrated by different combinations of MADS-domain transcription factors encoded by floral organ identity genes. In recent years, much has been revealed about the gene regulatory networks controlled by the floral organ identity genes and about the genetic pathways that control leaf development. This review examines how floral organ identity is connected with the control of morphogenesis and differentiation of shoot organs, focusing on the model species Arabidopsis thaliana. Direct links have emerged between floral organ identity genes and genes involved in abaxial-adaxial patterning, organ boundary formation, tissue growth, and cell differentiation. In parallel, predictive models have been developed to explain how the activity of regulatory genes can be coordinated by intercellular signalling and constrained by tissue mechanics. When combined, these advances provide a unique opportunity for revealing exactly how leaf-like organs have been 'metamorphosed' into floral organs during evolution and showing crucial regulatory points in the generation of plant form.

  19. Two different vestigial like 4 genes are differentially expressed during Xenopus laevis development.

    PubMed

    Barrionuevo, María-Guadalupe; Aybar, Manuel J; Tríbulo, Celeste

    2014-01-01

    The vestigial gene (vg) was first characterized in Drosophila and several homologues were identified in vertebrates and called vestigial like 1-4 (vgll1-4). Vgll proteins interact with the transcription factors TEF-1 and MEF-2 through a conserved region called TONDU (TDU). Vgll4s are characterized by two tandem TDU domains which differentiate them from other members of the vestigial family. In Xenopus two genes were identified as vgll4. Our bioinformatic analysis demonstrated that these two genes are paralogues and must be named differently. We designated them as vgll4 and vgll4l. In situ hybridization analysis revealed that the expression of these two genes is rather different. At gastrula stage, both were expressed in the animal pole. However, at neurula stage, vgll4 was mainly expressed in the neural plate and neural folds, while vgll4l prevailed in the neural folds and epidermis. From the advanced neurula stage onward, expression of both genes was strongly enhanced in neural tissues, anterior neural plate, migrating neural crest, optic and otic vesicles. Nevertheless, there were some differences: vgll4 presented somite expression and vgll4l was localized at the skin and notochord. Our results demonstrate that Xenopus has two orthologues of the vgll4 gene, vgll4 and vgll4l with differential expression in Xenopus embryos and they may well have different roles during development.

  20. Differential gene expression in fully-grown oocytes between gynogenetic and gonochoristic crucian carps.

    PubMed

    Xie, J; Wen, J J; Chen, B; Gui, J F

    2001-06-13

    Silver crucian carp (Carassius auratus gibelio) is a unique triploid bisexual species that can reproduce by gynogenesis. As all other gynogenetic animals, it keeps its chromosome integrity by inhibiting the first meiosis division (no extrusion of the first pole body). To understand the molecular events governing this reproduction mode, suppression subtractive hybridization was used to identify the genes differentially expressed in fully-grown oocytes of the gynogenetic and gonochoristic crucian carp (gyno-carp and gono-carp). From two specific subtractive cDNA libraries, the clones screened out by dot blots and virtual Northern blots were chosen to clone full-length cDNA by RACE. Four differentially expressed genes were obtained. Two are novel genes and are expressed specifically in the oocytes. The gyno-carp stores much more mRNA of cyclin A2, a new member of the fish A-type cyclin gene, in its fully-grown oocyte than in the gono-carp. The last gene is histone H2A. The histone H2As of these two closely related crucian carps are quite different in the C-terminus. Preliminary characterization of the four genes has been analyzed by nucleotide and deduced amino acid sequence and Northern analysis.

  1. Replication-dependent histone genes are actively transcribed in differentiating and aging retinal neurons.

    PubMed

    Banday, Abdul Rouf; Baumgartner, Marybeth; Al Seesi, Sahar; Karunakaran, Devi Krishna Priya; Venkatesh, Aditya; Congdon, Sean; Lemoine, Christopher; Kilcollins, Ashley M; Mandoiu, Ion; Punzo, Claudio; Kanadia, Rahul N

    2014-01-01

    In the mammalian genome, each histone family contains multiple replication-dependent paralogs, which are found in clusters where their transcription is thought to be coupled to the cell cycle. Here, we wanted to interrogate the transcriptional regulation of these paralogs during retinal development and aging. We employed deep sequencing, quantitative PCR, in situ hybridization (ISH), and microarray analysis, which revealed that replication-dependent histone genes were not only transcribed in progenitor cells but also in differentiating neurons. Specifically, by ISH analysis we found that different histone genes were actively transcribed in a subset of neurons between postnatal day 7 and 14. Interestingly, within a histone family, not all paralogs were transcribed at the same level during retinal development. For example, expression of Hist1h1b was higher embryonically, while that of Hist1h1c was higher postnatally. Finally, expression of replication-dependent histone genes was also observed in the aging retina. Moreover, transcription of replication-dependent histones was independent of rapamycin-mediated mTOR pathway inactivation. Overall, our data suggest the existence of variant nucleosomes produced by the differential expression of the replication-dependent histone genes across retinal development. Also, the expression of a subset of replication-dependent histone isotypes in senescent neurons warrants re-examining these genes as "replication-dependent." Thus, our findings underscore the importance of understanding the transcriptional regulation of replication-dependent histone genes in the maintenance and functioning of neurons.

  2. Differentially-Expressed Genes Associated with Faster Growth of the Pacific Abalone, Haliotis discus hannai

    PubMed Central

    Choi, Mi-Jin; Kim, Gun-Do; Kim, Jong-Myoung; Lim, Han Kyu

    2015-01-01

    The Pacific abalone Haliotis discus hannai is used for commercial aquaculture in Korea. We examined the transcriptome of Pacific abalone Haliotis discus hannai siblings using NGS technology to identify genes associated with high growth rates. Pacific abalones grown for 200 days post-fertilization were divided into small-, medium-, and large-size groups with mean weights of 0.26 ± 0.09 g, 1.43 ± 0.405 g, and 5.24 ± 1.09 g, respectively. RNA isolated from the soft tissues of each group was subjected to RNA sequencing. Approximately 1%–3% of the transcripts were differentially expressed in abalones, depending on the growth rate. RT-PCR was carried out on thirty four genes selected to confirm the relative differences in expression detected by RNA sequencing. Six differentially-expressed genes were identified as associated with faster growth of the Pacific abalone. These include five up-regulated genes (including one specific to females) encoding transcripts homologous to incilarin A, perlucin, transforming growth factor-beta-induced protein immunoglobulin-heavy chain 3 (ig-h3), vitelline envelope zona pellucida domain 4, and defensin, and one down-regulated gene encoding tomoregulin in large abalones. Most of the transcripts were expressed predominantly in the hepatopancreas. The genes identified in this study will lead to development of markers for identification of high-growth-rate abalones and female abalones. PMID:26593905

  3. Gene and environment interaction: Is the differential susceptibility hypothesis relevant for obesity?

    PubMed

    Dalle Molle, Roberta; Fatemi, Hajar; Dagher, Alain; Levitan, Robert D; Silveira, Patricia P; Dubé, Laurette

    2017-02-01

    The differential susceptibility model states that a given genetic variant is associated with an increased risk of pathology in negative environments but greater than average resilience in enriched ones. While this theory was first implemented in psychiatric-genetic research, it may also help us to unravel the complex ways that genes and environments interact to influence feeding behavior and obesity. We reviewed evidence on gene vs. environment interactions that influence obesity development, aiming to support the applicability of the differential susceptibility model for this condition, and propose that various environmental "layers" relevant for human development should be considered when bearing the differential susceptibility model in mind. Mother-child relationship, socioeconomic status and individual's response are important modifiers of BMI and food intake when interacting with gene variants, "for better and for worse". While only a few studies to date have investigated obesity outcomes using this approach, we propose that the differential susceptibility hypothesis is in fact highly applicable to the study of genetic and environmental influences on feeding behavior and obesity risk.

  4. Pyrophosphate Stimulates Differentiation, Matrix Gene Expression and Alkaline Phosphatase Activity in Osteoblasts

    PubMed Central

    Pujari-Palmer, Michael; Pujari-Palmer, Shiuli; Lu, Xi; Lind, Thomas; Melhus, Håkan; Engstrand, Thomas; Karlsson-Ott, Marjam; Engqvist, Hakan

    2016-01-01

    Pyrophosphate is a potent mitogen, capable of stimulating proliferation in multiple cell types, and a critical participant in bone mineralization. Pyrophosphate can also affect the resorption rate and bioactivity of orthopedic ceramics. The present study investigated whether calcium pyrophosphate affected proliferation, differentiation and gene expression in early (MC3T3 pre-osteoblast) and late stage (SAOS-2 osteosarcoma) osteoblasts. Pyrophosphate stimulated peak alkaline phosphatase activity by 50% and 150% at 100μM and 0.1μM in MC3T3, and by 40% in SAOS-2. The expression of differentiation markers collagen 1 (COL1), alkaline phosphatase (ALP), osteopontin (OPN), and osteocalcin (OCN) were increased by an average of 1.5, 2, 2 and 3 fold, by high concentrations of sodium pyrophosphate (100μM) after 7 days of exposure in MC3T3. COX-2 and ANK expression did not differ significantly from controls in either treatment group. Though both high and low concentrations of pyrophosphate stimulate ALP activity, only high concentrations (100μM) stimulated osteogenic gene expression. Pyrophosphate did not affect proliferation in either cell type. The results of this study confirm that chronic exposure to pyrophosphate exerts a physiological effect upon osteoblast differentiation and ALP activity, specifically by stimulating osteoblast differentiation markers and extracellular matrix gene expression. PMID:27701417

  5. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity.

    PubMed

    Pickworth, C L; Loerch, S C; Velleman, S G; Pate, J L; Poole, D H; Fluharty, F L

    2011-02-01

    Genetic regulation of the site of fat deposition is not well defined. The objective of this study was to investigate adipogenic differentiation state-specific gene expression in feedlot cattle (>75% Angus; <25% Simmental parentage) of varying adipose accretion patterns. Four groups of 4 steers were selected via ultrasound for the following adipose tissue characteristics: low subcutaneous-low intramuscular (LSQ-LIM), low subcutaneous-high intramuscular (LSQ-HIM), high subcutaneous-low intramuscular (HSQ-LIM), and high subcutaneous-high intramuscular (HSQ-HIM). Adipose tissue from the subcutaneous (SQ) and intramuscular (IM) depots was collected at slaughter. The relative expression of adipogenic genes was evaluated using quantitative PCR. Data were analyzed using the mixed model of SAS, and gene expression data were analyzed using covariate analysis with ribosomal protein L19 as the covariate. No interactions (P > 0.10) were observed between IM and SQ adipose tissue depots for any of the variables measured. Therefore, only the main effects of high and low accretion within a depot and the effects of depot are reported. Steers with LIM had smaller mean diameter IM adipocytes (P < 0.001) than HIM steers. Steers with HSQ had larger mean diameter SQ adipocytes (P < 0.001) than LSQ. However, there were no differences (P > 0.10) in any of the genes measured due to high or low adipose accretion. Preadipogenic delta-like kinase1 mRNA was greater in the IM than the SQ adipose tissue; conversely, differentiating and adipogenic genes, lipoprotein lipase, PPARγ, fatty acid synthetase, and fatty acid binding protein 4 were greater (P < 0.001) in the SQ than the IM depot. Intramuscular adipocytes were smaller than SQ adipocytes and had greater expression of the preadipogenic gene, indicating that more hyperplasia was occurring. Meanwhile, SQ adipose tissue contained much larger (P < 0.001) adipocytes that had a greater expression (P < 0.001) of differentiating and adipogenic

  6. Identification of differentially expressed genes in the livers of chronically i-As-treated hamsters.

    PubMed

    Hernández, Alba; Sampayo-Reyes, Adriana; Marcos, Ricard

    2011-08-01

    Inorganic arsenic (i-As) is a human carcinogen causing skin, lung, urinary bladder, liver and kidney tumors. Chronic exposure to this naturally occurring contaminant, mainly via drinking water, is a significant worldwide environmental health concern. To explore the molecular mechanisms of arsenic hepatic injury, a differential display polymerase chain reaction (DD-PCR) screening was undertaken to identify genes with distinct expression patterns between the liver of low i-As-exposed and control animals. Golden Syrian hamsters (5-6 weeks of age) received drinking water containing 15 mg i-As/L as sodium arsenite, or unaltered water for 18 weeks. The in vivo MN test was carried out, and the frequency of micronucleated reticulocytes (MN-RETs) was scored as a measure of exposure and As-related genotoxic/carcinogenic risk. A total of 68 differentially expressed bands were identified in our initial screen, 41 of which could be assigned to specific genes. Differential level of expression of a selected number of genes was verified using real-time RT-PCR with gene-specific primers. Arsenic-altered gene expression included genes related to stress response, cellular metabolism, cell cycle regulation, telomere maintenance, cell-cell communication and signal transduction. Significant differences of MN-RET were found between treated (8.70 ± 0.02 MN/1000RETs) and control (2.5 ± 0.70 MN/1000RETs) groups (P<0.001), demonstrating both the exposure and the i-As genotoxic/carcinogenic risk. Overall, this paper reveals some possible networks involved in hepatic arsenic-related genotoxicity, carcinogenesis and diabetogenesis. Additional studies to explore further the potential implications of each candidate gene are of especial interest. The present work opens the door to new prospects for the study of i-As mechanisms taking place in the liver under chronic settings.

  7. Regulation of mucous differentiation and mucin gene expression in the tracheobronchial epithelium.

    PubMed

    Gray, T; Koo, J S; Nettesheim, P

    2001-03-07

    The goal of our studies is to elucidate mechanisms that control and modulate mucous differentiation and mucin gene expression in the conducting airways. We used cultures of normal human tracheobronchial epithelial (NHTBE) cells that were shown to secrete two major airway mucins, namely MUC5AC and MUC5B as well as several other secretory products. Mucous differentiation and expression of MUC2, MUC5AC, MUC5B and MUC7, but not MUCi, MUC4, and MUC8 mucin genes, were shown to be retinoic acid- (RA) or retinol-dependent. We found that RA control of mucin genes was mediated by the retinoid acid receptors RAR alpha and, to a lesser extent, by RAR gamma. Our studies also showed that other important bioregulators such as thyroid hormone (T3) and epidermal growth factor (EGF) modulate basal expression of mucin genes, interacting with RA in a concentration-dependent manner. T3, which binds to thyroid receptors (TRs) belonging to the same superfamily of steroid hormone nuclear receptors as the RARs, inhibits mucin gene expression, particularly MUC5AC. One possible mechanism of this T3 effect is downregulation of RAR proteins, which are critical for mucin gene expression. However, we also found that T3 inhibits MUC5AC transcription.EGF, which had previously been shown to stimulate mucin expression and mucin secretion in cultured rat tracheal epithelial (RTE) cells, inhibited mucin secretion in human bronchial epithelial cell cultures. This effect was EGF concentration- and time-dependent and was progressively abolished by increasing the RA concentration. Subsequent studies suggested that the inhibitory effects of high concentrations of EGF may result from selective reduction of MUC5AC expression. These studies thus point to potentially important species differences in the mechanisms regulating mucous production, and they also confirm previous findings indicating differential regulation of MUC5AC and MUC5B gene expression.

  8. Gene Coexpression Analyses Differentiate Networks Associated with Diverse Cancers Harboring TP53 Missense or Null Mutations

    PubMed Central

    Oros Klein, Kathleen; Oualkacha, Karim; Lafond, Marie-Hélène; Bhatnagar, Sahir; Tonin, Patricia N.; Greenwood, Celia M. T.

    2016-01-01

    In a variety of solid cancers, missense mutations in the well-established TP53 tumor suppressor gene may lead to the presence of a partially-functioning protein molecule, whereas mutations affecting the protein encoding reading frame, often referred to as null mutations, result in the absence of p53 protein. Both types of mutations have been observed in the same cancer type. As the resulting tumor biology may be quite different between these two groups, we used RNA-sequencing data from The Cancer Genome Atlas (TCGA) from four different cancers with poor prognosis, namely ovarian, breast, lung and skin cancers, to compare the patterns of coexpression of genes in tumors grouped according to their TP53 missense or null mutation status. We used Weighted Gene Coexpression Network analysis (WGCNA) and a new test statistic built on differences between groups in the measures of gene connectivity. For each cancer, our analysis identified a set of genes showing differential coexpression patterns between the TP53 missense- and null mutation-carrying groups that was robust to the choice of the tuning parameter in WGCNA. After comparing these sets of genes across the four cancers, one gene (KIR3DL2) consistently showed differential coexpression patterns between the null and missense groups. KIR3DL2 is known to play an important role in regulating the immune response, which is consistent with our observation that this gene's strongly-correlated partners implicated many immune-related pathways. Examining mutation-type-related changes in correlations between sets of genes may provide new insight into tumor biology. PMID:27536319

  9. Differential transcription of multiple copies of a silk worm gene encoding tRNA(Gly1).

    PubMed

    Fournier, A; Taneja, R; Gopalkrishnan, R; Prudhomme, J C; Gopinathan, K P

    1993-12-08

    Ten different tRNA(Gly1) genes from the silk worm, Bombyx mori, have been cloned and characterized. These genes were transcribed in vitro in homologous nuclear extracts from the posterior silk gland (PSG) or nuclear extracts derived from the middle silk gland or ovarian tissues. Although the transcription levels were much higher in the PSG nuclear extracts, the transcriptional efficiency of the individual genes followed a similar pattern in all the extracts. Based on the levels of in vitro transcription, the ten tRNA(Gly1) genes could be divided into three groups, viz., those which were transcribed at very high levels (e.g., clone pR8), high to medium levels (e.g., pBmi1, pBmp1, pBmh1, pBmt1) and low to barely detectable levels (e.g., pBms1, pBmj1 and pBmk1). The coding sequences of all these tRNA genes being identical, the differential transcription suggested that the flanking sequences modulate their transcriptional efficiency. The presence of positive and negative regulatory elements in the 5' flanking regions of these genes was confirmed by transcription competition experiments. A positive element was present in the immediate upstream A+T-rich sequences in all the genes, but no consensus sequences correlating to the transcriptional status could be generated. The presence of negative elements on the other hand was indicated only in some of the genes and therefore may have a role in the differential transcription of these tRNA(Gly1) genes in vivo.

  10. The alpha-tubulin gene family expressed during cell differentiation in Naegleria gruberi

    PubMed Central

    1988-01-01

    Genes that direct the programmed synthesis of flagellar alpha-tubulin during the differentiation of Naegleria gruberi from amebae to flagellates have been cloned, and found to be novel with respect to gene organization, sequence, and conservation. The flagellar alpha- tubulin gene family is represented in the genome by about eight homologous DNA segments that are exceptionally similar and yet are neither identical nor arrayed in a short tandem repeat. The coding regions of three of these genes have been sequenced, two from cDNA clones and one from an intronless genomic gene. These three genes encode an identical alpha-tubulin that is conserved relative to the alpha-tubulins of other organisms except at the carboxyl terminus, where the protein is elongated by two residues and ends in a terminal glutamine instead of the canonical tyrosine. In spite of the protein conservation, the Naegleria DNA sequence has diverged markedly from the alpha-tubulin genes of other organisms, a counterexample to the idea that tubulin genes are conserved. alpha-Tubulin mRNA homologous to this gene family has not been detected in amebae. This mRNA increases markedly in abundance during the first hour of differentiation, and then decreases even more rapidly with a half-life of approximately 8 min. The abundance of physical alpha-tubulin mRNA rises and subsequently falls in parallel with the abundance of translatable flagellar tubulin mRNA and with the in vivo rate of flagellar tubulin synthesis, which indicates that flagellar tubulin synthesis is directly regulated by the relative rates of transcription and mRNA degradation. PMID:2838492

  11. Differential gene expression in the perichondrium and cartilage of the neonatal mouse temporomandibular joint

    PubMed Central

    Hinton, RJ; Serrano, M; So, S

    2009-01-01

    Objective To discover genes differentially expressed in the perichondrium of the mandibular condylar cartilage (MCC) that might enhance regenerative medicine or orthopedic therapies directed at the tissues of the temporomandibular joint Design We used targeted gene arrays (osteogenesis, stem cell) to identify genes preferentially expressed in the perichondrium (PC) and the cartilaginous (C) portions of the MCC in 2 day-old mice Results Genes with higher expression in the PC sample related to growth factor ligand-receptor interactions (FGF-13 (6.4X), FGF-18 (4X), NCAM (2X); PGDF receptors, TGF-β, and IGF-1), the Notch isoforms (especially Notch 3 and 4) and their ligands, or structural proteins/ proteoglycans (collagen XIV (21X), collagen XVIII (4X), decorin (2.5X)). Genes with higher expression in the C sample consisted mostly of known cartilage-specific genes (aggrecan (11X), procollagens X (33X), XI (14X), IX (4.5X), Sox 9 (4.4X), and Indian hedgehog (6.7X)). However, the functional or structural roles of several genes that were expressed at higher levels in the PC sample are unclear (myogenic factor 9 (9X), tooth-related genes such as tuftelin (2.5X) and dentin sialophosphoprotein (1.6X), VEGF–B (2X) and its receptors (3–4X), and sclerostin (1.7X)). Conclusions FGF, Notch, and TGF-β signaling may be important regulators of MCC proliferation and differentiation; the relatively high expression of genes such as myogenic factor 6 and VEGF–B and its receptors suggests a degree of unsuspected plasticity in PC cells. PMID:19627518

  12. Hox6 genes modulate in vitro differentiation of mESCs to insulin-producing cells.

    PubMed

    Larsen, Brian M; Marty-Santos, Leilani; Newman, Micaleah; Lukacs, Derek T; Spence, Jason R; Wellik, Deneen M

    2016-10-01

    The differentiation of glucose-responsive, insulin-producing cells from ESCs in vitro is promising as a cellular therapy for the treatment of diabetes, a devastating and common disease. Pancreatic β-cells are derived from the endoderm in vivo and therefore most current protocols attempt to generate a pure population of first endoderm, then pancreas epithelium, and finally insulin-producing cells. Despite this, differentiation protocols result in mixed populations of cells that are often poorly defined, but also contain mesoderm. Using an in vitro mESC-to-β cell differentiation protocol, we show that expression of region-specific Hox genes is induced. We also show that the loss of function of the Hox6 paralogous group, genes expressed only in the mesenchyme of the pancreas (not epithelium), affect the differentiation of insulin-producing cells in vitro. This work is consistent with the important role for these mesoderm-specific factors in vivo and highlights contribution of supporting mesenchymal cells in in vitro differentiation.

  13. The potential role of SRY in epigenetic gene regulation during brain sexual differentiation in mammals.

    PubMed

    Sekido, Ryohei

    2014-01-01

    The brain is a sexually dimorphic organ. Little is known about molecular mechanisms underlying sexual differentiation of the brain and behavior. The classical hypothesis of brain sexual differentiation suggests that a perinatal surge of organizational sex hormones secreted from the gonad leads to irreversible changes in morphology of the brain, followed by pubertal hormones that activate neural networks to express sex-specific behavioral phenotypes. However, recent studies propose that sex hormones are not the sole factor to establish sexual dimorphism in the brain. Since mammalian sex strictly relies on sex chromosome complement, i.e., XY for males and XX for females, intrinsic genetic differences between XY and XX cells are strong candidates for the cause of sexual dimorphism. Several genes on the Y chromosome are expressed in the male brain and may act in a dominant manner. Among these Y-linked genes, the testis-determining gene Sry is of particular interest. Although SRY is known to function as a transcriptional activator triggering testicular genetic pathway, several lines of evidence suggest that it also acts as an epigenetic regulator. This chapter provides a basic overview of mammalian sex determination and brain sexual differentiation. It summarizes current evidence of brain-specific epigenetic gene regulations in mammals and other species, and explores the common features between them. Potential roles of Sry during brain sexual development are described and prospects of this research field are discussed.

  14. Phytanic acid, a novel activator of uncoupling protein-1 gene transcription and brown adipocyte differentiation.

    PubMed Central

    Schlüter, Agatha; Barberá, Maria José; Iglesias, Roser; Giralt, Marta; Villarroya, Francesc

    2002-01-01

    Phytanic acid (3,7,11,15-tetramethylhexadecanoic acid) is a phytol-derived branched-chain fatty acid present in dietary products. Phytanic acid increased uncoupling protein-1 (UCP1) mRNA expression in brown adipocytes differentiated in culture. Phytanic acid induced the expression of the UCP1 gene promoter, which was enhanced by co-transfection with a retinoid X receptor (RXR) expression vector but not with other expression vectors driving peroxisome proliferator-activated receptor (PPAR)alpha, PPARgamma or a form of RXR devoid of ligand-dependent sensitivity. The effect of phytanic acid on the UCP1 gene required the 5' enhancer region of the gene and the effects of phytanic acid were mediated in an additive manner by three binding sites for RXR. Moreover, phytanic acid activates brown adipocyte differentiation: long-term exposure of brown preadipocytes to phytanic acid promoted the acquisition of the brown adipocyte morphology and caused a co-ordinate induction of the mRNAs for gene markers of brown adipocyte differentiation, such as UCP1, adipocyte lipid-binding protein aP2, lipoprotein lipase, the glucose transporter GLUT4 or subunit II of cytochrome c oxidase. In conclusion, phytanic acid is a natural product of phytol metabolism that activates brown adipocyte thermogenic function. It constitutes a potential nutritional signal linking dietary status to adaptive thermogenesis. PMID:11829740

  15. DExD/H-box RNA helicase genes are differentially expressed between males and females during the critical period of male sex differentiation in channel catfish.

    PubMed

    Tian, Changxu; Tan, Suxu; Bao, Lisui; Zeng, Qifan; Liu, Shikai; Yang, Yujia; Zhong, Xiaoxiao; Liu, Zhanjiang

    2017-03-01

    DExD/H-box RNA helicases are motor proteins participating in nearly all aspects of cellular processes, especially in RNA metabolism. In this study, a total of 54 DExD/H-box RNA helicase genes including 37 DDX (DEAD-box) and 17 DHX (DEAH-box) genes were characterized in channel catfish (Ictalurus punctatus), and annotated through phylogenetic and syntenic analyses. All the catfish RNA helicases contained conserved helicase signature motifs, demonstrating that the RNA helicase gene family was highly conserved. Analysis of the relative rates of synonymous (dS) and nonsynonymous (dN) substitutions revealed that the RNA helicase genes were subjected to strong negative (purifying) selection. Meta-analysis was conducted to determine expression of the RNA helicase genes during the critical period (90-110days post-fertilization, dpf) of male gonad differentiation. At 90dpf, 24 RNA helicase genes were highly differentially expressed in the gonad tissues between the males and females; similarly, 24 and 18 RNA helicase genes were found highly differentially expressed in the gonad tissues between the males and females at 100 and 110dpf, respectively (p<0.01). In general, the vast majority of the RNA helicase genes (31) were expressed at higher levels in females than in males. In the male gonad, a set of 8 RNA helicases were expressed at a significantly higher level at 110dpf than at 90dpf. These findings suggested that RNA helicases may play important roles in sex development and differentiation in teleosts.

  16. The KNOTTED-like genes of peach (Prunus persica L. Batsch) are differentially expressed during drupe growth and the class 1 KNOPE1 contributes to mesocarp development.

    PubMed

    Testone, Giulio; Condello, Emiliano; Di Giacomo, Elisabetta; Nicolodi, Chiara; Caboni, Emilia; Rasori, Angela; Bonghi, Claudio; Bruno, Leonardo; Bitonti, Maria Beatrice; Giannino, Donato

    2015-08-01

    The Knotted-like transcription factors (KNOX) contribute to plant organ development. The expression patterns of peach KNOX genes showed that the class 1 members act precociously (S1-S2 stages) and differentially during drupe growth. Specifically, the transcription of KNOPE1 and 6 decreased from early (cell division) to late (cell expansion) S1 sub-stages, whilst that of STMlike1, 2, KNOPE2, 2.1 ceased at early S1. The KNOPE1 role in mesocarp was further addressed by studying the mRNA localization in the pulp cells and vascular net at early and late S1. The message signal was first diffuse in parenchymatous cells and then confined to hypodermal cell layers, showing that the gene down-tuning accompanied cell expansion. As for bundles, the mRNA mainly featured in the procambium/phloem of collateral open types and subsequently in the phloem side of complex structures (converging bundles, ducts). The KNOPE1 overexpression in Arabidopsis caused fruit shortening, decrease of mesocarp cell size, diminution of vascular lignification together with the repression of the major gibberellin synthesis genes AtGA20ox1 and AtGA3ox1. Negative correlation between the expression of KNOPE1 and PpGA3ox1 was observed in four cultivars at S1, suggesting that the KNOPE1 repression of PpGA3ox1 may regulate mesocarp differentiation by acting on gibberellin homeostasis.

  17. Isolation and analysis of differentially expressed genes during asexual sporulation in liquid static culture of Ganoderma lucidum by suppression subtractive hybridization.

    PubMed

    Xu, Jun-Wei; Zhao, Wei; Xu, Yi-Ning; Zhong, Jian-Jiang

    2012-04-01

    Ganoderma lucidum differentiates in liquid static culture by forming aerial mycelia and asexual spores, and this differentiation process is accompanied by higher production of anti-tumor compounds ganoderic acids. To gain an insight into the molecular events during asexual sporulation of G. lucidum, comparative transcriptome analysis using suppression subtractive hybridization (SSH) technique was performed to identify preferentially expressed genes in liquid static culture vs. in traditional shaking culture. After macroarray analysis of 1920 cDNAs from SSH library, 147 unigenes which exhibited high expression in static culture were identified. Among these sequences, putative translations of 88 unigenes possessed much similarity to known proteins involved in cell organization, signal transduction, cell metabolism, protein biosynthesis and transcription regulation; 13 had significant similarity to hypothetical proteins; the remaining 46 showed little or no similarity to GenBank sequences. RT-qPCR analysis confirmed increases in transcripts of selected genes under liquid static culture condition. The results of this study present the useful application of EST analysis on G. lucidum and provide preliminary indication of gene expression putatively involved in asexual sporulation process.

  18. RANK ligand signaling modulates the matrix metalloproteinase-9 gene expression during osteoclast differentiation

    SciTech Connect

    Sundaram, Kumaran; Nishimura, Riko; Senn, Joseph; Youssef, Rimon F.; London, Steven D.; Reddy, Sakamuri V. . E-mail: reddysv@musc.edu

    2007-01-01

    Osteoclast differentiation is tightly regulated by receptor activator of NF-{kappa}B ligand (RANKL) signaling. Matrix metalloproteinase-9 (MMP-9), a type IV collagenase is highly expressed in osteoclast cells and plays an important role in degradation of extracellular matrix; however, the molecular mechanisms that regulate MMP-9 gene expression are unknown. In this study, we demonstrate that RANKL signaling induces MMP-9 gene expression in osteoclast precursor cells. We further show that RANKL regulates MMP-9 gene expression through TRAF6 but not TRAF2. Interestingly, blockade of p38 MAPK activity by pharmacological inhibitor, SB203580 increases MMP-9 activity whereas ERK1/2 inhibitor, PD98059 decreases RANKL induced MMP-9 activity in RAW264.7 cells. These data suggest that RANKL differentially regulates MMP-9 expression through p38 and ERK signaling pathways during osteoclast differentiation. Transient expression of MMP-9 gene (+ 1 to - 1174 bp relative to ATG start codon) promoter-luciferase reporter plasmids in RAW264.7 cells and RANKL stimulation showed significant increase (20-fold) of MMP-9 gene promoter activity; however, there is no significant change with respect to + 1 bp to - 446 bp promoter region and empty vector transfected cells. These results indicated that MMP-9 promoter sequence from - 446 bp to - 1174 bp relative to start codon is responsive to RANKL stimulation. Sequence analysis of the mouse MMP-9 gene promoter region further identified the presence of binding motif (- 1123 bp to - 1153 bp) for the nuclear factor of activated T cells 1 (NFATc1) transcription factor. Inhibition of NFATc1 using siRNA and VIVIT peptide inhibitor significantly decreased RANKL stimulation of MMP-9 activity. We further confirm by oligonucleotide pull-down assay that RANKL stimuli enhanced NFATc1 binding to MMP-9 gene promoter element. In addition, over-expression of constitutively active NFAT in RAW264.7 cells markedly increased (5-fold) MMP-9 gene promoter activity

  19. Examining smoking-induced differential gene expression changes in buccal mucosa

    PubMed Central

    2010-01-01

    Background Gene expression changes resulting from conditions such as disease, environmental stimuli, and drug use, can be monitored in the blood. However, a less invasive method of sample collection is of interest because of the discomfort and specialized personnel necessary for blood sampling especially if multiple samples are being collected. Buccal mucosa cells are easily collected and may be an alternative sample material for biomarker testing. A limited number of studies, primarily in the smoker/oral cancer literature, address this tissue's efficacy as an RNA source for expression analysis. The current study was undertaken to determine if total RNA isolated from buccal mucosa could be used as an alternative tissue source to assay relative gene expression. Methods Total RNA was isolated from swabs, reverse transcribed and amplified. The amplified cDNA was used in RT-qPCR and microarray analyses to evaluate gene expression in buccal cells. Initially, RT-qPCR was used to assess relative transcript levels of four genes from whole blood and buccal cells collected from the same seven individuals, concurrently. Second, buccal cell RNA was used for microarray-based differential gene expression studies by comparing gene expression between a group of female smokers and nonsmokers. Results An amplification protocol allowed use of less buccal cell total RNA (50 ng) than had been reported previously with human microarrays. Total RNA isolated from buccal cells was degraded but was of sufficient quality to be used with RT-qPCR to detect expression of specific genes. We report here the finding of a small number of statistically significant differentially expressed genes between smokers and nonsmokers, using buccal cells as starting material. Gene Set Enrichment Analysis confirmed that these genes had a similar expression pattern to results from another study. Conclusions Our results suggest that despite a high degree of degradation, RNA from buccal cells from cheek mucosa

  20. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer’s Disease Affected Brain Regions

    PubMed Central

    Berretta, Regina; Moscato, Pablo

    2016-01-01

    Background Alzheimer’s disease (AD) is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation. Methods The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD) from the Entorhinal Cortex (EC), Hippocampus (HIP), Middle temporal gyrus (MTG), Posterior cingulate cortex (PC), Superior frontal gyrus (SFG) and visual cortex (VCX) brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets. Results We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD

  1. A short upstream promoter region mediates transcriptional regulation of the mouse doublecortin gene in differentiating neurons

    PubMed Central

    2010-01-01

    Background Doublecortin (Dcx), a MAP (Microtubule-Associated Protein), is transiently expressed in migrating and differentiating neurons and thereby characterizes neuronal precursors and neurogenesis in developing and adult neurogenesis. In addition, reduced Dcx expression during development has been related to appearance of brain pathologies. Here, we attempt to unveil the molecular mechanisms controlling Dcx gene expression by studying its transcriptional regulation during neuronal differentiation. Results To determine and analyze important regulatory sequences of the Dcx promoter, we studied a putative regulatory region upstream from the mouse Dcx coding region (pdcx2kb) and several deletions thereof. These different fragments were used in vitro and in vivo to drive reporter gene expression. We demonstrated, using transient expression experiments, that pdcx2kb is sufficient to control specific reporter gene expression in cerebellar cells and in the developing brain (E14.5). We determined the temporal profile of Dcx promoter activity during neuronal differentiation of mouse embryonic stem cells (mESC) and found that transcriptional activation of the Dcx gene varies along with neuronal differentiation of mESC. Deletion experiments and sequence comparison of Dcx promoters across rodents, human and chicken revealed the importance of a highly conserved sequence in the proximal region of the promoter required for specific and strong expression in neuronal precursors and young neuronal cells. Further analyses revealed the presence in this short sequence of several conserved, putative transcription factor binding sites: LEF/TCF (Lymphoid Enhancer Factor/T-Cell Factor) which are effectors of the canonical Wnt pathway; HNF6/OC2 (Hepatocyte Nuclear Factor-6/Oncecut-2) members of the ONECUT family and NF-Y/CAAT (Nuclear Factor-Y). Conclusions Studies of Dcx gene regulatory sequences using native, deleted and mutated constructs suggest that fragments located upstream of the

  2. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.)

    PubMed Central

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-01-01

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar ‘EP6392’ which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296

  3. Discovery of differentially expressed genes in cashmere goat (Capra hircus) hair follicles by RNA sequencing.

    PubMed

    Qiao, X; Wu, J H; Wu, R B; Su, R; Li, C; Zhang, Y J; Wang, R J; Zhao, Y H; Fan, Y X; Zhang, W G; Li, J Q

    2016-09-02

    The mammalian hair follicle (HF) is a unique, highly regenerative organ with a distinct developmental cycle. Cashmere goat (Capra hircus) HFs can be divided into two categories based on structure and development time: primary and secondary follicles. To identify differentially expressed genes (DEGs) in the primary and secondary HFs of cashmere goats, the RNA sequencing of six individuals from Arbas, Inner Mongolia, was performed. A total of 617 DEGs were identified; 297 were upregulated while 320 were downregulated. Gene ontology analysis revealed that the main functions of the upregulated genes were electron transport, respiratory electron transport, mitochondrial electron transport, and gene expression. The downregulated genes were mainly involved in cell autophagy, protein complexes, neutrophil aggregation, and bacterial fungal defense reactions. According to the Kyoto Encyclopedia of Genes and Genomes database, these genes are mainly involved in the metabolism of cysteine and methionine, RNA polymerization, and the MAPK signaling pathway, and were enriched in primary follicles. A microRNA-target network revealed that secondary follicles are involved in several important biological processes, such as the synthesis of keratin-associated proteins and enzymes involved in amino acid biosynthesis. In summary, these findings will increase our understanding of the complex molecular mechanisms of HF development and cycling, and provide a basis for the further study of the genes and functions of HF development.

  4. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.).

    PubMed

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-05-11

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar 'EP6392' which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns.

  5. Differential gene expression according to race and host plant in the pea aphid.

    PubMed

    Eyres, Isobel; Jaquiéry, Julie; Sugio, Akiko; Duvaux, Ludovic; Gharbi, Karim; Zhou, Jing-Jiang; Legeai, Fabrice; Nelson, Michaela; Simon, Jean-Christophe; Smadja, Carole M; Butlin, Roger; Ferrari, Julia

    2016-09-01

    Host-race formation in phytophagous insects is thought to provide the opportunity for local adaptation and subsequent ecological speciation. Studying gene expression differences amongst host races may help to identify phenotypes under (or resulting from) divergent selection and their genetic, molecular and physiological bases. The pea aphid (Acyrthosiphon pisum) comprises host races specializing on numerous plants in the Fabaceae and provides a unique system for examining the early stages of diversification along a gradient of genetic and associated adaptive divergence. In this study, we examine transcriptome-wide gene expression both in response to environment and across pea aphid races selected to cover the range of genetic divergence reported in this species complex. We identify changes in expression in response to host plant, indicating the importance of gene expression in aphid-plant interactions. Races can be distinguished on the basis of gene expression, and higher numbers of differentially expressed genes are apparent between more divergent races; these expression differences between host races may result from genetic drift and reproductive isolation and possibly divergent selection. Expression differences related to plant adaptation include a subset of chemosensory and salivary genes. Genes showing expression changes in response to host plant do not make up a large portion of between-race expression differences, providing confirmation of previous studies' findings that genes involved in expression differences between diverging populations or species are not necessarily those showing initial plasticity in the face of environmental change.

  6. Global differential expression of genes located in the Down Syndrome Critical Region in normal human brain

    PubMed Central

    Montoya, Julio Cesar; Fajardo, Dianora; Peña, Angela; Sánchez, Adalberto; Domínguez, Martha C; Satizábal, José María

    2014-01-01

    Background: The information of gene expression obtained from databases, have made possible the extraction and analysis of data related with several molecular processes involving not only in brain homeostasis but its disruption in some neuropathologies; principally in Down syndrome and the Alzheimer disease. Objective: To correlate the levels of transcription of 19 genes located in the Down Syndrome Critical Region (DSCR) with their expression in several substructures of normal human brain. Methods: There were obtained expression profiles of 19 DSCR genes in 42 brain substructures, from gene expression values available at the database of the human brain of the Brain Atlas of the Allen Institute for Brain Sciences", (http://human.brain-map.org/). The co-expression patterns of DSCR genes in brain were calculated by using multivariate statistical methods. Results: Highest levels of gene expression were registered at caudate nucleus, nucleus accumbens and putamen among central areas of cerebral cortex. Increased expression levels of RCAN1 that encode by a protein involved in signal transduction process of the CNS were recorded for PCP4 that participates in the binding to calmodulin and TTC3; a protein that is associated with differentiation of neurons. That previously identified brain structures play a crucial role in the learning process, in different class of memory and in motor skills. Conclusion: The precise regulation of DSCR gene expression is crucial to maintain the brain homeostasis, especially in those areas with high levels of gene expression associated with a remarkable process of learning and cognition. PMID:25767303

  7. Comparative analysis of differentially expressed genes in Sika deer antler at different stages.

    PubMed

    Zhao, Yu; Yao, Baojin; Zhang, Mei; Wang, Siming; Zhang, Hui; Xiao, Wei

    2013-02-01

    Deer antlers serve as useful models of rapid growth and mineralization in mammals. During the period of rapid growth, the antlers of many species of deer will elongate by more than 2 cm per day, after which the antlers gradually ossify. However, little is known about the genes that are involved in their development, particularly the molecular mechanisms responsible for rapid growth and ossification. In our previous studies, we have reported on the transcriptome analysis of deer antlers at rapid growth and ossification stages. With the aim to get a comprehensive understanding of gene expression patterns during antler growth, in the present study, we performed a rigorous algorithm to identify differentially expressed genes between two different stages (60 and 90 days) during antler growth. A total of 16,905 significantly changed transcripts were identified. Those sequences were mapped to 5,573 genes with 2,217 genes up-regulated and 3,356 genes down-regulated (60 days vs. 90 days), including ribosomal proteins, translation initiation and elongation factors, transcription factors, signaling molecules and extracellular matrix proteins. We also performed the gene ontology (GO) functional enrichment and pathway enrichment analysis of gene expression patterns with hypergeometric test and Bonferroni Correction. Both the two stages were enriched with members of GO categories and distinct pathways. Our data represent the most comprehensive sequence resource available for the deer antler and provide a basis for further research on deer antler molecular genetics and functional genomics.

  8. Differential expression of ferritin genes in response to abiotic stresses and hormones in pear (Pyrus pyrifolia).

    PubMed

    Xi, Li; Xu, Kuanyong; Qiao, Yushan; Qu, Shenchun; Zhang, Zhen; Dai, Wenhao

    2011-10-01

    In this study, the expression patterns of four ferritin genes (PpFer1, PpFer2, PpFer3, and PpFer4) in pear were investigated using quantitative real-time PCR. Analysis of tissue-specific expression revealed higher expression level of these genes in leaves than in other tested tissues. These ferritin genes were differentially expressed in response to various abiotic stresses and hormones treatments. The expression of ferritin wasn't affected by Fe(III)-citrate treatment. Abscisic acid significantly enhanced the expression of all four ferritin genes, especially PpFer2, followed by N-benzylyminopurine, gibberellic acid, and indole-3-acetic acid. The expression peaks of PpFer1 and PpFer3 in leaves appeared at 6, 6, and 12 h, respectively, after pear plant was exposed to oxidative stress (5 mM H(2)O(2)), salt stress (200 mM NaCl), and heat stress (40°C). A significant increase in PpFer4 expression was detected at 6 h after salt stress or heat stress. The expression of ferritin genes was not altered by cold stress. These results suggested that ferritin genes might be functionally important in acclimation of pear to salt and oxidative stresses. Hormone treatments had no significant effect on expression of ferritin genes compared to abiotic stresses. This showed accumulation of ferritin genes could be operated by different transduction pathways under abiotic stresses and hormones treatments.

  9. MicroRNA-146b promotes myogenic differentiation and modulates multiple gene targets in muscle cells.

    PubMed

    Khanna, Nidhi; Ge, Yejing; Chen, Jie

    2014-01-01

    MicroRNAs are established as crucial modulators of skeletal myogenesis, but our knowledge about their identity and targets remains limited. In this study, we have identified microRNA-146b (miR-146b) as a novel regulator of skeletal myoblast differentiation. Following up on a previous microRNA profiling study, we establish that the expression of miR-146b is up-regulated during myoblast differentiation in vitro and muscle regeneration in vivo. Inhibition of miR-146b led to reduced myoblast differentiation, whereas overexpression of miR-146b enhanced differentiation. Computational prediction combined with gene expression information has revealed candidates for miR-146b targets in muscles. Among them, the expression of Smad4, Notch1, and Hmga2 are significantly suppressed by miR-146b overexpression in myocytes. In addition, expression levels of Smad4, Notch1 and Hmga2 are decreased during myoblast differentiation and muscle regeneration, inversely correlating to the levels of miR-146b. Importantly, inhibition of endogenous miR-146b prevents the down-regulation of Smad4, Notch1 and Hmga2 during differentiation. Furthermore, miR-146b directly targets the microRNA response elements (MREs) in the 3'UTR of those genes as assessed by reporter assays. Reporters with the seed regions of MREs mutated are insensitive to miR-146b, further confirming the specificity of targeting. In conclusion, miR-146b is a positive regulator of myogenic differentiation, possibly acting through multiple targets.

  10. MicroRNA-regulated gene networks during mammary cell differentiation are associated with breast cancer.

    PubMed

    Aydoğdu, Eylem; Katchy, Anne; Tsouko, Efrosini; Lin, Chin-Yo; Haldosén, Lars-Arne; Helguero, Luisa; Williams, Cecilia

    2012-08-01

    MicroRNAs (miRNAs) play pivotal roles in stem cell biology, differentiation and oncogenesis and are of high interest as potential breast cancer therapeutics. However, their expression and function during normal mammary differentiation and in breast cancer remain to be elucidated. In order to identify which miRNAs are involved in mammary differentiation, we thoroughly investigated miRNA expression during functional differentiation of undifferentiated, stem cell-like, murine mammary cells using two different large-scale approaches followed by qPCR. Significant changes in expression of 21 miRNAs were observed in repeated rounds of mammary cell differentiation. The majority, including the miR-200 family and known tumor suppressor miRNAs, was upregulated during differentiation. Only four miRNAs, including oncomiR miR-17, were downregulated. Pathway analysis indicated complex interactions between regulated miRNA clusters and major pathways involved in differentiation, proliferation and stem cell maintenance. Comparisons with human breast cancer tumors showed the gene profile from the undifferentiated, stem-like stage clustered with that of poor-prognosis breast cancer. A common nominator in these groups was the E2F pathway, which was overrepresented among genes targeted by the differentiation-induced miRNAs. A subset of miRNAs could further discriminate between human non-cancer and breast cancer cell lines, and miR-200a/miR-200b, miR-146b and miR-148a were specifically downregulated in triple-negative breast cancer cells. We show that miR-200a/miR-200b can inhibit epithelial-mesenchymal transition (EMT)-characteristic morphological changes in undifferentiated, non-tumorigenic mammary cells. Our studies propose EphA2 as a novel and important target gene for miR-200a. In conclusion, we present evidentiary data on how miRNAs are involved in mammary cell differentiation and indicate their related roles in breast cancer.

  11. Bisphenol A modulates expression of sex differentiation genes in the self-fertilizing fish, Kryptolebias marmoratus.

    PubMed

    Rhee, Jae-Sung; Kim, Bo-Mi; Lee, Chang Joo; Yoon, Yong-Dal; Lee, Young-Mi; Lee, Jae-Seong

    2011-08-01

    Endocrine disrupting chemicals (EDCs) have been a major concern in the normal reproduction and development of aquatic organisms. In the teleost, steroid hormones are synthesized via the steroidogenesis pathway, and play a key physiological role in the regulation of gonadal sex differentiation. The protogynous hermaphroditic fish, Kryptolebias marmoratus is the only vertebrate capable of reproducing through internal self-fertilization. To uncover the effect of bisphenol A (BPA) on sex differentiation genes on transcription, we investigated the expression patterns of several sex differentiation-related genes such as dax1, dmrt1, mis, sf1, figlα, StAR and wt1 after BPA exposure with controls (E2 and TMX). In response to 17β-estradiol (E2) exposure, a testis-specific gene, dmrt1 mRNA was down-regulated in the gonad of the secondary male but the expression of the female-specific gene, dax1 mRNA was significantly elevated in the brain and gonad. A high level of StAR mRNA was detected in the brain and gonad of both hermaphrodite and secondary males, suggesting that the elevated expression of dax1 and StAR genes would be involved in E2 exposure. As expected, upon BPA exposure, the dmrt1 and MIS mRNA level decreased in both hermaphrodite and secondary males, while the female-specific gene, figlα mRNA level increased in the gonad of both genders. BPA showed an opposite mode of action on the expression of dax1 (induction, P>0.05) and sf1 mRNA (inhibition, P>0.05) in the brain and gonad against both genders. The sensitivity of dax1 to BPA on expression was relatively high in the secondary male. The wt1 mRNA was up-regulated in most tissues except in the liver of BPA-exposed secondary males. Regarding the time course study, the figlα mRNA level increased at 6 h after BPA exposure. In addition, BPA elevated the expression of StAR, dax1, and wt1 mRNA but repressed sf1 mRNA. In this paper, we demonstrated that BPA may modulate the expression of sex differentiation and

  12. Differential Gene Expression Analysis of the Epacromius coerulipes (Orthoptera: Acrididae) Transcriptome

    PubMed Central

    Jin, Yongling; Cong, Bin; Wang, Liyan; Gao, Yugang; Zhang, Haiyan; Dong, Hui; Lin, Zhiwei

    2016-01-01

    Epacromius coerulipes (Ivanov) is one of the most widely distributed locusts. To date, the main methods to kill locusts still rely on chemical controls, which can result in the selection of locusts with resistance to chemical pesticides. Butene-fipronil is a new pesticide that was discovered by the structural modification of fipronil. This pesticide has been used to control various agricultural pests and has become an important pesticide product to control pests that exhibit resistance to other pesticides, including locusts. To extend its useful half-life, studies of the initiation and progression of resistance to this pesticide are needed. Herein, two E. coerulipes strains, a pesticide-sensitive (PS) and a pesticide-resistant (PR) strain, were chosen to undergo de novo assembly by paired-end transcriptome Illumina sequencing. Overall, 63,033 unigenes were detected; the average gene length was 772 bp and the N50 was 1,589 bp. Among these unigenes, ∼25,132 (39.87% of the total) could be identified as known proteins in bioinformatic databases from national centers. A comparison of the PR and PS strains revealed that 2,568 genes were differentially expressed, including 1,646 and 922 genes that were up- and down-regulated, respectively. According to the Gene Ontology (GO) database, among biological processes the metabolic process group was the largest group (6,900 genes, 22.47%) and contained a high frequency of differentially expressed genes (544 genes, 27.54%). According to the Clusters of Orthologous Groups (COG) categories, 28 genes, representing 2.98% of all genes, belonged to the group of genes involved in the biosynthesis, transportation, and catabolism of secondary metabolites. The differentially expressed genes that we identified are involved in 50 metabolic pathways. Among these pathways, the metabolism pathway was the most represented. After enrichment analysis of differential gene expression pathways, six pathways—ribosome; starch, and sucrose

  13. Immune- and wound-dependent differential gene expression in an ancient insect.

    PubMed

    Johnston, Paul R; Rolff, Jens

    2013-01-01

    Two of the main functions of the immune system are to control infections and to contribute to wound closure. Here we present the results of an RNAseq study of immune- and wound-response gene expression in the damselfly Coenagrion puella, a representative of the odonates, the oldest taxon of winged insects. De novo assembly of RNAseq data revealed a rich repertoire of canonical immune pathways, as known from model insects, including recognition, transduction and effector gene expression. A shared set of immune and wound repair genes were differentially expressed in both wounded and immune-challenged larvae. Moreover 3-fold more immune genes were induced only in the immune-challenged treatment. This is consistent with the notion that the immune-system reads a balance of signals related to wounding and infection and that the response is tailored accordingly.

  14. Differential Gene Expression Analysis of the Epacromius coerulipes (Orthoptera: Acrididae) Transcriptome.

    PubMed

    Jin, Yongling; Cong, Bin; Wang, Liyan; Gao, Yugang; Zhang, Haiyan; Dong, Hui; Lin, Zhiwei

    2016-01-01

    Epacromius coerulipes (Ivanov) is one of the most widely distributed locusts. To date, the main methods to kill locusts still rely on chemical controls, which can result in the selection of locusts with resistance to chemical pesticides. Butene-fipronil is a new pesticide that was discovered by the structural modification of fipronil. This pesticide has been used to control various agricultural pests and has become an important pesticide product to control pests that exhibit resistance to other pesticides, including locusts. To extend its useful half-life, studies of the initiation and progression of resistance to this pesticide are needed. Herein, two E. coerulipes strains, a pesticide-sensitive (PS) and a pesticide-resistant (PR) strain, were chosen to undergo de novo assembly by paired-end transcriptome Illumina sequencing. Overall, 63,033 unigenes were detected; the average gene length was 772 bp and the N50 was 1,589 bp. Among these unigenes, ∼ 25,132 (39.87% of the total) could be identified as known proteins in bioinformatic databases from national centers. A comparison of the PR and PS strains revealed that 2,568 genes were differentially expressed, including 1,646 and 922 genes that were up- and down-regulated, respectively. According to the Gene Ontology (GO) database, among biological processes the metabolic process group was the largest group (6,900 genes, 22.47%) and contained a high frequency of differentially expressed genes (544 genes, 27.54%). According to the Clusters of Orthologous Groups (COG) categories, 28 genes, representing 2.98% of all genes, belonged to the group of genes involved in the biosynthesis, transportation, and catabolism of secondary metabolites. The differentially expressed genes that we identified are involved in 50 metabolic pathways. Among these pathways, the metabolism pathway was the most represented. After enrichment analysis of differential gene expression pathways, six pathways--ribosome; starch, and sucrose

  15. LOXL2 Oxidizes Methylated TAF10 and Controls TFIID-Dependent Genes during Neural Progenitor Differentiation.

    PubMed

    Iturbide, Ane; Pascual-Reguant, Laura; Fargas, Laura; Cebrià, Joan Pau; Alsina, Berta; García de Herreros, Antonio; Peiró, Sandra

    2015-06-04

    Protein function is often regulated and controlled by posttranslational modifications, such as oxidation. Although oxidation has been mainly considered to be uncontrolled and nonenzymatic, many enzymatic oxidations occur on enzyme-selected lysine residues; for instance, LOXL2 oxidizes lysines by converting the ε-amino groups into aldehyde groups. Using an unbiased proteomic approach, we have identified methylated TAF10, a member of the TFIID complex, as a LOXL2 substrate. LOXL2 oxidation of TAF10 induces its release from its promoters, leading to a block in TFIID-dependent gene transcription. In embryonic stem cells, this results in the inactivation of the pluripotency genes and loss of the pluripotent capacity. During zebrafish development, the absence of LOXL2 resulted in the aberrant overexpression of the neural progenitor gene Sox2 and impaired neural differentiation. Thus, lysine oxidation of the transcription factor TAF10 is a controlled protein modification and demonstrates a role for protein oxidation in regulating pluripotency genes.

  16. Differential expression of genes during aflatoxin B1-induced hepatocarcinogenesis in tree shrews

    PubMed Central

    Li, Yuan; Wan, Da-Fang; Su, Jian-Jia; Cao, Ji; Ou, Chao; Qiu, Xiao-Kun; Ban, Ke-Chen; Yang, Chun; Qin, Liu-Liang; Luo, Dan; Yue, Hui-Fen; Zhang, Li-Sheng; Gu, Jian-Ren

    2004-01-01

    AIM: Through exploring the regulation of gene expression during hepatocarcinogenesis induced by aflatoxin B1 (AFB1), to find out the responsible genes for hepatocellular carcinoma (HCC) and to further understand the underlying molecular mechanism. METHODS: Tree shrews (Tupaia belangeri chinensis) were treated with or without AFB1 for about 90 weeks. Liver biopsies were performed regularly during the animal experiment. Eight shares of total RNA were respectively isolated from 2 HCC tissues, 2 HCC-surrounding non-cancerous liver tissues, 2 biopsied tissues at the early stage (30th week) of the experiment from the same animals as above, 1 mixed sample of three liver tissues biopsied at the beginning (0th week) of the experiment, and another 1 mixed sample of two liver tissues from the untreated control animals biopsied at the 90th week of the experiment. The samples were then tested with the method of AtlasTM cDNA microarray assay. The levels of gene expression in these tissues taken at different time points during hepatocarcinogenesis were compared. RESULTS: The profiles of differently expressed genes were quite different in different ways of comparison. At the same period of hepatocarcinogenesis, the genes in the same function group usually had the same tendency for up- or down-regulation. Among the checked 588 genes that were known to be related to human cancer, 89 genes (15.1%) were recognized as “important genes” because they showed frequent changes in different ways of comparison. The differentially expressed genes during hepatocarcinogenesis could be classified into four categories: genes up-regulated in HCC tissue, genes with similar expressing levels in both HCC and HCC-surrounding liver tissues which were higher than that in the tissues prior to the development of HCC, genes down-regulated in HCC tissue, and genes up-regulated prior to the development of HCC but down-regulated after the development of HCC. CONCLUSION: A considerable number of genes could

  17. Identification of differentially expressed genes in Mongolian sheep ovaries by suppression subtractive hybridization.

    PubMed

    He, Xiaolong; Li, Bei; Wang, Feng; Tian, Chunying; Rong, Weiheng; Liu, Yongbin

    2012-07-01

    Fecundity is an important trait in sheep. Because it is directly related to production costs and efficiency, it has great economic impact in sheep husbandry. Because Mongolian sheep are a longstanding, indigenous breed, they are genetically related to most other breeds of sheep in China. The study of genes related to reproductive traits is essential to improving the fecundity of Mongolian sheep. In the present study, suppression subtractive hybridization (SSH) was performed using forward and reverse nested primers on cDNA libraries from ovarian tissue of single-bearing (S) and biparous (B) Mongolian sheep (MS). This yielded 768 clones. The length of the inserted fragments ranged from 150 to 1000 bp. From these, dot blot hybridization followed by sequencing and homology blast search in GenBank resolved 373 differentially expressed clones, representing 185 gene sequences (homology >85% and length >200 bp), 10 expressed sequence tags (ESTs; homology >95% and length >100 bp), and 4 unknown ESTs. The analysis of the differentially expressed gene functions allowed these genes to be categorized into seven groups: cell/body or immune defense, metabolism, transportation, nucleic acid modification, cell development, signal transduction, and cell structure. Four differentially expressed genes, a disintegrin and metalloproteinase with thrombospondin motifs 1 (ADAMTS1), inhibitor of DNA binding 3 (ID3), bone morphogenetic protein 6 (BMP6), and integrin beta 1 (ITGB1), were randomly selected and verified using relative quantitative real-time polymerase chain reaction (RQ-PCR). The expression of these genes in BMS ovaries was 30.06, 11.55, 0.82, and 1.12-fold that of SMS ovaries, respectively.

  18. Differential gene expression in patients with subsyndromal symptomatic depression and major depressive disorder

    PubMed Central

    Li, Zezhi; Wang, Qingzhong; Wang, Xuemei; Yuan, Chengmei; Wang, Zuowei; Hong, Wu; Lu, Weihong; Cao, Lan; Chen, Jun; Wang, Yong; Yu, Shunying; Zhou, Yimin; Yi, Zhenghui; Fang, Yiru

    2017-01-01

    Background Subsyndromal symptomatic depression (SSD) is a subtype of subthreshold depressive and can lead to significant psychosocial functional impairment. Although the pathogenesis of major depressive disorder (MDD) and SSD still remains poorly understood, a set of studies have found that many same genetic factors play important roles in the etiology of these two disorders. Nowadays, the differential gene expression between MDD and SSD is still unknown. In our previous study, we compared the expression profile and made the classification with the leukocytes by using whole-genome cRNA microarrays among drug-free first-episode subjects with SSD, MDD and matched healthy controls (8 subjects in each group), and finally determined 48 gene expression signatures. Based on these findings, we further clarify whether these genes mRNA was different expressed in peripheral blood in patients with SSD, MDD and healthy controls (60 subjects respectively) Method With the help of the quantitative real-time reverse transcription-polymerase chain reaction (RT-qPCR), we gained gene relative expression levels among the three groups. Results We found that there are three of the forty eight co-regulated genes had differential expression in peripheral blood among the three groups, which are CD84, STRN, CTNS gene (F = 3.528, p = 0.034; F = 3.382, p = 0.039; F = 3.801, p = 0.026, respectively) while there were no significant differences for other genes. Conclusion CD84, STRN, CTNS gene may have significant value for performing diagnostic functions and classifying SSD, MDD and healthy controls. PMID:28333931

  19. The Gene bldA, a regulator of morphological differentiation and antibiotic production in streptomyces.

    PubMed

    Hackl, Stefanie; Bechthold, Andreas

    2015-07-01

    Streptomyces species are well known for their particular features of morphological differentiation. On solid agar, a mold-like aerial mycelium is formed and spores are produced, in which the bld genes play a crucial role. In S. coelicolor, mutations in one specific bld gene called bldA led to a "naked" phenotype lacking aerial hyphae and spores. This peculiar behavior became a major interest for scientific research in the past and it was revealed that bldA is coding for a unique tRNA able to translate a UUA codon into the amino acid leucine. UUA codons are a very rare property of G + C-rich Streptomyces genomes. The impact of bldA on morphology can in parts be attributed to the regulatory effect of bldA on the translational level, because TTA-containing genes can only be translated into their corresponding protein in the presence of a fully functioning bldA gene. In addition to the visible effect of bldA expression on the phenotype of S. coelicolor, bldA mutants were also deficient in antibiotic production. This led to the assumption that the role of bldA must exceed translational control. Many TTA-containing genes are coding for transcriptional regulators which are activating or repressing the transcription of many more genes. Proteomics and transcriptomics are two powerful methods for identifying bldA target genes and it was possible to assign also post-translational regulation to bldA. This review wants to give a short overview on the importance of bldA as a regulator of morphological differentiation and antibiotic production by switching on "silent" gene clusters in Streptomyces.

  20. Comorbid Analysis of Genes Associated with Autism Spectrum Disorders Reveals Differential Evolutionary Constraints

    PubMed Central

    David, Maude M.; Enard, David; Ozturk, Alp; Daniels, Jena; Jung, Jae-Yoon; Diaz-Beltran, Leticia; Wall, Dennis. P.

    2016-01-01

    The burden of comorbidity in Autism Spectrum Disorder (ASD) is substantial. The symptoms of autism overlap with many other human conditions, reflecting common molecular pathologies suggesting that cross-disorder analysis will help prioritize autism gene candidates. Genes in the intersection between autism and related conditions may represent nonspecific indicators of dysregulation while genes unique to autism may play a more causal role. Thorough literature review allowed us to extract 125 ICD-9 codes comorbid to ASD that we mapped to 30 specific human disorders. In the present work, we performed an automated extraction of genes associated with ASD and its comorbid disorders, and found 1031 genes involved in ASD, among which 262 are involved in ASD only, with the remaining 779 involved in ASD and at least one comorbid disorder. A pathway analysis revealed 13 pathways not involved in any other comorbid disorders and therefore unique to ASD, all associated with basal cellular functions. These pathways differ from the pathways associated with both ASD and its comorbid conditions, with the latter being more specific to neural function. To determine whether the sequence of these genes have been subjected to differential evolutionary constraints, we studied long term constraints by looking into Genomic Evolutionary Rate Profiling, and showed that genes involved in several comorbid disorders seem to have undergone more purifying selection than the genes involved in ASD only. This result was corroborated by a higher dN/dS ratio for genes unique to ASD as compare to those that are shared between ASD and its comorbid disorders. Short-term evolutionary constraints showed the same trend as the pN/pS ratio indicates that genes unique to ASD were under significantly less evolutionary constraint than the genes associated with all other disorders. PMID:27414027

  1. Differentiation of early germ cells from human skin-derived stem cells without exogenous gene integration

    PubMed Central

    Ge, Wei; Ma, Hua-Gang; Cheng, Shun-Feng; Sun, Yuan-Chao; Sun, Li-Lan; Sun, Xiao-Feng; Li, Lan; Dyce, Paul; Li, Julang; Shi, Qing-Hua; Shen, Wei

    2015-01-01

    Infertility has long been a difficult issue for many couples. The successful differentiation of germ cells and live progeny from pluripotent stem cells brings new hope to the couples suffering with infertility. Here we successfully isolated human fetus skin-derived stem cells (hfSDSCs) from fetus skin tissue and demonstrated that hfSDSCs can be differentiated into early human germ cell-like cells (hGCLCs). These cells express human germ cell markers DAZL and VASA. Moreover, these pluripotent stem cell-derived hGCLCs are free of exogenous gene integration. When hfSDSCs were differentiated in porcine follicle fluid (PFF) conditioned media, which has been shown to promote the differentiation of mouse and porcine SDSCs into oocyte-like cells (OLCs), we observed some vesicular structures formed from hfSDSCs. Moreover, when hfSDSCs were cultured with specific conditioned media, we observed punctate and elongated SCP3 staining foci, indicating the initiation of meiosis. Ploidy analysis and fluorescent in situ hybridization (FISH) analysis indicated that a small percentage of putative 1N populations formed from hfSDSCs when compared with positive controls. In conclusion, our data here, for the first time, demonstrated that hfSDSCs possess the differentiation potential into germ lines, and they may differentiate both male and female hGCLCs in vitro under appropriate conditions. PMID:26347377

  2. Differentially expressed genes in the silk gland of silkworm (Bombyx mori) treated with TiO2 NPs.

    PubMed

    Xue, Bin; Li, Fanchi; Hu, Jingsheng; Tian, Jianghai; Li, Jinxin; Cheng, Xiaoyu; Hu, Jiahuan; Li, Bing

    2017-05-05

    Silk gland is a silkworm organ where silk proteins are synthesized and secreted. Dietary supplement of TiO2 nanoparticles (NPs) promotes silk protein synthesis in silkworms. In this study, digital gene expression (DGE) tag was used to analyze the gene expression profile of the posterior silk gland of silkworms that were fed with TiO2 NPs. In total, 5,702,823 and 6,150,719 clean tags, 55,096 and 74,715 distinct tags were detected in TiO2 NPs treated and control groups, respectively. Compared with the control, TiO2 NPs treated silkworms showed 306 differentially expressed genes, including 137 upregulated genes and 169 downregulated genes. Of these differentially expressed genes, 106 genes were related to silk protein synthesis, among which 97 genes were upregulated and 9 genes were downregulated. Pathway mapping using the Kyoto Encyclopedia of Genes and Genomes (KEGG) showed that 20 pathways were significantly enriched in TiO2 NPs treated silkworms, and the metabolic pathway-related genes were the most significantly enriched. The DGE results were verified by qRT-PCR analysis of eight differentially expressed genes. The DGE and qRT-PCR results were consistent for all three upregulated genes and three of the five downregulated genes, but the expression trends of the remaining two genes were different between qRT-PCR and DGE analysis. This study enhances our understanding of the mechanism of TiO2 NPs promoted silk protein synthesis.

  3. Co-localization of growth QTL with differentially expressed candidate genes in rainbow trout.

    PubMed

    Kocmarek, Andrea L; Ferguson, Moira M; Danzmann, Roy G

    2015-09-01

    We tested whether genes differentially expressed between large and small rainbow trout co-localized with familial QTL regions for body size. Eleven chromosomes, known from previous work to house QTL for weight and length in rainbow trout, were examined for QTL in half-sibling families produced in September (1 XY male and 1 XX neomale) and December (1 XY male). In previous studies, we identified 108 candidate genes for growth expressed in the liver and white muscle in a subset of the fish used in this study. These gene sequences were BLASTN aligned against the rainbow trout and stickleback genomes to determine their location (rainbow trout) and inferred location based on synteny with the stickleback genome. Across the progeny of all three males used in the study, 63.9% of the genes with differential expression appear to co-localize with the QTL regions on 6 of the 11 chromosomes tested in these males. Genes that co-localized with QTL in the mixed-sex offspring of the two XY males primarily showed up-regulation in the muscle of large fish and were related to muscle growth, metabolism, and the stress response.

  4. Differential Gene Expression Profiling of Enriched Human Spermatogonia after Short- and Long-Term Culture

    PubMed Central

    Conrad, Sabine; Azizi, Hossein; Hatami, Maryam; Kubista, Mikael; Bonin, Michael; Hennenlotter, Jörg; Renninger, Markus; Skutella, Thomas

    2014-01-01

    This study aimed to provide a molecular signature for enriched adult human stem/progenitor spermatogonia during short-term (<2 weeks) and long-term culture (up to more than 14 months) in comparison to human testicular fibroblasts and human embryonic stem cells. Human spermatogonia were isolated by CD49f magnetic activated cell sorting and collagen−/laminin+ matrix binding from primary testis cultures obtained from ten adult men. For transcriptomic analysis, single spermatogonia-like cells were collected based on their morphology and dimensions using a micromanipulation system from the enriched germ cell cultures. Immunocytochemical, RT-PCR and microarray analyses revealed that the analyzed populations of cells were distinct at the molecular level. The germ- and pluripotency-associated genes and genes of differentiation/spermatogenesis pathway were highly expressed in enriched short-term cultured spermatogonia. After long-term culture, a proportion of cells retained and aggravated the “spermatogonial” gene expression profile with the expression of germ and pluripotency-associated genes, while in the majority of long-term cultured cells this molecular profile, typical for the differentiation pathway, was reduced and more genes related to the extracellular matrix production and attachment were expressed. The approach we provide here to study the molecular status of in vitro cultured spermatogonia may be important to optimize the culture conditions and to evaluate the germ cell plasticity in the future. PMID:24738045

  5. The Effects of Simulated Microgravity on Gene Expression in Human Bone Marrow MSC's Under Osteogenic Differentiation

    NASA Astrophysics Data System (ADS)

    Buravkova, L. B.; Gershovich, J. G.; Gershovich, P. M.; Grigoriev, A. I.

    2013-02-01

    In this work it was found that the expression level of 144 genes significantly changed in human mesenchymal stem cells during their osteogenic differentiation after 20 days of exposure to simulated microgravity: the expression of 30 genes significantly increased (from 1.7 to 11.9 fold), and 114 - decreased (from 0.2 to 0.6 fold). Most of the revealed genes were attributed to the 11 major groups corresponding to its biological role in the cells. Additional group was formed from the genes which did not belong to these categories, or did not have a description in the known databases (such as Pubmed). The greatest number of genes with altered expression was found in the group “Matrix and Adhesion", while the lowest - in the "Apoptosis and the response to external stimuli" group. These findings suggest that cultured hMSCs, placed in non-standard conditions, maintain a high level of viability, but have significantly altered functional properties which could affect their efficiency to differentiate towards osteogenic direction.

  6. Identification of differentially expressed genes in parasitic phase Miamiensis avidus (Ciliophora: Scuticociliatia) using suppression subtractive hybridization.

    PubMed

    Lee, Eun Hye; Kim, Ki Hong

    2011-04-06

    Miamiensis avidus, a causative agent of scuticociliatosis in cultured marine fish, can live not only in seawater as a free-living organism but also in fish as a parasite. In this study, a cDNA library of representative mRNAs more specific to parasitic phase M. avidus was generated using suppression subtractive hybridization (SSH), and 520 clones selected from the SSH library were single-run sequenced. The differential gene expression patterns were confirmed by semi-quantitative reverse-transcription PCR. Of the 510 SSH clones, 21 clones of 6 putative genes did not match sequences in the public database. The expectation values (E-values) of 117 clones encoding 9 putative genes were greater than 1 x 10(-5). The other 372 clones that met the criterion of E value <1 x 10-5 were matched to 26 known sequences in the database. Genes associated with signal transduction, cell proliferation, membrane transportation, protein translocation, and transcription regulation were preferentially expressed in parasitic phase M. avidus. The differential gene expression may be needed for the ciliates to survive in the host fish, and the corresponding proteins might be used as antigen candidates for development of scuticociliatosis vaccines.

  7. Differential expression of four soybean bZIP genes during Phakopsora pachyrhizi infection.

    PubMed

    Alves, Murilo S; Soares, Zamira G; Vidigal, Pedro M P; Barros, Everaldo G; Poddanosqui, Adriana M P; Aoyagi, Luciano N; Abdelnoor, Ricardo V; Marcelino-Guimarães, Francismar C; Fietto, Luciano G

    2015-11-01

    Asian soybean rust (ASR), caused by the obligate biotrophic fungus Phakopsora pachyrhizi, is one of most important diseases in the soybean (Glycine max (L.) Merr.) agribusiness. The identification and characterization of genes related to plant defense responses to fungal infection are essential to develop ASR-resistant plants. In this work, we describe four soybean genes, GmbZIP62, GmbZIP105, GmbZIPE1, and GmbZIPE2, which encode transcription factors containing a basic leucine zipper (bZIP) domain from two divergent classes, and that are responsive to P. pachyrhizi infection. Molecular phylogenetic analyses demonstrated that these genes encode proteins similar to bZIP factors responsive to pathogens. Yeast transactivation assays showed that only GmbZIP62 has strong transactivation activity in yeast. In addition, three of the bZIP transcription factors analyzed were also differentially expressed by plant defense hormones, and all were differentially expressed by fungal attack, indicating that these proteins might participate in response to ASR infection. The results suggested that these bZIP proteins are part of the plant defense response to P. pachyrhizi infection, by regulating the gene expression related to ASR infection responses. These bZIP genes are potential targets to obtain new soybean genotypes resistant to ASR.

  8. Identification of genes involved in the drought adaptation and recovery in Portulaca oleracea by differential display.

    PubMed

    D'Andrea, Rodrigo Matías; Triassi, Agustina; Casas, María Isabel; Andreo, Carlos Santiago; Lara, María Valeria

    2015-05-01

    Portulaca oleracea is one of the richest plant sources of ω-3 and ω-6 fatty acids and other compounds potentially valuable for nutrition. It is broadly established in arid, semiarid and well-watered fields, thus making it a promising candidate for research on abiotic stress resistance mechanisms. It is capable of withstanding severe drought and then of recovering upon rehydration. Here, the adaptation to drought and the posterior recovery was evaluated at transcriptomic level by differential display validated by qRT-PCR. Of the 2279 transcript-derived fragments amplified, 202 presented differential expression. Ninety of them were successfully isolated and sequenced. Selected genes were tested against different abiotic stresses in P. oleracea and the behavior of their orthologous genes in Arabidopsis thaliana was also explored to seek for conserved response mechanisms. In drought adapted and in recovered plants changes in expression of many protein metabolism-, lipid metabolism- and stress-related genes were observed. Many genes with unknown function were detected, which also respond to other abiotic stresses. Some of them are also involved in the seed desiccation/imbibition process and thus would be of great interest for further research. The potential use of candidate genes to engineer drought tolerance improvement and recovery is discussed.

  9. Expression of chondrogenic genes by undifferentiated vs. differentiated human mesenchymal stem cells using array technology.

    PubMed

    Henrionnet, Christel; Roeder, Emilie; Gillet, Romain; Galois, Laurent; Bensoussan, Danièle; Mainard, Didier; Netter, Patrick; Gillet, Pierre; Pinzano, Astrid

    2010-01-01

    This study investigated the gene expression profile of human mesenchymal stem cells seeded in collagen sponge for 28 days in three different mediums: (1) basal medium as control containing ITS alone, (2) ITS+TGF-β1 alone or (3) ITS 1% supplemented sequentially by TGF-β1 (D3-D14) followed by BMP-2 (D15-D28). Differential expression of 84 genes implicated in chondrogenic and osteogenic differentiation of MSCs was analyzed at D28 by real-time RT-PCR array technology. TGF-β1 alone down-regulated two genes, CD36 and cathepsin K. Sixteen genes were significantly up-regulated, notably type 2 and type 10 collagens, COMP and Sox9. The sequential combination of TGF-β1 and BMP-2 produced a similar profile with prominent expression of type 2 collagen and the alkaline phosphatase gene. Interestingly, in this in vitro condition, RUNX2 was not up-regulated, suggesting that the sequential combination of TGF-β1/BMP2 enhances the hypertrophic chondrogenic profile without turning towards the osteoblastic pathway.

  10. A Human Minor Histocompatibility Antigen Resulting from Differential Expression due to a Gene Deletion

    PubMed Central

    Murata, Makoto; Warren, Edus H.; Riddell, Stanley R.

    2003-01-01

    Minor histocompatibility antigens (minor H antigens) are targets of graft-versus-host disease and graft-versus-leukemia responses after allogeneic human leukocyte antigen identical hematopoietic stem cell transplantation. Only a few human minor H antigens have been molecularly characterized and in all cases, amino acid differences between homologous donor and recipient proteins due to nucleotide polymorphisms in the respective genes were responsible for immunogenicity. Here, we have used cDNA expression cloning to identify a novel human minor H antigen encoded by UGT2B17, an autosomal gene in the multigene UDP-glycosyltransferase 2 family that is selectively expressed in liver, intestine, and antigen-presenting cells. In contrast to previously defined human minor H antigens, UGT2B17 is immunogenic because of differential expression of the protein in donor and recipient cells as a consequence of a homozygous gene deletion in the donor. Deletion of individual members of large gene families is a common form of genetic variation in the population and our results provide the first evidence that differential protein expression as a consequence of gene deletion is a mechanism for generating minor H antigens in humans. PMID:12743171

  11. Differential var gene expression in children with malaria and antidromic effects on host gene expression.

    PubMed

    Kalmbach, Yvonne; Rottmann, Matthias; Kombila, Maryvonne; Kremsner, Peter G; Beck, Hans-Peter; Kun, Jürgen F J

    2010-07-15

    Among 62 children with mild malaria, cerebral malaria, or severe malarial anemia, we analyzed the transcription of different var gene types. There was no difference in parasitemia level or body temperature between groups. However, a significantly different expression pattern was observed in children with cerebral malaria, compared with that in patients in the other 2 groups: children with cerebral malaria had lower expression of the upsA subtype but higher expression of the upsB and upsC subtypes. Furthermore, expression of human genes responsive to tumor necrosis factor and hypoxia correlated with distinct ups types.

  12. Differential Gene Expression by Lactobacillus plantarum WCFS1 in Response to Phenolic Compounds Reveals New Genes Involved in Tannin Degradation.

    PubMed

    Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario

    2017-04-01

    other in the chromosome, suggesting concomitant regulation. Proteins involved in tannin metabolism and regulation, such GacP (gallic acid permease) and TanR (tannin transcriptional regulator), were identified by differential gene expression in knockout mutants with mutations in genes from this region. This study provides insights into the highly coordinated mechanisms that enable L. plantarum to adapt to plant food fermentations.

  13. Nutritionally driven differential gene expression leads to heterochronic brain development in honeybee castes.

    PubMed

    Moda, Lívia Maria; Vieira, Joseana; Guimarães Freire, Anna Cláudia; Bonatti, Vanessa; Bomtorin, Ana Durvalina; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino

    2013-01-01

    The differential feeding regimes experienced by the queen and worker larvae of the honeybee Apis mellifera shape a complex endocrine response cascade that ultimately gives rise to differences in brain morphologies. Brain development analyzed at the morphological level from the third (L3) through fifth (L5) larval instars revealed an asynchrony between queens and workers. In the feeding phase of the last larval instar (L5F), two well-formed structures, pedunculi and calyces, are identifiable in the mushroom bodies of queens, both of which are not present in workers until a later phase (spinning phase, L5S). Genome-wide expression analyses and normalized transcript expression experiments monitoring specific genes revealed that this differential brain development starts earlier, during L3. Analyzing brains from L3 through L5S1 larvae, we identified 21 genes with caste-specific transcription patterns (e.g., APC-4, GlcAT-P, fax, kr-h1 and shot), which encode proteins that are potentially involved in the development of brain tissues through controlling the cell proliferation rate (APC4, kr-h1) and fasciculation (GlcAT-P, fax, and shot). Shot, whose expression is known to be required for axon extension and cell proliferation, was found to be transcribed at significantly higher levels in L4 queens compared with worker larvae. Moreover, the protein encoded by this gene was immunolocalized to the cytoplasm of cells near the antennal lobe neuropiles and proximal to the Kenyon cells in the brains of L4 queens. In conclusion, during the larval period, the brains of queens are larger and develop more rapidly than workers' brains, which represents a developmental heterochrony reflecting the effect of the differential feeding regime of the two castes on nervous system development. Furthermore, this differential development is characterized by caste-specific transcriptional profiles of a set of genes, thus pointing to a link between differential nutrition and differential

  14. Stemness-Related Transcriptional Factors and Homing Gene Expression Profiles in Hepatic Differentiation and Cancer

    PubMed Central

    Toraih, Eman A; Fawzy, Manal S; El-Falouji, Abdullah I; Hamed, Elham O; Nemr, Nader A; Hussein, Mohammad H; Fadeal, Noha M Abd El

    2016-01-01

    Stem cell transcriptional signature activation is an essential event in the development of cancer. This study aimed to investigate the differential expression profiles of three pluripotency-associated genes, OCT4, NANOG and SOX2, G-protein-coupled chemokine receptor 4 (CXCR4) and the ligand CXCL2, and alpha-fetoprotein (AFP) in hepatogenic differentiated stem cells and in sera of hepatitis C virus (HCV) and HCV-induced hepatocellular carcinoma (HCC) patients. Mesenchymal stem cells derived from umbilical cord blood were differentiated using hepatogenic differentiation media. Serum specimens were collected from 96 patients (32 cirrhotic HCV, 32 early HCC and 32 late HCC) and 96 controls. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed for relative quantification of the six target genes using the Livak method. In silico network analysis was also executed to explore the pluripotency and tumorigenetic regulatory circuits in liver cancer. The expression levels of all genes declined gradually during the stages of stem cell differentiation. On univariate and multivariate analyses, NANOG, CXCR4 and AFP were significantly upregulated in late clinical stage HCC patients. In contrast, SOX2 and CXCL2 were markedly overexpressed in cirrhotic patients and could be used for clear demarcation between cirrhotic and HCC patients in our cases. In conclusion, our data highlight the potential role of the SOX2 stem cell marker and CXCL2 chemokine in liver cell degeneration and fibrogenesis in HCV-induced hepatic cirrhosis in our sample of the Egyptian population. In addition, the significant association of NANOG and CXCR4 high expression with late HCC could contribute to the acquisition of stem cell–like properties in hepatic cancer and dissemination in late stages, respectively. Taken together, our results could have potential application in HCC prognosis and treatment. PMID:27623812

  15. Blue Genes: An Integrative Laboratory to Differentiate Genetic Transformation from Gene Mutation for Underclassmen

    ERIC Educational Resources Information Center

    Militello, Kevin T.; Chang, Ming-Mei; Simon, Robert D.; Lazatin, Justine C.

    2016-01-01

    The ability of students to understand the relationship between genotype and phenotype, and the mechanisms by which genotypes and phenotypes can change is essential for students studying genetics. To this end, we have developed a four-week laboratory called Blue Genes, which is designed to help novice students discriminate between two mechanisms by…

  16. CoGA: An R Package to Identify Differentially Co-Expressed Gene Sets by Analyzing the Graph Spectra.

    PubMed

    Santos, Suzana de Siqueira; Galatro, Thais Fernanda de Almeida; Watanabe, Rodrigo Akira; Oba-Shinjo, Sueli Mieko; Nagahashi Marie, Suely Kazue; Fujita, André

    2015-01-01

    Gene set analysis aims to identify predefined sets of functionally related genes that are differentially expressed between two conditions. Although gene set analysis has been very successful, by incorporating biological knowledge about the gene sets and enhancing statistical power over gene-by-gene analyses, it does not take into account the correlation (association) structure among the genes. In this work, we present CoGA (Co-expression Graph Analyzer), an R package for the identification of groups of differentially associated genes between two phenotypes. The analysis is based on concepts of Information Theory applied to the spectral distributions of the gene co-expression graphs, such as the spectral entropy to measure the randomness of a graph structure and the Jensen-Shannon divergence to discriminate classes of graphs. The package also includes common measures to compare gene co-expression networks in terms of their structural properties, such as centrality, degree distribution, shortest path length, and clustering coefficient. Besides the structural analyses, CoGA also includes graphical interfaces for visual inspection of the networks, ranking of genes according to their "importance" in the network, and the standard differential expression analysis. We show by both simulation experiments and analyses of real data that the statistical tests performed by CoGA indeed control the rate of false positives and is able to identify differentially co-expressed genes that other methods failed.

  17. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail: INOUE-GER@h.u-tokyo.ac.jp

    2007-07-06

    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  18. Transcription of the histone H5 gene is regulated by three differentiation-specific enhancers.

    PubMed Central

    Rousseau, S; Asselin, M; Renaud, J; Ruiz-Carrillo, A

    1993-01-01

    Histone H5, an early marker of the avian erythroid lineage, is expressed at low levels in early erythroid precursors and at higher levels in more mature cells. We show that the increase in H5 expression is due to transcriptional activation of the H5 gene following differentiation of precursor CFU(E). We have found and characterized two upstream enhancers, E1 (between -2233 and -1878 from the site of transcription initiation, +1) and E3 (between -1321 and -1163), and confirmed the presence of a downstream enhancer (C. D. Trainor, S. J. Stamler, and J. D. Engel, Nature [London] 328:827-830, 1987) E7 (between +846 and +1181) which are responsible for the increase in H5 gene transcription. The enhancers had a weak effect in nondifferentiated CFU(E) but a strong effect when the cells were induced to differentiate. Cooperation among the three enhancers, however, was not required for H5 gene activity in the differentiated cells. The enhancers contain binding sites for several ubiquitous and erythroid cell-specific nuclear proteins, including GATA-1, as demonstrated with GATA-1-specific antibodies. Although the GATA sites were required for enhancer function, the concentration of GATA-1, GATA-2, and GATA-3 decreased during cell differentiation, and overexpression of these factors had little effect on H5 transcription. Hence, the differentiation-specific effect of the enhancers is not mediated by changes in relative levels of the GATA factors. Functional analysis of the H5 promoter indicated that the requirement of several elements, including a GC box necessary for transcription enhancement, did not change during the early stages of CFU(E) differentiation. However, the UPE, a positive element in proliferating CFU(E) recognized by the transcription factor H4TF2, was dispensable in the differentiated cells. These results suggest that as the cells enter the final stages of differentiation, there is a reprogramming of the regulatory factors that control H5 transcription and that

  19. Screening and identification of distant metastasis-related differentially expressed genes in human squamous cell lung carcinoma.

    PubMed

    Wang, Na; Zhou, Fachen; Xiong, Hai; Du, Sha; Ma, Jianwei; Okai, Issac; Wang, Jian; Suo, Jing; Hao, Lihong; Song, Yang; Hu, Jun; Shao, Shujuan

    2012-05-01

    Distant metastasis is one of the leading causes of lung cancer death. Detecting the early-stage molecular alternations in primary tumors, such as gene expression differences, provides a "prognostic" value to the precaution of tumor metastasis. The aim of this article is to screen and identify the metastasis-related genes in human squamous cell lung carcinoma. Primary tumor tissues of nine patients with subsequent metastasis and eight patients without metastasis were selected to perform the gene microarray experiment. GO and pathway analyses were used to determine the differentially expressed genes. Two identified genes were further validated by real-time quantitative reverse transcription polymerase chain reaction (PCR) (real-time qRT-PCR). Two hundred and thirty-eight differentially expressed genes were detected in gene chip experiment, including 51 up-regulated genes and 187 down-regulated genes. These genes were involved in several cellular processes, including cell adhesion, cell cycle regulation, and apoptosis. GO analysis showed that the differentially expressed genes participated in a wide ranging of metastasis-related processes, including extracellular region and regulation of liquid surface tension. In addition, pathway analysis demonstrated that the differentially expressed genes were enriched in pathways related to cell cycle and Wnt signaling. Real-time qRT-PCR validation experiment of LCN2 and PDZK1IP1 showed a consistent up-regulation in the metastasis group. The metastasis of human squamous cell lung carcinoma is a complex process that is regulated by multiple gene alternations on the expression levels. The 238 differentially expressed genes identified in this study presumably contain a core set of genes involved in tumor metastasis. The real-time qRT-PCR results of PDZK1IP1 and LCN2 validated the reliability of this gene microarray experiment.

  20. Differential expression of putative drug resistance genes in Mycobacterium tuberculosis clinical isolates.

    PubMed

    González-Escalante, Laura; Peñuelas-Urquides, Katia; Said-Fernández, Salvador; Silva-Ramírez, Beatriz; Bermúdez de León, Mario

    2015-12-01

    Understanding drug resistance in Mycobacterium tuberculosis requires an integrated analysis of strain lineages, mutations and gene expression. Previously, we reported the differential expression of esxG, esxH, infA, groES, rpmI, rpsA and lipF genes in a sensitive M. tuberculosis strain and in a multidrug-resistant clinical isolate. Here, we have evaluated the expression of these genes in 24 clinical isolates that belong to different lineages and have different drug resistance profiles. In vitro, growth kinetics analysis showed no difference in the growth of the clinical isolates, and thus drug resistance occurred without a fitness cost. However, a quantitative reverse transcription PCR analysis of gene expression revealed high variability among the clinical isolates, including those with similar drug resistance profiles. Due to the complexity of gene regulation pathways and the wide diversity of M. tuberculosis lineages, the use of gene expression as a molecular signature for drug resistance is not straightforward. Therefore, we recommend that the expression of M. tuberculosis genes be performed individually, and baseline expression levels should be verified among several different clinical isolates, before any further applications of these findings.

  1. Differential expression of alkaline phosphatase gene in proliferating primary lymphocytes and malignant lymphoid cell lines.

    PubMed

    Latheef, S A A; Devanabanda, Mallaiah; Sankati, Swetha; Madduri, Ramanadham

    2016-02-01

    Alkaline Phosphatase (APase) activity has been shown to be enhanced specifically in mitogen stimulated B lymphocytes committed to proliferation, but not in T lymphocytes. APase gene expression was analyzed in proliferating murine and human primary lymphocytes and human malignant cell lines using reverse transcriptase and real time PCR. In mitogen stimulated murine splenic lymphocytes, enhancement of APase activity correlated well with an increase in APase gene expression. However, in mitogen stimulated murine T lymphocytes and human PBL despite a vigorous proliferative response, no increase in APase enzyme activity or gene expression was observed. A constitutive expression of APase activity concomitant with APase gene expression was observed inhuman myeloma cell line, U266 B1. However, neither enzyme activity nor gene expression of APase were observed in human T cell lymphoma, SUPT-1. The results suggest a differential expression of APase activity and its gene in proliferating primary lymphocytes of mice and humans. The specific expression of APase activity and its gene only in human myeloma cells, but not in proliferating primary B cells can be exploited as a sensitive disease marker.

  2. Innate immune gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.

    PubMed

    Shaughnessy, Ronan G; Meade, Kieran G; Cahalane, Sarah; Allan, Brenda; Reiman, Carla; Callanan, John J; O'Farrelly, Cliona

    2009-12-15

    Salmonella enterica serovar Typhimurium and Campylobacter jejuni are major human pathogens, yet colonise chickens without causing pathology. The aim of this study was to compare intestinal innate immune responses to both bacterial species, in a 4-week-old broiler chicken model. Challenged and control birds were sacrificed and tissue samples taken for histopathology and RNA extraction. No significant clinical or pathological changes were observed in response to infection with either bacterial species. Expression of selected genes involved in pathogen detection and the innate immune response were profiled in caecal tissues by quantitative real-time PCR. TLR4 and TLR21 gene expression was transiently increased in response to both bacterial species (P<0.05). Significant increases in TLR5 and TLR15 gene expression were detected in response to S. Typhimurium but not to C. jejuni. Transient increases of proinflammatory cytokine (IL6 and IFNG) and chemokine (IL8 and K60) genes increased as early as 6h in response to S. Typhimurium. Minimal cytokine gene expression was detected in response to C. jejuni after 20h. IL8 gene expression however, was significantly increased by 24-fold (P<0.01). The differential expression profiles of innate immune genes in both infection models shed light on the tailored responses of the host immune system to specific microbes. It is further evidence that innate regulation of these responses is an important prerequisite to preventing development of disease.

  3. Microarray analysis of differentially expressed genes regulating lipid metabolism during melanoma progression.

    PubMed

    Sumantran, Venil N; Mishra, Pratik; Sudhakar, N

    2015-04-01

    A new hallmark of cancer involves acquisition of a lipogenic phenotype which promotes tumorigenesis. Little is known about lipid metabolism in melanomas. Therefore, we used BRB (Biometrics Research Branch) class comparison tool with multivariate analysis to identify differentially expressed genes in human cutaneous melanomas, compared with benign nevi and normal skin derived from the microarray dataset (GDS1375). The methods were validated by identifying known melanoma biomarkers (CITED1, FGFR2, PTPRF, LICAM, SPP1 and PHACTR1) in our results. Eighteen genes regulating metabolism of fatty acids, lipid second messengers and gangliosides were 2-9 fold upregulated in melanomas of GDS-1375. Out of the 18 genes, 13 were confirmed by KEGG pathway analysis and 10 were also significantly upregulated in human melanoma cell lines of NCI-60 Cell Miner database. Results showed that melanomas upregulated PPARGC1A transcription factor and its target genes regulating synthesis of fatty acids (SCD) and complex lipids (FABP3 and ACSL3). Melanoma also upregulated genes which prevented lipotoxicity (CPT2 and ACOT7) and regulated lipid second messengers, such as phosphatidic acid (AGPAT-4, PLD3) and inositol triphosphate (ITPKB, ITPR3). Genes for synthesis of pro-tumorigenic GM3 and GD3 gangliosides (UGCG, HEXA, ST3GAL5 and ST8SIA1) were also upregulated in melanoma. Overall, the microarray analysis of GDS-1375 dataset indicated that melanomas can become lipogenic by upregulating genes, leading to increase in fatty acid metabolism, metabolism of specific lipid second messengers, and ganglioside synthesis.

  4. Pathways enrichment analysis for differentially expressed genes in squamous lung cancer.

    PubMed

    Qian, Liqiang; Luo, Qingquan; Zhao, Xiaojing; Huang, Jia

    2014-01-01

    Squamous lung cancer (SQLC) is a common type of lung cancer, but its oncogenesis mechanism is not so clear. The aim of this study was to screen the potential pathways changed in SQLC and elucidate the mechanism of it. Published microarray data of GSE3268 series was downloaded from Gene Expression Omnibus (GEO). Significance analysis of microarrays was performed using software R, and differentially expressed genes (DEGs) were harvested. The functions and pathways of DEGs were mapped in Gene Otology and KEGG pathway database, respectively. A total of 2961 genes were filtered as DEGs between normal and SQLC cells. Cell cycle and metabolism were the mainly changed functions of SQLC cells. Meanwhile genes such as MCM, RFC, FEN1, and POLD may induce SQLC through DNA replication pathway, and genes such as PTTG1, CCNB1, CDC6, and PCNA may be involved in SQLC through cell cycle pathway. It is demonstrated that pathway analysis is useful in the identification of target genes in SQLC.

  5. Dexamethasone inhibits the differentiation of rat tendon stem cells into tenocytes by targeting the scleraxis gene.

    PubMed

    Chen, Wan; Tang, Hong; Zhou, Mei; Hu, Chao; Zhang, Jiqiang; Tang, Kanglai

    2015-08-01

    Glucocorticoid-induced tendon rupture is very common in clinical practice, and the overall outcome of surgical suture repair is rather poor. The mechanism remains unclear, and effective treatments are still lacking. In the present study, we investigated the effect of dexamethasone on the differentiation of rat tendon stem cells (TSCs) to tenocytes and the underlying molecular mechanisms and found that dexamethasone inhibits the differentiation of TSCs to tenocytes by analyzing the development of long, spindle-shaped cells and detecting the expression of tenocyte markers type I collagen and tenomodulin (TNMD) at both the mRNA and protein levels. We also discovered that after treatment with dexamethasone, the scleraxis expression level is downregulated in vitro and in human specimen. Chromatin immunoprecipitation (ChIP)-PCR showed that dexamethasone promotes glucocorticoid receptor interacted with the TGGAAGCC sequence located between -734 and -726 base pairs (bp) upstream of the start codon of the scleraxis gene. Furthermore, TSCs were transfected with scleraxis knockdown or overexpression plasmids, and the results indicated that scleraxis plays a pivotal role in the differentiation of TSCs to tenocytes. In conclusion, dexamethasone inhibits the differentiation of TSCs to tenocytes by inhibiting the scleraxis gene.

  6. Identification of driving network of cellular differentiation from single sample time course gene expression data

    NASA Astrophysics Data System (ADS)

    Chen, Ye; Wolanyk, Nathaniel; Ilker, Tunc; Gao, Shouguo; Wang, Xujing

    Methods developed based on bifurcation theory have demonstrated their potential in driving network identification for complex human diseases, including the work by Chen, et al. Recently bifurcation theory has been successfully applied to model cellular differentiation. However, there one often faces a technical challenge in driving network prediction: time course cellular differentiation study often only contains one sample at each time point, while driving network prediction typically require multiple samples at each time point to infer the variation and interaction structures of candidate genes for the driving network. In this study, we investigate several methods to identify both the critical time point and the driving network through examination of how each time point affects the autocorrelation and phase locking. We apply these methods to a high-throughput sequencing (RNA-Seq) dataset of 42 subsets of thymocytes and mature peripheral T cells at multiple time points during their differentiation (GSE48138 from GEO). We compare the predicted driving genes with known transcription regulators of cellular differentiation. We will discuss the advantages and limitations of our proposed methods, as well as potential further improvements of our methods.

  7. The Fto Gene Regulates the Proliferation and Differentiation of Pre-Adipocytes in Vitro.

    PubMed

    Jiao, Yang; Zhang, Jingying; Lu, Lunjie; Xu, Jiaying; Qin, Liqiang

    2016-02-19

    The highly regulated differentiation and proliferation of pre-adipocytes play a key role in the initiation of obesity. Fat mass and obesity associated (FTO) is a novel gene strongly associated with the risk of obesity. A deficiency of FTO may cause growth retardation in addition to fat mass and adipocyte size reduction in vivo. To investigate the potential role of Fto gene on the proliferation and differentiation of pre-adipocytes, we generated Fto-knockdown and overexpressed 3T3-L1 cells. Using numerous proliferation assays our results suggest that Fto knockdown leads to suppression of proliferation, lower mitochondrial membrane potential, less cellular ATP, and decreased and smaller intracellular lipid droplets compared with controls (p < 0.05). Western blot analysis demonstrated that Fto knockdown can significantly suppress peroxisome proliferator-activated receptor gamma (PPARγ) and glucose transporter type 4 (GLUT4) expression and inhibit Akt phosphorylation. By contrast, overexpression of Fto had the opposing effect on proliferation, mitochondrial membrane potential, ATP generation, in vitro differentiation, Akt phosphorylation, and PPARγ and GLUT4 expression. Moreover, we demonstrated that Wortmannin, a phosphoinositide 3-kinase (PI3K) inhibitor, could inhibit phospho-Akt in Fto overexpressed 3T3-L1 cells. Taken together, the results suggest that Fto regulates the proliferation and differentiation of 3T3-L1 cells via multiple mechanisms, including PPARγ and PI3K/Akt signaling.

  8. Induction of a program gene expression during osteoblast differentiation with strontium ranelate

    SciTech Connect

    Zhu Lingling; Zaidi, Samir; Peng Yuanzhen; Zhou Hang; Moonga, Baljit S.; Blesius, Alexia; Dupin-Roger, Isabelle; Zaidi, Mone . E-mail: mone.zaidi@mssm.edu; Sun Li

    2007-04-06

    Strontium ranelate, a new agent for the treatment of osteoporosis, has been shown stimulate bone formation in various experimental models. This study examines the effect of strontium ranelate on gene expression in osteoblasts, as well as the formation of mineralized (von Kossa-positive) colony-forming unit-osteoblasts (CFU-obs). Bone marrow-derived stromal cells cultured for 21 days under differentiating conditions, when exposed to strontium ranelate, displayed a significant time- and concentration-dependent increase in the expression of the master gene, Runx2, as well as bone sialoprotein (BSP), but interestingly without effects on osteocalcin. This was associated with a significant increase in the formation of CFU-obs at day 21 of culture. In U-33 pre-osteoblastic cells, strontium ranelate significantly enhanced the expression of Runx2 and osteocalcin, but not BSP. Late, more mature osteoblastic OB-6 cells showed significant elevations in BSP and osteocalcin, but with only minimal effects on Runx2. In conclusion, strontium ranelate stimulates osteoblast differentiation, but the induction of the program of gene expression appears to be cell type-specific. The increased osteoblastic differentiation is the likely basis underlying the therapeutic bone-forming actions of strontium ranelate.

  9. Concentration-response analysis of differential gene expression in the zebrafish embryotoxicity test following flusilazole exposure.

    PubMed

    Hermsen, Sanne A B; Pronk, Tessa E; van den Brandhof, Evert-Jan; van der Ven, Leo T M; Piersma, Aldert H

    2012-05-01

    The zebrafish embryotoxicity test (ZET) is considered a promising alternative model in predictive toxicology. Currently, morphological assessment of the embryo is the main readout for this assay. However, implementation of transcriptomics may help to detect more subtle effects, which may increase the sensitivity and predictability of the test. In this study, we tested a concentration response of flusilazole in the ZET. After exposure for 24 h postfertilization, microarray analysis revealed a number of processes to be regulated in a concentration-dependent way. We identified development related processes, retinol metabolism and transcription, as well as processes corresponding to the antifungal mechanism of action, steroid biosynthesis, and fatty acid metabolism, to be differentially regulated. Retinol metabolism and transcription were already significantly altered at concentrations that were not inducing morphological effects. Differential expression of genes related to steroid biosynthesis and fatty acid metabolism showed a concentration response similar to morphological response. An increase in concentration was also positively associated with an increase in magnitude of expression for individual genes within functional processes. Our study shows that transcriptomics analysis in the ZET is a more sensitive readout of compound-induced effects than morphological assessment. However, the interpretation of differential gene expression in terms of predicting morphological effects is not straightforward and requires further study.

  10. Heterogeneous activation of a slow myosin gene in proliferating myoblasts and differentiated single myofibers

    PubMed Central

    Wang, Jing-hua; Wang, Qiao-jing; Wang, Chao; Reinholt, Brad; Grant, Alan L; Gerrard, David E; Kuang, Shihuan

    2015-01-01

    Each skeletal muscle contains a fixed ratio of fast and slow myofibers that are distributed in a stereotyped pattern to achieve a specific motor function. How myofibers are specified during development and regeneration is poorly understood. Here we address this question using transgenic reporter mice that indelibly mark the myofiber lineages based on activation of fast or slow myosin. Lineage tracing indicates that during development all muscles have activated the fast myosin gene Myl1, but not the slow myosin gene Myh7, which is activated in all slow but a subset of fast myofibers. Similarly, most nascent myofibers do not activate Myh7 during fast muscle regeneration, but the ratio and pattern of fast and slow myofibers are restored at the completion of regeneration. At the single myofiber level, most mature fast myofibers are heterogeneous in nuclear composition, manifested by mosaic activation of Myh7. Strikingly, Myh7 is activated in a subpopulation of proliferating myoblasts that co-express the myogenic progenitor marker Pax7. When induced to differentiate, the Myh7-activated myoblasts differentiate more readily than the non-activated myoblasts, and have a higher tendency, but not restricted, to become slow myotubes. Together, our data reveal significant nuclear heterogeneity within a single myofiber, and challenge the conventional view that myosin genes are only expressed after myogenic differentiation. These results provide novel insights into the regulation of muscle fiber type specification. PMID:25794679

  11. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  12. Zebra fish myc family and max genes: differential expression and oncogenic activity throughout vertebrate evolution.

    PubMed Central

    Schreiber-Agus, N; Horner, J; Torres, R; Chiu, F C; DePinho, R A

    1993-01-01

    To gain insight into the role of Myc family oncoproteins and their associated protein Max in vertebrate growth and development, we sought to identify homologs in the zebra fish (Brachydanio rerio). A combination of a polymerase chain reaction-based cloning strategy and low-stringency hybridization screening allowed for the isolation of zebra fish c-, N-, and L-myc and max genes; subsequent structural characterization showed a high degree of conservation in regions that encode motifs of known functional significance. On the functional level, zebra fish Max, like its mammalian counterpart, served to suppress the transformation activity of mouse c-Myc in rat embryo fibroblasts. In addition, the zebra fish c-myc gene proved capable of cooperating with an activated H-ras to effect the malignant transformation of mammalian cells, albeit with diminished potency compared with mouse c-myc. With respect to their roles in normal developing tissues, the differential temporal and spatial patterns of steady-state mRNA expression observed for each zebra fish myc family member suggest unique functions for L-myc in early embryogenesis, for N-myc in establishment and growth of early organ systems, and for c-myc in increasingly differentiated tissues. Furthermore, significant alterations in the steady-state expression of zebra fish myc family genes concomitant with relatively constant max expression support the emerging model of regulation of Myc function in cellular growth and differentiation. Images PMID:8474440

  13. Identification of Differentially Expressed Genes Relevant to Corm Formation in Sagittaria trifolia

    PubMed Central

    Xu, Xiaoyong; Hussain, Javeed; Yin, Jingjing; Zhang, Yi; Li, Liangjun; Chen, Xuehao

    2013-01-01

    Sagittaria trifolia is a good model of wetland plants to elucidate the formation of corm. However, few studies have been conducted to uncover the complexity of gene expression involved in corm formation. In this study, high-throughput tag-sequencing based on Solexa Genome Analyzer Platform was applied to monitor the changes in gene expression with three libraries of differentially expressed genes (DEGs) (C1 library: stolon stage, C2 library: initial swelling stage and C3 library: swelling stage) during corm formation in Sagittaria trifolia. Approximately 6.0 million tags were sequenced, and 5854021, 5983454, and 5761079 clean tags including 138319, 116804, and 101739 distinct tags were obtained after removal of low quality tags from each library, respectively. About 46% distinct tags were unambiguous tags mapping to the reference genes, and 33% were unambiguous tag-mapped genes. Totally, 20575, 19807, and 18438 were annotated in C1, C2, and C3 libraries, respectively, after mapping their functions in existing databases. In addition, we found that profiling of gene expression in C1/C2 and C2/C3 libraries were different among most of the selected 20 DEGs. Most DEGs in C1/C2 libraries were relevant to hormone synthesis and response; energy metabolism and stress response, while most of the genes in C2/C3 libraries were involved in carbohydrate metabolism. All up-regulated transcriptional factors and 16 important genes relevant to corm formation in three libraries were also identified. To further analyze the expression of 9 genes, from the results of tag-sequencing, qRT-PCR was applied. In summary, this study provides a comprehensive understanding of gene expression, during the formation of corm in Sagittaria trifolia. PMID:23359383

  14. Sequencing and bioinformatics analysis of the differentially expressed genes in herniated discs with or without calcification

    PubMed Central

    Shao, Jia; Yu, Miao; Jiang, Liang; Wu, Fengliang; Liu, Xiaoguang

    2017-01-01

    The purpose of this study was to detect the differentially expressed genes between ossified herniated discs and herniated discs without ossification. In addition, we sought to identify a few candidate genes and pathways by using bioinformatics analysis. We analyzed 6 samples each of ossified herniated discs (experimental group) and herniated discs without ossification (control group). Purified mRNA and cDNA extracted from the samples were subjected to sequencing. The NOISeq method was used to statistically identify the differentially expressed genes (DEGs) between the 2 groups. An in-depth analysis using bioinformatics tools based on the DEGs was performed using Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, and protein-protein interaction network analysis. The top 6 DEGs were verified using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). A total of 132 DEGs was detected. A total of 129 genes in the ossified group were upregulated and 3 genes were found to be downregulated as compared to the control group. The top 3 cellular components in GO ontologies analysis were extracellular matrix components. GO functions were mainly related to the glycoprotein in the cell membrane and extracellular matrix. The GO process was related to completing response to stimulus, immune reflex and defense. The top 5 KEGG enrichment pathways were associated with infection and inflammation. Three of the top 20 DEGs [sclerostin (SOST), WNT inhibitory factor 1 (WIF1) and secreted frizzled related protein 4 (SFRP4)] were related to the inhibition of the Wnt pathway. The ossified discs exhibited a higher expression of the top 6 DEGs [SOST, joining chain of multimeric IgA and IgM (IGJ; also known as JCHAIN), defensin alpha 4 (DEFA4), SFRP4, proteinase 3 (PRTN3) and cathepsin G (CTSG)], with the associated P-values of 0.045, 0.000, 0.008, 0.010, 0.015 and 0.002, respectively, as calculated by the independent sample t

  15. Highly and moderately aggressive mouse ovarian cancer cell lines exhibit differential gene expression

    PubMed Central

    Zhang, Wensheng; Kale, Shubha P.; McFerrin, Harris; Davenport, Ian; Wang, Guangdi; Skripnikova, Elena; Li, Xiao-Lin; Bowen, Nathan J.; McDaniels, Leticia B; Meng, Yuan-Xiang; Polk, Paula; Liu, Yong-Yu; Zhang, Qian-Jin

    2017-01-01

    Patients with advanced epithelial ovarian cancer often experience disease recurrence after standard therapies, a critical factor in determining their five-year survival rate. Recent reports indicated that long-term or short-term survival is associated with varied gene expression of cancer cells. Thus, identification of novel prognostic biomarkers should be considered. Since the mouse genome is similar to the human genome, we explored potential prognostic biomarkers using two groups of mouse ovarian cancer cell lines (group 1: IG-10, IG-10pw, and IG-10pw/agar; group 2: IG-10 clones 2, 3, and 11) which display highly and moderately aggressive phenotypes in vivo. Mice injected with these cell lines have different survival time and rates, capacities of tumor, and ascites formations, reflecting different prognostic potentials. Using an Affymetrix Mouse Genome 430 2.0 Array, a total of 181 genes were differentially expressed (P<0.01) by at least twofold between two groups of the cell lines. Of the 181 genes, 109 and 72 genes were overexpressed in highly and moderately aggressive cell lines, respectively. Analysis of the 109 and 72 genes using Ingenuity Pathway Analysis (IPA) tool revealed two cancer-related gene networks. One was associated with the highly aggressive cell lines and affiliated with MYC gene, and another was associated with the moderately aggressive cell lines and affiliated with the androgen receptor (AR). Finally, the gene enrichment analysis indicated that the overexpressed 89 genes (out of 109 genes) in highly aggressive cell lines had a function annotation in the David database. The cancer-relevant significant gene ontology (GO) terms included Cell cycle, DNA metabolic process, and Programmed cell death. None of the genes from a set of the 72 genes overexpressed in the moderately aggressive cell lines had a function annotation in the David database. Our results suggested that the overexpressed MYC and 109 gene set represented highly aggressive ovarian

  16. Comparative study of gene expression during the differentiation of white and brown preadipocytes

    NASA Astrophysics Data System (ADS)

    Boeuf, Stéphane

    2002-08-01

    Introduction Mammals have two types of adipose tissue: the lipid storing white adipose tissue and the brown adipose tissue characterised by its capacity for non-shivering thermogenesis. White and brown adipocytes have the same origin in mesodermal stem cells. Yet nothing is known so far about the commitment of precursor cells to the white and brown adipose lineage. Several experimental approaches indicate that they originate from the differentiation of two distinct types of precursor cells, white and brown preadipocytes. Based on this hypothesis, the aim of this study was to analyse the gene expression of white and brown preadipocytes in a systematic approach. Experimental approach The white and brown preadipocytes to compare were obtained from primary cell cultures of preadipocytes from the Djungarian dwarf hamster. Representational difference analysis was used to isolate genes potentially differentially expressed between the two cell types. The thus obtained cDNA libraries were spotted on microarrays for a large scale gene expression analysis in cultured preadipocytes and adipocytes and in tissue samples. Results 4 genes with higher expression in white preadipocytes (3 members of the complement system and a fatty acid desaturase) and 8 with higher expression in brown preadipocytes were identified. From the latter 3 coded for structural proteins (fibronectin, metargidin and a actinin 4), 3 for proteins involved in transcriptional regulation (necdin, vigilin and the small nuclear ribonucleoprotein polypeptide A) and 2 are of unknown function. Cluster analysis was applied to the gene expression data in order to characterise them and led to the identification of four major typical expression profiles: genes up-regulated during differentiation, genes down-regulated during differentiation, genes higher expressed in white preadipocytes and genes higher expressed in brown preadipocytes. Conclusion This study shows that white and brown preadipocytes can be distinguished

  17. Electrical stimulation of neonatal cardiomyocytes results in the sequential activation of nuclear genes governing mitochondrial proliferation and differentiation

    PubMed Central

    Xia, Yang; Buja, L. Maximilian; Scarpulla, Richard C.; McMillin, Jeanie B.

    1997-01-01

    Electrical stimulation of neonatal cardiac myocytes produces hypertrophy and cellular maturation with increased mitochondrial content and activity. To investigate the patterns of gene expression associated with these processes, cardiac myocytes were stimulated for varying times up to 72 hr in serum-free culture. The mRNA contents for genes associated with transcriptional activation [c-fos, c-jun, JunB, nuclear respiratory factor 1 (NRF-1)], mitochondrial proliferation [cytochrome c (Cyt c), cytochrome oxidase], and mitochondrial differentiation [carnitine palmitoyltransferase I (CPT-I) isoforms] were measured. The results establish a temporal pattern of mRNA induction beginning with c-fos (0.25–3 hr) and followed sequentially by c-jun (0.5–3 hr), JunB (0.5–6 hr), NRF-1 (1–12 hr), Cyt c (12–72 hr), and muscle-specific CPT-I (48–72 hr). Induction of the latter was accompanied by a marked decrease in the liver-specific CPT-I mRNA, thus supporting the developmental fidelity of this pattern of gene regulation. Consistent with a transcriptional mechanism, electrical stimulation increased c-fos, β-myosin heavy chain, and Cyt c promoter activities. These increases coincided with a rise in their respective endogenous gene transcripts. NRF-1, cAMP response element, and Sp-1 site mutations within the Cyt c promoter reduced luciferase expression in both stimulated and nonstimulated myocytes. Mutations in the NRF-1 and CRE sites inhibited the induction by electrical stimulation (5-fold and 2-fold, respectively) whereas mutation of the Sp-1 site maintained or increased the fold induction. This finding is consistent with the appearance of NRF-1 and fos/jun mRNAs prior to that of Cyt c and suggests that induction of these transcription factors is a prerequisite for the transcriptional activation of Cyt c expression. These results support a regulatory role for NRF-1 and possibly AP-1 in the initiation of mitochondrial proliferation. PMID:9326621

  18. Ethylene-induced differential gene expression during abscission of citrus leaves

    PubMed Central

    Merelo, Paz; Cercós, Manuel; Tadeo, Francisco R.; Talón, Manuel

    2008-01-01

    The main objective of this work was to identify and classify genes involved in the process of leaf abscission in Clementina de Nules (Citrus clementina Hort. Ex Tan.). A 7 K unigene citrus cDNA microarray containing 12 K spots was used to characterize the transcriptome of the ethylene-induced abscission process in laminar abscission zone-enriched tissues and the petiole of debladed leaf explants. In these conditions, ethylene induced 100% leaf explant abscission in 72 h while, in air-treated samples, the abscission period started later and took 240 h. Gene expression monitored during the first 36 h of ethylene treatment showed that out of the 12 672 cDNA microarray probes, ethylene differentially induced 725 probes distributed as follows: 216 (29.8%) probes in the laminar abscission zone and 509 (70.2%) in the petiole. Functional MIPS classification and manual annotation of differentially expressed genes highlighted key processes regulating the activation and progress of the cell separation that brings about abscission. These included cell-wall modification, lipid transport, protein biosynthesis and degradation, and differential activation of signal transduction and transcription control pathways. Expression data associated with the petiole indicated the occurrence of a double defensive strategy mediated by the activation of a biochemical programme including scavenging ROS, defence and PR genes, and a physical response mostly based on lignin biosynthesis and deposition. This work identifies new genes probably involved in the onset and development of the leaf abscission process and suggests a different but co-ordinated and complementary role for the laminar abscission zone and the petiole during the process of abscission. PMID:18515267

  19. Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle

    PubMed Central

    2011-01-01

    Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia), 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy), and 16wk (market age) from two genetic lines: a randombred control line (RBC2) maintained without selection pressure, and a line (F) selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR < 0.001) by overall effect of development, while 16 genes were differentially expressed (FDR < 0.10) by overall effect of genetic line. Ingenuity Pathways Analysis was used to group annotated genes into networks, functions, and canonical pathways. The expression of 28 genes

  20. Differential gene expression profiling of Actinobacillus pleuropneumoniae during induction of primary alveolar macrophage apoptosis in piglets.

    PubMed

    Wang, Lei; Qin, Wanhai; Ruidong, Zhai; Liu, Shiting; Zhang, Hu; Sun, Changjiang; Feng, Xin; Gu, Jingmin; Du, Chongtao; Han, Wenyu; Langford, P R; Lei, Liancheng

    2015-01-01

    Actinobacillus pleuropneumoniae (A. pleuropneumoniae) is the causative agent of porcine pleuropneumonia, a disease that causes serious problems for the swine industry. Successful infection by this bacterium requires breaking the first line of defence in the lungs, the primary alveolar macrophages (PAMs). Therefore, exploring A. pleuropneumoniae-PAM interactions will provide vital groundwork for the scientific control of this infectious disease, which has been little studied up to now. In this work, PAMs were isolated from piglets and co-incubated with A. pleuropneumoniae serovar 5b strain L20 in vitro, and their interaction, PAM cell death, and differential gene expression of A. pleuropneumoniae in response to PAM cell death were observed and analysed using confocal microscopy, electron microscopy, RT-PCR, Western blot, flow cytometry and the use of a gene expression profile chip. A. pleuropneumoniae quickly adhered to and invaded PAMs, inducing apoptosis, which was confirmed using transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The highest percentage of apoptosis in cells was confirmed using flow cytometry when the cells were infected at a multiplicity of infection (MOI) of 10 and incubated for 5 h, with higher expression of activated caspase-3 as measured by Western blot. Using microarray gene chips with 2868 probes containing nearly all of the genomic sequence of A. pleuropneumoniae serotype 5b strain L20, a total of 185 bacterial genes were found to be differentially expressed (including 92 up-regulated and 93 down-regulated genes) and involved in the process of apoptosis, as compared with the expression of control bacteria cultured without PAMs in BHI medium (mean expression ratios >1.5-fold, p < 0.05). The up-regulated genes are involved in energy metabolism, gene transcription and translation, virulence related gene such as LPS, Trimeric Autotransporter Adhesin, RTX and similar genes. The down-regulated genes are

  1. Gene Expression upon Proliferation and Differentiation of Hematopoietic Cells with Ph Chromosome ex vivo

    PubMed Central

    Grineva, N.I.; Duchovenskay, E.A.; Timofeev, A.M.; Akhlynina, T.V.; Gerasimova, L.P.; Borovkova, T.V.; Schmarov, D.A.; Sarycheva, N.G.; Naydenova, N.M.; Gavrichkova, 
A.R.; Kolosova, L.Y.; Kolosheynova, T.I.; Kovaleva, L.G.

    2012-01-01

    The genesp53, mdm2, p21, c-myc,bcr/abl, bcr, bcl2, bax, and gapdh participate in the regulation of cell proliferation and differentiation, apoptosis and cell distribution for the cell cycle ex vivo in the Ph+cells of chronic myeloid leukemia containing the Ph chromosome andbcr/abloncogene. Expression of these genes correlates with regulation of cell proliferation and differentiation by alternating proliferation and maturation stages for three main Ph+cell types that occur under chronic myeloid leukemia. Thep53, p21, mdm2, and gapdh genes overexpress in active proliferating myeloid cells in the cell cycle S+ G2/M phases and when the phases are coincident with the proliferation stage. Expression of these genes decreases to a considerable level under alternation of the Ph+cell proliferation and maturation stages and whenever the expression is greatly diminished under significant neutrophil accumulation and especially under repeated alternation of the stages. In the course of neutrophil maturation, gene expression levels decrease in the range of gapdh > actin > c-myc, bcr/abl,p21 > p53 > bcl2 > bax.The expression levels of these genes in neutrophils are lower than those in myelocytes and lower by an order of magnitude than that in the cells with a prolonged proliferation stage. TheBcr/ablexpression gene under prolonged maturation and neutrophil accumulation is inhibited; however it is enhanced by 2–3 times for the proliferation stage with myelocyte accumulation. Minimalbcr/ablexpression is observed under overexpression ofp53, mdm2, p21, c-myc,as well as under cell maximum at the S and G2/M phases. Bcr/abloverexpression is observed under low expression of thep53, p21, mdm2genes. In the Ph+ cells with a high P/D efficiency index (5–20), overexpression of the genes in the range ofbcr> gapdh>bcr/abl, as well as a decreased expression of thep53, bcl2, mdm2, p21<< gapdh genes is observed for Ph+cells from the CML blast crisis and CML acceleration phase. Low control of

  2. Extinction of Oct-3/4 gene expression in embryonal carcinoma [times] fibroblast somatic cell hybrids is accompanied by changes in the methylation status, chromatin structure, and transcriptional activity of the Oct-3/4 upstream region

    SciTech Connect

    Ben-Shushan, E.; Pikarsky, E.; Klar, A.; Bergman, Y. )

    1993-02-01

    The OCT-3/4 gene provides an excellent model system with which to study the extinction phenomenon in somatic cell hybrids. The molecular mechanism that underlies the extinction of a tissue-specific transcription factor in somatic cell hybrides is evaluated and compared with its down-regulation in retinoic acid treated embryonal carcinoma cells. This study draws a connection between the shutdown of OCT-3/4 expression in retinoic acid (RA)-differentiated embryonal carcinoma (EC) cells and its extinction in hybrid cells. This repression of OCT-3/4 expression is achieved through changes in the methylation status, chromatin structure, and transcriptional activity of the OCT-3/4 upstream regulatory region. 59 refs.

  3. Wogonin induces the granulocytic differentiation of human NB4 promyelocytic leukemia cells and up-regulates phospholipid scramblase 1 gene expression.

    PubMed

    Zhang, Kun; Guo, Qing-Long; You, Qi-Dong; Yang, Yong; Zhang, Hai-Wei; Yang, Li; Gu, Hong-Yan; Qi, Qi; Tan, Zi; Wang, Xiaotang

    2008-04-01

    Previous studies have firmly demonstrated that wogonin, a naturally occurring monoflavonoid extracted from the root of the Chinese herb medicine Scutellaria baicalensis, could effectively inhibit the proliferation of several cancer cell lines. However, little is known about the effect of wogonin on differentiation induction of leukemic cells. Here we investigate the potential role of wogonin in the proliferation and differentiation of NB4, a human promyelocytic leukemia cell line derived from a patient with acute promyelocytic leukemia. Our results indicated that wogonin significantly suppressed the proliferation and efficiently induced the differentiation of NB4 cells. NB4 cell growth was inhibited by 55-60% after treatment with 50 microM wogonin for a period of 5 days. The results of the nitroblue tetrazolium (NBT) reduction test (with 67.13% positive cells by 50 microM wogonin for 5 days), Giemsa staining (with 67.24% positive cells by 50 microM wogonin for 5 days), and the expression of mature-related cell-surface differentiation antigens CD11b and CD14 (with 70.94% CD11b(+) and 5.82% CD14(+) cells by 50 microM wogonin for 5 days) demonstrated an increase in the differentiation-inducing action of wogonin on the NB4 cells, which was accompanied by an increase in mRNA and protein expression of phospholipids scramblase 1 (PLSCR1). Meanwhile, the level of phosphorylated PKC delta (Ser643) was dramatically increased in wogonin treated NB4 cells. Interestingly, wogonin treatment displayed little effect on the apoptosis of NB4 cells. Taken together, the results reported here demonstrated that wogonin could promote the granulocytic differentiation of NB4 cells by up-regulating the expression of PLSCR1 gene.

  4. Differentially Expressed Genes Associated with Improved Drought Tolerance in Creeping Bentgrass Overexpressing a Gene for Cytokinin Biosynthesis.

    PubMed

    Merewitz, Emily; Xu, Yi; Huang, Bingru

    2016-01-01

    Transformation with an isopentenyl transferase (ipt) gene controlling cytokinin (CK) synthesis has been shown to enhance plant drought tolerance. The objective of this study was to identify differentially-expressed genes (DEGs) in creeping bentgrass (Agrostis stolonifera) overexpressing ipt compared to non-transgenic plants. The ipt transgene was controlled by a senescence-activated promoter (SAG12). Both a null transformed line (NT) and SAG12-ipt plants were exposed to drought stress in an environmentally-controlled growth chamber until the soil water content declined to approximately 5% and leaf relative water content declined to 47%, which were both significantly below the well-watered controls. RNA was extracted from leaf samples of both well-watered and drought-stressed plants. Eight sets of subtractive hybridizations were performed for detection of up-regulated and down-regulated genes due to the presence of the transgene and due to drought stress in both NT and transgenic plants. Sequencing analysis revealed the identity of 252 DEGs due to either the transgene and drought stress. Sequencing analysis of 170 DEGs identified genes encoding for proteins that were related to energy production, metabolism, stress defense, signaling, protein synthesis and transport, and membrane transport could play major roles in the improved drought tolerance by overexpressing ipt in creeping bentgrass.

  5. Exploiting Differential Gene Expression and Epistasis to Discover Candidate Genes for Drought-Associated QTLs in Arabidopsis thaliana

    PubMed Central

    Lovell, John T.; Mullen, Jack L.; Lowry, David B.; Awole, Kedija; Richards, James H.; Sen, Saunak; Verslues, Paul E.; Juenger, Thomas E.; McKay, John K.

    2015-01-01

    Soil water availability represents one of the most important selective agents for plants in nature and the single greatest abiotic determinant of agricultural productivity, yet the genetic bases of drought acclimation responses remain poorly understood. Here, we developed a systems-genetic approach to characterize quantitative trait loci (QTLs), physiological traits and genes that affect responses to soil moisture deficit in the TSUxKAS mapping population of Arabidopsis thaliana. To determine the effects of candidate genes underlying QTLs, we analyzed gene expression as a covariate within the QTL model in an effort to mechanistically link markers, RNA expression, and the phenotype. This strategy produced ranked lists of candidate genes for several drought-associated traits, including water use efficiency, growth, abscisic acid concentration (ABA), and proline concentration. As a proof of concept, we recovered known causal loci for several QTLs. For other traits, including ABA, we identified novel loci not previously associated with drought. Furthermore, we documented natural variation at two key steps in proline metabolism and demonstrated that the mitochondrial genome differentially affects genomic QTLs to influence proline accumulation. These findings demonstrate that linking genome, transcriptome, and phenotype data holds great promise to extend the utility of genetic mapping, even when QTL effects are modest or complex. PMID:25873386

  6. Differentially Expressed Genes Associated with Improved Drought Tolerance in Creeping Bentgrass Overexpressing a Gene for Cytokinin Biosynthesis

    PubMed Central

    Merewitz, Emily; Xu, Yi; Huang, Bingru

    2016-01-01

    Transformation with an isopentenyl transferase (ipt) gene controlling cytokinin (CK) synthesis has been shown to enhance plant drought tolerance. The objective of this study was to identify differentially-expressed genes (DEGs) in creeping bentgrass (Agrostis stolonifera) overexpressing ipt compared to non-transgenic plants. The ipt transgene was controlled by a senescence-activated promoter (SAG12). Both a null transformed line (NT) and SAG12-ipt plants were exposed to drought stress in an environmentally-controlled growth chamber until the soil water content declined to approximately 5% and leaf relative water content declined to 47%, which were both significantly below the well-watered controls. RNA was extracted from leaf samples of both well-watered and drought-stressed plants. Eight sets of subtractive hybridizations were performed for detection of up-regulated and down-regulated genes due to the presence of the transgene and due to drought stress in both NT and transgenic plants. Sequencing analysis revealed the identity of 252 DEGs due to either the transgene and drought stress. Sequencing analysis of 170 DEGs identified genes encoding for proteins that were related to energy production, metabolism, stress defense, signaling, protein synthesis and transport, and membrane transport could play major roles in the improved drought tolerance by overexpressing ipt in creeping bentgrass. PMID:27855226

  7. Exploiting Differential Gene Expression and Epistasis to Discover Candidate Genes for Drought-Associated QTLs in Arabidopsis thaliana.

    PubMed

    Lovell, John T; Mullen, Jack L; Lowry, David B; Awole, Kedija; Richards, James H; Sen, Saunak; Verslues, Paul E; Juenger, Thomas E; McKay, John K

    2015-04-01

    Soil water availability represents one of the most important selective agents for plants in nature and the single greatest abiotic determinant of agricultural productivity, yet the genetic bases of drought acclimation responses remain poorly understood. Here, we developed a systems-genetic approach to characterize quantitative trait loci (QTLs), physiological traits and genes that affect responses to soil moisture deficit in the TSUxKAS mapping population of Arabidopsis thaliana. To determine the effects of candidate genes underlying QTLs, we analyzed gene expression as a covariate within the QTL model in an effort to mechanistically link markers, RNA expression, and the phenotype. This strategy produced ranked lists of candidate genes for several drought-associated traits, including water use efficiency, growth, abscisic acid concentration (ABA), and proline concentration. As a proof of concept, we recovered known causal loci for several QTLs. For other traits, including ABA, we identified novel loci not previously associated with drought. Furthermore, we documented natural variation at two key steps in proline metabolism and demonstrated that the mitochondrial genome differentially affects genomic QTLs to influence proline accumulation. These findings demonstrate that linking genome, transcriptome, and phenotype data holds great promise to extend the utility of genetic mapping, even when QTL effects are modest or complex.

  8. Differential gene expression during thermal stress and bleaching in the Caribbean coral Montastraea faveolata.

    PubMed

    DeSalvo, M K; Voolstra, C R; Sunagawa, S; Schwarz, J A; Stillman, J H; Coffroth, M A; Szmant, A M; Medina, M

    2008-09-01

    The declining health of coral reefs worldwide is likely to intensify in response to continued anthropogenic disturbance from coastal development, pollution, and climate change. In response to these stresses, reef-building corals may exhibit bleaching, which marks the breakdown in symbiosis between coral and zooxanthellae. Mass coral bleaching due to elevated water temperature can devastate coral reefs on a large geographical scale. In order to understand the molecular and cellular basis of bleaching in corals, we have measured gene expression changes associated with thermal stress and bleaching using a complementary DNA microarray containing 1310 genes of the Caribbean coral Montastraea faveolata. In a first experiment, we identified differentially expressed genes by comparing experimentally bleached M. faveolata fragments to control non-heat-stressed fragments. In a second experiment, we identified differentially expressed genes during a time course experiment with four time points across 9 days. Results suggest that thermal stress and bleaching in M. faveolata affect the following processes: oxidative stress, Ca(2+) homeostasis, cytoskeletal organization, cell death, calcification, metabolism, protein synthesis, heat shock protein activity, and transposon activity. These results represent the first medium-scale transcriptomic study focused on revealing the cellular foundation of thermal stress-induced coral bleaching. We postulate that oxidative stress in thermal-stressed corals causes a disruption of Ca(2+) homeostasis, which in turn leads to cytoskeletal and cell adhesion changes, decreased calcification, and the initiation of cell death via apoptosis and necrosis.

  9. A genetic analysis of intersex, a gene regulating sexual differentiation in Drosophila melanogaster females

    SciTech Connect

    Chase, B.A. |; Baker, B.S.

    1995-04-01

    Sex-type in Drosophila melanogaster is controlled by a hierarchically acting set of regulatory genes. At the terminus of this hierarchy lie those regulatory genes responsible for implementing sexual differentiation: genes that control the activity of target loci whose products give rise to sexually dimorphic phenotypes. The genetic analysis of the intersex (ix) gene presented here demonstrates that ix is such a terminally positioned regulatory locus. The ix locus has been localized to the cytogenetic interval between 47E3-6 and 47F11-18. A comparison of the morphological and behavioral phenotypes of homozygotes and hemizygotes for three point mutations at ix indicates that the null phenotypes of homozygotes diplo-X animals into intersexes while leaving haplo-X animals unaffected. Analysis of X-ray induced, mitotic recombination clones lacking ix{sup +} function in the abdomen of diplo-X individuals indicates that the ix{sup +} product functions in a cell-autonomous manner and that it is required at least until the termination of cell division in this tissue. Taken together with previous analyses, our results indicate that the ix{sup +} product is required to function with the female-specific product of doublesex to implement appropriate female sexual differentiation in diplo-X animals. 55 refs., 4 figs., 4 tabs.

  10. Differentially Expressed Genes in Hirudo medicinalis Ganglia after Acetyl-L-Carnitine Treatment

    PubMed Central

    Federighi, Giuseppe; Macchi, Monica; Bernardi, Rodolfo; Scuri, Rossana; Brunelli, Marcello; Durante, Mauro; Traina, Giovanna

    2013-01-01

    Acetyl-l-carnitine (ALC) is a naturally occurring substance that, when administered at supra-physiological concentration, is neuroprotective. It is involved in membrane stabilization and in enhancement of mitochondrial functions. It is a molecule of considerable interest for its clinical application in various neural disorders, including Alzheimer’s disease and painful neuropathies. ALC is known to improve the cognitive capability of aged animals chronically treated with the drug and, recently, it has been reported that it impairs forms of non-associative learning in the leech. In the present study the effects of ALC on gene expression have been analyzed in the leech Hirudo medicinalis. The suppression subtractive hybridisation methodology was used for the generation of subtracted cDNA libraries and the subsequent identification of differentially expressed transcripts in the leech nervous system after ALC treatment. The method detects differentially but also little expressed transcripts of genes whose sequence or identity is still unknown. We report that a single administration of ALC is able to modulate positively the expression of genes coding for functions that reveal a lasting effect of ALC on the invertebrate, and confirm the neuroprotective and neuromodulative role of the substance. In addition an important finding is the modulation of genes of vegetal origin. This might be considered an instance of ectosymbiotic mutualism. PMID:23308261

  11. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.

    1997-01-01

    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637

  12. Microcephaly gene links Trithorax and REST/NRSF to control neural stem cell proliferation and differentiation

    PubMed Central

    Yang, Yawei J.; Baltus, Andrew E.; Mathew, Rebecca S.; Murphy, Elisabeth A.; Evrony, Gilad D.; Gonzalez, Dilenny M.; Wang, Estee P.; Marshall-Walker, Christine A.; Barry, Brenda J.; Murn, Jernej; Tatarakis, Antonis; Mahajan, Muktar A.; Samuels, Herbert H.; Shi, Yang; Golden, Jeffrey A.; Mahajnah, Muhammad; Shenhav, Ruthie; Walsh, Christopher A.

    2013-01-01

    SUMMARY Microcephaly is a neurodevelopmental disorder causing significantly reduced cerebral cortex size. Many known microcephaly gene products localize to centrosomes, regulating cell fate and proliferation. Here, we identify and characterize a nuclear zinc finger protein, ZNF335/NIF-1, as a causative gene for severe microcephaly, small somatic size, and neonatal death. Znf335-null mice are embryonically lethal and conditional knockout leads to severely reduced cortical size. RNA-interference and postmortem human studies show that Znf335 is essential for neural progenitor self-renewal, neurogenesis, and neuronal differentiation. ZNF335 is a component of a vertebrate-specific, trithorax H3K4-methylation complex, directly regulating REST/NRSF, a master regulator of neural gene expression and cell fate, as well as other essential neural-specific genes. Our results reveal ZNF335 as an essential link between H3K4 complexes and REST/NRSF, and provide the first direct genetic evidence that this pathway regulates human neurogenesis and neuronal differentiation. PMID:23178126

  13. Differential effects of intermittent and continuous administration of parathyroid hormone on bone histomorphometry and gene expression

    NASA Technical Reports Server (NTRS)

    Lotinun, Sutada; Sibonga, Jean D.; Turner, Russell T.

    2002-01-01

    A mechanism explaining the differential skeletal effects of intermittent and continuous elevation of serum parathyroid hormone (PTH) remains elusive. Intermittent PTH increases bone formation and bone mass and is being investigated as a therapy for osteoporosis. By contrast, chronic hyperparathyroidism results in the metabolic bone disease osteitis fibrosa characterized by osteomalacia, focal bone resorption, and peritrabecular bone marrow fibrosis. Intermittent and continuous PTH have similar effects on the number of osteoblasts and bone-forming activity. Many of the beneficial as well as detrimental effects of the hormone appear to be mediated by osteoblast-derived growth factors. This hypothesis was tested using cDNA microgene arrays to compare gene expression in tibia of rats treated with continuous and pulsatile administration of PTH. These treatments result in differential expression of many genes, including growth factors. One of the genes whose steady-state mRNA levels was increased by continuous but not pulsatile administration was platelet-derived growth factor-A (PDGF-A). Administration of a PDGF-A antagonist greatly reduced bone resorption, osteomalacia, and bone marrow fibrosis in a rat model for hyperparathyroidism, suggesting that PDGF-A is a causative agent for this disease. These findings suggest that profiling changes in gene expression can help identify the metabolic pathways responsible for the skeletal responses to the hormone.

  14. Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes.

    PubMed

    Yang, G P; Ross, D T; Kuang, W W; Brown, P O; Weigel, R J

    1999-03-15

    Comparing patterns of gene expression in cell lines and tissues has important applications in a variety of biological systems. In this study we have examined whether the emerging technology of cDNA microarrays will allow a high throughput analysis of expression of cDNA clones generated by suppression subtractive hybridization (SSH). A set of cDNA clones including 332 SSH inserts amplified by PCR was arrayed using robotic printing. The cDNA arrays were hybridized with fluorescent labeled probes prepared from RNA from ER-positive (MCF7 and T47D) and ER-negative (MDA-MB-231 and HBL-100) breast cancer cell lines. Ten clones were identified that were over-expressed by at least a factor of five in the ER-positive cell lines. Northern blot analysis confirmed over-expression of these 10 cDNAs. Sequence analysis identified four of these clones as cytokeratin 19, GATA-3, CD24 and glutathione-S-transferase mu-3. Of the remaining six cDNA clones, four clones matched EST sequences from two different genes and two clones were novel sequences. Flow cytometry and immunofluorescence confirmed that CD24 protein was over-expressed in the ER-positive cell lines. We conclude that SSH and microarray technology can be successfully applied to identify differentially expressed genes. This approach allowed the identification of differentially expressed genes without the need to obtain previously cloned cDNAs.

  15. Differentially methylated obligatory epialleles modulate context-dependent LAM gene expression in the honeybee Apis mellifera

    PubMed Central

    Wedd, Laura; Kucharski, Robert; Maleszka, Ryszard

    2016-01-01

    ABSTRACT Differential intragenic methylation in social insects has been hailed as a prime mover of environmentally driven organismal plasticity and even as evidence for genomic imprinting. However, very little experimental work has been done to test these ideas and to prove the validity of such claims. Here we analyze in detail differentially methylated obligatory epialleles of a conserved gene encoding lysosomal α-mannosidase (AmLAM) in the honeybee. We combined genotyping of progenies derived from colonies founded by single drone inseminated queens, ultra-deep allele-specific bisulfite DNA sequencing, and gene expression to reveal how sequence variants, DNA methylation, and transcription interrelate. We show that both methylated and non-methylated states of AmLAM follow Mendelian inheritance patterns and are strongly influenced by polymorphic changes in DNA. Increased methylation of a given allele correlates with higher levels of context-dependent AmLAM expression and appears to affect the transcription of an antisense long noncoding RNA. No evidence of allelic imbalance or imprinting involved in this process has been found. Our data suggest that by generating alternate methylation states that affect gene expression, sequence variants provide organisms with a high level of epigenetic flexibility that can be used to select appropriate responses in various contexts. This study represents the first effort to integrate DNA sequence variants, gene expression, and methylation in a social insect to advance our understanding of their relationships in the context of causality. PMID:26507253

  16. Differentially methylated obligatory epialleles modulate context-dependent LAM gene expression in the honeybee Apis mellifera.

    PubMed

    Wedd, Laura; Kucharski, Robert; Maleszka, Ryszard

    2016-01-01

    Differential intragenic methylation in social insects has been hailed as a prime mover of environmentally driven organismal plasticity and even as evidence for genomic imprinting. However, very little experimental work has been done to test these ideas and to prove the validity of such claims. Here we analyze in detail differentially methylated obligatory epialleles of a conserved gene encoding lysosomal α-mannosidase (AmLAM) in the honeybee. We combined genotyping of progenies derived from colonies founded by single drone inseminated queens, ultra-deep allele-specific bisulfite DNA sequencing, and gene expression to reveal how sequence variants, DNA methylation, and transcription interrelate. We show that both methylated and non-methylated states of AmLAM follow Mendelian inheritance patterns and are strongly influenced by polymorphic changes in DNA. Increased methylation of a given allele correlates with higher levels of context-dependent AmLAM expression and appears to affect the transcription of an antisense long noncoding RNA. No evidence of allelic imbalance or imprinting involved in this process has been found. Our data suggest that by generating alternate methylation states that affect gene expression, sequence variants provide organisms with a high level of epigenetic flexibility that can be used to select appropriate responses in various contexts. This study represents the first effort to integrate DNA sequence variants, gene expression, and methylation in a social insect to advance our understanding of their relationships in the context of causality.

  17. Transcriptomic profiling of gene expression and RNA processing during Leishmania major differentiation

    PubMed Central

    Dillon, Laura A. L.; Okrah, Kwame; Hughitt, V. Keith; Suresh, Rahul; Li, Yuan; Fernandes, Maria Cecilia; Belew, A. Trey; Corrada Bravo, Hector; Mosser, David M.; El-Sayed, Najib M.

    2015-01-01

    Protozoan parasites of the genus Leishmania are the etiological agents of leishmaniasis, a group of diseases with a worldwide incidence of 0.9–1.6 million cases per year. We used RNA-seq to conduct a high-resolution transcriptomic analysis of the global changes in gene expression and RNA processing events that occur as L. major transforms from non-infective procyclic promastigotes to infective metacyclic promastigotes. Careful statistical analysis across multiple biological replicates and the removal of batch effects provided a high quality framework for comprehensively analyzing differential gene expression and transcriptome remodeling in this pathogen as it acquires its infectivity. We also identified precise 5′ and 3′ UTR boundaries for a majority of Leishmania genes and detected widespread alternative trans-splicing and polyadenylation. An investigation of possible correlations between stage-specific preferential trans-splicing or polyadenylation sites and differentially expressed genes revealed a lack of systematic association, establishing that differences in expression levels cannot be attributed to stage-regulated alternative RNA processing. Our findings build on and improve existing expression datasets and provide a substantially more detailed view of L. major biology that will inform the field and potentially provide a stronger basis for drug discovery and vaccine development efforts. PMID:26150419

  18. A novel approach identifies new differentially methylated regions (DMRs) associated with imprinted genes

    PubMed Central

    Choufani, Sanaa; Shapiro, Jonathan S.; Susiarjo, Martha; Butcher, Darci T.; Grafodatskaya, Daria; Lou, Youliang; Ferreira, Jose C.; Pinto, Dalila; Scherer, Stephen W.; Shaffer, Lisa G.; Coullin, Philippe; Caniggia, Isabella; Beyene, Joseph; Slim, Rima; Bartolomei, Marisa S.; Weksberg, Rosanna

    2011-01-01

    Imprinted genes are critical for normal human growth and neurodevelopment. They are characterized by differentially methylated regions (DMRs) of DNA that confer parent of origin-specific transcription. We developed a new strategy to identify imprinted gene-associated DMRs. Using genome-wide methylation profiling of sodium bisulfite modified DNA from normal human tissues of biparental origin, candidate DMRs were identified by selecting CpGs with methylation levels consistent with putative allelic differential methylation. In parallel, the methylation profiles of tissues of uniparental origin, i.e., paternally-derived androgenetic complete hydatidiform moles (AnCHMs), and maternally-derived mature cystic ovarian teratoma (MCT), were examined and then used to identify CpGs with parent of origin-specific DNA methylation. With this approach, we found known DMRs associated with imprinted genomic regions as well as new DMRs for known imprinted genes, NAP1L5 and ZNF597, and novel candidate imprinted genes. The paternally methylated DMR for one candidate, AXL, a receptor tyrosine kinase, was also validated in experiments with mouse embryos that demonstrated Axl was expressed preferentially from the maternal allele in a DNA methylation-dependent manner. PMID:21324877

  19. Differential gene expression in stromal cells of human giant cell tumor of bone.

    PubMed

    Wuelling, M; Delling, G; Kaiser, E

    2004-12-01

    Giant cell tumor (GCT) offers a unique model for the hematopoietic-stromal cell interaction in human bone marrow. Evidence has been presented that GCT stromal cells (GCTSCs) promote accumulation, size and activity of the giant cells. Although GCTSCs are considered the neoplastic component of GCT, little is known about their genetic basis and, to date, a tumor-specific gene expression pattern has not been characterized. Mesenchymal stem cells (MSCs) have been identified as the origin of the GCT neoplastic stromal cell. Using state of the art array technology, expression profiling was applied to enriched stromal cell populations from five different GCTs and two primary MSCs as controls. Of the 29 differentially expressed genes found, 25 showed an increased expression. Differential mRNA expression was verified by real-time polymerase chain reaction analysis of 10 selected genes, supporting the validity of cDNA arrays as a tool to identify tumor-related genes in GCTSCs. Increased expression of two oncogenes, JUN and NME2, was substantiated at the protein level, utilizing immunohistochemical evaluation of GCT sections and Western-blot analysis. Increased phosphorylation of JUN Ser-63 was also found.

  20. Estimation of male gene flow from measures of nuclear and female genetic differentiation.

    PubMed

    Hedrick, Philip W; Allendorf, Fred W; Baker, C Scott

    2013-01-01

    An approach is provided to estimate male gene flow and the ratio of male to female gene flow, given that there are estimates of diploid, nuclear gene flow and haploid, female gene flow. This approach can be applied to estimates of differentiation (F ST ) from biparentally and maternally inherited markers, assuming the equilibrium island model and equal effective numbers of males and females. Corrections to formulas used previously for California sea lions (González-Suárez M, Flatz R, Aurioles-Gamboa D, Hedrick PW, Gerber LR. 2009. Isolation by distance among California sea lion populations in Mexico: redefining management stocks. Mol Ecol. 18:1088-1099.) and American bison (Halbert ND, Gogan PJP, Hedrick PW, Wahl L, Derr JN. 2012. Genetic population substructure in bison in Yellowstone National Park. J Hered. 103:360-370.) are given and revised values for those species are calculated. The effect of unequal male and female effective population sizes, nonequilibrium conditions, and approximations of differentiation formulas are briefly discussed.

  1. Murine bone cell lines as models for spaceflight induced effects on differentiation and gene expression

    NASA Astrophysics Data System (ADS)

    Lau, P.; Hellweg, C. E.; Baumstark-Khan, C.; Reitz, G.

    Critical health factors for space crews especially on long-term missions are radiation exposure and the absence of gravity DNA double strand breaks DSB are presumed to be the most deleterious DNA lesions after radiation as they disrupt both DNA strands in close proximity Besides radiation risk the absence of gravity influences the complex skeletal apparatus concerning muscle and especially bone remodelling which results from mechanical forces exerting on the body Bone is a dynamic tissue which is life-long remodelled by cells from the osteoblast and osteoclast lineage Any imbalance of this system leads to pathological conditions such as osteoporosis or osteopetrosis Osteoblastic cells play a crucial role in bone matrix synthesis and differentiate either into bone-lining cells or into osteocytes Premature terminal differentiation has been reported to be induced by a number of DNA damaging or cell stress inducing agents including ionising and ultraviolet radiation as well as treatment with mitomycin C In the present study we compare the effects of sequential differentiation by adding osteoinductive substances ss -glycerophosphate and ascorbic acid Radiation-induced premature differentiation was investigated regarding the biosynthesis of specific osteogenic marker molecules and the differentiation dependent expression of marker genes The bone cell model established in our laboratory consists of the osteocyte cell line MLO-Y4 the osteoblast cell line OCT-1 and the subclones 4 and 24 of the osteoblast cell line MC3T3-E1 expressing several

  2. Differential Gene Expression between Leaf and Rhizome in Atractylodes lancea: A Comparative Transcriptome Analysis

    PubMed Central

    Huang, Qianqian; Huang, Xiao; Deng, Juan; Liu, Hegang; Liu, Yanwen; Yu, Kun; Huang, Bisheng

    2016-01-01

    The rhizome of Atractylodes lancea is extensively used in the practice of Traditional Chinese Medicine because of its broad pharmacological activities. This study was designed to characterize the transcriptome profiling of the rhizome and leaf of Atractylodes lancea in an attempt to uncover the molecular mechanisms regulating rhizome formation and growth. Over 270 million clean reads were assembled into 92,366 unigenes, 58% of which are homologous with sequences in public protein databases (NR, Swiss-Prot, GO, and KEGG). Analysis of expression levels showed that genes involved in photosynthesis, stress response, and translation were the most abundant transcripts in the leaf, while transcripts involved in stress response, transcription regulation, translation, and metabolism were dominant in the rhizome. Tissue-specific gene analysis identified distinct gene families active in the leaf and rhizome. Differential gene expression analysis revealed a clear difference in gene expression pattern, identifying 1518 up-regulated genes and 3464 down-regulated genes in the rhizome compared with the leaf, including a series of genes related to signal transduction, primary and secondary metabolism. Transcription factor (TF) analysis identified 42 TF families, with 67 and 60 TFs up-regulated in the rhizome and leaf, respectively. A total of 104 unigenes were identified as candidates for regulating rhizome formation and development. These data offer an overview of the gene expression pattern of the rhizome and leaf and provide essential information for future studies on the molecular mechanisms of controlling rhizome formation and growth. The extensive transcriptome data generated in this study will be a valuable resource for further functional genomics studies of A. lancea. PMID:27066021

  3. Differential Expression of Genes Involved in Host Recognition, Attachment, and Degradation in the Mycoparasite Tolypocladium ophioglossoides

    PubMed Central

    Quandt, C. Alisha; Di, Yanming; Elser, Justin; Jaiswal, Pankaj; Spatafora, Joseph W.

    2016-01-01

    The ability of a fungus to infect novel hosts is dependent on changes in gene content, expression, or regulation. Examining gene expression under simulated host conditions can explore which genes may contribute to host jumping. Insect pathogenesis is the inferred ancestral character state for species of Tolypocladium, however several species are parasites of truffles, including Tolypocladium ophioglossoides. To identify potentially crucial genes in this interkingdom host switch, T. ophioglossoides was grown on four media conditions: media containing the inner and outer portions of its natural host (truffles of Elaphomyces), cuticles from an ancestral host (beetle), and a rich medium (Yeast Malt). Through high-throughput RNASeq of mRNA from these conditions, many differentially expressed genes were identified in the experiment. These included PTH11-related G-protein-coupled receptors (GPCRs) hypothesized to be involved in host recognition, and also found to be upregulated in insect pathogens. A divergent chitinase with a signal peptide was also found to be highly upregulated on media containing truffle tissue, suggesting an exogenous degradative activity in the presence of the truffle host. The adhesin gene, Mad1, was highly expressed on truffle media as well. A BiNGO analysis of overrepresented GO terms from genes expressed during each growth condition found that genes involved in redox reactions and transmembrane transport were the most overrepresented during T. ophioglossoides growth on truffle media, suggesting their importance in growth on fungal tissue as compared to other hosts and environments. Genes involved in secondary metabolism were most highly expressed during growth on insect tissue, suggesting that their products may not be necessary during parasitism of Elaphomyces. This study provides clues into understanding genetic mechanisms underlying the transition from insect to truffle parasitism. PMID:26801645

  4. Differential metal response and regulation of human heavy metal-inducible genes.

    PubMed

    Murata, M; Gong, P; Suzuki, K; Koizumi, S

    1999-07-01

    A number of heavy metal-inducible genes have been reported, but their ranges of response to various metal species are not well known. It is also unclear if these genes are regulated through common mechanisms. To answer these questions, we compared induction kinetics of human metal-inducible genes including the MT-IIA (coding for a metallothionein isoform), hsp70 (coding for the 70-kDa heat-shock protein), and c-fos genes in HeLa cells exposed to Zn, Cd, Ag, Hg, Cu(II), Co, or Ni ions. Transcripts from these three genes were increased after exposure to wide ranges of metals, but each gene was unique in its induction kinetics. Generally, induction was observed at lower metal concentrations in the order of MT-IIA, hsp70, and c-fos. These genes also showed differential responses in time course: more rapid induction was observed in the order of c-fos, hsp70, and MT-IIA after exposure to Zn or Cd. Since the metal-responsive element (MRE) and heat shock element (HSE) of the MT-IIA and hsp70 genes, respectively, are thought to be the cis-acting DNA elements that mediate metal response, we compared the properties of proteins that specifically bind to these elements. MRE-binding activity was detected only in the extract from cells exposed to Zn. By contrast, HSE-binding activity was detected in extracts from cells treated with Zn, Cd, Ag, and Cu. The former was also activated by Zn in vitro, while the latter was not. Each of these DNA-binding activities showed no affinity to the recognition sequence of the other. These results demonstrate that the human metal-inducible genes have broad ranges of response to a variety of heavy metals, but suggest that they are probably regulated through independent mechanisms.

  5. Differential expression of imprinted genes in normal and IUGR human placentas.

    PubMed

    Diplas, Andreas I; Lambertini, Luca; Lee, Men-Jean; Sperling, Rhoda; Lee, Yin Leng; Wetmur, James; Chen, Jia

    2009-05-16

    Genomic imprinting refers to silencing of one parental allele in the zygotes of gametes depending upon the parent of origin. Loss of imprinting (LOI) is the gain of function from the silent allele that can have a maximum effect of doubling the gene dosage. LOI may play a significant role in the etiology of intrauterine growth restriction (IUGR). Using placental tissue from ten normal and seven IUGR pregnancies, we conducted a systematic survey of the expression of a panel of 74 "putatively" imprinted genes using quantitative RT-PCR. We found that 52/74 ( approximately 70%) of the genes were expressed in human placentas. Nine of the 52 (17%) expressed genes were significantly differentially expressed between normal and IUGR placentas; five were upregulated (PHLDA2, ILK2, NNAT, CCDC86, PEG10) and four downregulated (PLAGL1, DHCR24, ZNF331, CDKAL1). We also assessed LOI profile of 14 imprinted genes in 14 normal and 24 IUGR placentas using a functional and sensitive assay developed in our laboratory. Little LOI was observed in any placentas for five of the genes (PEG10, PHLDA2, MEG3, EPS15, CD44). With the 149 heterozygosities examined, 40 (26.8%) exhibited LOI >3%. Some genes exhibited frequent LOI in placentas regardless of the disease status (IGF2, TP73, MEST, SLC22A18, PEG3), while others exhibited LOI only in IUGR placentas (PLAGL1, DLK1, H19, SNRPN). Importantly, there was no correlation between gene expression and LOI profile. Our study suggests that genomic imprinting may play a role in IUGR pathogenesis, but mechanisms other than LOI may contribute to dysregulation of imprinted genes.

  6. Differential DNA sequence recognition is a determinant of specificity in homeotic gene action.

    PubMed Central

    Ekker, S C; von Kessler, D P; Beachy, P A

    1992-01-01

    The homeotic genes of Drosophila encode transcriptional regulatory proteins that specify distinct segment identities. Previous studies have implicated the homeodomain as a major determinant of biological specificity within these proteins, but have not established the physical basis of this specificity. We show here that the homeodomains encoded by the Ultrabithorax and Deformed homeotic genes bind optimally to distinct DNA sequences and have mapped the determinants responsible for differential recognition. We further show that relative transactivation by these two proteins in a simple in vivo system can differ by nearly two orders of magnitude. Such differences in DNA sequence recognition and target activation provide a biochemical basis for at least part of the biological specificity of homeotic gene action. Images PMID:1356765

  7. Screening of differentially expressed genes between multiple trauma patients with and without sepsis.

    PubMed

    Ji, S C; Pan, Y T; Lu, Q Y; Sun, Z Y; Liu, Y Z

    2014-03-17

    The purpose of this study was to identify critical genes associated with septic multiple trauma by comparing peripheral whole blood samples from multiple trauma patients with and without sepsis. A microarray data set was downloaded from the Gene Expression Omnibus (GEO) database. This data set included 70 samples, 36 from multiple trauma patients with sepsis and 34 from multiple trauma patients without sepsis (as a control set). The data were preprocessed, and differentially expressed genes (DEGs) were then screened for using packages of the R language. Functional analysis of DEGs was performed with DAVID. Interaction networks were then established for the most up- and down-regulated genes using HitPredict. Pathway-enrichment analysis was conducted for genes in the networks using WebGestalt. Fifty-eight DEGs were identified. The expression levels of PLAU (down-regulated) and MMP8 (up-regulated) presented the largest fold-changes, and interaction networks were established for these genes. Further analysis revealed that PLAT (plasminogen activator, tissue) and SERPINF2 (serpin peptidase inhibitor, clade F, member 2), which interact with PLAU, play important roles in the pathway of the component and coagulation cascade. We hypothesize that PLAU is a major regulator of the component and coagulation cascade, and down-regulation of PLAU results in dysfunction of the pathway, causing sepsis.

  8. Differential gene expression profiling of mouse uterine luminal epithelium during periimplantation.

    PubMed

    Xiao, Shuo; Diao, Honglu; Zhao, Fei; Li, Rong; He, Naya; Ye, Xiaoqin

    2014-03-01

    Uterine luminal epithelium (LE) is critical for establishing uterine receptivity. Microarray analysis of gestation day 3.5 (D3.5, preimplantation) and D4.5 (postimplantation) LE from natural pregnant mice identified 382 upregulated and 245 downregulated genes in the D4.5 LE. Gene Ontology annotation grouped 186 upregulated and 103 downregulated genes into 22 and 15 enriched subcategories, respectively, in regulating DNA-dependent transcription, metabolism, cell morphology, ion transport, immune response, apoptosis, signal transduction, and so on. Signaling pathway analysis revealed 99 genes in 21 significantly changed signaling pathways, with 14 of these pathways involved in metabolism. In situ hybridization confirmed the temporal expression of 12 previously uncharacterized genes, including Atp6v0a4, Atp6v0d2, F3, Ggh, Tmprss11d, Tmprss13, Anpep, Fxyd4, Naip5, Npl, Nudt19, and Tpm1 in the periimplantation uterus. This study provides a comprehensive picture of the differentially expressed genes in the periimplantation LE to help understand the molecular mechanism of LE transformation upon establishment of uterine receptivity.