Science.gov

Sample records for genes accompanies differentiation

  1. Nuclear envelope structural proteins facilitate nuclear shape changes accompanying embryonic differentiation and fidelity of gene expression.

    PubMed

    Smith, Elizabeth R; Meng, Yue; Moore, Robert; Tse, Jeffrey D; Xu, Arn G; Xu, Xiang-Xi

    2017-01-14

    Nuclear size and shape are specific to a cell type, function, and location, and can serve as indicators of disease and development. We previously found that lamin A/C and associated nuclear envelope structural proteins were upregulated when murine embryonic stem (ES) cells differentiated to primitive endoderm cells. Here we further investigated the morphological changes of nuclei that accompany this differentiation. The nuclei of undifferentiated wild type cells were found shaped as flattened, irregular ovals, whereas nuclei of Gata4-positive endoderm cells were more spherical, less flattened, and with a slightly reduced volume. The morphological change was confirmed in the trophectoderm and primitive endoderm lineages of E4.5 blastocysts, compared to larger and more irregularly shaped of the nuclei of the inner cell mass. We established ES cells genetically null for the nuclear lamina proteins lamin A/C or the inner nuclear envelope protein emerin, or compound mutant for both lamin A/C and emerin. ES cells deficient in lamin A/C differentiated to endoderm but less efficiently, and the nuclei remained flattened and failed to condense. The size and shape of emerin-deficient nuclei also remained uncondensed after treatment with RA. The emerin/lamin A/C double knockout ES cells failed to differentiate to endoderm cells, though the nuclei condensed but retained a generally flattened ellipsoid shape. Additionally, ES cells deficient for lamin A/C and/or emerin had compromised ability to undergo endoderm differentiation, where the differentiating cells often exhibited coexpression of pluripotent and differentiation markers, such as Oct3/4 and Gata4, respectively, indicating an infidelity of gene regulation. The results suggest that changes in nuclear size and shape, which are mediated by nuclear envelope structural proteins lamin A/C and/or emerin, also impact gene regulation and lineage differentiation in early embryos. Nevertheless, mice lacking both lamin A/C and

  2. NGF induction of the gene encoding the protease transin accompanies neuronal differentiation in PC12 cells.

    PubMed

    Machida, C M; Rodland, K D; Matrisian, L; Magun, B E; Ciment, G

    1989-06-01

    Various proteases have been found to be released by the growth cones of developing neurons in culture and have been hypothesized to play a role in the process of axon elongation. We report here that nerve growth factor (NGF) induced the gene encoding the metalloprotease transin in PC12 cells with a time course coincident with the initial appearance of neurites by these cells. Acidic and basic fibroblast growth factors also stimulated transin mRNA expression and neurite outgrowth, whereas various other agents had no effects on either of these phenomena. In contrast, dexamethasone was found to inhibit the induction of transin mRNA when added with, or following, NGF treatment. Finally, we show that sequences contained within 750 bp of the 5' untranscribed region of the transin gene confer responsiveness to NGF and dexamethasone.

  3. Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by cell differentiation defects.

    PubMed

    Henriques, Rossana; Jásik, Ján; Klein, Markus; Martinoia, Enrico; Feller, Urs; Schell, Jeff; Pais, Maria S; Koncz, Csaba

    2002-11-01

    IRT1 and IRT2 are members of the Arabidopsis ZIP metal transporter family that are specifically induced by iron deprivation in roots and act as heterologous suppressors of yeast mutations inhibiting iron and zinc uptake. Although IRT1 and IRT2 are thought to perform redundant functions as root-specific metal transporters, insertional inactivation of the IRT1 gene alone results in typical symptoms of iron deficiency causing severe leaf chlorosis and lethality in soil. The irt1 mutation is characterized by specific developmental defects, including a drastic reduction of chloroplast thylakoid stacking into grana and lack of palisade parenchyma differentiation in leaves, reduced number of vascular bundles in stems, and irregular patterns of enlarged endodermal and cortex cells in roots. Pulse labeling with 59Fe through the root system shows that the irt1 mutation reduces iron accumulation in the shoots. Short-term labeling with 65Zn reveals no alteration in spatial distribution of zinc, but indicates a lower level of zinc accumulation. In comparison to wild-type, the irt1 mutant responds to iron and zinc deprivation by altered expression of certain zinc and iron transporter genes, which results in the activation of ZIP1 in shoots, reduction of ZIP2 transcript levels in roots, and enhanced expression of IRT2 in roots. These data support the conclusion that IRT1 is an essential metal transporter required for proper development and regulation of iron and zinc homeostasis in Arabidopsis.

  4. Differential stress response in rats subjected to chronic mild stress is accompanied by changes in CRH-family gene expression at the pituitary level.

    PubMed

    Kolasa, Magdalena; Faron-Górecka, Agata; Kuśmider, Maciej; Szafran-Pilch, Kinga; Solich, Joanna; Żurawek, Dariusz; Gruca, Piotr; Papp, Mariusz; Dziedzicka-Wasylewska, Marta

    2014-11-01

    The purpose of this study was to examine molecular markers of the stress response at the pituitary and peripheral levels in animals that responded differently to chronic mild stress (CMS). Rats were subjected to 2-weeks CMS and symptoms of anhedonia was measured by the consumption of 1% sucrose solution. mRNA levels of CRH-family neuropeptides (Crh-corticotropin-releasing hormone, Ucn1-urocortin 1, Ucn2-urocortin 2, Ucn3-urocortin 3), CRH receptors (Crhr1-corticotropin-releasing hormone receptor 1, Crhr2-corticotropin-releasing hormone receptor 2) and Crhbp (corticotropin-releasing factor binding protein) in the pituitaries of rats were determined with real-time PCR. Plasma levels of ACTH (adrenocorticotropin), CRH and urocortins were measured with ELISA assays. CMS procedure led to the development of anhedonia manifested by the decreased sucrose consumption (stress-reactive, SR, stress-susceptible group). Additionally, the group of animals not exhibiting any signs of anhedonia (stress non-reactive, SNR, stress-resilient group) and the group characterized by the increased sucrose consumption (stress invert-reactive group SIR) were selected. The significant increases in ACTH plasma level accompanied by the decreases in the pituitary gene expression of the Crh, Ucn2 and Ucn3 in both stress non-reactive and stress invert-reactive groups were observed. The only molecular change observed in stress-reactive group was the increase in UCN2 plasma level. The differentiated behavioral stress responses were reflected by gene expression changes in the pituitary. Alterations in the mRNA levels of Crh, Ucn2 and Ucn3 in the pituitary might confirm the paracrine and/or autocrine effects of these peptides in stress response. The opposite behavioral effect between SNR vs. SIR groups and the surprising similarity at gene expression and plasma ACTH levels in these two groups may suggest the discrepancy between molecular and behavioral stress responses; however, there results might

  5. Histone acetylation accompanied with promoter sequences displaying differential expression profiles of B-class MADS-box genes for phalaenopsis floral morphogenesis.

    PubMed

    Hsu, Chia-Chi; Wu, Pei-Shan; Chen, Tien-Chih; Yu, Chun-Wei; Tsai, Wen-Chieh; Wu, Keqiang; Wu, Wen-Luan; Chen, Wen-Huei; Chen, Hong-Hwa

    2014-01-01

    Five B-class MADS-box genes, including four APETALA3 (AP3)-like PeMADS2∼5 and one PISTILLATA (PI)-like PeMADS6, specify the spectacular flower morphology in orchids. The PI-like PeMADS6 ubiquitously expresses in all floral organs. The four AP3-like genes, resulted from two duplication events, express ubiquitously at floral primordia and early floral organ stages, but show distinct expression profiles at late floral organ primordia and floral bud stages. Here, we isolated the upstream sequences of PeMADS2∼6 and studied the regulatory mechanism for their distinct gene expression. Phylogenetic footprinting analysis of the 1.3-kb upstream sequences of AP3-like PeMADS2∼5 showed that their promoter regions have sufficiently diverged and contributed to their subfunctionalization. The amplified promoter sequences of PeMADS2∼6 could drive beta-glucuronidase (GUS) gene expression in all floral organs, similar to their expression at the floral primordia stage. The promoter sequence of PeMADS4, exclusively expressed in lip and column, showed a 1.6∼3-fold higher expression in lip/column than in sepal/petal. Furthermore, we noted a 4.9-fold increase in histone acetylation (H3K9K14ac) in the translation start region of PeMADS4 in lip as compared in petal. All these results suggest that the regulation via the upstream sequences and increased H3K9K14ac level may act synergistically to display distinct expression profiles of the AP3-like genes at late floral organ primordia stage for Phalaenopsis floral morphogenesis.

  6. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation.

    PubMed

    Chidgey, M; Brakebusch, C; Gustafsson, E; Cruchley, A; Hail, C; Kirk, S; Merritt, A; North, A; Tselepis, C; Hewitt, J; Byrne, C; Fassler, R; Garrod, D

    2001-11-26

    The desmosomal cadherin desmocollin (Dsc)1 is expressed in upper epidermis where strong adhesion is required. To investigate its role in vivo, we have genetically engineered mice with a targeted disruption in the Dsc1 gene. Soon after birth, null mice exhibit flaky skin and a striking punctate epidermal barrier defect. The epidermis is fragile, and acantholysis in the granular layer generates localized lesions, compromising skin barrier function. Neutrophils accumulate in the lesions and further degrade the tissue, causing sloughing (flaking) of lesional epidermis, but rapid wound healing prevents the formation of overt lesions. Null epidermis is hyperproliferative and overexpresses keratins 6 and 16, indicating abnormal differentiation. From 6 wk, null mice develop ulcerating lesions resembling chronic dermatitis. We speculate that ulceration occurs after acantholysis in the fragile epidermis because environmental insults are more stringent and wound healing is less rapid than in neonatal mice. This dermatitis is accompanied by localized hair loss associated with formation of utriculi and dermal cysts, denoting hair follicle degeneration. Possible resemblance of the lesions to human blistering diseases is discussed. These results show that Dsc1 is required for strong adhesion and barrier maintenance in epidermis and contributes to epidermal differentiation.

  7. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation

    PubMed Central

    Chidgey, Martyn; Brakebusch, Cord; Gustafsson, Erika; Cruchley, Alan; Hail, Chris; Kirk, Sarah; Merritt, Anita; North, Alison; Tselepis, Chris; Hewitt, Jane; Byrne, Carolyn; Fassler, Reinhard; Garrod, David

    2001-01-01

    The desmosomal cadherin desmocollin (Dsc)1 is expressed in upper epidermis where strong adhesion is required. To investigate its role in vivo, we have genetically engineered mice with a targeted disruption in the Dsc1 gene. Soon after birth, null mice exhibit flaky skin and a striking punctate epidermal barrier defect. The epidermis is fragile, and acantholysis in the granular layer generates localized lesions, compromising skin barrier function. Neutrophils accumulate in the lesions and further degrade the tissue, causing sloughing (flaking) of lesional epidermis, but rapid wound healing prevents the formation of overt lesions. Null epidermis is hyperproliferative and overexpresses keratins 6 and 16, indicating abnormal differentiation. From 6 wk, null mice develop ulcerating lesions resembling chronic dermatitis. We speculate that ulceration occurs after acantholysis in the fragile epidermis because environmental insults are more stringent and wound healing is less rapid than in neonatal mice. This dermatitis is accompanied by localized hair loss associated with formation of utriculi and dermal cysts, denoting hair follicle degeneration. Possible resemblance of the lesions to human blistering diseases is discussed. These results show that Dsc1 is required for strong adhesion and barrier maintenance in epidermis and contributes to epidermal differentiation. PMID:11714727

  8. Cell differentiation along multiple pathways accompanied by changes in histone acetylation status.

    PubMed

    Legartová, Soňa; Kozubek, Stanislav; Franek, Michal; Zdráhal, Zbyněk; Lochmanová, Gabriela; Martinet, Nadine; Bártová, Eva

    2014-04-01

    Post-translational modification of histones is fundamental to the regulation of basic nuclear processes and subsequent cellular events, including differentiation. In this study, we analyzed acetylated forms of histones H2A, H2B, and H4 during induced differentiation in mouse (mESCs) and human (hESCs) embryonic stem cells and during induced enterocytic differentiation of colon cancer cells in vitro. Endoderm-like differentiation of mESCs induced by retinoic acid and enterocytic differentiation induced by histone deacetylase inhibitor sodium butyrate were accompanied by increased mono-, di-, and tri-acetylation of histone H2B and a pronounced increase in di- and tri-acetylation of histone H4. In enterocytes, mono-acetylation of histone H2A also increased and tetra-acetylation of histone H4 appeared only after induction of this differentiation pathway. During differentiation of hESCs, we observed increased mono-acetylation and decreased tri-acetylation of H2B. Mono-, di-, and tri-acetylation of H4 were reduced, manifested by a significant increase in nonacetylated H4 histones. Levels of acetylated histones increased during induced differentiation in mESCs and during histone deacetylase (HDAC) inhibitor-induced enterocytic differentiation, whereas differentiation of human ESCs was associated with reduced acetylation of histones H2B and H4.

  9. Gene Expression Dynamics Accompanying the Sponge Thermal Stress Response

    PubMed Central

    Guzman, Christine; Conaco, Cecilia

    2016-01-01

    Marine sponges are important members of coral reef ecosystems. Thus, their responses to changes in ocean chemistry and environmental conditions, particularly to higher seawater temperatures, will have potential impacts on the future of these reefs. To better understand the sponge thermal stress response, we investigated gene expression dynamics in the shallow water sponge, Haliclona tubifera (order Haplosclerida, class Demospongiae), subjected to elevated temperature. Using high-throughput transcriptome sequencing, we show that these conditions result in the activation of various processes that interact to maintain cellular homeostasis. Short-term thermal stress resulted in the induction of heat shock proteins, antioxidants, and genes involved in signal transduction and innate immunity pathways. Prolonged exposure to thermal stress affected the expression of genes involved in cellular damage repair, apoptosis, signaling and transcription. Interestingly, exposure to sublethal temperatures may improve the ability of the sponge to mitigate cellular damage under more extreme stress conditions. These insights into the potential mechanisms of adaptation and resilience of sponges contribute to a better understanding of sponge conservation status and the prediction of ecosystem trajectories under future climate conditions. PMID:27788197

  10. Poorly differentiated hepatocellular carcinoma accompanied by anti-Hu antibody-positive paraneoplastic peripheral neuropathy.

    PubMed

    Matsui, Takahiro; Hori, Yumiko; Nagano, Hiroaki; Eguchi, Hidetoshi; Marubashi, Shigeru; Wada, Hiroshi; Wada, Naoki; Ikeda, Jun-Ichiro; Sakamoto, Michiie; Morii, Eiichi

    2015-07-01

    The anti-Hu antibody is one of the most famous onco-neural antibodies related to paraneoplastic neurological syndrome, and is associated with small cell lung carcinoma in most cases. Here, we report a case of poorly differentiated hepatocellular carcinoma accompanied by paraneoplastic peripheral neuropathy positive for the anti-Hu antibody. Image inspection before operation revealed that no tumors were found in organs other than the liver, including lung, and that the liver tumor had no metastatic lesion. The liver tumor showed histological appearance of poorly differentiated carcinoma with cartilaginous metaplasia and partial blastoid cell appearance. Most tumor cells presented trabecular-like structure lined by sinusoidal vessels. Immunohistochemically, the tumor cells were positive for low molecular weight cytokeratin and vimentin, partially positive for cytokeratin 19 and CD56, but negative for synaptophysin, chromogranin A and alpha-fetoprotein. Based on the trabecular-like morphology and the results of immunohistochemical staining, we concluded that the tumor was diagnosed as poorly differentiated hepatocellular carcinoma. Anti-Hu antibody-positive paraneoplastic peripheral neuropathy accompanied with liver tumor is extremely rare as far as is known. The presented case indicates that poorly differentiated carcinoma has the potential to be the responsible lesion of anti-Hu antibody-positive paraneoplastic neurological syndrome and systemic work-up is important for the management of this neurological disorder.

  11. [A synovial cyst accompanied by asymptomatic lumbar vertebral fracture requiring differentiation from spinal metastasis].

    PubMed

    Miura, Isamu; Ujiie, Hiroshi; Nakagawa, Masanori; Saito, Taiichi; Shiono, Saori; Okada, Yoshikazu

    2015-06-01

    We experienced a case with a synovial cyst accompanied by asymptomatic lumbar vertebral fracture that required differentiation from spinal metastasis. An 82-year-old man suffered from right leg and anal pain. Computed tomography (CT) showed L5 spondylolysis. Magnetic resonance images (MRI) revealed an intra spinal cyst and acute lumbar vertebral fracture of L5 vertebral body. The surrounding area of the cyst presented contrast enhancement, and the extradural mass compressed the dural sac. Bone scintigraphy with 99m technetium-MDP demonstrated intense uptake on the right first, fourth, fifth, and seventh ribs and L2, L3, and L5 vertebra. The F-18 fluorodeoxyglucose positron emission tomography (FDG-PET) image demonstrated an increased radiotracer uptake in the L5 vertebra(standardized uptake value(SUV) max=3.5). Spinal metastasis was suspected. Because of the cauda equina compression syndrome, it was surgically removed. Intraoperatively, a well-demarcated extradural cyst was found and compressed the dural sac markedly. The cyst capsule was thin and contained clear, thin fluid with no signs of bleeding. The histological diagnosis was a synovial cyst. His neurological symptoms improved after the surgery. The synovial cyst may enlarge after asymptomatic vertebral fractures.

  12. Biochemical and Cytological Changes Accompanying Growth and Differentiation in the Roots of Zea mays

    PubMed Central

    Lund, H. A.; Vatter, A. E.; Hanson, J. B.

    1958-01-01

    The apical meristem of the root affords an excellent material with which to study changes in cellular components accompanying growth and differentiation. The ontogeny of cytoplasmic particles can be followed, since the younger cells are constantly dividing and reforming new cytoplasm. Electron microscope pictures of these newly formed cells reveal a dense background of microsomal granules and small, thin walled vesicles of the endoplasmic reticulum. Two types of mitochondria are noted and, as the cells enlarge, mitochondria regarded as immature can no longer be seen, but only mitochondria with well developed cristae. The development of these cristae was found to be associated with an increase in respiration of the tissue as well as with increased rates of oxidation and phosphorylation of isolated mitochondria. As the cells grow and mature, the mitochondria make up an increasing percentage of the total cytoplasmic protein, and this increase probably accounts to a great extent for the increase in tissue respiration. Concomitantly, there is a decrease in microsomal granules. All these changes have been verified by electron microscope pictures of cells in situ, chemical analysis of isolated particulates, and metabolic studies of tissue and isolated fractions. PMID:13502433

  13. Transient Pairing of Homologous Oct4 Alleles Accompanies the Onset of Embryonic Stem Cell Differentiation

    PubMed Central

    Hogan, Megan S.; Parfitt, David-Emlyn; Zepeda-Mendoza, Cinthya J.; Shen, Michael M.; Spector, David L.

    2015-01-01

    SUMMARY The relationship between chromatin organization and transcriptional regulation is an area of intense investigation. We have characterized the spatial relationships between alleles of the Oct4, Sox2, and Nanog genes in single cells during the earliest stages of mouse embryonic stem cell (ESC) differentiation and during embryonic development. We describe homologous pairing of the Oct4 alleles during ESC differentiation and embryogenesis, and present evidence that pairing is correlated with the kinetics of ESC differentiation. Importantly, we identify critical DNA elements within the Oct4 promoter/enhancer region that mediate pairing of Oct4 alleles. Finally, we show that mutation of OCT4/SOX2 binding sites within this region abolishes inter-chromosomal interactions and affects accumulation of the repressive H3K9me2 modification at the Oct4 enhancer. Our findings demonstrate that chromatin organization and transcriptional programs are intimately connected in ESCs, and that the dynamic positioning of the Oct4 alleles is associated with the transition from pluripotency to lineage specification. PMID:25748933

  14. Extensive Epigenetic Changes Accompany Terminal Differentiation of Mouse Hepatocytes After Birth

    PubMed Central

    Cannon, Matthew V.; Pilarowski, Genay; Liu, Xiuli; Serre, David

    2016-01-01

    DNA methylation is traditionally thought to be established during early development and to remain mostly unchanged thereafter in healthy tissues, although recent studies have shown that this epigenetic mark can be more dynamic. Epigenetic changes occur in the liver after birth, but the timing and underlying biological processes leading to DNA methylation changes are not well understood. We hypothesized that this epigenetic reprogramming was the result of terminal differentiation of hepatocyte precursors. Using genomic approaches, we characterized the DNA methylation patterns in mouse liver from E18.5 until adulthood to determine if the timing of the DNA methylation change overlaps with hepatocyte terminal differentiation, and to examine the genomic context of these changes and identify the regulatory elements involved. Out of 271,325 CpGs analyzed throughout the genome, 214,709 CpGs changed DNA methylation by more than 5% (e.g., from 5 to 10% methylation) between E18.5 and 9 wk of age, and 18,863 CpGs changed DNA methylation by more than 30%. Genome-scale data from six time points between E18.5 and P20 show that DNA methylation changes coincided with the terminal differentiation of hepatoblasts into hepatocytes. We also showed that epigenetic reprogramming occurred primarily in intergenic enhancer regions while gene promoters were less affected. Our data suggest that normal postnatal hepatic development and maturation involves extensive epigenetic remodeling of the genome, and that enhancers play a key role in controlling the transition from hepatoblasts to fully differentiated hepatocytes. Our study provides a solid foundation to support future research aimed at further revealing the role of epigenetics in stem cell biology. PMID:27652892

  15. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  16. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  17. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    PubMed

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  18. DNA microarray analysis of genes differentially expressed in adipocyte differentiation.

    PubMed

    Yin, Chunyan; Xiao, Yanfeng; Zhang, Wei; Xu, Erdi; Liu, Weihua; Yi, Xiaoqing; Chang, Ming

    2014-06-01

    In the present study, the human liposarcoma cell line SW872 was used to identify global changes in gene expression profiles occurring during adipogenesis. We further explored some of the genes expressed during the late phase of adipocyte differentiation. These genes may play a major role in promoting excessive proliferation and accumulation of lipid droplets, which contribute to the development of obesity. By using microarray-based technology, we examined differential gene expression in early differentiated adipocytes and late differentiated adipocytes. Validated genes exhibited a greater than or equal to 10-fold increase in the late phase of adipocyte differentiation by polymerase chain reaction (RT-PCR). Compared with undifferentiated preadipocytes, we found that 763 genes were increased in early differentiated adipocytes, and 667 genes were increased in later differentiated adipocytes. Furthermore, 21 genes were found being expressed 10-fold higher in the late phase of adipocyte differentiation. The results were in accordance with the RTPCR test, which validated 11 genes, namely, CIDEC, PID1, LYRM1, ADD1, PPAR?2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Most of these genes were found being expressed in the later phase of adipocyte differentiation involved in obesity-related diseases. The findings may help to better understand the mechanism of obesity and related diseases.

  19. Increased expression of acetylcholinesterase T and R transcripts during hematopoietic differentiation is accompanied by parallel elevations in the levels of their respective molecular forms.

    PubMed

    Chan, R Y; Adatia, F A; Krupa, A M; Jasmin, B J

    1998-04-17

    Differentiation of hematopoietic cells is known to be accompanied by profound changes in acetylcholinesterase (AChE) enzyme activity, yet the basic mechanisms underlying this developmental regulation remain unknown. We initiated a series of experiments to examine the molecular mechanisms involved in regulating AChE expression during hematopoiesis. Differentiation of murine erythroleukemia (MEL) cells using dimethyl sulfoxide resulted in a 5- and 10-fold increase in intracellular and secreted AChE enzyme activity, respectively. Interestingly, these increases resulted from a preferential induction of the globular molecular form G1 and a slight increase in G4 instead of an increase in the levels of the G2 membrane-bound form, a molecular form expressed in mature erythrocytes. Concomitantly, expression of the two predominant AChE transcripts (R and T, for read-through and tail, respectively) in MEL cells was induced to a similar extent with differentiation. Nuclear run-on assays performed with nuclei isolated from induced versus uninduced MEL cells revealed that in contrast to the large increases seen in the transcription of the beta-globin gene, the transcriptional activity of the AChE gene remained largely unaffected after differentiation. Determination of the half-lives of the R and T transcripts demonstrated that they both exhibited an increase in stability in induced MEL cells. Taken together, results from these studies indicate that post-transcriptional regulatory mechanisms account for the increased expression of AChE in differentiated hematopoietic cells.

  20. Molecular evolution accompanying functional divergence of duplicated genes along the plant starch biosynthesis pathway.

    PubMed

    Nougué, Odrade; Corbi, Jonathan; Ball, Steven G; Manicacci, Domenica; Tenaillon, Maud I

    2014-05-15

    Starch is the main source of carbon storage in the Archaeplastida. The starch biosynthesis pathway (sbp) emerged from cytosolic glycogen metabolism shortly after plastid endosymbiosis and was redirected to the plastid stroma during the green lineage divergence. The SBP is a complex network of genes, most of which are members of large multigene families. While some gene duplications occurred in the Archaeplastida ancestor, most were generated during the sbp redirection process, and the remaining few paralogs were generated through compartmentalization or tissue specialization during the evolution of the land plants. In the present study, we tested models of duplicated gene evolution in order to understand the evolutionary forces that have led to the development of SBP in angiosperms. We combined phylogenetic analyses and tests on the rates of evolution along branches emerging from major duplication events in six gene families encoding sbp enzymes. We found evidence of positive selection along branches following cytosolic or plastidial specialization in two starch phosphorylases and identified numerous residues that exhibited changes in volume, polarity or charge. Starch synthases, branching and debranching enzymes functional specializations were also accompanied by accelerated evolution. However, none of the sites targeted by selection corresponded to known functional domains, catalytic or regulatory. Interestingly, among the 13 duplications tested, 7 exhibited evidence of positive selection in both branches emerging from the duplication, 2 in only one branch, and 4 in none of the branches. The majority of duplications were followed by accelerated evolution targeting specific residues along both branches. This pattern was consistent with the optimization of the two sub-functions originally fulfilled by the ancestral gene before duplication. Our results thereby provide strong support to the so-called "Escape from Adaptive Conflict" (EAC) model. Because none of the

  1. Morc3 mutant mice exhibit reduced cortical area and thickness, accompanied by altered haematopoietic stem cells niche and bone cell differentiation

    PubMed Central

    Jadhav, Gaurav; Teguh, Dian; Kenny, Jacob; Tickner, Jennifer; Xu, Jiake

    2016-01-01

    Morc3, a member of a highly conserved nuclear matrix protein super-family plays an important part in chromatin remodeling, DNA repair, epigenetic regulation and cellular senescence. However, its role in bone homeostasis is not known. In the present study, a phenotype-driven ENU mouse mutagenesis screen revealed that Morc3mut +/− mice exhibit reduced cortical area and thickness with increased cortical porosity. Morc3mut +/− mice displayed reduced osteoclast numbers and surface per bone surface as well as osteocyte numbers, concomitant with altered gene expressions such as Rankl/Opg and Sost in ex vivo long bones. In vitro experiments revealed a significant increase in the number of Sca-1+/c-kit+ haematopoietic stem cells (HSCs), and a significant reduction in senescence associated β-galactosidase activity in bone marrow macrophages (BMMs). In addition, we observed a decrease in osteoclastogenesis and bone resorption accompanied by upregulation of STAT1 expression in osteoclast lineage cells. Strikingly, Morc3 protein localization within the nuclear membrane was shifted to the cytoplasm in Morc3mut +/− osteoclasts. Further, Morc3mut +/− mice displayed increased osteoblast differentiation and altered gene expression. Collectively, our data show that Morc3 is a previously unreported regulator of cortical bone homeostasis and haematopoietic stem cells niche, accompanied by altered bone cell differentiation. PMID:27188231

  2. Differentially Coexpressed Disease Gene Identification Based on Gene Coexpression Network.

    PubMed

    Jiang, Xue; Zhang, Han; Quan, Xiongwen

    2016-01-01

    Screening disease-related genes by analyzing gene expression data has become a popular theme. Traditional disease-related gene selection methods always focus on identifying differentially expressed gene between case samples and a control group. These traditional methods may not fully consider the changes of interactions between genes at different cell states and the dynamic processes of gene expression levels during the disease progression. However, in order to understand the mechanism of disease, it is important to explore the dynamic changes of interactions between genes in biological networks at different cell states. In this study, we designed a novel framework to identify disease-related genes and developed a differentially coexpressed disease-related gene identification method based on gene coexpression network (DCGN) to screen differentially coexpressed genes. We firstly constructed phase-specific gene coexpression network using time-series gene expression data and defined the conception of differential coexpression of genes in coexpression network. Then, we designed two metrics to measure the value of gene differential coexpression according to the change of local topological structures between different phase-specific networks. Finally, we conducted meta-analysis of gene differential coexpression based on the rank-product method. Experimental results demonstrated the feasibility and effectiveness of DCGN and the superior performance of DCGN over other popular disease-related gene selection methods through real-world gene expression data sets.

  3. Differentially Coexpressed Disease Gene Identification Based on Gene Coexpression Network

    PubMed Central

    Quan, Xiongwen

    2016-01-01

    Screening disease-related genes by analyzing gene expression data has become a popular theme. Traditional disease-related gene selection methods always focus on identifying differentially expressed gene between case samples and a control group. These traditional methods may not fully consider the changes of interactions between genes at different cell states and the dynamic processes of gene expression levels during the disease progression. However, in order to understand the mechanism of disease, it is important to explore the dynamic changes of interactions between genes in biological networks at different cell states. In this study, we designed a novel framework to identify disease-related genes and developed a differentially coexpressed disease-related gene identification method based on gene coexpression network (DCGN) to screen differentially coexpressed genes. We firstly constructed phase-specific gene coexpression network using time-series gene expression data and defined the conception of differential coexpression of genes in coexpression network. Then, we designed two metrics to measure the value of gene differential coexpression according to the change of local topological structures between different phase-specific networks. Finally, we conducted meta-analysis of gene differential coexpression based on the rank-product method. Experimental results demonstrated the feasibility and effectiveness of DCGN and the superior performance of DCGN over other popular disease-related gene selection methods through real-world gene expression data sets. PMID:28042568

  4. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  5. A multilocus perspective on colonization accompanied by selection and gene flow.

    PubMed

    Rosenblum, Erica Bree; Hickerson, Michael J; Moritz, Craig

    2007-12-01

    initial bottleneck. Both ABC analyses and measures of mtDNA sequence diversity also suggested that population reductions were more severe in the black lava compared to the white sands habitat. Differences observed between habitats may be explained by differences in colonization time, habitat geometry, and strength or response to natural selection for substrate matching. Finally, effective population size reductions in this system appear to be more dramatic when colonization is accompanied by a change in selection regime. Our analyses are consistent with a demographic cost of adaptation to novel environments and show that it is possible to infer aspects of the historical demography of local adaptation even in the presence of ongoing gene flow.

  6. Differential gene expression during multistage carcinogenesis

    SciTech Connect

    Bowden, G.T. ); Krieg, P. )

    1991-06-01

    The use of the mouse skin multistage model of carcinogenesis has aided our understanding of critical target genes in chemical carcinogenesis. The mutagenic activation of the Harvey-ras proto-oncogene has been found to be an early event associated with the initiation of mouse skin tumors by the polycyclic aromatic hydrocarbon 7,12 dimethylbenz(a)anthracene and the pure initiator ethyl carbamate (urethane). In contrast to chemical initiation of mouse skin tumors, ionizing radiation-initiated malignant skin tumors have been shown to possess distinct non-ras transforming gene(s). Differential screening of cDNA libraries made from chemically initiated malignant skin tumors has been used to identify a number of cellular gene transcripts that are overexpressed during mouse skin tumor progression. These differentially expressed genes include {beta}-actin, ubiquitin, a hyperproliferative keratin (K6), a gene whose product is a member of a fatty acid or lipid-binding protein family, and a gene called transin or stromelysin. The overexpression of the stromelysin gene, which encodes a metalloproteinase that degrades proteins in the basement membrane, is hypothesized to play a functional role in malignant tumor cell invasion and metastasis. The authors believe that the cloning, identification, and characterization of gene sequences that are differentially expressed during tumor progression could lead to the discovery of gene products that either play functional roles in skin tumor progression or in the maintenance of various progressive tumor phenotypes.

  7. Dissecting Gene Expression Changes Accompanying a Ploidy-Based Phenotypic Switch

    PubMed Central

    Cromie, Gareth A.; Tan, Zhihao; Hays, Michelle; Jeffery, Eric W.; Dudley, Aimée M.

    2016-01-01

    Aneuploidy, a state in which the chromosome number deviates from a multiple of the haploid count, significantly impacts human health. The phenotypic consequences of aneuploidy are believed to arise from gene expression changes associated with the altered copy number of genes on the aneuploid chromosomes. To dissect the mechanisms underlying altered gene expression in aneuploids, we used RNA-seq to measure transcript abundance in colonies of the haploid Saccharomyces cerevisiae strain F45 and two aneuploid derivatives harboring disomies of chromosomes XV and XVI. F45 colonies display complex “fluffy” morphologies, while the disomic colonies are smooth, resembling laboratory strains. Our two disomes displayed similar transcriptional profiles, a phenomenon not driven by their shared smooth colony morphology nor simply by their karyotype. Surprisingly, the environmental stress response (ESR) was induced in F45, relative to the two disomes. We also identified genes whose expression reflected a nonlinear interaction between the copy number of a transcriptional regulatory gene on chromosome XVI, DIG1, and the copy number of other chromosome XVI genes. DIG1 and the remaining chromosome XVI genes also demonstrated distinct contributions to the effect of the chromosome XVI disome on ESR gene expression. Expression changes in aneuploids appear to reflect a mixture of effects shared between different aneuploidies and effects unique to perturbing the copy number of particular chromosomes, including nonlinear copy number interactions between genes. The balance between these two phenomena is likely to be genotype- and environment-specific. PMID:27836908

  8. Increased expression of differentiation markers can accompany laminin-induced attachment of small cell lung cancer cells.

    PubMed Central

    Giaccone, G.; Broers, J.; Jensen, S.; Fridman, R. I.; Linnoila, R.; Gazdar, A. F.

    1992-01-01

    We investigated the interaction between human lung cancer cells, laminin, and several differentiating agents. When grown on laminin coated substrate eight out of 11 small cell lung cancer (SCLC) cell lines exhibited attachment to laminin and three had extensive outgrowth of long neurite-like processes. Of seven non-small cell lung cancer cell lines, selected for their in vitro anchorage-independent growth, attachment was observed in only three cell lines, and process formation was far less extensive than in SCLC cell lines. Among several differentiating agents, only dcAMP, which alone induced attachment and some process formation, increased laminin-mediated attachment and process formation of two SCLC cell lines, NCI-N417 a variant cell line, and NCI-H345, a classic cell line. The expression of several neuroendocrine and neuronal markers was investigated in these two SCLC cell lines. The expression of the light subunit of neurofilaments increased in NCI-N417 within 3 to 4 days of seeding, while NCI-H345 exhibited approximately 5 fold increase in expression of the GRP gene and a 3 fold increase expression of the beta-actin gene. The expression of a number of other neuroendocrine and neuronal markers did not change following growth on laminin. The doubling times remained unchanged independent of the presence of and attachment to laminin while topoisomerase II gene expression levels in NCI-N417 cells decreased approximately 5 fold when cells were growing on laminin. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:1325826

  9. Bayesian modeling of differential gene expression.

    PubMed

    Lewin, Alex; Richardson, Sylvia; Marshall, Clare; Glazier, Anne; Aitman, Tim

    2006-03-01

    We present a Bayesian hierarchical model for detecting differentially expressing genes that includes simultaneous estimation of array effects, and show how to use the output for choosing lists of genes for further investigation. We give empirical evidence that expression-level dependent array effects are needed, and explore different nonlinear functions as part of our model-based approach to normalization. The model includes gene-specific variances but imposes some necessary shrinkage through a hierarchical structure. Model criticism via posterior predictive checks is discussed. Modeling the array effects (normalization) simultaneously with differential expression gives fewer false positive results. To choose a list of genes, we propose to combine various criteria (for instance, fold change and overall expression) into a single indicator variable for each gene. The posterior distribution of these variables is used to pick the list of genes, thereby taking into account uncertainty in parameter estimates. In an application to mouse knockout data, Gene Ontology annotations over- and underrepresented among the genes on the chosen list are consistent with biological expectations.

  10. Quantum changes in Helicobacter pylori gene expression accompany host-adaptation

    PubMed Central

    Wise, Michael J.; Khosravi, Yalda; Seow, Shih-Wee; Amoyo, Arlaine A.; Pettersson, Sven; Peters, Fanny; Tay, Chin-Yen; Perkins, Timothy T.; Loke, Mun-Fai; Marshall, Barry J.; Vadivelu, Jamuna

    2017-01-01

    Abstract Helicobacter pylori is a highly successful gastric pathogen. High genomic plasticity allows its adaptation to changing host environments. Complete genomes of H. pylori clinical isolate UM032 and its mice-adapted serial derivatives 298 and 299, generated using both PacBio RS and Illumina MiSeq sequencing technologies, were compared to identify novel elements responsible for host-adaptation. The acquisition of a jhp0562-like allele, which encodes for a galactosyltransferase, was identified in the mice-adapted strains. Our analysis implies a new β-1,4-galactosyltransferase role for this enzyme, essential for Ley antigen expression. Intragenomic recombination between babA and babB genes was also observed. Further, we expanded on the list of candidate genes whose expression patterns have been mediated by upstream homopolymer-length alterations to facilitate host adaption. Importantly, greater than four-fold reduction of mRNA levels was demonstrated in five genes. Among the down-regulated genes, three encode for outer membrane proteins, including BabA, BabB and HopD. As expected, a substantial reduction in BabA protein abundance was detected in mice-adapted strains 298 and 299 via Western analysis. Our results suggest that the expression of Ley antigen and reduced outer membrane protein expressions may facilitate H. pylori colonisation of mouse gastric epithelium. PMID:27803027

  11. Quantum changes in Helicobacter pylori gene expression accompany host-adaptation.

    PubMed

    Chua, Eng-Guan; Wise, Michael J; Khosravi, Yalda; Seow, Shih-Wee; Amoyo, Arlaine A; Pettersson, Sven; Peters, Fanny; Tay, Chin-Yen; Perkins, Timothy T; Loke, Mun-Fai; Marshall, Barry J; Vadivelu, Jamuna

    2017-02-01

    Helicobacter pylori is a highly successful gastric pathogen. High genomic plasticity allows its adaptation to changing host environments. Complete genomes of H. pylori clinical isolate UM032 and its mice-adapted serial derivatives 298 and 299, generated using both PacBio RS and Illumina MiSeq sequencing technologies, were compared to identify novel elements responsible for host-adaptation. The acquisition of a jhp0562-like allele, which encodes for a galactosyltransferase, was identified in the mice-adapted strains. Our analysis implies a new β-1,4-galactosyltransferase role for this enzyme, essential for Ley antigen expression. Intragenomic recombination between babA and babB genes was also observed. Further, we expanded on the list of candidate genes whose expression patterns have been mediated by upstream homopolymer-length alterations to facilitate host adaption. Importantly, greater than four-fold reduction of mRNA levels was demonstrated in five genes. Among the down-regulated genes, three encode for outer membrane proteins, including BabA, BabB and HopD. As expected, a substantial reduction in BabA protein abundance was detected in mice-adapted strains 298 and 299 via Western analysis. Our results suggest that the expression of Ley antigen and reduced outer membrane protein expressions may facilitate H. pylori colonisation of mouse gastric epithelium. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  12. DNA methylation changes in plasticity genes accompany the formation and maintenance of memory.

    PubMed

    Halder, Rashi; Hennion, Magali; Vidal, Ramon O; Shomroni, Orr; Rahman, Raza-Ur; Rajput, Ashish; Centeno, Tonatiuh Pena; van Bebber, Frauke; Capece, Vincenzo; Garcia Vizcaino, Julio C; Schuetz, Anna-Lena; Burkhardt, Susanne; Benito, Eva; Navarro Sala, Magdalena; Javan, Sanaz Bahari; Haass, Christian; Schmid, Bettina; Fischer, Andre; Bonn, Stefan

    2016-01-01

    The ability to form memories is a prerequisite for an organism's behavioral adaptation to environmental changes. At the molecular level, the acquisition and maintenance of memory requires changes in chromatin modifications. In an effort to unravel the epigenetic network underlying both short- and long-term memory, we examined chromatin modification changes in two distinct mouse brain regions, two cell types and three time points before and after contextual learning. We found that histone modifications predominantly changed during memory acquisition and correlated surprisingly little with changes in gene expression. Although long-lasting changes were almost exclusive to neurons, learning-related histone modification and DNA methylation changes also occurred in non-neuronal cell types, suggesting a functional role for non-neuronal cells in epigenetic learning. Finally, our data provide evidence for a molecular framework of memory acquisition and maintenance, wherein DNA methylation could alter the expression and splicing of genes involved in functional plasticity and synaptic wiring.

  13. Differential gene detection incorporating common expression patterns

    NASA Astrophysics Data System (ADS)

    Oba, Shigeyuki; Ishii, Shin

    2009-12-01

    In detection of differentially expressed (DE) genes between different groups of samples based on a high-throughput expression measurement system, we often use a classical statistical testing based on a simple assumption that the expression of a certain DE gene in one group is higher or lower in average than that in the other group. Based on this simple assumption, the theory of optimal discovery procedure (ODP) (Storey, 2005) provided an optimal thresholding function for DE gene detection. However, expression patterns of DE genes over samples may have such a structure that is not exactly consistent with group labels assigned to the samples. Appropriate treatment of such a structure can increase the detection ability. Namely, genes showing similar expression patterns to other biologically meaningful genes can be regarded as statistically more significant than those showing expression patterns independent of other genes, even if differences in mean expression levels are comparable. In this study, we propose a new statistical thresholding function based on a latent variable model incorporating expression patterns together with the ODP theory. The latent variable model assumes hidden common signals behind expression patterns over samples and the ODP theory is extended to involve the latent variables. When applied to several gene expression data matrices which include cluster structures or 'cancer outlier' structures, the newly-proposed thresholding functions showed prominently better detection performance of DE genes than the original ODP thresholding function did. We also demonstrate how the proposed methods behave through analyses of real breast cancer and lymphoma datasets.

  14. Variation and selection at the CAULIFLOWER floral homeotic gene accompanying the evolution of domesticated Brassica oleracea.

    PubMed Central

    Purugganan, M D; Boyles, A L; Suddith, J I

    2000-01-01

    The evolution of plant morphologies during domestication events provides clues to the origin of crop species and the evolutionary genetics of structural diversification. The CAULIFLOWER gene, a floral regulatory locus, has been implicated in the cauliflower phenotype in both Arabidopsis thaliana and Brassica oleracea. Molecular population genetic analysis indicates that alleles carrying a nonsense mutation in exon 5 of the B. oleracea CAULIFLOWER (BoCAL) gene are segregating in both wild and domesticated B. oleracea subspecies. Alleles carrying this nonsense mutation are nearly fixed in B. oleracea ssp. botrytis (domestic cauliflower) and B. oleracea ssp. italica (broccoli), both of which show evolutionary modifications of inflorescence structures. Tests for selection indicate that the pattern of variation at this locus is consistent with positive selection at BoCAL in these two subspecies. This nonsense polymorphism, however, is also present in both B. oleracea ssp. acephala (kale) and B. oleracea ssp. oleracea (wild cabbage). These results indicate that specific alleles of BoCAL were selected by early farmers during the domestication of modified inflorescence structures in B. oleracea. PMID:10835404

  15. Neuroendocrine Tumors in the Stomach, Duodenum, and Pancreas Accompanied by Novel MEN1 Gene Mutation.

    PubMed

    Yang, Min A; Lee, Woong Ki; Shin, Hong Shik; Park, Sung Hyun; Kim, Byung Sun; Kim, Ji Woong; Cho, Jin Woong; Yun, So Hee

    2017-03-25

    Multiple endocrine neoplasia type 1 (MEN1) syndrome is a relatively rare disease, characterized by the occurrence of multiple endocrine tumors in the parathyroid and pituitary glands as well as the pancreas. Here, we report a case of MEN1 with neuroendocrine tumors (NETs) in the stomach, duodenum, and pancreas. A 53-year-old man visited our hospital to manage gastric NET. Five years prior to his visit, he had undergone surgery for incidental meningioma. His brother had pancreatic nodules and a history of surgery for adrenal adenoma. His brother's daughter also had pancreatic nodules, but had not undergone surgery. The lesion was treated by endoscopic submucosal dissection and diagnosed as a grade 1 NET. Another small NET was detected in the second duodenal portion, resected by endoscopic submucosal dissection, which was also diagnosed as a grade 1 NET. During evaluation, three nodules were detected in the pancreas, and no evidence of pituitary, parathyroid tumors, or metastasis was observed. After surgery, the pancreatic lesions were diagnosed as NETs, with the same immunohistochemical patterns as those of the stomach and duodenum. Genetic testing was performed, and a heterozygous mutation was detected in the MEN1 gene, which is located on 11q13.

  16. Gene regulatory logic of dopaminergic neuron differentiation

    PubMed Central

    Flames, Nuria; Hobert, Oliver

    2009-01-01

    Dopamine signaling regulates a variety of complex behaviors and defects in dopaminergic neuron function or survival result in severe human pathologies, such as Parkinson's disease 1. The common denominator of all dopaminergic neurons is the expression of dopamine pathway genes, which code for a set of phylogenetically conserved proteins involved in dopamine synthesis and transport. Gene regulatory mechanisms that result in the activation of dopamine pathway genes and thereby ultimately determine the identity of dopaminergic neurons are poorly understood in any system studied to date 2. We show here that a simple cis-regulatory element, the DA motif, controls the expression of all dopamine pathway genes in all dopaminergic cell types in C. elegans. The DA motif is activated by the ETS transcription factor, AST-1. Loss of ast-1 results in the failure of all distinct dopaminergic neuronal subtypes to terminally differentiate. Ectopic expression of ast-1 is sufficient to activate the dopamine production pathway in some cellular contexts. Vertebrate dopaminergic pathway genes also contain phylogenetically conserved DA motifs that can be activated by the mouse ETS transcription factor Etv1/ER81 and a specific class of dopaminergic neurons fails to differentiate in mice lacking Etv1/ER81. Moreover, ectopic Etv1/ER81 expression induces dopaminergic fate marker expression in neuronal primary cultures. Mouse Etv1/ER81 can also functionally substitute for ast-1 in C.elegans. Our studies reveal an astoundingly simple and apparently conserved regulatory logic of dopaminergic neuron terminal differentiation and may provide new entry points into the diagnosis or therapy of conditions in which dopamine neurons are defective. PMID:19287374

  17. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  18. The PLETHORA Gene Regulatory Network Guides Growth and Cell Differentiation in Arabidopsis Roots[OPEN

    PubMed Central

    Sanchez-Perez, Gabino F.; Rutjens, Bas; Gorte, Maartje; Prasad, Kalika; Bao, Dongping; Timmermans-Hereijgers, Johanna L.P.M.; Maeo, Kenichiro; Nakamura, Kenzo; Shimotohno, Akie; Pencik, Ales; van Heesch, Sebastiaan; de Bruijn, Ewart; Cuppen, Edwin; Willemsen, Viola

    2016-01-01

    Organ formation in animals and plants relies on precise control of cell state transitions to turn stem cell daughters into fully differentiated cells. In plants, cells cannot rearrange due to shared cell walls. Thus, differentiation progression and the accompanying cell expansion must be tightly coordinated across tissues. PLETHORA (PLT) transcription factor gradients are unique in their ability to guide the progression of cell differentiation at different positions in the growing Arabidopsis thaliana root, which contrasts with well-described transcription factor gradients in animals specifying distinct cell fates within an essentially static context. To understand the output of the PLT gradient, we studied the gene set transcriptionally controlled by PLTs. Our work reveals how the PLT gradient can regulate cell state by region-specific induction of cell proliferation genes and repression of differentiation. Moreover, PLT targets include major patterning genes and autoregulatory feedback components, enforcing their role as master regulators of organ development. PMID:27920338

  19. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  20. Collagen gene expression during limb cartilage differentiation

    PubMed Central

    1986-01-01

    As limb mesenchymal cells differentiate into chondrocytes, they initiate the synthesis of type II collagen and cease synthesizing type I collagen. Changes in the cytoplasmic levels of type I and type II collagen mRNAs during the course of limb chondrogenesis in vivo and in vitro were examined using cloned cDNA probes. A striking increase in cytoplasmic type II collagen mRNA occurs coincident with the crucial condensation stage of chondrogenesis in vitro, in which prechondrogenic mesenchymal cells become closely juxtaposed before depositing a cartilage matrix. Thereafter, a continuous and progressive increase in the accumulation of cytoplasmic type II collagen mRNA occurs which parallels the progressive accumulation of cartilage matrix by cells. The onset of overt chondrogenesis, however, does not involve activation of the transcription of the type II collagen gene. Low levels of type II collagen mRNA are present in the cytoplasm of prechondrogenic mesenchymal cells at the earliest stages of limb development, well before the accumulation of detectable levels of type II collagen. Type I collagen gene expression during chondrogenesis is regulated, at least in part, at the translational level. Type I collagen mRNAs are present in the cytoplasm of differentiated chondrocytes, which have ceased synthesizing detectable amounts of type I collagen. PMID:3754261

  1. MYCN gene expression is required for the onset of the differentiation programme in neuroblastoma cells

    PubMed Central

    Guglielmi, L; Cinnella, C; Nardella, M; Maresca, G; Valentini, A; Mercanti, D; Felsani, A; D'Agnano, I

    2014-01-01

    Neuroblastoma is an embryonic tumour of the sympathetic nervous system and is one of the most common cancers in childhood. A high differentiation stage has been associated with a favourable outcome; however, the mechanisms governing neuroblastoma cell differentiation are not completely understood. The MYCN gene is considered the hallmark of neuroblastoma. Even though it has been reported that MYCN has a role during embryonic development, it is needed its decrease so that differentiation can be completed. We aimed to better define the role of MYCN in the differentiation processes, particularly during the early stages. Considering the ability of MYCN to regulate non-coding RNAs, our hypothesis was that N-Myc protein might be necessary to activate differentiation (mimicking embryonic development events) by regulating miRNAs critical for this process. We show that MYCN expression increased in embryonic cortical neural precursor cells at an early stage after differentiation induction. To investigate our hypothesis, we used human neuroblastoma cell lines. In LAN-5 neuroblastoma cells, MYCN was upregulated after 2 days of differentiation induction before its expected downregulation. Positive modulation of various differentiation markers was associated with the increased MYCN expression. Similarly, MYCN silencing inhibited such differentiation, leading to negative modulation of various differentiation markers. Furthermore, MYCN gene overexpression in the poorly differentiating neuroblastoma cell line SK-N-AS restored the ability of such cells to differentiate. We identified three key miRNAs, which could regulate the onset of differentiation programme in the neuroblastoma cells in which we modulated MYCN. Interestingly, these effects were accompanied by changes in the apoptotic compartment evaluated both as expression of apoptosis-related genes and as fraction of apoptotic cells. Therefore, our idea is that MYCN is necessary during the activation of neuroblastoma

  2. Differentiation to adipocytes in accompanied by an increase in the amounts of Gi- and Go-proteins in 3T3-L1 cells

    SciTech Connect

    Watkins, D.C.; Northup, J.K.; Malbon, C.C.

    1986-05-01

    Treatment of cultures of 3T3-L1 cells with methylisobutyl-xanthine and dexamethasone has been shown to result in accumulation of lipid and conversion to the morphology of adipocytes in more than 90% of the cells. The status of the stimulatory (Gs), inhibitory (Gi) and Go-proteins during the course of 3T3-L1 differentiation was examined. The amount of alpha subunit of Gs (..cap alpha..Gs), assayed by radiolabeling in the presence of cholera toxin and (/sup 32/P)NAD/sup +/, increased upon differentiation as previously described by others. The amounts of ..cap alpha..Gi and ..cap alpha..Go assayed by radiolabeling in the presence of pertussis toxin and (/sup 32/P)NAD/sup +/ increased 3-fold upon differentiation. Immunoblots of cell membranes subjected to gel electrophoresis in sodium dodecyl sulfate were probed with two rabbit antisera raised against bovine brain ..cap alpha..Go and with one raised against the..beta..-subunit of the bovine rod-outer-segment G-protein, referred to as transducin. The immunoblotting data confirm the increase upon differentiation of ..cap alpha..Go and also demonstrate an increase in the amount of the ..beta..-subunit. Thus differentiation of 3T3-L1 cells is accompanied by dramatic changes in the complexion of G-proteins in the membranes.

  3. Tea catechin suppresses adipocyte differentiation accompanied by down-regulation of PPARgamma2 and C/EBPalpha in 3T3-L1 cells.

    PubMed

    Furuyashiki, Takashi; Nagayasu, Hironobu; Aoki, Yukiko; Bessho, Hiroaki; Hashimoto, Takashi; Kanazawa, Kazuki; Ashida, Hitoshi

    2004-11-01

    Obesity is a serious health problem, and its prevention is promoted through life style including diet and exercise. In this study, we investigated the suppressive effects of tea catechin on the differentiation of 3T3-L1 preadipocytes to adipocytes. (-)-Catechin 3-gallate (CG), (-)-epigallocatechin (EGC), (-)-epicatechin 3-gallate, and (-)-epigallocatechin 3-gallate at 5 muM suppressed intracellular lipid accumulation. The suppressive effects of CG and EGC were stronger than the others, and CG and EGC also suppressed the activity of glycerol-3-phosphate dehydrogenase as a differentiation marker. These catechins inhibited the expression of peroxisome proliferator-activated receptor (PPAR) gamma2 and CCAAT/enhancer-binding protein (C/EBP) alpha, both of which act as key transcription factors at an early stage of differentiation, followed by the expression of glucose transporter (GLUT) 4 at a later stage. In addition, the catechins did not affect the phosphorylation status of the insulin signal pathway. Thus, catechin suppressed adipocyte differentiation accompanied by the down-regulation of PPARgamma2, C/EBPalpha, and GLUT4. These results suggest that tea catechin prevents obesity through the suppression of adipocyte differentiation.

  4. Neural Differentiation in HDAC1-Depleted Cells Is Accompanied by Coilin Downregulation and the Accumulation of Cajal Bodies in Nucleoli

    PubMed Central

    Krejčí, Jana; Legartová, Soňa

    2017-01-01

    Cajal bodies (CBs) are important compartments containing accumulated proteins that preferentially regulate RNA-related nuclear events, including splicing. Here, we studied the nuclear distribution pattern of CBs in neurogenesis. In adult brains, coilin was present at a high density, but CB formation was absent in the nuclei of the choroid plexus of the lateral ventricles. Cells of the adult hippocampus were characterized by a crescent-like morphology of coilin protein. We additionally observed a 70 kDa splice variant of coilin in adult mouse brains, which was different to embryonic brains and mouse pluripotent embryonic stem cells (mESCs), characterized by the 80 kDa standard variant of coilin. Here, we also showed that depletion of coilin is induced during neural differentiation and HDAC1 deficiency in mESCs caused coilin accumulation inside the fibrillarin-positive region of the nucleoli. A similar distribution pattern was observed in adult brain hippocampi, characterized by lower levels of both coilin and HDAC1. In summary, we observed that neural differentiation and HDAC1 deficiency lead to coilin depletion and coilin accumulation in body-like structures inside the nucleoli. PMID:28337219

  5. Neural Differentiation in HDAC1-Depleted Cells Is Accompanied by Coilin Downregulation and the Accumulation of Cajal Bodies in Nucleoli.

    PubMed

    Krejčí, Jana; Legartová, Soňa; Bártová, Eva

    2017-01-01

    Cajal bodies (CBs) are important compartments containing accumulated proteins that preferentially regulate RNA-related nuclear events, including splicing. Here, we studied the nuclear distribution pattern of CBs in neurogenesis. In adult brains, coilin was present at a high density, but CB formation was absent in the nuclei of the choroid plexus of the lateral ventricles. Cells of the adult hippocampus were characterized by a crescent-like morphology of coilin protein. We additionally observed a 70 kDa splice variant of coilin in adult mouse brains, which was different to embryonic brains and mouse pluripotent embryonic stem cells (mESCs), characterized by the 80 kDa standard variant of coilin. Here, we also showed that depletion of coilin is induced during neural differentiation and HDAC1 deficiency in mESCs caused coilin accumulation inside the fibrillarin-positive region of the nucleoli. A similar distribution pattern was observed in adult brain hippocampi, characterized by lower levels of both coilin and HDAC1. In summary, we observed that neural differentiation and HDAC1 deficiency lead to coilin depletion and coilin accumulation in body-like structures inside the nucleoli.

  6. Common and differential pathophysiological features accompany comparable cognitive impairments in medication-free patients with schizophrenia and in healthy aging subjects

    PubMed Central

    Dreher, Jean-Claude; Koch, Paul; Kohn, Philip; Apud, Jose; Weinberger, Daniel R.; Berman, Karen Faith

    2016-01-01

    Background Dysfunction of the dorsolateral prefrontal cortex (DLPFC) and parahippocampal region along with poor working memory are common neurophysiological and behavioral features associated with schizophrenia and normal aging. It is, however, unknown whether the associated patterns of neural activation differ between these two groups when their cognitive performance is closely matched in a pairwise manner. The authors sought to pinpoint common and differential pathophysiological features that accompany comparable working memory impairments in schizophrenia and healthy aging. Methods Fifty-three subjects were scanned using H215O PET regional cerebral blood flow measurements during working memory. Seventeen medication-free patients with schizophrenia were individually matched for working memory performance with seventeen healthy aging subjects. Brain activation of the two index groups were compared to each other and to nineteen young healthy individuals. Results Patients with schizophrenia showed right DLPFC hypoactivation, both when compared to age-matched controls, and after direct comparison with working memory performance-matched elderly subjects. Moreover, both groups with working memory deficits shared an inability to suppress parahippocampal and anterior medial prefrontal cortex activation. Conclusions These results provide new insights into the mechanisms by which impaired working memory performance can arise by showing that both common (parahippocampal/anterior medial PFC) and differential (DLPFC) pathophysiological features accompany similar cognitive impairments. The aging data also demonstrate that poor performance is not necessarily accompanied by the DLPFC hypofunction that was seen in schizophrenia. Finally, these results more closely link the DLPFC functional abnormalities in schizophrenia to the pathophysiology of the disorder, rather than to poor performance per se. PMID:22341369

  7. [Differential expression of genes that encode glycolysis enzymes in kidney and lung cancer in humans].

    PubMed

    Oparina, N Yu; Snezhkina, A V; Sadritdinova, A F; Veselovskii, V A; Dmitriev, A A; Senchenko, V N; Mel'nikova, N V; Speranskaya, A S; Darii, M V; Stepanov, O A; Barkhatov, I M; Kudryavtseva, A V

    2013-07-01

    Glycolysis is a main catabolic pathway of glucose metabolism, accompanied by ATP synthesis. More than 30 enzymes are involved in glycolysis, and genes that encode them can be considered housekeeping genes due to the high conservatism and evolutionary antiquity of the process. We studied the expression of these genes in kidney papillary cancer and planocellular lung cancer via the bioinformatic analysis of transcriptome database and method of quantitative real time PCR. Quantitative analysis of mRNA level demonstrated that only a part ofgenes that encode glycolysis enzymes maintain relatively stable mRNA level, including the HK1, ADPGK, GPI, PGK1, and PKM2 genes in kidney papillary cancer and the ADPGK, ALDOA, GAPDH, PGK1, BPGM, ENO1, and PKM2 genes in planocellular lung cancer. The frequent increase in the mRNA expression of PFKP, ALDOA, and GAPDH genes in kidney cancer, as well as the GPI gene in lung cancer, were detected for the first time by real time PCR. For other genes, their differential expression was demonstrated; the cases of both a decrease and increase in the mRNA level were detected. Thus, several genes that can be used as control genes in transcriptome analysis by real time PCR in kidney and lung cancer, as well as a number of differentially expressed genes that can be potential oncomarkers, were identified.

  8. Epigenetic Modifications Unlock the Milk Protein Gene Loci during Mouse Mammary Gland Development and Differentiation

    PubMed Central

    Rijnkels, Monique; Freeman-Zadrowski, Courtneay; Hernandez, Joseph; Potluri, Vani; Wang, Liguo; Li, Wei; Lemay, Danielle G.

    2013-01-01

    Background Unlike other tissues, development and differentiation of the mammary gland occur mostly after birth. The roles of systemic hormones and local growth factors important for this development and functional differentiation are well-studied. In other tissues, it has been shown that chromatin organization plays a key role in transcriptional regulation and underlies epigenetic regulation during development and differentiation. However, the role of chromatin organization in mammary gland development and differentiation is less well-defined. Here, we have studied the changes in chromatin organization at the milk protein gene loci (casein, whey acidic protein, and others) in the mouse mammary gland before and after functional differentiation. Methodology/Principal Findings Distal regulatory elements within the casein gene cluster and whey acidic protein gene region have an open chromatin organization after pubertal development, while proximal promoters only gain open-chromatin marks during pregnancy in conjunction with the major induction of their expression. In contrast, other milk protein genes, such as alpha-lactalbumin, already have an open chromatin organization in the mature virgin gland. Changes in chromatin organization in the casein gene cluster region that are present after puberty persisted after lactation has ceased, while the changes which occurred during pregnancy at the gene promoters were not maintained. In general, mammary gland expressed genes and their regulatory elements exhibit developmental stage- and tissue-specific chromatin organization. Conclusions/Significance A progressive gain of epigenetic marks indicative of open/active chromatin on genes marking functional differentiation accompanies the development of the mammary gland. These results support a model in which a chromatin organization is established during pubertal development that is then poised to respond to the systemic hormonal signals of pregnancy and lactation to achieve the

  9. Brief isoflurane anaesthesia affects differential gene expression, gene ontology and gene networks in rat brain.

    PubMed

    Lowes, Damon A; Galley, Helen F; Moura, Alessandro P S; Webster, Nigel R

    2017-01-15

    Much is still unknown about the mechanisms of effects of even brief anaesthesia on the brain and previous studies have simply compared differential expression profiles with and without anaesthesia. We hypothesised that network analysis, in addition to the traditional differential gene expression and ontology analysis, would enable identification of the effects of anaesthesia on interactions between genes. Rats (n=10 per group) were randomised to anaesthesia with isoflurane in oxygen or oxygen only for 15min, and 6h later brains were removed. Differential gene expression and gene ontology analysis of microarray data was performed. Standard clustering techniques and principal component analysis with Bayesian rules were used along with social network analysis methods, to quantitatively model and describe the gene networks. Anaesthesia had marked effects on genes in the brain with differential regulation of 416 probe sets by at least 2 fold. Gene ontology analysis showed 23 genes were functionally related to the anaesthesia and of these, 12 were involved with neurotransmitter release, transport and secretion. Gene network analysis revealed much greater connectivity in genes from brains from anaesthetised rats compared to controls. Other importance measures were also altered after anaesthesia; median [range] closeness centrality (shortest path) was lower in anaesthetized animals (0.07 [0-0.30]) than controls (0.39 [0.30-0.53], p<0.0001) and betweenness centrality was higher (53.85 [32.56-70.00]% compared to 5.93 [0-30.65]%, p<0.0001). Simply studying the actions of individual components does not fully describe dynamic and complex systems. Network analysis allows insight into the interactions between genes after anaesthesia and suggests future targets for investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Different level of population differentiation among human genes.

    PubMed

    Wu, Dong-Dong; Zhang, Ya-Ping

    2011-01-14

    During the colonization of the world, after dispersal out of African, modern humans encountered changeable environments and substantial phenotypic variations that involve diverse behaviors, lifestyles and cultures, were generated among the different modern human populations. Here, we study the level of population differentiation among different populations of human genes. Intriguingly, genes involved in osteoblast development were identified as being enriched with higher FST SNPs, a result consistent with the proposed role of the skeletal system in accounting for variation among human populations. Genes involved in the development of hair follicles, where hair is produced, were also found to have higher levels of population differentiation, consistent with hair morphology being a distinctive trait among human populations. Other genes that showed higher levels of population differentiation include those involved in pigmentation, spermatid, nervous system and organ development, and some metabolic pathways, but few involved with the immune system. Disease-related genes demonstrate excessive SNPs with lower levels of population differentiation, probably due to purifying selection. Surprisingly, we find that Mendelian-disease genes appear to have a significant excessive of SNPs with high levels of population differentiation, possibly because the incidence and susceptibility of these diseases show differences among populations. As expected, microRNA regulated genes show lower levels of population differentiation due to purifying selection. Our analysis demonstrates different level of population differentiation among human populations for different gene groups.

  11. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  12. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  13. Dynamic changes in gene expression during human trophoblast differentiation.

    PubMed

    Handwerger, Stuart; Aronow, Bruce

    2003-01-01

    The genetic program that directs human placental differentiation is poorly understood. In a recent study, we used DNA microarray analyses to determine genes that are dynamically regulated during human placental development in an in vitro model system in which highly purified cytotrophoblast cells aggregate spontaneously and fuse to form a multinucleated syncytium that expresses placental lactogen, human chorionic gonadotropin, and other proteins normally expressed by fully differentiated syncytiotrophoblast cells. Of the 6918 genes present on the Incyte Human GEM V microarray that we analyzed over a 9-day period, 141 were induced and 256 were downregulated by more than 2-fold. The dynamically regulated genes fell into nine distinct kinetic patterns of induction or repression, as detected by the K-means algorithm. Classifying the genes according to functional characteristics, the regulated genes could be divided into six overall categories: cell and tissue structural dynamics, cell cycle and apoptosis, intercellular communication, metabolism, regulation of gene expression, and expressed sequence tags and function unknown. Gene expression changes within key functional categories were tightly coupled to the morphological changes that occurred during trophoblast differentiation. Within several key gene categories (e.g., cell and tissue structure), many genes were strongly activated, while others with related function were strongly repressed. These findings suggest that trophoblast differentiation is augmented by "categorical reprogramming" in which the ability of induced genes to function is enhanced by diminished synthesis of other genes within the same category. We also observed categorical reprogramming in human decidual fibroblasts decidualized in vitro in response to progesterone, estradiol, and cyclic AMP. While there was little overlap between genes that are dynamically regulated during trophoblast differentiation versus decidualization, many of the categories

  14. Evolution and organization of the fibrinogen locus on chromosome 4: gene duplication accompanied by transposition and inversion.

    PubMed Central

    Kant, J A; Fornace, A J; Saxe, D; Simon, M I; McBride, O W; Crabtree, G R

    1985-01-01

    Human fibrinogen cDNA probes for the alpha-, beta-, and gamma-polypeptide chains have been used to isolate the corresponding genes from human genomic libraries. There is a single copy of each gene. Restriction endonuclease analysis of isolated genomic clones and human genomic DNA indicates that the human alpha-, beta-, and gamma-fibrinogen genes are closely linked in a 50-kilobase region of a single human chromosome: the alpha-gene in the middle flanked by the beta-gene on one side and the gamma-gene on the other. The alpha- and gamma-chain genes are oriented in tandem and transcribed toward the beta-chain gene. The beta-chain gene is transcribed from the opposite DNA strand toward the gamma- and alpha-chain genes. The three genes have been localized to the distal third of the long arm of chromosome 4, bands q23-q32, by in situ hybridization with fibrinogen cDNAs and by examination of DNA from multiple rodent-human somatic cell hybrids. Alternative explanations for the present arrangement of the three fibrinogen genes involve either a three-step mechanism with inversion of the alpha/gamma-region or a two-step mechanism involving remote transposition and inversion. The second more simple mechanism has a precedent in the origin of repeated regions of the fibrinogen and immunoglobulin genes. Images PMID:2986113

  15. Sex determining genes and sexual differentiation in a marsupial.

    PubMed

    Pask, A; Renfree, M B

    2001-11-01

    The role of genes in the differentiation of the testis and ovary has been extensively studied in the human and the mouse. Despite over a decade of investigations, the precise roles of genes and their interactions in the pathway of sex determination are still unclear. We have chosen to take a comparative look at sex determination and differentiation to gain insights into the evolution and the conserved functions of these genes. To achieve this, we have examined a wide variety of eutherian sex determining genes in a marsupial, the tammar wallaby, to determine which genes have a conserved and fundamental mammalian sex determining role. These investigations have provided many unique insights. Here, we review the recent molecular and endocrine investigations into sexual development in marsupials, and highlight how these studies have shed light on the roles of genes and hormones in mammalian sex determination and differentiation.

  16. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  17. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.

    PubMed

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan

    2017-02-01

    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  18. Onset of sex differentiation: dialog between genes and cells.

    PubMed

    Merchant-Larios, H; Moreno-Mendoza, N

    2001-01-01

    During the late 1940s, Alfred Jost demonstrated that mammalian sex differentiation begins in fetal testis, producing two factors necessary for the establishment of phenotypic males. Castrated embryos prior to testis differentiation led to phenotypic female differentiation. Jost proposed the existence of a testis-determining factor (TDF), elucidated in 1990 and named SRY for humans and Sry for mice. Thereafter, an increasing list of genes expressed in the genital ridges of mouse embryos at the onset of gonad differentiation has appeared. To date, it is clear that complete understanding of the mechanisms underlying gonadal sex differentiation in mammals requires identification of key cell lineages in which gonadal-specific genes are expressed. Here, a correlation between known gene expression and gonadal morphologic changes is attempted.

  19. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  20. Differential methylation during maize leaf growth targets developmentally regulated genes.

    PubMed

    Candaele, Jasper; Demuynck, Kirin; Mosoti, Douglas; Beemster, Gerrit T S; Inzé, Dirk; Nelissen, Hilde

    2014-03-01

    DNA methylation is an important and widespread epigenetic modification in plant genomes, mediated by DNA methyltransferases (DMTs). DNA methylation is known to play a role in genome protection, regulation of gene expression, and splicing and was previously associated with major developmental reprogramming in plants, such as vernalization and transition to flowering. Here, we show that DNA methylation also controls the growth processes of cell division and cell expansion within a growing organ. The maize (Zea mays) leaf offers a great tool to study growth processes, as the cells progressively move through the spatial gradient encompassing the division zone, transition zone, elongation zone, and mature zone. Opposite to de novo DMTs, the maintenance DMTs were transcriptionally regulated throughout the growth zone of the maize leaf, concomitant with differential CCGG methylation levels in the four zones. Surprisingly, the majority of differentially methylated sequences mapped on or close to gene bodies and not to repeat-rich loci. Moreover, especially the 5' and 3' regions of genes, which show overall low methylation levels, underwent differential methylation in a developmental context. Genes involved in processes such as chromatin remodeling, cell cycle progression, and growth regulation, were differentially methylated. The presence of differential methylation located upstream of the gene anticorrelated with transcript expression, while gene body differential methylation was unrelated to the expression level. These data indicate that DNA methylation is correlated with the decision to exit mitotic cell division and to enter cell expansion, which adds a new epigenetic level to the regulation of growth processes.

  1. Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

    PubMed Central

    2012-01-01

    Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD). Methods In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I

  2. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  3. [Screening of differentially expressed genes during adipocyte differentiation by suppression subtractive hybridization technique].

    PubMed

    Yi, Xiao-qing; Xiao, Yan-feng; Yin, Chun-yan; Xu, Er-di

    2012-05-01

    To screening differentially expressed genes related to adipocyte differentiation. Total RNA extracted from the preadipocyte cell line SW872 was taken as the Driver and the total RNA from the differentiated adipocytes SW872 as the Tester. Suppression subtractive hybridization (SSH) was used to isolate the cDNA fragments of differentially expressed genes. The products of SSH were inserted into pGM-T vector to establish the subtractive library. The library was amplified through E.coli transformation and positive clones of the transformants were screened. Positive clones were sequenced. Nucleic acid similarity was subsequently analyzed by comparing with the data from GenBank. There were 135 white clones in the cDNA library, 64 positive clones were chosen randomly and sequenced and similarity search revealed 34 genes which expressed differentially in adipocyte differentiation. The subtracted cDNA library for differentially expressed in adipocyte differentiation has been successfully constructed and the interesting candidate genes related to adipocyte differentiation have been identified.

  4. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  5. Role of Hox genes in stem cell differentiation.

    PubMed

    Seifert, Anne; Werheid, David F; Knapp, Silvana M; Tobiasch, Edda

    2015-04-26

    Hox genes are an evolutionary highly conserved gene family. They determine the anterior-posterior body axis in bilateral organisms and influence the developmental fate of cells. Embryonic stem cells are usually devoid of any Hox gene expression, but these transcription factors are activated in varying spatial and temporal patterns defining the development of various body regions. In the adult body, Hox genes are among others responsible for driving the differentiation of tissue stem cells towards their respective lineages in order to repair and maintain the correct function of tissues and organs. Due to their involvement in the embryonic and adult body, they have been suggested to be useable for improving stem cell differentiations in vitro and in vivo. In many studies Hox genes have been found as driving factors in stem cell differentiation towards adipogenesis, in lineages involved in bone and joint formation, mainly chondrogenesis and osteogenesis, in cardiovascular lineages including endothelial and smooth muscle cell differentiations, and in neurogenesis. As life expectancy is rising, the demand for tissue reconstruction continues to increase. Stem cells have become an increasingly popular choice for creating therapies in regenerative medicine due to their self-renewal and differentiation potential. Especially mesenchymal stem cells are used more and more frequently due to their easy handling and accessibility, combined with a low tumorgenicity and little ethical concerns. This review therefore intends to summarize to date known correlations between natural Hox gene expression patterns in body tissues and during the differentiation of various stem cells towards their respective lineages with a major focus on mesenchymal stem cell differentiations. This overview shall help to understand the complex interactions of Hox genes and differentiation processes all over the body as well as in vitro for further improvement of stem cell treatments in future regenerative

  6. Role of Hox genes in stem cell differentiation

    PubMed Central

    Seifert, Anne; Werheid, David F; Knapp, Silvana M; Tobiasch, Edda

    2015-01-01

    Hox genes are an evolutionary highly conserved gene family. They determine the anterior-posterior body axis in bilateral organisms and influence the developmental fate of cells. Embryonic stem cells are usually devoid of any Hox gene expression, but these transcription factors are activated in varying spatial and temporal patterns defining the development of various body regions. In the adult body, Hox genes are among others responsible for driving the differentiation of tissue stem cells towards their respective lineages in order to repair and maintain the correct function of tissues and organs. Due to their involvement in the embryonic and adult body, they have been suggested to be useable for improving stem cell differentiations in vitro and in vivo. In many studies Hox genes have been found as driving factors in stem cell differentiation towards adipogenesis, in lineages involved in bone and joint formation, mainly chondrogenesis and osteogenesis, in cardiovascular lineages including endothelial and smooth muscle cell differentiations, and in neurogenesis. As life expectancy is rising, the demand for tissue reconstruction continues to increase. Stem cells have become an increasingly popular choice for creating therapies in regenerative medicine due to their self-renewal and differentiation potential. Especially mesenchymal stem cells are used more and more frequently due to their easy handling and accessibility, combined with a low tumorgenicity and little ethical concerns. This review therefore intends to summarize to date known correlations between natural Hox gene expression patterns in body tissues and during the differentiation of various stem cells towards their respective lineages with a major focus on mesenchymal stem cell differentiations. This overview shall help to understand the complex interactions of Hox genes and differentiation processes all over the body as well as in vitro for further improvement of stem cell treatments in future regenerative

  7. Melatonin and nitric oxide regulate sunflower seedling growth under salt stress accompanying differential expression of Cu/Zn SOD and Mn SOD.

    PubMed

    Arora, Dhara; Bhatla, Satish C

    2017-02-28

    Salinity results in significant reduction in sunflower (Helianthus annuus L.) seedling growth and excessive generation of reactive oxygen species (ROS). Present work highlights the possible role of melatonin as an antioxidant through its interaction with nitric oxide (NO), and as an early and long distance NaCl-stress sensing signaling molecule in seedling cotyledons. Exogenous melatonin (15µM)±NaCl (120mM) inhibit seedling growth, which is also correlated with NO availability, accumulation of potential superoxide anion (O2(•-)) and peroxynitrite anion (ONOO(-)), extent of tyrosine-nitration of proteins, spatial localization and activity of superoxide dismutase (SOD) isoforms. NO acts as a positive modulator of melatonin accumulation in seedling cotyledons as a long-distance signaling response. Modulation of superoxide anion and peroxynitrite anion content by melatonin highlights its crucial role in combating deleterious effects of ROS and reactive nitrogen species (RNS). Present findings provide evidence for an interaction between melatonin and NO in their effect on seedling growth under salt stress accompanying differential modulation of two SOD isoforms, i.e. Cu/Zn SOD and Mn SOD.

  8. Altering equine corneal fibroblast differentiation through Smad gene transfer.

    PubMed

    Marlo, Todd L; Giuliano, Elizabeth A; Tripathi, Ratnakar; Sharma, Ajay; Mohan, Rajiv R

    2017-07-06

    To explore the impact of equine corneal fibroblast (ECF) to myofibroblast (ECM) differentiation by altering the expression of the Smad genes either individually or in combination. Specifically, we sought to examine the ECF differentiation after (a) silencing of Smad2, 3, and 4 profibrotic genes individually and (b) overexpression of antifibrotic Smad7 gene and in a combination with pro- and antifibrotic Smad genes. Equine corneal fibroblast primary cultures were generated as previously described. ECFs were transfected with individual plasmids which silenced gene expression of either Smad2, 3, or 4 or in combination with a plasmid overexpressing Smad7 using Lipofectamine 2000™ or Lipofectamine BLOCK-iT™. Smad-transfected clones were then exposed to TGF-β1 to induce differentiation to myofibroblasts. Immunofluorescence and qRT-PCR techniques quantified levels of ECF differentiation to ECM by measuring alpha smooth muscle actin, a known marker of ECM transdifferentiation. Silencing of individual Smad2, 3, or 4 genes or overexpression of Smad7 showed significant inhibition of ECF transdifferentiation (73-83% reduction). Silencing of Smad2 showed the greatest inhibition of ECF transdifferentiation in (a) and was therefore utilized for the combination gene transfer testing. The combination gene transfer consisting of Smad7 overexpression and Smad2 silencing attenuated ECF differentiation significantly; however, the level was not significant compared to the overexpression of Smad7 individually. Using gene transfer technology involving profibrotic Smad silencing, antifibrotic Smad overexpression or its combination is a novel strategy to control TGF-β1-mediated fibrosis in equine fibroblasts. Combination gene therapy was not better than single gene therapy in this study. © 2017 American College of Veterinary Ophthalmologists.

  9. Changes in alternative splicing of human and mouse genes are accompanied by faster evolution of constitutive exons.

    PubMed

    Cusack, Brian P; Wolfe, Kenneth H

    2005-11-01

    Alternative splicing is known to be an important source of protein sequence variation, but its evolutionary impact has not been explored in detail. Studying alternative splicing requires extensive sampling of the transcriptome, but new data sets based on expressed sequence tags aligned to chromosomes make it possible to study alternative splicing on a genome-wide scale. Although genes showing alternative splicing by exon skipping are conserved as compared to the genome as a whole, we find that genes where structural differences between human and mouse result in genome-specific alternatively spliced exons in one species show almost 60% greater nonsynonymous divergence in constitutive exons than genes where exon skipping is conserved. This effect is also seen for genes showing species-specific patterns of alternative splicing where gene structure is conserved. Our observations are not attributable to an inherent difference in rate of evolution between these two sets of proteins or to differences with respect to predictors of evolutionary rate such as expression level, tissue specificity, or genetic redundancy. Where genome-specific alternatively spliced exons are seen in mammals, the vast majority of skipped exons appear to be recent additions to gene structures. Furthermore, among genes with genome-specific alternatively spliced exons, the degree of nonsynonymous divergence in constitutive sequence is a function of the frequency of incorporation of these alternative exons into transcripts. These results suggest that alterations in alternative splicing pattern can have knock-on effects in terms of accelerated sequence evolution in constant regions of the protein.

  10. Single-walled carbon nanotubes selectively influence maize root tissue development accompanied by the change in the related gene expression.

    PubMed

    Yan, Shihan; Zhao, Lin; Li, Hui; Zhang, Qi; Tan, Junjun; Huang, Min; He, Shibin; Li, Lijia

    2013-02-15

    The inconsistent impact of nanomaterials on different plant species has been reported, but little is known about this effect at the cellular and genetic levels. Here we report that single-walled carbon nanotubes (SWCNTs) accelerate maize seminal root growth, but display little effect on the primary root growth. In contrast, root hair growth inhibition by SWCNTs is observed. Further gene transcription analysis shows that SWCNTs could increase the expression of seminal root associated genes whereas decrease root hair associated gene expression. Their effect is on both tissue and gene selectiveness since both enhanced and inhibited gene expression and tissue growth are observed during root development. Microscopy images reveal the distribution of SWCNTs inside the root and mainly in the intercellular space in cortex tissues. We also find that SWCNT-treatment dynamically and selectively induces the up-regulation of epigenetic modification enzyme genes, leading to global deacetylation of histone H3, similar to the response of plants to other stress. Our results suggest that the nanoparticle-root cell interaction could cause the change in gene expression, and consequently affect relative root growth and development. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Xyloglucan endotransglucosylase/hydrolase genes in cucumber (Cucumis sativus) - differential expression during somatic embryogenesis.

    PubMed

    Malinowski, Robert; Filipecki, Marcin; Tagashira, Norikazu; Wiśniewska, Anita; Gaj, Paweł; Plader, Wojciech; Malepszy, Stefan

    2004-04-01

    Defined changes in the cell wall directed by many proteins accompany every morphogenetic process in plants. Xyloglucan endotransglucosylase/hydrolase proteins (XTH; EC 2.4.1.207) have the potential to modify the hemicellulose matrix within the cell wall. Cs-XTH1 and Cs-XTH3 genes, which encode XTH proteins, were found among numerous genes that are differentially expressed after the induction of cucumber somatic embryogenesis. The expression of these genes increased during somatic embryogenesis. The Cs-XTH1 gene was localized on the second chromosome near the centromere region, whereas Cs-XTH3 was found in the middle of the fifth chromosome's longer arm. Northern blot hybridization showed that both genes were preferentially expressed in roots. We also observed higher accumulation of both transcripts in somatic embryos than in the proembryogenic mass. The localization of mRNA by in situ hybridization revealed that the Cs-XTH1 transcripts were largely accumulated in the presumptive cotyledon primordia of somatic embryos. The XTH gene family consists of a number of genes with a high degree of structural similarity. Screening a cucumber genomic library has identified other members of this gene family. The intron/exon structure, sequence similarities and the close chromosomal distance between some members suggest their common evolutionary origin. The involvement of XTH-related genes in somatic embryo formation is discussed.

  12. DGCA: A comprehensive R package for Differential Gene Correlation Analysis.

    PubMed

    McKenzie, Andrew T; Katsyv, Igor; Song, Won-Min; Wang, Minghui; Zhang, Bin

    2016-11-15

    Dissecting the regulatory relationships between genes is a critical step towards building accurate predictive models of biological systems. A powerful approach towards this end is to systematically study the differences in correlation between gene pairs in more than one distinct condition. In this study we develop an R package, DGCA (for Differential Gene Correlation Analysis), which offers a suite of tools for computing and analyzing differential correlations between gene pairs across multiple conditions. To minimize parametric assumptions, DGCA computes empirical p-values via permutation testing. To understand differential correlations at a systems level, DGCA performs higher-order analyses such as measuring the average difference in correlation and multiscale clustering analysis of differential correlation networks. Through a simulation study, we show that the straightforward z-score based method that DGCA employs significantly outperforms the existing alternative methods for calculating differential correlation. Application of DGCA to the TCGA RNA-seq data in breast cancer not only identifies key changes in the regulatory relationships between TP53 and PTEN and their target genes in the presence of inactivating mutations, but also reveals an immune-related differential correlation module that is specific to triple negative breast cancer (TNBC). DGCA is an R package for systematically assessing the difference in gene-gene regulatory relationships under different conditions. This user-friendly, effective, and comprehensive software tool will greatly facilitate the application of differential correlation analysis in many biological studies and thus will help identification of novel signaling pathways, biomarkers, and targets in complex biological systems and diseases.

  13. The PLETHORA Gene Regulatory Network Guides Growth and Cell Differentiation in Arabidopsis Roots.

    PubMed

    Santuari, Luca; Sanchez-Perez, Gabino F; Luijten, Marijn; Rutjens, Bas; Terpstra, Inez; Berke, Lidija; Gorte, Maartje; Prasad, Kalika; Bao, Dongping; Timmermans-Hereijgers, Johanna L P M; Maeo, Kenichiro; Nakamura, Kenzo; Shimotohno, Akie; Pencik, Ales; Novak, Ondrej; Ljung, Karin; van Heesch, Sebastiaan; de Bruijn, Ewart; Cuppen, Edwin; Willemsen, Viola; Mähönen, Ari Pekka; Lukowitz, Wolfgang; Snel, Berend; de Ridder, Dick; Scheres, Ben; Heidstra, Renze

    2016-12-01

    Organ formation in animals and plants relies on precise control of cell state transitions to turn stem cell daughters into fully differentiated cells. In plants, cells cannot rearrange due to shared cell walls. Thus, differentiation progression and the accompanying cell expansion must be tightly coordinated across tissues. PLETHORA (PLT) transcription factor gradients are unique in their ability to guide the progression of cell differentiation at different positions in the growing Arabidopsis thaliana root, which contrasts with well-described transcription factor gradients in animals specifying distinct cell fates within an essentially static context. To understand the output of the PLT gradient, we studied the gene set transcriptionally controlled by PLTs. Our work reveals how the PLT gradient can regulate cell state by region-specific induction of cell proliferation genes and repression of differentiation. Moreover, PLT targets include major patterning genes and autoregulatory feedback components, enforcing their role as master regulators of organ development. © 2016 American Society of Plant Biologists. All rights reserved.

  14. Multiple differential expression networks identify key genes in rectal cancer.

    PubMed

    Li, Ri-Heng; Zhang, Ai-Min; Li, Shuang; Li, Tian-Yang; Wang, Lian-Jing; Zhang, Hao-Ran; Li, Ping; Jia, Xiong-Jie; Zhang, Tao; Peng, Xin-Yu; Liu, Min-Di; Wang, Xu; Lang, Yan; Xue, Wei-Lan; Liu, Jing; Wang, Yan-Yan

    2016-01-01

    Rectal cancer is an important contributor to cancer mortality. The objective of this paper is to identify key genes across three phenotypes (fungating, polypoid and polypoid & small-ulcer) of rectal cancer based on multiple differential expression networks (DENs). Differential interactions and non-differential interactions were evaluated according to Spearman correlation coefficient (SCC) algorithm, and were selected to construct DENs. Topological analysis was performed for exploring hub genes in largest components of DENs. Key genes were denoted as intersections between nodes of DENs and rectal cancer associated genes from Genecards. Finally, we utilized hub genes to classify phenotypes of rectal cancer on the basis of support vector machines (SVM) methodology. We obtained 19 hub genes and total 12 common key genes of three largest components of DENs, and EGFR was the common element. The SVM results revealed that hub genes could classify phenotypes, and validated feasibility of DEN methods. We have successfully identified significant genes (such as EGFR and UBC) across fungating, polypoid and polypoid & small-ulcer phenotype of rectal cancer. They might be potential biomarkers for classification, detection and therapy of this cancer.

  15. Clustering of Tissue-Specific Sub-TADs Accompanies the Regulation of HoxA Genes in Developing Limbs

    PubMed Central

    Berlivet, Soizik; Paquette, Denis; Dumouchel, Annie; Langlais, David; Dostie, Josée; Kmita, Marie

    2013-01-01

    HoxA genes exhibit central roles during development and causal mutations have been found in several human syndromes including limb malformation. Despite their importance, information on how these genes are regulated is lacking. Here, we report on the first identification of bona fide transcriptional enhancers controlling HoxA genes in developing limbs and show that these enhancers are grouped into distinct topological domains at the sub-megabase scale (sub-TADs). We provide evidence that target genes and regulatory elements physically interact with each other through contacts between sub-TADs rather than by the formation of discreet “DNA loops”. Interestingly, there is no obvious relationship between the functional domains of the enhancers within the limb and how they are partitioned among the topological domains, suggesting that sub-TAD formation does not rely on enhancer activity. Moreover, we show that suppressing the transcriptional activity of enhancers does not abrogate their contacts with HoxA genes. Based on these data, we propose a model whereby chromatin architecture defines the functional landscapes of enhancers. From an evolutionary standpoint, our data points to the convergent evolution of HoxA and HoxD regulation in the fin-to-limb transition, one of the major morphological innovations in vertebrates. PMID:24385922

  16. Pomelo II: finding differentially expressed genes.

    PubMed

    Morrissey, Edward R; Diaz-Uriarte, Ramón

    2009-07-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool.

  17. Pomelo II: finding differentially expressed genes

    PubMed Central

    Morrissey, Edward R.; Diaz-Uriarte, Ramón

    2009-01-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool. PMID:19435879

  18. Repression of genes involved in melanocyte differentiation in uveal melanoma

    PubMed Central

    Bergeron, Marjorie-Allison; Champagne, Sophie; Gaudreault, Manon; Deschambeault, Alexandre

    2012-01-01

    Purpose Uveal melanoma (UM) has been the subject of intense interest due to its distinctive metastatic pattern, which involves hematogenous dissemination of cancerous cells toward the liver in 50% of patients. To search for new UM prognostic markers, the Suppressive Subtractive Hybridization (SSH) technique was used to isolate genes that are differentially expressed between UM primary tumors and normal uveal melanocytes (UVM). Methods A subtracted cDNA library was prepared using cDNA from uncultured UM primary tumors and UVM. The expression level of selected genes was further validated by cDNA microarray, semi-quantitative reverse transcription polymerase chain reaction (RT-PCR), and immunofluorescence analyses. Results One hundred-fifteen genes were identified using the SSH technique. Microarray analyses comparing the gene expression profiles of UM primary tumors to UVM validated a significant differential expression for 48% of these genes. The expression pattern of selected genes was then analyzed by semi-quantitative RT–PCR and was found to be consistent with the SSH and cDNA microarray findings. A down-regulation of genes associated with melanocyte differentiation was confirmed in UM primary tumors. Presence of undifferentiated cells in the UM was demonstrated by the expression of stem cell markers ATP-binding cassette sub-family G member 2 (ABCG2) and octamer-binding protein 4 (OCT4). Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes between UM and UVM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. In addition, deregulation of the melanocyte differentiation pathway revealed the presence of UM cells exhibiting a stem cell-like phenotype. PMID:22815634

  19. Accumulation of Potato spindle tuber viroid-specific small RNAs is accompanied by specific changes in tomato gene expression

    USDA-ARS?s Scientific Manuscript database

    Post-transcriptional gene silencing appears to play a key role in viroid pathogenicity. To better understand the biogenesis of viroid-specific small RNAs and their possible role in disease induction, we have examined the accumulation of these small RNAs in the leaves and stems of potato spindle tub...

  20. Phenotypes, antioxidant responses, and gene expression changes accompanying a sugar-only diet in Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    PubMed

    Chen, Er-Hu; Hou, Qiu-Li; Wei, Dan-Dan; Jiang, Hong-Bo; Wang, Jin-Jun

    2017-08-17

    Diet composition (yeast:carbohydrate ratio) is an important determinant of growth, development, and reproduction. Recent studies have shown that decreased yeast intake elicits numerous transcriptomic changes and enhances somatic maintenance and lifespan, which in turn reduces reproduction in various insects. However, our understanding of the responses leading to a decrease in yeast ratio to 0% is limited. In the present study, we investigated the effects of a sugar-only diet (SD) on the gene expression patterns of the oriental fruit fly, Bactrocera dorsalis (Hendel), one of the most economically important pests in the family Tephritidae. RNA sequencing analyses showed that flies reared on an SD induced significant changes in the expression levels of genes associated with specific metabolic as well as cell growth and death pathways. Moreover, the observed upregulated genes in energy production and downregulated genes associated with reproduction suggested that SD affects somatic maintenance and reproduction in B. dorsalis. As expected, we observed that SD altered B. dorsalis phenotypes by significantly increasing stress (starvation and desiccation) resistance, decreasing reproduction, but did not extend lifespan compared to those that received a normal diet (ND) regime. In addition, administration of an SD resulted in a reduction in antioxidant enzyme activities and an increase in MDA concentrations, thereby suggesting that antioxidants cannot keep up with the increase in oxidative damage induced by SD regime. The application of an SD diet induces changes in phenotypes, antioxidant responses, and gene expressions in B. dorsalis. Previous studies have associated extended lifespan with reduced fecundity. The current study did not observe a prolongation of lifespan in B. dorsalis, which instead incurred oxidative damage. The findings of the present study improve our understanding of the molecular, biochemical, and phenotypic response of B. dorsalis to an SD diet.

  1. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  2. Identifying gene regulatory network rewiring using latent differential graphical models

    PubMed Central

    Tian, Dechao; Gu, Quanquan; Ma, Jian

    2016-01-01

    Gene regulatory networks (GRNs) are highly dynamic among different tissue types. Identifying tissue-specific gene regulation is critically important to understand gene function in a particular cellular context. Graphical models have been used to estimate GRN from gene expression data to distinguish direct interactions from indirect associations. However, most existing methods estimate GRN for a specific cell/tissue type or in a tissue-naive way, or do not specifically focus on network rewiring between different tissues. Here, we describe a new method called Latent Differential Graphical Model (LDGM). The motivation of our method is to estimate the differential network between two tissue types directly without inferring the network for individual tissues, which has the advantage of utilizing much smaller sample size to achieve reliable differential network estimation. Our simulation results demonstrated that LDGM consistently outperforms other Gaussian graphical model based methods. We further evaluated LDGM by applying to the brain and blood gene expression data from the GTEx consortium. We also applied LDGM to identify network rewiring between cancer subtypes using the TCGA breast cancer samples. Our results suggest that LDGM is an effective method to infer differential network using high-throughput gene expression data to identify GRN dynamics among different cellular conditions. PMID:27378774

  3. Bioluminescence imaging of c-fos gene expression accompanying filial imprinting in the newly hatched chick brain.

    PubMed

    Yamaguchi, Shinji; Iikubo, Eiji; Hirose, Naoki; Kitajima, Takaaki; Katagiri, Sachiko; Kawamori, Ai; Fujii-Taira, Ikuko; Matsushima, Toshiya; Homma, Koichi J

    2010-06-01

    Bioluminescence imaging is a powerful tool for examining gene expression in living animals. Previously, we reported that exogenous DNA could be successfully delivered into neurons in the newly hatched chick brain using electroporation. Here, we show the in vivo bioluminescence imaging of c-fos promoter activity and its upregulation, which is associated with filial imprinting. The upregulation of c-fos gene expression correlated with both the strength of the chicks' approach activity to the training object and the acquisition of memory. The present technique should be a powerful tool for analyzing the time changes in neural activity of certain brain areas in real-time during memory formation, using brains of living animals.

  4. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.

    PubMed

    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata

    2015-04-01

    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  5. Microarray analysis reveals differential gene expression in hybrid sunflower species

    PubMed Central

    LAI, ZHAO; GROSS, BRIANA L.; YIZOU; ANDREWS, JUSTEN; RIESEBERG, LOREN H.

    2008-01-01

    This paper describes the creation of a cDNA microarray for annual sunflowers and its use to elucidate patterns of gene expression in Helianthus annuus, Helianthus petiolaris, and the homoploid hybrid species Helianthus deserticola. The array comprises 3743 ESTs (expressed sequence tags) representing approximately 2897 unique genes. It has an average clone/EST identity rate of 91%, is applicable across species boundaries within the annual sunflowers, and shows patterns of gene expression that are highly reproducible according to real-time RT–PCR (reverse transcription–polymerase chain reaction) results. Overall, 12.8% of genes on the array showed statistically significant differential expression across the three species. Helianthus deserticola displayed transgressive, or extreme, expression for 58 genes, with roughly equal numbers exhibiting up- or down-regulation relative to both parental species. Transport-related proteins were strongly over-represented among the transgressively expressed genes, which makes functional sense given the extreme desert floor habitat of H. deserticola. The potential adaptive value of differential gene expression was evaluated for five genes in two populations of early generation (BC2) hybrids between the parental species grown in the H. deserticola habitat. One gene (a G protein-coupled receptor) had a significant association with fitness and maps close to a QTL controlling traits that may be adaptive in the desert habitat. PMID:16626449

  6. Dynamic Gene Regulatory Networks of Human Myeloid Differentiation.

    PubMed

    Ramirez, Ricardo N; El-Ali, Nicole C; Mager, Mikayla Anne; Wyman, Dana; Conesa, Ana; Mortazavi, Ali

    2017-03-27

    The reconstruction of gene regulatory networks underlying cell differentiation from high-throughput gene expression and chromatin data remains a challenge. Here, we derive dynamic gene regulatory networks for human myeloid differentiation using a 5-day time series of RNA-seq and ATAC-seq data. We profile HL-60 promyelocytes differentiating into macrophages, neutrophils, monocytes, and monocyte-derived macrophages. We find a rapid response in the expression of key transcription factors and lineage markers that only regulate a subset of their targets at a given time, which is followed by chromatin accessibility changes that occur later along with further gene expression changes. We observe differences between promyelocyte- and monocyte-derived macrophages at both the transcriptional and chromatin landscape level, despite using the same differentiation stimulus, which suggest that the path taken by cells in the differentiation landscape defines their end cell state. More generally, our approach of combining neighboring time points and replicates to achieve greater sequencing depth can efficiently infer footprint-based regulatory networks from long series data.

  7. Intermediate filament genes as differentiation markers in the leech Helobdella.

    PubMed

    Kuo, Dian-Han; Weisblat, David A

    2011-10-01

    The intermediate filament (IF) cytoskeleton is a general feature of differentiated cells. Its molecular components, IF proteins, constitute a large family including the evolutionarily conserved nuclear lamins and the more diverse collection of cytoplasmic intermediate filament (CIF) proteins. In vertebrates, genes encoding CIFs exhibit cell/tissue type-specific expression profiles and are thus useful as differentiation markers. The expression of invertebrate CIFs, however, is not well documented. Here, we report a whole-genome survey of IF genes and their developmental expression patterns in the leech Helobdella, a lophotrochozoan model for developmental biology research. We found that, as in vertebrates, each of the leech CIF genes is expressed in a specific set of cell/tissue types. This allows us to detect earliest points of differentiation for multiple cell types in leech development and to use CIFs as molecular markers for studying cell fate specification in leech embryos. In addition, to determine the feasibility of using CIFs as universal metazoan differentiation markers, we examined phylogenetic relationships of IF genes from various species. Our results suggest that CIFs, and thus their cell/tissue-specific expression patterns, have expanded several times independently during metazoan evolution. Moreover, comparing the expression patterns of CIF orthologs between two leech species suggests that rapid evolutionary changes in the cell or tissue specificity of CIFs have occurred among leeches. Hence, CIFs are not suitable for identifying cell or tissue homology except among very closely related species, but they are nevertheless useful species-specific differentiation markers.

  8. Endosymbiotic origin and differential loss of eukaryotic genes.

    PubMed

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Sousa, Filipa L; Lockhart, Peter J; Bryant, David; Hazkani-Covo, Einat; McInerney, James O; Landan, Giddy; Martin, William F

    2015-08-27

    Chloroplasts arose from cyanobacteria, mitochondria arose from proteobacteria. Both organelles have conserved their prokaryotic biochemistry, but their genomes are reduced, and most organelle proteins are encoded in the nucleus. Endosymbiotic theory posits that bacterial genes in eukaryotic genomes entered the eukaryotic lineage via organelle ancestors. It predicts episodic influx of prokaryotic genes into the eukaryotic lineage, with acquisition corresponding to endosymbiotic events. Eukaryotic genome sequences, however, increasingly implicate lateral gene transfer, both from prokaryotes to eukaryotes and among eukaryotes, as a source of gene content variation in eukaryotic genomes, which predicts continuous, lineage-specific acquisition of prokaryotic genes in divergent eukaryotic groups. Here we discriminate between these two alternatives by clustering and phylogenetic analysis of eukaryotic gene families having prokaryotic homologues. Our results indicate (1) that gene transfer from bacteria to eukaryotes is episodic, as revealed by gene distributions, and coincides with major evolutionary transitions at the origin of chloroplasts and mitochondria; (2) that gene inheritance in eukaryotes is vertical, as revealed by extensive topological comparison, sparse gene distributions stemming from differential loss; and (3) that continuous, lineage-specific lateral gene transfer, although it sometimes occurs, does not contribute to long-term gene content evolution in eukaryotic genomes.

  9. Elevated expression of proto-oncogenes accompany enhanced induction of heat-shock genes after exposure of rat embryos in utero to ionizing irradiation

    SciTech Connect

    Higo, H.; Lee, J.Y.; Satow, Y.; Higo, K. )

    1989-01-01

    We have recently found that the effects of exposing rat embryos in utero to teratogens capable of producing cardiac anomalies were expressed later as enhanced induction of heat-shock proteins (hsp70 family) when embryonic hearts were cultured in vitro. However, it remained to be determined whether heat-shock proteins are induced in vivo after exposure to teratogens. The heat-shock response in some mammalian systems is known to be accompanied by elevated expression of proto-oncogenes. Using gene-specific DNA probes, we examined the levels of the expression (transcription) of heat-shock protein genes and two nuclear proto-oncogenes, c-fos and c-myc, in the embryos removed from irradiated pregnant mother rats 4 or 5 days after the irradiation. We found that the levels of expression in vivo of the hsp70 and c-myc genes in the irradiated embryos increased by approximately twofold as compared with those in the control. The expression in vivo of the c-fos gene was not detected in either the irradiated or non-irradiated embryos. After 0.5-hr incubation in vitro of the embryos, however, the expression of the c-fos gene in the irradiated embryos was highly enhanced whereas the control showed no changes. Although the exact functions of these gene products still remain obscure, the enhanced expression of hsp70 gene(s) and the nuclear proto-oncogenes observed in the present study may reflect repair of intracellular damages and/or regeneration of tissue by compensatory cell proliferation, processes that may disturb the normal program of organogenesis.

  10. Phenotypic plasticity, trade-offs and gene expression changes accompanying dietary restriction and switches in Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    PubMed

    Chen, Er-Hu; Hou, Qiu-Li; Wei, Dan-Dan; Jiang, Hong-Bo; Wang, Jin-Jun

    2017-05-16

    In this study, we investigated the effects of dietary restriction (DR) and variable diets on phenotypes and gene expression in oriental fruit fly, Bactrocera dorsalis (Hendel), one of the most economically important pests in the family Tephritidae around the world. As expected, we found that DR altered the B. dorsalis phenotypes by significantly increasing stress resistance and lifespan, but reduced egg production when compared with the control diet. The results suggested a trade-off between reproduction versus somatic maintenance (stress resistance) and lifespan in B. dorsalis. Diet also had a significant effect on hatchability, and DR could increase the egg hatching success of B. dorsalis. Furthermore, DR up-regulated metabolic pathways involved in energy homeostasis and down-regulated pathways in egg production, which might mediate trade-offs between somatic maintenance and reproduction under DR regimes. The gene expression profiles in response to the acute dietary switches indicated that the digestive and metabolic pathways maybe involved in the adaptability of flies to variable dietary resources. In summary, the research facilitates a better understanding of the molecular mechanisms responsible for the B. dorsalis' phenotypic adjustments to the different qualities of the available diets.

  11. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  12. A study of genes involved in adipocyte differentiation.

    PubMed

    Zhu, Shunming; Cheng, Gong; Zhu, Huolan; Guan, Gongchang

    2015-01-01

    With the use of the microarray technique, genes expressed in the late phase of adipocyte differentiation were investigated. These genes play an important role in stimulating adipocyte growth and lipid droplet formation. Therefore, they contribute a great deal to the onset of obesity. With the use of SW872 adipocytes and the microarray technique, genes related to adipocyte differentiation were tested and compared with undifferentiated preadipocytes 14 days after induction. Real-time reverse transcription polymerase chain reaction (RT-PCR) was used for confirmation. More than 21,329 transcriptors were expressed and determined, of which 1326 increased and 687 decreased undifferentiated adipocytes. Among them, 21 were highly expressed by more than 10-fold. With RT-PCR, 12 were confirmed, including apelin, CIDEC, PID1, LYRM1, ADD1, PPARγ2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Furthermore, genes involved in lipid metabolism, signal transduction, DNA replication, redox status and transcription factors were determined as well. Novel genes involved in adipogenesis (e.g., apelin) were detected. A variety of genes were discovered and validated with RT-PCR at the late phase of adipocyte differentiation. This may help us better understand the onset of obesity and the potential role of adipocytes in other organs.

  13. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  14. Differential methylation of imprinted genes in growth-restricted placentas.

    PubMed

    Lambertini, Luca; Lee, Tin-Lap; Chan, Wai-Yee; Lee, Men-Jean; Diplas, Andreas; Wetmur, James; Chen, Jia

    2011-11-01

    A complex network of epigenetic factors participates in regulating the monoallelic expression of a small subset of genes (~1%) in the human genome. This phenomenon goes under the definition of genomic imprinting, a parent-of-origin effect that, when altered during early embryogenesis, may influence fetal development into adulthood. Pertubations in genomic imprinting have been associated with placental and fetal growth restrictions. We analyzed the differential DNA methylation of all known imprinted genes on 10 appropriate-for-gestational-age, clinically normal, placentas and 7 severe intrauterine growth-restricted placentas. Samples were pooled according to the diagnosis and analyzed by methylated DNA immunoprecipitation (MeDIP) on a tiling microarray platform. The distribution of the differentially methylated regions (DMRs) identified in growth-restricted placentas showed a slight tendency toward hypermethylation. Imprinted genes not expressed in placenta showed a unique DMR profile with the fewest hyper- and hypomethylated DMRs. Promoter and CpG island DMRs were sporadic and randomly distributed. The vast majority of DMR identified (~99%) were mapped in introns, showing no common sequence features. Also, by using the more advanced array data mining softwares, no significant patterns emerged. In contrast, differential methylation showed a highly significant correlation with gene length. Overall these data suggest that differential methylation changes in growth-restricted placentas occur throughout the genomic regions, encompassing genes actively expressed in the placenta. These findings warrant caution in interpreting the significance of genes carrying clustered DMRs because the distribution of DMRs in a gene may be attributed as a function of its length rather than as a specific biological role.

  15. The gene road to royalty--differential expression of hydroxylating genes in the mandibular glands of the honeybee.

    PubMed

    Malka, Osnat; Karunker, Iris; Yeheskel, Adva; Morin, Shai; Hefetz, Abraham

    2009-10-01

    The advances in honeybee sociogenomics have paved the way for the study of social communication processes at the gene level, in particular the expression of caste-specific pheromones. The queen honeybee mandibular pheromone provides an excellent model system, in that biosynthesis of the hydroxylating fatty acid caste-specific pheromone appears to be reduced to a single chemical hydroxylation step of stearic acid. Queens are typified by omega-1-hydroxylation, as opposed to the worker-typical omega-hydroxylation. We hypothesized that this bifurcation is the consequence of differential expression of caste-specific genes that code for fatty acid-hydroxylating enzymes from the cytochrome P450 (CYP) family. Bioinformatics studies disclosed two candidate proteins CYP4AA1 and CYP18A1. We thus investigated the expression of these genes in the mandibular glands of queens, and of queenright (QR) and queenless (QL) workers. The real-time PCR results revealed that CYP4AA1 (omega-hydroxylation) was expressed at high levels in both QR and QL workers, whereas in queens its expression was negligible. The expression of CYP18A1 (omega-1-hydroxylation), on the other hand, was high in the queen's glands and negligible in those of QR workers. In QL workers, however, the expression of CYP18A1 was considerably elevated and significantly greater than in QR workers. Three-dimensional structural models constructed for these enzymes demonstrate differences in the active site between CYP18A1 and CYP4AA1, in line with their differential catalytic specificity. The fact that queen pheromone plasticity can be tracked all the way to gene expression provides a new insight into the process of caste differentiation and the accompanying social communication.

  16. Ezh1 and Ezh2 differentially regulate PSD-95 gene transcription in developing hippocampal neurons.

    PubMed

    Henriquez, Berta; Bustos, Fernando J; Aguilar, Rodrigo; Becerra, Alvaro; Simon, Felipe; Montecino, Martin; van Zundert, Brigitte

    2013-11-01

    Polycomb Repressive Complex 2 (PRC2) mediates transcriptional silencing by catalyzing histone H3 lysine 27 trimethylation (H3K27me3), but its role in the maturation of postmitotic mammalian neurons remains largely unknown. We report that the PRC2 paralogs Ezh1 and Ezh2 are differentially expressed during hippocampal development. We show that depletion of Ezh2 leads to increased expression of PSD-95, a critical plasticity gene, and that reduced PSD-95 gene transcription is correlated with enrichment of Ezh2 at the PSD-95 gene promoter; however, the H3K27me3 epigenetic mark is not present at the PSD-95 gene promoter, likely due to the antagonizing effects of the H3S28P and H3K27Ac marks and the activity of the H3K27 demethylases JMJD3 and UTX. In contrast, increased PSD-95 gene transcription is accompanied by the presence of Ezh1 and elongation-engaged RNA Polymerase II complexes at the PSD-95 gene promoter, while knock-down of Ezh1 reduces PSD-95 transcription. These results indicate that Ezh1 and Ezh2 have antagonistic roles in regulating PSD-95 transcription. © 2013.

  17. Meta-analysis of differentially expressed genes in ankylosing spondylitis.

    PubMed

    Lee, Y H; Song, G G

    2015-05-18

    The purpose of this study was to identify differentially expressed (DE) genes and biological processes associated with changes in gene expression in ankylosing spondylitis (AS). We performed a meta-analysis using the integrative meta-analysis of expression data program on publicly available microarray AS Gene Expression Omnibus (GEO) datasets. We performed Gene Ontology (GO) enrichment analyses and pathway analysis using the Kyoto Encyclopedia of Genes and Genomes. Four GEO datasets, including 31 patients with AS and 39 controls, were available for the meta-analysis. We identified 65 genes across the studies that were consistently DE in patients with AS vs controls (23 upregulated and 42 downregulated). The upregulated gene with the largest effect size (ES; -1.2628, P = 0.020951) was integral membrane protein 2A (ITM2A), which is expressed by CD4+ T cells and plays a role in activation of T cells. The downregulated gene with the largest ES (1.2299, P = 0.040075) was mitochondrial ribosomal protein S11 (MRPS11). The most significant GO enrichment was in the respiratory electron transport chain category (P = 1.67 x 10-9). Therefore, our meta-analysis identified genes that were consistently DE as well as biological pathways associated with gene expression changes in AS.

  18. Increased expression of prion protein gene is accompanied by demethylation of CpG sites in a mouse embryonal carcinoma cell line, P19C6

    PubMed Central

    DALAI, Wuyun; MATSUO, Eiko; TAKEYAMA, Natsumi; KAWANO, Junichi; SAEKI, Keiichi

    2017-01-01

    Elucidation of the processes regulating the prion protein gene (Prnp) is an important key to understanding the development of prion disorders. In this study, we explored the involvement of DNA methylation in Prnp transcriptional regulation during neuronal differentiation of embryonic carcinoma P19C6 cells. When P19C6 cells were differentiated into neuronal cells, the expression of Prnp was markedly increased, while CpG methylation was significantly demethylated at the nucleotide region between −599 and −238 from the transcription start site. In addition, when P19C6 cells were applied in a DNA methyltransferase inhibitor, RG108, Prnp transcripts were also significantly increased in relation to the decreased methylation statuses. These findings helped to elucidate the DNA methylation-mediated regulation of Prnp expression during neuronal differentiation. PMID:28132962

  19. LSOSS: Detection of Cancer Outlier Differential Gene Expression.

    PubMed

    Wang, Yupeng; Rekaya, Romdhane

    2010-08-05

    Detection of differential gene expression using microarray technology has received considerable interest in cancer research studies. Recently, many researchers discovered that oncogenes may be activated in some but not all samples in a given disease group. The existing statistical tools for detecting differentially expressed genes in a subset of the disease group mainly include cancer outlier profile analysis (COPA), outlier sum (OS), outlier robust t-statistic (ORT) and maximum ordered subset t-statistics (MOST). In this study, another approach named Least Sum of Ordered Subset Square t-statistic (LSOSS) is proposed. The results of our simulation studies indicated that LSOSS often has more power than previous statistical methods. When applied to real human breast and prostate cancer data sets, LSOSS was competitive in terms of the biological relevance of top ranked genes. Furthermore, a modified hierarchical clustering method was developed to classify the heterogeneous gene activation patterns of human breast cancer samples based on the significant genes detected by LSOSS. Three classes of gene activation patterns, which correspond to estrogen receptor (ER)+, ER- and a mixture of ER+ and ER-, were detected and each class was assigned a different gene signature.

  20. Graded Dorsal and Differential Gene Regulation in the Drosophila Embryo

    PubMed Central

    Reeves, Gregory T.; Stathopoulos, Angelike

    2009-01-01

    A gradient of Dorsal activity patterns the dorsoventral (DV) axis of the early Drosophila melanogaster embryo by controlling the expression of genes that delineate presumptive mesoderm, neuroectoderm, and dorsal ectoderm. The availability of the Drosophila melanogaster genome sequence has accelerated the study of embryonic DV patterning, enabling the use of systems-level approaches. As a result, our understanding of Dorsal-dependent gene regulation has expanded to encompass a collection of more than 50 genes and 30 cis-regulatory sequences. This information, which has been integrated into a spatiotemporal atlas of gene regulatory interactions, comprises one of the best-understood networks controlling any developmental process to date. In this article, we focus on how Dorsal controls differential gene expression and how recent studies have expanded our understanding of Drosophila embryonic development from the cis-regulatory level to that controlling morphogenesis of the embryo. PMID:20066095

  1. Differential methylation of genes and repeats in land plants.

    PubMed

    Rabinowicz, Pablo D; Citek, Robert; Budiman, Muhammad A; Nunberg, Andrew; Bedell, Joseph A; Lakey, Nathan; O'Shaughnessy, Andrew L; Nascimento, Lidia U; McCombie, W Richard; Martienssen, Robert A

    2005-10-01

    The hypomethylated fraction of plant genomes is usually enriched in genes and can be selectively cloned using methylation filtration (MF). Therefore, MF has been used as a gene enrichment technology in sorghum and maize, where gene enrichment was proportional to genome size. Here we apply MF to a broad variety of plant species spanning a wide range of genome sizes. Differential methylation of genic and non-genic sequences was observed in all species tested, from non-vascular to vascular plants, but in some cases, such as wheat and pine, a lower than expected level of enrichment was observed. Remarkably, hexaploid wheat and pine show a dramatically large number of gene-like sequences relative to other plants. In hexaploid wheat, this apparent excess of genes may reflect an abundance of methylated pseudogenes, which may thus be more prevalent in recent polyploids.

  2. Effects of HOX homeobox genes in blood cell differentiation.

    PubMed

    Magli, M C; Largman, C; Lawrence, H J

    1997-11-01

    The burgeoning number of articles concerning the role of HOX genes and hematopoiesis ensures that this will continue to be an area of very active research. It seems clear that HOX genes are expressed in stage- and lineage-specific patterns during early stages of hematopoietic development and differentiation. Several lines of evidence suggest that multiple genes of the HOXB (B2, B4, B6-B9), HOXC (C6, C8), and HOXA (A5) are involved in erythropoiesis. Similarly, a number of genes of the HOXA, HOXB, and HOXC appear to play a role in lymphoid cells. Furthermore, several genes, such as A9, A10, B3, B7, and B8, may control myelomonocytic differentiation. The question arises as to whether such a multiplicity of HOX genes reflects redundancy or indicates subtlety of the regulatory machinary. A similar complexity has been observed for hematopoietic cytokines, and the current view is that, although multiple molecules may have similar or overlapping effects, each factor has a specific function and regulatory combinations appear to play a critical role in controlling hematopoietic cell processes (99). One challenge for the future is to delineate in more detail the precise expression patterns of these genes in the many distinct subpopulations of blood cells and during fetal development. Overexpression of HOX genes in hematopoietic cells can dramatically perturb the differentiation of various cell lineages and can contribute to leukemogenesis. Future studies may involve the overexpression of alternatively spliced versions of different HOX genes or of truncated versions of HOX genes to ascertain the functional domains of the proteins that mediate the biologic effects. The findings in HOX knockout mice confirm a role for these genes in normal blood cell development. Further work in this area will require careful examination of fetal hematopoiesis and of animals bearing multiple HOX gene knockouts. Involvement of HOX genes in leukemia is just beginning to be appreciated

  3. Dynamic Gene Regulatory Networks Drive Hematopoietic Specification and Differentiation

    PubMed Central

    Goode, Debbie K.; Obier, Nadine; Vijayabaskar, M.S.; Lie-A-Ling, Michael; Lilly, Andrew J.; Hannah, Rebecca; Lichtinger, Monika; Batta, Kiran; Florkowska, Magdalena; Patel, Rahima; Challinor, Mairi; Wallace, Kirstie; Gilmour, Jane; Assi, Salam A.; Cauchy, Pierre; Hoogenkamp, Maarten; Westhead, David R.; Lacaud, Georges; Kouskoff, Valerie; Göttgens, Berthold; Bonifer, Constanze

    2016-01-01

    Summary Metazoan development involves the successive activation and silencing of specific gene expression programs and is driven by tissue-specific transcription factors programming the chromatin landscape. To understand how this process executes an entire developmental pathway, we generated global gene expression, chromatin accessibility, histone modification, and transcription factor binding data from purified embryonic stem cell-derived cells representing six sequential stages of hematopoietic specification and differentiation. Our data reveal the nature of regulatory elements driving differential gene expression and inform how transcription factor binding impacts on promoter activity. We present a dynamic core regulatory network model for hematopoietic specification and demonstrate its utility for the design of reprogramming experiments. Functional studies motivated by our genome-wide data uncovered a stage-specific role for TEAD/YAP factors in mammalian hematopoietic specification. Our study presents a powerful resource for studying hematopoiesis and demonstrates how such data advance our understanding of mammalian development. PMID:26923725

  4. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  5. Epigenetic control of skin differentiation genes by phytocannabinoids

    PubMed Central

    Pucci, Mariangela; Rapino, Cinzia; Di Francesco, Andrea; Dainese, Enrico; D'Addario, Claudio; Maccarrone, Mauro

    2013-01-01

    BACKGROUND AND PURPOSE Endocannabinoid signalling has been shown to have a role in the control of epidermal physiology, whereby anandamide is able to regulate the expression of skin differentiation genes through DNA methylation. Here, we investigated the possible epigenetic regulation of these genes by several phytocannabinoids, plant-derived cannabinoids that have the potential to be novel therapeutics for various human diseases. EXPERIMENTAL APPROACH The effects of cannabidiol, cannabigerol and cannabidivarin on the expression of skin differentiation genes keratins 1 and 10, involucrin and transglutaminase 5, as well as on DNA methylation of keratin 10 gene, were investigated in human keratinocytes (HaCaT cells). The effects of these phytocannabinoids on global DNA methylation and the activity and expression of four major DNA methyltransferases (DNMT1, 3a, 3b and 3L) were also examined. KEY RESULTS Cannabidiol and cannabigerol significantly reduced the expression of all the genes tested in differentiated HaCaT cells, by increasing DNA methylation of keratin 10 gene, but cannabidivarin was ineffective. Remarkably, cannabidiol reduced keratin 10 mRNA through a type-1 cannabinoid (CB1) receptor-dependent mechanism, whereas cannabigerol did not affect either CB1 or CB2 receptors of HaCaT cells. In addition, cannabidiol, but not cannabigerol, increased global DNA methylation levels by selectively enhancing DNMT1 expression, without affecting DNMT 3a, 3b or 3L. CONCLUSIONS AND IMPLICATIONS These findings show that the phytocannabinoids cannabidiol and cannabigerol are transcriptional repressors that can control cell proliferation and differentiation. This indicates that they (especially cannabidiol) have the potential to be lead compounds for the development of novel therapeutics for skin diseases. PMID:23869687

  6. Epigenetic control of skin differentiation genes by phytocannabinoids.

    PubMed

    Pucci, Mariangela; Rapino, Cinzia; Di Francesco, Andrea; Dainese, Enrico; D'Addario, Claudio; Maccarrone, Mauro

    2013-10-01

    Endocannabinoid signalling has been shown to have a role in the control of epidermal physiology, whereby anandamide is able to regulate the expression of skin differentiation genes through DNA methylation. Here, we investigated the possible epigenetic regulation of these genes by several phytocannabinoids, plant-derived cannabinoids that have the potential to be novel therapeutics for various human diseases. The effects of cannabidiol, cannabigerol and cannabidivarin on the expression of skin differentiation genes keratins 1 and 10, involucrin and transglutaminase 5, as well as on DNA methylation of keratin 10 gene, were investigated in human keratinocytes (HaCaT cells). The effects of these phytocannabinoids on global DNA methylation and the activity and expression of four major DNA methyltransferases (DNMT1, 3a, 3b and 3L) were also examined. Cannabidiol and cannabigerol significantly reduced the expression of all the genes tested in differentiated HaCaT cells, by increasing DNA methylation of keratin 10 gene, but cannabidivarin was ineffective. Remarkably, cannabidiol reduced keratin 10 mRNA through a type-1 cannabinoid (CB1 ) receptor-dependent mechanism, whereas cannabigerol did not affect either CB1 or CB2 receptors of HaCaT cells. In addition, cannabidiol, but not cannabigerol, increased global DNA methylation levels by selectively enhancing DNMT1 expression, without affecting DNMT 3a, 3b or 3L. These findings show that the phytocannabinoids cannabidiol and cannabigerol are transcriptional repressors that can control cell proliferation and differentiation. This indicates that they (especially cannabidiol) have the potential to be lead compounds for the development of novel therapeutics for skin diseases. © 2013 The British Pharmacological Society.

  7. Differential expression of genes identified by suppression subtractive hybridization in petals of opening carnation flowers.

    PubMed

    Harada, Taro; Torii, Yuka; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru

    2010-05-01

    Flower opening is an event accompanied by morphological changes in petals which include elongation, expansion, and outward-curving. Petal cell growth is a fundamental process that underlies such phenomena, but its molecular mechanism remains largely unknown. Suppression subtractive hybridization was performed between petals during the early elongation period (stage 1) and during the opening period (stage 5) in carnation flowers and a pair of subtraction libraries abundant in differentially expressed genes was constructed at each stage. 393 cDNA clones picked up by differential screening out of 1728 clones were sequenced and 235 different cDNA fragments were identified, among which 211 did not match any known nucleotide sequence of carnation genes in the databases. BLASTX search of nucleotide sequences revealed that putative functions of the translational products can be classified into several categories including transcription, signalling, cell wall modification, lipid metabolism, and transport. Open reading frames of 15 selected genes were successfully determined by rapid amplification of cDNA ends (RACE). Time-course analysis of these genes by real-time RT-PCR showed that transcript levels of several genes correlatively fluctuate in petals of opening carnation flowers, suggesting an association with the morphological changes by elongation or curving. Based on the results, it is suggested that the growth of carnation petals is controlled by co-ordinated gene expression during the progress of flower opening. In addition, the possible roles of some key genes in the initiation of cell growth, the construction of the cell wall and cuticle, and transport across membranes were discussed.

  8. Differential Gene Retention in Plastids of Common Recent Origin

    PubMed Central

    Reyes-Prieto, Adrian; Yoon, Hwan Su; Moustafa, Ahmed; Yang, Eun Chan; Andersen, Robert A.; Boo, Sung Min; Nakayama, Takuro; Ishida, Ken-ichiro; Bhattacharya, Debashish

    2010-01-01

    The cyanobacterium-derived plastids of algae and plants have supported the diversification of much of extant eukaryotic life. Inferences about early events in plastid evolution must rely on reconstructing events that occurred over a billion years ago. In contrast, the photosynthetic amoeba Paulinella chromatophora provides an exceptional model to study organelle evolution in a prokaryote–eukaryote (primary) endosymbiosis that occurred approximately 60 mya. Here we sequenced the plastid genome (0.977 Mb) from the recently described Paulinella FK01 and compared the sequence with the existing data from the sister taxon Paulinella M0880/a. Alignment of the two plastid genomes shows significant conservation of gene order and only a handful of minor gene rearrangements. Analysis of gene content reveals 66 differential gene losses that appear to be outright gene deletions rather than endosymbiotic gene transfers to the host nuclear genome. Phylogenomic analysis validates the plastid ancestor as a member of the Synechococcus–Prochlorococcus group, and the cyanobacterial provenance of all plastid genes suggests that these organelles were not targets of interphylum gene transfers after endosymbiosis. Inspection of 681 DNA alignments of protein-encoding genes shows that the vast majority have dN/dS ratios <<1, providing evidence for purifying selection. Our study demonstrates that plastid genomes in sister taxa are strongly constrained by selection but follow distinct trajectories during the earlier phases of organelle evolution. PMID:20123796

  9. Age-related changes in cerebellar and hypothalamic function accompany non-microglial immune gene expression, altered synapse organization, and excitatory amino acid neurotransmission deficits

    PubMed Central

    Bonasera, Stephen J.; Arikkath, Jyothi; Boska, Michael D.; Chaudoin, Tammy R.; DeKorver, Nicholas W.; Goulding, Evan H.; Hoke, Traci A.; Mojtahedzedah, Vahid; Reyelts, Crystal D.; Sajja, Balasrinivasa; Schenk, A. Katrin; Tecott, Laurence H.; Volden, Tiffany A.

    2016-01-01

    We describe age-related molecular and neuronal changes that disrupt mobility or energy balance based on brain region and genetic background. Compared to young mice, aged C57BL/6 mice exhibit marked locomotor (but not energy balance) impairments. In contrast, aged BALB mice exhibit marked energy balance (but not locomotor) impairments. Age-related changes in cerebellar or hypothalamic gene expression accompany these phenotypes. Aging evokes upregulation of immune pattern recognition receptors and cell adhesion molecules. However, these changes do not localize to microglia, the major CNS immunocyte. Consistent with a neuronal role, there is a marked age-related increase in excitatory synapses over the cerebellum and hypothalamus. Functional imaging of these regions is consistent with age-related synaptic impairments. These studies suggest that aging reactivates a developmental program employed during embryogenesis where immune molecules guide synapse formation and pruning. Renewed activity in this program may disrupt excitatory neurotransmission, causing significant behavioral deficits. PMID:27689748

  10. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  11. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  12. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo

    2009-01-01

    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  13. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  14. Gene Sets Net Correlations Analysis (GSNCA): a multivariate differential coexpression test for gene sets

    PubMed Central

    Rahmatallah, Yasir; Emmert-Streib, Frank; Glazko, Galina

    2014-01-01

    Motivation: To date, gene set analysis approaches primarily focus on identifying differentially expressed gene sets (pathways). Methods for identifying differentially coexpressed pathways also exist but are mostly based on aggregated pairwise correlations or other pairwise measures of coexpression. Instead, we propose Gene Sets Net Correlations Analysis (GSNCA), a multivariate differential coexpression test that accounts for the complete correlation structure between genes. Results: In GSNCA, weight factors are assigned to genes in proportion to the genes’ cross-correlations (intergene correlations). The problem of finding the weight vectors is formulated as an eigenvector problem with a unique solution. GSNCA tests the null hypothesis that for a gene set there is no difference in the weight vectors of the genes between two conditions. In simulation studies and the analyses of experimental data, we demonstrate that GSNCA captures changes in the structure of genes’ cross-correlations rather than differences in the averaged pairwise correlations. Thus, GSNCA infers differences in coexpression networks, however, bypassing method-dependent steps of network inference. As an additional result from GSNCA, we define hub genes as genes with the largest weights and show that these genes correspond frequently to major and specific pathway regulators, as well as to genes that are most affected by the biological difference between two conditions. In summary, GSNCA is a new approach for the analysis of differentially coexpressed pathways that also evaluates the importance of the genes in the pathways, thus providing unique information that may result in the generation of novel biological hypotheses. Availability and implementation: Implementation of the GSNCA test in R is available upon request from the authors. Contact: YRahmatallah@uams.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24292935

  15. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  16. Differential Gene Expression in HIV-Infected Individuals Following ART

    PubMed Central

    Massanella, Marta; Singhania, Akul; Beliakova-Bethell, Nadejda; Pier, Rose; Lada, Steven; White, Cory H.; Pérez-Santiago, Josué; Blanco, Julià; Richman, Douglas D.; Little, Susan J.; Woelk, Christopher H.

    2013-01-01

    Previous studies of the effect of ART on gene expression in HIV-infected individuals have identified small numbers of modulated genes. Since these studies were underpowered or cross-sectional in design, a paired analysis of peripheral blood mononuclear cells (PBMCs), isolated before and after ART, from a robust number of HIV-infected patients (N=32) was performed. Gene expression was assayed by microarray and 4,157 differentially expressed genes (DEGs) were identified following ART using multivariate permutation tests. Pathways and Gene Ontology (GO) terms over-represented for DEGs reflected the transition from a period of active virus replication before ART to one of viral suppression (e.g., repression of JAK-STAT signaling) and possible prolonged drug exposure (e.g. oxidative phosphorylation pathway) following ART. CMYC was the DEG whose product made the greatest number of interactions at the protein level in protein interaction networks (PINs), which has implications for the increased incidence of Hodgkin’s lymphoma (HL) in HIV-infected patients. The differential expression of multiple genes was confirmed by RT-qPCR including well-known drug metabolism genes (e.g., ALOX12 and CYP2S1). Targets not confirmed by RT-qPCR (i.e., GSTM2 and RPL5) were significantly confirmed by droplet digital (ddPCR), which may represent a superior method when confirming DEGs with low fold changes. In conclusion, a paired design revealed that the number of genes modulated following ART was an order of magnitude higher than previously recognized. PMID:23933117

  17. Key Role of the Cdx2 Homeobox Gene in Extracellular Matrix–mediated Intestinal Cell Differentiation

    PubMed Central

    Lorentz, Olivier; Duluc, Isabelle; Arcangelis, Adèle De; Simon-Assmann, Patricia; Kedinger, Michèle; Freund, Jean-Noël

    1997-01-01

    To explore the role of homeobox genes in the intestine, the human colon adenocarcinoma cell line Caco2-TC7 has been stably transfected with plasmids synthesizing Cdx1 and Cdx2 sense and antisense RNAs. Cdx1 overexpression or inhibition by antisense RNA does not markedly modify the cell differentiation markers analyzed in this study. In contrast, Cdx2 overexpression stimulates two typical markers of enterocytic differentiation: sucrase-isomaltase and lactase. Cells in which the endogenous expression of Cdx2 is reduced by antisense RNA attach poorly to the substratum. Conversely, Cdx2 overexpression modifies the expression of molecules involved in cell–cell and cell–substratum interactions and in transduction process: indeed, E-cadherin, integrin-β4 subunit, laminin-γ2 chain, hemidesmosomal protein, APC, and α-actinin are upregulated. Interestingly, most of these molecules are preferentially expressed in vivo in the differentiated villi enterocytes rather than in crypt cells. Cdx2 overexpression also results in the stimulation of HoxA-9 mRNA expression, an homeobox gene selectively expressed in the colon. In contrast, Cdx2-overexpressing cells display a decline of Cdx1 mRNA, which is mostly found in vivo in crypt cells. When implanted in nude mice, Cdx2-overexpressing cells produce larger tumors than control cells, and form glandular and villus-like structures. Laminin-1 is known to stimulate intestinal cell differentiation in vitro. In the present study, we demonstrate that the differentiating effect of laminin-1 coatings on Caco2-TC7 cells is accompanied by an upregulation of Cdx2. To further document this observation, we analyzed a series of Caco2 clones in which the production of laminin-α1 chain is differentially inhibited by antisense RNA. We found a positive correlation between the level of Cdx2 expression, that of endogenous laminin-α1 chain mRNA and that of sucrase-isomaltase expression in these cell lines. Taken together, these results suggest (a

  18. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  19. Characterization of DNA methylation change in stem cell marker genes during differentiation of human embryonic stem cells.

    PubMed

    Yeo, Seungeun; Jeong, Sangkyun; Kim, Janghwan; Han, Jee-Soo; Han, Yong-Mahn; Kang, Yong-Kook

    2007-08-03

    Pluripotent human embryonic stem cells (hESCs) have the distinguishing feature of innate capacity to allow indefinite self-renewal. This attribute continues until specific constraints or restrictions, such as DNA methylation, are imposed on the genome, usually accompanied by differentiation. With the aim of utilizing DNA methylation as a sign of early differentiation, we probed the genomic regions of hESCs, particularly focusing on stem cell marker (SCM) genes to identify regulatory sequences that display differentiation-sensitive alterations in DNA methylation. We show that the promoter regions of OCT4 and NANOG, but not SOX2, REX1 and FOXD3, undergo significant methylation during hESCs differentiation in which SCM genes are substantially repressed. Thus, following exposure to differentiation stimuli, OCT4 and NANOG gene loci are modified relatively rapidly by DNA methylation. Accordingly, we propose that the DNA methylation states of OCT4 and NANOG sequences may be utilized as barometers to determine the extent of hESC differentiation.

  20. Random forests-based differential analysis of gene sets for gene expression data.

    PubMed

    Hsueh, Huey-Miin; Zhou, Da-Wei; Tsai, Chen-An

    2013-04-10

    In DNA microarray studies, gene-set analysis (GSA) has become the focus of gene expression data analysis. GSA utilizes the gene expression profiles of functionally related gene sets in Gene Ontology (GO) categories or priori-defined biological classes to assess the significance of gene sets associated with clinical outcomes or phenotypes. Many statistical approaches have been proposed to determine whether such functionally related gene sets express differentially (enrichment and/or deletion) in variations of phenotypes. However, little attention has been given to the discriminatory power of gene sets and classification of patients. In this study, we propose a method of gene set analysis, in which gene sets are used to develop classifications of patients based on the Random Forest (RF) algorithm. The corresponding empirical p-value of an observed out-of-bag (OOB) error rate of the classifier is introduced to identify differentially expressed gene sets using an adequate resampling method. In addition, we discuss the impacts and correlations of genes within each gene set based on the measures of variable importance in the RF algorithm. Significant classifications are reported and visualized together with the underlying gene sets and their contribution to the phenotypes of interest. Numerical studies using both synthesized data and a series of publicly available gene expression data sets are conducted to evaluate the performance of the proposed methods. Compared with other hypothesis testing approaches, our proposed methods are reliable and successful in identifying enriched gene sets and in discovering the contributions of genes within a gene set. The classification results of identified gene sets can provide an valuable alternative to gene set testing to reveal the unknown, biologically relevant classes of samples or patients. In summary, our proposed method allows one to simultaneously assess the discriminatory ability of gene sets and the importance of genes for

  1. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  2. Differential gene expression in auristatin PHE-treated Cryptococcus neoformans.

    PubMed

    Woyke, Tanja; Berens, Michael E; Hoelzinger, Dominique B; Pettit, George R; Winkelmann, Günther; Pettit, Robin K

    2004-02-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 micro M) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans.

  3. Differential Gene Expression in Auristatin PHE-Treated Cryptococcus neoformans

    PubMed Central

    Woyke, Tanja; Berens, Michael E.; Hoelzinger, Dominique B.; Pettit, George R.; Winkelmann, Günther; Pettit, Robin K.

    2004-01-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 μM) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans. PMID:14742210

  4. Changes in expression of cell wall turnover genes accompany inhibition of chromosome segregation by bovine protein kinase C alpha expression in Saccharomyces cerevisiae.

    PubMed

    Sprowl, Jason A; Villeneuve, David J; Guo, Baoqing; Young, Andrew J M; Hembruff, Stacey L; Parissenti, Amadeo M

    2007-10-01

    Expression of bovine PKCalpha in Saccharomyces cerevisiae results in growth inhibition, which is strongly augmented upon addition of phorbol esters. To investigate the nature of this PKC-induced inhibition of cell growth, wildtype and bovine PKCalpha-expressing yeast cells were examined by flow cytometry and by fluorescence microscopy after staining with propidium iodide. Upon expression and activation of the mammalian PKC isoform, cells accumulated in the G2/M phase of the cell cycle and exhibited impaired chromsome segregation. In some instances, PKC expression and activation was accompanied by a defect in septum formation between mother and daughter cells. cDNA microarray analysis revealed 4 genes (CTS1, DSE1, DSE2, and SVS1) that changed expression in both a PKCalpha- and phorbol ester-dependent manner. These findings were confirmed by quantitative real-time PCR. Three of these genes are involved in cell wall turnover and are regulated by a single transcription factor (Ace 2) that localizes to daughter cell nuclei after cytokinesis. Taken together, these observations suggest that expression and activation of bovine PKCalpha in yeast cells repress growth by inducing an accumulation of cells in G2/M, likely through an impairment of chromosome segregation, cytokinesis, and septum formation. Moreover, when these observations are taken in the context of previously published observations with various yeast null mutants, we propose that bovine PKCalpha may directly or indirectly activate a subunit of the PP2A phosphatase complex (cdc55), which is a component of the mitotic spindle checkpoint.

  5. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  6. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  7. Cytokine-induced macrophage differentiation: a tale of 2 genes.

    PubMed

    Winston, B W; Krein, P M; Mowat, C; Huang, Y

    1999-12-01

    Macrophages are versatile cells found in every tissue in the body. They must perform a number of diverse cellular functions that allow them to kill invading micro-organisms and neoplastic cells as well as produce growth factors involved in wound healing. Macrophages that develop these diverse functions arise from a common precursor. By a process of selective adaptation, the common precursor monocyte/macrophage differentiates into a distinctive macrophage with a different and specific phenotype, characterized by the expression of a specific set of gene products. The local environment plays a critical role in shaping or directing the pattern or pathway of macrophage differentiation. The authors have focused on 2 specific macrophage differentiation pathways in a murine bone marrow-derived macrophage model. One pathway is believed to play a role in wound repair and is characterized by the induction of insulin-like growth factor-1 (IGF-I). The second pathway is involved in macrophage cytocidal activation and is characterized by the induction of the inducible form of nitric oxide synthase (iNOS). The pleotropic cytokine tumour necrosis factor-alpha (TNF-alpha) appears to mediate macrophage differentiation along both of these pathways. Interferon-gamma (IFN-gamma), however, appears to act as a molecular switch. In the presence of IFN-gamma, stimulation of macrophages with TNF-alpha results in macrophage differentiation along a pathway in which iNOS is expressed, whereas, in the absence of IFN-gamma, stimulation of macrophages with TNF-alpha results in differentiation along a pathway in which IGF-I is expressed. The authors focus on some of the molecular events involved in TNF-alpha and IFN-gamma signal transduction and the regulation of iNOS and IGF-I genes in macrophages.

  8. Hunting complex differential gene interaction patterns across molecular contexts

    PubMed Central

    Song, Mingzhou; Zhang, Yang; Katzaroff, Alexia J.; Edgar, Bruce A.; Buttitta, Laura

    2014-01-01

    Heterogeneity in genetic networks across different signaling molecular contexts can suggest molecular regulatory mechanisms. Here we describe a comparative chi-square analysis (CPχ2) method, considerably more flexible and effective than other alternatives, to screen large gene expression data sets for conserved and differential interactions. CPχ2 decomposes interactions across conditions to assess homogeneity and heterogeneity. Theoretically, we prove an asymptotic chi-square null distribution for the interaction heterogeneity statistic. Empirically, on synthetic yeast cell cycle data, CPχ2 achieved much higher statistical power in detecting differential networks than alternative approaches. We applied CPχ2 to Drosophila melanogaster wing gene expression arrays collected under normal conditions, and conditions with overexpressed E2F and Cabut, two transcription factor complexes that promote ectopic cell cycling. The resulting differential networks suggest a mechanism by which E2F and Cabut regulate distinct gene interactions, while still sharing a small core network. Thus, CPχ2 is sensitive in detecting network rewiring, useful in comparing related biological systems. PMID:24482443

  9. Differentially expressed genes in metastatic advanced Egyptian bladder cancer.

    PubMed

    Zekri, Abdel-Rahman N; Hassan, Zeinab Korany; Bahnassy, Abeer A; Khaled, Hussein M; El-Rouby, Mahmoud N; Haggag, Rasha M; Abu-Taleb, Fouad M

    2015-01-01

    Bladder cancer is one of the most common cancers worldwide. Gene expression profiling using microarray technologies improves the understanding of cancer biology. The aim of this study was to determine the gene expression profile in Egyptian bladder cancer patients. Samples from 29 human bladder cancers and adjacent non-neoplastic tissues were analyzed by cDNA microarray, with hierarchical clustering and multidimensional analysis. Five hundred and sixteen genes were differentially expressed of which SOS1, HDAC2, PLXNC1, GTSE1, ULK2, IRS2, ABCA12, TOP3A, HES1, and SRP68 genes were involved in 33 different pathways. The most frequently detected genes were: SOS1 in 20 different pathways; HDAC2 in 5 different pathways; IRS2 in 3 different pathways. There were 388 down-regulated genes. PLCB2 was involved in 11 different pathways, MDM2 in 9 pathways, FZD4 in 5 pathways, p15 and FGF12 in 4 pathways, POLE2 in 3 pathways, and MCM4 and POLR2E in 2 pathways. Thirty genes showed significant differences between transitional cell cancer (TCC) and squamous cell cancer (SCC) samples. Unsupervised cluster analysis of DNA microarray data revealed a clear distinction between low and high grade tumors. In addition 26 genes showed significant differences between low and high tumor stages, including fragile histidine triad, Ras and sialyltransferase 8 (alpha) and 16 showed significant differences between low and high tumor grades, like methionine adenosyl transferase II, beta. The present study identified some genes, that can be used as molecular biomarkers or target genes in Egyptian bladder cancer patients.

  10. The renal stanniocalcin-1 gene is differentially regulated by hypertonicity and hypovolemia in the rat.

    PubMed

    Turner, Jeffrey; Xiang, Fu-Li; Feng, Qingping; Wagner, Graham F

    2011-01-01

    Stanniocalcin-1 (STC-1) is made by kidney collecting duct cells for autocrine and paracrine targeting of nephron cell mitochondria. Here, the ligand stimulates respiratory uncoupling and calcium uniport activity. However, the underlying purpose of these actions and how the renal gene is regulated are poorly understood. In a previous study, we described the time-dependent, stimulatory effects of water deprivation on renal STC-1 mRNA levels in both rats and mice. In cortical kidney, STC-1 mRNA levels were increased 8-fold by 72h of water deprivation, whereas the gene response in outer and inner medulla was less pronounced (2-4 fold). Gene induction occurred equally in males and females and was accompanied by increased mitochondrial STC-1 protein levels. As water deprivation increases extracellular fluid (ECF) tonicity and at the same time reduces ECF volume, the present study examined the individual effects of hypertonicity and hypovolemia on renal gene activity in rats. Hypertonicity, whether induced by mannitol, glucose or NaCl, uniquely stimulated the cortical gene, to the extent that transcript levels were positively correlated with serum osmolality. This was in contrast to high dietary sodium, which had no bearing on cortical or medullary transcript levels. The situation was reversed in the case of hypovolemia. Inner medullary gene expression was uniquely induced by hypovolemia (low sodium diet or polyethylene glycol) such that transcript levels were positively correlated with hematocrit, while cortical gene activity was unaffected or reduced. Hence, the cortical and medullary genes proved to be differentially regulated by changing ECF tonicity and volume, respectively. The findings are therefore indicative of cortical and medullary STC-1 having separate roles in the renal control of ECF balance. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  11. Differential gene expression of mammalian SPO11/TOP6A homologs during meiosis.

    PubMed

    Shannon, M; Richardson, L; Christian, A; Handel, M A; Thelen, M P

    1999-12-03

    As the initiator of DNA double-strand breaks during meiosis in Saccharomyces cerevisiae, the SPO11 protein is essential for recombination. Similarity between SPO11 and archaebacterial TOP6A proteins points to evolutionary specialization of a DNA cleavage function for meiotic recombination. To determine whether this extends to mammals, we isolated and characterized mouse and human SPO11 cDNAs. Mammalian SPO11 genes were found to be expressed at high levels only in testis, wherein mouse Spo11 transcript is restricted primarily to meiotic germ cells and is maximally expressed at midpachynema. Mouse Spo11 is located near the distal end of chromosome 2, while human SPO11 is found in the homologous position of chromosome 20q13.2-13.3, a region that is amplified in some breast cancers. Sequence homology and differential expression together support a highly conserved role for SPO11 in the enzymatic cleavage of DNA that accompanies meiotic recombination.

  12. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  13. Improved detection of differentially expressed genes through incorporation of gene locations.

    PubMed

    Xiao, Guanghua; Reilly, Cavan; Khodursky, Arkady B

    2009-09-01

    In determining differential expression in cDNA microarray experiments, the expression level of an individual gene is usually assumed to be independent of the expression levels of other genes, but many recent studies have shown that a gene's expression level tends to be similar to that of its neighbors on a chromosome, and differentially expressed (DE) genes are likely to form clusters of similar transcriptional activity along the chromosome. When modeled as a one-dimensional spatial series, the expression level of genes on the same chromosome frequently exhibit significant spatial correlation, reflecting spatial patterns in transcription. By modeling these spatial correlations, we can obtain improved estimates of transcript levels. Here, we demonstrate the existence of spatial correlations in transcriptional activity in the Escherichia coli (E. coli) chromosome across more than 50 experimental conditions. Based on this finding, we propose a hierarchical Bayesian model that borrows information from neighboring genes to improve the estimation of the expression level of a given gene and hence the detection of DE genes. Furthermore, we extend the model to account for the circular structure of E. coli chromosome and the intergenetic distance between gene neighbors. The simulation studies and analysis of real data examples in E. coli and yeast Saccharomyces cerevisiae show that the proposed method outperforms the commonly used significant analysis of microarray (SAM) t-statistic in detecting DE genes.

  14. Altered patterns of gene duplication and differential gene gain and loss in fungal pathogens

    PubMed Central

    Powell, Amy J; Conant, Gavin C; Brown, Douglas E; Carbone, Ignazio; Dean, Ralph A

    2008-01-01

    Background Duplication, followed by fixation or random loss of novel genes, contributes to genome evolution. Particular outcomes of duplication events are possibly associated with pathogenic life histories in fungi. To date, differential gene gain and loss have not been studied at genomic scales in fungal pathogens, despite this phenomenon's known importance in virulence in bacteria and viruses. Results To determine if patterns of gene duplication differed between pathogens and non-pathogens, we identified gene families across nine euascomycete and two basidiomycete species. Gene family size distributions were fit to power laws to compare gene duplication trends in pathogens versus non-pathogens. Fungal phytopathogens showed globally altered patterns of gene duplication, as indicated by differences in gene family size distribution. We also identified sixteen examples of gene family expansion and five instances of gene family contraction in pathogenic lineages. Expanded gene families included those predicted to be important in melanin biosynthesis, host cell wall degradation and transport functions. Contracted families included those encoding genes involved in toxin production, genes with oxidoreductase activity, as well as subunits of the vacuolar ATPase complex. Surveys of the functional distribution of gene duplicates indicated that pathogens show enrichment for gene duplicates associated with receptor and hydrolase activities, while euascomycete pathogens appeared to have not only these differences, but also significantly more duplicates associated with regulatory and carbohydrate binding functions. Conclusion Differences in the overall levels of gene duplication in phytopathogenic species versus non-pathogenic relatives implicate gene inventory flux as an important virulence-associated process in fungi. We hypothesize that the observed patterns of gene duplicate enrichment, gene family expansion and contraction reflect adaptation within pathogenic life

  15. Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

    We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

  16. Gene turnover and differential retention in the relaxin/insulin-like gene family in primates.

    PubMed

    Arroyo, José Ignacio; Hoffmann, Federico G; Opazo, Juan C

    2012-06-01

    The relaxin/insulin-like gene family is related to the insulin gene family, and includes two separate types of peptides: relaxins (RLNs) and insulin-like peptides (INSLs) that perform a variety of physiological roles including testicular descent, growth and differentiation of the mammary glands, trophoblast development, and cell differentiation. In vertebrates, these genes are found on three separate genomic loci, and in mammals, variation in the number and nature of genes in this family is mostly restricted to the Relaxin Family Locus B. For example, this locus contains a single copy of RLN in platypus and opossum, whereas it contains copies of the INSL6, INSL4, RLN2 and RLN1 genes in human and chimp. The main objective of this research is to characterize changes in the size and membership composition of the RLN/INSL gene family in primates, reconstruct the history of the RLN/INSL genes of primates, and test competing evolutionary scenarios regarding the origin of INSL4 and of the duplicated copies of the RLN gene of apes. Our results show that the relaxin/INSL-like gene family of primates has had a more dynamic evolutionary history than previously thought, including several examples of gene duplications and losses which are consistent with the predictions of the birth-and-death model of gene family evolution. In particular, we found that the differential retention of relatively old paralogs played a key role in shaping the gene complement of this family in primates. Two examples of this phenomenon are the origin of the INSL4 gene of catarrhines (the group that includes Old World monkeys and apes), and of the duplicate RLN1 and RLN2 paralogs of apes. In the case of INSL4, comparative genomics and phylogenetic analyses indicate that the origin of this gene, which was thought to represent a catarrhine-specific evolutionary innovation, is as old as the split between carnivores and primates, which took place approximately 97 million years ago. In addition, in the case

  17. Characteristic Changes in Cell Surface Glycosylation Accompany Intestinal Epithelial Cell (IEC) Differentiation: High Mannose Structures Dominate the Cell Surface Glycome of Undifferentiated Enterocytes.

    PubMed

    Park, Dayoung; Brune, Kristin A; Mitra, Anupam; Marusina, Alina I; Maverakis, Emanual; Lebrilla, Carlito B

    2015-11-01

    Changes in cell surface glycosylation occur during the development and differentiation of cells and have been widely correlated with the progression of several diseases. Because of their structural diversity and sensitivity to intra- and extracellular conditions, glycans are an indispensable tool for analyzing cellular transformations. Glycans present on the surface of intestinal epithelial cells (IEC) mediate interactions with billions of native microorganisms, which continuously populate the mammalian gut. A distinct feature of IECs is that they differentiate as they migrate upwards from the crypt base to the villus tip. In this study, nano-LC/ESI QTOF MS profiling was used to characterize the changes in glycosylation that correspond to Caco-2 cell differentiation. As Caco-2 cells differentiate to form a brush border membrane, a decrease in high mannose type glycans and a concurrent increase in fucosylated and sialylated complex/hybrid type glycans were observed. At day 21, when cells appear to be completely differentiated, remodeling of the cell surface glycome ceases. Differential expression of glycans during IEC maturation appears to play a key functional role in regulating the membrane-associated hydrolases and contributes to the mucosal surface innate defense mechanisms. Developing methodologies to rapidly identify changes in IEC surface glycans may lead to a rapid screening approach for a variety of disease states affecting the GI tract. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Wilms' tumor (WT1) gene expression in rat decidual differentiation.

    PubMed

    Zhou, J; Rauscher, F J; Bondy, C

    1993-09-01

    The Wilm's tumor suppressor gene (WT1) encodes a zinc-finger containing transcription factor that is selectively expressed in the developing urogenital tract, where it is thought to play a role in the differentiation of these tissues. We have used immunocytochemistry and in situ hybridization to study WT1 expression in the rat uterus during normal development and pregnancy from 0 to 20 days post coitum (p.c.). WT1 mRNA was abundant in uterine stroma from juvenile rats, but was much less abundant in uterine tissue from sexually mature rats; WT1 expression is not affected by ovariectomy or by treatment with estradiol or estradiol plus progesterone. WT1 gene was highly expressed, however, in the endometrial cells of early pregnancy. On day 6 p.c. WT1 mRNA was detected in anti-mesometrial decidual cells, and WT1 immunoreactivity was concentrated in the nuclei of these cells. All cells of fully-developed deciduoma at 7-8 days p.c. demonstrated WT1 expression. WT1 was not detected in trophoblast/placental tissues but remained abundant in the decidua basalis until parturition. The expression of WT1 was compared with insulin-like growth factor-II (IGF-II) and its receptor in the decidual since it has been shown that IGF-II gene transcription is repressed by WT1 in vitro. However, no spatiotemporal correlation in the expression of these three genes was found in differentiation of the rat decidua. In summary, these data suggest a role for WT1 in decidualization, since its expression is activated during the differentiation of uterine stromal cells into decidual cells.

  19. Decreased sucrase and lactase activity in iron deficiency is accompanied by reduced gene expression and upregulation of the transcriptional repressor PDX-1.

    PubMed

    West, Adrian R; Oates, Phillip S

    2005-12-01

    Disaccharidases are important digestive enzymes whose activities can be reduced by iron deficiency. We hypothesise that this is due to reduced gene expression, either by impairment to enterocyte differentiation or by iron-sensitive mechanisms that regulate mRNA levels in enterocytes. Iron-deficient Wistar rats were generated by dietary means. The enzyme activities and kinetics of sucrase and lactase were tested as well as the activity of intestinal alkaline phosphatase (IAP)-II because it is unrelated to carbohydrate digestion. mRNA levels of beta-actin, sucrase, lactase, and the associated transcription factors pancreatic duodenal homeobox (PDX)-1, caudal-related homeobox (CDX)-2, GATA-binding protein (GATA)-4, and hepatocyte nuclear factor (HNF)-1 were measured by real-time PCR. Spatial patterns of protein and gene expression were assessed by immunofluorescence and in situ hybridization, respectively. It was found that iron-deficient rats had significantly lower sucrase (19.5% lower) and lactase (56.8% lower) but not IAP-II activity than control rats. Kinetic properties of both enzymes remained unchanged from controls, suggesting a decrease in the quantity of enzyme present. Sucrase and lactase mRNA levels were reduced by 44.5% and 67.9%, respectively, by iron deficiency, suggesting that enzyme activity is controlled primarily by gene expression. Iron deficiency did not affect the pattern of protein and gene expression along the crypt to villus axis. Expression of PDX-1, a repressor of sucrase and lactase promoters, was 4.5-fold higher in iron deficiency, whereas CDX-2, GATA-4, and HNF-1 levels were not significantly different. These data suggest that decreases in sucrase and lactase activities result from a reduction in gene expression, following from increased levels of the transcriptional repressor PDX-1.

  20. Hybrid weakness in a rice interspecific hybrid is nitrogen-dependent, and accompanied by changes in gene expression at both total transcript level and parental allele partitioning

    PubMed Central

    Lin, Xiuyun; Wang, Jie; Yu, Jiamiao; Sun, Yue; Miao, Yiling; Li, Qiuping; Sanguinet, Karen A.; Liu, Bao

    2017-01-01

    Background Hybrid weakness, a phenomenon opposite to heterosis, refers to inferior growth and development in a hybrid relative to its pure-line parents. Little attention has been paid to the phenomenological or mechanistic aspect of hybrid weakness, probably due to its rare occurrence. Methodology/Principal findings Here, using a set of interspecific triploid F1 hybrids between Oryza sativa, ssp. japonica (genome AA) and a tetraploid wild rice species, O. alta (genome, CCDD), we investigated the phenotypic and physiological differences between the F1 hybrids and their parents under normal and nitrogen-limiting conditions. We quantified the expression levels of 21 key genes involved in three important pathways pertinent to the assayed phenotypic and physiological traits by real-time qRT-PCR. Further, we assayed expression partitioning of parental alleles for eight genes in the F1 hybrids relative to the in silico “hybrids” (parental cDNA mixture) under both normal and N-limiting conditions by using locus-specific cDNA pyrosequencing. Conclusions/Significance We report that the F1 hybrids showed weakness in several phenotypic traits at the final seedling-stage compared with their corresponding mid-parent values (MPVs). Nine of the 21 studied genes showed contrasted expression levels between hybrids and parents (MPVs) under normal vs. N-limiting conditions. Interestingly, under N-limiting conditions, the overtly enhanced partitioning of maternal allele expression in the hybrids for eight assayed genes echo their attenuated hybrid weakness in phenotypes, an observation further bolstered by more resemblance of hybrids to the maternal parent under N-limiting conditions compared to normal conditions in a suite of measured physiological traits. Our observations suggest that both overall expression level and differential partitioning of parental alleles of critical genes contribute to condition-specific hybrid weakness. PMID:28248994

  1. Decreased hypertrophic differentiation accompanies enhanced matrix formation in co-cultures of outer meniscus cells with bone marrow mesenchymal stromal cells

    PubMed Central

    2012-01-01

    MSCs, MCI and MCO. The expression of collagen I (COL1A2) mRNA increased in co-cultured cells relative to mono-cultures of MCO and MCI but not compared to MSC mono-cultures. Collagen II (COL2A1) mRNA expression increased significantly in co-cultures of both MCO and MCI with MSCs compared to their own controls (mono-cultures of MCO and MCI respectively) but only the co-cultures of MCO:MSCs were significantly increased compared to MSC control mono-cultures. Increased collagen II protein expression was visible by collagen II immuno-histochemistry. The mRNA expression level of Sox9 was similar in all pellet cultures. The expression of collagen × (COL10A1) mRNA was 2-fold higher in co-cultures of MCI:MSCs relative to co-cultures of MCO:MSCs. Additionally, other hypertrophic genes, MMP-13 and Indian Hedgehog (IHh), were highly expressed by 4-fold and 18-fold, respectively, in co-cultures of MCI:MSCs relative to co-cultures of MCO:MSCs. Conclusions Co-culture of primary MCI or MCO with MSCs resulted in enhanced matrix formation. MCI and MCO increased matrix formation similarly after co-culture with MSCs. However, MCO was more potent than MCI in suppressing hypertrophic differentiation of MSCs. These findings suggest that meniscus cells from the outer-vascular regions of the meniscus can be supplemented with MSCs in order to engineer functional grafts to reconstruct inner-avascular meniscus. PMID:22726892

  2. RNA-seq Analysis of Host and Viral Gene Expression Highlights Interaction between Varicella Zoster Virus and Keratinocyte Differentiation

    PubMed Central

    Singh, Manuraj; Kanda, Ravinder K.; Yee, Michael B.; Kellam, Paul; Hollinshead, Michael; Kinchington, Paul R.; O'Toole, Edel A.; Breuer, Judith

    2014-01-01

    Varicella zoster virus (VZV) is the etiological agent of chickenpox and shingles, diseases characterized by epidermal skin blistering. Using a calcium-induced keratinocyte differentiation model we investigated the interaction between epidermal differentiation and VZV infection. RNA-seq analysis showed that VZV infection has a profound effect on differentiating keratinocytes, altering the normal process of epidermal gene expression to generate a signature that resembles patterns of gene expression seen in both heritable and acquired skin-blistering disorders. Further investigation by real-time PCR, protein analysis and electron microscopy revealed that VZV specifically reduced expression of specific suprabasal cytokeratins and desmosomal proteins, leading to disruption of epidermal structure and function. These changes were accompanied by an upregulation of kallikreins and serine proteases. Taken together VZV infection promotes blistering and desquamation of the epidermis, both of which are necessary to the viral spread and pathogenesis. At the same time, analysis of the viral transcriptome provided evidence that VZV gene expression was significantly increased following calcium treatment of keratinocytes. Using reporter viruses and immunohistochemistry we confirmed that VZV gene and protein expression in skin is linked with cellular differentiation. These studies highlight the intimate host-pathogen interaction following VZV infection of skin and provide insight into the mechanisms by which VZV remodels the epidermal environment to promote its own replication and spread. PMID:24497829

  3. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  4. Pheromone-regulated genes required for yeast mating differentiation.

    PubMed

    Erdman, S; Lin, L; Malczynski, M; Snyder, M

    1998-02-09

    Yeast cells mate by an inducible pathway that involves agglutination, mating projection formation, cell fusion, and nuclear fusion. To obtain insight into the mating differentiation of Saccharomyces cerevisiae, we carried out a large-scale transposon tagging screen to identify genes whose expression is regulated by mating pheromone. 91,200 transformants containing random lacZ insertions were screened for beta-galactosidase (beta-gal) expression in the presence and absence of alpha factor, and 189 strains containing pheromone-regulated lacZ insertions were identified. Transposon insertion alleles corresponding to 20 genes that are novel or had not previously been known to be pheromone regulated were examined for effects on the mating process. Mutations in four novel genes, FIG1, FIG2, KAR5/ FIG3, and FIG4 were found to cause mating defects. Three of the proteins encoded by these genes, Fig1p, Fig2p, and Fig4p, are dispensible for cell polarization in uniform concentrations of mating pheromone, but are required for normal cell polarization in mating mixtures, conditions that involve cell-cell communication. Fig1p and Fig2p are also important for cell fusion and conjugation bridge shape, respectively. The fourth protein, Kar5p/Fig3p, is required for nuclear fusion. Fig1p and Fig2p are likely to act at the cell surface as Fig1:: beta-gal and Fig2::beta-gal fusion proteins localize to the periphery of mating cells. Fig4p is a member of a family of eukaryotic proteins that contain a domain homologous to the yeast Sac1p. Our results indicate that a variety of novel genes are expressed specifically during mating differentiation to mediate proper cell morphogenesis, cell fusion, and other steps of the mating process.

  5. Identification of H ferritin-dependent and independent genes in K562 differentiating cells by targeted gene silencing and expression profiling.

    PubMed

    Misaggi, Roberta; Di Sanzo, Maddalena; Cosentino, Carlo; Bond, Heather M; Scumaci, Domenica; Romeo, Francesco; Stellato, Claudia; Giurato, Giorgio; Weisz, Alessandro; Quaresima, Barbara; Barni, Tullio; Amato, Francesco; Viglietto, Giuseppe; Morrone, Giovanni; Cuda, Giovanni; Faniello, Maria Concetta; Costanzo, Francesco

    2014-02-10

    Ferritin is best known as the key molecule in intracellular iron storage, and is involved in several metabolic processes such as cell proliferation, differentiation and neoplastic transformation. We have recently demonstrated that the shRNA silencing of the ferritin heavy subunit (FHC) in a melanoma cell line is accompanied by a consistent modification of gene expression pattern leading to a reduced potential in terms of proliferation, invasiveness, and adhesion ability of the silenced cells. In this study we sought to define the repertoire of genes whose expression might be affected by FHC during the hemin-induced differentiation of the erythromyeloid cell line K562. To this aim, gene expression profiling was performed in four different sets of cells: i) wild type K562; ii) sh-RNA FHC-silenced K562; iii) hemin-treated wild-type K562; and iv) hemin-treated FHC-silenced K562. Statistical analysis of the gene expression data, performed by two-factor ANOVA, identified three distinct classes of transcripts: a) Class 1, including 657 mRNAs whose expression is modified exclusively during hemin-induced differentiation of K562 cells, independently from the FHC relative amounts; b) Class 2, containing a set of 70 mRNAs which are consistently modified by hemin and FHC-silencing; and c) Class 3, including 128 transcripts modified by FHC-silencing but not by hemin. Our data indicate that FHC may function as a modulator of gene expression during erythroid differentiation and add new findings to the knowledge of the complex gene network modulated during erythroid differentiation. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Candidate egg case silk genes for the spider Argiope argentata from differential gene expression analyses.

    PubMed

    Chaw, R C; Arensburger, P; Clarke, T H; Ayoub, N A; Hayashi, C Y

    2016-12-01

    Orb-web weaving spiders produce a variety of task-specific silks from specialized silk glands. The genetics underlying the synthesis of specific silk types are largely unknown, and transcriptome analysis could be a powerful approach for identifying candidate genes. However, de novo assembly and expression profiling of silk glands with RNA-sequencing (RNAseq) are problematic because the few known gene transcripts for silk proteins are extremely long and highly repetitive. To identify candidate genes for tubuliform (egg case) silk synthesis by the orb-weaver Argiope argentata (Araneidae), we estimated transcript abundance using two sequencing methods: RNAseq reads from throughout the length of mRNA molecules, and 3' digital gene expression reads from the 3' region of mRNA molecules. Both analyses identified similar sets of genes as differentially expressed when comparing tubuliform and nonsilk gland tissue. However, incompletely assembled silk gene transcripts were identified as differentially expressed because of RNAseq read alignments to highly repetitive regions, confounding interpretation of RNAseq results. Homologues of egg case silk protein (ECP) genes were upregulated in tubuliform glands. This discovery is the first description of ECP homologues in an araneid. We also propose additional candidate genes involved in synthesis of tubuliform or other silk types. © 2016 The Authors. Insect Molecular Biology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society.

  7. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  8. Profiling of differentially expressed genes in haemophilia A with inhibitor.

    PubMed

    Hwang, S H; Lim, J A; Kim, M J; Kim, H C; Lee, H W; Yoo, K Y; You, C W; Lee, K S; Kim, H S

    2012-05-01

    Inhibitor development is the most significant complication in the therapy of haemophilia A (HA) patients. In spite of many studies, not much is known regarding the mechanism underlying inhibitor development. To understand the mechanism, we analysed profiles of differentially expressed genes (DEGs) between inhibitor and non-inhibitor HA via a microarray technique. Twenty unrelated Korean HAs were studied: 11 were non-inhibitor and nine were HA with inhibitor (≥5 BU mL(-1)). Microarray analysis was conducted using a Human Ref-8 expression Beadchip system (Illumina) and the data were analysed using Beadstudio software. We identified 545 DEGs in inhibitor HA as compared with the non-inhibitor patients; 384 genes were up-regulated and 161 genes were down-regulated. Among them, 75 genes whose expressions were altered by at least two-fold (>+2 or <-2) were selected and classified via the PANTHER classification method. The expressions of signal transduction and immunity-related genes differed significantly in the two groups. For validation of the DEGs, semi-quantitative RT-PCR (semi-qRT-PCR) was conducted with the six selected DEGs. The results corresponded to the microarray data, with the exception of one gene. We also examined the expression of the genes associated with the antigen presentation process via real-time PCR. The average levels of IL10, CTLA4 and TNFα slightly reduced, whereas that of IFNγ increased in the inhibitor HA group. We are currently unable to explain whether this phenomenon is a function of the inhibitor-inducing factor or is an epiphenomenon of antibody production. Nevertheless, our results provide a possible explanation for inhibitor development.

  9. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  10. Statistical ensemble of gene regulatory networks of macrophage differentiation.

    PubMed

    Castiglione, Filippo; Tieri, Paolo; Palma, Alessandro; Jarrah, Abdul Salam

    2016-12-22

    Macrophages cover a major role in the immune system, being the most plastic cell yielding several key immune functions. Here we derived a minimalistic gene regulatory network model for the differentiation of macrophages into the two phenotypes M1 (pro-) and M2 (anti-inflammatory). To test the model, we simulated a large number of such networks as in a statistical ensemble. In other words, to enable the inter-cellular crosstalk required to obtain an immune activation in which the macrophage plays its role, the simulated networks are not taken in isolation but combined with other cellular agents, thus setting up a discrete minimalistic model of the immune system at the microscopic/intracellular (i.e., genetic regulation) and mesoscopic/intercellular scale. We show that within the mesoscopic level description of cellular interaction and cooperation, the gene regulatory logic is coherent and contributes to the overall dynamics of the ensembles that shows, statistically, the expected behaviour.

  11. Evolution of tuf genes: ancient duplication, differential loss and gene conversion.

    PubMed

    Lathe, W C; Bork, P

    2001-08-03

    The tuf gene of eubacteria, encoding the EF-tu elongation factor, was duplicated early in the evolution of the taxon. Phylogenetic and genomic location analysis of 20 complete eubacterial genomes suggests that this ancient duplication has been differentially lost and maintained in eubacteria.

  12. Protein kinase A inhibition of macrophage maturation is accompanied by an increase in DNA methylation of the colony-stimulating factor 1 receptor gene.

    PubMed

    Zasłona, Zbigniew; Scruggs, Anne M; Peters-Golden, Marc; Huang, Steven K

    2016-10-01

    Macrophage colony-stimulating factor 1 (CSF-1) plays a critical role in the differentiation of mononuclear phagocytes from bone marrow precursors, and maturing monocytes and macrophages exhibit increased expression of the CSF-1 receptor, CSF1R. The expression of CSF1R is tightly regulated by transcription factors and epigenetic mechanisms. We previously showed that prostaglandin E2 and subsequent activation of protein kinase A (PKA) inhibited CSF1R expression and macrophage maturation. Here, we examine the DNA methylation changes that occur at the Csf1r locus during macrophage maturation in the presence or absence of activated PKA. Murine bone marrow cells were matured to macrophages by incubating cells with CSF-1-containing conditioned medium for up to 6 days in the presence or absence of the PKA agonist 6-bnz-cAMP. DNA methylation of Csf1r promoter and enhancer regions was assayed by bisulphite pyrosequencing. DNA methylation of Csf1r decreased during normal macrophage maturation in concert with an increase in Csf1r mRNA expression. Treatment with the PKA agonist inhibited Csf1r mRNA and protein expression, and increased DNA methylation at the Csf1r promoter. This was associated with decreased binding of the transcription factor PU.1 to the Csf1r promoter. Treatment with the PKA agonist inhibited the responsiveness of macrophages to CSF-1. Levels of endogenous PKA activity decreased during normal macrophage maturation, suggesting that attenuation of this signalling pathway contributes to the increase in CSF1R expression during macrophage maturation. Together, these results demonstrate that macrophage maturation is accompanied by Csf1r hypomethylation, and illustrates for the first time the ability of PKA to increase Csf1r DNA methylation. © 2016 John Wiley & Sons Ltd.

  13. DNA methylation and differential gene regulation in photoreceptor cell death.

    PubMed

    Farinelli, P; Perera, A; Arango-Gonzalez, B; Trifunovic, D; Wagner, M; Carell, T; Biel, M; Zrenner, E; Michalakis, S; Paquet-Durand, F; Ekström, P A R

    2014-12-04

    Retinitis pigmentosa (RP) defines a group of inherited degenerative retinal diseases causing progressive loss of photoreceptors. To this day, RP is still untreatable and rational treatment development will require a thorough understanding of the underlying cell death mechanisms. Methylation of the DNA base cytosine by DNA methyltransferases (DNMTs) is an important epigenetic factor regulating gene expression, cell differentiation, cell death, and survival. Previous studies suggested an involvement of epigenetic mechanisms in RP, and in this study, increased cytosine methylation was detected in dying photoreceptors in the rd1, rd2, P23H, and S334ter rodent models for RP. Ultrastructural analysis of photoreceptor nuclear morphology in the rd1 mouse model for RP revealed a severely altered chromatin structure during retinal degeneration that coincided with an increased expression of the DNMT isozyme DNMT3a. To identify disease-specific differentially methylated DNA regions (DMRs) on a genomic level, we immunoprecipitated methylated DNA fragments and subsequently analyzed them with a targeted microarray. Genome-wide comparison of DMRs between rd1 and wild-type retina revealed hypermethylation of genes involved in cell death and survival as well as cell morphology and nervous system development. When correlating DMRs with gene expression data, we found that hypermethylation occurred alongside transcriptional repression. Consistently, motif analysis showed that binding sites of several important transcription factors for retinal physiology were hypermethylated in the mutant model, which also correlated with transcriptional silencing of their respective target genes. Finally, inhibition of DNMTs in rd1 organotypic retinal explants using decitabine resulted in a substantial reduction of photoreceptor cell death, suggesting inhibition of DNA methylation as a potential novel treatment in RP.

  14. Density based pruning for identification of differentially expressed genes from microarray data

    PubMed Central

    2010-01-01

    Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning) is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO) with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website http://mleg.cse.sc.edu/degprune PMID:21047384

  15. Differential Shannon entropy and differential coefficient of variation: alternatives and augmentations to differential expression in the search for disease-related genes.

    PubMed

    Wang, Kai; Phillips, Charles A; Rogers, Gary L; Barrenas, Fredrik; Benson, Mikael; Langston, Michael A

    2014-01-01

    Differential expression has been a standard tool for analysing case-control transcriptomic data since the advent of microarray technology. It has proved invaluable in characterising the molecular mechanisms of disease. Nevertheless, the expression profile of a gene across samples can be perturbed in ways that leave the expression level unaltered, while a biological effect is nonetheless present. This paper describes and analyses differential Shannon entropy and differential coefficient of variation, two alternate techniques for identifying genes of interest. Ontological analysis across 16 human disease datasets demonstrates that these alternatives are effective at identifying disease-related genes not found by mere differential expression alone. Because the two alternate techniques are based on somewhat different mathematical formulations, they tend to produce somewhat different gene lists. Moreover, each may pinpoint genes completely overlooked by the other. Thus, measures of entropy and variation can be used to replace or better yet augment standard differential expression computations.

  16. Identification of genes differentially expressed in menstrual breakdown and repair.

    PubMed

    Paiva, Premila; Lockhart, Michelle G; Girling, Jane E; Olshansky, Moshe; Woodrow, Nicole; Marino, Jennifer L; Hickey, Martha; Rogers, Peter A W

    2016-12-01

    Does the changing molecular profile of the endometrium during menstruation correlate with the histological profile of menstruation. We identified several genes not previously associated with menstruation; on Day 2 of menstruation (early-menstruation), processes related to inflammation are predominantly up-regulated and on Day 4 (late-menstruation), the endometrium is predominantly repairing and regenerating. Menstruation is induced by progesterone withdrawal at the end of the menstrual cycle and involves endometrial tissue breakdown, regeneration and repair. Perturbations in the regulation of menstruation may result in menstrual disorders including abnormal uterine bleeding. Endometrial samples were collected by Pipelle biopsy on Days 2 (n = 9), 3 (n = 9) or 4 (n = 6) of menstruation. RNA was extracted from endometrial biopsies and analysed by genome wide expression Illumina Sentrix Human HT12 arrays. Data were analysed using 'Remove Unwanted Variation-inverse (RUV-inv)'. Ingenuity pathway analysis (IPA) and the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.7 were used to identify canonical pathways, upstream regulators and functional gene clusters enriched between Days 2, 3 and 4 of menstruation. Selected individual genes were validated by quantitative PCR. Overall, 1753 genes were differentially expressed in one or more comparisons. Significant canonical pathways, gene clusters and upstream regulators enriched during menstrual bleeding included those associated with immune cell trafficking, inflammation, cell cycle regulation, extracellular remodelling and the complement and coagulation cascade. We provide the first evidence for a role for glutathione-mediated detoxification (glutathione-S-transferase mu 1 and 2; GSTM1 and GSTM2) during menstruation. The largest number of differentially expressed genes was between Days 2 and 4 of menstruation (n = 1176). We identified several genes not previously associated with menstruation

  17. Integrated analysis of differentially expressed genes in breast cancer pathogenesis

    PubMed Central

    CHEN, DAOBAO; YANG, HONGJIAN

    2015-01-01

    The present study aimed to detect the differences between breast cancer cells and normal breast cells, and investigate the potential pathogenetic mechanisms of breast cancer. The sample GSE9574 series was downloaded, and the microarray data was analyzed to identify differentially expressed genes (DEGs). Gene Ontology (GO) cluster analysis using the GO Enrichment Analysis Software Toolkit platform and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for DEGs was conducted using the Gene Set Analysis Toolkit V2. In addition, a protein-protein interaction (PPI) network was constructed, and target sites of potential transcription factors and potential microRNA (miRNA) molecules were screened. A total of 106 DEGs were identified in the current study. Based on these DEGs, a number of bio-pathways appear to be altered in breast cancer, including a number of signaling pathways and other disease-associated pathways, as indicated by KEGG pathway clustering analysis. ATF3, JUND, FOSB and JUNB were detected in the PPI network. Finally, the most significant potential target sites of transcription factors and miRNAs in breast cancer, which are important in the regulation of gene expression, were identified. The results indicated that miR-93, miR-302A, miR-302B, miR-302C, miR-302D, miR-372, miR-373, miR-520E and miR-520A were closely associated with the occurrence and development of breast cancer. Therefore, changes in the expression of these miRNAs may alter cell metabolism and trigger the development of breast cancer and its complications. PMID:26137106

  18. Genomic differentiation among wild cyanophages despite widespread horizontal gene transfer

    DOE PAGES

    Gregory, Ann C.; Solonenko, Sergei A.; Ignacio-Espinoza, J. Cesar; ...

    2016-11-16

    Genetic recombination is a driving force in genome evolution. Among viruses it has a dual role. For genomes with higher fitness, it maintains genome integrity in the face of high mutation rates. Conversely, for genomes with lower fitness, it provides immediate access to sequence space that cannot be reached by mutation alone. Understanding how recombination impacts the cohesion and dissolution of individual whole genomes within viral sequence space is poorly understood across double-stranded DNA bacteriophages (a.k.a phages) due to the challenges of obtaining appropriately scaled genomic datasets. Here in this study we explore the role of recombination in both maintainingmore » and differentiating whole genomes of 142 wild double-stranded DNA marine cyanophages. Phylogenomic analysis across the 51 core genes revealed ten lineages, six of which were well represented. These phylogenomic lineages represent discrete genotypic populations based on comparisons of intra- and inter- lineage shared gene content, genome-wide average nucleotide identity, as well as detected gaps in the distribution of pairwise differences between genomes. McDonald-Kreitman selection tests identified putative niche-differentiating genes under positive selection that differed across the six well-represented genotypic populations and that may have driven initial divergence. Concurrent with patterns of recombination of discrete populations, recombination analyses of both genic and intergenic regions largely revealed decreased genetic exchange across individual genomes between relative to within populations. Lastly, these findings suggest that discrete double-stranded DNA marine cyanophage populations occur in nature and are maintained by patterns of recombination akin to those observed in bacteria, archaea and in sexual eukaryotes.« less

  19. Genomic differentiation among wild cyanophages despite widespread horizontal gene transfer

    SciTech Connect

    Gregory, Ann C.; Solonenko, Sergei A.; Ignacio-Espinoza, J. Cesar; LaButti, Kurt; Copeland, Alex; Sudek, Sebastian; Maitland, Ashley; Chittick, Lauren; dos Santos, Filipa; Weitz, Joshua S.; Worden, Alexandra Z.; Woyke, Tanja; Sullivan, Matthew B.

    2016-11-16

    Genetic recombination is a driving force in genome evolution. Among viruses it has a dual role. For genomes with higher fitness, it maintains genome integrity in the face of high mutation rates. Conversely, for genomes with lower fitness, it provides immediate access to sequence space that cannot be reached by mutation alone. Understanding how recombination impacts the cohesion and dissolution of individual whole genomes within viral sequence space is poorly understood across double-stranded DNA bacteriophages (a.k.a phages) due to the challenges of obtaining appropriately scaled genomic datasets. Here in this study we explore the role of recombination in both maintaining and differentiating whole genomes of 142 wild double-stranded DNA marine cyanophages. Phylogenomic analysis across the 51 core genes revealed ten lineages, six of which were well represented. These phylogenomic lineages represent discrete genotypic populations based on comparisons of intra- and inter- lineage shared gene content, genome-wide average nucleotide identity, as well as detected gaps in the distribution of pairwise differences between genomes. McDonald-Kreitman selection tests identified putative niche-differentiating genes under positive selection that differed across the six well-represented genotypic populations and that may have driven initial divergence. Concurrent with patterns of recombination of discrete populations, recombination analyses of both genic and intergenic regions largely revealed decreased genetic exchange across individual genomes between relative to within populations. Lastly, these findings suggest that discrete double-stranded DNA marine cyanophage populations occur in nature and are maintained by patterns of recombination akin to those observed in bacteria, archaea and in sexual eukaryotes.

  20. Molecular cloning and characterization of the obg gene of Streptomyces griseus in relation to the onset of morphological differentiation.

    PubMed Central

    Okamoto, S; Itoh, M; Ochi, K

    1997-01-01

    Morphological differentiation in microorganisms is usually accompanied by a decrease in intracellular GTP pool size, as has been demonstrated in bacillaceae, streptomycetaceae, and yeasts. The obg gene, which codes for a GTP-binding protein belonging to the GTPase superfamily of proteins, was cloned from Streptomyces griseus IFO13189. The gene is located just downstream of the genes for ribosomal proteins L21 and L27, encoded a protein of 478 amino acids (51 kDa), and possessed three consensus motifs which confer GTP-binding ability; Obg protein expressed in Escherichia coli bound GTP, as demonstrated using a UV cross-linking method. Introduction of multiple copies of obg into wild-type S. griseus suppressed aerial mycelium development in cells on solid media. However, no effect on streptomycin production was detected, indicating that Obg is involved in the regulation of the onset of morphological but not physiological differentiation. Multiple copies of obg also suppressed submerged spore formation in liquid culture. Southern hybridization studies indicated that genes homologous to obg exist widely in streptomycetes, and an obg homolog was successfully cloned from S. coelicolor A3(2). We propose that by monitoring the intracellular GTP pool size, the Obg protein is involved in sensing changes in the nutritional environment leading ultimately to morphological differentiation. PMID:8981995

  1. Differential Gene Susceptibility to Sperm DNA Damage: Analysis of Developmental Key Genes in Trout

    PubMed Central

    González-Rojo, Silvia; Fernández-Díez, Cristina; Guerra, Susana M.; Robles, Vanesa; Herraez, Maria Paz

    2014-01-01

    Sperm chromatin in mammals is packaged in different blocks associated to protamines (PDNA), histones (HDNA), or nuclear matrix proteins. Differential packaging has been related to early or late transcription and also to differential susceptibility to genotoxic damage. Genes located in the more accessible HDNA could be more susceptible to injuries than those located in PDNA, being potential biomarkers of paternal DNA damage. Fish sperm chromatin organization is much diversified, some species lacking protamines and some others totally depleted of histones. Analyzing genotoxic damage in a species homogeneously compacted with some sperm nuclear basic protein type, could help in deciphering the clues of differential susceptibility to damage. In the present study we analyzed in rainbow trout the differential susceptibility of nine genes to UV irradiation and H2O2 treatment. The absence of histones in the sperm nuclei was confirmed by Western blot. The chromatin fractionation in sensitive and resistant regions to PvuII (presumably HDNA-like and PDNA-like, respectively) revealed that the nine genes locate in the same resistant region. The number of lesions promoted was quantified using a qPCR approach. Location of 8-hydroxyguanosine (8-OHdG) was analyzed by immunocytochemistry and confocal microscopy. UV irradiation promoted similar number of lesions in all the analyzed genes and a homogenous distribution of 8-OHdG within the nuclei. 8-OHdG was located in the peripheral area of the nucleus after H2O2 treatment, which promoted a significantly higher number of lesions in developmental-related genes (8.76–10.95 lesions/10 kb) than in rDNA genes (1.05–1.67 lesions/10 kb). We showed for the first time, that differential susceptibility to damage is dependent on the genotoxic mechanism and relies on positional differences between genes. Sensitive genes were also analyzed in cryopreserved sperm showing a lower number of lesions than the previous treatments and a predominant

  2. Inhibition of LINE-1 retrotransposon-encoded reverse transcriptase modulates the expression of cell differentiation genes in breast cancer cells.

    PubMed

    Patnala, Radhika; Lee, Sung-Hun; Dahlstrom, Jane E; Ohms, Stephen; Chen, Long; Dheen, S Thameem; Rangasamy, Danny

    2014-01-01

    Long Interspersed Elements (L1 elements) are biologically active retrotransposons that are capable of autonomous replication using their own reverse transcriptase (RT) enzyme. Expression of the normally repressed RT has been implicated in cancer cell growth. However, at present, little is known about the expression of L1-encoded RT activity or the molecular changes that are associated with RT activity in the development of breast cancer. Here, we report that RT activity is widespread in breast cancer cells. The expression of RT protein decreased markedly in breast cancer cells after treatment with the antiretroviral drug, efavirenz. While the majority of cells showed a significant reduction in proliferation, inhibition of RT was also accompanied by cell-specific differences in morphology. MCF7 cells displayed elongated microtubule extensions that adhered tightly to their substrate, while a large fraction of the T47D cells that we studied formed long filopodia projections. These morphological changes were reversible upon cessation of RT inhibition, confirming their dependence on RT activity. We also carried out gene expression profiling with microarrays and determined the genes that were differentially expressed during the process of cellular differentiation. Genes involved in proliferation, cell migration, and invasive activity were repressed in RT-inhibited cells. Concomitantly, genes involved in cell projection, formation of vacuolar membranes, and cell-to-cell junctions were significantly upregulated in RT-inhibited cells. qRT-PCR examination of the mRNA expression of these genes in additional cell lines yielded close correlation between their differential expression and the degree of cellular differentiation. Our study demonstrates that the inhibition of L1-encoded RT can reduce the rate of proliferation and promote differentiation of breast cancer cells. Together, these results provide a direct functional link between the expression of L1 retrotransposons and

  3. Differential toxicity and venom gland gene expression in Centruroides vittatus.

    PubMed

    McElroy, Thomas; McReynolds, C Neal; Gulledge, Alyssa; Knight, Kelci R; Smith, Whitney E; Albrecht, Eric A

    2017-01-01

    Variation in venom toxicity and composition exists in many species. In this study, venom potency and venom gland gene expression was evaluated in Centruroides vittatus, size class I-II (immature) and size class IV (adults/penultimate instars) size classes. Venom toxicity was evaluated by probit analysis and returned ED50 values of 50.1 μg/g for class IV compared to 134.2 μg/g for class I-II 24 hours post injection, suggesting size class IV was 2.7 fold more potent. Next generation sequencing (NGS and qPCR were used to characterize venom gland gene expression. NGS data was assembled into 36,795 contigs, and annotated using BLASTx with UNIPROT. EdgeR analysis of the sequences showed statistically significant differential expression in transcripts associated with sodium and potassium channel modulation. Sodium channel modulator expression generally favored size class IV; in contrast, potassium channel modulators were favored in size class I-II expression. Real-time quantitative PCR of 14 venom toxin transcripts detected relative expression ratios that paralleled NGS data and identified potential family members or splice variants for several sodium channel modulators. Our data suggests ontogenetic differences in venom potency and venom related genes expression exist between size classes I-II and IV.

  4. Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

    SciTech Connect

    Sternberg, E.A.; Spizz, G.; Perry, W.M.; Vizard, D.; Weil, T.; Olson, E.N.

    1988-07-01

    Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

  5. Population differentiation and behavioural association of the two 'personality' genes DRD4 and SERT in dunnocks (Prunella modularis).

    PubMed

    Holtmann, B; Grosser, S; Lagisz, M; Johnson, S L; Santos, E S A; Lara, C E; Robertson, B C; Nakagawa, S

    2016-02-01

    Quantifying the variation in behaviour-related genes within and between populations provides insight into how evolutionary processes shape consistent behavioural traits (i.e. personality). Deliberate introductions of non-native species offer opportunities to investigate how such genes differ between native and introduced populations and how polymorphisms in the genes are related to variation in behaviour. Here, we compared the genetic variation of the two 'personality' genes, DRD4 and SERT, between a native (United Kingdom, UK) and an introduced (New Zealand, NZ) population of dunnocks, Prunella modularis. The NZ population showed a significantly lower number of single nucleotide polymorphisms (SNPs) compared to the UK population. Standardized F'st estimates of the personality genes and neutral microsatellites indicate that selection (anthropogenic and natural) probably occurred during and post the introduction event. Notably, the largest genetic differentiation was found in the intronic regions of the genes. In the NZ population, we also examined the association between polymorphisms in DRD4 and SERT and two highly repeatable behavioural traits: flight-initiation distance and mating status (promiscuous females and cobreeding males). We found 38 significant associations (for different allele effect models) between the two behavioural traits and the studied genes. Further, 22 of the tested associations showed antagonistic allele effects for males and females. Our findings illustrate how introduction events and accompanying ecological changes could influence the genetic diversity of behaviour-related genes.

  6. Identification of suitable reference genes for quantitative gene expression analysis in rat adipose stromal cells induced to trilineage differentiation.

    PubMed

    Santos, Bruno Paiva Dos; da Costa Diesel, Luciana Fraga; da Silva Meirelles, Lindolfo; Nardi, Nance Beyer; Camassola, Melissa

    2016-12-15

    This study was designed to (i) identify stable reference genes for the analysis of gene expression during in vitro differentiation of rat adipose stromal cells (rASCs), (ii) recommend stable genes for individual treatment conditions, and (iii) validate these genes by comparison with normalization results from stable and unstable reference genes. On the basis of a literature review, eight genes were selected: Actb, B2m, Hprt1, Ppia, Rplp0, Rpl13a, Rpl5, and Ywhaz. Genes were ranked according to their stability under different culture conditions as assessed using GenNorm, NormFinder, and RefFinder algorithms. Although the employed algorithms returned different rankings, the most frequently top-ranked genes were: B2m and/or Ppia for all 28day treatments (ALL28); Ppia and Hprt1 (adipogenic differentiation; A28), B2m (chondrogenic differentiation; C28), Rpl5 (controls maintained in complete culture medium; CCM), Rplp0 (osteogenic differentiation for 3days; O3), Rpl13a and Actb (osteogenic differentiation for 7days; O7), Rplp0 and Ppia (osteogenic differentiation for 14days; O14), Hprt1 and Ppia (osteogenic differentiation for 28days; O28), as well as Actb (all osteogenesis time points combined; ALLOSTEO). The obtained results indicate that the performance of reference genes depends on the differentiation protocol and on the analysis time, thus providing valuable information for the design of RT-PCR experiments.

  7. Differentially expressed genes and gene networks involved in pig ovarian follicular atresia.

    PubMed

    Terenina, Elena; Fabre, Stephane; Bonnet, Agnès; Monniaux, Danielle; Robert-Granié, Christèle; SanCristobal, Magali; Sarry, Julien; Vignoles, Florence; Gondret, Florence; Monget, Philippe; Tosser-Klopp, Gwenola

    2017-02-01

    Ovarian folliculogenesis corresponds to the development of follicles leading to either ovulation or degeneration, this latter process being called atresia. Even if atresia involves apoptosis, its mechanism is not well understood. The objective of this study was to analyze global gene expression in pig granulosa cells of ovarian follicles during atresia. The transcriptome analysis was performed on a 9,216 cDNA microarray to identify gene networks and candidate genes involved in pig ovarian follicular atresia. We found 1,684 significantly regulated genes to be differentially regulated between small healthy follicles and small atretic follicles. Among them, 287 genes had a fold-change higher than two between the two follicle groups. Eleven genes (DKK3, GADD45A, CAMTA2, CCDC80, DAPK2, ECSIT, MSMB, NUPR1, RUNX2, SAMD4A, and ZNF628) having a fold-change higher than five between groups could likely serve as markers of follicular atresia. Moreover, automatic confrontation of deregulated genes with literature data highlighted 93 genes as regulatory candidates of pig granulosa cell atresia. Among these genes known to be inhibitors of apoptosis, stimulators of apoptosis, or tumor suppressors INHBB, HNF4, CLU, different interleukins (IL5, IL24), TNF-associated receptor (TNFR1), and cytochrome-c oxidase (COX) were suggested as playing an important role in porcine atresia. The present study also enlists key upstream regulators in follicle atresia based on our results and on a literature review. The novel gene candidates and gene networks identified in the current study lead to a better understanding of the molecular regulation of ovarian follicular atresia. Copyright © 2017 the American Physiological Society.

  8. Differential transformation of mammary epithelial cells by Wnt genes.

    PubMed Central

    Wong, G T; Gavin, B J; McMahon, A P

    1994-01-01

    The mouse Wnt family includes at least 10 genes that encode structurally related secreted glycoproteins. Wnt-1 and Wnt-3 were originally identified as oncogenes activated by the insertion of mouse mammary tumor virus in virus-induced mammary adenocarcinomas, although they are not expressed in the normal mammary gland. However, five other Wnt genes are differentially expressed during development of adult mammary tissue, suggesting that they may play distinct roles in various phases of mammary gland growth and development. Induction of transformation by Wnt-1 and Wnt-3 may be due to interference with these normal regulatory events; however, there is no direct evidence for this hypothesis. We have tested Wnt family members for the ability to induce transformation of cultured mammary cells. The results demonstrate that the Wnt gene family can be divided into three groups depending on their ability to induce morphological transformation and altered growth characteristics of the C57MG mammary epithelial cell line. Wnt-1, Wnt-3A, and Wnt-7A were highly transforming and induced colonies which formed and shed balls of cells. Wnt-2, Wnt-5B, and Wnt-7B also induced transformation but with a lower frequency and an apparent decrease in saturation density. In contrast, Wnt-6 and two other family members which are normally expressed in C57MG cells, Wnt-4 and Wnt-5A, failed to induce transformation. These data demonstrate that the Wnt genes have distinct effects on cell growth and should not be regarded as functionally equivalent. Images PMID:8065359

  9. Screening key genes associated with congenital heart defects in Down syndrome based on differential expression network.

    PubMed

    Yu, Shan; Yi, Huani; Wang, Zhimin; Dong, Juan

    2015-01-01

    Down syndrome (DS) is the most common viable chromosomal disorder with intellectual impairment and several other developmental abnormalities. Forty to fifty percent of newborns with DS have some form of congenital heart defects (CHD). The genome of CHD in DS has already been obtained, but the underlying genomic or gene expression variation that contributes to the manifestation of a CHD in DS is still unknown. This study was aimed to analyze key genes of patients with CHD in DS. Differential expression network (DEN) approach was employed to analyze the dyeregulated genes and pathways in this study. First, the differentially expressed genes (DEGs) between CHD in DS and normal subjects were screened based on the microarray expression data. Next, the differential interactions were identified using spearman correlation coefficients of edges in different conditions. The DEN was then constructed combining both DEGs and differential interactions, and HUB genes were gained by degree centrality analysis of DEN. Meanwhile, disease genes included in the DEN were also ascertained. When analyzing gene expression values in different conditions, no DEGs were identified. While, a total of 984 gene pairs with significant differential expression were identified. Finally, the DEN was constructed only using differential edges in our study. In this network, eight HUB genes were identified, and thereinto four genes (UBC, APP, HUWE1 and SRC) were both HUB genes and disease genes. DEN approach should be taken as a useful complement to traditional differential genes methods. We provide several potential underlying biomarkers for CHD in DS.

  10. Differential hormonal and gene expression dynamics in two inbred sunflower lines with contrasting dormancy level.

    PubMed

    Roselló, Paula L; Vigliocco, Ana E; Andrade, Andrea M; Riera, Natalí V; Calafat, Mario; Molas, María L; Alemano, Sergio G

    2016-05-01

    Seed germination and dormancy are tightly regulated by hormone metabolism and signaling pathway. We investigated the endogenous content of abscisic acid (ABA), its catabolites, and gibberellins (GAs), as well as the expression level of certain ABA and GAs metabolic and signaling genes in embryo of dry and imbibed cypselas of inbred sunflower (Helianthus annuus L., Asteraceae) lines: B123 (dormant) and B91 (non-dormant). Under our experimental conditions, the expression of RGL2 gene might be related to the ABA peak in B123 line at 3 h of imbibition. Indeed, RGL2 transcripts are absent in dry and early embedded cypselas of the non-dormant line B91. ABA increase was accompanied by a significant ABA-Glucosyl ester (ABA-GE) and phaseic acid (PA) (two ABA catabolites) decrease in B123 line (3 h) which indicates that ABA metabolism seems to be more active in this line, and that it would be involved in the imposition and maintenance of sunflower seed dormancy, as it has been reported for many species. Finally, an increase of bioactive GAs (GA1 and GA3) occurs at 12 h of imbibition in both lines after a decrease in ABA content. This study shows the first report about the RGL2 tissue-specific gene expression in sunflower inbred lines with contrasting dormancy level. Furthermore, our results provide evidence that ABA and GAs content and differential expression of metabolism and signaling genes would be interacting in seed dormancy regulation through a mechanism of action related to embryo itself.

  11. CT gene modulate differential expression of chitinase gene under variant habitats in Vibrio cholerae

    PubMed Central

    Verma, Yogendra Kumar; Verma, Mahendra Kumar

    2013-01-01

    Objective To investigate the interrelation of cholera toxin gene (CT gene) in expression of chitinase gene under different pH conditions among pathogenic and Non-pathogenic strains of Vibrio cholera (V. cholera). Methods The chitinase assay well diffusion method and calorimetric chitinase assay were performed. Further, time depended chitinase activity among pathogenic and nonpathogenic strain was evaluated with control as Escherichia coli. The expressed protein in variant environment was purified by cascade of chromatographic techniques. The partially purified protein was analyzed by SDS-PAGE in both the strain of V. cholera. Results The results have shown differential expression of chitinase gene among vibrio in time depended chitinase activity, purification of expressed protein and SDS-PAGE analysis. Conclusions From the current study, two conclusions came in picture, habitat is prime factor that regulation of chitin gene expression among many bacterial strains, second, moreover among the vibrio pathogenic strains (CT+) expression of chitinase gene is more precisely regulated by CT gene rather than external environments while in non-pathogenic strain ( CT-) completely absent.

  12. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  13. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia

    PubMed Central

    Ge, Yubin; Dombkowski, Alan A.; LaFiura, Katherine M.; Tatman, Dana; Yedidi, Ravikiran S.; Stout, Mark L.; Buck, Steven A.; Massey, Gita; Becton, David L.; Weinstein, Howard J.; Ravindranath, Yaddanapudi; Matherly, Larry H.; Taub, Jeffrey W.

    2006-01-01

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins. PMID:16249385

  14. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae)

    PubMed Central

    Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings. PMID:25924061

  15. Differential gene expression, GATA1 target genes, and the chemotherapy sensitivity of Down syndrome megakaryocytic leukemia.

    PubMed

    Ge, Yubin; Dombkowski, Alan A; LaFiura, Katherine M; Tatman, Dana; Yedidi, Ravikiran S; Stout, Mark L; Buck, Steven A; Massey, Gita; Becton, David L; Weinstein, Howard J; Ravindranath, Yaddanapudi; Matherly, Larry H; Taub, Jeffrey W

    2006-02-15

    Children with Down syndrome (DS) with acute megakaryocytic leukemia (AMkL) have very high survival rates compared with non-DS AMkL patients. Somatic mutations identified in the X-linked transcription factor gene, GATA1, in essentially all DS AMkL cases result in the synthesis of a shorter (40 kDa) protein (GATA1s) with altered transactivation activity and may lead to altered expression of GATA1 target genes. Using the Affymetrix U133A microarray chip, we identified 551 differentially expressed genes between DS and non-DS AMkL samples. Transcripts for the bone marrow stromal-cell antigen 2 (BST2) gene, encoding a transmembrane glycoprotein potentially involved in interactions between leukemia cells and bone marrow stromal cells, were 7.3-fold higher (validated by real-time polymerase chain reaction) in the non-DS compared with the DS group. Additional studies confirmed GATA1 protein binding and transactivation of the BST2 promoter; however, stimulation of BST2 promoter activity by GATA1s was substantially reduced compared with the full-length GATA1. CMK sublines, transfected with the BST2 cDNA and incubated with HS-5 bone marrow stromal cells, exhibited up to 1.7-fold reduced cytosine arabinoside (ara-C)-induced apoptosis, compared with mock-transfected cells. Our results demonstrate that genes that account for differences in survival between DS and non-DS AMkL cases may be identified by microarray analysis and that differential gene expression may reflect relative transactivation capacities of the GATA1s and full-length GATA1 proteins.

  16. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae).

    PubMed

    Behringer, David; Zimmermann, Heike; Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings.

  17. Identification of differentially expressed protective genes in liver of two rainbow trout strains.

    PubMed

    Rebl, Alexander; Verleih, Marieke; Korytář, Thomáš; Kühn, Carsten; Wimmers, Klaus; Köllner, Bernd; Goldammer, Tom

    2012-01-15

    Since 1975, the rainbow trout strain BORN (Germany) has been bred in brackish water from a coastal form imported from Denmark. Accompanying phenotypic monitoring of the adapted BORN trout until now revealed that this selection strain manifested a generally elevated resistance towards high stress and pathogenic challenge including lower susceptibility towards Aeromonas salmonicida infections in comparison to other trout strains in local aqua farms. We focus on the elucidation of both, genetic background and immunological basis for the increased survivorship to infections. A first comparison of gene expression profiles in liver tissue of healthy rainbow trout from the local selection strain BORN and imported trout using a GRASP 16K cDNA microarray revealed six differentially expressed genes evoking pathogen and wounding responses, LEAP2A (encoding for liver-expressed antimicrobial peptide), SERPINA1 (alpha-1 antitrypsin), FTH1 (middle subunit of ferritin), FGL2 (fibroleukin), CLEC4E (macrophage-inducible C-type lectin), and SERPINF2 (alpha-2 antiplasmin). Since the latter gene is not described in salmonid species so far, our first aim was to characterize the respective sequence in rainbow trout. Two trout SERPINF2 genes were identified, which share only 48% identical amino acid residues and a characteristic SERPIN domain. Second, we aimed to analyse the expression of those genes after temperature challenge (8 °C and 23 °C). Only FTH1 was upregulated in BORN and import trout after increase of temperature, while SERPINA1 and FGL2 were only elevated in import trout. Third, the expression of all named genes was analyzed after pathogen challenge with A. salmonicida subsp. salmonicida. As a main finding, we detected a comparably faster regeneration of LEAP2A mRNA abundance in BORN trout following bacterial infection. Ingenuity Pathways Analysis suggested a functional interplay among the mentioned factors and the pro-inflammatory cytokine TNF, whose stronger expression

  18. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

    PubMed

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

    2007-02-01

    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  19. Microarray analysis of differentially expressed genes in preeclamptic and normal placental tissues.

    PubMed

    Ma, K; Lian, Y; Zhou, S; Hu, R; Xiong, Y; Ting, P; Xiong, Y; Li, X; Wang, X

    2014-01-01

    To detect the candidate genes for preeclampsia (PE). The gene expression profiles in preeclamptic and normal placental tissues were analyzed using cDNA microarray approach and the altered expression of important genes were further confirmed by real-time RT-PCR (reverse transcription polymerase chain reaction) technique. Total RNA was extracted from placental tissues of three cases with severe PE and from three cases with normal pregnancy. After scanning, differentially expressed genes were detected by software. In two experiments (the fluorescent labels were exchanged), a total of 111 differentially expressed genes were detected. In placental tissue ofpreeclamptic pregnancy, 68 differentially expressed genes were up-regulated, and 44 differentially expressed genes were down-regulated. Of these genes, 16 highly differentially expressed genes were confirmed by real-time fluorescent quantitative RT-PCR, and the result showed that the ratio of gene expression differences was comparable to that detected by cDNA microarray. The results of bioinformatic analysis showed that encoding products of differentially expressed genes were correlated to infiltration of placenta trophoblastic cells, immunomodulatory factors, pregnancy-associated plasma protein, signal transduction pathway, and cell adhesion. Further studies on the biological function and regulating mechanism of these genes will provide new clues for better understanding of etiology and pathogenesis of PE.

  20. Differential gene expression analysis of Paracoccidioides brasiliensis during keratinocyte infection.

    PubMed

    Peres da Silva, Roberta; Matsumoto, Marcelo Teruyuki; Braz, Jaqueline Derissi; Voltan, Aline Raquel; de Oliveira, Haroldo Cesar; Soares, Christiane Pienna; Mendes Giannini, Maria José Soares

    2011-03-01

    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, one of the most important systemic fungal diseases in Latin America. This initiates in lung tissue and can subsequently disseminate to other tissues. Clinical manifestations range from localized forms to disseminated disease that can progress to lethality, probably depending on the relationships among the virulence of the fungus, the immune response and the ability to interact with the surface structures and invade epithelial cells and mononuclear cells of the host. It is generally regarded as a multifocal disease, with oral lesions as the prominent feature. The aim of this study was to evaluate P. brasiliensis yeast infection in normal oral keratinocytes (NOKs). The differential expression of mRNAs and proteins was also determined when the fungus was placed in contact with the cell in order to characterize differentially expressed genes and proteins during P. brasiliensis infection. After contact with NOKs, the fungus appeared to induce alterations in the cells, which showed cellular extensions and cavitations, probably resulting from changes in the actin cytoskeleton seen at 5 and 8 h after infection. Levels of protein expression were higher after reisolation of the fungus from infected NOK culture compared with culture of the fungus in medium. The analysis identified transcripts related to 19 proteins involved in different biological processes. Transcripts were found with multiple functions including induction of cytokines, protein metabolism, alternative carbon metabolism, zinc transport and the stress response during contact with NOKs. The proteins found suggested that the yeast was in a stress situation, as indicated by the presence of RDS1. Nevertheless, the yeast seemed to be proliferating and metabolically active, as shown by the presence of a proteasome, short-chain acetylator, glucosamine-6-phosphate isomerase and ADP/ATP carrier transcripts. Additionally, metabolic pathways may

  1. The APOE Gene is Differentially Methylated in Alzheimer's Disease.

    PubMed

    Foraker, Jessica; Millard, Steven P; Leong, Lesley; Thomson, Zachary; Chen, Sunny; Keene, C Dirk; Bekris, Lynn M; Yu, Chang-En

    2015-01-01

    The ɛ4 allele of the human apolipoprotein E gene (APOE) is a well-proven genetic risk factor for the late onset form of Alzheimer's disease (AD). However, the biological mechanisms through which the ɛ4 allele contributes to disease pathophysiology are incompletely understood. The three common alleles of APOE, ɛ2, ɛ3 and ɛ4, are defined by two single nucleotide polymorphisms (SNPs) that reside in the coding region of exon 4, which overlaps with a well-defined CpG island (CGI). Both SNPs change not only the protein codon but also the quantity of CpG dinucleotides, primary sites for DNA methylation. Thus, we hypothesize that the presence of an ɛ4 allele changes the DNA methylation landscape of the APOE CGI and that such epigenetic alteration contributes to AD susceptibility. To explore the relationship between APOE genotype, AD risk, and DNA methylation of the APOE CGI, we applied bisulfite pyrosequencing and evaluated methylation profiles of postmortem brain from 15 AD and 10 control subjects. We observed a tissue-specific decrease in DNA methylation with AD and identified two AD-specific differentially methylated regions (DMRs), which were also associated with APOE genotype. We further demonstrated that one DMR was completely un-methylated in a sub-population of genomes, possibly due to a subset of brain cells carrying deviated APOE methylation profiles. These data suggest that the APOE CGI is differentially methylated in AD brain in a tissue- and APOE-genotype-specific manner. Such epigenetic alteration might contribute to neural cell dysfunction in AD brain.

  2. Differential gene expression in anterior and posterior annulus fibrosus.

    PubMed

    Koerner, John D; Markova, Dessislava Z; Yadla, Sanjay; Mendelis, Joseph; Hilibrand, Alan; Vaccaro, Alexander R; Risbud, Makarand V; Albert, Todd J; Anderson, D Greg; Kepler, Christopher K

    2014-11-01

    Laboratory study. To evaluate the differential gene expression of cytokines and growth factors in anterior versus posterior annulus fibrosus (AF) intervertebral disc (IVD) specimens. Histological analysis has demonstrated regional differences in vascular and neural ingrowth in the IVD, and similar differences may exist for cytokine and growth factor expression in patients with degenerative disc disease (DDD). Regional expression of these cytokines may also be related to the pain experienced in DDD. IVD tissue was obtained from patients undergoing anterior lumbar interbody fusion surgery for back pain with radiological evidence of disc degeneration. For a control group, the discs of patients undergoing anterior lumbar discectomy for degenerative scoliosis were obtained as well. The tissue was carefully removed and separated into anterior and posterior AF. After tissue processing, an antibody array was completed to determine expression levels of 42 cytokines and growth factors. Nine discs from 7 patients with DDD and 5 discs from 2 patients with scoliosis were analyzed. In the DDD group, there were 10 cytokines and growth factors with significantly increased expression in the posterior AF versus the anterior AF ([interleukin] IL-4, IL-5, IL-6, M-CSF, MDC, tumor necrosis factor β, EGF, IGF-1, angiogenin, leptin). In the scoliosis group, only angiogenin and PDGF-BB demonstrated increased expression in the posterior AF. No cytokines or growth factors had increased expression in the anterior AF compared with posterior AF. The posterior AF expresses increased levels of cytokines and growth factors compared with the anterior AF in patients with DDD. This differential expression may be important for targeting treatment of painful IVDs. N/A.

  3. Active suppression of major histocompatibility complex class II gene expression during differentiation from B cells to plasma cells

    SciTech Connect

    Latron, F.; Maffei, A.; Scarpellino, L.; Bernard, M.; Accolla, R.S. ); Jotterand-Bellomo, M. ); Strominger, J.L. )

    1988-04-01

    Constitutive expression of major histocompatibility complex class II genes is acquired very early in B-cell ontogeny and is maintained up to the B-cell blast stage. Terminal differentiation in plasma cells is, however, accompanied by a loss of class II gene expression. In B cells this gene system is under the control of several loci encoding transacting factors with activator function, one of which, the aIr-1 gene product, operates across species barriers. In this report human class II gene expression is shown to be extinguished in somatic cell hybrids between the human class II-positive B-cell line Raji and the mouse class-II negative plasmacytoma cell line P3-U1. Since all murine chromosomes are retained in these hybrids and no preferential segregation of a specific human chromosome is observed, the results are compatible with the presence of suppressor factors of mouse origin, operating across species barriers and inhibiting class II gene expression. Suppression seems to act at the level of transcription or accumulation of class II-specific mRNA, since no human, and very few murine, class II transcripts are detectable in the hybrids.

  4. Gene duplication, population genomics, and species-level differentiation within a tropical mountain shrub.

    PubMed

    Mastretta-Yanes, Alicia; Zamudio, Sergio; Jorgensen, Tove H; Arrigo, Nils; Alvarez, Nadir; Piñero, Daniel; Emerson, Brent C

    2014-09-14

    Gene duplication leads to paralogy, which complicates the de novo assembly of genotyping-by-sequencing (GBS) data. The issue of paralogous genes is exacerbated in plants, because they are particularly prone to gene duplication events. Paralogs are normally filtered from GBS data before undertaking population genomics or phylogenetic analyses. However, gene duplication plays an important role in the functional diversification of genes and it can also lead to the formation of postzygotic barriers. Using populations and closely related species of a tropical mountain shrub, we examine 1) the genomic differentiation produced by putative orthologs, and 2) the distribution of recent gene duplication among lineages and geography. We find high differentiation among populations from isolated mountain peaks and species-level differentiation within what is morphologically described as a single species. The inferred distribution of paralogs among populations is congruent with taxonomy and shows that GBS could be used to examine recent gene duplication as a source of genomic differentiation of nonmodel species.

  5. Gene amplification during differentiation of mammalian neural stem cells in vitro and in vivo.

    PubMed

    Fischer, Ulrike; Backes, Christina; Raslan, Abdulrahman; Keller, Andreas; Meier, Carola; Meese, Eckart

    2015-03-30

    In development of amphibians and flies, gene amplification is one of mechanisms to increase gene expression. In mammalian cells, gene amplification seems to be restricted to tumorigenesis and acquiring of drug-resistance in cancer cells. Here, we report a complex gene amplification pattern in mouse neural progenitor cells during differentiation with approximately 10% of the genome involved. Half of the amplified mouse chromosome regions overlap with amplified regions previously reported in human neural progenitor cells, indicating conserved mechanisms during differentiation. Using fluorescence in situ hybridization, we verified the amplification in single cells of primary mouse mesencephalon E14 (embryonic stage) neurosphere cells during differentiation. In vivo we confirmed gene amplifications of the TRP53 gene in cryosections from mouse embryos at stage E11.5. Gene amplification is not only a cancer-related mechanism but is also conserved in evolution, occurring during differentiation of mammalian neural stem cells.

  6. Incorporating prior biological knowledge for network-based differential gene expression analysis using differentially weighted graphical LASSO.

    PubMed

    Zuo, Yiming; Cui, Yi; Yu, Guoqiang; Li, Ruijiang; Ressom, Habtom W

    2017-02-10

    Conventional differential gene expression analysis by methods such as student's t-test, SAM, and Empirical Bayes often searches for statistically significant genes without considering the interactions among them. Network-based approaches provide a natural way to study these interactions and to investigate the rewiring interactions in disease versus control groups. In this paper, we apply weighted graphical LASSO (wgLASSO) algorithm to integrate a data-driven network model with prior biological knowledge (i.e., protein-protein interactions) for biological network inference. We propose a novel differentially weighted graphical LASSO (dwgLASSO) algorithm that builds group-specific networks and perform network-based differential gene expression analysis to select biomarker candidates by considering their topological differences between the groups. Through simulation, we showed that wgLASSO can achieve better performance in building biologically relevant networks than purely data-driven models (e.g., neighbor selection, graphical LASSO), even when only a moderate level of information is available as prior biological knowledge. We evaluated the performance of dwgLASSO for survival time prediction using two microarray breast cancer datasets previously reported by Bild et al. and van de Vijver et al. Compared with the top 10 significant genes selected by conventional differential gene expression analysis method, the top 10 significant genes selected by dwgLASSO in the dataset from Bild et al. led to a significantly improved survival time prediction in the independent dataset from van de Vijver et al. Among the 10 genes selected by dwgLASSO, UBE2S, SALL2, XBP1 and KIAA0922 have been confirmed by literature survey to be highly relevant in breast cancer biomarker discovery study. Additionally, we tested dwgLASSO on TCGA RNA-seq data acquired from patients with hepatocellular carcinoma (HCC) on tumors samples and their corresponding non-tumorous liver tissues. Improved

  7. DiGeorge syndrome gene tbx1 functions through wnt11r to regulate heart looping and differentiation.

    PubMed

    Choudhry, Priya; Trede, Nikolaus S

    2013-01-01

    DiGeorge syndrome (DGS) is the most common microdeletion syndrome, and is characterized by congenital cardiac, craniofacial and immune system abnormalities. The cardiac defects in DGS patients include conotruncal and ventricular septal defects. Although the etiology of DGS is critically regulated by TBX1 gene, the molecular pathways underpinning TBX1's role in heart development are not fully understood. In this study, we characterized heart defects and downstream signaling in the zebrafish tbx1(-/-) mutant, which has craniofacial and immune defects similar to DGS patients. We show that tbx1(-/-) mutants have defective heart looping, morphology and function. Defective heart looping is accompanied by failure of cardiomyocytes to differentiate normally and failure to change shape from isotropic to anisotropic morphology in the outer curvatures of the heart. This is the first demonstration of tbx1's role in regulating heart looping, cardiomyocyte shape and differentiation, and may explain how Tbx1 regulates conotruncal development in humans. Next we elucidated tbx1's molecular signaling pathway guided by the cardiac phenotype of tbx1(-/-) mutants. We show for the first time that wnt11r (wnt11 related), a member of the non-canonical Wnt pathway, and its downstream effector gene alcama (activated leukocyte cell adhesion molecule a) regulate heart looping and differentiation similarly to tbx1. Expression of both wnt11r and alcama are downregulated in tbx1(-/-) mutants. In addition, both wnt11r (-/-) mutants and alcama morphants have heart looping and differentiation defects similar to tbx1(-/-) mutants. Strikingly, heart looping and differentiation in tbx1(-/-) mutants can be partially rescued by ectopic expression of wnt11r or alcama, supporting a model whereby heart looping and differentiation are regulated by tbx1 in a linear pathway through wnt11r and alcama. This is the first study linking tbx1 and non-canonical Wnt signaling and extends our understanding of DGS and

  8. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells

    PubMed Central

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji

    2016-01-01

    Abstract Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines. PMID:27733097

  9. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells.

    PubMed

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji; Furue, Miho K

    2016-12-15

    Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines.

  10. Widespread DNA hypomethylation and differential gene expression in Turner syndrome

    PubMed Central

    Trolle, Christian; Nielsen, Morten Muhlig; Skakkebæk, Anne; Lamy, Philippe; Vang, Søren; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Pedersen, Jakob Skou; Gravholt, Claus Højbjerg

    2016-01-01

    Adults with 45,X monosomy (Turner syndrome) reflect a surviving minority since more than 99% of fetuses with 45,X monosomy die in utero. In adulthood 45,X monosomy is associated with increased morbidity and mortality, although strikingly heterogeneous with some individuals left untouched while others suffer from cardiovascular disease, autoimmune disease and infertility. The present study investigates the leukocyte DNAmethylation profile by using the 450K-Illumina Infinium assay and the leukocyte RNA-expression profile in 45,X monosomy compared with karyotypically normal female and male controls. We present results illustrating that genome wide X-chromosome RNA-expression profile, autosomal DNA-methylation profile, and the X-chromosome methylation profile clearly distinguish Turner syndrome from controls. Our results reveal genome wide hypomethylation with most differentially methylated positions showing a medium level of methylation. Contrary to previous studies, applying a single loci specific analysis at well-defined DNA loci, our results indicate that the hypomethylation extend to repetitive elements. We describe novel candidate genes that could be involved in comorbidity in TS and explain congenital urinary malformations (PRKX), premature ovarian failure (KDM6A), and aortic aneurysm formation (ZFYVE9 and TIMP1). PMID:27687697

  11. Divergent fructokinase genes are differentially expressed in tomato.

    PubMed Central

    Kanayama, Y; Dai, N; Granot, D; Petreikov, M; Schaffer, A; Bennett, A B

    1997-01-01

    Two cDNA clones (Frk1 and Frk2) encoding fructokinase (EC 2.7.1.4) were isolated from tomato (Lycopersicon esculentum). The Frk2 cDNA encoded a deduced protein of 328 amino acids that was more than 90% identical with a previously characterized potato (Solanum tuberosum) fructokinase. In contrast, the Frk1 cDNA encoded a deduced protein of 347 amino acids that shared only 55% amino acid identity with Frk2. Both deduced proteins possessed and ATP-binding motif and putative substrate recognition site sequences identified in bacterial fructokinases. The Frk1 cDNA was expressed in a mutant yeast (Saccharomyces cerevisiae) line, which lacks the ability to phosphorylate glucose and fructose and is unable to grow on glucose or fructose. Mutant cells expressing Frk1 were complemented to grow on fructose but not glucose, indicating that Frk1 phosphorylates fructose but not glucose, and this activity was verified in extracts of transformed yeast. The mRNA corresponding to Frk2 accumulated to high levels in young, developing tomato fruit, whereas the Frk1 mRNA accumulated to higher levels late in fruit development. The results indicate that fructokinase in tomato is encoded by two divergent genes, which exhibit a differential pattern of expression during fruit development. PMID:9112782

  12. Local differentiation in the presence of gene flow in the citril finch Serinus citrinella

    PubMed Central

    Senar, Juan Carlos; Borras, Antoni; Cabrera, Josep; Cabrera, Toni; Björklund, Mats

    2005-01-01

    It is well known theoretically that gene flow can impede genetic differentiation between populations. In this study, we show that in a highly mobile bird species, where dispersal is well documented, there is a strong genetic and morphological differentiation over a very short geographical scale (less than 5 km). Allocation tests revealed that birds caught in one area were assigned genetically to the same area with a very high probability, in spite of current gene flow. Populations were also morphologically differentiated. The results suggest that the relationship between gene flow and differentiation can be rather complicated and non-intuitive. PMID:17148333

  13. Differentiation phenotypes of pancreatic islet beta- and alpha-cells are closely related with homeotic genes and a group of differentially expressed genes.

    PubMed

    Mizusawa, Noriko; Hasegawa, Tomoko; Ohigashi, Izumi; Tanaka-Kosugi, Chisato; Harada, Nagakatsu; Itakura, Mitsuo; Yoshimoto, Katsuhiko

    2004-04-28

    To identify the genes that determine differentiation phenotypes, we compared gene expression of pancreatic islet beta- and alpha-cells, which are derived from the common precursor and secrete insulin and glucagon, respectively. The expression levels of homeotic genes including Hox genes known to determine region specificity in the antero-posterior (AP) body axis, tissue-specific homeobox genes, and other 8,734 genes were compared in a beta- and alpha-cell line of MIN6 and alpha TC1.6. The expression of homeotic genes were surveyed with reverse transcription-polymerase chain reaction (RT-PCR) using degenerate primers corresponding to invariant amino acid sequences within the homeodomain and subsequently with specific primers. Expression of Hoxc6, Hoxc9, Hoxc10, Pdx1, Cdx2, Gbx2, Pax4, and Hlxb9 genes in MIN6 was higher than those in alpha TC1.6, while expression of Hoxa2, Hoxa3, Hoxa5, Hoxa6, Hoxa7, Hoxa9, Hoxa10, Hoxa13, Hoxb3, Hoxb5, Hoxb6, Hoxb13, Hoxb8, and Brain4 genes in alpha TC1.6 was higher than those in MIN6. Out of 8,734 mouse genes screened with high-density mouse cDNA microarrays for MIN6- and alpha TC1.6-derived cDNA, 58 and 25 genes were differentially over- and under-expressed in MIN6, respectively. GLUTag, which is derived from a large bowel tumor and expresses the proglucagon gene, showed a comparatively similar expression profile to that of alpha TC1.6 in both homeotic and other genes analyzed in cDNA microarray. Our results are consistent with the interpretation that not only the tissue-specific homeotic genes, but also Hox genes are related to differentiation phenotypes of pancreatic beta- and alpha-cells rather than their regional specification of the body in vertebrates.

  14. A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes

    PubMed Central

    Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

    2015-01-01

    In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data. PMID:26201006

  15. Comprehensive DNA Methylation and Gene Expression Profiling in Differentiating Human Adipocytes.

    PubMed

    van den Dungen, Myrthe W; Murk, Albertinka J; Kok, Dieuwertje E; Steegenga, Wilma T

    2016-12-01

    Insight into the processes controlling adipogenesis is important in the battle against the obesity epidemic and its related disorders. The transcriptional regulatory cascade involved in adipocyte differentiation has been extensively studied, however, the mechanisms driving the transcription activation are still poorly understood. In this study, we explored the involvement of DNA methylation in transcriptional regulation during adipocyte differentiation of primary human mesenchymal stem cells (hMSCs). Genome-wide changes in DNA methylation were measured using the Illumina 450K BeadChip. In addition, expression of 84 adipogenic genes was determined, of which 43 genes showed significant expression changes during the differentiation process. Among these 43 differentially expressed genes, differentially methylated regions (DMRs) were detected in only three genes. By comparing genome-wide DNA methylation profiles in undifferentiated and differentiated adipocytes 793 significant DMRs were detected. Pathway analysis revealed the adipogenesis pathway as the most statistically significant, although only a small number of genes were differentially methylated. Genome-wide DNA methylation changes for single probes were most often located in intergenic regions, and underrepresented close to the transcription start site. In conclusion, DNA methylation remained relatively stable during adipocyte differentiation, implying that changes in DNA methylation are not the underlying mechanism regulating gene expression during adipocyte differentiation. J. Cell. Biochem. 117: 2707-2718, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Characterization of Differentially Expressed Genes Involved in Pathways Associated with Gastric Cancer

    PubMed Central

    Li, Hao; Yu, Beiqin; Li, Jianfang; Su, Liping; Yan, Min; Zhang, Jun; Li, Chen; Zhu, Zhenggang; Liu, Bingya

    2015-01-01

    To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR) value was < 0.01, P-value was <0.01 and the fold change (FC) was >2. Subsequently, Gene Ontology (GO) categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease. PMID:25928635

  17. Unravelling personalized dysfunctional gene network of complex diseases based on differential network model.

    PubMed

    Yu, Xiangtian; Zeng, Tao; Wang, Xiangdong; Li, Guojun; Chen, Luonan

    2015-06-13

    In the conventional analysis of complex diseases, the control and case samples are assumed to be of great purity. However, due to the heterogeneity of disease samples, many disease genes are even not always consistently up-/down-regulated, leading to be under-estimated. This problem will seriously influence effective personalized diagnosis or treatment. The expression variance and expression covariance can address such a problem in a network manner. But, these analyses always require multiple samples rather than one sample, which is generally not available in clinical practice for each individual. To extract the common and specific network characteristics for individual patients in this paper, a novel differential network model, e.g. personalized dysfunctional gene network, is proposed to integrate those genes with different features, such as genes with the differential gene expression (DEG), genes with the differential expression variance (DEVG) and gene-pairs with the differential expression covariance (DECG) simultaneously, to construct personalized dysfunctional networks. This model uses a new statistic-like measurement on differential information, i.e., a differential score (DEVC), to reconstruct the differential expression network between groups of normal and diseased samples; and further quantitatively evaluate different feature genes in the patient-specific network for each individual. This DEVC-based differential expression network (DEVC-net) has been applied to the study of complex diseases for prostate cancer and diabetes. (1) Characterizing the global expression change between normal and diseased samples, the differential gene networks of those diseases were found to have a new bi-coloured topological structure, where their non hub-centred sub-networks are mainly composed of genes/proteins controlling various biological processes. (2) The differential expression variance/covariance rather than differential expression is new informative sources, and can

  18. Gene expression kinetics in individual plasmodial cells reveal alternative programs of differential regulation during commitment and differentiation.

    PubMed

    Rätzel, Viktoria; Marwan, Wolfgang

    2015-05-26

    During its life cycle, the amoebozoon Physarum polycephalum forms multinucleate plasmodial cells that can grow to macroscopic size while maintaining a naturally synchronous population of nuclei. Sporulation-competent plasmodia were stimulated through photoactivation of the phytochrome photoreceptor and the expression of sporulation marker genes was analyzed quantitatively by repeatedly taking samples of the same plasmodial cell at successive time points after the stimulus pulse. Principal component analysis of the gene expression data revealed that plasmodial cells take different trajectories leading to cell fate decision and differentiation and suggested that averaging over individual cells is inappropriate. Queries for genes with pairwise correlated expression kinetics revealed qualitatively different patterns of co-regulation, indicating that alternative programs of differential regulation are operational in individual plasmodial cells. At the single cell level, the response to stimulation of a non-sporulating mutant was qualitatively different as compared to the wild type with respect to the differentially regulated genes and their patterns of co-regulation. The observation of individual differences during commitment and differentiation supports the concept of a Waddington-type quasipotential landscape for the regulatory control of cell differentiation. Comparison of wild type and sporulation mutant data further supports the idea that mutations may impact the topology of this landscape.

  19. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  20. Fat accumulation in differentiated brown adipocytes is linked with expression of Hox genes.

    PubMed

    Singh, Smita; Rajput, Yudhishthir S; Barui, Amit K; Sharma, Rajan; Datta, Tirtha K

    2016-03-01

    Homeobox (Hox) genes are involved in body plan of embryo along the anterior-posterior axis. Presence of several Hox genes in white adipose tissue (WAT) and brown adipose tissue (BAT) is indicative of involvement of Hox genes in adipogenesis. We propose that differentiation inducing agents viz. isobutyl-methyl-xanthine (IBMX), indomethacin, dexamethasone (DEX), triiodothyronine (T3) and insulin may regulate differentiation in brown adipose tissue through Hox genes. In vitro culture of brown fat stromalvascular fraction (SVF) in presence or absence of differentiation inducing agents was used for establishing relationship between fat accumulation in differentiated adipocytes and expression of Hox genes. Relative expression of Pref1, UCP1 and Hox genes was determined in different stages of adipogenesis. Presence or absence of IBMX, indomethacin and DEX during differentiation of proliferated pre-adipocytes resulted in marked differences in expression of Hox genes and lipid accumulation. In presence of these inducing agents, lipid accumulation as well as expression of HoxA1, HoxA5, HoxC4 &HoxC8 markedly enhanced. Irrespective of presence or absence of T3, insulin down regulates HoxA10. T3 results in over expression of HoxA5, HoxC4 and HoxC8 genes, whereas insulin up regulates expression of only HoxC8. Findings suggest that accumulation of fat in differentiated adipocytes is linked with expression of Hox genes.

  1. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

    PubMed Central

    Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

  2. A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

    PubMed

    Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

  3. Genomic Determinants of Gene Regulation by 1,25-Dihydroxyvitamin D3 during Osteoblast-lineage Cell Differentiation*♦

    PubMed Central

    Meyer, Mark B.; Benkusky, Nancy A.; Lee, Chang-Hun; Pike, J. Wesley

    2014-01-01

    The biological effects of 1α,25-dihydroxyvitamin D3 (1,25 (OH)2D3) on osteoblast differentiation and function differ significantly depending upon the cellular state of maturation. To explore this phenomenon mechanistically, we examined the impact of 1,25(OH)2D3 on the transcriptomes of both pre-osteoblastic (POBs) and differentiated osteoblastic (OBs) MC3T3-E1 cells, and assessed localization of the vitamin D receptor (VDR) at sites of action on a genome-scale using ChIP sequence analysis. We observed that the 1,25(OH)2D3-induced transcriptomes of POBs and OBs were quantitatively and qualitatively different, supporting not only the altered biology observed but the potential for a change in VDR interaction at the genome as well. This idea was confirmed through discovery that VDR cistromes in POBs and OBs were also strikingly different. Depletion of VDR-binding sites in OBs, due in part to reduced VDR expression, was the likely cause of the loss of VDR-target gene interaction. Continued novel regulation by 1,25(OH)2D3, however, suggested that factors in addition to the VDR might also be involved. Accordingly, we show that transcriptomic modifications are also accompanied by changes in genome binding of the master osteoblast regulator RUNX2 and the chromatin remodeler CCAAT/enhancer-binding protein β. Importantly, genome occupancy was also highlighted by the presence of epigenetic enhancer signatures that were selectively changed in response to both differentiation and 1,25(OH)2D3. The impact of VDR, RUNX2, and C/EBPβ on osteoblast differentiation is exemplified by their actions at the Runx2 and Sp7 gene loci. We conclude that each of these mechanisms may contribute to the diverse actions of 1,25(OH)2D3 on differentiating osteoblasts. PMID:24891508

  4. Genome-wide gene amplification during differentiation of neural progenitor cells in vitro.

    PubMed

    Fischer, Ulrike; Keller, Andreas; Voss, Meike; Backes, Christina; Welter, Cornelius; Meese, Eckart

    2012-01-01

    DNA sequence amplification is a phenomenon that occurs predictably at defined stages during normal development in some organisms. Developmental gene amplification was first described in amphibians during gametogenesis and has not yet been described in humans. To date gene amplification in humans is a hallmark of many tumors. We used array-CGH (comparative genomic hybridization) and FISH (fluorescence in situ hybridization) to discover gene amplifications during in vitro differentiation of human neural progenitor cells. Here we report a complex gene amplification pattern two and five days after induction of differentiation of human neural progenitor cells. We identified several amplified genes in neural progenitor cells that are known to be amplified in malignant tumors. There is also a striking overlap of amplified chromosomal regions between differentiating neural progenitor cells and malignant tumor cells derived from astrocytes. Gene amplifications in normal human cells as physiological process has not been reported yet and may bear resemblance to developmental gene amplifications in amphibians and insects.

  5. A Model-Based Joint Identification of Differentially Expressed Genes and Phenotype-Associated Genes

    PubMed Central

    Seo, Minseok; Shin, Su-kyung; Kwon, Eun-Young; Kim, Sung-Eun; Bae, Yun-Jung; Lee, Seungyeoun; Sung, Mi-Kyung; Choi, Myung-Sook; Park, Taesung

    2016-01-01

    Over the last decade, many analytical methods and tools have been developed for microarray data. The detection of differentially expressed genes (DEGs) among different treatment groups is often a primary purpose of microarray data analysis. In addition, association studies investigating the relationship between genes and a phenotype of interest such as survival time are also popular in microarray data analysis. Phenotype association analysis provides a list of phenotype-associated genes (PAGs). However, it is sometimes necessary to identify genes that are both DEGs and PAGs. We consider the joint identification of DEGs and PAGs in microarray data analyses. The first approach we used was a naïve approach that detects DEGs and PAGs separately and then identifies the genes in an intersection of the list of PAGs and DEGs. The second approach we considered was a hierarchical approach that detects DEGs first and then chooses PAGs from among the DEGs or vice versa. In this study, we propose a new model-based approach for the joint identification of DEGs and PAGs. Unlike the previous two-step approaches, the proposed method identifies genes simultaneously that are DEGs and PAGs. This method uses standard regression models but adopts different null hypothesis from ordinary regression models, which allows us to perform joint identification in one-step. The proposed model-based methods were evaluated using experimental data and simulation studies. The proposed methods were used to analyze a microarray experiment in which the main interest lies in detecting genes that are both DEGs and PAGs, where DEGs are identified between two diet groups and PAGs are associated with four phenotypes reflecting the expression of leptin, adiponectin, insulin-like growth factor 1, and insulin. Model-based approaches provided a larger number of genes, which are both DEGs and PAGs, than other methods. Simulation studies showed that they have more power than other methods. Through analysis of

  6. Melanoma differentiation associated gene-7 (mda-7): a novel anti-tumor gene for cancer gene therapy.

    PubMed Central

    Mhashilkar, A. M.; Schrock, R. D.; Hindi, M.; Liao, J.; Sieger, K.; Kourouma, F.; Zou-Yang, X. H.; Onishi, E.; Takh, O.; Vedvick, T. S.; Fanger, G.; Stewart, L.; Watson, G. J.; Snary, D.; Fisher, P. B.; Saeki, T.; Roth, J. A.; Ramesh, R.; Chada, S.

    2001-01-01

    BACKGROUND: The mda-7 gene (melanoma differentiation associated gene-7) is a novel tumor suppressor gene. The anti-proliferative activity of MDA-7 has been previously reported. In this report, we analyze the anti-tumor efficacy of Ad-mda7 in a broad spectrum of cancer lines. MATERIALS AND METHODS: Ad-mda7-transduced cancer or normal cell lines were assayed for cell proliferation (tritiated thymidine incorporation assay, Alamar blue assay, and trypan-blue exclusion assay), apoptosis (TUNEL, and Annexin V staining visualized by fluorescent microscopy or FACs analysis), and cell cycle regulation (Propidium Iodide staining and FACs analysis). RESULTS: Ad-mda7 treatment of tumor cells resulted in growth inhibition and apoptosis in a temporal and dose-dependent manner. The anti-tumor effects were independent of the genomic status of p53, RB, p16, ras, bax, and caspase 3 in these cells. In addition, normal cell lines did not show inhibition of proliferation or apoptotic response to Ad-mda7. Moreover, Ad-mda7-transduced cancer cells secreted a soluble form of MDA-7 protein. Thus, Ad-mda7 may represent a novel gene-therapeutic agent for the treatment of a variety of cancers. CONCLUSIONS: The potent and selective killing activity of Ad-mda7 in cancer cells but not in normal cells makes this vector a potential candidate for cancer gene therapy. PMID:11471572

  7. RNAi Knockdown of Ape1 Gene in the Differentiation of Mouse Embryonic Stem Cells.

    PubMed

    Zou, Gang-Ming; Yu, Jieqing; LeBron, Cynthia; Fu, Yumei

    2017-01-01

    Murine embryonic stem cells (ES) are pluripotent cells and have the potential to become a wide variety of specialized cell types. Mouse ES cell differentiation can be regarded as a valuable biological tool that has led to major advances in our understanding of cell and developmental biology. In vitro differentiation of mouse ES cells can be directed to a specific lineage formation, such as hematopoietic lineage, by appropriate cytokine and/or growth factor stimulation. To study specific gene function in early developmental events, gene knockout approaches have been traditionally used, however, this is a time-consuming and expensive approach. Recently, we have shown that siRNA is an effective strategy to knock down target gene expression, such as Ape1, during ES cell differentiation, and consequently, one can alter cell fates in ES-derived differentiated cells. This approach will be applicable to test the function of a wide variety of gene products using the ES cell differentiation system.

  8. Differential expression of genes related to gain and intake in the liver of beef cattle

    USDA-ARS?s Scientific Manuscript database

    Background: To better understand which genes play a role in cattle feed intake and gain, we evaluated differential expression of genes related to gain and intake in the liver of crossbred beef steers. Based on past transcriptomics studies on cattle liver, we hypothesized that genes related to metabo...

  9. Identification of differentially expressed genes induced by beet curly top virus infection in sugarbeet

    USDA-ARS?s Scientific Manuscript database

    Resistance to beet curly top virus (BCTV) trait is crucial in Western USA. There is sparse public knowledge of genes regulating resistance. This research focused on gene expression profiling of resistance to the three BCTV strains: Cal/Logan (Cal), Worland (Wor), and severe. Differential gene exp...

  10. Comprehensive Gene Expression Analysis of Human Embryonic Stem Cells during Differentiation into Neural Cells

    PubMed Central

    Fathi, Ali; Hatami, Maryam; Hajihosseini, Vahid; Fattahi, Faranak; Kiani, Sahar; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

    2011-01-01

    Global gene expression analysis of human embryonic stem cells (hESCs) that differentiate into neural cells would help to further define the molecular mechanisms involved in neurogenesis in humans. We performed a comprehensive transcripteome analysis of hESC differentiation at three different stages: early neural differentiation, neural ectoderm, and differentiated neurons. We identified and validated time-dependent gene expression patterns and showed that the gene expression patterns reflect early ESC differentiation. Sets of genes are induced in primary ectodermal lineages and then in differentiated neurons, constituting consecutive waves of known and novel genes. Pathway analysis revealed dynamic expression patterns of members of several signaling pathways, including NOTCH, mTOR and Toll like receptors (TLR), during neural differentiation. An interaction network analysis revealed that the TGFβ family of genes, including LEFTY1, ID1 and ID2, are possible key players in the proliferation and maintenance of neural ectoderm. Collectively, these results enhance our understanding of the molecular dynamics underlying neural commitment and differentiation. PMID:21829537

  11. Differentially correlated genes in co-expression networks control phenotype transitions.

    PubMed

    Thomas, Lina D; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Co-expression networks are a tool widely used for analysis of "Big Data" in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as "bottlenecks" rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we showed that they play

  12. Differentially correlated genes in co-expression networks control phenotype transitions

    PubMed Central

    Thomas, Lina D.; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey

    2016-01-01

    Background: Co-expression networks are a tool widely used for analysis of “Big Data” in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as “bottlenecks” rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we

  13. Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes

    PubMed Central

    Premzl, Marko

    2015-01-01

    Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed. PMID:25941635

  14. Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes.

    PubMed

    Premzl, Marko

    2015-06-01

    Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed.

  15. Joint analysis of differential gene expression in multiple studies using correlation motifs

    PubMed Central

    Wei, Yingying; Tenzen, Toyoaki; Ji, Hongkai

    2015-01-01

    The standard methods for detecting differential gene expression are mostly designed for analyzing a single gene expression experiment. When data from multiple related gene expression studies are available, separately analyzing each study is not ideal as it may fail to detect important genes with consistent but relatively weak differential signals in multiple studies. Jointly modeling all data allows one to borrow information across studies to improve the analysis. However, a simple concordance model, in which each gene is assumed to be differential in either all studies or none of the studies, is incapable of handling genes with study-specific differential expression. In contrast, a model that naively enumerates and analyzes all possible differential patterns across studies can deal with study-specificity and allow information pooling, but the complexity of its parameter space grows exponentially as the number of studies increases. Here, we propose a correlation motif approach to address this dilemma. This approach searches for a small number of latent probability vectors called correlation motifs to capture the major correlation patterns among multiple studies. The motifs provide the basis for sharing information among studies and genes. The approach has flexibility to handle all possible study-specific differential patterns. It improves detection of differential expression and overcomes the barrier of exponential model complexity. PMID:25143368

  16. A Cbx8-Containing Polycomb Complex Facilitates the Transition to Gene Activation during ES Cell Differentiation

    PubMed Central

    Malinverni, Roberto; Valero, Vanesa; Buschbeck, Marcus

    2014-01-01

    Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq). Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs. PMID:25500566

  17. Reciprocal gene replacements reveal unique functions for Phox2 genes during neural differentiation

    PubMed Central

    Coppola, Eva; Pattyn, Alexandre; Guthrie, Sarah C; Goridis, Christo; Studer, Michèle

    2005-01-01

    The paralogous paired-like homeobox genes Phox2a and Phox2b are involved in the development of specific neural subtypes in the central and peripheral nervous systems. The different phenotypes of Phox2 knockout mutants, together with their asynchronous onset of expression, prompted us to generate two knock-in mutant mice, in which Phox2a is replaced by the Phox2b coding sequence, and vice versa. Our results indicate that Phox2a and Phox2b are not functionally equivalent, as only Phox2b can fulfill the role of Phox2a in the structures that depend on both genes. Furthermore, we demonstrate unique roles of Phox2 genes in the differentiation of specific motor neurons. Whereas the oculomotor and the trochlear neurons require Phox2a for their proper development, the migration of the facial branchiomotor neurons depends on Phox2b. Therefore, our analysis strongly indicates that biochemical differences between the proteins rather than temporal regulation of their expression account for the specific function of each paralogue. PMID:16319924

  18. Gene expression profiling of bone marrow mesenchymal stem cells from Osteogenesis Imperfecta patients during osteoblast differentiation.

    PubMed

    Kaneto, Carla Martins; Pereira Lima, Patrícia S; Prata, Karen Lima; Dos Santos, Jane Lima; de Pina Neto, João Monteiro; Panepucci, Rodrigo Alexandre; Noushmehr, Houtan; Covas, Dimas Tadeu; de Paula, Francisco José Alburquerque; Silva, Wilson Araújo

    2017-06-01

    Mesenchymal stem cells (MSCs) are precursors present in adult bone marrow that are able to differentiate into osteoblasts, adipocytes and chondroblasts that have gained great importance as a source for cell therapy. Recently, a number of studies involving the analysis of gene expression of undifferentiated MSCs and of MSCs in the differentiation into multiple lineage processes were observed but there is no information concerning the gene expression of MSCs from Osteogenesis Imperfecta (OI) patients. Osteogenesis Imperfecta is characterized as a genetic disorder in which a generalized osteopenia leads to excessive bone fragility and severe bone deformities. The aim of this study was to analyze gene expression profile during osteogenic differentiation from BMMSCs (Bone Marrow Mesenchymal Stem Cells) obtained from patients with Osteogenesis Imperfecta and from control subjects. Bone marrow samples were collected from three normal subjects and five patients with OI. Mononuclear cells were isolated for obtaining mesenchymal cells that had been expanded until osteogenic differentiation was induced. RNA was harvested at seven time points during the osteogenic differentiation period (D0, D+1, D+2, D+7, D+12, D+17 and D+21). Gene expression analysis was performed by the microarray technique and identified several differentially expressed genes. Some important genes for osteoblast differentiation had lower expression in OI patients, suggesting a smaller commitment of these patient's MSCs with the osteogenic lineage. Other genes also had their differential expression confirmed by RT-qPCR. An increase in the expression of genes related to adipocytes was observed, suggesting an increase of adipogenic differentiation at the expense osteogenic differentiation. Copyright © 2017. Published by Elsevier Masson SAS.

  19. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  20. Differential replication dynamics for large and small Vibrio chromosomes affect gene dosage, expression and location

    PubMed Central

    Dryselius, Rikard; Izutsu, Kaori; Honda, Takeshi; Iida, Tetsuya

    2008-01-01

    Background Replication of bacterial chromosomes increases copy numbers of genes located near origins of replication relative to genes located near termini. Such differential gene dosage depends on replication rate, doubling time and chromosome size. Although little explored, differential gene dosage may influence both gene expression and location. For vibrios, a diverse family of fast growing gammaproteobacteria, gene dosage may be particularly important as they harbor two chromosomes of different size. Results Here we examined replication dynamics and gene dosage effects for the separate chromosomes of three Vibrio species. We also investigated locations for specific gene types within the genome. The results showed consistently larger gene dosage differences for the large chromosome which also initiated replication long before the small. Accordingly, large chromosome gene expression levels were generally higher and showed an influence from gene dosage. This was reflected by a higher abundance of growth essential and growth contributing genes of which many locate near the origin of replication. In contrast, small chromosome gene expression levels were low and appeared independent of gene dosage. Also, species specific genes are highly abundant and an over-representation of genes involved in transcription could explain its gene dosage independent expression. Conclusion Here we establish a link between replication dynamics and differential gene dosage on one hand and gene expression levels and the location of specific gene types on the other. For vibrios, this relationship appears connected to a polarisation of genetic content between its chromosomes, which may both contribute to and be enhanced by an improved adaptive capacity. PMID:19032792

  1. Mitochondrial DNA haplotypes induce differential patterns of DNA methylation that result in differential chromosomal gene expression patterns

    PubMed Central

    Lee, William T; Sun, Xin; Tsai, Te-Sha; Johnson, Jacqueline L; Gould, Jodee A; Garama, Daniel J; Gough, Daniel J; McKenzie, Matthew; Trounce, Ian A; St. John, Justin C

    2017-01-01

    Mitochondrial DNA copy number is strictly regulated during development as naive cells differentiate into mature cells to ensure that specific cell types have sufficient copies of mitochondrial DNA to perform their specialised functions. Mitochondrial DNA haplotypes are defined as specific regions of mitochondrial DNA that cluster with other mitochondrial sequences to show the phylogenetic origins of maternal lineages. Mitochondrial DNA haplotypes are associated with a range of phenotypes and disease. To understand how mitochondrial DNA haplotypes induce these characteristics, we used four embryonic stem cell lines that have the same set of chromosomes but possess different mitochondrial DNA haplotypes. We show that mitochondrial DNA haplotypes influence changes in chromosomal gene expression and affinity for nuclear-encoded mitochondrial DNA replication factors to modulate mitochondrial DNA copy number, two events that act synchronously during differentiation. Global DNA methylation analysis showed that each haplotype induces distinct DNA methylation patterns, which, when modulated by DNA demethylation agents, resulted in skewed gene expression patterns that highlight the effectiveness of the new DNA methylation patterns established by each haplotype. The haplotypes differentially regulate α-ketoglutarate, a metabolite from the TCA cycle that modulates the TET family of proteins, which catalyse the transition from 5-methylcytosine, indicative of DNA methylation, to 5-hydroxymethylcytosine, indicative of DNA demethylation. Our outcomes show that mitochondrial DNA haplotypes differentially modulate chromosomal gene expression patterns of naive and differentiating cells by establishing mitochondrial DNA haplotype-specific DNA methylation patterns. PMID:28900542

  2. Comparative Transcriptomic Analyses of Differentially Expressed Genes in Transgenic Melatonin Biosynthesis Ovine HIOMT Gene in Switchgrass

    PubMed Central

    Yuan, Shan; Guan, Cong; Liu, Sijia; Huang, Yanhua; Tian, Danyang; Cui, Xin; Zhang, Yunwei; Yang, Fuyu

    2016-01-01

    Melatonin serves pleiotropic functions in prompting plant growth and resistance to various stresses. The accurate biosynthetic pathway of melatonin remains elusive in plant species, while the N-acetyltransferase and O-methyltransferase were considered to be the last two key enzymes during its biosynthesis. To investigate the biosynthesis and metabolic pathway of melatonin in plants, the RNA-seq profile of overexpression of the ovine HIOMT was analyzed and compared with the previous transcriptome of transgenic oAANAT gene in switchgrass, a model plant for cellulosic ethanol production. A total of 946, 405, and 807 differentially expressed unigenes were observed in AANAT vs. control, HIOMT vs. control, and AANAT vs. HIOMT, respectively. Two hundred and seventy-five upregulated and 130 downregulated unigenes were detected in transgenic oHIOMT line comparing with control, including the significantly upregulated (F-box/kelch-repeat protein, zinc finger BED domain-containing protein-3) genes, which were potentially correlated with enhanced phenotypes of shoot, stem and root growth in transgenic oHIOMT switchgrass. Several stress resistant related genes (SPX domain-containing membrane protein, copper transporter 1, late blight resistance protein homolog R1A-6 OS etc.) were specifically and significantly upregulated in transgenic oHIOMT only, while metabolism-related genes (phenylalanine-4-hydroxylase, tyrosine decarboxylase 1, protein disulfide-isomerase and galactinol synthase 2 etc.) were significantly upregulated in transgenic oAANAT only. These results provide new sights into the biosynthetic and physiological functional networks of melatonin in plants. PMID:27877177

  3. A role for the Drosophila neurogenic genes in mesoderm differentiation.

    PubMed

    Corbin, V; Michelson, A M; Abmayr, S M; Neel, V; Alcamo, E; Maniatis, T; Young, M W

    1991-10-18

    The neurogenic genes of Drosophila have long been known to regulate cell fate decisions in the developing ectoderm. In this paper we show that these genes also control mesoderm development. Embryonic cells that express the muscle-specific gene nautilus are overproduced in each of seven neurogenic mutants (Notch, Delta, Enhancer of split, big brain, mastermind, neuralized, and almondex), at the apparent expense of neighboring, nonexpressing mesodermal cells. The mesodermal defect does not appear to be a simple consequence of associated neural hypertrophy, suggesting that the neurogenic genes may function similarly and independently in establishing cell fates in both ectoderm and mesoderm. Altered patterns of beta 3-tubulin and myosin heavy chain gene expression in the mutants indicate a role for the neurogenic genes in development of most visceral and somatic muscles. We propose that the signal produced by the neurogenic genes is a general one, effective in both ectoderm and mesoderm.

  4. Viral oncogenes, proto-oncogenes and homoeotic genes related to cell proliferation and differentiation.

    PubMed

    Antohi, S; Antohi-Talle, O

    1987-01-01

    Molecular studies on viral oncogenes and their products have led to the discovery of physiological proto-oncogenes, involved in the control of cell proliferation and gene activation. Other genetic and molecular investigations, initiated in Drosophila melanogaster and continued in different multicellular eukaryotes, have made evident the homoeotic genes, which are directly correlated with cell specialization, in the complex processes of differentiation and morphogenesis. Both gene classes are conserved to a high extent during evolution. They are involved in the eukaryotic mechanisms of differentiation control and proto-oncogenes, in particular, are related to malignant transformation. Some available data suggest a certain extent of relatedness between the gene products of both gene classes. A differentiation trigger model, including retroviral transposition, homoeotic genes and proto-oncogenes is discussed.

  5. Divergence and differential expression of soybean actin genes.

    PubMed Central

    Hightower, R C; Meagher, R B

    1985-01-01

    DNA sequence analysis as well as genomic blotting experiments using cloned soybean actin DNA sequences as probes show that large sequence heterogeneity exists among members of the soybean actin multigene family. This heterogeneity suggested that the members of this family might be diverged in function and/or regulation. Five of the six soybean actin gene family members examined are shown to be significantly more diverged from one another than members of other known actin gene families. This high level of divergence was utilized in the preparation of actin gene-specific probes in the analysis of the complexity and expression of these members of the soybean actin gene family. Hybridization studies indicate that the six soybean actin genes fall into three classes with a pair of genes in each class. These six genes account for all but two actin gene fragments detected in the soybean genome. We have compared the relative steady state mRNA levels of these classes of soybean actin genes in three organs of soybean. We find that actin genes SAc6 and SAc7 are most highly expressed accounting for 80% of all actin mRNA with respect to the six soybean actin genes examined. Actin genes SAc3 and SAc1 are expressed at intermediate and low levels respectively; and SAc2 and SAc4 are expressed at barely detectable levels. Four of the six soybean actin genes appear to be expressed at the same level in root, shoot and hypocotyl. SAc3 and SAc7 genes appear to be more highly expressed in shoot and 2,4-dichlorophenoxyacetic acid-induced hypocotyl than in root and hypocotyl.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:2410251

  6. Effects of Sample Size on Differential Gene Expression, Rank Order and Prediction Accuracy of a Gene Signature

    PubMed Central

    Stretch, Cynthia; Khan, Sheehan; Asgarian, Nasimeh; Eisner, Roman; Vaisipour, Saman; Damaraju, Sambasivarao; Graham, Kathryn; Bathe, Oliver F.; Steed, Helen; Greiner, Russell; Baracos, Vickie E.

    2013-01-01

    Top differentially expressed gene lists are often inconsistent between studies and it has been suggested that small sample sizes contribute to lack of reproducibility and poor prediction accuracy in discriminative models. We considered sex differences (69♂, 65♀) in 134 human skeletal muscle biopsies using DNA microarray. The full dataset and subsamples (n = 10 (5♂, 5♀) to n = 120 (60♂, 60♀)) thereof were used to assess the effect of sample size on the differential expression of single genes, gene rank order and prediction accuracy. Using our full dataset (n = 134), we identified 717 differentially expressed transcripts (p<0.0001) and we were able predict sex with ∼90% accuracy, both within our dataset and on external datasets. Both p-values and rank order of top differentially expressed genes became more variable using smaller subsamples. For example, at n = 10 (5♂, 5♀), no gene was considered differentially expressed at p<0.0001 and prediction accuracy was ∼50% (no better than chance). We found that sample size clearly affects microarray analysis results; small sample sizes result in unstable gene lists and poor prediction accuracy. We anticipate this will apply to other phenotypes, in addition to sex. PMID:23755224

  7. Stage and gene specific signatures defined by histones H3K4me2 and H3K27me3 accompany mammalian retina maturation in vivo.

    PubMed

    Popova, Evgenya Y; Xu, Xuming; DeWan, Andrew T; Salzberg, Anna C; Berg, Arthur; Hoh, Josephine; Zhang, Samuel S; Barnstable, Colin J

    2012-01-01

    The epigenetic contribution to neurogenesis is largely unknown. There is, however, growing evidence that posttranslational modification of histones is a dynamic process that shows many correlations with gene expression. Here we have followed the genome-wide distribution of two important histone H3 modifications, H3K4me2 and H3K27me3 during late mouse retina development. The retina provides an ideal model for these studies because of its well-characterized structure and development and also the extensive studies of the retinal transcriptome and its development. We found that a group of genes expressed only in mature rod photoreceptors have a unique signature consisting of de-novo accumulation of H3K4me2, both at the transcription start site (TSS) and over the whole gene, that correlates with the increase in transcription, but no accumulation of H3K27me3 at any stage. By in silico analysis of this unique signature we have identified a larger group of genes that may be selectively expressed in mature rod photoreceptors. We also found that the distribution of H3K4me2 and H3K27me3 on the genes widely expressed is not always associated with their transcriptional levels. Different histone signatures for retinal genes with the same gene expression pattern suggest the diversities of epigenetic regulation. Genes without H3K4me2 and H3K27me3 accumulation at any stage represent a large group of transcripts never expressed in retina. The epigenetic signatures defined by H3K4me2 and H3K27me3 can distinguish cell-type specific genes from widespread transcripts and may be reflective of cell specificity during retina maturation. In addition to the developmental patterns seen in wild type retina, the dramatic changes of histone modification in the retinas of mutant animals lacking rod photoreceptors provide a tool to study the epigenetic changes in other cell types and thus describe a broad range of epigenetic events in a solid tissue in vivo.

  8. Reversal of age-associated cognitive deficits is accompanied by increased plasticity-related gene expression after chronic antidepressant administration in middle-aged mice.

    PubMed

    Li, Yan; Abdourahman, Aicha; Tamm, Joseph A; Pehrson, Alan L; Sánchez, Connie; Gulinello, Maria

    2015-08-01

    Cognitive decline occurs during healthy aging, even in middle-aged subjects, via mechanisms that could include reduced stem cell proliferation, changed growth factor expression and/or reduced expression of synaptic plasticity genes. Although antidepressants alter these mechanisms in young rodents, their effects in older animals are unclear. In middle-aged mice, we examined the effects of a selective serotonin reuptake inhibitor (fluoxetine) and a multimodal antidepressant (vortioxetine) on cognitive and affective behaviors, brain stem cell proliferation, growth factor and gene expression. Twelve-month-old female C57BL/6 mice exhibited impaired visuospatial memory in the novel object placement (location) task associated with reduced expression of several plasticity-related genes. Chronic treatment with vortioxetine, but not fluoxetine, improved visuospatial memory and reduced depression-like behavior in the forced swim test in middle-aged mice. Vortioxetine, but not fluoxetine, increased hippocampal expression of several neuroplasticity-related genes in middle-aged mice (e.g., Nfkb1, Fos, Fmr1, Camk2a, Arc, Shank1, Nlgn2, and Rab3a). Neither drug reversed the age-associated decrease in stem cell proliferation. Hippocampal growth factor levels were not consistent with behavioral outcomes. Thus, a change in the expression of multiple genes involved in neuronal plasticity by antidepressant treatment was associated with improved cognitive function and a reduction in depression-like behavior in middle-aged mice. Copyright © 2015. Published by Elsevier Inc.

  9. Induction of differentiation of the human myeloid cell line, ML3, by tumour necrosis factor and interferon-gamma is accompanied by enhanced expression of the CD4 protein and messenger RNA.

    PubMed

    Cassatella, M A; Trinchieri, G; Hassan, N F; Hartman, L; Sorio, C; Berton, G

    1992-05-01

    Tumour necrosis factor (TNF) and interferon-gamma (IFN-gamma) induce differentiation of human myeloid cell lines along the monocytic lineage. In this study we investigated the effects of TNF and IFN-gamma on the expression of the CD4 protein and messenger RNA (mRNA) in the two myeloid cell lines, ML3 and HL-60. We observed that CD4 antigen expression on ML3 cells is almost undetectable and that TNF and IFN-gamma induced CD4 antigen expression on these cells. HL-60 cells express surface CD4 antigen at high density and treatment with TNF and IFN-gamma caused a decrease of CD4 expression. We also investigated the expression of CD4 mRNA in ML3 and HL-60 cells. ML3 constitutively express, albeit at low levels, CD4 mRNA. TNF induced CD4 mRNA in ML3 cells and IFN-gamma synergistically potentiated the effect of TNF, thus indicating that the enhanced expression of the CD4 protein on ML3 cells is due, at least in part, to an enhanced accumulation of the CD4 mRNA. CD4 mRNA is constitutively expressed in HL-60 cells at high levels. TNF and IFN-gamma, alone or in combination, did not cause any significant change of CD4 mRNA expression in HL-60 cells, thus indicating that decrease of surface CD4, which accompanies differentiation with these cytokines, is likely due to alterations of the CD4 protein synthesis and/or transport to the plasma membrane. These results provide evidence that myeloid cell lines are heterogeneous in expression of CD4, and that in ML3 cells, which constitutively express low levels of CD4 mRNA and undetectable amounts of surface CD4, the predominant effect of the two cytokines is to induce both CD4 mRNA and protein.

  10. Six family genes control the proliferation and differentiation of muscle satellite cells

    SciTech Connect

    Yajima, Hiroshi; Motohashi, Norio; Ono, Yusuke; Sato, Shigeru; Ikeda, Keiko; Masuda, Satoru; Yada, Erica; Kanesaki, Hironori; Miyagoe-Suzuki, Yuko; Takeda, Shin'ichi; Kawakami, Kiyoshi

    2010-10-15

    Muscle satellite cells are essential for muscle growth and regeneration and their morphology, behavior and gene expression have been extensively studied. However, the mechanisms involved in their proliferation and differentiation remain elusive. Six1 and Six4 proteins were expressed in the nuclei of myofibers of adult mice and the numbers of myoblasts positive for Six1 and Six4 increased during regeneration of skeletal muscles. Six1 and Six4 were expressed in quiescent, activated and differentiated muscle satellite cells isolated from adult skeletal muscle. Overexpression of Six4 and Six5 repressed the proliferation and differentiation of satellite cells. Conversely, knockdown of Six5 resulted in augmented proliferation, and that of Six4 inhibited differentiation. Muscle satellite cells isolated from Six4{sup +/-}Six5{sup -/-} mice proliferated to higher cell density though their differentiation was not altered. Meanwhile, overproduction of Six1 repressed proliferation and promoted differentiation of satellite cells. In addition, Six4 and Six5 repressed, while Six1 activated myogenin expression, suggesting that the differential regulation of myogenin expression is responsible for the differential effects of Six genes. The results indicated the involvement of Six genes in the behavior of satellite cells and identified Six genes as potential target for manipulation of proliferation and differentiation of muscle satellite cells for therapeutic applications.

  11. Blue genes: An integrative laboratory to differentiate genetic transformation from gene mutation for underclassmen.

    PubMed

    Militello, Kevin T; Chang, Ming-Mei; Simon, Robert D; Lazatin, Justine C

    2016-01-01

    The ability of students to understand the relationship between genotype and phenotype, and the mechanisms by which genotypes and phenotypes can change is essential for students studying genetics. To this end, we have developed a four-week laboratory called Blue Genes, which is designed to help novice students discriminate between two mechanisms by which the genetic material can be altered: genetic transformation and gene mutation. In the first week of the laboratory, students incubate a plasmid DNA with calcium chloride-treated Escherichia coli JM109 cells and observe a phenotype change from ampicillin sensitive to ampicillin resistant and from white color to blue color on plates containing 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) and isopropyl β-D-thiogalactopyranoside (IPTG). Over the course of the next three weeks, students use a battery of approaches including plasmid DNA isolation experiments, restriction maps, and PCR to differentiate between mutation and transformation. The students ultimately come to the conclusion that the changes in phenotypes are due to genetic transformation and not mutation based on the evidence generated over the four-week period. Pre-laboratory tests and post-laboratory tests indicate that this set of exercises is successful in helping students differentiate between transformation and mutation. The laboratory is designed for underclassmen and is a good prerequisite for an apprentice-based research opportunity, although it is not designed as a class based research experience. Potential modifications and future directions of the laboratory based upon student experiences and assessment are presented.

  12. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central

    2010-01-01

    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  13. Differential extra-renal expression of the mouse renin genes.

    PubMed Central

    Miller, C C; Carter, A T; Brooks, J I; Lovell-Badge, R H; Brammar, W J

    1989-01-01

    We have used RNase-protection analyses to study renin gene expression in one- and two-gene mouse strains. The RNase-protection assay is capable of discriminating between the transcripts from the different renin genes. In a two-gene strain containing Ren-1D and Ren-2, we demonstrate transcriptional activity from Ren-1D in kidney, submandibular gland (SMG), testes, liver, brain and heart. Ren-2 is clearly expressed in kidney, SMG and testes. Similar analyses of one gene strains (containing Ren-1C only) show expression in kidney, SMG, testes, brain and heart. We cannot detect renin mRNA in the liver of these mice. Ren-1C and Ren-1D thus display quite different tissue-specificities. In order to determine whether the different tissue-specificities of the highly homologous Ren-1C and Ren-1D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-1D transgene (Ren-1*) into a background strain containing only the Ren-1C gene. The transgene exhibits the same tissue-specificity as the Ren-1D gene of two-gene strains suggesting the presence of different cis-acting DNA elements in Ren-1C and Ren-1D. Images PMID:2657654

  14. Reconstructing differentially co-expressed gene modules and regulatory networks of soybean cells

    PubMed Central

    2012-01-01

    Background Current experimental evidence indicates that functionally related genes show coordinated expression in order to perform their cellular functions. In this way, the cell transcriptional machinery can respond optimally to internal or external stimuli. This provides a research opportunity to identify and study co-expressed gene modules whose transcription is controlled by shared gene regulatory networks. Results We developed and integrated a set of computational methods of differential gene expression analysis, gene clustering, gene network inference, gene function prediction, and DNA motif identification to automatically identify differentially co-expressed gene modules, reconstruct their regulatory networks, and validate their correctness. We tested the methods using microarray data derived from soybean cells grown under various stress conditions. Our methods were able to identify 42 coherent gene modules within which average gene expression correlation coefficients are greater than 0.8 and reconstruct their putative regulatory networks. A total of 32 modules and their regulatory networks were further validated by the coherence of predicted gene functions and the consistency of putative transcription factor binding motifs. Approximately half of the 32 modules were partially supported by the literature, which demonstrates that the bioinformatic methods used can help elucidate the molecular responses of soybean cells upon various environmental stresses. Conclusions The bioinformatics methods and genome-wide data sources for gene expression, clustering, regulation, and function analysis were integrated seamlessly into one modular protocol to systematically analyze and infer modules and networks from only differential expression genes in soybean cells grown under stress conditions. Our approach appears to effectively reduce the complexity of the problem, and is sufficiently robust and accurate to generate a rather complete and detailed view of putative soybean

  15. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon.

    PubMed

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation.

  16. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon

    PubMed Central

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S.

    2016-01-01

    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation. PMID:26950546

  17. Node-based learning of differential networks from multi-platform gene expression data.

    PubMed

    Ou-Yang, Le; Zhang, Xiao-Fei; Wu, Min; Li, Xiao-Li

    2017-06-01

    Recovering gene regulatory networks and exploring the network rewiring between two different disease states are important for revealing the mechanisms behind disease progression. The advent of high-throughput experimental techniques has enabled the possibility of inferring gene regulatory networks and differential networks using computational methods. However, most of existing differential network analysis methods are designed for single-platform data analysis and assume that differences between networks are driven by individual edges. Therefore, they cannot take into account the common information shared across different data platforms and may fail in identifying driver genes that lead to the change of network. In this study, we develop a node-based multi-view differential network analysis model to simultaneously estimate multiple gene regulatory networks and their differences from multi-platform gene expression data. Our model can leverage the strength across multiple data platforms to improve the accuracy of network inference and differential network estimation. Simulation studies demonstrate that our model can obtain more accurate estimations of gene regulatory networks and differential networks than other existing state-of-the-art models. We apply our model on TCGA ovarian cancer samples to identify network rewiring associated with drug resistance. We observe from our experiments that the hub nodes of our identified differential networks include known drug resistance-related genes and potential targets that are useful to improve the treatment of drug resistant tumors. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Characterizing differential gene expression in polyploid grasses lacking a reference transcriptome

    USDA-ARS?s Scientific Manuscript database

    Basal transcriptome characterization and differential gene expression in response to varying conditions are often addressed through next generation sequencing (NGS) and data analysis techniques. While these strategies are commonly used, there are countless tools, pipelines, data analysis methods an...

  19. Data mining in networks of differentially expressed genes during sow pregnancy.

    PubMed

    Wang, Ligang; Zhang, Longchao; Li, Yong; Li, Wen; Luo, Weizhen; Cheng, Duxue; Yan, Hua; Ma, Xiaojun; Liu, Xin; Song, Xin; Liang, Jing; Zhao, Kebin; Wang, Lixian

    2012-01-01

    Small to moderate gains in Pig fertility can mean large returns in overall efficiency, and developing methods to improve it is highly desirable. High fertility rates depend on completion of successful pregnancies. To understand the molecular signals associated with pregnancy in sows, expression profiling experiments were conducted to identify differentially expressed genes in ovary and myometrium at different pregnancy periods using the Affymetrix Porcine GeneChip(TM). A total of 974, 1800, 335 and 710 differentially expressed transcripts were identified in the myometrium during early pregnancy (EP) and late pregnancy (LP), and in the ovary during EP and LP, respectively. Self-Organizing Map (SOM) clusters indicated the differentially expressed genes belonged to 7 different functional groups. Based on BLASTX searches and Gene Ontology (GO) classifications, 129 unique genes closely related to pregnancy showed differential expression patterns. GO analysis also indicated that there were 21 different molecular function categories, 20 different biological process categories, and 8 different cellular component categories of genes differentially expressed during sow pregnancy. Gene regulatory network reconstruction provided us with an interaction model of known genes such as insulin-like growth factor 2 (IGF2) gene, estrogen receptor (ESR) gene, retinol-binding protein-4 (RBP4) gene, and several unknown candidate genes related to reproduction. Several pitch point genes were selected for association study with reproduction traits. For instance, DPPA5 g.363 T>C was found to associate with litter born weight at later parities in Beijing Black pigs significantly (p < 0.05). Overall, this study contributes to elucidating the mechanism underlying pregnancy processes, which maybe provide valuable information for pig reproduction improvement.

  20. Identification and expression profiling analysis of goose melanoma differentiation associated gene 5 (MDA5) gene.

    PubMed

    Wei, L M; Jiao, P R; Song, Y F; Han, F; Cao, L; Yang, F; Ren, T; Liao, M

    2013-10-01

    Melanoma differentiation associated gene 5 (MDA5) is an important cytoplasmic receptor that recognizes long molecules of viral double-stranded RNA and single-stranded RNA with 5' triphosphate and mediates type I interferon secretion. In this study, the full-length MDA5 gene in the goose was identified and characterized. The cDNA of goose MDA5 was 3,306 bp in length with an open reading frame of 3,018 bp, which encoded a polypeptide of 1,005 amino acids. The deduced amino acid sequence contained 6 main structure domains including 2 caspase activation and recruitment domains, one DExD/H-box helicase domain, one type III restriction enzyme domain, one helicase conserved C-terminal domain, and one RIG-I C-terminal domain. Quantitative real-time PCR analysis indicated that goose MDA5 mRNA was constitutively expressed in all sampled tissues. It was highly expressed in the jejunum, trachea, ileum, colon, and kidney, and lowly expressed in the muscular stomach, glandular stomach, and muscle. A significant increase in the transcription of MDA5 was detected in the brain, spleen, and lungs of geese after infection with H5N1 highly pathogenic avian influenza virus compared with uninfected tissues. These findings indicated that goose MDA5 was an important receptor, involved in the antiviral innate immune defense to H5N1 highly pathogenic avian influenza virus in geese.

  1. The Wilms’ Tumor Suppressor Gene (wt1) Product Regulates Dax-1 Gene Expression during Gonadal Differentiation

    PubMed Central

    Kim, Jungho; Prawitt, Dirk; Bardeesy, Nabeel; Torban, Elena; Vicaner, Caroline; Goodyer, Paul; Zabel, Bernard; Pelletier, Jerry

    1999-01-01

    Gonadal differentiation is dependent upon a molecular cascade responsible for ovarian or testicular development from the bipotential gonadal ridge. Genetic analysis has implicated a number of gene products essential for this process, which include Sry, WT1, SF-1, and DAX-1. We have sought to better define the role of WT1 in this process by identifying downstream targets of WT1 during normal gonadal development. We have noticed that in the developing murine gonadal ridge, wt1 expression precedes expression of Dax-1, a nuclear receptor gene. We document here that the spatial distribution profiles of both proteins in the developing gonad overlap. We also demonstrate that WT1 can activate the Dax-1 promoter. Footprinting analysis, transient transfections, promoter mutagenesis, and mobility shift assays suggest that WT1 regulates Dax-1 via GC-rich binding sites found upstream of the Dax-1 TATA box. We show that two WT1-interacting proteins, the product of a Denys-Drash syndrome allele of wt1 and prostate apoptosis response-4 protein, inhibit WT1-mediated transactivation of Dax-1. In addition, we demonstrate that WT1 can activate the endogenous Dax-1 promoter. Our results indicate that the WT1–DAX-1 pathway is an early event in the process of mammalian sex determination. PMID:10022915

  2. Differential gene expression and bioinformatics analysis of copper resistance gene afe_1073 in Acidithiobacillus ferrooxidans.

    PubMed

    Hu, Qi; Wu, Xueling; Jiang, Ying; Liu, Yuandong; Liang, Yili; Liu, Xueduan; Yin, Huaqun; Baba, Ngom

    2013-04-01

    Copper resistance of acidophilic bacteria is very significant in bioleaching of copper ore since high concentration of copper are harmful to the growth of organisms. Copper resistance gene afe_1073 was putatively considered to be involved in copper homeostasis in Acidithiobacillus ferrooxidans ATCC23270. In the present study, differential expression of afe_1073 in A. ferrooxidans strain DY26 and DC was assessed with quantitative reverse transcription polymerase chain reaction. The results showed the expression of afe_1073 in two strains increased with the increment of copper concentrations. The expression of DY26 was lower than that of DC at the same copper concentration although A. ferrooxidans strain DY26 possessed higher copper resistance than strain DC. In addition, bioinformatics analysis showed AFE_1073 was a typical transmembrane protein P1b1-ATPase, which could reduce the harm of Cu(+) by pumping it out from the cell. There were two mutation sites in AFE_1073 between DY26 and DC and one may change the hydrophobicity of AFE_1073, which could enhance the ability of DY26 to pump out Cu(+). Therefore, DY26 needed less gene expression of afe_1073 for resisting copper toxicity than that of DC at the same copper stress. Our study will be beneficial to understanding the copper resistance mechanism of A. ferrooxidans.

  3. Blue light-promoted rice leaf bending and unrolling are due to up-regulated brassinosteroid biosynthesis genes accompanied by accumulation of castasterone.

    PubMed

    Asahina, Masashi; Tamaki, Yuji; Sakamoto, Tomoaki; Shibata, Kyomi; Nomura, Takahito; Yokota, Takao

    2014-08-01

    In this study the relationship between blue light- and brassinosteroid-enhanced leaf lamina bending and unrolling in rice was investigated. Twenty-four hours (h) irradiation with white or blue light increased endogenous brassinosteroid levels, especially those of typhasterol and castasterone, in aerial tissues of rice seedlings. There was an accompanying up-regulation of transcript levels of CYP85A1/OsDWARF, encoding an enzyme catalyzing C-6 oxidation, after 6h under either white or blue light. These effects were not observed in seedlings placed under far-red or red light regimes. It was concluded that blue light up-regulates the levels of several cytochrome P450 enzymes including CYP85A1, thereby promoting the synthesis of castasterone, a biologically active brassinosteroid in rice. Based on these findings, it is considered that blue light-mediated rice leaf bending and unrolling are consequences of the enhanced biosynthesis of endogenous castasterone. In contrast to aerial tissues, brassinosteroid synthesis in roots appeared to be negatively regulated by white, blue and red light but positively controlled by far-red light.

  4. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression.

    PubMed

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree.

  5. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression

    PubMed Central

    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min

    2015-01-01

    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree. PMID:26147807

  6. Identification of differentially expressed genes and signalling pathways in bark of Hevea brasiliensis seedlings associated with secondary laticifer differentiation using gene expression microarray.

    PubMed

    Loh, Swee Cheng; Thottathil, Gincy P; Othman, Ahmad Sofiman

    2016-10-01

    The natural rubber of Para rubber tree, Hevea brasiliensis, is the main crop involved in industrial rubber production due to its superior quality. The Hevea bark is commercially exploited to obtain latex, which is produced from the articulated secondary laticifer. The laticifer is well defined in the aspect of morphology; however, only some genes associated with its development have been reported. We successfully induced secondary laticifer in the jasmonic acid (JA)-treated and linolenic acid (LA)-treated Hevea bark but secondary laticifer is not observed in the ethephon (ET)-treated and untreated Hevea bark. In this study, we analysed 27,195 gene models using NimbleGen microarrays based on the Hevea draft genome. 491 filtered differentially expressed (FDE) transcripts that are common to both JA- and LA-treated bark samples but not ET-treated bark samples were identified. In the Eukaryotic Orthologous Group (KOG) analysis, 491 FDE transcripts belong to different functional categories that reflect the diverse processes and pathways involved in laticifer differentiation. In the Kyoto Encyclopedia of Genes and Genomes (KEGG) and KOG analysis, the profile of the FDE transcripts suggest that JA- and LA-treated bark samples have a sufficient molecular basis for secondary laticifer differentiation, especially regarding secondary metabolites metabolism. FDE genes in this category are from the cytochrome (CYP) P450 family, ATP-binding cassette (ABC) transporter family, short-chain dehydrogenase/reductase (SDR) family, or cinnamyl alcohol dehydrogenase (CAD) family. The data includes many genes involved in cell division, cell wall synthesis, and cell differentiation. The most abundant transcript in FDE list was SDR65C, reflecting its importance in laticifer differentiation. Using the Basic Local Alignment Search Tool (BLAST) as part of annotation and functional prediction, several characterised as well as uncharacterized transcription factors and genes were found in the

  7. Application of community phylogenetic approaches to understand gene expression: differential exploration of venom gene space in predatory marine gastropods.

    PubMed

    Chang, Dan; Duda, Thomas F

    2014-06-05

    Predatory marine gastropods of the genus Conus exhibit substantial variation in venom composition both within and among species. Apart from mechanisms associated with extensive turnover of gene families and rapid evolution of genes that encode venom components ('conotoxins'), the evolution of distinct conotoxin expression patterns is an additional source of variation that may drive interspecific differences in the utilization of species' 'venom gene space'. To determine the evolution of expression patterns of venom genes of Conus species, we evaluated the expression of A-superfamily conotoxin genes of a set of closely related Conus species by comparing recovered transcripts of A-superfamily genes that were previously identified from the genomes of these species. We modified community phylogenetics approaches to incorporate phylogenetic history and disparity of genes and their expression profiles to determine patterns of venom gene space utilization. Less than half of the A-superfamily gene repertoire of these species is expressed, and only a few orthologous genes are coexpressed among species. Species exhibit substantially distinct expression strategies, with some expressing sets of closely related loci ('under-dispersed' expression of available genes) while others express sets of more disparate genes ('over-dispersed' expression). In addition, expressed genes show higher dN/dS values than either unexpressed or ancestral genes; this implies that expression exposes genes to selection and facilitates rapid evolution of these genes. Few recent lineage-specific gene duplicates are expressed simultaneously, suggesting that expression divergence among redundant gene copies may be established shortly after gene duplication. Our study demonstrates that venom gene space is explored differentially by Conus species, a process that effectively permits the independent and rapid evolution of venoms in these species.

  8. Quantitative set analysis for gene expression: a method to quantify gene set differential expression including gene-gene correlations.

    PubMed

    Yaari, Gur; Bolen, Christopher R; Thakar, Juilee; Kleinstein, Steven H

    2013-10-01

    Enrichment analysis of gene sets is a popular approach that provides a functional interpretation of genome-wide expression data. Existing tests are affected by inter-gene correlations, resulting in a high Type I error. The most widely used test, Gene Set Enrichment Analysis, relies on computationally intensive permutations of sample labels to generate a null distribution that preserves gene-gene correlations. A more recent approach, CAMERA, attempts to correct for these correlations by estimating a variance inflation factor directly from the data. Although these methods generate P-values for detecting gene set activity, they are unable to produce confidence intervals or allow for post hoc comparisons. We have developed a new computational framework for Quantitative Set Analysis of Gene Expression (QuSAGE). QuSAGE accounts for inter-gene correlations, improves the estimation of the variance inflation factor and, rather than evaluating the deviation from a null hypothesis with a P-value, it quantifies gene-set activity with a complete probability density function. From this probability density function, P-values and confidence intervals can be extracted and post hoc analysis can be carried out while maintaining statistical traceability. Compared with Gene Set Enrichment Analysis and CAMERA, QuSAGE exhibits better sensitivity and specificity on real data profiling the response to interferon therapy (in chronic Hepatitis C virus patients) and Influenza A virus infection. QuSAGE is available as an R package, which includes the core functions for the method as well as functions to plot and visualize the results.

  9. Transcriptome Analysis and Identification of Differentially Expressed Transcripts of Immune-Related Genes in Spleen of Gosling and Adult Goose

    PubMed Central

    Wang, Anqi; Liu, Fei; Chen, Shun; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Wu, Ying; Chen, Xiaoyue; Cheng, Anchun

    2015-01-01

    The goose (Anser cygnoides), having high nutritional value, high-quality feathers and high economic benefit, is an economically important poultry species. However, the molecular mechanisms underlying the higher susceptibility to pathogens in goslings than in adult geese remains poorly understood. In this study, the histological sections of spleen tissue from a two-week-old gosling and an adult goose, respectively, were subjected to comparative analysis. The spleen of gosling was mainly composed of mesenchyma, accompanied by scattered lymphocytes, whereas the spleen parenchyma was well developed in the adult goose. To investigate goose immune-related genes, we performed deep transcriptome and gene expression analyses of the spleen samples using paired-end sequencing technology (Illumina). In total, 50,390 unigenes were assembled using Trinity software and TGICL software. Moreover, these assembled unigenes were annotated with gene descriptions and gene ontology (GO) analysis was performed. Through Kyoto encyclopedia of genes and genomes (KEGG) analysis, we investigated 558 important immune-relevant unigenes and 23 predicted cytokines. In addition, 22 immune-related genes with differential expression between gosling and adult goose were identified, among which the three genes showing largest differences in expression were immunoglobulin alpha heavy chain (IgH), mannan-binding lectin serine protease 1 isoform X1 (MASP1) and C–X–C chemokine receptor type 4 (CXCR4). Finally, of these 22 differentially expressed immune-related genes, seven genes, including tumor necrosis factor receptor superfamily member 13B (TNFRSF13B), C-C motif chemokine 4-like (CCL4), CXCR4, interleukin 2 receptor alpha (IL2RA), MHC class I heavy chain (MHCIα), transporter of antigen processing 2 (TAP2) IgH, were confirmed by quantitative real-time PCR (qRT-PCR). The expression levels of all the candidate unigenes were up-regulated in adult geese other than that of TNFRSF13B. The comparative

  10. Transcriptome Analysis and Identification of Differentially Expressed Transcripts of Immune-Related Genes in Spleen of Gosling and Adult Goose.

    PubMed

    Wang, Anqi; Liu, Fei; Chen, Shun; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Wu, Ying; Chen, Xiaoyue; Cheng, Anchun

    2015-09-22

    The goose (Anser cygnoides), having high nutritional value, high-quality feathers and high economic benefit, is an economically important poultry species. However, the molecular mechanisms underlying the higher susceptibility to pathogens in goslings than in adult geese remains poorly understood. In this study, the histological sections of spleen tissue from a two-week-old gosling and an adult goose, respectively, were subjected to comparative analysis. The spleen of gosling was mainly composed of mesenchyma, accompanied by scattered lymphocytes, whereas the spleen parenchyma was well developed in the adult goose. To investigate goose immune-related genes, we performed deep transcriptome and gene expression analyses of the spleen samples using paired-end sequencing technology (Illumina). In total, 50,390 unigenes were assembled using Trinity software and TGICL software. Moreover, these assembled unigenes were annotated with gene descriptions and gene ontology (GO) analysis was performed. Through Kyoto encyclopedia of genes and genomes (KEGG) analysis, we investigated 558 important immune-relevant unigenes and 23 predicted cytokines. In addition, 22 immune-related genes with differential expression between gosling and adult goose were identified, among which the three genes showing largest differences in expression were immunoglobulin alpha heavy chain (IgH), mannan-binding lectin serine protease 1 isoform X1 (MASP1) and C-X-C chemokine receptor type 4 (CXCR4). Finally, of these 22 differentially expressed immune-related genes, seven genes, including tumor necrosis factor receptor superfamily member 13B (TNFRSF13B), C-C motif chemokine 4-like (CCL4), CXCR4, interleukin 2 receptor alpha (IL2RA), MHC class I heavy chain (MHCIα), transporter of antigen processing 2 (TAP2) IgH, were confirmed by quantitative real-time PCR (qRT-PCR). The expression levels of all the candidate unigenes were up-regulated in adult geese other than that of TNFRSF13B. The comparative

  11. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    PubMed

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  12. Adaptations to Endosymbiosis in a Cnidarian-Dinoflagellate Association: Differential Gene Expression and Specific Gene Duplications

    PubMed Central

    Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-01-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K–dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  13. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad

    2006-01-01

    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  14. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad

    2006-01-01

    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  15. Differential gene expression analysis of ovarian cancer in a population isolate.

    PubMed

    Grazio, D; Pichler, I; Fuchsberger, C; Zolezzi, F; Guarnieri, P; Heidegger, H; Scherer, A; Engl, B; Messini, S; Egarter-Vigl, E; Pramstaller, P P

    2008-01-01

    Gene expression products represent candidate biomarkers with the potential for early screening and therapy of patients with ovarian serous carcinoma. The present study, using patients that originate from the population isolate of South Tyrol, Italy, substantiates the feasibility of differential gene expression analysis in a genetically isolated population for the identification of potential markers of ovarian cancer. Gene expression profiles of fresh-frozen ovarian serous papillary carcinoma samples were analyzed and compared to normal ovarian control tissues using oligonucleotide microarrays complementary to 14,500 human genes. Supervised analysis of gene expression profiling data identified 225 genes that are down-regulated and 635 that are up-regulated in malignant compared to normal ovarian tissues. Class-prediction analysis identified 40 differentially expressed genes for further investigation as potential classifiers for ovarian cancer, including 20 novel candidates. Our findings provide a glimpse into the potential of population isolate genomics in oncological research.

  16. [Identification and application of marker genes for differential diagnosis of chronic fatigue syndrome].

    PubMed

    Kawai, Tomoko; Rokutan, Kazuhito

    2007-06-01

    Chronic fatigue syndrome (CFS) is a complex disease and has no laboratory biomarkers, which makes diagnosis of CFS difficult. Several research groups challenged to identify genes specific for CFS; however, there are no overlaps between studies. The U.S. Centers for Disease Control and Prevention reported remarkable gene expression profiles of a large scale cohort study recruited 227 people. Reported genes were mostly different from the previously reported genes, again featuring the complexity of CFS. Separately, we identified 9 genes that were significantly and differentially expressed between CFS patients and healthy subjects using an original microarray. The changes in expression of 9 genes were confirmed by quantitative PCR. We also demonstrated the usefulness of 9 genes for differential diagnosis of CFS.

  17. Differential Coexpression Analysis Reveals Extensive Rewiring of Arabidopsis Gene Coexpression in Response to Pseudomonas syringae Infection

    PubMed Central

    Jiang, Zhenhong; Dong, Xiaobao; Li, Zhi-Gang; He, Fei; Zhang, Ziding

    2016-01-01

    Plant defense responses to pathogens involve massive transcriptional reprogramming. Recently, differential coexpression analysis has been developed to study the rewiring of gene networks through microarray data, which is becoming an important complement to traditional differential expression analysis. Using time-series microarray data of Arabidopsis thaliana infected with Pseudomonas syringae, we analyzed Arabidopsis defense responses to P. syringae through differential coexpression analysis. Overall, we found that differential coexpression was a common phenomenon of plant immunity. Genes that were frequently involved in differential coexpression tend to be related to plant immune responses. Importantly, many of those genes have similar average expression levels between normal plant growth and pathogen infection but have different coexpression partners. By integrating the Arabidopsis regulatory network into our analysis, we identified several transcription factors that may be regulators of differential coexpression during plant immune responses. We also observed extensive differential coexpression between genes within the same metabolic pathways. Several metabolic pathways, such as photosynthesis light reactions, exhibited significant changes in expression correlation between normal growth and pathogen infection. Taken together, differential coexpression analysis provides a new strategy for analyzing transcriptional data related to plant defense responses and new insights into the understanding of plant-pathogen interactions. PMID:27721457

  18. Differential Coexpression Analysis Reveals Extensive Rewiring of Arabidopsis Gene Coexpression in Response to Pseudomonas syringae Infection.

    PubMed

    Jiang, Zhenhong; Dong, Xiaobao; Li, Zhi-Gang; He, Fei; Zhang, Ziding

    2016-10-10

    Plant defense responses to pathogens involve massive transcriptional reprogramming. Recently, differential coexpression analysis has been developed to study the rewiring of gene networks through microarray data, which is becoming an important complement to traditional differential expression analysis. Using time-series microarray data of Arabidopsis thaliana infected with Pseudomonas syringae, we analyzed Arabidopsis defense responses to P. syringae through differential coexpression analysis. Overall, we found that differential coexpression was a common phenomenon of plant immunity. Genes that were frequently involved in differential coexpression tend to be related to plant immune responses. Importantly, many of those genes have similar average expression levels between normal plant growth and pathogen infection but have different coexpression partners. By integrating the Arabidopsis regulatory network into our analysis, we identified several transcription factors that may be regulators of differential coexpression during plant immune responses. We also observed extensive differential coexpression between genes within the same metabolic pathways. Several metabolic pathways, such as photosynthesis light reactions, exhibited significant changes in expression correlation between normal growth and pathogen infection. Taken together, differential coexpression analysis provides a new strategy for analyzing transcriptional data related to plant defense responses and new insights into the understanding of plant-pathogen interactions.

  19. The double-antigen ELISA concept for early detection of E(rns) -specific classical swine fever virus antibodies and application as an accompanying test for differentiation of infected from marker vaccinated animals.

    PubMed

    Meyer, D; Fritsche, S; Luo, Y; Engemann, C; Blome, S; Beyerbach, M; Chang, C-Y; Qiu, H-J; Becher, P; Postel, A

    2017-02-03

    Emergency vaccination with live marker vaccines represents a promising control strategy for future classical swine fever (CSF) outbreaks, and the first live marker vaccine is available in Europe. Successful implementation is dependent on a reliable accompanying diagnostic assay that allows differentiation of infected from vaccinated animals (DIVA). As induction of a protective immune response relies on virus-neutralizing antibodies against E2 protein of CSF virus (CSFV), the most promising DIVA strategy is based on detection of E(rns) -specific antibodies in infected swine. The aim of this study was to develop and to evaluate a novel E(rns) -specific prototype ELISA (pigtype CSFV E(rns) Ab), which may be used for CSF diagnosis including application as an accompanying discriminatory test for CSFV marker vaccines. The concept of a double-antigen ELISA was shown to be a solid strategy to detect E(rns) -specific antibodies against CSFV isolates of different genotypes (sensitivity: 93.5%; specificity: 99.7%). Furthermore, detection of early seroconversion is advantageous compared with a frequently used CSFV E2 antibody ELISA. Clear differences in reactivity between sera taken from infected animals and animals vaccinated with various marker vaccines were observed. In combination with the marker vaccine CP7_E2alf, the novel ELISA represents a sensitivity of 90.2% and a specificity of 93.8%. However, cross-reactivity with antibodies against ruminant pestiviruses was observed. Interestingly, the majority of samples tested false-positive in other E(rns) -based antibody ELISAs were identified correctly by the novel prototype E(rns) ELISA and vice versa. In conclusion, the pigtype CSFV E(rns) Ab ELISA can contribute to an improvement in routine CSFV antibody screening, particularly for analysis of sera taken at an early time point after infection and is applicable as a DIVA assay. An additional E(rns) antibody assay is recommended for identification of false-positive results

  20. Gene expression profiling data of Schizosaccharomyces pombe under nitrosative stress using differential display

    PubMed Central

    Biswas, Pranjal; Majumdar, Uddalak; Ghosh, Sanjay

    2015-01-01

    Excess production of nitric oxide (NO) and reactive nitrogen intermediates (RNIs) causes nitrosative stress on cells. Schizosaccharomyces pombe was used as a model to study nitrosative stress response. In the present data article, we have used differential display to identify the differentially expressed genes in the fission yeast under nitrosative stress conditions. We have used pure NO donor compound detaNONOate at final concentrations of 0.1 mM and 1 mM to treat the cells for 15 min alongside control before studying their gene expression profiles. At both the treated conditions, we identified genes which were commonly repressed while several genes were induced upon both 0.1 mM and 1 mM treatments. The differentially expressed genes were further analyzed in DAVID and categorized into several different pathways. PMID:26858975

  1. Differential Methylation during Maize Leaf Growth Targets Developmentally Regulated Genes1[C][W][OPEN

    PubMed Central

    Candaele, Jasper; Demuynck, Kirin; Mosoti, Douglas; Beemster, Gerrit T.S.; Inzé, Dirk; Nelissen, Hilde

    2014-01-01

    DNA methylation is an important and widespread epigenetic modification in plant genomes, mediated by DNA methyltransferases (DMTs). DNA methylation is known to play a role in genome protection, regulation of gene expression, and splicing and was previously associated with major developmental reprogramming in plants, such as vernalization and transition to flowering. Here, we show that DNA methylation also controls the growth processes of cell division and cell expansion within a growing organ. The maize (Zea mays) leaf offers a great tool to study growth processes, as the cells progressively move through the spatial gradient encompassing the division zone, transition zone, elongation zone, and mature zone. Opposite to de novo DMTs, the maintenance DMTs were transcriptionally regulated throughout the growth zone of the maize leaf, concomitant with differential CCGG methylation levels in the four zones. Surprisingly, the majority of differentially methylated sequences mapped on or close to gene bodies and not to repeat-rich loci. Moreover, especially the 5′ and 3′ regions of genes, which show overall low methylation levels, underwent differential methylation in a developmental context. Genes involved in processes such as chromatin remodeling, cell cycle progression, and growth regulation, were differentially methylated. The presence of differential methylation located upstream of the gene anticorrelated with transcript expression, while gene body differential methylation was unrelated to the expression level. These data indicate that DNA methylation is correlated with the decision to exit mitotic cell division and to enter cell expansion, which adds a new epigenetic level to the regulation of growth processes. PMID:24488968

  2. Differential Gene Expression in the Human Brain Is Associated with Conserved, but Not Accelerated, Noncoding Sequences

    PubMed Central

    Meyer, Kyle A.; Marques-Bonet, Tomas

    2017-01-01

    Previous studies have found that genes which are differentially expressed within the developing human brain disproportionately neighbor conserved noncoding sequences (CNSs) that have an elevated substitution rate in humans and in other species. One explanation for this general association of differential expression with accelerated CNSs is that genes with pre-existing patterns of differential expression have been preferentially targeted by species-specific regulatory changes. Here we provide support for an alternative explanation: genes that neighbor a greater number of CNSs have a higher probability of differential expression and a higher probability of neighboring a CNS with lineage-specific acceleration. Thus, neighboring an accelerated element from any species signals that a gene likely neighbors many CNSs. We extend the analyses beyond the prenatal time points considered in previous studies to demonstrate that this association persists across developmental and adult periods. Examining differential expression between non-neural tissues suggests that the relationship between the number of CNSs a gene neighbors and its differential expression status may be particularly strong for expression differences among brain regions. In addition, by considering this relationship, we highlight a recently defined set of putative human-specific gain-of-function sequences that, even after adjusting for the number of CNSs neighbored by genes, shows a positive relationship with upregulation in the brain compared with other tissues examined. PMID:28204568

  3. Differential distribution improves gene selection stability and has competitive classification performance for patient survival.

    PubMed

    Strbenac, Dario; Mann, Graham J; Yang, Jean Y H; Ormerod, John T

    2016-07-27

    A consistent difference in average expression level, often referred to as differential expression (DE), has long been used to identify genes useful for classification. However, recent cancer studies have shown that when transcription factors or epigenetic signals become deregulated, a change in expression variability (DV) of target genes is frequently observed. This suggests that assessing the importance of genes by either differential expression or variability alone potentially misses sets of important biomarkers that could lead to improved predictions and treatments. Here, we describe a new approach for assessing the importance of genes based on differential distribution (DD), which combines information from differential expression and differential variability into a unified metric. We show that feature ranking and selection stability based on DD can perform two to three times better than DE or DV alone, and that DD yields equivalent error rates to DE and DV. Finally, assessing genes via differential distribution produces a complementary set of selected genes to DE and DV, potentially opening up new categories of biomarkers. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Hyperradiance accompanied by nonclassicality

    NASA Astrophysics Data System (ADS)

    Xu, Jingping; Chang, Shenglong; Yang, Yaping; Zhu, Shiyao; Agarwal, G. S.

    2017-07-01

    Several recent experiments have reported a variety of new collective behaviors of two atoms in a cavity. An important experimental result was that the back-reaction in a high-quality cavity leads to subradiance rather than superradiance. Further investigation by changing the parameter domain has shown the possibility of hyperradiance. In this paper we present a model of hyperradiance which is based on the idea of vacuum Rabi splittings when the driving field is detuned from the atom or cavity resonance so that it hits one of the dressed states. We show that this hyperradiance is accompanied by significant nonclassicality of the output. Some aspects, but not nonclassicality, of the hyperradiance when the driving field is very weak can be understood semiclassically. Our mechanism of hyperradiance applies to atoms coupled symmetrically to the cavity mode, whereas in the work of M. Pleinert et al. [Optica 4, 779 (2017), 10.1364/OPTICA.4.000779] atoms have to be coupled almost asymmetrically to the cavity.

  5. Activation of human heat shock genes is accompanied by oligomerization, modification, and rapid translocation of heat shock transcription factor HSF1.

    PubMed Central

    Baler, R; Dahl, G; Voellmy, R

    1993-01-01

    Transcriptional activity of heat shock (hsp) genes is controlled by a heat-activated, group-specific transcription factor(s) recognizing arrays of inverted repeats of the element NGAAN. To date genes for two human factors, HSF1 and HSF2, have been isolated. To define their properties as well as the changes they undergo during heat stress activation, we prepared polyclonal antibodies to these factors. Using these tools, we have shown that human HeLa cells constitutively synthesize HSF1, but we were unable to detect HSF2. In unstressed cells HSF1 is present mainly in complexes with an apparent molecular mass of about 200 kDa, unable to bind to DNA. Heat treatment induces a shift in the apparent molecular mass of HSF1 to about 700 kDa, concomitant with the acquisition of DNA-binding ability. Cross-linking experiments suggest that this change in complex size may reflect the trimerization of monomeric HSF1. Human HSF1 expressed in Xenopus oocytes does not bind DNA, but derepression of DNA-binding activity, as well as oligomerization of HSF1, occurs during heat treatment at the same temperature at which hsp gene expression is induced in this organism, suggesting that a conserved Xenopus protein(s) plays a role in this regulation. Inactive HSF1 resides in the cytoplasm of human cells; on activation it rapidly translocates to a soluble nuclear fraction, and shortly thereafter it becomes associated with the nuclear pellet. On heat shock, activatable HSF1, which might already have been posttranslationally modified in the unstressed cell, undergoes further modification. These different process provide multiple points of regulation of hsp gene expression. Images PMID:8455624

  6. Analysis of differential gene expression under low-temperature stress in Nile tilapia (Oreochromis niloticus) using digital gene expression.

    PubMed

    Yang, Changgeng; Jiang, Ming; Wen, Hua; Tian, Juan; Liu, Wei; Wu, Fan; Gou, Gengwu

    2015-06-15

    Tilapia (Oreochromis niloticus) do not survive well at low temperatures. Therefore, improvement of the low-temperature resistance has become an important issue for aquaculture development of tilapia. The objective of this study was to construct a digital gene expression tag profile to identify genes potentially related to low temperature in tilapia. In this study, tilapia was treated at 30°C to lethal temperature 10°C in decrement of 1°CD(-1). Digital gene expression analysis was performed using the Illumina technique to investigate differentially expressed genes in tilapia cultured at different temperatures (30°C, 26°C, 20°C, 16°C, and 10°C). A total of 206,861, 188,082, 185,827, 188,067, and 214,171 distinct tags were obtained by sequencing these five libraries, respectively. Compared with the 30°C library, there were 304, 407, 709, and 772 upregulated genes and 342, 793, 771, and 1466 downregulated genes in 26°C, 20°C, 16°C, and 10°C libraries, respectively. Trend analysis of these differentially expressed genes identified six statistically significant trends. Functional annotation analysis of the differentially expressed genes identified various functions associated with the response to low-temperature stress. When tilapia are subjected to low-temperature stress, expression changes were observed in genes associated with nucleic acid synthesis and metabolism, amino acid metabolism and protein synthesis, lipid and carbohydrate content and types, material transport, apoptosis, and immunity. The differentially expressed genes obtained in this study may provide useful insights to help further understand the effects of low temperature on tilapia.

  7. Acquisition of the capsule locus by horizontal gene transfer in Neisseria meningitidis is often accompanied by the loss of UDP-GalNAc synthesis

    PubMed Central

    Bartley, Stephanie N.; Mowlaboccus, Shakeel; Mullally, Christopher A.; Stubbs, Keith A.; Vrielink, Alice; Maiden, Martin C. J.; Harrison, Odile B.; Perkins, Timothy T.; Kahler, Charlene M.

    2017-01-01

    Pathogenic meningococci have acquired a 24 kb capsule synthesis island (cps) by horizontal gene transfer which consists of a synthetic locus and associated capsule transport genes flanked by repetitive Regions D and D’. Regions D and D’ contain an intact gene encoding a UDP-galactose epimerase (galE1) and a truncated remnant (galE2), respectively. In this study, GalE protein alleles were shown to be either mono-functional, synthesising UDP-galactose (UDP-Gal), or bi-functional, synthesising UDP-Gal and UDP-galactosamine (UDP-GalNAc). Meningococci possessing a capsule null locus (cnl) typically possessed a single bi-functional galE. Separation of functionality between galE1 and galE2 alleles in meningococcal isolates was retained for all serogroups except serogroup E which has a synthetic requirement for UDP-GalNAc. The truncated galE2 remnant in Region D’ was also phylogenetically related to the bi-functional galE of the cnl locus suggesting common ancestry. A model is proposed in which the illegitimate recombination of the cps island into the galE allele of the cnl locus results in the formation of Region D’ containing the truncated galE2 locus and the capture of the cps island en bloc. The retention of the duplicated Regions D and D’ enables inversion of the synthetic locus within the cps island during bacterial growth. PMID:28290510

  8. Transcriptome-Wide Differential Gene Expression in Bicyclus anynana Butterflies: Female Vision-Related Genes Are More Plastic.

    PubMed

    Macias-Muñoz, Aide; Smith, Gilbert; Monteiro, Antónia; Briscoe, Adriana D

    2016-01-01

    Vision is energetically costly to maintain. Consequently, over time many cave-adapted species downregulate the expression of vision genes or even lose their eyes and associated eye genes entirely. Alternatively, organisms that live in fluctuating environments, with different requirements for vision at different times, may evolve phenotypic plasticity for expression of vision genes. Here, we use a global transcriptomic and candidate gene approach to compare gene expression in the heads of a polyphenic butterfly. Bicyclus anynana have two seasonal forms that display sexual dimorphism and plasticity in eye morphology, and female-specific plasticity in opsin gene expression. Nonchoosy dry season females downregulate opsin expression, consistent with the high physiological cost of vision. To identify other genes associated with sexually dimorphic and seasonally plastic differences in vision, we analyzed RNA-sequencing data from whole head tissues. We identified two eye development genes (klarsicht and warts homologs) and an eye pigment biosynthesis gene (henna) differentially expressed between seasonal forms. By comparing sex-specific expression across seasonal forms, we found that klarsicht, warts, henna, and another eye development gene (domeless) were plastic in a female-specific manner. In a male-only analysis, white (w) was differentially expressed between seasonal forms. Reverse transcription polymerase chain reaction confirmed that warts and white are expressed in eyes only, whereas klarsicht, henna and domeless are expressed in both eyes and brain. We find that differential expression of eye development and eye pigment genes is associated with divergent eye phenotypes in B. anynana seasonal forms, and that there is a larger effect of season on female vision-related genes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Improvements in growth performance, bone mineral status and nutrient digestibility in pigs following the dietary inclusion of phytase are accompanied by modifications in intestinal nutrient transporter gene expression.

    PubMed

    Vigors, Stafford; Sweeney, Torres; O'Shea, Cormac J; Browne, John A; O'Doherty, John V

    2014-09-14

    Phytase (PHY) improves growth performance, nutrient digestibility and bone structure in pigs; however, little is known about its effects on intestinal nutrient transporter gene expression. In the present study, a 44 d experiment was carried out using forty-eight pigs (11·76 (sem 0·75) kg) assigned to one of three dietary treatment groups to measure growth performance, coefficient of apparent ileal digestibility (CAID), coefficient of apparent total tract nutrient digestibility (CATTD) and intestinal nutrient transporter gene expression. Dietary treatments during the experimental period were as follows: (1) a high-P (HP) diet containing 3·4 g/kg available P and 7·0 g/kg Ca; (2) a low-P (LP) diet containing 1·9 g/kg available P and 5·9 g/kg Ca; (3) a PHY diet containing LP diet ingredients+1000 phytase units (FTU)/kg of PHY. The PHY diet increased the average daily gain (P< 0·05) and final body weight (P< 0·01) and decreased the feed conversion ratio (P< 0·05) compared with the LP diet. Pigs fed the PHY diet had a higher CAID of gross energy compared with those fed the HP and LP diets (P< 0·001). Pigs fed the PHY diet had increased CAID of P (P< 0·01) and CATTD of Ca and P (P< 0·001) compared with those fed the LP diet. The PHY diet increased the gene expression of the peptide transporter 1 (PEPT1/SLC15A1) (P< 0·05) in the ileum compared with the LP diet. The LP diet decreased the gene expression of the sodium-glucose-linked transporter 1 (SGLT1/SLC5A1) and GLUT2/SLC2A2 (P< 0·05) and increased the expression of membrane Ca channel (TRPV6) and calbindin compared with the HP diet (P< 0·001). In conclusion, feeding a diet supplemented with PHY improves growth performance and nutrient digestibility as well as increases the gene expression of the peptide transporter PEPT1.

  10. The nuclear protein-coding gene ANKRD23 negatively regulates myoblast differentiation.

    PubMed

    Wang, Xiaojing; Zeng, Rui; Xu, Haiyang; Xu, Zaiyan; Zuo, Bo

    2017-09-20

    Muscle fiber formation is a complex process and subject to fine regulation of a variety of protein-coding genes and non-coding RNA. In this study, we identified a nuclear protein-coding gene ANKRD23 which was highly expressed in muscle. Quantitative real-time PCR, western blotting and immunofluorescence were used to detect the expression change of myoblast differentiation marker genes after knockdown and overexpression of ANKRD23. The results showed that the expression of myoblast differentiation marker genes were increased by interference and reduced by ANKRD23 overexpression, indicating that ANKRD23 played a negative role in the myoblast differentiation. Interestingly, we discovered a long non-coding RNA-AK004293 which was overlapped with the 3'UTR of ANKRD23 gene. Then we detected the effect of AK004293 on the expression of ANKRD23 and myoblast differentiation marker genes in C2C12 myoblasts. The results showed that AK004293 had no significant effect on the expression of myoblast differentiation maker genes and ANKRD23. In conclusion, our results established the foundation for further studies about the regulation mechanism of ANKRD23 in muscle development. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Differential Gene Expression in Chemically Induced Mouse Lung Adenomas1

    PubMed Central

    Yao, Ruisheng; Wang, Yian; Lubet, Ronald A; You, Ming

    2003-01-01

    Abstract Because of similarities in histopathology and tumor progression stages between mouse and human lung adenocarcinomas, the mouse lung tumor model with lung adenomas as the endpoint has been used extensively to evaluate the efficacy of putative lung cancer chemopreventive agents. In this study, a competitive cDNA library screening (CCLS) was employed to determine changes in the expression of mRNA in chemically induced lung adenomas compared with paired normal lung tissues. A total of 2555 clones having altered expression in tumors were observed following competitive hybridization between normal lung and lung adenomas after primary screening of over 160,000 clones from a mouse lung cDNA library. Among the 755 clones confirmed by dot blot hybridization, 240 clones were underexpressed, whereas 515 clones were overexpressed in tumors. Sixty-five clones with the most frequently altered expression in six individual tumors were confirmed by semiquantitative RT-PCR. When examining the 58 known genes, 39 clones had increased expression and 19 had decreased expression, whereas the 7 novel genes showed overexpression. A high percentage (>60%) of overexpressed or underexpressed genes was observed in at least two or three of the lesions. Reproducibly overexpressed genes included ERK-1, JAK-1, surfactant proteins A, B, and C, NFAT1, α-1 protease inhibitor, helix-loop-helix ubiquitous kinase (CHUK), α-adaptin, α-1 PI2, thioether S-methyltransferase, and CYP2C40. Reproducibly underexpressed genes included paroxanase, ALDH II, CC10, von Ebner salivary gland protein, and α- and β-globin. In addition, CCLS identified several novel genes or genes not previously associated with lung carcinogenesis, including a hypothetical protein (FLJ11240) and a guanine nucleotide exchange factor homologue. This study shows the efficacy of this methodology for identifying genes with altered expression. These genes may prove to be helpful in our understanding of the genetic basis of lung

  12. Identification of therapeutic targets for Alzheimer's disease via differentially expressed gene and weighted gene co-expression network analyses.

    PubMed

    Jia, Yujie; Nie, Kun; Li, Jing; Liang, Xinyue; Zhang, Xuezhu

    2016-11-01

    In order to investigate the pathogenic targets and associated biological process of Alzheimer's disease in the present study, mRNA expression profiles (GSE28146) and microRNA (miRNA) expression profiles (GSE16759) were downloaded from the Gene Expression Omnibus database. In GSE28146, eight control samples, and Alzheimer's disease samples comprising seven incipient, eight moderate, seven severe Alzheimer's disease samples, were included. The Affy package in R was used for background correction and normalization of the raw microarray data. The differentially expressed genes (DEGs) and differentially expressed miRNAs were identified using the Limma package. In addition, mRNAs were clustered using weighted gene correlation network analysis, and modules found to be significantly associated with the stages of Alzheimer's disease were screened out. The Database for Annotation, Visualization, and Integrated Discovery was used to perform Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses. The target genes of the differentially expressed miRNAs were identified using the miRWalk database. Compared with the control samples, 175,59 genes and 90 DEGs were identified in the incipient, moderate and severe Alzheimer's disease samples, respectively. A module, which contained 1,592 genes was found to be closely associated with the stage of Alzheimer's disease and biological processes. In addition, pathways associated with Alzheimer's disease and other neurological diseases were found to be enriched in those genes. A total of 139 overlapped genes were identified between those genes and the DEGs in the three groups. From the miRNA expression profiles, 189 miRNAs were found differentially expressed in the samples from patients with Alzheimer's disease and 1,647 target genes were obtained. In addition, five overlapped genes were identified between those 1,647 target genes and the 139 genes, and these genes may be important pathogenic targets for Alzheimer

  13. Dynamic changes in the expression of apoptosis-related genes in differentiating gonocytes and in seminomas.

    PubMed

    Manku, Gurpreet; Culty, Martine

    2015-01-01

    Apoptosis is an integral part of the spermatogenic process, necessary to maintain a proper ratio of Sertoli to germ cell numbers and provide an adequate microenvironment to germ cells. Apoptosis may also represent a protective mechanism mediating the elimination of abnormal germ cells. Extensive apoptosis occurs between the first and second postnatal weeks, at the point when gonocytes, precursors of spermatogonial stem cells, should have migrated toward the basement membrane of the tubules and differentiated into spermatogonia. The mechanisms regulating this process are not well-understood. Gonocytes undergo phases of proliferation, migration, and differentiation which occur in a timely and closely regulated manner. Gonocytes failing to migrate and differentiate properly undergo apoptosis. Inadequate gonocyte differentiation has been suggested to lead to testicular germ cell tumor (TGCT) formation. Here, we examined the expression levels of apoptosis-related genes during gonocyte differentiation by quantitative real-time polymerase chain reaction, identifying 48 pro- and anti-apoptotic genes increased by at least two-fold in rat gonocytes induced to differentiate by retinoic acid, when compared to untreated gonocytes. Further analysis of the most highly expressed genes identified the pro-apoptotic genes Gadd45a and Cycs as upregulated in differentiating gonocytes and in spermatogonia compared with gonocytes. These genes were also significantly downregulated in seminomas, the most common type of TGCT, compared with normal human testicular tissues. These results indicate that apoptosis-related genes are actively regulated during gonocyte differentiation. Moreover, the down-regulation of pro-apoptotic genes in seminomas suggests that they could represent new therapeutic targets in the treatment of TGCTs.

  14. Polymorphic GGC repeat differentially regulates human reelin gene expression levels.

    PubMed

    Persico, A M; Levitt, P; Pimenta, A F

    2006-10-01

    The human gene encoding Reelin (RELN), a pivotal protein in neurodevelopment, includes a polymorphic GGC repeat in its 5' untranslated region (UTR). CHO cells transfected with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of the luciferase reporter gene show declining luciferase activity with increasing GGC repeat number (P < 0.005), as predicted by computer-based simulations. Conversely, RELN 5'UTR sequences boost reporter gene expression above control levels in neuronal SN56 and N2A cell lines, but 12- and 13-repeat alleles still yield 50-60% less luciferase activity compared to the more common 8- and 10-repeat alleles (P < 0.0001). RELN "long" GGC alleles significantly blunt gene expression and may, through this effect, confer vulnerability to human disorders, such as schizophrenia and autism.

  15. Applying Attractor Dynamics to Infer Gene Regulatory Interactions Involved in Cellular Differentiation.

    PubMed

    Ghaffarizadeh, Ahmadreza; Podgorski, Gregory J; Flann, Nicholas S

    2017-02-27

    The dynamics of gene regulatory networks (GRNs) guide cellular differentiation. Determining the ways regulatory genes control expression of their targets is essential to understand and control cellular differentiation. The way a regulatory gene controls its target can be expressed as a gene regulatory function. Manual derivation of these regulatory functions is slow, error-prone and difficult to update as new information arises. Automating this process is a significant challenge and the subject of intensive effort. This work presents a novel approach to discovering biologically plausible gene regulatory interactions that control cellular differentiation. This method integrates known cell type expression data, genetic interactions, and knowledge of the effects of gene knockouts to determine likely GRN regulatory functions. We employ a genetic algorithm to search for candidate GRNs that use a set of transcription factors that control differentiation within a lineage. Nested canalyzing functions are used to constrain the search space to biologically plausible networks. The method identifies an ensemble of GRNs whose dynamics reproduce the gene expression pattern for each cell type within a particular lineage. The method's effectiveness was tested by inferring consensus GRNs for myeloid and pancreatic cell differentiation and comparing the predicted gene regulatory interactions to manually derived interactions. We identified many regulatory interactions reported in the literature and also found differences from published reports. These discrepancies suggest areas for biological studies of myeloid and pancreatic differentiation. We also performed a study that used defined synthetic networks to evaluate the accuracy of the automated search method and found that the search algorithm was able to discover the regulatory interactions in these defined networks with high accuracy. We suggest that the GRN functions derived from the methods described here can be used to fill

  16. [Food-procuring stereotype movements is accompanied by changes of c-Fos gene expression in the amygdala and modulation of heart rate in rats].

    PubMed

    Dovgan', O V; Vlasenko, O V; Buzyka, T V; Maĭs'kyĭ, V O; Piliavs'kyĭ, O I; Maznychenko, A V

    2012-01-01

    The distribution of Fos-immunoreactive (Fos-ir) and NADPH Diaphorase reactive (NADPH-dr-) neurons in the different subnuclei of amygdala and insular cortex (on the level -2,12 to -3,14 mm from bregma), and the associated changes of heart rate (HR) in intact, food-deprivated and executed food-procuring movements of rats were studied. In comparison with other groups of animals, the mean number of the Fos-ir neurons in the central nucleus of amygdala (Ce) and the insular cortex (GI/DI) at all studied levels was significantly greater in the executed food-procuring movements in rats. The main focus of localization of the Fos-ir neurons was found in lateral part of the Ce (58.5 +/- 1.9 units in 40-microm-thick section) at the level -2.56 mm. The mean number of Fos-ir neurons was significantly greater also in the lateral and capsular parts of the Ce. The mean number of Fos-ir neurons in the GI/DI was 165.5 +/- 3.2 cells in section. The number and density of NADPH-d reactive neurons was not significantly different in the brain structures of all animal groups studied. The double stained neurons (Fos-ir + NADPH-dr) were registered in medial, basolateral, anterior cortical amygdaloid nuclei and substantia innominata (SI) in rats after realization food-procuring movements. It was found that realization of food-procuring movements by the forelimb during repeated sessions was accompanied with the gradual decline of mean values of the HR (from 5% to 12% of control level) with subsequent renewal of them to the initial values (tonic component). The analysis of dynamics of the HR changes during realization of separate purposeful motion has shown the transient period of the HR suppression (500 ms), which coincided with the terminal phase of grasping of food pellet (phasic component). We suggest that the revealed focuses of localization of Fos-ir neurons in the lateral and medial subregions of amigdaloid Ce and also GI/DI, and SI testified that these structures of brain are involved

  17. Meta-Analysis of Differential Connectivity in Gene Co-Expression Networks in Multiple Sclerosis

    PubMed Central

    Creanza, Teresa Maria; Liguori, Maria; Liuni, Sabino; Nuzziello, Nicoletta; Ancona, Nicola

    2016-01-01

    Differential gene expression analyses to investigate multiple sclerosis (MS) molecular pathogenesis cannot detect genes harboring genetic and/or epigenetic modifications that change the gene functions without affecting their expression. Differential co-expression network approaches may capture changes in functional interactions resulting from these alterations. We re-analyzed 595 mRNA arrays from publicly available datasets by studying changes in gene co-expression networks in MS and in response to interferon (IFN)-β treatment. Interestingly, MS networks show a reduced connectivity relative to the healthy condition, and the treatment activates the transcription of genes and increases their connectivity in MS patients. Importantly, the analysis of changes in gene connectivity in MS patients provides new evidence of association for genes already implicated in MS by single-nucleotide polymorphism studies and that do not show differential expression. This is the case of amiloride-sensitive cation channel 1 neuronal (ACCN1) that shows a reduced number of interacting partners in MS networks, and it is known for its role in synaptic transmission and central nervous system (CNS) development. Furthermore, our study confirms a deregulation of the vitamin D system: among the transcription factors that potentially regulate the deregulated genes, we find TCF3 and SP1 that are both involved in vitamin D3-induced p27Kip1 expression. Unveiling differential network properties allows us to gain systems-level insights into disease mechanisms and may suggest putative targets for the treatment. PMID:27314336

  18. Evaluation of New Biomarker Genes for Differentiating Haemophilus influenzae from Haemophilus haemolyticus

    PubMed Central

    Anderson, Raydel D.; Wang, Xin; Katz, Lee S.; Vuong, Jeni T.; Bell, Melissa E.; Juni, Billie A.; Lowther, Sara A.; Lynfield, Ruth; MacNeil, Jessica R.; Mayer, Leonard W.

    2012-01-01

    PCR detecting the protein D (hpd) and fuculose kinase (fucK) genes showed high sensitivity and specificity for identifying Haemophilus influenzae and differentiating it from H. haemolyticus. Phylogenetic analysis using the 16S rRNA gene demonstrated two distinct groups for H. influenzae and H. haemolyticus. PMID:22301020

  19. Evaluation of new biomarker genes for differentiating Haemophilus influenzae from Haemophilus haemolyticus.

    PubMed

    Theodore, M Jordan; Anderson, Raydel D; Wang, Xin; Katz, Lee S; Vuong, Jeni T; Bell, Melissa E; Juni, Billie A; Lowther, Sara A; Lynfield, Ruth; MacNeil, Jessica R; Mayer, Leonard W

    2012-04-01

    PCR detecting the protein D (hpd) and fuculose kinase (fucK) genes showed high sensitivity and specificity for identifying Haemophilus influenzae and differentiating it from H. haemolyticus. Phylogenetic analysis using the 16S rRNA gene demonstrated two distinct groups for H. influenzae and H. haemolyticus.

  20. A Microarray Analysis for Differential Gene Expression in the Soybean Genome Using Bioconductor and R

    USDA-ARS?s Scientific Manuscript database

    This paper describes specific procedures for conducting quality assessment of Affymetrix GeneChip® soybean genome data and performing analyses to determine differential gene expression using the open-source R language and environment in conjunction with the open-source Bioconductor package. Procedu...

  1. EVE (external variance estimation) increases statistical power for detecting differentially expressed genes.

    PubMed

    Wille, Anja; Gruissem, Wilhelm; Bühlmann, Peter; Hennig, Lars

    2007-11-01

    Accurately identifying differentially expressed genes from microarray data is not a trivial task, partly because of poor variance estimates of gene expression signals. Here, after analyzing 380 replicated microarray experiments, we found that probesets have typical, distinct variances that can be estimated based on a large number of microarray experiments. These probeset-specific variances depend at least in part on the function of the probed gene: genes for ribosomal or structural proteins often have a small variance, while genes implicated in stress responses often have large variances. We used these variance estimates to develop a statistical test for differentially expressed genes called EVE (external variance estimation). The EVE algorithm performs better than the t-test and LIMMA on some real-world data, where external information from appropriate databases is available. Thus, EVE helps to maximize the information gained from a typical microarray experiment. Nonetheless, only a large number of replicates will guarantee to identify nearly all truly differentially expressed genes. However, our simulation studies suggest that even limited numbers of replicates will usually result in good coverage of strongly differentially expressed genes.

  2. Differential gene expression profiling of vocal fold polyps and Reinke's edema by complementary DNA microarray.

    PubMed

    Duflo, Suzy M; Thibeault, Susan L; Li, Wenhua; Smith, Marshall E; Schade, Goetz; Hess, Markus M

    2006-09-01

    Our purpose was to determine whether complementary DNA (cDNA) microarray analysis (MA) can establish distinct gene expression profiles for 2 phenotypically similar vocal fold lesions: Reinke's edema (RE) and polyps. Established transcript profiles can provide insight into the molecular and cellular processes involved in these diseases. Eleven RE specimens and 17 polyps were analyzed with MA for 8,745 genes. Further MA profiling was attempted within each lesion group to identify molecular markers for reflux exposure and smoking. Prediction analysis was used to predict lesion classification for 2 unclassified samples. A real-time polymerase chain reaction was performed to corroborate MA transcript levels for selected significant genes. Sixty-five genes were found to differentiate RE and polyps (p = .0088). For RE, 19 genes were differentiated for reflux exposure (p = .016). No genes were found to differentiate smokers from nonsmokers. For polyps, no genes were found to differentiate for reflux (p = .16) and smoking (p = .565). Categorization of unclassified lesions was possible with a minimum of 13 genes. We demonstrate the feasibility of benign lesion classification based on MA. Microarray analysis is useful not only for improving diagnosis and classification of such lesions, but also for potentially generating prognostic indicators and targets for therapy.

  3. A new gene regulatory network model based on BP algorithm for interrogating differentially expressed genes of Sea Urchin.

    PubMed

    Liu, Longlong; Zhao, Tingting; Ma, Meng; Wang, Yan

    2016-01-01

    Computer science and mathematical theories are combined to analyze the complex interactions among genes, which are simplified to a network to establish a theoretical model for the analysis of the structure, module and dynamic properties. In contrast, traditional model of gene regulatory networks often lack an effective method for solving gene expression data because of high durational and spatial complexity. In this paper, we propose a new model for constructing gene regulatory networks using back propagation (BP) neural network based on predictive function and network topology. Combined with complex nonlinear mapping and self-learning, the BP neural network was mapped into a complex network. Network characteristics were obtained from the parameters of the average path length, average clustering coefficient, average degree, modularity, and map's density to simulate the real gene network by an artificial network. Through the statistical analysis and comparison of network parameters of Sea Urchin mRNA microarray data under different temperatures, the value of network parameters was observed. Differentially expressed Sea Urchin genes associated with temperature were determined by calculating the difference in the degree of each gene from different networks. The new model we developed is suitable to simulate gene regulatory network and has capability of determining differentially expressed genes.

  4. Positions of pluripotency genes and hepatocyte-specific genes in the nucleus before and after mouse ES cell differentiation.

    PubMed

    Udagawa, K; Ohyama, T

    2014-03-24

    Spatial positioning of genes in the cell nucleus plays an important role in the regulation of genomic functions. Evidence for changes in gene positioning associated with transcriptional activity has been reported. However, our understanding of this phenomenon is still quite limited. We examined how pluripotency genes and hepatocyte-specific genes behave during the differentiation of mouse embryonic stem (ES) cells into hepatocytes, by targeting the loci of the Klf4, Nanog, Oct4, Sox2, Cyp7α1, Pck1, Tat, and Tdo2 genes, and using three-dimensional fluorescence in situ hybridization analyses. We found that each gene has a distinctly inherent localization profile in the ES cell nucleus. During differentiation, the Klf4, Nanog, Oct4, Cyp7α1, Pck1, and Tat loci shifted toward the nuclear center, while the Sox2 and Tdo2 loci shifted toward the periphery. The Klf4, Nanog, Oct4, and Tdo2 seem to prefer the outer regions, rather than the inner regions, when they are active. We also found that the radial positioning of the focused genes in the hepatocyte cell nucleus was highly correlated with the local GC content and the gene density of the surrounding region, but not with gene activity.

  5. Phenotypic differentiation of Streptococcus pyogenes populations is induced by recombination-driven gene-specific sweeps

    PubMed Central

    Bao, Yun-Juan; Shapiro, B. Jesse; Lee, Shaun W.; Ploplis, Victoria A.; Castellino, Francis J.

    2016-01-01

    Genomic recombination plays an important role in driving adaptive evolution and population differentiation in bacteria. However, controversy exists as to the effects of recombination on population diversity and differentiation, i.e., recombination is frequent enough to sweep through the population at selected gene loci (gene-specific sweeps), or the recombination rate is low without interfering genome-wide selective sweeps. Observations supporting either view are sparse. Pathogenic bacteria causing infectious diseases are promising candidates to provide observations of recombination. However, phenotype-associated differentiations are usually vague among them due to diverse disease manifestations. Here we report a population genomic study of the group A Streptococcus pyogenes (GAS), a human pathogen with highly recombining genomes. By employing a genome-wide association study on single nucleotide polymorphisms (SNPs), we demonstrate a phenotypic differentiation of GAS, represented by separate clustering of two sublineages associated with niche-specific infections, i.e., skin infection and pharyngitis-induced acute rheumatic fever. By quantifying SNPs associated with the differentiation in a statistical and phylogenetic context, we propose that the phenotype-associated differentiation arose through recombination-driven gene-specific sweeps, rather than genome-wide sweeps. Our work provides a novel paradigm of phenotype-associated differentiation induced by gene-specific sweeps in a human pathogen and has implications for understanding of driving forces of bacterial evolution. PMID:27821851

  6. Chromatin signatures in multipotent human hematopoietic stem cells indicate the fate of bivalent genes during differentiation.

    PubMed

    Cui, Kairong; Zang, Chongzhi; Roh, Tae-Young; Schones, Dustin E; Childs, Richard W; Peng, Weiqun; Zhao, Keji

    2009-01-09

    Histone modifications have been implicated in stem cell maintenance and differentiation. We have analyzed genome-wide changes in gene expression and histone modifications during differentiation of multipotent human primary hematopoietic stem cells/progenitor cells (HSCs/HPCs) into erythrocyte precursors. Our data indicate that H3K4me1, H3K9me1, and H3K27me1 associate with enhancers of differentiation genes prior to their activation and correlate with basal expression, suggesting that these monomethylations are involved in the maintenance of activation potential required for differentiation. In addition, although the majority of genes associated with both H3K4me3 and H3K27me3 in HSCs/HPCs become silent and lose H3K4me3 after differentiation, those that lose H3K27me3 and become activated after differentiation are associated with increased levels of H2A.Z, H3K4me1, H3K9me1, H4K20me1, and RNA polymerase II in HSCs/HPCs. Thus, our data suggest that gene expression changes during differentiation are programmed by chromatin modifications present at the HSC/HPC stage and provide a resource for enhancer and promoter identification.

  7. Identifying differential networks based on multi-platform gene expression data.

    PubMed

    Ou-Yang, Le; Yan, Hong; Zhang, Xiao-Fei

    2016-12-20

    Exploring how the structure of a gene regulatory network differs between two different disease states is fundamental for understanding the biological mechanisms behind disease development and progression. Recently, with rapid advances in microarray technologies, gene expression profiles of the same patients can be collected from multiple microarray platforms. However, previous differential network analysis methods were usually developed based on a single type of platform, which could not utilize the common information shared across different platforms. In this study, we introduce a multi-view differential network analysis model to infer the differential network between two different patient groups based on gene expression profiles collected from multiple platforms. Unlike previous differential network analysis models that need to analyze each platform separately, our model can draw support from multiple data platforms to jointly estimate the differential networks and produce more accurate and reliable results. Our simulation studies demonstrate that our method consistently outperforms other available differential network analysis methods. We also applied our method to identify network rewiring associated with platinum resistance using TCGA ovarian cancer samples. The experimental results demonstrate that the hub genes in our identified differential networks on the PI3K/AKT/mTOR pathway play an important role in drug resistance.

  8. Gene expression analysis of terminal differentiation of human melanoma cells highlights global reductions in cell cycle-associated genes.

    PubMed

    Huynh, Kim Mai; Kim, Gyoungmi; Kim, Dong-Joon; Yang, Suk-Jin; Park, Seong-min; Yeom, Young-Il; Fisher, Paul B; Kang, Dongchul

    2009-03-15

    Defects in differentiation are frequently observed in cancer cells. By appropriate treatment specific tumor cell types can be induced to terminally differentiate. Metastatic HO-1 human melanoma cells treated with IFN-beta plus mezerein (MEZ) undergo irreversible growth arrest and terminal differentiation followed by apoptosis. In order to define the molecular changes associated with this process, changes in gene expression were analyzed by cDNA microarray hybridization and by semi-quantitative and quantitative RT-PCRs of representative 44 genes. The expression of 210 genes was changed more than two-fold at either 8 or 24 h post-treatment (166 up and 44 down). Major biological processes associated with the up-regulated genes were response to endogenous/exogenous stimuli (38%), cell proliferation (13%), cell death (16%) and development (30%). Approximately 34% of the down-regulated genes were associated with cell cycle, 9% in DNA replication and 11% in chromosome organization, respectively. Suppression of cell cycle associated genes appeared to directly correlate with growth arrest observed in the terminal differentiation process. Expression of Calpain 3 (CAPN3) variant 6 was suppressed by the combined treatment and maintained high in various melanoma cell lines. However, over-expression of the CAPN3 did not significantly affect growth kinetics and cell viability, suggesting that up-regulation of CAPN3 alone may not be a causative, but an associated change with melanoma development. This analysis provides further insights into the spectrum of up-regulated and the first detailed investigation of down-regulated gene changes associated with and potentially causative of induction of loss of proliferative capacity and terminal differentiation in human melanoma cells.

  9. Forced expression of Hnf4a induces hepatic gene activation through directed differentiation.

    PubMed

    Yahoo, Neda; Pournasr, Behshad; Rostamzadeh, Jalal; Fathi, Fardin

    2016-08-05

    Embryonic stem (ES) cells are capable of unlimited self-renewal and have a diverse differentiation potential. These unique features make ES cells as an attractive source for developmental biology studies. Having the mature hepatocyte in the lab with functional activities is valuable in drug discovery studies. Overexpression of hepatocyte lineage-specific transcription factors (TFs) becomes a promising approach in pluripotent cell differentiation toward liver cells. Many studies generate transgenic ES cell lines to examine the effects of specific TFs overexpression in cell differentiation. In the present report, we have addressed whether a suspension or adherent model of differentiation is an appropriate way to study the role of Hnf4a overexpression. We generated ES cells that carried a doxycycline (Dox)-inducible Hnf4a using lentiviral vectors. The transduced cells were subjected to induced Hnf4a overexpression through both spontaneous and directed differentiation methods. Gene expression analysis showed substantially increased expression of hepatic gene markers, particularly Ttr and endogenous Hnf4a, in transduced cells differentiated by the directed approach. These results demonstrated that forced expression of TFs during directed differentiation would be an appropriate way to study relevant gene activation and the effects of overexpression in the context of hepatic differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Zebrafish sex determination and differentiation: Involvement of FTZ-F1 genes

    PubMed Central

    von Hofsten, Jonas; Olsson, Per-Erik

    2005-01-01

    Sex determination is the process deciding the sex of a developing embryo. This is usually determined genetically; however it is a delicate process, which in many cases can be influenced by environmental factors. The mechanisms controlling zebrafish sex determination and differentiation are not known. To date no sex linked genes have been identified in zebrafish and no sex chromosomes have been identified. However, a number of genes, as presented here, have been linked to the process of sex determination or differentiation in zebrafish. The zebrafish FTZ-F1 genes are of central interest as they are involved in regulating interrenal development and thereby steroid biosynthesis, as well as that they show expression patterns congruent with reproductive tissue differentiation and function. Zebrafish can be sex reversed by exposure to estrogens, suggesting that the estrogen levels are crucial during sex differentiation. The Cyp19 gene product aromatase converts testosterone into 17 beta-estradiol, and when inhibited leads to male to female sex reversal. FTZ-F1 genes are strongly linked to steroid biosynthesis and the regulatory region of Cyp19 contains binding sites for FTZ-F1 genes, further linking FTZ-F1 to this process. The role of FTZ-F1 and other candidates for zebrafish sex determination and differentiation is in focus of this review. PMID:16281973

  11. Live-Cell, Temporal Gene Expression Analysis of Osteogenic Differentiation in Adipose-Derived Stem Cells

    PubMed Central

    Desai, Hetal V.; Voruganti, Indu S.; Jayasuriya, Chathuraka; Chen, Qian

    2014-01-01

    Adipose-derived stem cells (ASCs) are a widely investigated type of mesenchymal stem cells with great potential for musculoskeletal regeneration. However, the use of ASCs is complicated by their cellular heterogeneity, which exists at both the population and single-cell levels. This study demonstrates a live-cell assay to investigate gene expression in ASCs undergoing osteogenesis using fluorescently tagged DNA hybridization probes called molecular beacons. A molecular beacon was designed to target the mRNA sequence for alkaline phosphatase (ALPL), a gene characteristically expressed during early osteogenesis. The percentage of cells expressing this gene in a population was monitored daily to quantify the uniformity of the differentiation process. Differentiating ASC populations were repeatedly measured in a nondestructive fashion over a 10-day period to obtain temporal gene expression data. Results showed consistent expression patterns for the investigated osteogenic genes in response to induction medium. Peak signal level, indicating when the most cells expressed ALPL at once, was observed on days 3–5. The differentiation response of sample populations was generally uniform when assessed on a well-by-well basis over time. The expression of alkaline phosphatase is consistent with previous studies of osteogenic differentiation, suggesting that molecular beacons are a viable means of monitoring the spatiotemporal gene expression of live, differentiating ASCs. PMID:24367991

  12. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    PubMed

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. © 2016 The Royal Entomological Society.

  13. Differential loss of ancestral gene families as a source of genomic divergence in animals.

    PubMed Central

    Hughes, Austin L; Friedman, Robert

    2004-01-01

    A phylogenetic approach was used to reconstruct the pattern of an apparent loss of 2106 ancestral gene families in four animal genomes (Caenorhabditis elegans, Drosophila melanogaster, human and fugu). Substantially higher rates of loss of ancestral gene families were found in the invertebrates than in the vertebrates. These results indicate that the differential loss of ancestral gene families can be a significant factor in the evolutionary diversification of organisms. PMID:15101434

  14. Identification of stable reference genes in differentiating human pluripotent stem cells.

    PubMed

    Holmgren, Gustav; Ghosheh, Nidal; Zeng, Xianmin; Bogestål, Yalda; Sartipy, Peter; Synnergren, Jane

    2015-06-01

    Reference genes, often referred to as housekeeping genes (HKGs), are frequently used to normalize gene expression data based on the assumption that they are expressed at a constant level in the cells. However, several studies have shown that there may be a large variability in the gene expression levels of HKGs in various cell types. In a previous study, employing human embryonic stem cells (hESCs) subjected to spontaneous differentiation, we observed that the expression of commonly used HKG varied to a degree that rendered them inappropriate to use as reference genes under those experimental settings. Here we present a substantially extended study of the HKG signature in human pluripotent stem cells (hPSC), including nine global gene expression datasets from both hESC and human induced pluripotent stem cells, obtained during directed differentiation toward endoderm-, mesoderm-, and ectoderm derivatives. Sets of stably expressed genes were compiled, and a handful of genes (e.g., EID2, ZNF324B, CAPN10, and RABEP2) were identified as generally applicable reference genes in hPSCs across all cell lines and experimental conditions. The stability in gene expression profiles was confirmed by reverse transcription quantitative PCR analysis. Taken together, the current results suggest that differentiating hPSCs have a distinct HKG signature, which in some aspects is different from somatic cell types, and underscore the necessity to validate the stability of reference genes under the actual experimental setup used. In addition, the novel putative HKGs identified in this study can preferentially be used for normalization of gene expression data obtained from differentiating hPSCs.

  15. Differential gene expression patterns between smokers and non-smokers: cause or consequence?

    PubMed

    Vink, Jacqueline M; Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H; Penninx, Brenda W; Boomsma, Dorret I

    2017-03-01

    The molecular mechanisms causing smoking-induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome-wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex-smokers were available from two population-based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty-two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10(-6) , Bonferroni correction). The most significant genes were G protein-coupled receptor 15 (P < 1 × 10(-150) ) and leucine-rich repeat neuronal 3 (P < 1 × 10(-44) ). The smoking-related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex-smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis-expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome-wide association meta-analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression.

  16. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    PubMed Central

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.

    2015-01-01

    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10−6, Bonferroni correction). The most significant genes were G protein‐coupled receptor 15 (P < 1 × 10−150) and leucine‐rich repeat neuronal 3 (P < 1 × 10−44). The smoking‐related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex‐smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene

  17. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    PubMed

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2016-09-19

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  18. Balancing Type One and Two Errors in Multiple Testing for Differential Expression of Genes

    PubMed Central

    Gordon, Alexander; Chen, Linlin; Glazko, Galina; Yakovlev, Andrei

    2009-01-01

    A new procedure is proposed to balance type I and II errors in significance testing for differential expression of individual genes. Suppose that a collection, ℱk, of k lists of selected genes is available, each of them approximating by their content the true set of differentially expressed genes. For example, such sets can be generated by a subsampling counterpart of the delete-d-jackknife method controlling the per-comparison error rate for each subsample. A final list of candidate genes, denoted by S*, is composed in such a way that its contents be closest in some sense to all the sets thus generated. To measure “closeness” of gene lists, we introduce an asymmetric distance between sets with its asymmetry arising from a generally unequal assignment of the relative costs of type I and type II errors committed in the course of gene selection. The optimal set S* is defined as a minimizer of the average asymmetric distance from an arbitrary set S to all sets in the collection ℱk. The minimization problem can be solved explicitly, leading to a frequency criterion for the inclusion of each gene in the final set. The proposed method is tested by resampling from real microarray gene expression data with artificially introduced shifts in expression levels of pre-defined genes, thereby mimicking their differential expression. PMID:20161303

  19. Differential gene expression in Symbiodinium microadriaticum clade B following stress.

    PubMed

    Karako-Lampert, S; Hershkovits, G; Stambler, N; Simon-Blecher, N; Achituv, Y; Dubinsky, Z; Katcoff, D J

    2006-01-01

    Coral bleaching is caused by the loss of symbiont zooxanthellae and/or decrease in their pigments. Since the algal symbionts provide the energy basis for corals and whole reefs, their loss or impairment of function leads to widespread mortality. This phenomenon has been documented numerous times in recent years, and has extensively damaged coral reefs all over the world. Temperature has been found to be the major cause of bleaching, and rising sea temperatures have increased the frequency of these catastrophic episodes. To characterize the response of zooxanthellae to temperature stress at the molecular level, we used the mRNA differential display technique to monitor changes in the abundance of specific mRNA species in the cell under different temperature conditions. Axenically grown zooxanthellae were exposed to a range of temperatures (21.7, 17, 26 degrees C) before extraction of their mRNA. Of numerous differentially expressed sequences, seven mRNA species were amplified by the polymerase chain reaction (PCR) and sequenced. One of those sequences was positively identified as encoding a multifunction cell surface aminopeptidase, dipeptidyl peptidase IV, which is active in cell matrix adhesion. Our work illustrates the power of the differential display technique as a useful tool to study the response of zooxanthellae to stressors.

  20. Identification of genes differentially expressed in ectomycorrhizal roots during the Pinus pinaster-Laccaria bicolor interaction.

    PubMed

    Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M

    2013-06-01

    Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.

  1. CEDER: Accurate detection of differentially expressed genes by combining significance of exons using RNA-Seq

    PubMed Central

    Wan, Lin; Sun, Fengzhu

    2012-01-01

    RNA-Seq is widely used in transcriptome studies, and the detection of differentially expressed genes (DEGs) between two classes of individuals, e.g. cases vs controls, using RNA-Seq is of fundamental importance. Many statistical methods for DEG detection based on RNA-Seq data have been developed and most of them are based on the read counts mapped to individual genes. On the other hand, genes are composed of exons and the distribution of reads for the different exons can be heterogeneous. We hypothesize that the detection accuracy of differentially expressed genes can be increased by analyzing individual exons within a gene and then combining the results of the exons. We therefore developed a novel program, termed CEDER, to accurately detect DGEs by combining the significance of the exons. CEDER first tests for differentially expressed exons yielding a p-value for each, and then gives a score indicating the potential for a gene to be differentially expressed by integrating the p-values of the exons in the gene. We showed that CEDER can significantly increase the accuracy of existing methods for detecting DEGs on two benchmark RNA-Seq datasets and simulated datasets. PMID:22641709

  2. Gene differential coexpression analysis based on biweight correlation and maximum clique.

    PubMed

    Zheng, Chun-Hou; Yuan, Lin; Sha, Wen; Sun, Zhan-Li

    2014-01-01

    Differential coexpression analysis usually requires the definition of 'distance' or 'similarity' between measured datasets. Until now, the most common choice is Pearson correlation coefficient. However, Pearson correlation coefficient is sensitive to outliers. Biweight midcorrelation is considered to be a good alternative to Pearson correlation since it is more robust to outliers. In this paper, we introduce to use Biweight Midcorrelation to measure 'similarity' between gene expression profiles, and provide a new approach for gene differential coexpression analysis. Firstly, we calculate the biweight midcorrelation coefficients between all gene pairs. Then, we filter out non-informative correlation pairs using the 'half-thresholding' strategy and calculate the differential coexpression value of gene, The experimental results on simulated data show that the new approach performed better than three previously published differential coexpression analysis (DCEA) methods. Moreover, we use the maximum clique analysis to gene subset included genes identified by our approach and previously reported T2D-related genes, many additional discoveries can be found through our method.

  3. Gene Duplication, Population Genomics, and Species-Level Differentiation within a Tropical Mountain Shrub

    PubMed Central

    Mastretta-Yanes, Alicia; Zamudio, Sergio; Jorgensen, Tove H.; Arrigo, Nils; Alvarez, Nadir; Piñero, Daniel; Emerson, Brent C.

    2014-01-01

    Gene duplication leads to paralogy, which complicates the de novo assembly of genotyping-by-sequencing (GBS) data. The issue of paralogous genes is exacerbated in plants, because they are particularly prone to gene duplication events. Paralogs are normally filtered from GBS data before undertaking population genomics or phylogenetic analyses. However, gene duplication plays an important role in the functional diversification of genes and it can also lead to the formation of postzygotic barriers. Using populations and closely related species of a tropical mountain shrub, we examine 1) the genomic differentiation produced by putative orthologs, and 2) the distribution of recent gene duplication among lineages and geography. We find high differentiation among populations from isolated mountain peaks and species-level differentiation within what is morphologically described as a single species. The inferred distribution of paralogs among populations is congruent with taxonomy and shows that GBS could be used to examine recent gene duplication as a source of genomic differentiation of nonmodel species. PMID:25223767

  4. EMDomics: a robust and powerful method for the identification of genes differentially expressed between heterogeneous classes.

    PubMed

    Nabavi, Sheida; Schmolze, Daniel; Maitituoheti, Mayinuer; Malladi, Sadhika; Beck, Andrew H

    2016-02-15

    A major goal of biomedical research is to identify molecular features associated with a biological or clinical class of interest. Differential expression analysis has long been used for this purpose; however, conventional methods perform poorly when applied to data with high within class heterogeneity. To address this challenge, we developed EMDomics, a new method that uses the Earth mover's distance to measure the overall difference between the distributions of a gene's expression in two classes of samples and uses permutations to obtain q-values for each gene. We applied EMDomics to the challenging problem of identifying genes associated with drug resistance in ovarian cancer. We also used simulated data to evaluate the performance of EMDomics, in terms of sensitivity and specificity for identifying differentially expressed gene in classes with high within class heterogeneity. In both the simulated and real biological data, EMDomics outperformed competing approaches for the identification of differentially expressed genes, and EMDomics was significantly more powerful than conventional methods for the identification of drug resistance-associated gene sets. EMDomics represents a new approach for the identification of genes differentially expressed between heterogeneous classes and has utility in a wide range of complex biomedical conditions in which sample classes show within class heterogeneity. The R package is available at http://www.bioconductor.org/packages/release/bioc/html/EMDomics.html. © The Author 2015. Published by Oxford University Press.

  5. Conjugated linoleic acid-induced milk fat depression in lactating ewes is accompanied by reduced expression of mammary genes involved in lipid synthesis.

    PubMed

    Hussein, M; Harvatine, K H; Weerasinghe, W M P B; Sinclair, L A; Bauman, D E

    2013-06-01

    Conjugated linoleic acids (CLA) are produced during rumen biohydrogenation and exert a range of biological effects. The trans-10,cis-12 CLA isomer is a potent inhibitor of milk fat synthesis in lactating dairy cows and some aspects of the mechanism have been established. Conjugated linoleic acid-induced milk fat depression has also been observed in small ruminants and our objective was to examine the molecular mechanism in lactating ewes. Multiparous lactating ewes were fed a basal ration (0.55:0.45 concentrate-to-forage ratio; dry matter basis) and randomly allocated to 2 dietary CLA levels (n=8 ewes/treatment). Treatments were zero CLA (control) or 15 g/d of lipid-encapsulated CLA supplement containing cis-9,trans-11 and trans-10,cis-12 CLA isomers in equal proportions. Treatments were fed for 10 wk and the CLA supplement provided 1.5 g of trans-10,cis-12/d. No treatment effects were observed on milk yield or milk composition for protein or lactose at wk 10 of the study. In contrast, CLA treatment significantly decreased both milk fat percentage and milk fat yield (g/d) by about 23%. The de novo synthesized fatty acids (FA; C16) was increased (10%) for the CLA treatment. In agreement with the reduced de novo FA synthesis, mRNA abundance of acetyl-coenzyme A carboxylase α, FA synthase, stearoyl-CoA desaturase 1, and glycerol-3-phosphate acyltransferase 6 decreased by 25 to 40% in the CLA-treated group. Conjugated linoleic acid treatment did not significantly reduce the mRNA abundance of enzymes involved in NADPH production, but the mRNA abundance for sterol regulatory element-binding factor 1 and insulin-induced gene 1, genes involved in regulation of transcription of lipogenic enzymes, was decreased by almost 30 and 55%, respectively, with CLA treatment. Furthermore, mRNA abundance of lipoprotein lipase decreased by almost 40% due to CLA treatment

  6. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling

    PubMed Central

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-01-01

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori. PMID:25736158

  7. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling.

    PubMed

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2015-03-04

    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori.

  8. Staphylococcus aureus Biofilm and Planktonic cultures differentially impact gene expression, mapk phosphorylation, and cytokine production in human keratinocytes.

    PubMed

    Secor, Patrick R; James, Garth A; Fleckman, Philip; Olerud, John E; McInnerney, Kate; Stewart, Philip S

    2011-06-21

    Many chronic diseases, such as non-healing wounds are characterized by prolonged inflammation and respond poorly to conventional treatment. Bacterial biofilms are a major impediment to wound healing. Persistent infection of the skin allows the formation of complex bacterial communities termed biofilm. Bacteria living in biofilms are phenotypically distinct from their planktonic counterparts and are orders of magnitude more resistant to antibiotics, host immune response, and environmental stress. Staphylococcus aureus is prevalent in cutaneous infections such as chronic wounds and is an important human pathogen. The impact of S. aureus soluble products in biofilm-conditioned medium (BCM) or in planktonic-conditioned medium (PCM) on human keratinocytes was investigated. Proteomic analysis of BCM and PCM revealed differential protein compositions with PCM containing several enzymes involved in glycolysis. Global gene expression of keratinocytes exposed to biofilm and planktonic S. aureus was analyzed after four hours of exposure. Gene ontology terms associated with responses to bacteria, inflammation, apoptosis, chemotaxis, and signal transduction were enriched in BCM treated keratinocytes. Several transcripts encoding cytokines were also upregulated by BCM after four hours. ELISA analysis of cytokines confirmed microarray results at four hours and revealed that after 24 hours of exposure, S. aureus biofilm induced sustained low level cytokine production compared to near exponential increases of cytokines in planktonic treated keratinocytes. The reduction in cytokines produced by keratinocytes exposed to biofilm was accompanied by suppressed phosphorylation of MAPKs. Chemical inhibition of MAPKs did not drastically reduce cytokine production in BCM-treated keratinocytes suggesting that the majority of cytokine production is mediated through MAPK-independent mechanisms. Collectively the results indicate that S. aureus biofilms induce a distinct inflammatory response

  9. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba.

    PubMed

    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong

    2016-09-20

    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  10. Gene expression signatures defining fundamental biological processes in pluripotent, early, and late differentiated embryonic stem cells.

    PubMed

    Gaspar, John Antonydas; Doss, Michael Xavier; Winkler, Johannes; Wagh, Vilas; Hescheler, Jürgen; Kolde, Raivo; Vilo, Jaak; Schulz, Herbert; Sachinidis, Agapios

    2012-09-01

    Investigating the molecular mechanisms controlling the in vivo developmental program postembryogenesis is challenging and time consuming. However, the developmental program can be partly recapitulated in vitro by the use of cultured embryonic stem cells (ESCs). Similar to the totipotent cells of the inner cell mass, gene expression and morphological changes in cultured ESCs occur hierarchically during their differentiation, with epiblast cells developing first, followed by germ layers and finally somatic cells. Combination of high throughput -omics technologies with murine ESCs offers an alternative approach for studying developmental processes toward organ-specific cell phenotypes. We have made an attempt to understand differentiation networks controlling embryogenesis in vivo using a time kinetic, by identifying molecules defining fundamental biological processes in the pluripotent state as well as in early and the late differentiation stages of ESCs. Our microarray data of the differentiation of the ESCs clearly demonstrate that the most critical early differentiation processes occur at days 2 and 3 of differentiation. Besides monitoring well-annotated markers pertinent to both self-renewal and potency (capacity to differentiate to different cell lineage), we have identified candidate molecules for relevant signaling pathways. These molecules can be further investigated in gain and loss-of-function studies to elucidate their role for pluripotency and differentiation. As an example, siRNA knockdown of MageB16, a gene highly expressed in the pluripotent state, has proven its influence in inducing differentiation when its function is repressed.

  11. DNA methylation dynamics during intestinal stem cell differentiation reveals enhancers driving gene expression in the villus

    PubMed Central

    2013-01-01

    Background DNA methylation is of pivotal importance during development. Previous genome-wide studies identified numerous differentially methylated regions upon differentiation of stem cells, many of them associated with transcriptional start sites. Results We present the first genome-wide, single-base-resolution view into DNA methylation dynamics during differentiation of a mammalian epithelial stem cell: the mouse small intestinal Lgr5+ stem cell. Very little change was observed at transcriptional start sites and our data suggest that differentiation-related genes are already primed for expression in the stem cell. Genome-wide, only 50 differentially methylated regions were identified. Almost all of these loci represent enhancers driving gene expression in the differentiated part of the small intestine. Finally, we show that binding of the transcription factor Tcf4 correlates with hypo-methylation and demonstrate that Tcf4 is one of the factors contributing to formation of differentially methylated regions. Conclusions Our results reveal limited DNA methylation dynamics during small intestine stem cell differentiation and an impact of transcription factor binding on shaping the DNA methylation landscape during differentiation of stem cells in vivo. PMID:23714178

  12. The Antiaging Gene Klotho Regulates Proliferation and Differentiation of Adipose-Derived Stem Cells

    PubMed Central

    Fan, Jun; Sun, Zhongjie

    2017-01-01

    Klotho was originally discovered as an aging-suppressor gene. The purpose of this study was to investigate whether secreted Klotho (SKL) affects the proliferation and differentiation of adipose-derived stem cells (ADSCs). RT-PCR and Western blot analysis showed that short-form Klotho was expressed in mouse ADSCs. The Klotho gene mutation KL(−/−) significantly decreased proliferation of ADSCs and expression of pluripotent transcription factors (Nanog, Sox-2, and Oct-4) in mice. The adipogenic differentiation of ADSCs was also decreased in KL(−/−) mice. Incubation with Klotho-deficient medium decreased ADSC proliferation, pluripotent transcription factor levels, and adipogenic differentiation, which is similar to what was found in KL(−/−) mice. These results indicate that Klotho deficiency suppresses ADSC proliferation and differentiation. Interestingly, treatment with recombinant SKL protein rescued the Klotho deficiency-induced impairment in ADSC proliferation and adipogenic differentiation. SKL also regulated ADSCs’ differentiation to other cell lineages (osteoblasts, myofibroblasts), indicating that SKL maintains stemness of ADSCs. It is intriguing that overexpression of SKL significantly increased PPAR-γ expression and lipid formation in ADSCs following adipogenic induction, indicating enhanced adipogenic differentiation. Overexpression of SKL inhibited expression of TGFβ1 and its downstream signaling mediator Smad2/3. This study demonstrates, for the first time, that SKL is essential to the maintenance of normal proliferation and differentiation in ADSCs. Klotho regulates adipogenic differentiation in ADSCs, likely via inhibition of TGFβ1 and activation of PPAR-γ. PMID:26865060

  13. Adiponectin differentially affects gene expression in human mammary epithelial and breast cancer cells.

    PubMed

    Treeck, O; Lattrich, C; Juhasz-Boess, I; Buchholz, S; Pfeiler, G; Ortmann, O

    2008-10-21

    Serum levels of adiponectin are inversely associated with breast cancer risk. In this study, its effect on growth and gene expression of MCF-7 breast cancer cells and MCF-10A human mammary epithelial cells was compared. The antiproliferative effect of adiponectin on MCF-10A cells was more pronounced and was accompanied by elevated transcript levels of caspase 1, ERbeta2, ERbeta5, TR2 and USP2. Our data suggest that upregulation of genes with known growth inhibitory or apoptotic functions in mammary epithelial cells might contribute to the protective action of this adipocytokine.

  14. Differential Expression of Genes of the Calvin-Benson Cycle and its Related Genes During Leaf Development in Rice.

    PubMed

    Yamaoka, Chihiro; Suzuki, Yuji; Makino, Amane

    2016-01-01

    To understand how the machinery for photosynthetic carbon assimilation is formed and maintained during leaf development, changes in the mRNA levels of the Calvin-Benson cycle enzymes, ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) activase and two key enzymes for sucrose synthesis were determined in rice (Oryza sativa L.). According to the patterns of changes in the mRNA levels, these genes were categorized into three groups. Group 1 included most of the genes involved in the carboxylation and reduction phases of the Calvin-Benson cycle, as well as three genes in the regeneration phase. The mRNA levels increased and reached maxima during leaf expansion and then rapidly declined, although there were some variations in the residual mRNA levels in senescent leaves. Group 2 included a number of genes involved in the regeneration phase, one gene in the reduction phase of the Calvin-Benson cycle and one gene in sucrose synthesis. The mRNA levels increased and almost reached maxima before full expansion and then gradually declined. Group 3 included Rubisco activase, one gene involved in the regeneration phase and one gene in sucrose synthesis. The overall pattern was similar to that in group 2 genes except that the mRNA levels reached maxima after the stage of full expansion. Thus, genes of the Calvin-Benson cycle and its related genes were differentially expressed during leaf development in rice, suggesting that such differential gene expression is necessary for formation and maintenance of the machinery of photosynthetic carbon assimilation. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  15. Differential retention of gene functions in a secondary metabolite cluster

    USDA-ARS?s Scientific Manuscript database

    In fungi, distribution of secondary metabolite (SM) gene clusters is often associated with host- or environment-specific benefits provided by the SMs. In the plant pathogen Alternaria brassicicola (Dothideomycetes), the DEP cluster confers an ability to synthesize the SM depudecin, a histone deacety...

  16. Stress response in tardigrades: differential gene expression of molecular chaperones.

    PubMed

    Reuner, Andy; Hengherr, Steffen; Mali, Brahim; Förster, Frank; Arndt, Detlev; Reinhardt, Richard; Dandekar, Thomas; Frohme, Marcus; Brümmer, Franz; Schill, Ralph O

    2010-07-01

    Semi-terrestrial tardigrades exhibit a remarkable tolerance to desiccation by entering a state called anhydrobiosis. In this state, they show a strong resistance against several kinds of physical extremes. Because of the probable importance of stress proteins during the phases of dehydration and rehydration, the relative abundance of transcripts coding for two alpha-crystallin heat-shock proteins (Mt-sHsp17.2 and Mt-sHsp19.5), as well for the heat-shock proteins Mt-sHsp10, Mt-Hsp60, Mt-Hsp70 and Mt-Hsp90, were analysed in active and anhydrobiotic tardigrades of the species Milnesium tardigradum. They were also analysed in the transitional stage (I) of dehydration, the transitional stage (II) of rehydration and in heat-shocked specimens. A variable pattern of expression was detected, with most candidates being downregulated. Gene transcripts of one Mt-hsp70 isoform in the transitional stage I and Mt-hsp90 in the anhydrobiotic stage were significantly upregulated. A high gene expression (778.6-fold) was found for the small alpha-crystallin heat-shock protein gene Mt-sHsp17.2 after heat shock. We discuss the limited role of the stress-gene expression in the transitional stages between the active and anhydrobiotic tardigrades and other mechanisms which allow tardigrades to survive desiccation.

  17. Differential loss of embryonic globin genes during the radiation of placental mammals

    PubMed Central

    Opazo, Juan C.; Hoffmann, Federico G.; Storz, Jay F.

    2008-01-01

    The differential gain and loss of genes from homologous gene families represents an important source of functional variation among the genomes of different species. Differences in gene content between species are primarily attributable to lineage-specific gene gains via duplication and lineage-specific losses via deletion or inactivation. Here, we use a comparative genomic approach to investigate this process of gene turnover in the β-globin gene family of placental mammals. By analyzing genomic sequence data from representatives of each of the main superordinal clades of placental mammals, we were able to reconstruct pathways of gene family evolution during the basal radiation of this physiologically and morphologically diverse vertebrate group. Our analysis revealed that an initial expansion of the nonadult portion of the β-globin gene cluster in the ancestor of placental mammals was followed by the differential loss and retention of ancestral gene lineages, thereby generating variation in the complement of embryonic globin genes among contemporary species. The sorting of ε-, γ-, and η-globin gene lineages among the basal clades of placental mammals has produced species differences in the functional types of hemoglobin isoforms that can be synthesized during the course of embryonic development. PMID:18755893

  18. Differentiating mechanisms of toxicity using global gene expression analysis in Saccharomyces cerevisiae.

    PubMed

    Caba, Ebru; Dickinson, Donna A; Warnes, Gregory R; Aubrecht, Jiri

    2005-08-04

    Genotoxic stress triggers a variety of biological responses including the transcriptional activation of genes regulating DNA repair, cell survival and cell death. Genomic approaches, which monitor gene expressions across large numbers of genes, can serve as a powerful tool for exploring mechanisms of toxicity. Here, using five different agents, we investigated whether the analysis of genome-wide expression profiles in Saccharomyces cerevisiae could provide insights into mechanisms of genotoxicity versus cytotoxicity. To differentiate the genotoxic stress-associated expression signatures from that of a general cytotoxic stress, we compared gene expression profiles following the treatment with DNA-reactive (cisplatin, MMS, bleomycin) and DNA non-reactive (ethanol and sodium chloride) compounds. Although each of the tested chemicals produced a distinct gene expression profile, we were able to identify a gene expression signature consisting of a relatively small number of biologically relevant genes capable of differentiating genotoxic and cytotoxic stress. The gene set includes such upregulated genes as HUG1, ECM4 and previously uncharacterized gene, YLR297W in the genotoxic and GAP1, CGR1 in the cytotoxic group. Our results indicate the potential of gene expression profile analysis for elucidating mechanism of action of genotoxic agents.

  19. MRI reporter genes: applications for imaging of cell survival, proliferation, migration and differentiation.

    PubMed

    Vandsburger, Moriel H; Radoul, Marina; Cohen, Batya; Neeman, Michal

    2013-07-01

    Molecular imaging strives to detect molecular events at the level of the whole organism. In some cases, the molecule of interest can be detected either directly or with targeted contrast media. However many genes and proteins and particularly those located in intracellular compartments are not accessible for targeted agents. The transcriptional regulation of these genes can nevertheless be detected, although indirectly, using reporter gene encoding for readily detectable proteins. Such reporter proteins can be expressed in the tissue of interest by genetically introducing the reporter gene in the target cells. Imaging of reporter genes has become a powerful tool in modern biomedical research. Typically, expression of fluorescent and bioluminescent proteins and the reaction product of expressed enzymes and exogenous substrates were examined using in vitro histological methods and in vivo whole body imaging methods. Recent advances in MRI reporter gene methods raised the possibility that MRI could become a powerful tool for concomitant high-resolution anatomical and functional imaging and for imaging of reporter gene activity. An immediate application of MRI reporter gene methods was by monitoring gene expression patterns in gene therapy and in vivo imaging of the survival, proliferation, migration and differentiation of pluripotent and multipotent cells used in cell-based regenerative therapies for cancer, myocardial infarction and neural degeneration. In this review, we characterized a variety of MRI reporter gene methods based on their applicability to report cell survival/proliferation, migration and differentiation. In particular, we discussed which methods were best suited for translation to clinical use in regenerative therapies.

  20. Differential loss of embryonic globin genes during the radiation of placental mammals.

    PubMed

    Opazo, Juan C; Hoffmann, Federico G; Storz, Jay F

    2008-09-02

    The differential gain and loss of genes from homologous gene families represents an important source of functional variation among the genomes of different species. Differences in gene content between species are primarily attributable to lineage-specific gene gains via duplication and lineage-specific losses via deletion or inactivation. Here, we use a comparative genomic approach to investigate this process of gene turnover in the beta-globin gene family of placental mammals. By analyzing genomic sequence data from representatives of each of the main superordinal clades of placental mammals, we were able to reconstruct pathways of gene family evolution during the basal radiation of this physiologically and morphologically diverse vertebrate group. Our analysis revealed that an initial expansion of the nonadult portion of the beta-globin gene cluster in the ancestor of placental mammals was followed by the differential loss and retention of ancestral gene lineages, thereby generating variation in the complement of embryonic globin genes among contemporary species. The sorting of epsilon-, gamma-, and eta-globin gene lineages among the basal clades of placental mammals has produced species differences in the functional types of hemoglobin isoforms that can be synthesized during the course of embryonic development.

  1. Transcriptome Analysis of Differentially Expressed Genes Relevant to Variegation in Peach Flowers

    PubMed Central

    Yu, Faxin; Li, Shuxian; Yin, Tongming

    2014-01-01

    Background Variegation in flower color is commonly observed in many plant species and also occurs on ornamental peaches (Prunus persica f. versicolor [Sieb.] Voss). Variegated plants are highly valuable in the floricultural market. To gain a global perspective on genes differentially expressed in variegated peach flowers, we performed large-scale transcriptome sequencing of white and red petals separately collected from a variegated peach tree. Results A total of 1,556,597 high-quality reads were obtained, with an average read length of 445 bp. The ESTs were assembled into 16,530 contigs and 42,050 singletons. The resulting unigenes covered about 60% of total predicted genes in the peach genome. These unigenes were further subjected to functional annotation and biochemical pathway analysis. Digital expression analysis identified a total of 514 genes differentially expressed between red and white flower petals. Since peach flower coloration is determined by the expression and regulation of structural genes relevant to flavonoid biosynthesis, a detailed examination detected four key structural genes, including C4H, CHS, CHI and F3H, expressed at a significantly higher level in red than in white petal. Except for the structural genes, we also detected 11 differentially expressed regulatory genes relating to flavonoid biosynthesis. Using the differentially expressed structural genes as the test objects, we validated the digital expression results by using quantitative real-time PCR, and the differential expression of C4H, CHS and F3H were confirmed. Conclusion In this study, we generated a large EST collection from flower petals of a variegated peach. By digital expression analysis, we identified an informative list of candidate genes associated with variegation in peach flowers, which offered a unique opportunity to uncover the genetic mechanisms underlying flower color variegation. PMID:24603808

  2. Changes in red cell ion transport, reduced intratumoral neovascularization, and some mild motor function abnormalities accompany targeted disruption of the Mouse Kell gene (Kel).

    PubMed

    Zhu, Xiang; Rivera, Alicia; Golub, Mari S; Peng, Jianbin; Sha, Quan; Wu, Xu; Song, Xiaoling; Kumarathasan, Prem; Ho, Mac; Redman, Colvin M; Lee, Soohee

    2009-08-01

    Kell (ECE-3), a highly polymorphic blood group glycoprotein, displays more than 30 antigens that produce allo-antibodies and, on red blood cells (RBCs), is complexed through a single disulfide bond with the integral membrane protein, XK. XK is a putative membrane transporter whose absence results in a late onset form of neuromuscular abnormalities known as the McLeod syndrome. Although Kell glycoprotein is known to be an endothelin-3-converting enzyme, the full extent of its physiological function is unknown. To study the functions of Kell glycoprotein, we undertook targeted disruption of the murine Kel gene by homologous recombination. RBCs from Kel(-/-) mice lacked Kell glycoprotein, Kell/XK complex, and endothelin-3-converting enzyme activity and had reduced levels of XK. XK mRNA levels in spleen, brain, and testis were unchanged. In Kel(-/-) mice RBC Gardos channel activity was increased and the normal enhancement by endothelin-3 was blunted. Analysis of the microvessels of tumors produced from LL2 cells indicated that the central portion of tumors from wild-type mice were populated with many mature blood vessels, but that vessels in tumors from Kel(-/-) mice were fewer and smaller. The absence of Kell glycoprotein mildly affected some motor activities identified by foot splay on the drop tests. The targeted disruption of Kel in mouse enabled us to identify phenotypes that would not be easily detected in humans lacking Kell glycoprotein. In this regard, the Kell knockout mouse provides a good animal model for the study of normal and/or pathophysiological functions of Kell glycoprotein.

  3. A study on differentially expressed gene screening of Chrysanthemum plants under sound stress.

    PubMed

    Hongbo, Shao; Biao, Li; Bochu, Wang; Kun, Tang; Yilong, Liang

    2008-05-01

    Environmental stress can induce differential expression of genes of flower plants. It had been found that sound stimulation had an obvious effect on the growth and development of flower plants, but it is not reported on the differentially expressed genes and their expressing characteristics under sound stimulation. This is one of the few reports in terms of using the DDRT-PCR technique for screening the differentially expressed cDNA fragments responding to sound-wave stress on Chrysanthemum. Six differentially expressed cDNA fragments were obtained. Molecular weight of fragments was from 200 to 600 bp, respectively. Among differential fragments acquired, three of them (SA3, SG7-1, and CA2) were found to be positive fragments by northern dot hybridization, whose molecular weight are 270, 580 and 370 bp, respectively. SA3 was differentially expressed and SG7-1 was preferably expressed, while CA2 was restrained by the sound wave. These results indicated that expression of some genes was turned on, meanwhile the stress restrained some genes from expression under the mode of sound-stress stimulation.

  4. Sequential changes at differentiation gene promoters as they become active in a stem cell lineage

    PubMed Central

    Chen, Xin; Lu, Chenggang; Prado, Jose Rafael Morillo; Eun, Suk Ho; Fuller, Margaret T.

    2011-01-01

    Transcriptional silencing of terminal differentiation genes by the Polycomb group (PcG) machinery is emerging as a key feature of precursor cells in stem cell lineages. How, then, is this epigenetic silencing reversed for proper cellular differentiation? Here, we investigate how the developmental program reverses local PcG action to allow expression of terminal differentiation genes in the Drosophila male germline stem cell (GSC) lineage. We find that the silenced state, set up in precursor cells, is relieved through developmentally regulated sequential events at promoters once cells commit to spermatocyte differentiation. The programmed events include global downregulation of Polycomb repressive complex 2 (PRC2) components, recruitment of hypophosphorylated RNA polymerase II (Pol II) to promoters, as well as the expression and action of testis-specific homologs of TATA-binding protein-associated factors (tTAFs). In addition, action of the testis-specific meiotic arrest complex (tMAC), a tissue-specific version of the MIP/dREAM complex, is required both for recruitment of tTAFs to target differentiation genes and for proper cell type-specific localization of PRC1 components and tTAFs within the spermatocyte nucleolus. Together, the action of the tMAC and tTAF cell type-specific chromatin and transcription machinery leads to loss of Polycomb and release of stalled Pol II from the terminal differentiation gene promoters, allowing robust transcription. PMID:21610025

  5. Gluten affects epithelial differentiation-associated genes in small intestinal mucosa of coeliac patients.

    PubMed

    Juuti-Uusitalo, K; Mäki, M; Kainulainen, H; Isola, J; Kaukinen, K

    2007-11-01

    In coeliac disease gluten induces an immunological reaction in genetically susceptible patients, and influences on epithelial cell proliferation and differentiation in the small-bowel mucosa. Our aim was to find novel genes which operate similarly in epithelial proliferation and differentiation in an epithelial cell differentiation model and in coeliac disease patient small-bowel mucosal biopsy samples. The combination of cDNA microarray data originating from a three-dimensional T84 epithelial cell differentiation model and small-bowel mucosal biopsy samples from untreated and treated coeliac disease patients and healthy controls resulted in 30 genes whose mRNA expression was similarly affected. Nine of 30 were located directly or indirectly in the receptor tyrosine kinase pathway starting from the epithelial growth factor receptor. Removal of gluten from the diet resulted in a reversion in the expression of 29 of the 30 genes in the small-bowel mucosal biopsy samples. Further characterization by blotting and labelling revealed increased epidermal growth factor receptor and beta-catenin protein expression in the small-bowel mucosal epithelium in untreated coeliac disease patients compared to healthy controls and treated coeliac patients. We found 30 genes whose mRNA expression was affected similarly in the epithelial cell differentiation model and in the coeliac disease patient small-bowel mucosal biopsy samples. In particular, those genes involved in the epithelial growth factor-mediated signalling pathways may be involved in epithelial cell differentiation and coeliac disease pathogenesis. The epithelial cell differentiation model is a useful tool for studying gene expression changes in the crypt-villus axis.

  6. Extent of differential allelic expression of candidate breast cancer genes is similar in blood and breast.

    PubMed

    Maia, Ana-Teresa; Spiteri, Inmaculada; Lee, Alvin J X; O'Reilly, Martin; Jones, Linda; Caldas, Carlos; Ponder, Bruce A J

    2009-01-01

    Normal gene expression variation is thought to play a central role in inter-individual variation and susceptibility to disease. Regulatory polymorphisms in cis-acting elements result in the unequal expression of alleles. Differential allelic expression (DAE) in heterozygote individuals could be used to develop a new approach to discover regulatory breast cancer susceptibility loci. As access to large numbers of fresh breast tissue to perform such studies is difficult, a suitable surrogate test tissue must be identified for future studies. We measured differential allelic expression of 12 candidate genes possibly related to breast cancer susceptibility (BRCA1, BRCA2, C1qA, CCND3, EMSY, GPX1, GPX4, MLH3, MTHFR, NBS1, TP53 and TRXR2) in breast tissue (n = 40) and fresh blood (n = 170) of healthy individuals and EBV-transformed lymphoblastoid cells (n = 19). Differential allelic expression ratios were determined by Taqman assay. Ratio distributions were compared using t-test and Wilcoxon rank sum test, for mean ratios and variances respectively. We show that differential allelic expression is common among these 12 candidate genes and is comparable between breast and blood (fresh and transformed lymphoblasts) in a significant proportion of them. We found that eight out of nine genes with DAE in breast and fresh blood were comparable, as were 10 out of 11 genes between breast and transformed lymphoblasts. Our findings support the use of differential allelic expression in blood as a surrogate for breast tissue in future studies on predisposition to breast cancer.

  7. Differential modulation of gene expression in the NMDA postsynaptic density of schizophrenic and control smokers.

    PubMed

    Mexal, S; Frank, M; Berger, R; Adams, C E; Ross, R G; Freedman, R; Leonard, S

    2005-10-03

    Nicotine is known to induce the release of multiple neurotransmitters, including glutamate and dopamine, through activation of nicotinic receptors. Gene expression in the N-methyl-d-aspartate postsynaptic density (NMDA-PSD), as well as other functional groups, was compared in postmortem hippocampus of schizophrenic and nonmentally ill smokers and nonsmokers utilizing a microarray and quantitative RT-PCR approach. The expression of 277 genes was significantly changed between all smokers and nonsmokers. Specific gene groups, most notably genes expressed in the NMDA-PSD, were prevalent among these transcripts. Analysis of the interaction between smoking and schizophrenia identified several genes in the NMDA-PSD that were differentially affected by smoking in patients. The present findings suggest that smoking may differentially modulate glutamatergic function in schizophrenic patients and control subjects. The biological mechanisms underlying chronic tobacco use are likely to differ substantially between these two groups.

  8. Identification of differentially expressed genes in uveal melanoma using suppressive subtractive hybridization

    PubMed Central

    Landreville, Solange; Lupien, Caroline B.; Vigneault, Francois; Gaudreault, Manon; Mathieu, Mélissa; Rousseau, Alain P.; Guérin, Sylvain L.

    2011-01-01

    Purpose Uveal melanoma (UM) is the most common primary cancer of the eye, resulting not only in vision loss, but also in metastatic death. This study attempts to identify changes in the patterns of gene expression that lead to malignant transformation and proliferation of normal uveal melanocytes (UVM) using the Suppressive Subtractive Hybridization (SSH) technique. Methods The SSH technique was used to isolate genes that are differentially expressed in the TP31 cell line derived from a primary UM compared to UVM. The expression level of selected genes was further validated by microarray, semi-quantitative RT–PCR and western blot analyses. Results Analysis of the subtracted libraries revealed that 37 and 36 genes were, respectively, up- and downregulated in TP31 cells compared to UVM. Differential expression of the majority of these genes was confirmed by comparing UM cells with UVM by microarray. The expression pattern of selected genes was analyzed by semi-quantitative RT–PCR and western blot, and was found to be consistent with the SSH findings. Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes in UM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. PMID:21647268

  9. Differential gene expression profiles of peripheral blood mononuclear cells in childhood asthma.

    PubMed

    Kong, Qian; Li, Wen-Jing; Huang, Hua-Rong; Zhong, Ying-Qiang; Fang, Jian-Pei

    2015-05-01

    Asthma is a common childhood disease with strong genetic components. This study compared whole-genome expression differences between asthmatic young children and healthy controls to identify gene signatures of childhood asthma. Total RNA extracted from peripheral blood mononuclear cells (PBMC) was subjected to microarray analysis. QRT-PCR was performed to verify the microarray results. Classification and functional characterization of differential genes were illustrated by hierarchical clustering and gene ontology analysis. Multiple logistic regression (MLR) analysis, receiver operating characteristic (ROC) curve analysis, and discriminate power were used to scan asthma-specific diagnostic markers. For fold-change>2 and p < 0.05, there were 758 named differential genes. The results of QRT-PCR confirmed successfully the array data. Hierarchical clustering divided 29 highly possible genes into seven categories and the genes in the same cluster were likely to possess similar expression patterns or functions. Gene ontology analysis presented that differential genes primarily enriched in immune response, response to stress or stimulus, and regulation of apoptosis in biological process. MLR and ROC curve analysis revealed that the combination of ADAM33, Smad7, and LIGHT possessed excellent discriminating power. The combination of ADAM33, Smad7, and LIGHT would be a reliable and useful childhood asthma model for prediction and diagnosis.

  10. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    PubMed Central

    Nindl, Ingo; Dang, Chantip; Forschner, Tobias; Kuban, Ralf J; Meyer, Thomas; Sterry, Wolfram; Stockfleth, Eggert

    2006-01-01

    Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC). Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled), actinic keratosis (AK) (two were pooled), and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p < 0.05). Verification of 13 up- or down-regulated genes was performed by quantitative real-time reverse transcription (RT)-PCR and genes were additionally confirmed by sequencing. Broad coherent patterns in normal skin vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described. PMID:16893473

  11. Gene expression profiling reveals epithelial mesenchymal transition (EMT) genes can selectively differentiate eribulin sensitive breast cancer cells.

    PubMed

    Dezső, Zoltán; Oestreicher, Judith; Weaver, Amy; Santiago, Stephanie; Agoulnik, Sergei; Chow, Jesse; Oda, Yoshiya; Funahashi, Yasuhiro

    2014-01-01

    Eribulin mesylate is a synthetic macrocyclic ketone analog of the marine sponge natural product halichondrin B. Eribulin is a mechanistically unique inhibitor of microtubule dynamics. In this study, we investigated whether selective signal pathways were associated with eribulin activity compared to paclitaxel, which stabilizes microtubules, based on gene expression profiling of cell line panels of breast, endometrial, and ovarian cancer in vitro. We determined the sets of genes that were differentially altered between eribulin and paclitaxel treatment in breast, endometrial, and ovarian cancer cell line panels. Our unsupervised clustering analyses revealed that expression profiles of gene sets altered with treatments were correlated with the in vitro antiproliferative activities of the drugs. Several tubulin isotypes had significantly lower expression in cell lines treated with eribulin compared to paclitaxel. Pathway enrichment analyses of gene sets revealed that the common pathways altered between treatments in the 3 cancer panels were related to cytoskeleton remodeling and cell cycle regulation. The epithelial-mesenchymal transition (EMT) pathway was enriched in genes with significantly altered expression between the two drugs for breast and endometrial cancers, but not for ovarian cancer. Expression of genes from the EMT pathway correlated with eribulin sensitivity in breast cancer and with paclitaxel sensitivity in endometrial cancer. Alteration of expression profiles of EMT genes between sensitive and resistant cell lines allowed us to predict drug sensitivity for breast and endometrial cancers. Gene expression analysis showed that gene sets that were altered between eribulin and paclitaxel correlated with drug in vitro antiproliferative activities in breast and endometrial cancer cell line panels. Among the panels, breast cancer provided the strongest differentiation between eribulin and paclitaxel sensitivities based on gene expression. In addition, EMT

  12. Parsing parallel evolution: ecological divergence and differential gene expression in the adaptive radiations of thick-lipped Midas cichlid fishes from Nicaragua.

    PubMed

    Manousaki, Tereza; Hull, Pincelli M; Kusche, Henrik; Machado-Schiaffino, Gonzalo; Franchini, Paolo; Harrod, Chris; Elmer, Kathryn R; Meyer, Axel

    2013-02-01

    The study of parallel evolution facilitates the discovery of common rules of diversification. Here, we examine the repeated evolution of thick lips in Midas cichlid fishes (the Amphilophus citrinellus species complex)-from two Great Lakes and two crater lakes in Nicaragua-to assess whether similar changes in ecology, phenotypic trophic traits and gene expression accompany parallel trait evolution. Using next-generation sequencing technology, we characterize transcriptome-wide differential gene expression in the lips of wild-caught sympatric thick- and thin-lipped cichlids from all four instances of repeated thick-lip evolution. Six genes (apolipoprotein D, myelin-associated glycoprotein precursor, four-and-a-half LIM domain protein 2, calpain-9, GTPase IMAP family member 8-like and one hypothetical protein) are significantly underexpressed in the thick-lipped morph across all four lakes. However, other aspects of lips' gene expression in sympatric morphs differ in a lake-specific pattern, including the magnitude of differentially expressed genes (97-510). Generally, fewer genes are differentially expressed among morphs in the younger crater lakes than in those from the older Great Lakes. Body shape, lower pharyngeal jaw size and shape, and stable isotopes (δ(13)C and δ(15)N) differ between all sympatric morphs, with the greatest differentiation in the Great Lake Nicaragua. Some ecological traits evolve in parallel (those related to foraging ecology; e.g. lip size, body and head shape) but others, somewhat surprisingly, do not (those related to diet and food processing; e.g. jaw size and shape, stable isotopes). Taken together, this case of parallelism among thick- and thin-lipped cichlids shows a mosaic pattern of parallel and nonparallel evolution.

  13. Differential gene expression in femoral bone from red junglefowl and domestic chicken, differing for bone phenotypic traits

    PubMed Central

    Rubin, Carl-Johan; Lindberg, Johan; Fitzsimmons, Carolyn; Savolainen, Peter; Jensen, Per; Lundeberg, Joakim; Andersson, Leif; Kindmark, Andreas

    2007-01-01

    Background Osteoporosis is frequently observed among aging hens from egg-producing strains (layers) of domestic chicken. White Leghorn (WL) has been intensively selected for egg production and it manifests striking phenotypic differences for a number of traits including several bone phenotypes in comparison with the wild ancestor of chicken, the red junglefowl (RJ). Previously, we have identified four Quantitative Trait Loci (QTL) affecting bone mineral density and bone strength in an intercross between RJ and WL. With the aim of further elucidating the genetic basis of bone traits in chicken, we have now utilized cDNA-microarray technology in order to compare global RNA-expression in femoral bone from adult RJ and WL (five of each sex and population). Results When contrasting microarray data for all WL-individuals to that of all RJ-individuals we observed differential expression (False discovery rate adjusted p-values < 0.015) for 604 microarray probes. In corresponding male and female contrasts, differential expression was observed for 410 and 270 probes, respectively. Altogether, the three contrasts between WL and RJ revealed differential expression of 779 unique transcripts, 57 of which are located to previously identified QTL-regions for bone traits. Some differentially expressed genes have previously been attributed roles in bone metabolism and these were: WNT inhibitory factor 1 (WIF1), WD repeat-containing protein 5 (WDR5) and Syndecan 3 (SDC3). Among differentially expressed transcripts, those encoding structural ribosomal proteins were highly enriched and all 15 had lower expression in WL. Conclusion We report the identification of 779 differentially expressed transcripts, several residing within QTL-regions for bone traits. Among differentially expressed transcripts, those encoding structural ribosomal proteins were highly enriched and all had lower expression levels in WL. In addition, transcripts encoding four translation initiation and translation

  14. Differentiation of Xylella fastidiosa strains via multilocus sequence analysis of environmentally mediated genes (MLSA-E).

    PubMed

    Parker, Jennifer K; Havird, Justin C; De La Fuente, Leonardo

    2012-03-01

    Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though <1 due to high sequence similarity, are significantly greater than housekeeping gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing

  15. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION.

    PubMed

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J; Alexander, Warren S; Smyth, Gordon K

    2016-06-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  16. ROBUST HYPERPARAMETER ESTIMATION PROTECTS AGAINST HYPERVARIABLE GENES AND IMPROVES POWER TO DETECT DIFFERENTIAL EXPRESSION

    PubMed Central

    Phipson, Belinda; Lee, Stanley; Majewski, Ian J.; Alexander, Warren S.; Smyth, Gordon K.

    2017-01-01

    One of the most common analysis tasks in genomic research is to identify genes that are differentially expressed (DE) between experimental conditions. Empirical Bayes (EB) statistical tests using moderated genewise variances have been very effective for this purpose, especially when the number of biological replicate samples is small. The EB procedures can however be heavily influenced by a small number of genes with very large or very small variances. This article improves the differential expression tests by robustifying the hyperparameter estimation procedure. The robust procedure has the effect of decreasing the informativeness of the prior distribution for outlier genes while increasing its informativeness for other genes. This effect has the double benefit of reducing the chance that hypervariable genes will be spuriously identified as DE while increasing statistical power for the main body of genes. The robust EB algorithm is fast and numerically stable. The procedure allows exact small-sample null distributions for the test statistics and reduces exactly to the original EB procedure when no outlier genes are present. Simulations show that the robustified tests have similar performance to the original tests in the absence of outlier genes but have greater power and robustness when outliers are present. The article includes case studies for which the robust method correctly identifies and downweights genes associated with hidden covariates and detects more genes likely to be scientifically relevant to the experimental conditions. The new procedure is implemented in the limma software package freely available from the Bioconductor repository.

  17. The Program of Gene Transcription for a Single Differentiating Cell Type during Sporulation in Bacillus subtilis

    PubMed Central

    Eichenberger, Patrick; Fujita, Masaya; Jensen, Shane T; Conlon, Erin M; Rudner, David Z; Wang, Stephanie T; Ferguson, Caitlin; Haga, Koki; Sato, Tsutomu; Liu, Jun S

    2004-01-01

    Asymmetric division during sporulation by Bacillus subtilis generates a mother cell that undergoes a 5-h program of differentiation. The program is governed by a hierarchical cascade consisting of the transcription factors: σE, σK, GerE, GerR, and SpoIIID. The program consists of the activation and repression of 383 genes. The σE factor turns on 262 genes, including those for GerR and SpoIIID. These DNA-binding proteins downregulate almost half of the genes in the σE regulon. In addition, SpoIIID turns on ten genes, including genes involved in the appearance of σK . Next, σK activates 75 additional genes, including that for GerE. This DNA-binding protein, in turn, represses half of the genes that had been activated by σK while switching on a final set of 36 genes. Evidence is presented that repression and activation contribute to proper morphogenesis. The program of gene expression is driven forward by its hierarchical organization and by the repressive effects of the DNA-binding proteins. The logic of the program is that of a linked series of feed-forward loops, which generate successive pulses of gene transcription. Similar regulatory circuits could be a common feature of other systems of cellular differentiation. PMID:15383836

  18. An Orthologous Epigenetic Gene Expression Signature Derived from Differentiating Embryonic Stem Cells Identifies Regulators of Cardiogenesis.

    PubMed

    Busser, Brian W; Lin, Yongshun; Yang, Yanqin; Zhu, Jun; Chen, Guokai; Michelson, Alan M

    2015-01-01

    Here we used predictive gene expression signatures within a multi-species framework to identify the genes that underlie cardiac cell fate decisions in differentiating embryonic stem cells. We show that the overlapping orthologous mouse and human genes are the most accurate candidate cardiogenic genes as these genes identified the most conserved developmental pathways that characterize the cardiac lineage. An RNAi-based screen of the candidate genes in Drosophila uncovered numerous novel cardiogenic genes. shRNA knockdown combined with transcriptome profiling of the newly-identified transcription factors zinc finger protein 503 and zinc finger E-box binding homeobox 2 and the well-known cardiac regulatory factor NK2 homeobox 5 revealed that zinc finger E-box binding homeobox 2 activates terminal differentiation genes required for cardiomyocyte structure and function whereas zinc finger protein 503 and NK2 homeobox 5 are required for specification of the cardiac lineage. We further demonstrated that an essential role of NK2 homeobox 5 and zinc finger protein 503 in specification of the cardiac lineage is the repression of gene expression programs characteristic of alternative cell fates. Collectively, these results show that orthologous gene expression signatures can be used to identify conserved cardiogenic pathways.

  19. Genes of Both Parental Origins Are Differentially Involved in Early Embryogenesis of a Tobacco Interspecies Hybrid

    PubMed Central

    Xin, Hai-Ping; Zhao, Jing; Li, Shi-Sheng; Qu, Liang-Huan; Ma, Li-Gang; Scholten, Stefan; Sun, Meng-Xiang

    2011-01-01

    Background In animals, early embryonic development is largely dependent on maternal transcripts synthesized during gametogenesis. However, in higher plants, the extent of maternal control over zygote development and early embryogenesis is not fully understood yet. Nothing is known about the activity of the parental genomes during seed formation of interspecies hybrids. Methodology/Principal Findings Here, we report that an interspecies hybridization system between SR1 (Nicotiana tabacum) and Hamayan (N. rustica) has been successfully established. Based on the system we selected 58 genes that have polymorphic sites between SR1 and Hamayan, and analyzed the allele-specific expression of 28 genes in their hybrid zygotes (Hamayan x SR1). Finally the allele-specific expressions of 8 genes in hybrid zygotes were repeatedly confirmed. Among them, 4 genes were of paternal origin, 1 gene was of maternal origin and 3 genes were of biparental origin. These results revealed obvious biparental involvement and differentially contribution of parental-origin genes to zygote development in the interspecies hybrid. We further detected the expression pattern of the genes at 8-celled embryo stage found that the involvement of the parental-origin genes may change at different stages of embryogenesis. Conclusions/Significance We reveal that genes of both parental origins are differentially involved in early embryogenesis of a tobacco interspecies hybrid and functions in a developmental stage-dependent manner. This finding may open a window to seek for the possible molecular mechanism of hybrid vigor. PMID:21829711

  20. Fully Bayesian mixture model for differential gene expression: simulations and model checks.

    PubMed

    Lewin, Alex; Bochkina, Natalia; Richardson, Sylvia

    2007-01-01

    We present a Bayesian hierarchical model for detecting differentially expressed genes using a mixture prior on the parameters representing differential effects. We formulate an easily interpretable 3-component mixture to classify genes as over-expressed, under-expressed and non-differentially expressed, and model gene variances as exchangeable to allow for variability between genes. We show how the proportion of differentially expressed genes, and the mixture parameters, can be estimated in a fully Bayesian way, extending previous approaches where this proportion was fixed and empirically estimated. Good estimates of the false discovery rates are also obtained. Different parametric families for the mixture components can lead to quite different classifications of genes for a given data set. Using Affymetrix data from a knock out and wildtype mice experiment, we show how predictive model checks can be used to guide the choice between possible mixture priors. These checks show that extending the mixture model to allow extra variability around zero instead of the usual point mass null fits the data better. A software package for R is available.

  1. DNA Methylation Profiling Reveals Correlation of Differential Methylation Patterns with Gene Expression in Human Epilepsy.

    PubMed

    Wang, Liang; Fu, Xinwei; Peng, Xi; Xiao, Zheng; Li, Zhonggui; Chen, Guojun; Wang, Xuefeng

    2016-05-01

    DNA methylation plays important roles in regulating gene expression and has been reported to be related with epilepsy. This study aimed to define differential DNA methylation patterns in drug-refractory epilepsy patients and to investigate the role of DNA methylation in human epilepsy. We performed DNA methylation profiling in brain tissues from epileptic and control patients via methylated-cytosine DNA immunoprecipitation microarray chip. Differentially methylated loci were validated by bisulfite sequencing PCR, and the messenger RNA (mRNA) levels of candidate genes were evaluated by reverse transcriptase PCR. We found 224 genes that showed differential DNA methylation between epileptic patients and controls. Among the seven candidate genes, three genes (TUBB2B, ATPGD1, and HTR6) showed relative transcriptional regulation by DNA methylation. TUBB2B and ATPGD1 exhibited hypermethylation and decreased mRNA levels, whereas HTR6 displayed hypomethylation and increased mRNA levels in the epileptic samples. Our findings suggest that certain genes become differentially regulated by DNA methylation in human epilepsy.

  2. Umbilical cord mesenchymal stem cells: role of regulatory genes in their differentiation to osteoblasts.

    PubMed

    Ciavarella, Sabino; Dammacco, Franco; De Matteo, Monica; Loverro, Giuseppe; Silvestris, Franco

    2009-10-01

    Umbilical cord (UC) mesenchymal stem cells (MSCs) are being currently investigated as an alternative to bone marrow (BM) MSCs for bone repair and regeneration. Here, we describe the gene regulation of their differentiation to osteogenic, adipogenic, and chondrogenic precursors and demonstrate their tendency to differentiate toward the osteoblast lineage. Fibroblast-like cells from the Warthon's Jelly were cultured with dedicated media to obtain osteogenic-, adipogenic-, and chondrogenic-differentiated cells. After induction, a typical fibroblast-like shape with condensed fibers of F-actin was early noted in osteogenic-induced UC-MSCs, whereas those differentiating to adipocytes were flat with minor cytoskeleton relevance. Real-time PCR measured the transcription of master genes of the three lineages, thus revealing a remarkable up-regulation of Runx2 in osteogenic-induced cells with respect to both PPARg and SOX9 for adipogenic- and chondrogenic-differentiating UC-MSCs. However, TAZ, a coactivator of the nuclear transcription of Runx2 previously detected in BM-MSCs, was expressed in osteogenic- and, at lower magnitude, in adipogenic-induced cells, in keeping with its role in the reciprocal control of the differentiation between osteogenic- and adipogenic-induced cells. Its differential role in these cells was confirmed by its accumulation as protein product in the nuclei to activate Runx2 in osteogenic-differentiating UC-MSCs. These data emphasize the predominant expression by UC-MSCs of genes engaged in the osteogenic differentiation and their tendency to differentiate into osteoblasts, being similar in this respect to BM-MSCs. They may, thus, constitute a promising option for bone remodeling in regenerative medicine.

  3. Gene expression profiling of human neural progenitor cells following the serum-induced astrocyte differentiation.

    PubMed

    Obayashi, Shinya; Tabunoki, Hiroko; Kim, Seung U; Satoh, Jun-ichi

    2009-05-01

    Neural stem cells (NSC) with self-renewal and multipotent properties could provide an ideal cell source for transplantation to treat spinal cord injury, stroke, and neurodegenerative diseases. However, the majority of transplanted NSC and neural progenitor cells (NPC) differentiate into astrocytes in vivo under pathological environments in the central nervous system, which potentially cause reactive gliosis. Because the serum is a potent inducer of astrocyte differentiation of rodent NPC in culture, we studied the effect of the serum on gene expression profile of cultured human NPC to identify the gene signature of astrocyte differentiation of human NPC. Human NPC spheres maintained in the serum-free culture medium were exposed to 10% fetal bovine serum (FBS) for 72 h, and processed for analyzing on a Whole Human Genome Microarray of 41,000 genes, and the microarray data were validated by real-time RT-PCR. The serum elevated the levels of expression of 45 genes, including ID1, ID2, ID3, CTGF, TGFA, METRN, GFAP, CRYAB and CSPG3, whereas it reduced the expression of 23 genes, such as DLL1, DLL3, PDGFRA, SOX4, CSPG4, GAS1 and HES5. Thus, the serum-induced astrocyte differentiation of human NPC is characterized by a counteraction of ID family genes on Delta family genes. Coimmunoprecipitation analysis identified ID1 as a direct binding partner of a proneural basic helix-loop-helix (bHLH) transcription factor MASH1. Luciferase assay indicated that activation of the DLL1 promoter by MASH1 was counteracted by ID1. Bone morphogenetic protein 4 (BMP4) elevated the levels of ID1 and GFAP expression in NPC under the serum-free culture conditions. Because the serum contains BMP4, these results suggest that the serum factor(s), most probably BMP4, induces astrocyte differentiation by upregulating the expression of ID family genes that repress the proneural bHLH protein-mediated Delta expression in human NPC.

  4. Identification of differentially expressed genes in flax (Linum usitatissimum L.) under saline-alkaline stress by digital gene expression.

    PubMed

    Yu, Ying; Huang, Wengong; Chen, Hongyu; Wu, Guangwen; Yuan, Hongmei; Song, Xixia; Kang, Qinghua; Zhao, Dongsheng; Jiang, Weidong; Liu, Yan; Wu, Jianzhong; Cheng, Lili; Yao, Yubo; Guan, Fengzhi

    2014-10-01

    The salinization and alkalization of soil are widespread environmental problems, and alkaline salt stress is more destructive than neutral salt stress. Therefore, understanding the mechanism of plant tolerance to saline-alkaline stress has become a major challenge. However, little attention has been paid to the mechanism of plant alkaline salt tolerance. In this study, gene expression profiling of flax was analyzed under alkaline-salt stress (AS2), neutral salt stress (NSS) and alkaline stress (AS) by digital gene expression. Three-week-old flax seedlings were placed in 25 mM Na2CO3 (pH11.6) (AS2), 50mM NaCl (NSS) and NaOH (pH11.6) (AS) for 18 h. There were 7736, 1566 and 454 differentially expressed genes in AS2, NSS and AS compared to CK, respectively. The GO category gene enrichment analysis revealed that photosynthesis was particularly affected in AS2, carbohydrate metabolism was particularly affected in NSS, and the response to biotic stimulus was particularly affected in AS. We also analyzed the expression pattern of five categories of genes including transcription factors, signaling transduction proteins, phytohormones, reactive oxygen species proteins and transporters under these three stresses. Some key regulatory gene families involved in abiotic stress, such as WRKY, MAPKKK, ABA, PrxR and ion channels, were differentially expressed. Compared with NSS and AS, AS2 triggered more differentially expressed genes and special pathways, indicating that the mechanism of AS2 was more complex than NSS and AS. To the best of our knowledge, this was the first transcriptome analysis of flax in response to saline-alkaline stress. These data indicate that common and diverse features of saline-alkaline stress provide novel insights into the molecular mechanisms of plant saline-alkaline tolerance and offer a number of candidate genes as potential markers of tolerance to saline-alkaline stress.

  5. Exposure to an organophosphate pesticide, individually or in combination with other Gulf War agents, impairs synaptic integrity and neuronal differentiation, and is accompanied by subtle microvascular injury in a mouse model of Gulf War agent exposure.

    PubMed

    Ojo, Joseph O; Abdullah, Laila; Evans, James; Reed, Jon Mike; Montague, Hannah; Mullan, Michael J; Crawford, Fiona C

    2014-04-01

    Gulf War illness (GWI) is a currently untreatable multi-symptom disorder experienced by 1990-1991 Persian Gulf War (GW) veterans. The characteristic hallmarks of GWI include cognitive dysfunction, tremors, migraine, and psychological disturbances such as depression and anxiety. Meta-analyses of epidemiological studies have consistently linked these symptomatic profiles to the combined exposure of GW agents such as organophosphate-based and pyrethroid-based pesticides (e.g. chlorpyrifos (CPF) and permethrin (PER) respectively) and the prophylactic use of pyridostigmine bromide (PB) as a treatment against neurotoxins. Due to the multi-symptomatic presentation of this illness and the lack of available autopsy tissue from GWI patients, very little is currently known about the distinct early pathological profile implicated in GWI (including its influence on synaptic function and aspects of neurogenesis). In this study, we used preclinical models of GW agent exposure to investigate whether 6-month-old mice exposed to CPF alone, or a combined dose of CPF, PB and PER daily for 10 days, demonstrate any notable pathological changes in hippocampal, cortical (motor, piriform) or amygdalar morphometry. We report that at an acute post-exposure time point (after 3 days), both exposures resulted in the impairment of synaptic integrity (reducing synaptophysin levels) in the CA3 hippocampal region and altered neuronal differentiation in the dentate gyrus (DG), demonstrated by a significant reduction in doublecortin positive cells. Both exposures also significantly increased astrocytic GFAP immunoreactivity in the piriform cortex, motor cortex and the basolateral amygdala and this was accompanied by an increase in (basal) brain acetylcholine (ACh) levels. There was no evidence of microglial activation or structural deterioration of principal neurons in these regions following exposure to CPF alone or in combination with PB and PER. Evidence of subtle microvascular injury was

  6. Climate niche differentiation between two passerines despite ongoing gene flow.

    PubMed

    Shaner, Pei-Jen L; Tsao, Tzu-Hsuan; Lin, Rong-Chien; Liang, Wei; Yeh, Chia-Fen; Yang, Xiao-Jun; Lei, Fu-Min; Zhou, Fang; Yang, Can-Chao; Hung, Le Manh; Hsu, Yu-Cheng; Li, Shou-Hsien

    2015-05-01

    Niche evolution underpins the generation and maintenance of biological diversity, but niche conservatism, in which niches remain little changed over time in closely related taxa, and the role of ecology in niche evolution are continually debated. To test whether climate niches are conserved in two closely related passerines in East Asia - the vinous-throated (Paradoxornis webbianus) and ashy-throated (P. alphonsianus) parrotbills - we established their potential allopatric and sympatric regions using ecological niche models and compared differences in their climate niches using niche overlap indices in background tests and multivariate statistical analyses. We also used polymorphism data on 44 nuclear genes to infer their divergence demography. We found that these two parrotbills occupy different climate niches, in both their allopatric and potential sympatric regions. Because the potential sympatric region is the area predicted to be suitable for both parrotbills based on the ecological niche models, it can serve as a natural common garden. Therefore, their observed niche differences in this potential sympatry were not simply rendered by phenotypic plasticity and probably had a genetic basis. Our genetic analyses revealed that the two parrotbills are not evolutionarily independent for the most recent part of their divergence history. The two parrotbills diverged c. 856,000 years ago and have had substantial gene flow since a presumed secondary contact c. 290,000 years ago. This study provides an empirical case demonstrating that climate niches may not be homogenized in nascent species in spite of substantial, ongoing gene flow, which in turn suggests a role for ecology in promoting and maintaining diversification among incipient species.

  7. FOXO1A differentially regulates genes of decidualization.

    PubMed

    Buzzio, Oscar L; Lu, Zhenxiao; Miller, Curt D; Unterman, Terry G; Kim, J Julie

    2006-08-01

    The forkhead box O1A (FOXO1A) has been identified as one gene that is up-regulated early in the decidualization process. To further investigate the role of FOXO1A during this process, six genes, IGFBP1, PRL, TIMP3, LAMB1, CNR1, and DCN, shown to be up-regulated during decidualization, were chosen as potential targets of FOXO1A action. Treatment of human endometrial stromal cells with hormones (estradiol and medroxyprogesterone acetate) plus dibutyryl cAMP (H+dbcAMP) for 48 h increased expression of IGFBP1, PRL, TIMP3, CNR1, and DCN but not LAMB1, as measured by real-time PCR. Silencing of FOXO1A using small interfering RNA oligonucleotides decreased IGFBP1 and DCN levels and increased CNR1, TIMP3, and PRL levels. LAMB1 was not affected. When FOXO1A was overexpressed in human endometrial stromal cells, expression of IGFBP1, DCN, and PRL increased, whereas levels of TIMP3 and CNR1 decreased. Addition of H+dbcAMP caused an increased expression of IGFBP1, PRL, and DCN beyond that of FOXO1A alone. TIMP3 and CNR1 levels decreased even further in response to H+dbcAMP compared with FOXO1A alone. LAMB1, which was unresponsive to FOXO1A, decreased when H+dbcAMP was added. Overexpressing FOXO1A also caused a change in cell shape, in that the stromal fibroblasts acquired a rounded, epithelioid appearance. Finally, reporter studies showed that cotransfection of FOXO1A significantly increased PRL promoter activity but not TIMP3 promoter activity. Addition of H+dbcAMP resulted in a significant increase in PRL promoter activity and a significant decrease in TIMP3 promoter activity. In summary, this study demonstrates the versatile nature of FOXO1A in the regulation of a number of decidualization-specific genes.

  8. Differential expression of endocannabinoid system-related genes in the dorsal hippocampus following expression and reinstatement of morphine conditioned place preference in mice.

    PubMed

    Li, Wei; Zhang, Cong-Li; Qiu, Zheng-Guo

    2017-03-16

    The endocannabinoid signaling plays a critical role in mediating rewarding effects to morphine. The relative stability for the expression and reinstatement of morphine conditioned place preference (CPP) suggests the involvement of differential neuroadaptations in learned associations between environmental cues and morphine. Changes in gene expression in hippocampus through the endogenous cannabinoid system (eCB) may accompany and mediate the development of such neuroadaptations to repeated morphine stimulation. To test this possibility, we systematically compared the expression of eCB-related genes in the dorsal hippocampus following the expression, extinction, and reinstatement of morphine CPP using quantitative RT-PCR analyses. We found that expression of morphine CPP was associated with significant increases in mRNA expression for the primary clearance routes for anandamide (AEA) and 2-AG (fatty acid amide hydrolase [FAAH] and monoacylglycerol lipase [MAGL], respectively), but with reductions in cannabinoid 1 receptors (CB1R) and CB2R in dorsal hippocampus following the expression of CPP. However, our results indicated that decreased in MAGL and increased CB1R mRNA levels were accompanied with morphine CPP reinstatement. No significant changes in mRNA expression for enzymes involved in AEA and 2-AG biosynthesis (N-acylphosphatidylethanolamine phospholipase D [NAPEPLD] and diacylglycerol lipase-α/β [DAGLα/β], respectively) were found in all conditions. These results suggest that differential regulation of the synthesis and/or degradation of the eCB system contribute to the expression and reinstatement of morphine CPP.

  9. Replicon-dependent differentiation of symbiosis-related genes in Sinorhizobium strains nodulating Glycine max.

    PubMed

    Guo, Hui Juan; Wang, En Tao; Zhang, Xing Xing; Li, Qin Qin; Zhang, Yan Ming; Tian, Chang Fu; Chen, Wen Xin

    2014-02-01

    In order to investigate the genetic differentiation of Sinorhizobium strains nodulating Glycine max and related microevolutionary mechanisms, three housekeeping genes (SMc00019, truA, and thrA) and 16 symbiosis-related genes on the chromosome (7 genes), pSymA (6 genes), and pSymB (3 genes) were analyzed. Five distinct species were identified among the test strains by calculating the average nucleotide identity (ANI) of SMc00019-truA-thrA: Sinorhizobium fredii, Sinorhizobium sojae, Sinorhizobium sp. I, Sinorhizobium sp. II, and Sinorhizobium sp. III. These species assignments were also supported by population genetics and phylogenetic analyses of housekeeping genes and symbiosis-related genes on the chromosome and pSymB. Different levels of genetic differentiation were observed among these species or different replicons. S. sojae was the most divergent from the other test species and was characterized by its low intraspecies diversity and limited geographic distribution. Intergenic recombination dominated the evolution of 19 genes from different replicons. Intraspecies recombination happened frequently in housekeeping genes and symbiosis-related genes on the chromosome and pSymB, whereas pSymA genes showed a clear pattern of lateral-transfer events between different species. Moreover, pSymA genes were characterized by a lower level of polymorphism and recombination than those on the chromosome and pSymB. Taken together, genes from different replicons of rhizobia might be involved in the establishment of symbiosis with legumes, but these symbiosis-related genes might have evolved differently according to their corresponding replicons.

  10. Replicon-Dependent Differentiation of Symbiosis-Related Genes in Sinorhizobium Strains Nodulating Glycine max

    PubMed Central

    Guo, Hui Juan; Wang, En Tao; Zhang, Xing Xing; Li, Qin Qin; Zhang, Yan Ming; Chen, Wen Xin

    2014-01-01

    In order to investigate the genetic differentiation of Sinorhizobium strains nodulating Glycine max and related microevolutionary mechanisms, three housekeeping genes (SMc00019, truA, and thrA) and 16 symbiosis-related genes on the chromosome (7 genes), pSymA (6 genes), and pSymB (3 genes) were analyzed. Five distinct species were identified among the test strains by calculating the average nucleotide identity (ANI) of SMc00019-truA-thrA: Sinorhizobium fredii, Sinorhizobium sojae, Sinorhizobium sp. I, Sinorhizobium sp. II, and Sinorhizobium sp. III. These species assignments were also supported by population genetics and phylogenetic analyses of housekeeping genes and symbiosis-related genes on the chromosome and pSymB. Different levels of genetic differentiation were observed among these species or different replicons. S. sojae was the most divergent from the other test species and was characterized by its low intraspecies diversity and limited geographic distribution. Intergenic recombination dominated the evolution of 19 genes from different replicons. Intraspecies recombination happened frequently in housekeeping genes and symbiosis-related genes on the chromosome and pSymB, whereas pSymA genes showed a clear pattern of lateral-transfer events between different species. Moreover, pSymA genes were characterized by a lower level of polymorphism and recombination than those on the chromosome and pSymB. Taken together, genes from different replicons of rhizobia might be involved in the establishment of symbiosis with legumes, but these symbiosis-related genes might have evolved differently according to their corresponding replicons. PMID:24317084

  11. Gene Expression Profiling of H9c2 Myoblast Differentiation towards a Cardiac-Like Phenotype

    PubMed Central

    Branco, Ana F.; Pereira, Susana P.; Gonzalez, Susana; Gusev, Oleg; Rizvanov, Albert A.; Oliveira, Paulo J.

    2015-01-01

    H9c2 myoblasts are a cell model used as an alternative for cardiomyocytes. H9c2 cells have the ability to differentiate towards a cardiac phenotype when the media serum is reduced in the presence of all-trans-retinoic acid (RA), creating multinucleated cells with low proliferative capacity. In the present study, we performed for the first time a transcriptional analysis of the H9c2 cell line in two differentiation states, i.e. embryonic cells and differentiated cardiac-like cells. The results show that RA-induced H9c2 differentiation increased the expression of genes encoding for cardiac sarcomeric proteins such as troponin T, or calcium transporters and associated machinery, including SERCA2, ryanodine receptor and phospholamban as well as genes associated with mitochondrial energy production including respiratory chain complexes subunits, mitochondrial creatine kinase, carnitine palmitoyltransferase I and uncoupling proteins. Undifferentiated myoblasts showed increased gene expression of pro-survival proteins such as Bcl-2 as well as cell cycle-regulating proteins. The results indicate that the differentiation of H9c2 cells lead to an increase of transcripts and protein levels involved in calcium handling, glycolytic and mitochondrial metabolism, confirming that H9c2 cell differentiation induced by RA towards a more cardiac-like phenotype involves remodeled mitochondrial function. PI3K, PDK1 and p-CREB also appear to be involved on H9c2 differentiation. Furthermore, complex analysis of differently expressed transcripts revealed significant up-regulation of gene expression related to cardiac muscle contraction, dilated cardiomyopathy and other pathways specific for the cardiac tissue. Metabolic and gene expression remodeling impacts cell responses to different stimuli and determine how these cells are used for biochemical assays. PMID:26121149

  12. Cross talk among PMCA, calcineurin and NFAT transcription factors in control of calmodulin gene expression in differentiating PC12 cells.

    PubMed

    Boczek, Tomasz; Lisek, Malwina; Ferenc, Bozena; Zylinska, Ludmila

    2017-04-01

    Brain aging is characterized by progressive loss of plasma membrane calcium pump (PMCA) and its activator - calmodulin (CaM), but the mechanism of this phenomenon remains unresolved. CaM encoded by three genes Calm1, Calm2, Calm3, works to translate Ca(2+) signal into changes in frequently opposite cellular activities. This unique function allows CaM to affect gene expression via stimulation of calcineurin (CaN) and its downstream target - nuclear factor of activated T-cells (NFAT) and to terminate Ca(2+) signal by stimulation of its extrusion. PMCA, which exists in four isoforms PMCA1-4, may in turn shape the pattern of Ca(2+) transients and control CaN activity by its direct binding. Therefore, the interplay between PMCA, CaM and CaN/NFAT is highly plausible. To verify that, we used differentiated PC12 cells with reduced expression of PMCA2 or PMCA3 to mimic the potential changes in aged brain. Manipulation in PMCAs level decreased CaM protein in PMCA2 or PMCA3-reduced lines that was accompanied by down-regulation of Calm1 and Calm2 in both lines, but Calm3 only in PMCA2-reduced cells. Further studies showed substantially higher NFATc2 nuclear accumulation and increased NFAT transcriptional activity. Blocking of CaN/NFAT signalling resulted in almost full CaM recovery, mainly due to up-regulation of Calm2 and Calm3 genes. Moreover, higher occupancy of Calm2 and Calm3 promoters by NFATc2 and increased expression of these genes in response to NFATc2 silencing were demonstrated in PMCA2 and PMCA3-reduced lines. Our results indicate that decrease in CaM level in response to PMCAs downregulation can be driven by CaN/NFAT pathway. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Analysis of differentially expressed genes in human hepatocellular carcinoma using suppression subtractive hybridization

    PubMed Central

    Miyasaka, Y; Enomoto, N; Nagayama, K; Izumi, N; Marumo, F; Watanabe, M; Sato, C

    2001-01-01

    The genetic basis of hepatocellular carcinoma (HCC) has not yet been fully understood. Although various methods have been developed to detect differentially expressed genes in malignant diseases, efficient analysis from clinical specimens is generally difficult to perform due to the requirement of a large amount of samples. In the present study, we analysed differentially expressed genes with a small amount of human HCC samples using suppression subtractive hybridization (SSH). Total RNA were obtained from the hepatitis C virus-associated HCC and adjacent non-HCC liver tissues. cDNA was synthesized using modified RT-PCR, and then tester cDNA was ligated with 2 different kinds of adaptors and hybridized with an excess amount of driver cDNA. Tester specific cDNA was obtained by suppression PCR and the final PCR product was subcloned and sequenced. We identified 7 known genes (focal adhesion kinase, deleted in colon cancer, guanine binding inhibitory protein α, glutamine synthetase, ornithine aminotransferase, M130, and pepsinogen C) and 2 previously unknown genes as being overexpressed in HCC, and 1 gene (decorin) as suppressed in HCC. Quantitative analysis of gene expression using quantitative RT-PCR demonstrated the differential expression of these genes in the original and other HCC samples. These findings demonstrated that it is possible to identify the previously unknown, differential gene expression from a small amount of clinical samples. Information about such alterations in gene expression could be useful for elucidating the genetic events in HCC pathogenesis, developing the new diagnosic markers, or determining novel therapeutic targets. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11461082

  14. Global Regulation of Differential Gene Expression by c-Abl/Arg Oncogenic Kinases.

    PubMed

    Dong, Qincai; Li, Chenggong; Qu, Xiuhua; Cao, Cheng; Liu, Xuan

    2017-05-30

    BACKGROUND Studies have found that c-Abl oncogenic kinases may regulate gene transcription by RNA polymerase II phosphorylation or by direct regulation of specific transcription factors or coactivators. However, the global regulation of differential gene expression by c-Abl/Arg is largely unknown. In this study, differentially expressed genes (DEGs) regulated by c-Abl/Arg were identified, and related cellular functions and associated pathways were investigated. MATERIAL AND METHODS RNA obtained from wild-type and c-Abl/Arg gene-silenced MCF-7 cells was analyzed by RNA-Seq. DEGs were identified using edgeR software and partially validated by qRT-PCR. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were used to explore the potential functions of these DEGs. RESULTS A total of 1,034 DEGs were significantly regulated by c-Abl/Arg (399 were up-regulated and 635 were down-regulated after c-Abl/Arg double knockdown). GO and KEGG analyses showed that the DEGs were primarily involved in cellular metabolic processes, neurodegenerative disease, the metabolic process and signaling pathway of cAMP, angiogenesis, and cell proliferation. CONCLUSIONS Our data collectively support the hypothesis that c-Abl/Arg regulate differential gene expression, providing new insights into the biological functions of c-Abl and Arg.

  15. Inhibition of human primary megakaryocyte differentiation by anagrelide: a gene expression profiling analysis.

    PubMed

    Sakurai, Kazuki; Fujiwara, Tohru; Hasegawa, Shin; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Yamada-Fujiwara, Minami; Ichinohasama, Ryo; Harigae, Hideo

    2016-08-01

    Anagrelide is a treatment option for patients with essential thrombocythemia. Although the clinical efficacy of anagrelide has been established, there is limited knowledge of the molecular mechanism underlying its effect. Here, we evaluated the effect of anagrelide on primary megakaryocytic progenitors from cord blood-derived CD34-positive cells. Anagrelide treatment reduced the expression of megakaryocytic markers (CD41 and CD61). Microarray analysis was performed to characterize gene profiles altered by exposure to anagrelide. The analysis demonstrated upregulation and downregulation (>2-fold) of eight and 34 genes, respectively, in anagrelide-treated megakaryocyte progenitors. This included genes encoding prototypical megakaryocytic proteins, such as PPBP, PF4, and GP6. Gene ontology analysis of genes suppressed by anagrelide treatment revealed significant enrichment of genes involved in platelet activation and degranulation. Expression levels of transcription factors involved in megakaryocyte commitment/differentiation were further evaluated by quantitative RT-PCR, demonstrating significant downregulation of FLI1 and TAL1 in anagrelide-treated megakaryocyte progenitors. Knockdown of TAL1 in primary megakaryocyte progenitors confirmed significant downregulation of FLI1 and megakaryocytic genes. Anagrelide had no significant effect on the surface expression of erythroid markers or on the expression of transcription factors involved in erythroid commitment/differentiation. In conclusion, anagrelide suppresses megakaryocytic differentiation, partly through decreasing the expression of megakaryocytic transcription factors.

  16. Comparative transcriptome analysis reveals differentially expressed genes associated with sex expression in garden asparagus (Asparagus officinalis).

    PubMed

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

    2017-08-22

    Garden asparagus (Asparagus officinalis) is a highly valuable vegetable crop of commercial and nutritional interest. It is also commonly used to investigate the mechanisms of sex determination and differentiation in plants. However, the sex expression mechanisms in asparagus remain poorly understood. De novo transcriptome sequencing via Illumina paired-end sequencing revealed more than 26 billion bases of high-quality sequence data from male and female asparagus flower buds. A total of 72,626 unigenes with an average length of 979 bp were assembled. In comparative transcriptome analysis, 4876 differentially expressed genes (DEGs) were identified in the possible sex-determining stage of female and male/supermale flower buds. Of these DEGs, 433, including 285 male/supermale-biased and 149 female-biased genes, were annotated as flower related. Of the male/supermale-biased flower-related genes, 102 were probably involved in anther development. In addition, 43 DEGs implicated in hormone response and biosynthesis putatively associated with sex expression and reproduction were discovered. Moreover, 128 transcription factor (TF)-related genes belonging to various families were found to be differentially expressed, and this finding implied the essential roles of TF in sex determination or differentiation in asparagus. Correlation analysis indicated that miRNA-DEG pairs were also implicated in asparagus sexual development. Our study identified a large number of DEGs involved in the sex expression and reproduction of asparagus, including known genes participating in plant reproduction, plant hormone signaling, TF encoding, and genes with unclear functions. We also found that miRNAs might be involved in the sex differentiation process. Our study could provide a valuable basis for further investigations on the regulatory networks of sex determination and differentiation in asparagus and facilitate further genetic and genomic studies on this dioecious species.

  17. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  18. Genes related to mitochondrial functions are differentially expressed in phosphine-resistant and -susceptible Tribolium castaneum.

    PubMed

    Oppert, Brenda; Guedes, Raul N C; Aikins, Michael J; Perkin, Lindsey; Chen, Zhaorigetu; Phillips, Thomas W; Zhu, Kun Yan; Opit, George P; Hoon, Kelly; Sun, Yongming; Meredith, Gavin; Bramlett, Kelli; Hernandez, Natalie Supunpong; Sanderson, Brian; Taylor, Madison W; Dhingra, Dalia; Blakey, Brandon; Lorenzen, Marcé; Adedipe, Folukemi; Arthur, Frank

    2015-11-18

    Phosphine is a valuable fumigant to control pest populations in stored grains and grain products. However, recent studies indicate a substantial increase in phosphine resistance in stored product pests worldwide. To understand the molecular bases of phosphine resistance in insects, we used RNA-Seq to compare gene expression in phosphine-resistant and susceptible laboratory populations of the red flour beetle, Tribolium castaneum. Each population was evaluated as either phosphine-exposed or no phosphine (untreated controls) in triplicate biological replicates (12 samples total). Pairwise analysis indicated there were eight genes differentially expressed between susceptible and resistant insects not exposed to phosphine (i.e., basal expression) or those exposed to phopshine (>8-fold expression and 90 % C.I.). However, 214 genes were differentially expressed among all four treatment groups at a statistically significant level (ANOVA, p < 0.05). Increased expression of 44 cytochrome P450 genes was found in resistant vs. susceptible insects, and phosphine exposure resulted in additional increases of 21 of these genes, five of which were significant among all treatment groups (p < 0.05). Expression of two genes encoding anti-diruetic peptide was 2- to 8-fold reduced in phosphine-resistant insects, and when exposed to phosphine, expression was further reduced 36- to 500-fold compared to susceptible. Phosphine-resistant insects also displayed differential expression of cuticle, carbohydrate, protease, transporter, and many mitochondrial genes, among others. Gene ontology terms associated with mitochondrial functions (oxidation biological processes, monooxygenase and catalytic molecular functions, and iron, heme, and tetrapyyrole binding) were enriched in the significantly differentially expressed dataset. Sequence polymorphism was found in transcripts encoding a known phosphine resistance gene, dihydrolipoamide dehydrogenase, in both susceptible and resistant

  19. Transcriptome Profiling Identifies Differentially Expressed Genes in Postnatal Developing Pituitary Gland of Miniature Pig

    PubMed Central

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development. PMID:24282060

  20. Transcriptome profiling identifies differentially expressed genes in postnatal developing pituitary gland of miniature pig.

    PubMed

    Shan, Lei; Wu, Qi; Li, Yuli; Shang, Haitao; Guo, Kenan; Wu, Jiayan; Wei, Hong; Zhao, Jianguo; Yu, Jun; Li, Meng-Hua

    2014-01-01

    In recent years, Tibetan pig and Bama pig are popularly used as animal models for medical researches. However, little genomic information is available for the two breeds, particularly regarding gene expression pattern at the whole-transcriptome level. In this study, we characterized the pituitary transcriptome profile along their postnatal developmental stages within and between the two breeds in order to illustrate the differential dynamics and functions of differentially expressed genes. We obtained a total of ∼300 million 80-bp paired-end reads, detected 15 715 previously annotated genes. Most of the genes (90.33%) were shared between the two breeds with the main functions in metabolic process. Four hormone genes (GH, PRL, LHB, and FSHB) were detected in all samples with extremely high levels of expression. Functional differences between the three developmental stages (infancy, puberty and adulthood) in each breed were dominantly presented by the gene expressions at the first stage. That is, Bama pig was over-represented in the genes involved in the cellular process, while Tibetan pig was over-represented in the genes represented by the reproductive process. The identified SNPs indicated that the divergence between the miniature pig breeds and the large pig (Duroc) were greater than that between the two miniature pig breeds. This study substantially expands our knowledge concerning the genes transcribed in the pig pituitary gland and provides an overview of pituitary transcriptome dynamics throughout the period of postnatal development.

  1. Differential co-expression analysis reveals a novel prognostic gene module in ovarian cancer.

    PubMed

    Gov, Esra; Arga, Kazim Yalcin

    2017-07-10

    Ovarian cancer is one of the most significant disease among gynecological disorders that women suffered from over the centuries. However, disease-specific and effective biomarkers were still not available, since studies have focused on individual genes associated with ovarian cancer, ignoring the interactions and associations among the gene products. Here, ovarian cancer differential co-expression networks were reconstructed via meta-analysis of gene expression data and co-expressed gene modules were identified in epithelial cells from ovarian tumor and healthy ovarian surface epithelial samples to propose ovarian cancer associated genes and their interactions. We propose a novel, highly interconnected, differentially co-expressed, and co-regulated gene module in ovarian cancer consisting of 84 prognostic genes. Furthermore, the specificity of the module to ovarian cancer was shown through analyses of datasets in nine other cancers. These observations underscore the importance of transcriptome based systems biomarkers research in deciphering the elusive pathophysiology of ovarian cancer, and here, we present reciprocal interplay between candidate ovarian cancer genes and their transcriptional regulatory dynamics. The corresponding gene module might provide new insights on ovarian cancer prognosis and treatment strategies that continue to place a significant burden on global health.

  2. Accompanied consultations in occupational health.

    PubMed

    Hobson, J; Hobson, H; Sharp, R

    2016-04-01

    Accompanied consultations are often reported as difficult by occupational physicians but have not been studied in the occupational health setting. To collect information about accompanied consultations and the impact of the companion on the consultation. We collected data on all accompanied consultations by two occupational physicians working in a private sector occupational health service over the course of 16 months. Accompanied consultations were matched to non-accompanied consultations for comparison. We collected data on 108 accompanied consultations. Accompanied consultations were more likely to be connected with ill health retirement (P < 0.01), have a neurological diagnosis or multiple diagnoses (P < 0.01), be rated as complex (P < 0.01) and take longer than 30 minutes (P < 0.01) than non-accompanied consultations. Over half of the companions (54%) were a spouse or partner. An impact by the companion was recorded in 81% of consultations but this was most frequently that they had provided information (56%) and in over a quarter the impact was recorded as helpful. Interruptions were recorded in 28% of accompanied consultations but only 6% of consultations had free text suggesting that the consultation or companion was difficult. Accompanied consultations are likely to be more challenging in terms of the reason for referral, the presenting medical problems, the complexity of the case and the duration of the consultation. However, the companion is more likely to be of benefit than cause difficulty. Occupational health practitioners may benefit from better understanding of accompanied consultations and guidance on their management. © The Author 2015. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    PubMed

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  4. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes.

    PubMed

    Gierz, Sarah L; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral's daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions.

  5. Transcriptomic Analysis of Thermally Stressed Symbiodinium Reveals Differential Expression of Stress and Metabolism Genes

    PubMed Central

    Gierz, Sarah L.; Forêt, Sylvain; Leggat, William

    2017-01-01

    Endosymbioses between dinoflagellate algae (Symbiodinium sp.) and scleractinian coral species form the foundation of coral reef ecosystems. The coral symbiosis is highly susceptible to elevated temperatures, resulting in coral bleaching, where the algal symbiont is released from host cells. This experiment aimed to determine the transcriptional changes in cultured Symbiodinium, to better understand the response of cellular mechanisms under future temperature conditions. Cultures were exposed to elevated temperatures (average 31°C) or control conditions (24.5°C) for a period of 28 days. Whole transcriptome sequencing of Symbiodinium cells on days 4, 19, and 28 were used to identify differentially expressed genes under thermal stress. A large number of genes representing 37.01% of the transcriptome (∼23,654 unique genes, FDR < 0.05) with differential expression were detected at no less than one of the time points. Consistent with previous studies of Symbiodinium gene expression, fold changes across the transcriptome were low, with 92.49% differentially expressed genes at ≤2-fold change. The transcriptional response included differential expression of genes encoding stress response components such as the antioxidant network and molecular chaperones, cellular components such as core photosynthesis machinery, integral light-harvesting protein complexes and enzymes such as fatty acid desaturases. Differential expression of genes encoding glyoxylate cycle enzymes were also found, representing the first report of this in Symbiodinium. As photosynthate transfer from Symbiodinium to coral hosts provides up to 90% of a coral’s daily energy requirements, the implications of altered metabolic processes from exposure to thermal stress found in this study on coral-Symbiodinium associations are unknown and should be considered when assessing the stability of the symbiotic relationship under future climate conditions. PMID:28293249

  6. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-07-07

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development.

  7. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling

    PubMed Central

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  8. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    SciTech Connect

    Robinson, Claire; Kolb, Andreas F.

    2009-02-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A {beta}-galactosidase reporter gene was inserted in place of the {beta}-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the {beta}-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal {beta}-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the {beta}-casein gene.

  9. Identification of differentially expressed genes in Chrysanthemum nankingense (Asteraceae) under heat stress by RNA Seq.

    PubMed

    Sun, Jing; Ren, Liping; Cheng, Yue; Gao, Jiaojiao; Dong, Bin; Chen, Sumei; Chen, Fadi; Jiang, Jiafu

    2014-11-15

    The RNA-Seq platform was used to characterize the high-temperature stress response of Chrysanthemum nankingense. A set of 54,668 differentially expressed unigenes was identified. After a threshold of ratio change ≥ 2 and a q-value of <0.05 were applied, the number of differentially transcribed genes was reduced to 3955, of which 765 were up-regulated and 3190 were down-regulated in response to heat stress. The differentially transcribed genes were predicted to participate in 26 biological processes, 4 cellular components, and 13 molecular functions. Among the most differentially expressed genes between the two libraries were well-recognized high-temperature responsive protein families, such as heat shock factors and heat shock proteins, various transcription factor families, and a number of RNA metabolism-related genes. Overall, the RNA-Seq analyses revealed a high degree of transcriptional complexity in early heat stress response. Some of these high-temperature responsive C. nankingense genes may prove useful in efforts to improve thermotolerance of commercial chrysanthemum. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. NetDiff – Bayesian model selection for differential gene regulatory network inference

    PubMed Central

    Thorne, Thomas

    2016-01-01

    Differential networks allow us to better understand the changes in cellular processes that are exhibited in conditions of interest, identifying variations in gene regulation or protein interaction between, for example, cases and controls, or in response to external stimuli. Here we present a novel methodology for the inference of differential gene regulatory networks from gene expression microarray data. Specifically we apply a Bayesian model selection approach to compare models of conserved and varying network structure, and use Gaussian graphical models to represent the network structures. We apply a variational inference approach to the learning of Gaussian graphical models of gene regulatory networks, that enables us to perform Bayesian model selection that is significantly more computationally efficient than Markov Chain Monte Carlo approaches. Our method is demonstrated to be more robust than independent analysis of data from multiple conditions when applied to synthetic network data, generating fewer false positive predictions of differential edges. We demonstrate the utility of our approach on real world gene expression microarray data by applying it to existing data from amyotrophic lateral sclerosis cases with and without mutations in C9orf72, and controls, where we are able to identify differential network interactions for further investigation. PMID:27982083

  11. Differential gene expression profiling of large and small retinal ganglion cells

    PubMed Central

    Ivanov, Dmitry; Dvoriantchikova, Galina; Barakat, David J.; Nathanson, Lubov; Shestopalov, Valery I.

    2014-01-01

    Different sub-populations of retinal ganglion cells (RGCs) vary in their sensitivity to pathological conditions such as retinal ischemia, diabetic retinopathy and glaucoma. Comparative transcriptomic analysis of such groups will likely reveal molecular determinants of differential sensitivity to stress. However, gene expression profiling of primary neuronal sub-populations represent a challenge due to the cellular heterogeneity of retinal tissue. In this manuscript, we report the use of a fluorescent neural tracer to specifically label and selectively isolate RGCs with different soma sizes by fluorescence-activated cell sorting (FACS) for the purpose of differential gene expression profiling. We identified 145 genes that were more active in the large RGCs and 312 genes in the small RGCs. Differential data were validated by quantitative RT-PCR, several corresponding proteins were confirmed by immunohistochemistry. Functional characterization revealed differential activity of genes implicated in synaptic transmission, neurotransmitter secretion, axon guidance, chemotaxis, ion transport and tolerance to stress. An in silico reconstruction of cellular networks suggested that differences in pathway activity between the two sub-populations of RGCs are controlled by networks interconnected by SP-1, Erk2(MAPK1), Egr1, Egr2 and, potentially, regulated via transcription factors C/EBPbeta, HSF1, STAT1- and c-Myc. The results show that FACS-aided purification of retrogradely labeled cells can be effectively utilized for transcriptional profiling of adult retinal neurons. PMID:18640154

  12. NetDiff - Bayesian model selection for differential gene regulatory network inference.

    PubMed

    Thorne, Thomas

    2016-12-16

    Differential networks allow us to better understand the changes in cellular processes that are exhibited in conditions of interest, identifying variations in gene regulation or protein interaction between, for example, cases and controls, or in response to external stimuli. Here we present a novel methodology for the inference of differential gene regulatory networks from gene expression microarray data. Specifically we apply a Bayesian model selection approach to compare models of conserved and varying network structure, and use Gaussian graphical models to represent the network structures. We apply a variational inference approach to the learning of Gaussian graphical models of gene regulatory networks, that enables us to perform Bayesian model selection that is significantly more computationally efficient than Markov Chain Monte Carlo approaches. Our method is demonstrated to be more robust than independent analysis of data from multiple conditions when applied to synthetic network data, generating fewer false positive predictions of differential edges. We demonstrate the utility of our approach on real world gene expression microarray data by applying it to existing data from amyotrophic lateral sclerosis cases with and without mutations in C9orf72, and controls, where we are able to identify differential network interactions for further investigation.

  13. An independent validation of a gene expression signature to differentiate malignant melanoma from benign melanocytic nevi

    PubMed Central

    Flake, Darl D.; Busam, Klaus; Cockerell, Clay; Helm, Klaus; McNiff, Jennifer; Reed, Jon; Tschen, Jaime; Kim, Jinah; Barnhill, Raymond; Elenitsas, Rosalie; Prieto, Victor G.; Nelson, Jonathan; Kimbrell, Hillary; Kolquist, Kathryn A.; Brown, Krystal L.; Warf, M. Bryan; Roa, Benjamin B.; Wenstrup, Richard J.

    2016-01-01

    BACKGROUND Recently, a 23‐gene signature was developed to produce a melanoma diagnostic score capable of differentiating malignant and benign melanocytic lesions. The primary objective of this study was to independently assess the ability of the gene signature to differentiate melanoma from benign nevi in clinically relevant lesions. METHODS A set of 1400 melanocytic lesions was selected from samples prospectively submitted for gene expression testing at a clinical laboratory. Each sample was tested and subjected to an independent histopathologic evaluation by 3 experienced dermatopathologists. A primary diagnosis (benign or malignant) was assigned to each sample, and diagnostic concordance among the 3 dermatopathologists was required for inclusion in analyses. The sensitivity and specificity of the score in differentiating benign and malignant melanocytic lesions were calculated to assess the association between the score and the pathologic diagnosis. RESULTS The gene expression signature differentiated benign nevi from malignant melanoma with a sensitivity of 91.5% and a specificity of 92.5%. CONCLUSIONS These results reflect the performance of the gene signature in a diverse array of samples encountered in routine clinical practice. Cancer 2017;123:617–628. © 2016 American Cancer Society. PMID:27768230

  14. Expression of the HMGI(Y) gene products in human neuroblastic tumours correlates with differentiation status

    PubMed Central

    Giannini, G; Kim, C J; Marcotullio, L Di; Manfioletti, G; Cardinali, B; Cerignoli, F; Ristori, E; Zani, M; Frati, L; Screpanti, I; Gulino, A

    2000-01-01

    HMGI and HMGY are splicing variants of the HMGI(Y) gene and together with HMGI-C, belong to a family of DNA binding proteins involved in maintaining active chromatin conformation and in the regulation of gene transcription. The expression of the HMGI(Y) gene is maximal during embryonic development, declines in adult differentiated tissues and is reactivated in most transformed cells in vitro and in many human cancers in vivo. The HMGI(Y) genomic locus is frequently rearranged in mesenchymal tumours, suggesting a biological role for HMGI(Y) gene products in tumour biology. HMGIs are both target and modulators of retinoic acid activity. In fact, HMGI(Y) gene expression is differentially regulated by retinoic acid in retinoid-sensitive and -resistant neuroblastoma cells, while HMGI-C participates in conferring retinoic acid resistance in some neuroblastoma cells. In this paper we show that HMGI and HMGY isoforms are equally regulated by retinoic acid in neuroblastoma cell lines at both RNA and protein levels. More importantly our immunohistochemical analysis shows that, although HMGI(Y) is expressed in all neuroblastic tumours, consistently higher levels are observed in less differentiated neuroblastomas compared to more differentiated ganglioneuromas, indicating that HMGI(Y) expression should be evaluated as a potential diagnostic and prognostic marker in neuroblastic tumours. © 2000 Cancer Research Campaign http://www.bjcancer.com PMID:11076660

  15. Mining differential top-k co-expression patterns from time course comparative gene expression datasets

    PubMed Central

    2013-01-01

    Background Frequent pattern mining analysis applied on microarray dataset appears to be a promising strategy for identifying relationships between gene expression levels. Unfortunately, too many itemsets (co-expressed genes) are identified by this analysis method since it does not consider the importance of each gene within biological processes to a cellular response and does not take into account temporal properties under biological treatment-control matched conditions in a microarray dataset. Results We propose a method termed TIIM (Top-k Impactful Itemsets Miner), which only requires specifying a user-defined number k to explore the top k itemsets with the most significantly differentially co-expressed genes between 2 conditions in a time course. To give genes different weights, a table with impact degrees for each gene was constructed based on the number of neighboring genes that are differently expressed in the dataset within gene regulatory networks. Finally, the resulting top-k impactful itemsets were manually evaluated using previous literature and analyzed by a Gene Ontology enrichment method. Conclusions In this study, the proposed method was evaluated in 2 publicly available time course microarray datasets with 2 different experimental conditions. Both datasets identified potential itemsets with co-expressed genes evaluated from the literature and showed higher accuracies compared to the 2 corresponding control methods: i) performing TIIM without considering the gene expression differentiation between 2 different experimental conditions and impact degrees, and ii) performing TIIM with a constant impact degree for each gene. Our proposed method found that several new gene regulations involved in these itemsets were useful for biologists and provided further insights into the mechanisms underpinning biological processes. The Java source code and other related materials used in this study are available at

  16. Juvenile Hormone Differentially Regulates Two Grp78 Genes Encoding Protein Chaperones Required for Insect Fat Body Cell Homeostasis and Vitellogenesis.

    PubMed

    Luo, Maowu; Li, Dong; Wang, Zhiming; Guo, Wei; Kang, Le; Zhou, Shutang

    2017-03-29

    Juvenile hormone (JH) has a well-known role in stimulating insect vitellogenesis (i.e. yolk deposition) and oocyte maturation, but the molecular mechanisms of JH action in insect reproduction are unclear. Glucose-regulated protein of 78 kDa (Grp78) is a heat shock protein 70 kDa family member and one of the most abundant chaperones in the endoplasmic reticulum (ER) where it helps fold newly synthesized peptides. Because of its prominent role in protein folding and also ER stress, we hypothesized that Grp78 might be involved in fat body cell homeostasis and vitellogenesis and a regulatory target of JH. We report here that the migratory locust Locusta migratoria possesses two Grp78 genes that are differentially regulated by JH. We found that Grp78-1 is regulated by JH through Mcm4/7-dependent DNA replication and polyploidization, whereas Grp78-2 expression is directly activated by the JH-receptor complex comprising Methoprene-tolerant and Taiman proteins. Interestingly, Grp78-2 expression in the fat body is about 10-fold higher than that of Grp78-1 Knockdown of either Grp78-1 or Grp78-2 significantly reduced levels of vitellogenin (Vg) protein, accompanied by retarded maturation of oocytes. Depletion of both Grp78-1 and Grp78-2 resulted in ER stress and apoptosis in the fat body and in severely defective Vg synthesis and oocyte maturation. These results indicate a crucial role of Grp78 in JH-dependent vitellogenesis and egg production. The presence and differential regulation of two Grp78 genes in L. migratoria likely help accelerate the production of this chaperone in the fat body to facilitate folding of massively synthesized Vg and other proteins.

  17. Genome-wide p63-regulated gene expression in differentiating epidermal keratinocytes

    PubMed Central

    Oti, Martin; Kouwenhoven, Evelyn N.; Zhou, Huiqing

    2015-01-01

    The transcription factor p63 is a key regulator in epidermal keratinocyte proliferation and differentiation. However, the role of p63 in gene regulation during these processes is not well understood. To investigate this, we recently generated genome-wide profiles of gene expression, p63 binding sites and active regulatory regions with the H3K27ac histone mark (Kouwenhoven et al., 2015). We showed that only a subset of p63 binding sites are active in keratinocytes, and that differentiation-associated gene expression dynamics correlate with the activity of p63 binding sites rather than with their occurrence per se. Here we describe in detail the generation and processing of the ChIP-seq and RNA-seq datasets used in this study. These data sets are deposited in the Gene Expression Omnibus (GEO) repository under the accession number GSE59827. PMID:26484246

  18. Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus

    PubMed Central

    Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

    2016-01-01

    This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus. PMID:27853123

  19. Differentially expressed genes under simulated microgravity in fruiting bodies of the fungus Pleurotus ostreatus.

    PubMed

    Miyazaki, Yasumasa; Sunagawa, Masahide; Higashibata, Akira; Ishioka, Noriaki; Babasaki, Katsuhiko; Yamazaki, Takashi

    2010-06-01

    In response to a change in the direction of gravity, morphogenetic changes of fruiting bodies of fungi are usually observed as gravitropism. Although gravitropism in higher fungi has been studied for over 100 years, there is no convincing evidence regarding the graviperception mechanism in mushrooms. To understand gravitropism in mushrooms, we isolated differentially expressed genes in Pleurotus ostreatus (oyster mushroom) fruiting bodies developed under three-dimensional clinostat-simulated microgravity. Subtractive hybridization, cDNA representational difference analysis was used for gene analysis and resulted in the isolation of 36 individual genes (17 upregulated and 19 downregulated) under clinorotation. The phenotype of fruiting bodies developed under simulated microgravity vividly depicted the gravitropism in mushrooms. Our results suggest that the differentially expressed genes responding to gravitational change are involved in several potential cellular mechanisms during fruiting body formation of P. ostreatus.

  20. Differential regulation of alpha7 nicotinic receptor gene (CHRNA7) expression in schizophrenic smokers.

    PubMed

    Mexal, Sharon; Berger, Ralph; Logel, Judy; Ross, Randal G; Freedman, Robert; Leonard, Sherry

    2010-01-01

    The alpha7 neuronal nicotinic receptor gene (CHRNA7) has been implicated in the pathophysiology of schizophrenia by genetic and pharmacological studies. Expression of the alpha7* receptor, as measured by [(125)I]alpha-bungarotoxin autoradiography, is decreased in postmortem brain of schizophrenic subjects compared to non-mentally ill controls. Most schizophrenic patients are heavy smokers, with high levels of serum cotinine. Smoking changes the expression of multiple genes and differentially regulates gene expression in schizophrenic hippocampus. We examined the effects of smoking on CHRNA7 expression in the same tissue and find that smoking differentially regulates expression of both mRNA and protein for this gene. CHRNA7 mRNA and protein levels are significantly lower in schizophrenic nonsmokers compared to control nonsmokers and are brought to control levels in schizophrenic smokers. Sufficient protein but low surface expression of the alpha7* receptor, seen in the autoradiographic studies, suggests aberrant assembly or trafficking of the receptor.

  1. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

    PubMed

    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

    2014-11-01

    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

  2. Global gene expression profiling reveals genes expressed differentially in cattle with high and low residual feed intake.

    PubMed

    Chen, Y; Gondro, C; Quinn, K; Herd, R M; Parnell, P F; Vanselow, B

    2011-10-01

    Feed efficiency is an economically important trait in beef production. It can be measured as residual feed intake. This is the difference between actual feed intake recorded over a test period and the expected feed intake of an animal based on its size and growth rate. DNA-based marker-assisted selection would help beef breeders to accelerate genetic improvement for feed efficiency by reducing the generation interval and would obviate the high cost of measuring residual feed intake. Although numbers of quantitative trait loci and candidate genes have been identified with the advance of molecular genetics, our understanding of the physiological mechanisms and the nature of genes underlying residual feed intake is limited. The aim of the study was to use global gene expression profiling by microarray to identify genes that are differentially expressed in cattle, using lines genetically selected for low and high residual feed intake, and to uncover candidate genes for residual feed intake. A long-oligo microarray with 24 000 probes was used to profile the liver transcriptome of 44 cattle selected for high or low residual feed intake. One hundred and sixty-one unique genes were identified as being differentially expressed between animals with high and low residual feed intake. These genes were involved in seven gene networks affecting cellular growth and proliferation, cellular assembly and organization, cell signalling, drug metabolism, protein synthesis, lipid metabolism, and carbohydrate metabolism. Analysis of functional data using a transcriptional approach allows a better understanding of the underlying biological processes involved in residual feed intake and also allows the identification of candidate genes for marker-assisted selection. © 2011 The Authors, Animal Genetics © 2011 Stichting International Foundation for Animal Genetics.

  3. Phorbaketal A inhibits adipogenic differentiation through the suppression of PPARγ-mediated gene transcription by TAZ.

    PubMed

    Byun, Mi Ran; Lee, Cham Han; Hwang, Jun-Ha; Kim, A Rum; Moon, Sung Ah; Sung, Mi Kyung; Roh, Jung-Rae; Hwang, Eun Sook; Hong, Jeong-Ho

    2013-10-15

    Obesity causes several metabolic diseases, including diabetes. Adipogenic differentiation is an important event for fat formation in obesity. Natural compounds that inhibit adipogenic differentiation are frequently screened to develop therapeutic drugs for treating obesity. Here we investigated the effects of phorbaketal A, a natural marine compound, on adipogenic differentiation of mesenchymal stem cells. Phorbaketal A significantly inhibited adipogenic differentiation as indicated by less fat droplets and decreased expression of adipogenic marker genes. The expression of TAZ (transcriptional coactivator with PDZ-binding motif), an inhibitor of adipogenic differentiation, significantly increased during adipogenic differentiation in the presence of phorbaketal A. Phorbaketal A increased the interaction of TAZ and PPARγ to suppress PPARγ (peroxisome proliferator-activated receptor γ) target gene expression. TAZ-depleted cells showed higher adipogenic potential than that of control cells even in the presence of phorbaketal A. During cellular signaling induced by phorbaketal A, ERK (extracellular signal-regulated kinase) played an important role in adipogenic suppression; an inhibitor of ERK blocked phorbaketal A-induced adipogenic suppression. Thus, the results show that phorbaketal A inhibits adipocyte differentiation through TAZ.

  4. Exogenous polyamines promote osteogenic differentiation by reciprocally regulating osteogenic and adipogenic gene expression.

    PubMed

    Lee, Mon-Juan; Chen, Yuhsin; Huang, Yuan-Pin; Hsu, Yi-Chiang; Chiang, Lan-Hsin; Chen, Tzu-Yu; Wang, Gwo-Jaw

    2013-12-01

    Polyamines are naturally occurring organic polycations that are ubiquitous in all organisms, and are essential for cell proliferation and differentiation. Although polyamines are involved in various cellular processes, their roles in stem cell differentiation are relatively unexplored. In this study, we found that exogenous polyamines, putrescine, spermidine, and spermine, promoted osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) without inducing cell death or apoptosis. Alkaline phosphatase (ALP) activity and the mRNA level of osteogenic genes, including Runx2, ALP, osteopontin, and osteocalcin, were up-regulated by exogenous polyamines. When hBMSCs were cultured at high cell density favoring adipocyte formation, exogenous polyamines resulted in down-regulation of adipogenic genes such as PPARγ, aP2, and adipsin. Extracellular matrix mineralization, a marker for osteoblast maturation, was enhanced in the presence of exogenous polyamines, while lipid accumulation, an indication of adipogenic differentiation, was attenuated. Exogenous polyamines increased the mRNA expression of polyamine-modulated factor 1 (PMF-1) and its downstream effector, spermidine/spermine N(1)-acetyltransferase (SSAT), while that of ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis, was suppressed. These results lead to possible connections between polyamine metabolism and osteogenic differentiation pathways. To summarize, this study provides evidence for the involvement of polyamines in osteogenic differentiation of hBMSCs, and is the first to demonstrate that osteogenic and adipogenic differentiation are reciprocally regulated by exogenous polyamines.

  5. Transcriptome Analysis in Prenatal IGF1-Deficient Mice Identifies Molecular Pathways and Target Genes Involved in Distal Lung Differentiation

    PubMed Central

    Hernández-Porras, Isabel; López, Icíar Paula; De Las Rivas, Javier; Pichel, José García

    2013-01-01

    Background Insulin-like Growth Factor 1 (IGF1) is a multifunctional regulator of somatic growth and development throughout evolution. IGF1 signaling through IGF type 1 receptor (IGF1R) controls cell proliferation, survival and differentiation in multiple cell types. IGF1 deficiency in mice disrupts lung morphogenesis, causing altered prenatal pulmonary alveologenesis. Nevertheless, little is known about the cellular and molecular basis of IGF1 activity during lung development. Methods/Principal Findings Prenatal Igf1−/− mutant mice with a C57Bl/6J genetic background displayed severe disproportional lung hypoplasia, leading to lethal neonatal respiratory distress. Immuno-histological analysis of their lungs showed a thickened mesenchyme, alterations in extracellular matrix deposition, thinner smooth muscles and dilated blood vessels, which indicated immature and delayed distal pulmonary organogenesis. Transcriptomic analysis of Igf1−/− E18.5 lungs using RNA microarrays identified deregulated genes related to vascularization, morphogenesis and cellular growth, and to MAP-kinase, Wnt and cell-adhesion pathways. Up-regulation of immunity-related genes was verified by an increase in inflammatory markers. Increased expression of Nfib and reduced expression of Klf2, Egr1 and Ctgf regulatory proteins as well as activation of ERK2 MAP-kinase were corroborated by Western blot. Among IGF-system genes only IGFBP2 revealed a reduction in mRNA expression in mutant lungs. Immuno-staining patterns for IGF1R and IGF2, similar in both genotypes, correlated to alterations found in specific cell compartments of Igf1−/− lungs. IGF1 addition to Igf1−/− embryonic lungs cultured ex vivo increased airway septa remodeling and distal epithelium maturation, processes accompanied by up-regulation of Nfib and Klf2 transcription factors and Cyr61 matricellular protein. Conclusions/Significance We demonstrated the functional tissue specific implication of IGF1 on fetal lung

  6. Isolation of Regulated Genes of the Cyanobacterium Synechocystis sp. Strain PCC 6803 by Differential Display†

    PubMed Central

    Bhaya, Devaki; Vaulot, Daniel; Amin, Pinky; Takahashi, Akiko Watanabe; Grossman, Arthur R.

    2000-01-01

    Global identification of differentially regulated genes in prokaryotes is constrained because the mRNA does not have a 3′ polyadenylation extension; this precludes specific separation of mRNA from rRNA and tRNA and synthesis of cDNAs from the entire mRNA population. Knowledge of the entire genome sequence of Synechocystis sp. strain PCC 6803 has enabled us to develop a differential display procedure that takes advantage of a short palindromic sequence that is dispersed throughout the Synechocystis sp. strain PCC 6803 genome. This sequence, designated the HIP (highly iterated palindrome) element, occurs in approximately half of the Synechocystis sp. strain PCC 6803 genes but is absent in rRNA and tRNA genes. To determine the feasibility of exploiting the HIP element, alone or in combination with specific primer subsets, for analyzing differential gene expression, we used HIP-based primers to identify light intensity-regulated genes. Several gene fragments, including those encoding ribosomal proteins and phycobiliprotein subunits, were differentially amplified from RNA templates derived from cells grown in low light or exposed to high light for 3 h. One novel finding was that expression of certain genes of the pho regulon, which are under the control of environmental phosphate levels, were markedly elevated in high light. High-light activation of pho regulon genes correlated with elevated growth rates that occur when the cells are transferred from low to high light. These results suggest that in high light, the rate of growth of Synechocystis sp. strain PCC 6803 exceeds its capacity to assimilate phosphate, which, in turn, may trigger a phosphate starvation response and activation of the pho regulon. PMID:11004166

  7. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium.

    PubMed

    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan

    2013-12-01

    The aim of this study was to determine the steady-state expression of 13 selected housekeeping genes in the myometrium of cyclic and pregnant cows. Cells taken from bovine myometrium on days 1-5, 6-10, 11-16 and 17-20 of the oestrous cycle and in weeks 3-5, 6-8 and 9-12 of pregnancy were used. Reverse transcribed RNA was amplified in real-time PCR using designed primers. Reaction efficiency was determined with the Linreg programme. The geNorm and NormFinder programmes were used to select the best housekeeping genes. They calculate the expression stability factor for each used housekeeping gene with the smallest value for most stably expressed genes. According to geNorm, the most stable housekeeping genes in the myometrium were C2orf29, TPB and TUBB2B, while the least stably expressed genes were 18S RNA, HPRT1 and GAPDH. NormFinder identified the best genes in the myometrium as C2orf29, MRPL12 and TBP, while the worst genes were 18S RNA, B2M and SF3A1. Differences in stability factors between the two programmes may also indicate that the physiological status of the female, e.g. pregnancy, affects the stability of expression of housekeeping genes. The different expression stability of housekeeping genes did not affect progesterone receptor expression but it could be important if small differences in gene expression were measured between studies.

  8. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    PubMed Central

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  9. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho

    2017-01-01

    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  10. Microarray analysis of differentially expressed genes engaged in fruit development between Prunus mume and Prunus armeniaca.

    PubMed

    Li, Xiaoying; Korir, Nicholas Kibet; Liu, Lili; Shangguan, Lingfei; Wang, Yuzhu; Han, Jian; Chen, Ming; Fang, Jinggui

    2012-11-15

    Microarray analysis is a technique that can be employed to provide expression profiles of single genes and new insights to elucidate the biological mechanisms responsible for fruit development. To evaluate expression of genes mostly engaged in fruit development between Prunus mume and Prunus armeniaca, we first identified differentially expressed transcripts along the entire fruit life cycle by using microarrays spotted with 10,641 ESTs collected from P. mume and other Prunus EST sequences. A total of 1418 ESTs were selected after quality control of microarray spots and analysis for differential gene expression patterns during fruit development of P. mume and P. Armeniaca. From these, 707 up-regulated and 711 down-regulated genes showing more than two-fold differences in expression level were annotated by GO based on biological processes, molecular functions and cellular components. These differentially expressed genes were found to be involved in several important pathways of carbohydrate, galactose, and starch and sucrose metabolism as well as in biosynthesis of other secondary metabolites via KEGG. This could provide detailed information on the fruit quality differences during development and ripening of these two species. With the results obtained, we provide a practical database for comprehensive understanding of molecular events during fruit development and also lay a theoretical foundation for the cloning of genes regulating in a series of important rate-limiting enzymes involved in vital metabolic pathways during fruit development. Copyright © 2012 Elsevier GmbH. All rights reserved.

  11. Differential gene expression in human abdominal aortic aneurysm and aortic occlusive disease

    PubMed Central

    Moran, Corey S.; Schreurs, Charlotte; Lindeman, Jan H. N.; Walker, Philip J.; Nataatmadja, Maria; West, Malcolm; Holdt, Lesca M.; Hinterseher, Irene; Pilarsky, Christian; Golledge, Jonathan

    2015-01-01

    Abdominal aortic aneurysm (AAA) and aortic occlusive disease (AOD) represent common causes of morbidity and mortality in elderly populations which were previously believed to have common aetiologies. The aim of this study was to assess the gene expression in human AAA and AOD. We performed microarrays using aortic specimen obtained from 20 patients with small AAAs (≤ 55mm), 29 patients with large AAAs (> 55mm), 9 AOD patients, and 10 control aortic specimens obtained from organ donors. Some differentially expressed genes were validated by quantitative-PCR (qRT-PCR)/immunohistochemistry. We identified 840 and 1,014 differentially expressed genes in small and large AAAs, respectively. Immune-related pathways including cytokine-cytokine receptor interaction and T-cell-receptor signalling were upregulated in both small and large AAAs. Examples of validated genes included CTLA4 (2.01-fold upregulated in small AAA, P = 0.002), NKTR (2.37-and 2.66-fold upregulated in small and large AAA with P = 0.041 and P = 0.015, respectively), and CD8A (2.57-fold upregulated in large AAA, P = 0.004). 1,765 differentially expressed genes were identified in AOD. Pathways upregulated in AOD included metabolic and oxidative phosphorylation categories. The UCP2 gene was downregulated in AOD (3.73-fold downregulated, validated P = 0.017). In conclusion, the AAA and AOD transcriptomes were very different suggesting that AAA and AOD have distinct pathogenic mechanisms. PMID:25944698

  12. Investigatory and analytical approaches to differential gene expression profiling in mantle cell lymphoma.

    PubMed

    Zhu, Ying; Hollmén, Jaakko; Räty, Riikka; Aalto, Yan; Nagy, Balint; Elonen, Erkki; Kere, Juha; Mannila, Heikki; Franssila, Kaarle; Knuutila, Sakari

    2002-12-01

    Mantle cell lymphoma (MCL) is a non-Hodgkin's lymphoma of B-cell lineage. The blastoid variant of MCL, characterized by high mitotic rate, is clinically more aggressive than common MCL. We used the cDNA array technology to examine the gene expression profiles of both blastoid variant and common MCL. The data was analysed by regression analysis, principal component analysis and the naive Bayes' classifier. Eight genes were identified as differentially deregulated between the two groups. Oncogenes CMYC, BCL2 and PIM1 were upregulated more frequently in the blastoid variant than in common MCL. This implied that the gp130-mediated signal transducer and activator of transcription 3 (STAT3) signalling pathway was involved in the blastoid variant transformation of MCL. Other differentially deregulated genes were TOP1, CD23, CD45, CD70 and NFATC. By using the eight differentially deregulated genes, we created a classifier to distinguish the blastoid variant from common MCL with high accuracy. We also identified 18 genes that were deregulated in both groups. Among them, BCL1, CALLA/CD10 and GRN were suggested to be oncogenes. The products of RGS1, RGS2, ANX2 and CD44H were suggested to promote tumour metastasis. CD66D was suggested to be a tumour suppressor gene.

  13. In Vitro Study of Putative Genomic Biomarkers of Nephrotoxicity Through Differential Gene Expression Using Gentamicin.

    PubMed

    Silva, Sarah Cristina Teixeira; de Almeida, Leonardo Augusto; Soares, Stellamaris; Grossi, Marina Felipe; Valente, Anete Maria Santana; Tagliati, Carlos Alberto

    2017-04-03

    Drug-induced nephrotoxicity is one of the most frequently observed effects in long-term pharmacotherapy. The effects of nephrotoxicity are commonly discovered later due to a lack of sensitivity in in vivo methods. Therefore, researchers have tried to develop in vitro alternative methods for early identification of toxicity. In this study, LLC-PK1 cells were exposed to gentamicin through MTT and trypan blue assay. Concentrations of 4 (low), 8 (medium), and 12 (high) mM, were used to evaluate differential gene expression. A panel of genes was selected based on gene expression changes. The search for sequences of mRNA encoding proteins previously associated with kidney damage was conducted in the databases of the National Center for Biotechnology Information (USA). RNA was extracted from the cells, and RT-qPCR was performed to evaluate differential expression profiles of the selected genes. Among the eleven analyzed genes, four proved to be differentially up-regulated in cells exposed to gentamicin: HAVcr1, caspase3, ICAM-1, and EXOC6. According to this study's results, we suggest that these genes play an important role in the mechanism of in vitro neprotoxicity caused by gentamicin and can be used as early in vitro biomarkers to identify nephrotoxicity when developing safer drugs.

  14. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.)

    PubMed Central

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M.; Liu, Liwang

    2016-01-01

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish. PMID:26902837

  15. Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.).

    PubMed

    Zhai, Lulu; Xu, Liang; Wang, Yan; Zhu, Xianwen; Feng, Haiyang; Li, Chao; Luo, Xiaobo; Everlyne, Muleke M; Liu, Liwang

    2016-02-23

    Embryogenesis is an important component in the life cycle of most plant species. Due to the difficulty in embryo isolation, the global gene expression involved in plant embryogenesis, especially the early events following fertilization are largely unknown in radish. In this study, three cDNA libraries from ovules of radish before and after fertilization were sequenced using the Digital Gene Expression (DGE) tag profiling strategy. A total of 5,777 differentially expressed transcripts were detected based on pairwise comparison in the three libraries (0_DAP, 7_DAP and 15_DAP). Results from Gene Ontology (GO) and pathway enrichment analysis revealed that these differentially expressed genes (DEGs) were implicated in numerous life processes including embryo development and phytohormones biosynthesis. Notably, some genes encoding auxin response factor (ARF ), Leafy cotyledon1 (LEC1) and somatic embryogenesis receptor-like kinase (SERK ) known to be involved in radish embryogenesis were differentially expressed. The expression patterns of 30 genes including LEC1-2, AGL9, LRR, PKL and ARF8-1 were validated by qRT-PCR. Furthermore, the cooperation between miRNA and mRNA may play a pivotal role in the radish embryogenesis process. This is the first report on identification of DEGs profiles related to radish embryogenesis and seed development. These results could facilitate further dissection of the molecular mechanisms underlying embryogenesis and seed development in radish.

  16. Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display.

    PubMed

    Li, Xiang; Bi, Zhenghong; Di, Rong; Liang, Peng; He, Qiguang; Liu, Wenbo; Miao, Weiguo; Zheng, Fucong

    2016-01-29

    Powdery mildew is an important disease of rubber trees caused by Oidium heveae B. A. Steinmann. As far as we know, none of the resistance genes related to powdery mildew have been isolated from the rubber tree. There is little information available at the molecular level regarding how a rubber tree develops defense mechanisms against this pathogen. We have studied rubber tree mRNA transcripts from the resistant RRIC52 cultivar by differential display analysis. Leaves inoculated with the spores of O. heveae were collected from 0 to 120 hpi in order to identify pathogen-regulated genes at different infection stages. We identified 78 rubber tree genes that were differentially expressed during the plant-pathogen interaction. BLAST analysis for these 78 ESTs classified them into seven functional groups: cell wall and membrane pathways, transcription factor and regulatory proteins, transporters, signal transduction, phytoalexin biosynthesis, other metabolism functions, and unknown functions. The gene expression for eight of these genes was validated by qRT-PCR in both RRIC52 and the partially susceptible Reyan 7-33-97 cultivars, revealing the similar or differential changes of gene expressions between these two cultivars. This study has improved our overall understanding of the molecular mechanisms of rubber tree resistance to powdery mildew.

  17. Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display

    PubMed Central

    Li, Xiang; Bi, Zhenghong; Di, Rong; Liang, Peng; He, Qiguang; Liu, Wenbo; Miao, Weiguo; Zheng, Fucong

    2016-01-01

    Powdery mildew is an important disease of rubber trees caused by Oidium heveae B. A. Steinmann. As far as we know, none of the resistance genes related to powdery mildew have been isolated from the rubber tree. There is little information available at the molecular level regarding how a rubber tree develops defense mechanisms against this pathogen. We have studied rubber tree mRNA transcripts from the resistant RRIC52 cultivar by differential display analysis. Leaves inoculated with the spores of O. heveae were collected from 0 to 120 hpi in order to identify pathogen-regulated genes at different infection stages. We identified 78 rubber tree genes that were differentially expressed during the plant–pathogen interaction. BLAST analysis for these 78 ESTs classified them into seven functional groups: cell wall and membrane pathways, transcription factor and regulatory proteins, transporters, signal transduction, phytoalexin biosynthesis, other metabolism functions, and unknown functions. The gene expression for eight of these genes was validated by qRT-PCR in both RRIC52 and the partially susceptible Reyan 7-33-97 cultivars, revealing the similar or differential changes of gene expressions between these two cultivars. This study has improved our overall understanding of the molecular mechanisms of rubber tree resistance to powdery mildew. PMID:26840302

  18. Integrative meta-analysis of differentially expressed genes in osteoarthritis using microarray technology.

    PubMed

    Wang, Xi; Ning, Yujie; Guo, Xiong

    2015-09-01

    The aim of the present study was to identify differentially expressed (DE) genes in patients with osteoarthritis (OA), and biological processes associated with changes in gene expression that occur in this disease. Using the INMEX (integrative meta‑analysis of expression data) software tool, a meta‑analysis of publicly available microarray Gene Expression Omnibus (GEO) datasets of OA was performed. Gene ontology (GO) enrichment analysis was performed in order to detect enriched functional attributes based on gene‑associated GO terms. Three GEO datasets, containing 137 patients with OA and 52 healthy controls, were included in the meta‑analysis. The analysis identified 85 genes that were consistently differentially expressed in OA (30 genes were upregulated and 55 genes were downregulated). The upregulated gene with the lowest P‑value (P=5.36E‑07) was S‑phase kinase‑associated protein 2, E3 ubiquitin protein ligase (SKP2). The downregulated gene with the lowest P‑value (P=4.42E‑09) was Proline rich 5 like (PRR5L). Among the 210 GO terms that were associated with the set of DE genes, the most significant two enrichments were observed in the GO categories of 'Immune response', with a P‑value of 0.000129438, and 'Immune effectors process', with a P‑value of 0.000288619. The current meta‑analysis identified genes that were consistently DE in OA, in addition to biological pathways associated with changes in gene expression that occur during OA, which may provide insight into the molecular mechanisms underlying the pathogenesis of this disease.

  19. Cooperative Stimulation of Megakaryocytic Differentiation by Gfi1b Gene Targets Kindlin3 and Talin1

    PubMed Central

    Singh, Divya; Upadhyay, Ghanshyam; Sengupta, Ananya; Biplob, Mohammed A.; Chakyayil, Shaleen; George, Tiji; Saleque, Shireen

    2016-01-01

    Understanding the production and differentiation of megakaryocytes from progenitors is crucial for realizing the biology and functions of these vital cells. Previous gene ablation studies demonstrated the essential role of the transcriptional repressor Gfi1b (growth factor independence 1b) in the generation of both erythroid and megakaryocytic cells. However, our recent work has demonstrated the down-regulation of this factor during megakaryocytic differentiation. In this study we identify two new gene targets of Gfi1b, the cytoskeletal proteins Kindlin3 and Talin1, and demonstrate the inverse expression and functions of these cytoskeletal targets relative to Gfi1b, during megakaryocytic differentiation. Both kindlin3 and talin1 promoters exhibit dose dependent Gfi1b and LSD1 (lysine specific demethylase 1; a Gfi1b cofactor) enrichment in megakaryocytes and repression in non-hematopoietic cells. Accordingly the expression of these genes is elevated in gfi1b mutant and LSD1 inhibited hematopoietic cells, while during megakaryocytic differentiation, declining Gfi1b levels fostered the reciprocal upregulation of these cytoskeletal factors. Concordantly, manipulation of Kindlin3 and Talin1 expression demonstrated positive correlation with megakaryocytic differentiation with over-expression stimulating, and inhibition diminishing, this process. Co-operativity between these factors and integrins in promoting differentiation was further underscored by physical interactions between them and integrinβ3/CD61 and by stimulation of differentiation by the Talin1 head domain, which is necessary and sufficient for integrin activation. Therefore this study demonstrates the significance of Gfi1b regulated Kindlin3-Talin1 expression in driving megakaryocytic differentiation and highlights the contribution of cytoskeletal agents in the developmental progression of these platelet progenitors. PMID:27768697

  20. Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

    PubMed Central

    Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

    2011-01-01

    Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

  1. Eos negatively regulates human γ-globin gene transcription during erythroid differentiation.

    PubMed

    Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

    2011-01-01

    Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation.

  2. Mammalian polycomb-like Pcl2/Mtf2 is a novel regulatory component of PRC2 that can differentially modulate polycomb activity both at the Hox gene cluster and at Cdkn2a genes.

    PubMed

    Li, Xiangzhi; Isono, Kyo-Ichi; Yamada, Daisuke; Endo, Takaho A; Endoh, Mitsuhiro; Shinga, Jun; Mizutani-Koseki, Yoko; Otte, Arie P; Casanova, Miguel; Kitamura, Hiroshi; Kamijo, Takehiko; Sharif, Jafar; Ohara, Osamu; Toyada, Tetsuro; Bernstein, Bradley E; Brockdorff, Neil; Koseki, Haruhiko

    2011-01-01

    The Polycomb group of proteins forms at least two distinct complexes designated the Polycomb repressive complex-1 (PRC1) and PRC2. These complexes cooperate to mediate transcriptional repression of their target genes, including the Hox gene cluster and the Cdkn2a genes. Mammalian Polycomb-like gene Pcl2/Mtf2 is expressed as four different isoforms, and the longest one contains a Tudor domain and two plant homeodomain (PHD) fingers. Pcl2 forms a complex with PRC2 and binds to Hox genes in a PRC2-dependent manner. We show that Pcl2 is a functional component of PRC2 and is required for PRC2-mediated Hox repression. Pcl2, however, exhibits a profound synergistic effect on PRC1-mediated Hox repression, which is not accompanied by major alterations in the local trimethylation of histone H3 at lysine 27 (H3K27me3) or PRC1 deposition. Pcl2 therefore functions in collaboration with both PRC2 and PRC1 to repress Hox gene expression during axial development. Paradoxically, in embryonic fibroblasts, Pcl2 is shown to activate the expression of Cdkn2a and promote cellular senescence, presumably by suppressing the catalytic activity of PRC2 locally. Taken together, we show that Pcl2 differentially regulates Polycomb-mediated repression of Hox and Cdkn2a genes. We therefore propose a novel role for Pcl2 to modify functional engagement of PRC2 and PRC1, which could be modulated by sensing cellular circumstances.

  3. Profile of Inflammation-associated genes during Hepatic Differentiation of Human Pluripotent Stem Cells.

    PubMed

    Ignatius Irudayam, Joseph; Contreras, Deisy; Spurka, Lindsay; Ren, Songyang; Kanagavel, Vidhya; Ramaiah, Arunachalam; Annamalai, Alagappan; French, Samuel W; Klein, Andrew S; Funari, Vincent; Arumugaswami, Vaithilingaraja

    2015-12-01

    Expression of genes associated with inflammation was analyzed during differentiation of human pluripotent stem cells (PSCs) to hepatic cells. Messenger RNA transcript profiles of differentiated endoderm (day 5), hepatoblast (day 15) and hepatocyte-like cells (day 21) were obtained by RNA sequencing analysis. When compared to endoderm cells an immature cell type, the hepatic cells (days 15 and 21) had significantly higher expression of acute phase protein genes including complement factors, coagulation factors, serum amyloid A and serpins. Furthermore, hepatic phase of cells expressed proinflammatory cytokines IL18 and IL32 as well as cytokine receptors IL18R1, IL1R1, IL1RAP, IL2RG, IL6R, IL6ST and IL10RB. These cells also produced CCL14, CCL15, and CXCL- 1, 2, 3, 16 and 17 chemokines. Endoderm cells had higher levels of chemokine receptors, CXCR4 and CXCR7, than that of hepatic cells. Sirtuin family of genes involved in aging, inflammation and metabolism were differentially regulated in endoderm and hepatic phase cells. Ligands and receptors of the tumor necrosis factor (TNF) family as well as downstream signaling factors TRAF2, TRAF4, FADD, NFKB1 and NFKBIB were differentially expressed during hepatic differentiation.

  4. Profile of Inflammation-associated genes during Hepatic Differentiation of Human Pluripotent Stem Cells

    PubMed Central

    Ignatius Irudayam, Joseph; Contreras, Deisy; Spurka, Lindsay; Ren, Songyang; Kanagavel, Vidhya; Ramaiah, Arunachalam; Annamalai, Alagappan; French, Samuel W.; Klein, Andrew S.; Funari, Vincent; Arumugaswami, Vaithilingaraja

    2015-01-01

    Expression of genes associated with inflammation was analyzed during differentiation of human pluripotent stem cells (PSCs) to hepatic cells. Messenger RNA transcript profiles of differentiated endoderm (day 5), hepatoblast (day 15) and hepatocyte-like cells (day 21) were obtained by RNA sequencing analysis. When compared to endoderm cells an immature cell type, the hepatic cells (days 15 and 21) had significantly higher expression of acute phase protein genes including complement factors, coagulation factors, serum amyloid A and serpins. Furthermore, hepatic phase of cells expressed proinflammatory cytokines IL18 and IL32 as well as cytokine receptors IL18R1, IL1R1, IL1RAP, IL2RG, IL6R, IL6ST and IL10RB. These cells also produced CCL14, CCL15, and CXCL- 1, 2, 3, 16 and 17 chemokines. Endoderm cells had higher levels of chemokine receptors, CXCR4 and CXCR7, than that of hepatic cells. Sirtuin family of genes involved in aging, inflammation and metabolism were differentially regulated in endoderm and hepatic phase cells. Ligands and receptors of the tumor necrosis factor (TNF) family as well as downstream signaling factors TRAF2, TRAF4, FADD, NFKB1 and NFKBIB were differentially expressed during hepatic differentiation. PMID:26702414

  5. The Populus homeobox gene ARBORKNOX2 regulates cell differentiation during secondary growth.

    PubMed

    Du, Juan; Mansfield, Shawn D; Groover, Andrew T

    2009-12-01

    The stem cells of the vascular cambium divide to produce daughter cells, which in turn divide before undergoing differentiation during the radial growth of woody stems. The genetic regulation of these developmental events is poorly understood, however. We report here the cloning and functional characterization of a Populus class-I KNOX homeobox gene, ARBORKNOX2 (ARK2), which we show influences terminal cell differentiation and cell wall properties during secondary growth. In the early stages of secondary growth, ARK2 is expressed broadly in the cambial zone and in terminally differentiating cell types, before becoming progressively restricted to the cambium. ARK2 overexpression and synthetic miRNA-suppression transgenics reveal positive correlations between ARK2 expression level and the timing of cambium formation, the width of the cambial zone and inhibition of cambial daughter cell differentiation. These phenotypes in turn correlate with changes in the expression of genes affecting transcription, cell division, auxin and cell wall synthesis. Notably, wood properties associated with secondary cell wall synthesis are negatively associated with ARK2 expression, including lignin and cellulose content. Together, our results suggest that ARK2 functions primarily to regulate a complex suite of genes that together influence cell differentiation during secondary growth. We propose that ARK2 may represent a co-evolved transcriptional module that influences complex, adaptive wood properties.

  6. Regulation of adipocyte differentiation and gene expression-crosstalk between TGFβ and wnt signaling pathways.

    PubMed

    Lu, Hang; Ward, Meliza G; Adeola, Olayiwola; Ajuwon, Kolapo M

    2013-09-01

    Obesity results in reduced differentiation potential of adipocytes leading to adipose tissue insulin resistance. Elevated proinflammatory cytokines from adipose tissue in obesity, such as TNFα have been implicated in the reduced adipocyte differentiation. Other mediators of reduced adipocyte differentiation include TGFβ and wnt proteins. Although some overlap exists in the signaling cascades of the wnt and TGFβ pathways it is unknown if TGFβ or wnt proteins reciprocally induce the expression of each other to maximize their biological effects in adipocytes. Therefore, we investigated the possible involvement of TGFβ signaling in wnt induced gene expression and vice versa in 3T3-L1 adipocyte. Effect of TGFβ and Wnt pathways on differentiation was studied in preadipocytes induced to differentiate in the presence of Wnt3a or TGFβ1 and their inhibitors (FZ8-CRD and SB431542, respectively). Regulation of intracellular signaling and gene expression was also studied in mature adipocytes. Our results show that both TGFβ1 and Wnt3a lead to increased accumulation of β-catenin, phosphorylation of AKT and p44/42 MAPK. However, differences were found in the pattern of gene expression induced by the two proteins suggesting that distinct, but complex, signaling pathways are activated by TGFβ and wnt proteins to independently regulate adipocyte function.

  7. Analysis on differential expressed genes of ovarian tissue between high- and low-yield laying hen.

    PubMed

    Chen, Wei; Song, Ling-Jun; Zeng, Yong-Qing; Yang, Yun; Wang, Hui

    2013-01-01

    In order to elucidate molecular genetic mechanism of laying hen reproduction at the transcriptional level and the structure of significantly differential genes, the mRNA differential display and reverse northern dot-blot were used to detect the differential expression of genes in the ovary tissue of low-yield laying hens and high-yield laying hens in the present study. Sixteen 32-week-old CAU-pink laying hens divided into two groups were used and the laying performance was measured. The results showed that only the egg numbers were significantly different between the two groups; and from 15 primer pairs, a total of 336 bands were di