Chi, Zhenming; Chi, Zhe; Zhang, Tong; Liu, Guanglei; Li, Jing; Wang, Xianghong
2009-01-01
In this review article, the extracellular enzymes production, their properties and cloning of the genes encoding the enzymes from marine yeasts are overviewed. Several yeast strains which could produce different kinds of extracellular enzymes were selected from the culture collection of marine yeasts available in this laboratory. The strains selected belong to different genera such as Yarrowia, Aureobasidium, Pichia, Metschnikowia and Cryptococcus. The extracellular enzymes include cellulase, alkaline protease, aspartic protease, amylase, inulinase, lipase and phytase, as well as killer toxin. The conditions and media for the enzyme production by the marine yeasts have been optimized and the enzymes have been purified and characterized. Some genes encoding the extracellular enzymes from the marine yeast strains have been cloned, sequenced and expressed. It was found that some properties of the enzymes from the marine yeasts are unique compared to those of the homologous enzymes from terrestrial yeasts and the genes encoding the enzymes in marine yeasts are different from those in terrestrial yeasts. Therefore, it is of very importance to further study the enzymes and their genes from the marine yeasts. This is the first review on the extracellular enzymes and their genes from the marine yeasts.
Darbro, Benjamin W.; Mahajan, Vinit B.; Gakhar, Lokesh; Skeie, Jessica M.; Campbell, Elizabeth; Wu, Shu; Bing, Xinyu; Millen, Kathleen J.; Dobyns, William B.; Kessler, John A.; Jalali, Ali; Cremer, James; Segre, Alberto; Manak, J. Robert; Aldinger, Kimerbly A.; Suzuki, Satoshi; Natsume, Nagato; Ono, Maya; Hai, Huynh Dai; Viet, Le Thi; Loddo, Sara; Valente, Enza M.; Bernardini, Laura; Ghonge, Nitin; Ferguson, Polly J.; Bassuk, Alexander G.
2013-01-01
We performed whole-exome sequencing of a family with autosomal dominant Dandy-Walker malformation and occipital cephaloceles (ADDWOC) and detected a mutation in the extracellular matrix protein encoding gene NID1. In a second family, protein interaction network analysis identified a mutation in LAMC1, which encodes a NID1 binding partner. Structural modeling the NID1-LAMC1 complex demonstrated that each mutation disrupts the interaction. These findings implicate the extracellular matrix in the pathogenesis of Dandy-Walker spectrum disorders. PMID:23674478
The bglA Gene of Aspergillus kawachii Encodes Both Extracellular and Cell Wall-Bound β-Glucosidases
Iwashita, Kazuhiro; Nagahara, Tatsuya; Kimura, Hitoshi; Takano, Makoto; Shimoi, Hitoshi; Ito, Kiyoshi
1999-01-01
We cloned the genomic DNA and cDNA of bglA, which encodes β-glucosidase in Aspergillus kawachii, based on a partial amino acid sequence of purified cell wall-bound β-glucosidase CB-1. The nucleotide sequence of the cloned bglA gene revealed a 2,933-bp open reading frame with six introns that encodes an 860-amino-acid protein. Based on the deduced amino acid sequence, we concluded that the bglA gene encodes cell wall-bound β-glucosidase CB-1. The amino acid sequence exhibited high levels of homology with the amino acid sequences of fungal β-glucosidases classified in subfamily B. We expressed the bglA cDNA in Saccharomyces cerevisiae and detected the recombinant β-glucosidase in the periplasm fraction of the recombinant yeast. A. kawachii can produce two extracellular β-glucosidases (EX-1 and EX-2) in addition to the cell wall-bound β-glucosidase. A. kawachii in which the bglA gene was disrupted produced none of the three β-glucosidases, as determined by enzyme assays and a Western blot analysis. Thus, we concluded that the bglA gene encodes both extracellular and cell wall-bound β-glucosidases in A. kawachii. PMID:10584016
Gene encoding a novel extracellular metalloprotease in Bacillus subtilis.
Sloma, A; Rudolph, C F; Rufo, G A; Sullivan, B J; Theriault, K A; Ally, D; Pero, J
1990-01-01
The gene for a novel extracellular metalloprotease was cloned, and its nucleotide sequence was determined. The gene (mpr) encodes a primary product of 313 amino acids that has little similarity to other known Bacillus proteases. The amino acid sequence of the mature protease was preceded by a signal sequence of approximately 34 amino acids and a pro sequence of 58 amino acids. Four cysteine residues were found in the deduced amino acid sequence of the mature protein, indicating the possible presence of disulfide bonds. The mpr gene mapped in the cysA-aroI region of the chromosome and was not required for growth or sporulation. Images FIG. 2 FIG. 7 PMID:2105291
Qian, Guoliang; Zhou, Yijing; Zhao, Yancun; Song, Zhiwei; Wang, Suyan; Fan, Jiaqin; Hu, Baishi; Venturi, Vittorio; Liu, Fengquan
2013-07-05
Quorum sensing (QS) in Xanthomonas oryzae pv. oryzicola (Xoc), the causal agent of bacterial leaf streak, is mediated by the diffusible signal factor (DSF). DSF-mediating QS has been shown to control virulence and a set of virulence-related functions; however, the expression profiles and functions of extracellular proteins controlled by DSF signal remain largely unclear. In the present study, 33 DSF-regulated extracellular proteins, whose functions include small-protein mediating QS, oxidative adaptation, macromolecule metabolism, cell structure, biosynthesis of small molecules, intermediary metabolism, cellular process, protein catabolism, and hypothetical function, were identified by proteomics in Xoc. Of these, 15 protein encoding genes were in-frame deleted, and 4 of them, including three genes encoding type II secretion system (T2SS)-dependent proteins and one gene encoding an Ax21 (activator of XA21-mediated immunity)-like protein (a novel small-protein type QS signal) were determined to be required for full virulence in Xoc. The contributions of these four genes to important virulence-associated functions, including bacterial colonization, extracellular polysaccharide, cell motility, biofilm formation, and antioxidative ability, are presented. To our knowledge, our analysis is the first complete list of DSF-regulated extracellular proteins and functions in a Xanthomonas species. Our results show that DSF-type QS played critical roles in regulation of T2SS and Ax21-mediating QS, which sheds light on the role of DSF signaling in Xanthomonas.
The pine Pschi4 promoter directs wound-induced transcription
Haiguo Wu; Charles H. Michler; Liborio LaRussa; John M. Davis
1999-01-01
Mechanical wounding stimulates the accumulation of Pschi4 transcripts (encoding a putative extracellular chitinase) in pine trees. To gain insight into the transcriptional regulatory region(s) in this gymnosperm defense gene, the 5'-flanking region of Pschi4 was fused to the uidA reporter gene encoding -...
Darbro, Benjamin W; Mahajan, Vinit B; Gakhar, Lokesh; Skeie, Jessica M; Campbell, Elizabeth; Wu, Shu; Bing, Xinyu; Millen, Kathleen J; Dobyns, William B; Kessler, John A; Jalali, Ali; Cremer, James; Segre, Alberto; Manak, J Robert; Aldinger, Kimerbly A; Suzuki, Satoshi; Natsume, Nagato; Ono, Maya; Hai, Huynh Dai; Viet, Le Thi; Loddo, Sara; Valente, Enza M; Bernardini, Laura; Ghonge, Nitin; Ferguson, Polly J; Bassuk, Alexander G
2013-08-01
We performed whole-exome sequencing of a family with autosomal dominant Dandy-Walker malformation and occipital cephaloceles and detected a mutation in the extracellular matrix (ECM) protein-encoding gene NID1. In a second family, protein interaction network analysis identified a mutation in LAMC1, which encodes a NID1-binding partner. Structural modeling of the NID1-LAMC1 complex demonstrated that each mutation disrupts the interaction. These findings implicate the ECM in the pathogenesis of Dandy-Walker spectrum disorders. © 2013 WILEY PERIODICALS, INC.
Receptor protein kinase gene encoded at the self-incompatibility locus
Nasrallah, June B.; Nasrallah, Mikhail E.; Stein, Joshua
1996-01-01
Described herein is a S receptor kinase gene (SRK), derived from the S locus in Brassica oleracea, having a extracellular domain highly similar to the secreted product of the S-locus glycoprotein gene.
Eriksson, A R; Andersson, R A; Pirhonen, M; Palva, E T
1998-08-01
Production of extracellular, plant cell wall degrading enzymes, the main virulence determinants of the plant pathogen Erwinia carotovora subsp. carotovora, is coordinately controlled by a complex regulatory network. Insertion mutants in the exp (extracellular enzyme production) loci exhibit pleiotropic defects in virulence and the growth-phase-dependent transcriptional activation of genes encoding extracellular enzymes. Two new exp mutations, designated expA and expS, were characterized. Introduction of the corresponding wild-type alleles to the mutants complemented both the lack of virulence and the impaired production of plant cell wall degrading enzymes. The expA gene was shown to encode a 24-kDa polypeptide that is structurally and functionally related to the uvrY gene product of Escherichia coli and the GacA response regulator of Pseudomonas fluorescens. Functional similarity of expA and uvrY was demonstrated by genetic complementation. The expA gene is organized in an operon together with a uvrC-like gene, identical to the organization of uvrY and uvrC in E. coli. The unlinked expS gene encodes a putative sensor kinase that shows 92% identity to the recently described rpfA gene product from another E. carotovora subsp. carotovora strain. Our data suggest that ExpS and ExpA are members of two-component sensor kinase and response regulator families, respectively. These two proteins might interact in controlling virulence gene expression in E. carotovora subsp. carotovora.
Deriabin, A N; Berdichevets, I N; Burakhanova, E A; Trunova, T I
2014-01-01
Some properties and activity of extracellular invertase in the Saccharomyces cerevisiae yeasts encoded by the suc2 gene in heterologous expression were described. It was shown that the target suc2 gene is actively expressed in the genome of the transformed potato plants and S. cerevisiae invertase synthesized by this gene is transported into the apoplast due to the signal peptide of the proteinase II inhibitor. This enzyme is present in the apoplast in a soluble form and absorbed into the cell wall.
Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D
2008-04-01
A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.
Reid, Vernita J.; Theron, Louwrens W.; du Toit, Maret
2012-01-01
The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence. PMID:22820332
Characterization of ROS1 cDNA from a human glioblastoma cell line
DOE Office of Scientific and Technical Information (OSTI.GOV)
Birchmeier, C.; O'Neill, K.; Riggs, M.
1990-06-01
The authors have isolated and characterized a human ROS1 cDNA from the glioblastoma cell line SW-1088. The cDNA, 8.3 kilobases long, has the potential to encode a transmembrane tyrosine-specific protein kinase with a predicted molecular mass of 259 kDa. The putative extracellular domain of ROS1 is homologous to the extracellular domain of the sevenless gene product from Drosophila. No comparable similarities in the extracellular domains were found between ROS1 and other receptor-type tyrosine kinases. Together, ROS1 and sevenless gene products define a distinct subclass of transmember tyrosine kinases.
Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes
Phil Kersten; Dan Cullen
2014-01-01
Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...
Stevenson, G; Andrianopoulos, K; Hobbs, M; Reeves, P R
1996-01-01
Colanic acid (CA) is an extracellular polysaccharide produced by most Escherichia coli strains as well as by other species of the family Enterobacteriaceae. We have determined the sequence of a 23-kb segment of the E. coli K-12 chromosome which includes the cluster of genes necessary for production of CA. The CA cluster comprises 19 genes. Two other sequenced genes (orf1.3 and galF), which are situated between the CA cluster and the O-antigen cluster, were shown to be unnecessary for CA production. The CA cluster includes genes for synthesis of GDP-L-fucose, one of the precursors of CA, and the gene for one of the enzymes in this pathway (GDP-D-mannose 4,6-dehydratase) was identified by biochemical assay. Six of the inferred proteins show sequence similarity to glycosyl transferases, and two others have sequence similarity to acetyl transferases. Another gene (wzx) is predicted to encode a protein with multiple transmembrane segments and may function in export of the CA repeat unit from the cytoplasm into the periplasm in a process analogous to O-unit export. The first three genes of the cluster are predicted to encode an outer membrane lipoprotein, a phosphatase, and an inner membrane protein with an ATP-binding domain. Since homologs of these genes are found in other extracellular polysaccharide gene clusters, they may have a common function, such as export of polysaccharide from the cell. PMID:8759852
Johnson, Jeremiah G; Murphy, Caitlin N; Sippy, Jean; Johnson, Tylor J; Clegg, Steven
2011-07-01
Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression.
Johnson, Jeremiah G.; Murphy, Caitlin N.; Sippy, Jean; Johnson, Tylor J.; Clegg, Steven
2011-01-01
Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression. PMID:21571997
Blackburn, Michael B; Sparks, Michael E; Gundersen-Rindal, Dawn E
2016-12-01
The genome of Chromobacterium subtsugae strain PRAA4-1, a betaproteobacterium producing insecticidal compounds, was sequenced and compared with the genome of C. violaceum ATCC 12472. The genome of C. subtsugae displayed a reduction in genes devoted to capsular and extracellular polysaccharide, possessed no genes encoding nitrate reductases, and exhibited many more phage-related sequences than were observed for C. violaceum. The genomes of both species possess a number of gene clusters predicted to encode biosynthetic complexes for secondary metabolites; these clusters suggest they produce overlapping, but distinct assortments of metabolites.
Borlee, Bradley R; Goldman, Aaron D; Murakami, Keiji; Samudrala, Ram; Wozniak, Daniel J; Parsek, Matthew R
2010-01-01
Pseudomonas aeruginosa, the principal pathogen of cystic fibrosis patients, forms antibiotic-resistant biofilms promoting chronic colonization of the airways. The extracellular (EPS) matrix is a crucial component of biofilms that provides the community multiple benefits. Recent work suggests that the secondary messenger, cyclic-di-GMP, promotes biofilm formation. An analysis of factors specifically expressed in P. aeruginosa under conditions of elevated c-di-GMP, revealed functions involved in the production and maintenance of the biofilm extracellular matrix. We have characterized one of these components, encoded by the PA4625 gene, as a putative adhesin and designated it cdrA. CdrA shares structural similarities to extracellular adhesins that belong to two-partner secretion systems. The cdrA gene is in a two gene operon that also encodes a putative outer membrane transporter, CdrB. The cdrA gene encodes a 220 KDa protein that is predicted to be rod-shaped protein harbouring a β-helix structural motif. Western analysis indicates that the CdrA is produced as a 220 kDa proprotein and processed to 150 kDa before secretion into the extracellular medium. We demonstrated that cdrAB expression is minimal in liquid culture, but is elevated in biofilm cultures. CdrAB expression was found to promote biofilm formation and auto-aggregation in liquid culture. Aggregation mediated by CdrA is dependent on the Psl polysaccharide and can be disrupted by adding mannose, a key structural component of Psl. Immunoprecipitation of Psl present in culture supernatants resulted in co-immunoprecipitation of CdrA, providing additional evidence that CdrA directly binds to Psl. A mutation in cdrA caused a decrease in biofilm biomass and resulted in the formation of biofilms exhibiting decreased structural integrity. Psl-specific lectin staining suggests that CdrA either cross-links Psl polysaccharide polymers and/or tethers Psl to the cells, resulting in increased biofilm structural stability. Thus, this study identifies a key protein structural component of the P. aeruginosa EPS matrix. PMID:20088866
Porcine NAMPT gene: search for polymorphism, mapping and association studies
USDA-ARS?s Scientific Manuscript database
NAMPT encodes for an enzyme catalysing the rate-limiting step in NAD biosynthesis. The extracellular form of the enzyme is known as adipokine visfatin. We detected SNP AM999341:g.669T>C in intron 9 and SNP FN392209:g.358A>G in the promoter of the gene. RH mapping linked the gene to microsatellite SW...
USDA-ARS?s Scientific Manuscript database
Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor....
Laasik, Eve; Ojarand, Merli; Pajunen, Maria; Savilahti, Harri; Mäe, Andres
2005-02-01
As in Erwinia carotovora subsp. carotovora the regulation details of the main virulence factors, encoding extracellular enzymes that degrade the plant cell wall, is only rudimentally understood, we performed a genetic screen to identify novel candidate genes involved in the process. Initially, we used Mu transpososome-mediated mutagenesis approach to generate a comprehensive transposon insertion mutant library of ca. 10000 clones and screened the clones for the loss of extracellular enzyme production. Extracellular enzymes production was abolished by mutations in the chromosomal helEcc, trkAEcc yheLEcc, glsEcc, igaAEcc and cysQEcc genes. The findings reported here demonstrate that we have isolated six new representatives that belong to the pool of genes modulating the production of virulence factors in E. carotovora.
Kantyka, Tomasz; Rawlings, Neil D.; Potempa, Jan
2010-01-01
In metazoan organisms protein inhibitors of peptidases are important factors essential for regulation of proteolytic activity. In vertebrates genes encoding peptidase inhibitors constitute up to 1% of genes reflecting a need for tight and specific control of proteolysis especially in extracellular body fluids. In stark contrast unicellular organisms, both prokaryotic and eukaryotic consistently contain only few, if any, genes coding for putative peptidase inhibitors. This may seem perplexing in the light of the fact that these organisms produce large numbers of proteases of different catalytic classes with the genes constituting up to 6% of the total gene count with the average being about 3%. Apparently, however, a unicellular life-style is fully compatible with other mechanisms of regulation of proteolysis and does not require protein inhibitors to control their intracellular and extracellular proteolytic activity. So in prokaryotes occurrence of genes encoding different types of peptidase inhibitors is infrequent and often scattered among phylogenetically distinct orders or even phyla of microbiota. Genes encoding proteins homologous to alpha-2-macroglobulin (family I39), serine carboxypeptidase Y inhibitor (family I51), alpha-1-peptidase inhibitor (family I4) and ecotin (family I11) are the most frequently represented in Bacteria. Although several of these gene products were shown to possess inhibitory activity, with an exception of ecotin and staphostatins, the biological function of microbial inhibitors is unclear. In this review we present distribution of protein inhibitors from different families among prokaryotes, describe their mode of action and hypothesize on their role in microbial physiology and interactions with hosts and environment. PMID:20558234
Tang, Hongliang; Li, Xiaoqing; Zu, Chao; Zhang, Fusuo; Shen, Jianbo
2013-09-15
Acid phosphatases (APases) play a key role in phosphorus (P) acquisition and recycling in plants. White lupin (Lupinus albus L.) forms cluster roots (CRs) and produces large amounts of APases under P deficiency. However, the relationships between the activity of intracellular and extracellular APases (EC 3.1.3.2) and CR development are not fully understood. Here, comparative studies were conducted to examine the spatial variation pattern of APase activity during CR development using the enzyme-labelled fluorescence-97 (ELF-97) and the p-nitrophenyl phosphate methods. The activity of intracellular and extracellular APases was significantly enhanced under P deficiency in the non-CRs and CRs at different developmental stages. These two APases exhibited different spatial distribution patterns during CR development, and these distribution patterns were highly modified by P deficiency. The activity of extracellular APase increased steadily with CR development from meristematic, juvenile, mature to senescent stages under P deficiency. In comparison, P deficiency-induced increase in the activity of intracellular APase remained relatively constant during CR development. Increased activity of intracellular and extracellular APases was associated with enhanced expression of LaSAP1 encoding intracellular APase and LaSAP2 encoding extracellular APase. The expression levels of these two genes were significantly higher at transcriptional level in both mature and senescent CRs. Taken together, these findings demonstrate that both activity and gene expression of intracellular or extracellular APases exhibit a differential response pattern during CR development, depending on root types, CR developmental stages and P supply. Simultaneous in situ determination of intracellular and extracellular APase activity has proved to be an effective approach for studying spatial variation of APases during CR development. Copyright © 2013 Elsevier GmbH. All rights reserved.
Molecular genetics of Erwinia amylovora involved in the development of fire blight.
Oh, Chang-Sik; Beer, Steven V
2005-12-15
The bacterial plant pathogen, Erwinia amylovora, causes the devastating disease known as fire blight in some Rosaceous plants like apple, pear, quince, raspberry and several ornamentals. Knowledge of the factors affecting the development of fire blight has mushroomed in the last quarter century. On the molecular level, genes encoding a Hrp type III secretion system, genes encoding enzymes involved in synthesis of extracellular polysaccharides and genes facilitating the growth of E. amylovora in its host plants have been characterized. The Hrp pathogenicity island, delimited by genes suggesting horizontal gene transfer, is composed of four distinct regions, the hrp/hrc region, the HEE (Hrp effectors and elicitors) region, the HAE (Hrp-associated enzymes) region, and the IT (Island transfer) region. The Hrp pathogenicity island encodes a Hrp type III secretion system (TTSS), which delivers several proteins from bacteria to plant apoplasts or cytoplasm. E. amylovora produces two exopolysaccharides, amylovoran and levan, which cause the characteristic fire blight wilting symptom in host plants. In addition, other genes, and their encoded proteins, have been characterized as virulence factors of E. amylovora that encode enzymes facilitating sorbitol metabolism, proteolytic activity and iron harvesting. This review summarizes our understanding of the genes and gene products of E. amylovora that are involved in the development of the fire blight disease.
Sawhney, Neha
2014-01-01
Methylglucuronoarabinoxylan (MeGAXn) from agricultural residues and energy crops is a significant yet underutilized biomass resource for production of biofuels and chemicals. Mild thermochemical pretreatment of bagasse yields MeGAXn requiring saccharifying enzymes for conversion to fermentable sugars. A xylanolytic bacterium, Paenibacillus sp. strain JDR-2, produces an extracellular cell-associated GH10 endoxylanse (XynA1) which efficiently depolymerizes methylglucuronoxylan (MeGXn) from hardwoods coupled with assimilation of oligosaccharides for further processing by intracellular GH67 α-glucuronidase, GH10 endoxylanase, and GH43 β-xylosidase. This process has been ascribed to genes that comprise a xylan utilization regulon that encodes XynA1 and includes a gene cluster encoding transcriptional regulators, ABC transporters, and intracellular enzymes that convert assimilated oligosaccharides to fermentable sugars. Here we show that Paenibacillus sp. JDR-2 utilized MeGAXn without accumulation of oligosaccharides in the medium. The Paenibacillus sp. JDR-2 growth rate on MeGAXn was 3.1-fold greater than that on oligosaccharides generated from MeGAXn by XynA1. Candidate genes encoding GH51 arabinofuranosidases with potential roles were identified. Following growth on MeGAXn, quantitative reverse transcription-PCR identified a cluster of genes encoding a GH51 arabinofuranosidase (AbfB) and transcriptional regulators which were coordinately expressed along with the genes comprising the xylan utilization regulon. The action of XynA1 on MeGAXn generated arabinoxylobiose, arabinoxylotriose, xylobiose, xylotriose, and methylglucuronoxylotriose. Recombinant AbfB processed arabinoxylooligosaccharides to xylooligosaccharides and arabinose. MeGAXn processing by Paenibacillus sp. JDR-2 may be achieved by extracellular depolymerization by XynA1 coupled to assimilation of oligosaccharides and further processing by intracellular enzymes, including AbfB. Paenibacillus sp. JDR-2 provides a GH10/GH67 system complemented with genes encoding intracellular GH51 arabinofuranosidases for efficient utilization of MeGAXn. PMID:25063665
Han, Jisu; Jin, Wook; Ho, Ngoc Anh; Hong, Jeongpyo; Kim, Yoon Ju; Shin, Yungyeong; Lee, Hanki; Suh, Joo-Won
2018-05-23
The coumarins decursin and decursinol angelate, which are found in Angelica gigas Nakai, have a variety of biological functions. Here, we show that treatment with these compounds improves wound healing by HaCaT human keratinocytes. Wound healing was increased by treatment with up to a threshold concentration of decursin, decursinol angelate, a mixture of both, and a nano-emulsion of these compounds, but inhibited by treatment with higher concentrations. Immunoblotting and fluorescence imaging of cells expressing an epidermal growth factor receptor (EGFR) biosensor demonstrated that these compounds did not stimulate wound healing by inducing EGFR phosphorylation. Rather, transcriptional analysis revealed that decursin and decursinol angelate improved wound healing by upregulating the expression of genes encoding extracellular matrix remodeling proteins, inflammatory cytokines, and growth factors. Copyright © 2018 Elsevier Inc. All rights reserved.
Desfougères, Thomas; Haddouche, Ramdane; Fudalej, Franck; Neuvéglise, Cécile; Nicaud, Jean-Marc
2010-02-01
The oleaginous yeast Yarrowia lipolytica efficiently metabolizes hydrophobic substrates such as alkanes, fatty acids or triacylglycerol. This yeast has been identified in oil-polluted water and in lipid-rich food. The enzymes involved in lipid breakdown, for use as a carbon source, are known, but the molecular mechanisms controlling the expression of the genes encoding these enzymes are still poorly understood. The study of mRNAs obtained from cells grown on oleic acid identified a new group of genes called SOA genes (specific for oleic acid). SOA1 and SOA2 are two small genes coding for proteins with no known homologs. Single- and double-disrupted strains were constructed. Wild-type and mutant strains were grown on dextrose, oleic acid and triacylglycerols. The double mutant presents a clear phenotype consisting of a growth defect on tributyrin and triolein, but not on dextrose or oleic acid media. Lipase activity was 50-fold lower in this mutant than in the wild-type strain. The impact of SOA deletion on the expression of the main extracellular lipase gene (LIP2) was monitored using a LIP2-beta-galactosidase promoter fusion protein. These data suggest that Soa proteins are components of a molecular mechanism controlling lipase gene expression in response to extracellular triacylglycerol.
Lara-Diaz, V J; Castilla-Cortazar, I; Martín-Estal, I; García-Magariño, M; Aguirre, G A; Puche, J E; de la Garza, R G; Morales, L A; Muñoz, U
2017-05-01
Even though the liver synthesizes most of circulating IGF-1, it lacks its receptor under physiological conditions. However, according to previous studies, a damaged liver expresses the receptor. For this reason, herein, we examine hepatic histology and expression of genes encoding proteins of the cytoskeleton, extracellular matrix, and cell-cell molecules and inflammation-related proteins. A partial IGF-1 deficiency murine model was used to investigate IGF-1's effects on liver by comparing wild-type controls, heterozygous igf1 +/- , and heterozygous mice treated with IGF-1 for 10 days. Histology, microarray for mRNA gene expression, RT-qPCR, and lipid peroxidation were assessed. Microarray analyses revealed significant underexpression of igf1 in heterozygous mice compared to control mice, restoring normal liver expression after treatment, which then normalized its circulating levels. IGF-1 receptor mRNA was overexpressed in Hz mice liver, while treated mice displayed a similar expression to that of the controls. Heterozygous mice showed overexpression of several genes encoding proteins related to inflammatory and acute-phase proteins and underexpression or overexpression of genes which coded for extracellular matrix, cytoskeleton, and cell junction components. Histology revealed an altered hepatic architecture. In addition, liver oxidative damage was found increased in the heterozygous group. The mere IGF-1 partial deficiency is associated with relevant alterations of the hepatic architecture and expression of genes involved in cytoskeleton, hepatocyte polarity, cell junctions, and extracellular matrix proteins. Moreover, it induces hepatic expression of the IGF-1 receptor and elevated acute-phase and inflammation mediators, which all resulted in liver oxidative damage.
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Nong, Guang; Rice, John D; Chow, Virginia; Preston, James F
2009-07-01
Paenibacillus sp. strain JDR-2, an aggressively xylanolytic bacterium isolated from decaying sweet gum wood, secretes a multimodular glycohydrolase family GH10 endoxylanase (XynA1) anchored to the cell surface. The gene encoding XynA1 is part of a xylan utilization regulon that includes an aldouronate utilization gene cluster with genes encoding a GH67 alpha-glucuronidase (AguA), a GH10 endoxylanase (XynA2), and a GH43 arabinofuranosidase/beta-xylosidase (XynB). Here we show that this Paenibacillus sp. strain is able to utilize methylglucuronoxylose (MeGAX(1)), an aldobiuronate product that accumulates during acid pretreatment of lignocellulosic biomass, and methylglucuronoxylotriose (MeGAX(3)), the product of the extracellular XynA1 acting on methylglucuronoxylan (MeGAX(n)). The average rates of utilization of MeGAX(n), MeGAX(1), and MeGAX(3) were 149.8, 59.4, and 54.3 microg xylose equivalents.ml(-1).h(-1), respectively, and were proportional to the specific growth rates on the substrates. AguA was active with MeGAX(1) and MeGAX(3), releasing 4-O-methyl-d-glucuronate alpha-1,2 linked to a nonreducing terminal xylose residue. XynA2 converted xylotriose, generated by the action of AguA on MeGAX(3), to xylose and xylobiose. The ability to utilize MeGAX(1) provides a novel metabolic potential for bioconversion of acid hydrolysates of lignocellulosics. The 2.8-fold-greater rate of utilization of polymeric MeGAX(n) than that of MeGAX(3) indicates that there is coupling of extracellular depolymerization, assimilation, and intracellular metabolism, allowing utilization of lignocellulosics with minimal pretreatment. Along with adjacent genes encoding transcriptional regulators and ABC transporter proteins, the aguA and xynA2 genes in the cluster described above contribute to the efficient utilization of aldouronates derived from dilute acid and/or enzyme pretreatment protocols applied to the conversion of hemicellulose to biofuels and chemicals.
Nucleases from Prevotella intermedia can degrade neutrophil extracellular traps.
Doke, M; Fukamachi, H; Morisaki, H; Arimoto, T; Kataoka, H; Kuwata, H
2017-08-01
Periodontitis is an inflammatory disease caused by periodontal bacteria in subgingival plaque. These bacteria are able to colonize the periodontal region by evading the host immune response. Neutrophils, the host's first line of defense against infection, use various strategies to kill invading pathogens, including neutrophil extracellular traps (NETs). These are extracellular net-like fibers comprising DNA and antimicrobial components such as histones, LL-37, defensins, myeloperoxidase, and neutrophil elastase from neutrophils that disarm and kill bacteria extracellularly. Bacterial nuclease degrades the NETs to escape NET killing. It has now been shown that extracellular nucleases enable bacteria to evade this host antimicrobial mechanism, leading to increased pathogenicity. Here, we compared the DNA degradation activity of major Gram-negative periodontopathogenic bacteria, Porphyromonas gingivalis, Prevotella intermedia, Fusobacterium nucleatum, and Aggregatibacter actinomycetemcomitans. We found that Pr. intermedia showed the highest DNA degradation activity. A genome search of Pr. intermedia revealed the presence of two genes, nucA and nucD, putatively encoding secreted nucleases, although their enzymatic and biological activities are unknown. We cloned nucA- and nucD-encoding nucleases from Pr. intermedia ATCC 25611 and characterized their gene products. Recombinant NucA and NucD digested DNA and RNA, which required both Mg 2+ and Ca 2+ for optimal activity. In addition, NucA and NucD were able to degrade the DNA matrix comprising NETs. © 2016 The Authors Molecular Oral Microbiology Published by John Wiley & Sons Ltd.
Matsunaga, James; Medeiros, Marco A; Sanchez, Yolanda; Werneid, Kristian F; Ko, Albert I
2007-10-01
The life cycle of the pathogen Leptospira interrogans involves stages outside and inside the host. Entry of L. interrogans from moist environments into the host is likely to be accompanied by the induction of genes encoding virulence determinants and the concomitant repression of genes encoding products required for survival outside of the host. The expression of the adhesin LigA, the haemolysin Sph2 (Lk73.5) and the outer-membrane lipoprotein LipL36 of pathogenic Leptospira species have been reported to be regulated by mammalian host signals. A previous study demonstrated that raising the osmolarity of the leptospiral growth medium to physiological levels encountered in the host by addition of various salts enhanced the levels of cell-associated LigA and LigB and extracellular LigA. In this study, we systematically examined the effects of osmotic upshift with ionic and non-ionic solutes on expression of the known mammalian host-regulated leptospiral genes. The levels of cell-associated LigA, LigB and Sph2 increased at physiological osmolarity, whereas LipL36 levels decreased, corresponding to changes in specific transcript levels. These changes in expression occurred irrespective of whether sodium chloride or sucrose was used as the solute. The increase of cellular LigA, LigB and Sph2 protein levels occurred within hours of adding sodium chloride. Extracellular Sph2 levels increased when either sodium chloride or sucrose was added to achieve physiological osmolarity. In contrast, enhanced levels of extracellular LigA were observed only with an increase in ionic strength. These results indicate that the mechanisms for release of LigA and Sph2 differ during host infection. Thus, osmolarity not only affects leptospiral gene expression by affecting transcript levels of putative virulence determinants but also affects the release of such proteins into the surroundings.
Cloning and expression analysis of FaPR-1 gene in strawberry
NASA Astrophysics Data System (ADS)
Mo, Fan; Luo, Ya; Ge, Cong; Mo, Qin; Ling, Yajie; Luo, Shu; Tang, Haoru
2018-04-01
The FaPR-1 gene was cloned by RT-PCR from `Benihoppe' strawberry and its bioinformatics analysis was conducted. The results showed that the open reading frame was 483 bp encoding encoding l60 amino acids which protein molecular weight and theoretical isoelectricity were 17854.17 and 8.72 respectively. Subcellular localization prediction shows that this gene is located extracellularly. By comparing strawberry FaPR-l and other plant Pathogenesis-related protein, homology and phylogenetic tree construction showed that the homology with grapes, peach is relatively close. In the treatments of ABA, sucrose and the mixture of the two, the expression of FaPR-1 in strawberry fruit were significantly increased.
Genomic analyses of bacterial porin-cytochrome gene clusters
Shi, Liang; Fredrickson, James K.; Zachara, John M.
2014-11-26
In this study, the porin-cytochrome (Pcc) protein complex is responsible for trans-outer membrane electron transfer during extracellular reduction of Fe(III) by the dissimilatory metal-reducing bacterium Geobacter sulfurreducens PCA. The identified and characterized Pcc complex of G. sulfurreducens PCA consists of a porin-like outer-membrane protein, a periplasmic 8-heme c type cytochrome (c-Cyt) and an outer-membrane 12-heme c-Cyt, and the genes encoding the Pcc proteins are clustered in the same regions of genome (i.e., the pcc gene clusters) of G. sulfurreducens PCA. A survey of additionally microbial genomes has identified the pcc gene clusters in all sequenced Geobacter spp. and other bacteriamore » from six different phyla, including Anaeromyxobacter dehalogenans 2CP-1, A. dehalogenans 2CP-C, Anaeromyxobacter sp. K, Candidatus Kuenenia stuttgartiensis, Denitrovibrio acetiphilus DSM 12809, Desulfurispirillum indicum S5, Desulfurivibrio alkaliphilus AHT2, Desulfurobacterium thermolithotrophum DSM 11699, Desulfuromonas acetoxidans DSM 684, Ignavibacterium album JCM 16511, and Thermovibrio ammonificans HB-1. The numbers of genes in the pcc gene clusters vary, ranging from two to nine. Similar to the metal-reducing (Mtr) gene clusters of other Fe(III)-reducing bacteria, such as Shewanella spp., additional genes that encode putative c-Cyts with predicted cellular localizations at the cytoplasmic membrane, periplasm and outer membrane often associate with the pcc gene clusters. This suggests that the Pcc-associated c-Cyts may be part of the pathways for extracellular electron transfer reactions. The presence of pcc gene clusters in the microorganisms that do not reduce solid-phase Fe(III) and Mn(IV) oxides, such as D. alkaliphilus AHT2 and I. album JCM 16511, also suggests that some of the pcc gene clusters may be involved in extracellular electron transfer reactions with the substrates other than Fe(III) and Mn(IV) oxides.« less
Lessons on the pathogenesis of aneurysm from heritable conditions
Lindsay, Mark E.; Dietz, Harry C.
2013-01-01
Aortic aneurysm is common, accounting for 1–2% of all deaths in industrialized countries. Early theories of the causes of human aneurysm mostly focused on inherited or acquired defects in components of the extracellular matrix in the aorta. Although several mutations in the genes encoding extracellular matrix proteins have been recognized, more recent discoveries have shown important perturbations in cytokine signalling cascades and intracellular components of the smooth muscle contractile apparatus. The modelling of single-gene heritable aneurysm disorders in mice has shown unexpected involvement of the transforming growth factor-β cytokine pathway in aortic aneurysm, highlighting the potential for new therapeutic strategies. PMID:21593863
Capsule Production and Glucose Metabolism Dictate Fitness during Serratia marcescens Bacteremia.
Anderson, Mark T; Mitchell, Lindsay A; Zhao, Lili; Mobley, Harry L T
2017-05-23
Serratia marcescens is an opportunistic pathogen that causes a range of human infections, including bacteremia, keratitis, wound infections, and urinary tract infections. Compared to other members of the Enterobacteriaceae family, the genetic factors that facilitate Serratia proliferation within the mammalian host are less well defined. An in vivo screen of transposon insertion mutants identified 212 S. marcescens fitness genes that contribute to bacterial survival in a murine model of bloodstream infection. Among those identified, 11 genes were located within an 18-gene cluster encoding predicted extracellular polysaccharide biosynthesis proteins. A mutation in the wzx gene contained within this locus conferred a loss of fitness in competition infections with the wild-type strain and a reduction in extracellular uronic acids correlating with capsule loss. A second gene, pgm , encoding a phosphoglucomutase exhibited similar capsule-deficient phenotypes, linking central glucose metabolism with capsule production and fitness of Serratia during mammalian infection. Further evidence of the importance of central metabolism was obtained with a pfkA glycolytic mutant that demonstrated reduced replication in human serum and during murine infection. An MgtB magnesium transporter homolog was also among the fitness factors identified, and an S. marcescens mgtB mutant exhibited decreased growth in defined medium containing low concentrations of magnesium and was outcompeted ~10-fold by wild-type bacteria in mice. Together, these newly identified genes provide a more complete understanding of the specific requirements for S. marcescens survival in the mammalian host and provide a framework for further investigation of the means by which S. marcescens causes opportunistic infections. IMPORTANCE Serratia marcescens is a remarkably prolific organism that replicates in diverse environments, including as an opportunistic pathogen in human bacteremia. The genetic requirements for S. marcescens survival in the mammalian bloodstream were defined in this work by transposon insertion sequencing. In total, 212 genes that contribute to bacterial fitness were identified. When sorted via biological function, two of the major fitness categories identified herein were genes encoding capsule polysaccharide biogenesis functions and genes involved in glucose utilization. Further investigation determined that certain glucose metabolism fitness genes are also important for the generation of extracellular polysaccharides. Together, these results identify critical biological processes that allow S. marcescens to colonize the mammalian bloodstream. Copyright © 2017 Anderson et al.
Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R
1992-01-01
The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011
Galdino, Alexsandro S; Ulhoa, Cirano J; Moraes, Lídia Maria P; Prates, Maura V; Bloch, Carlos; Torres, Fernando A G
2008-03-01
A Cryptococcus flavus gene (AMY1) encoding an extracellular alpha-amylase has been cloned. The nucleotide sequence of the cDNA revealed an ORF of 1896 bp encoding for a 631 amino acid polypeptide with high sequence identity with a homologous protein isolated from Cryptococcus sp. S-2. The presence of four conserved signature regions, (I) (144)DVVVNH(149), (II) (235)GLRIDSLQQ(243), (III) (263)GEVFN(267), (IV) (327)FLENQD(332), placed the enzyme in the GH13 alpha-amylase family. Furthermore, sequence comparison suggests that the C. flavusalpha-amylase has a C-terminal starch-binding domain characteristic of the CBM20 family. AMY1 was successfully expressed in Saccharomyces cerevisiae. The time course of amylase secretion in S. cerevisiae resulted in a maximal extracellular amylolytic activity (3.93 U mL(-1)) at 60 h of incubation. The recombinant protein had an apparent molecular mass similar to the native enzyme (c. 67 kDa), part of which was due to N-glycosylation.
Autolytic hydrolases affect sexual and asexual development of Aspergillus nidulans.
Emri, Tamás; Vékony, Viktória; Gila, Barnabás; Nagy, Flóra; Forgács, Katalin; Pócsi, István
2018-03-30
Radial growth, asexual sporulation, and cleistothecia formation as well as extracellular chitinase and proteinase formation of Aspergillus nidulans were monitored in surface cultures in order to study the physiological role of extracellular hydrolase production in carbon-stressed cultures. We set up carbon-stressed and carbon-overfed experimental conditions by varying the starting glucose concentration within the range of 2.5 and 40 g/L. Glucose starvation induced radial growth and hydrolase production and enhanced the maturation of cleistothecia; meanwhile, glucose-rich conditions enhanced mycelial biomass, conidia, and cleistothecia production. Double deletion of chiB and engA (encoding an extracellular endochitinase and a β-1,3-endoglucanase, respectively) decreased conidia production under carbon-stressed conditions, suggesting that these autolytic hydrolases can support conidia formation by releasing nutrients from the cell wall polysaccharides of dead hyphae. Double deletion of prtA and pepJ (both genes encode extracellular proteases) reduced the number of cleistothecia even under carbon-rich conditions except in the presence of casamino acids, which supports the view that sexual development and amino acid metabolism are tightly connected to each other in this fungus.
Inoue, Kotomi; Takahashi, Yui; Obara, Ken; Murakami, Shuichiro
2017-03-01
Cell wall-associated β-xylosidase was isolated from Aspergillus niger E-1 and identified as XlsIV, corresponding to the extracellular enzyme XlnD reported previously. xlsIV was transcribed only in the early cultivation period. Cell wall-associated enzyme activity gradually decreased, but extracellular activity increased as the strain grew. These results indicate that XlsIV (XlnD) was secreted into culture after localizing at cell wall.
Tanaka, T; Kawata, M
1988-08-01
We have isolated a DNA fragment from Bacillus subtilis 168 which, when present in a high-copy plasmid, inhibited production of extracellular alkaline and neutral proteases. The gene responsible for this activity was referred to as iep. The open reading frame of iep was found to be incomplete in the cloned DNA fragment. When the intact iep gene was reconstructed after the missing part of the iep gene had been cloned, it showed an enhancing effect on the production of the extracellular proteases. The open reading frame encodes a polypeptide of 229 amino acids with a molecular weight of ca. 25,866. Deletion of two amino acids from the N-terminal half of the putative iep protein resulted in dual effects, i.e., a decrease in the inhibitory activity shown by the incomplete iep gene and a slight increase in the enhancing activity shown by the complete iep gene. These results show that the iep gene product is a bifunctional protein, containing inhibitory and enhancing activities for the exoprotease production in the N-terminal and C-terminal regions, respectively. It was found by genetic and functional analyses that iep lies very close to sacU.
Structural Heterogeneity and Functional Domains of Murine Immunoglobulin G Fc Receptors
NASA Astrophysics Data System (ADS)
Ravetch, Jeffrey V.; Luster, Andrew D.; Weinshank, Richard; Kochan, Jarema; Pavlovec, Amalia; Portnoy, Daniel A.; Hulmes, Jeffrey; Pan, Yu-Ching E.; Unkeless, Jay C.
1986-11-01
Binding of antibodies to effector cells by way of receptors to their constant regions (Fc receptors) is central to the pathway that leads to clearance of antigens by the immune system. The structure and function of this important class of receptors on immune cells is addressed through the molecular characterization of Fc receptors (FcR) specific for the murine immunoglobulin G isotype. Structural diversity is encoded by two genes that by alternative splicing result in expression of molecules with highly conserved extracellular domains and different transmembrane and intracytoplasmic domains. The proteins encoded by these genes are members of the immunoglobulin supergene family, most homologous to the major histocompatibility complex molecule Eβ. Functional reconstitution of ligand binding by transfection of individual FcR genes demonstrates that the requirements for ligand binding are encoded in a single gene. These studies demonstrate the molecular basis for the functional heterogeneity of FcR's, accounting for the possible transduction of different signals in response to a single ligand.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Norton, Jeanette M.; Klotz, Martin G; Stein, Lisa Y
2008-01-01
The complete genome of the ammonia-oxidizing bacterium, Nitrosospira multiformis (ATCC 25196T), consists of a circular chromosome and three small plasmids totaling 3,234,309 bp and encoding 2827 putative proteins. Of these, 2026 proteins have predicted functions and 801 are without conserved functional domains, yet 747 of these have similarity to other predicted proteins in databases. Gene homologs from Nitrosomonas europaea and N. eutropha were the best match for 42% of the predicted genes in N. multiformis. The genome contains three nearly identical copies of amo and hao gene clusters as large repeats. Distinguishing features compared to N. europaea include: the presencemore » of gene clusters encoding urease and hydrogenase, a RuBisCO-encoding operon of distinctive structure and phylogeny, and a relatively small complement of genes related to Fe acquisition. Systems for synthesis of a pyoverdine-like siderophore and for acyl-homoserine lactone were unique to N. multiformis among the sequenced AOB genomes. Gene clusters encoding proteins associated with outer membrane and cell envelope functions including transporters, porins, exopolysaccharide synthesis, capsule formation and protein sorting/export were abundant. Numerous sensory transduction and response regulator gene systems directed towards sensing of the extracellular environment are described. Gene clusters for glycogen, polyphosphate and cyanophycin storage and utilization were identified providing mechanisms for meeting energy requirements under substrate-limited conditions. The genome of N. multiformis encodes the core pathways for chemolithoautotrophy along with adaptations for surface growth and survival in soil environments.« less
The candidate histocompatibility locus of a Basal chordate encodes two highly polymorphic proteins.
Nydam, Marie L; Netuschil, Nikolai; Sanders, Erin; Langenbacher, Adam; Lewis, Daniel D; Taketa, Daryl A; Marimuthu, Arumugapradeep; Gracey, Andrew Y; De Tomaso, Anthony W
2013-01-01
The basal chordate Botryllus schlosseri undergoes a natural transplantation reaction governed by a single, highly polymorphic locus called the fuhc. Our initial characterization of this locus suggested it encoded a single gene alternatively spliced into two transcripts: a 555 amino acid-secreted form containing the first half of the gene, and a full-length, 1008 amino acid transmembrane form, with polymorphisms throughout the ectodomain determining outcome. We have now found that the locus encodes two highly polymorphic genes which are separated by a 227 bp intergenic region: first, the secreted form as previously described, and a second gene encoding a 531 amino acid membrane-bound gene containing three extracellular immunoglobulin domains. While northern blotting revealed only these two mRNAs, both PCR and mRNA-seq detect a single capped and polyadenylated transcript that encodes processed forms of both genes linked by the intergenic region, as well as other transcripts in which exons of the two genes are spliced together. These results might suggest that the two genes are expressed as an operon, during which both genes are co-transcribed and then trans-spliced into two separate messages. This type of transcriptional regulation has been described in tunicates previously; however, the membrane-bound gene does not encode a typical Splice Leader (SL) sequence at the 5' terminus that usually accompanies trans-splicing. Thus, the presence of stable transcripts encoding both genes may suggest a novel mechanism of regulation, or conversely may be rare but stable transcripts in which the two mRNAs are linked due to a small amount of read-through by RNA polymerase. Both genes are highly polymorphic and co-expressed on tissues involved in histocompatibility. In addition, polymorphisms on both genes correlate with outcome, although we have found a case in which it appears that the secreted form may be major allorecognition determinant.
A putative regulatory genetic locus modulates virulence in the pathogen Leptospira interrogans.
Eshghi, Azad; Becam, Jérôme; Lambert, Ambroise; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Wunder, Elsio A; Ko, Albert I; Coppee, Jean-Yves; Goarant, Cyrille; Picardeau, Mathieu
2014-06-01
Limited research has been conducted on the role of transcriptional regulators in relation to virulence in Leptospira interrogans, the etiological agent of leptospirosis. Here, we identify an L. interrogans locus that encodes a sensor protein, an anti-sigma factor antagonist, and two genes encoding proteins of unknown function. Transposon insertion into the gene encoding the sensor protein led to dampened transcription of the other 3 genes in this locus. This lb139 insertion mutant (the lb139(-) mutant) displayed attenuated virulence in the hamster model of infection and reduced motility in vitro. Whole-transcriptome analyses using RNA sequencing revealed the downregulation of 115 genes and the upregulation of 28 genes, with an overrepresentation of gene products functioning in motility and signal transduction and numerous gene products with unknown functions, predicted to be localized to the extracellular space. Another significant finding encompassed suppressed expression of the majority of the genes previously demonstrated to be upregulated at physiological osmolarity, including the sphingomyelinase C precursor Sph2 and LigB. We provide insight into a possible requirement for transcriptional regulation as it relates to leptospiral virulence and suggest various biological processes that are affected due to the loss of native expression of this genetic locus.
Reduced Dermatopontin Expression Is a Molecular Link Between Uterine Leiomyomas and Keloids
Catherino, William H.; Leppert, Phyllis C.; Stenmark, Matthew H.; Payson, Mark; Potlog-Nahari, Clariss; Nieman, Lynnette K.; Segars, James H.
2014-01-01
Uterine leiomyomas are prevalent estrogen-responsive clonal tumors, but the specific genetic alterations that contribute to their development have not been elucidated. To identify genes involved in the formation of leiomyomas, we used global expression profiling to compare clonal tumors with normal myometrium. Contrary to expectation, genes involved in estrogen action were not differentially expressed between leiomyoma and normal myometrium. Genes encoding extracellular-matrix proteins were prominently featured, suggesting their involvement in formation of a myofibroblast phenotype. Analysis of the extracellular matrix in the leiomyomas revealed a disordered collagen fibril orientation. Expression of the collagen-binding protein dermatopontin was found to be consistently decreased in leiomyoma by both reverse transcriptase-polymerase chain reaction (RT-PCR) and real-time RT-PCR (mean underexpression = 9.41-fold) regardless of leiomyoma size, leiomyoma location, patient race, and patient age. This expression pattern was observed in 11 subjects and a total of 23 leiomyoma: myometrium pairs. Decreased expression of dermatopontin was also associated with keloid formation, a fibrotic disease that shares epidemiologic similarities with leiomyoma. Immunohistochemical studies of leiomyomas and keloids demonstrated reduced levels of dermatopontin in both tissues. In addition, ultrastructural analysis revealed that the orientation of the collagen fibrils in the keloid tissues strongly resembled that in the leiomyomas. Reduction in dermatopontin was associated with an increase in transforming growth factor–β3 (TGFB3) mRNA levels in leiomyomas, whereas other genes involved in dermatopontin signaling were not differentially expressed. These findings suggest that leiomyoma development involves a myofibroblast cell phenotype characterized by dysregulation of genes encoding extracellular-matrix proteins. In particular, decreased expression of dermatopontin represents a molecular link between the leiomyoma and keloid phenotypes. PMID:15139000
Wang, Q; Liu, Q; Ma, Y; Rui, H; Zhang, Y
2007-11-01
To characterize the luxO gene in fish pathogen Vibrio alginolyticus MVP01 and investigate its roles in regulation of extracellular products (ECP) and siderophore production. The luxO gene was cloned from V. alginolyticus MVP01. Genetic analysis revealed that it encoded a protein with high similarity to other LuxO homologues. The luxO in-frame deletion mutant and rpoN null mutant were constructed with suicide plasmids. We demonstrated that sole deletion in LuxO increased the secretion of extracellular protease and haemolytic products, but decreased siderophore production for V. alginolyticus MVP01. Mutants with null rpoN displayed significantly enhanced protease level and siderophore production while notable reduction in haemolytic activities of ECP. Vibrio alginolyticus harbours functional luxO gene that regulates the secretion of extracellular protease and haemolytic materials as well as siderophore production in either sigma(54) dependent or independent manners. The current study demonstrated that V. alginolyticus MVP01 produces extracellular protease and haemolytic activity material as well as siderophore, which may be characteristics of the virulence of the strain. Revelations that secretion of these products is under the regulation of LuxO and sigma(54) as well as the potential quorum sensing systems in V. alginolyticus MVP01 will expedite the understanding of vibriosis pathogenesis.
Reid, S D; Green, N M; Buss, J K; Lei, B; Musser, J M
2001-06-19
Species of pathogenic microbes are composed of an array of evolutionarily distinct chromosomal genotypes characterized by diversity in gene content and sequence (allelic variation). The occurrence of substantial genetic diversity has hindered progress in developing a comprehensive understanding of the molecular basis of virulence and new therapeutics such as vaccines. To provide new information that bears on these issues, 11 genes encoding extracellular proteins in the human bacterial pathogen group A Streptococcus identified by analysis of four genomes were studied. Eight of the 11 genes encode proteins with a LPXTG(L) motif that covalently links Gram-positive virulence factors to the bacterial cell surface. Sequence analysis of the 11 genes in 37 geographically and phylogenetically diverse group A Streptococcus strains cultured from patients with different infection types found that recent horizontal gene transfer has contributed substantially to chromosomal diversity. Regions of the inferred proteins likely to interact with the host were identified by molecular population genetic analysis, and Western immunoblot analysis with sera from infected patients confirmed that they were antigenic. Real-time reverse transcriptase-PCR (TaqMan) assays found that transcription of six of the 11 genes was substantially up-regulated in the stationary phase. In addition, transcription of many genes was influenced by the covR and mga trans-acting gene regulatory loci. Multilocus investigation of putative virulence genes by the integrated approach described herein provides an important strategy to aid microbial pathogenesis research and rapidly identify new targets for therapeutics research.
Sloma, A; Rufo, G A; Theriault, K A; Dwyer, M; Wilson, S W; Pero, J
1991-11-01
We have purified a minor extracellular serine protease from a strain of Bacillus subtilis bearing null mutations in five extracellular protease genes: apr, npr, epr, bpr, and mpr (A. Sloma, C. Rudolph, G. Rufo, Jr., B. Sullivan, K. Theriault, D. Ally, and J. Pero, J. Bacteriol. 172:1024-1029, 1990). During purification, this novel protease (Vpr) was found bound in a complex in the void volume after gel filtration chromatography. The amino-terminal sequence of the purified protein was determined, and an oligonucleotide probe was constructed on the basis of the amino acid sequence. This probe was used to clone the structural gene (vpr) for this protease. The gene encodes a primary product of 806 amino acids. The amino acid sequence of the mature protein was preceded by a signal sequence of approximately 28 amino acids and a prosequence of approximately 132 amino acids. The mature protein has a predicted molecular weight of 68,197; however, the isolated protein has an apparent molecular weight of 28,500, suggesting that Vpr undergoes C-terminal processing or proteolysis. The vpr gene maps in the ctrA-sacA-epr region of the chromosome and is not required for growth or sporulation.
Root Border Cells and Their Role in Plant Defense.
Hawes, Martha; Allen, Caitilyn; Turgeon, B Gillian; Curlango-Rivera, Gilberto; Minh Tran, Tuan; Huskey, David A; Xiong, Zhongguo
2016-08-04
Root border cells separate from plant root tips and disperse into the soil environment. In most species, each root tip can produce thousands of metabolically active cells daily, with specialized patterns of gene expression. Their function has been an enduring mystery. Recent studies suggest that border cells operate in a manner similar to mammalian neutrophils: Both cell types export a complex of extracellular DNA (exDNA) and antimicrobial proteins that neutralize threats by trapping pathogens and thereby preventing invasion of host tissues. Extracellular DNases (exDNases) of pathogens promote virulence and systemic spread of the microbes. In plants, adding DNase I to root tips eliminates border cell extracellular traps and abolishes root tip resistance to infection. Mutation of genes encoding exDNase activity in plant-pathogenic bacteria (Ralstonia solanacearum) and fungi (Cochliobolus heterostrophus) results in reduced virulence. The study of exDNase activities in plant pathogens may yield new targets for disease control.
Nong, Guang; Rice, John D.; Chow, Virginia; Preston, James F.
2009-01-01
Paenibacillus sp. strain JDR-2, an aggressively xylanolytic bacterium isolated from decaying sweet gum wood, secretes a multimodular glycohydrolase family GH10 endoxylanase (XynA1) anchored to the cell surface. The gene encoding XynA1 is part of a xylan utilization regulon that includes an aldouronate utilization gene cluster with genes encoding a GH67 α-glucuronidase (AguA), a GH10 endoxylanase (XynA2), and a GH43 arabinofuranosidase/β-xylosidase (XynB). Here we show that this Paenibacillus sp. strain is able to utilize methylglucuronoxylose (MeGAX1), an aldobiuronate product that accumulates during acid pretreatment of lignocellulosic biomass, and methylglucuronoxylotriose (MeGAX3), the product of the extracellular XynA1 acting on methylglucuronoxylan (MeGAXn). The average rates of utilization of MeGAXn, MeGAX1, and MeGAX3 were 149.8, 59.4, and 54.3 μg xylose equivalents·ml−1·h−1, respectively, and were proportional to the specific growth rates on the substrates. AguA was active with MeGAX1 and MeGAX3, releasing 4-O-methyl-d-glucuronate α-1,2 linked to a nonreducing terminal xylose residue. XynA2 converted xylotriose, generated by the action of AguA on MeGAX3, to xylose and xylobiose. The ability to utilize MeGAX1 provides a novel metabolic potential for bioconversion of acid hydrolysates of lignocellulosics. The 2.8-fold-greater rate of utilization of polymeric MeGAXn than that of MeGAX3 indicates that there is coupling of extracellular depolymerization, assimilation, and intracellular metabolism, allowing utilization of lignocellulosics with minimal pretreatment. Along with adjacent genes encoding transcriptional regulators and ABC transporter proteins, the aguA and xynA2 genes in the cluster described above contribute to the efficient utilization of aldouronates derived from dilute acid and/or enzyme pretreatment protocols applied to the conversion of hemicellulose to biofuels and chemicals. PMID:19395566
Banks, David J; Porcella, Stephen F; Barbian, Kent D; Beres, Stephen B; Philips, Lauren E; Voyich, Jovanka M; DeLeo, Frank R; Martin, Judith M; Somerville, Greg A; Musser, James M
2004-08-15
We describe the genome sequence of a macrolide-resistant strain (MGAS10394) of serotype M6 group A Streptococcus (GAS). The genome is 1,900,156 bp in length, and 8 prophage-like elements or remnants compose 12.4% of the chromosome. A 8.3-kb prophage remnant encodes the SpeA4 variant of streptococcal pyrogenic exotoxin A. The genome of strain MGAS10394 contains a chimeric genetic element composed of prophage genes and a transposon encoding the mefA gene conferring macrolide resistance. This chimeric element also has a gene encoding a novel surface-exposed protein (designated "R6 protein"), with an LPKTG cell-anchor motif located at the carboxyterminus. Surface expression of this protein was confirmed by flow cytometry. Humans with GAS pharyngitis caused by serotype M6 strains had antibody against the R6 protein present in convalescent, but not acute, serum samples. Our studies add to the theme that GAS prophage-encoded extracellular proteins contribute to host-pathogen interactions in a strain-specific fashion.
Herrera, Elizabeth; del Mar Lorenzo, María; Blasco, Rafael; Isaacs, Stuart N.
1998-01-01
Vaccinia virus has two forms of infectious virions: the intracellular mature virus and the extracellular enveloped virus (EEV). EEV is critical for cell-to-cell and long-range spread of the virus. The B5R open reading frame (ORF) encodes a membrane protein that is essential for EEV formation. Deletion of the B5R ORF results in a dramatic reduction of EEV, and as a consequence, the virus produces small plaques in vitro and is highly attenuated in vivo. The extracellular portion of B5R is composed mainly of four domains that are similar to the short consensus repeats (SCRs) present in complement regulatory proteins. To determine the contribution of these putative SCR domains to EEV formation, we constructed recombinant vaccinia viruses that replaced the wild-type B5R gene with a mutated gene encoding a B5R protein lacking the SCRs. The resulting recombinant viruses produced large plaques, indicating efficient cell-to-cell spread in vitro, and gradient centrifugation of supernatants from infected cells confirmed that EEV was formed. In contrast, phalloidin staining of infected cells showed that the virus lacking the SCR domains was deficient in the induction of thick actin bundles. Thus, the highly conserved SCR domains present in the extracellular portion of the B5R protein are dispensable for EEV formation. This indicates that the B5R protein is a key viral protein with multiple functions in the process of virus envelopment and release. In addition, given the similarity of the extracellular domain to complement control proteins, the B5R protein may be involved in viral evasion from host immune responses. PMID:9420227
Tanaka, T; Kawata, M
1988-01-01
We have isolated a DNA fragment from Bacillus subtilis 168 which, when present in a high-copy plasmid, inhibited production of extracellular alkaline and neutral proteases. The gene responsible for this activity was referred to as iep. The open reading frame of iep was found to be incomplete in the cloned DNA fragment. When the intact iep gene was reconstructed after the missing part of the iep gene had been cloned, it showed an enhancing effect on the production of the extracellular proteases. The open reading frame encodes a polypeptide of 229 amino acids with a molecular weight of ca. 25,866. Deletion of two amino acids from the N-terminal half of the putative iep protein resulted in dual effects, i.e., a decrease in the inhibitory activity shown by the incomplete iep gene and a slight increase in the enhancing activity shown by the complete iep gene. These results show that the iep gene product is a bifunctional protein, containing inhibitory and enhancing activities for the exoprotease production in the N-terminal and C-terminal regions, respectively. It was found by genetic and functional analyses that iep lies very close to sacU. Images PMID:3136143
USDA-ARS?s Scientific Manuscript database
Many glycosylphosphatidylinositol-anchored proteins (GPI-APs) of fungi are membrane enzymes, organization components, and extracellular matrix adhesins. We analyzed eight Aspergillus flavus transcriptomes for the GPI-AP gene family and identified AFLA_040110, AFLA_063860 and AFLA_113120 to be among ...
Yoshino, Miho; Murayama, Somay Y.; Sunaoshi, Katsuhiko; Wajima, Takeaki; Takahashi, Miki; Masaki, Junko; Kurokawa, Iku; Ubukata, Kimiko
2010-01-01
Among nonhemolytic Streptococcus pyogenes (group A streptococcus) strains (n = 9) isolated from patients with pharyngitis or acute otitis media, we identified three deletions in the region from the epf gene, encoding the extracellular matrix binding protein, to the sag operon, mediating streptolysin S production. PMID:20018818
Jiang, Ruifan; Qiu, Yibin; Huang, Weiwei; Zhang, Li; Xue, Feng; Ni, Hao; Mei, Difen; Gao, Jian; Xu, Hong
2018-06-18
Inulo-oligosaccharides (IOSs), a novel food additive and health product, represent a promising alternative to antibiotics. As prebiotics, IOSs can be obtained from inulin by endo-inulinase-mediated hydrolysis. Nonetheless, enzymatic catalysis is not feasible industrially because of the required catalytic conditions and cost. In this study, a 2331-bp optimized gene inuQ (from Pseudomonas mucidolens) encoding endo-inulinase was cloned into shuttle vector PHY300PLK and transfected into Bacillus subtilis WB800-R, with the simultaneous deletion of gene sacC encoding levanase. The maximal IOS yield after hydrolysis of the crude extract of inulin was 67.84 ± 0.72 g/L for a recombinant strain with the signal peptide nprB from alkaline protease and promoter P 43 . The conversion rate reached 75.38%. For the major IOSs, the degree of polymerization was between 3 and 5. This study offers a simple and efficient one-step bioprocess for IOS production from inulin through secretion of an extracellular heterologous endo-inulinase by B. subtilis.
Singh, Sudhir Kumar; Bharati, Akhilendra Pratap; Singh, Neha; Pandey, Praveen; Joshi, Pankaj; Singh, Kavita; Mitra, Kalyan; Gayen, Jiaur R.; Sarkar, Jayanta; Akhtar, Md. Sohail
2014-01-01
Streptococcus equi is the causative agent of the highly contagious disease “strangles” in equines and zoonotic meningitis in human. Spreading of infection in host tissues is thought to be facilitated by the bacterial gene encoded extracellular hyaluronate lyase (HL), which degrades hyaluronan (HA), chondroitin 6-sulfate, and dermatan sulfate of the extracellular matrix). The clinical strain S. equi 4047 however, lacks a functional extracellular HL. The prophages of S. equi and other streptococci encode intracellular HLs which are reported to partially degrade HA and do not cleave any other glycosaminoglycans. The phage HLs are thus thought to play a role limited to the penetration of streptococcal HA capsules, facilitating bacterial lysogenization and not in the bacterial pathogenesis. Here we systematically looked into the structure-function relationship of S. equi 4047 phage HL. Although HA is the preferred substrate, this HL has weak activity toward chondroitin 6-sulfate and dermatan sulfate and can completely degrade all of them. Even though the catalytic triple-stranded β-helix domain of phage HL is functionally independent, its catalytic efficiency and specificity is influenced by the N-terminal domain. The phage HL also interacts with human transmembrane glycoprotein CD44. The above results suggest that the streptococci can use phage HLs to degrade glycosaminoglycans of the extracellular matrix for spreading virulence factors and toxins while utilizing the disaccharides as a nutrient source for proliferation at the site of infection. PMID:25378402
Singh, Sudhir Kumar; Bharati, Akhilendra Pratap; Singh, Neha; Pandey, Praveen; Joshi, Pankaj; Singh, Kavita; Mitra, Kalyan; Gayen, Jiaur R; Sarkar, Jayanta; Akhtar, Md Sohail
2014-12-19
Streptococcus equi is the causative agent of the highly contagious disease "strangles" in equines and zoonotic meningitis in human. Spreading of infection in host tissues is thought to be facilitated by the bacterial gene encoded extracellular hyaluronate lyase (HL), which degrades hyaluronan (HA), chondroitin 6-sulfate, and dermatan sulfate of the extracellular matrix). The clinical strain S. equi 4047 however, lacks a functional extracellular HL. The prophages of S. equi and other streptococci encode intracellular HLs which are reported to partially degrade HA and do not cleave any other glycosaminoglycans. The phage HLs are thus thought to play a role limited to the penetration of streptococcal HA capsules, facilitating bacterial lysogenization and not in the bacterial pathogenesis. Here we systematically looked into the structure-function relationship of S. equi 4047 phage HL. Although HA is the preferred substrate, this HL has weak activity toward chondroitin 6-sulfate and dermatan sulfate and can completely degrade all of them. Even though the catalytic triple-stranded β-helix domain of phage HL is functionally independent, its catalytic efficiency and specificity is influenced by the N-terminal domain. The phage HL also interacts with human transmembrane glycoprotein CD44. The above results suggest that the streptococci can use phage HLs to degrade glycosaminoglycans of the extracellular matrix for spreading virulence factors and toxins while utilizing the disaccharides as a nutrient source for proliferation at the site of infection. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
eap Gene as novel target for specific identification of Staphylococcus aureus.
Hussain, Muzaffar; von Eiff, Christof; Sinha, Bhanu; Joost, Insa; Herrmann, Mathias; Peters, Georg; Becker, Karsten
2008-02-01
The cell surface-associated extracellular adherence protein (Eap) mediates adherence of Staphylococcus aureus to host extracellular matrix components and inhibits inflammation, wound healing, and angiogenesis. A well-characterized collection of S. aureus and non-S. aureus staphylococcal isolates (n = 813) was tested for the presence of the Eap-encoding gene (eap) by PCR to investigate the use of the eap gene as a specific diagnostic tool for identification of S. aureus. Whereas all 597 S. aureus isolates were eap positive, this gene was not detectable in 216 non-S. aureus staphylococcal isolates comprising 47 different species and subspecies of coagulase-negative staphylococci and non-S. aureus coagulase-positive or coagulase-variable staphylococci. Furthermore, non-S. aureus isolates did not express Eap homologs, as verified on the transcriptional and protein levels. Based on these data, the sensitivity and specificity of the newly developed PCR targeting the eap gene were both 100%. Thus, the unique occurrence of Eap in S. aureus offers a promising tool particularly suitable for molecular diagnostics of this pathogen.
Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J.; ...
2016-01-26
Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30–84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surfaceattached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30–84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conductedmore » comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30–84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage- derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30–84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J.
Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30–84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surfaceattached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30–84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conductedmore » comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30–84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage- derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30–84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities.« less
Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J.; Pierson, Leland S.; Pierson, Elizabeth A.
2016-01-01
Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30–84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surface-attached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30–84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conducted comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30–84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage-derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30–84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities. PMID:26812402
Shimada, Nao; Nishio, Keiko; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi
2004-10-01
Dd-STATa is a functional Dictyostelium homologue of metazoan STAT (signal transducers and activators of transcription) proteins, which is activated by cAMP and is thereby translocated into the nuclei of anterior tip cells of the prestalk region of the slug. By using in situ hybridization analyses, we found that the SLF308 cDNA clone, which contains the ecmF gene that encodes a putative extracellular matrix protein and is expressed in the anterior tip cells, was greatly down-regulated in the Dd-STATa-null mutant. Disruption of the ecmF gene, however, resulted in almost no phenotypic change. The absence of any obvious mutant phenotype in the ecmF-null mutant could be due to a redundancy of similar genes. In fact, a search of the Dictyostelium whole genome database demonstrates the existence of an additional 16 homologues, all of which contain a cellulose-binding module. Among these homologues, four genes show Dd-STATa-dependent expression, while the others are Dd-STATa-independent. We discuss the potential role of Dd-STATa in morphogenesis via its effect on the interaction between cellulose and these extracellular matrix family proteins.
Cost, Hoa N.; Noratel, Elizabeth F.; Blumberg, Daphne D.
2013-01-01
The Dictyostelium discoideum ampA gene encodes a multifunctional regulator protein that modulates cell–cell and cell–substrate adhesions and actin polymerization during growth and is necessary for correct cell type specification and patterning during development. Insertional inactivation of the ampA gene results in defects that define two distinct roles for the ampA gene during development. AmpA is necessary in a non-cell autonomous manner to prevent premature expression of a prespore gene marker. It is also necessary in a cell autonomous manner for the anterior like cells, which express the ampA gene, to migrate to the upper cup during culmination. It is also necessary to prevent excessive cell–cell agglutination when cells are developed in a submerged suspension culture. Here, we demonstrate that a supernatant source of AmpA protein, added extracellularly, can prevent the premature mis-expression of the prespore marker. Synthetic oligopeptides are used to identify the domain of the AmpA protein that is important for preventing cells from mis-expressing the prespore gene. We further demonstrate that a factor capable of inducing additional cells to express the prespore gene marker accumulates extracellularly in the absence of AmpA protein. While the secreted AmpA acts extracellularly to suppress prespore gene expression, the effects of AmpA on cell agglutination and on actin polymerization in growing cells are not due to an extracellular role of secreted AmpA protein. Rather, these effects appear to reflect a distinct cell autonomous role of the ampA gene. Finally, we show that secretion of AmpA protein is brought about by elevating the levels of expression of ampA so that the protein accumulates to an excessive level. PMID:23911723
Doi, Hidetaka; Tokura, Yuriko; Mori, Yukiko; Mori, Kenichi; Asakura, Yoko; Usuda, Yoshihiro; Fukuda, Hiroo; Chinen, Akito
2017-02-01
Alginate is a marine non-food-competing polysaccharide that has potential applications in biorefinery. Owing to its large size (molecular weight >300,000 Da), alginate cannot pass through the bacterial cell membrane. Therefore, bacteria that utilize alginate are presumed to have an enzyme that degrades extracellular alginate. Recently, Vibrio algivorus sp. SA2 T was identified as a novel alginate-decomposing and alginate-utilizing species. However, little is known about the mechanism of alginate degradation and metabolism in this species. To address this issue, we screened the V. algivorus genomic DNA library for genes encoding polysaccharide-decomposing enzymes using a novel double-layer plate screening method and identified alyB as a candidate. Most identified alginate-decomposing enzymes (i.e., alginate lyases) must be concentrated and purified before extracellular alginate depolymerization. AlyB of V. algivorus heterologously expressed in Escherichia coli depolymerized extracellular alginate without requiring concentration or purification. We found seven homologues in the V. algivorus genome (alyB, alyD, oalA, oalB, oalC, dehR, and toaA) that are thought to encode enzymes responsible for alginate transport and metabolism. Introducing these genes into E. coli enabled the cells to assimilate soluble alginate depolymerized by V. algivorus AlyB as the sole carbon source. The alginate was bioconverted into L-lysine (43.3 mg/l) in E. coli strain AJIK01. These findings demonstrate a simple and novel screening method for identifying polysaccharide-degrading enzymes in bacteria and provide a simple alginate biocatalyst and fermentation system with potential applications in industrial biorefinery.
Zhang, Zhanquan; Qin, Guozheng; Li, Boqiang; Tian, Shiping
2014-06-01
Pathogenic fungi usually secrete a series of virulence factors to the extracellular environment to facilitate infection. Rab GTPases play a central role in the secretory pathway. To explore the function of Rab/GTPase in filamentous fungi, we knocked out a Rab/GTPase family gene, Bcsas1, in Botrytis cinerea, an aggressive fungal pathogen that infects more than 200 plant species. A detailed analysis was conducted on the virulence and the secretory capability of the mutants. The results indicated that knockout of Bcsas1 inhibited hyphal development and reduced sporulation of B. cinerea on potato dextrose agar plates resulting in reduced virulence on various fruit hosts. Knocking out the Bcsas1 gene led to an accumulation of transport vesicles at the hyphal tip, significantly reduced extracellular protein content, and lowered the activity of polygalacturonase and xylanase in the extracellular medium. However, mutation of Bcsas1 did not affect the expression of genes encoding polygalacturonase and xylanase, suggesting the secretion of these two family enzymes was suppressed in the mutant. Moreover, a comparative analysis of the secretome provided further evidence that the disruption of Bcsas1 in mutant strains significantly depressed the secretion of polysaccharide hydrolases and proteases. The results indicate that Bcsas1, the Rab8/SEC4-like gene, plays a crucial role in development, protein secretion, and virulence of B. cinerea.
Napolitano, Mauro; Rubio, Miguel Ángel; Santamaría-Gómez, Javier; Olmedo-Verd, Elvira; Robinson, Nigel J; Luque, Ignacio
2012-05-01
Zur regulators control zinc homeostasis by repressing target genes under zinc-sufficient conditions in a wide variety of bacteria. This paper describes how part of a survey of duplicated genes led to the identification of the open reading frame all2473 as the gene encoding the Zur regulator of the cyanobacterium Anabaena sp. strain PCC 7120. All2473 binds to DNA in a zinc-dependent manner, and its DNA-binding sequence was characterized, which allowed us to determine the relative contribution of particular nucleotides to Zur binding. A zur mutant was found to be impaired in the regulation of zinc homeostasis, showing sensitivity to elevated concentrations of zinc but not other metals. In an effort to characterize the Zur regulon in Anabaena, 23 genes containing upstream putative Zur-binding sequences were identified and found to be regulated by Zur. These genes are organized in six single transcriptional units and six operons, some of them containing multiple Zur-regulated promoters. The identities of genes of the Zur regulon indicate that Anabaena adapts to conditions of zinc deficiency by replacing zinc metalloproteins with paralogues that fulfill the same function but presumably with a lower zinc demand, and with inducing putative metallochaperones and membrane transport systems likely being involved in the scavenging of extracellular zinc, including plasma membrane ABC transport systems and outer membrane TonB-dependent receptors. Among the Zur-regulated genes, the ones showing the highest induction level encode proteins of the outer membrane, suggesting a primary role for components of this cell compartment in the capture of zinc cations from the extracellular medium.
Molecular cloning and characterization of the spaB gene of Streptococcus sobrinus.
Holt, R G; Perry, S E
1990-07-01
A gene of Streptococcus sobrinus 6715 (serotype g) designated spaB and encoding a surface protein antigen was isolated from a cosmid gene bank. A 5.4 kb HindIII/AvaI DNA fragment containing the gene was inserted into plasmid pBR322 to yield plasmid pXI404. Analysis of plasmid-encoded gene products showed that the 5.4 kb fragment of pXI404 encoded a 195 kDa protein. Southern blot experiments revealed that the 5.4 kb chromosomal insert DNA had sequence similarity with genomic DNA of S. sobrinus 6715, S. sobrinus B13 (serotype d) and Streptococcus cricetus HS6 (serotype a). The recombinant SpaB protein (rSpaB) was purified and monospecific antiserum was prepared. With immunological techniques and the anti-rSpaB serum, we have shown: (1) that the rSpaB protein has physico-chemical and antigenic identity with the S. sobrinus SpaB protein, (2) the presence of cross-reactive proteins in the extracellular protein of serotypes a and d of the mutans group of streptococci and (3) that the SpaB protein is expressed on the surface of mutans streptococcal serotypes a, d and g.
Myasthenic syndromes due to defects in COL13A1 and in the N-linked glycosylation pathway.
Beeson, David; Cossins, Judith; Rodriguez-Cruz, Pedro; Maxwell, Susan; Liu, Wei-Wei; Palace, Jacqueline
2018-02-01
The congenital myasthenic syndromes (CMS) are hereditary disorders of neuromuscular transmission. The number of cases recognized, at around 1:100,000 in the United Kingdom, is increasing with improved diagnosis. The advent of next-generation sequencing has facilitated the discovery of many genes that harbor CMS-associated mutations. An emerging group of CMS, characterized by a limb-girdle pattern of muscle weakness, is caused by mutations in genes that encode proteins involved in the initial steps of the N-linked glycosylation pathway, which is surprising, since this pathway is found in all mammalian cells. However, mutations in these genes may also give rise to multisystem disorders (congenital disorders of glycosylation) or muscle disorders where the myasthenic symptoms constitute only one component within a wider phenotypic spectrum. We also report a CMS due to mutations in COL13A1, which encodes an extracellular matrix protein that is concentrated at the neuromuscular junction and highlights a role for these extracellular matrix proteins in maintaining synaptic stability that is independent of the AGRN/MuSK clustering pathway. Knowledge about the neuromuscular synapse and the different proteins involved in maintaining its structure as well as function enables us to tailor treatments to the underlying pathogenic mechanisms. © 2018 New York Academy of Sciences.
Sloma, A; Rufo, G A; Theriault, K A; Dwyer, M; Wilson, S W; Pero, J
1991-01-01
We have purified a minor extracellular serine protease from a strain of Bacillus subtilis bearing null mutations in five extracellular protease genes: apr, npr, epr, bpr, and mpr (A. Sloma, C. Rudolph, G. Rufo, Jr., B. Sullivan, K. Theriault, D. Ally, and J. Pero, J. Bacteriol. 172:1024-1029, 1990). During purification, this novel protease (Vpr) was found bound in a complex in the void volume after gel filtration chromatography. The amino-terminal sequence of the purified protein was determined, and an oligonucleotide probe was constructed on the basis of the amino acid sequence. This probe was used to clone the structural gene (vpr) for this protease. The gene encodes a primary product of 806 amino acids. The amino acid sequence of the mature protein was preceded by a signal sequence of approximately 28 amino acids and a prosequence of approximately 132 amino acids. The mature protein has a predicted molecular weight of 68,197; however, the isolated protein has an apparent molecular weight of 28,500, suggesting that Vpr undergoes C-terminal processing or proteolysis. The vpr gene maps in the ctrA-sacA-epr region of the chromosome and is not required for growth or sporulation. Images FIG. 1 PMID:1938892
Buravkova, L B; Andreeva, E R; Lobanova, M V; Cotnezova, E V; Grigoriev, A I
2018-03-01
The dynamics of the expression of genes encoding adhesion molecules, molecules of the connective tissue matrix, and its remodeling enzymes was studied in multipotent mesenchymal stromal cells (MSCs) from human adipose tissue after interaction with cord blood hematopoietic progenitors (HSPCs). An upregulation of ICAM1 and VCAM1, directly proportional to the coculture time (24-72 h), was found. After 72 h of culturing, a downregulation of the genes encoding the majority of matrix molecules (SPP1; COL6A2,7A1; MMP1,3; TIMP1,3; and HAS1) and cell-matrix adhesion molecules (ITGs) was revealed. The detected changes may ensure the realization of the stromal MSC function due to improvement of adhesion and transmigration of HSPCs into the subcellular space.
de Vries, Ronald P.; Poulsen, Charlotte H.; Madrid, Susan; Visser, Jaap
1998-01-01
An extracellular α-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70°C. The α-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and β-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this α-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and α-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose. PMID:9440512
de Vries, R P; Poulsen, C H; Madrid, S; Visser, J
1998-01-01
An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.
Golzio, Muriel; Sersa, Gregor; Escoffre, Jean-Michel; Coer, Andrej; Vidic, Suzana; Teissie, Justin
2012-01-01
Abstract One of the applications of electroporation/electropulsation in biomedicine is gene electrotransfer, the wider use of which is hindered by low transfection efficiency in vivo compared with viral vectors. The aim of our study was to determine whether modulation of the extracellular matrix in solid tumors, using collagenase and hyaluronidase, could increase the transfection efficiency of gene electrotransfer in histologically different solid subcutaneous tumors in mice. Tumors were treated with enzymes before electrotransfer of plasmid DNA encoding either green fluorescent protein or luciferase. Transfection efficiency was determined 3, 9, and 15 days posttransfection. We demonstrated that pretreatment of tumors with a combination of enzymes significantly increased the transfection efficiency of electrotransfer in tumors with a high extracellular matrix area (LPB fibrosarcoma). In tumors with a smaller extracellular matrix area and less organized collagen lattice, the increase was not so pronounced (SA-1 fibrosarcoma and EAT carcinoma), whereas in B16 melanoma, in which only traces of collagen are present, pretreatment of tumors with hyaluronidase alone was more efficient than pretreatment with both enzymes. In conclusion, our results suggest that modification of the extracellular matrix could improve distribution of plasmid DNA in solid subcutaneous tumors, demonstrated by an increase in transfection efficiency, and thus have important clinical implications for electrogene therapy. PMID:21797718
He, S Y; Lindeberg, M; Chatterjee, A K; Collmer, A
1991-02-01
The out genes of the enterobacterial plant pathogen Erwinia chrysanthemi are responsible for the efficient extracellular secretion of multiple plant cell wall-degrading enzymes, including four isozymes of pectate lyase, exo-poly-alpha-D-galacturonosidase, pectin methylesterase, and cellulase. Out- mutants of Er. chrysanthemi are unable to export any of these proteins beyond the periplasm and are severely reduced in virulence. We have cloned out genes from Er. chrysanthemi in the stable, low-copy-number cosmid pCPP19 by complementing several transposon-induced mutations. The cloned out genes were clustered in a 12-kilobase chromosomal DNA region, complemented all existing out mutations in Er. chrysanthemi EC16, and enabled Escherichia coli strains to efficiently secrete the extracellular pectic enzymes produced from cloned Er. chrysanthemi genes, while retaining the periplasmic marker protein beta-lactamase. DNA sequencing of a 2.4-kilobase EcoRI fragment within the out cluster revealed four genes arranged colinearly and sharing substantial similarity with the Klebsiella pneumoniae genes pulH, pulI, pulJ, and pulK, which are necessary for pullulanase secretion. However, K. pneumoniae cells harboring the cloned Er. chrysanthemi pelE gene were unable to secrete the Erwinia pectate lyase. Furthermore, the Er. chrysanthemi Out system was unable to secrete an extracellular pectate lyase encoded by a gene from a closely related plant pathogen. Erwinia carotovora ssp. carotovora. The results suggest that these enterobacteria secrete polysaccharidases by a conserved mechanism whose protein-recognition capacities have diverged.
Easton, Donna M.; Totsika, Makrina; Allsopp, Luke P.; Phan, Minh-Duy; Idris, Adi; Wurpel, Daniël J.; Sherlock, Orla; Zhang, Bing; Venturini, Carola; Beatson, Scott A.; Mahony, Timothy J.; Cobbold, Rowland N.; Schembri, Mark A.
2011-01-01
Enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC) are diarrheagenic pathotypes of E. coli that cause gastrointestinal disease with the potential for life-threatening sequelae. While certain EHEC and EPEC virulence mechanisms have been extensively studied, the factors that mediate host colonization remain to be properly defined. Previously, we identified four genes (ehaA, ehaB, ehaC, and ehaD) from the prototypic EHEC strain EDL933 that encode for proteins that belong to the autotransporter (AT) family. Here we have examined the prevalence of these genes, as well as several other AT-encoding genes, in a collection of EHEC and EPEC strains. We show that the complement of AT-encoding genes in EHEC and EPEC strains is variable, with some AT-encoding genes being highly prevalent. One previously uncharacterized AT-encoding gene, which we have termed ehaJ, was identified in 12/44 (27%) of EHEC and 2/20 (10%) of EPEC strains. The ehaJ gene lies immediately adjacent to a gene encoding a putative glycosyltransferase (referred to as egtA). Western blot analysis using an EhaJ-specific antibody indicated that EhaJ is glycosylated by EgtA. Expression of EhaJ in a recombinant E. coli strain, revealed EhaJ is located at the cell surface and in the presence of the egtA glycosyltransferase gene mediates strong biofilm formation in microtiter plate and flow cell assays. EhaJ also mediated adherence to a range of extracellular matrix proteins, however this occurred independent of glycosylation. We also demonstrate that EhaJ is expressed in a wild-type EPEC strain following in vitro growth. However, deletion of ehaJ did not significantly alter its adherence or biofilm properties. In summary, EhaJ is a new glycosylated AT protein from EPEC and EHEC. Further studies are required to elucidate the function of EhaJ in colonization and virulence. PMID:21687429
Hong, Hyerim; Jung, Jaejoon; Park, Woojun
2014-01-01
Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538
Hong, Hyerim; Jung, Jaejoon; Park, Woojun
2014-01-01
Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment.
Ashton, G H S
2004-03-01
Kindler syndrome is a rare, autosomal recessive skin fragility disorder characterized by blistering in infancy, followed by photosensitivity and progressive poikiloderma. Ultrastructural examination reveals marked basement membrane reduplication and variable levels of cleavage at the dermal-epidermal junction. The molecular pathology underlying Kindler syndrome has recently been shown to involve loss-of-function mutations in a novel gene, KIND1, encoding kindlin-1. Immunofluorescence, gene expression and cell biology studies have shown that kindlin-1 is expressed mainly in basal keratinocytes and plays a role in the attachment of the actin cytoskeleton via focal contacts to the extracellular matrix. Thus, Kindler syndrome is the first genodermatosis caused by a defect in actin-extracellular matrix linkage rather than the classic keratin-extracellular matrix linkage underlying the pathology of other inherited skin fragility disorders such as epidermolysis bullosa. This article reviews the clinical features as well as the molecular and cellular pathology of Kindler syndrome and highlights the importance of the new protein, kindlin-1, in cell-matrix adhesion and its intriguing link to photosensitivity.
The tyrosine kinase Stitcher activates Grainy head and epidermal wound healing in Drosophila.
Wang, Shenqiu; Tsarouhas, Vasilios; Xylourgidis, Nikos; Sabri, Nafiseh; Tiklová, Katarína; Nautiyal, Naumi; Gallio, Marco; Samakovlis, Christos
2009-07-01
Epidermal injury initiates a cascade of inflammation, epithelial remodelling and integument repair at wound sites. The regeneration of the extracellular barrier and damaged tissue repair rely on the precise orchestration of epithelial responses triggered by the injury. Grainy head (Grh) transcription factors induce gene expression to crosslink the extracellular barrier in wounded flies and mice. However, the activation mechanisms and functions of Grh factors in re-epithelialization remain unknown. Here we identify stitcher (stit), a new Grh target in Drosophila melanogaster. stit encodes a Ret-family receptor tyrosine kinase required for efficient epidermal wound healing. Live imaging analysis reveals that Stit promotes actin cable assembly during wound re-epithelialization. Stit activation also induces extracellular signal-regulated kinase (ERK) phosphorylation along with the Grh-dependent expression of stit and barrier repair genes at the wound sites. The transcriptional stimulation of stit on injury triggers a positive feedback loop increasing the magnitude of epithelial responses. Thus, Stit activation upon wounding coordinates cytoskeletal rearrangements and the level of Grh-mediated transcriptional wound responses.
A Serpin Shapes the Extracellular Environment to Prevent Influenza A Virus Maturation
Dittmann, Meike; Hoffmann, Hans-Heinrich; Scull, Margaret A.; Gilmore, Rachel H.; Bell, Kierstin L.; Ciancanelli, Michael; Wilson, Sam J.; Crotta, Stefania; Yu, Yingpu; Flatley, Brenna; Xiao, Jing W.; Casanova, Jean-Laurent; Wack, Andreas; Bieniasz, Paul D.; Rice, Charles M.
2015-01-01
Summary Interferon-stimulated genes (ISGs) act in concert to provide a tight barrier against viruses. Recent studies have shed light on the contribution of individual ISG effectors to the antiviral state, but most have examined those acting on early, intracellular stages of the viral life cycle. Here, we applied an image-based screen to identify ISGs inhibiting late stages of influenza A virus (IAV) infection. We unraveled a directly antiviral function for the gene SERPINE1, encoding plasminogen activator inhibitor 1 (PAI-1). By targeting extracellular airway proteases, PAI-1 inhibits IAV glycoprotein cleavage, thereby reducing infectivity of progeny viruses. This was biologically relevant for IAV restriction in vivo. Further, partial PAI-1 deficiency, attributable to a polymorphism in human SERPINE1, conferred increased susceptibility to IAV in vitro. Together, our findings reveal that manipulating the extracellular environment to inhibit the last step in a virus life cycle is an important mechanism of the antiviral response. PMID:25679759
Siegel, Dawn H; Ashton, Gabrielle H S; Penagos, Homero G; Lee, James V; Feiler, Heidi S; Wilhelmsen, Kirk C; South, Andrew P; Smith, Frances J D; Prescott, Alan R; Wessagowit, Vesarat; Oyama, Noritaka; Akiyama, Masashi; Al Aboud, Daifullah; Al Aboud, Khalid; Al Githami, Ahmad; Al Hawsawi, Khalid; Al Ismaily, Abla; Al-Suwaid, Raouf; Atherton, David J; Caputo, Ruggero; Fine, Jo-David; Frieden, Ilona J; Fuchs, Elaine; Haber, Richard M; Harada, Takashi; Kitajima, Yasuo; Mallory, Susan B; Ogawa, Hideoki; Sahin, Sedef; Shimizu, Hiroshi; Suga, Yasushi; Tadini, Gianluca; Tsuchiya, Kikuo; Wiebe, Colin B; Wojnarowska, Fenella; Zaghloul, Adel B; Hamada, Takahiro; Mallipeddi, Rajeev; Eady, Robin A J; McLean, W H Irwin; McGrath, John A; Epstein, Ervin H
2003-07-01
Kindler syndrome is an autosomal recessive disorder characterized by neonatal blistering, sun sensitivity, atrophy, abnormal pigmentation, and fragility of the skin. Linkage and homozygosity analysis in an isolated Panamanian cohort and in additional inbred families mapped the gene to 20p12.3. Loss-of-function mutations were identified in the FLJ20116 gene (renamed "KIND1" [encoding kindlin-1]). Kindlin-1 is a human homolog of the Caenorhabditis elegans protein UNC-112, a membrane-associated structural/signaling protein that has been implicated in linking the actin cytoskeleton to the extracellular matrix (ECM). Thus, Kindler syndrome is, to our knowledge, the first skin fragility disorder caused by a defect in actin-ECM linkage, rather than keratin-ECM linkage.
Capsule Production and Glucose Metabolism Dictate Fitness during Serratia marcescens Bacteremia
Anderson, Mark T.; Mitchell, Lindsay A.; Zhao, Lili
2017-01-01
ABSTRACT Serratia marcescens is an opportunistic pathogen that causes a range of human infections, including bacteremia, keratitis, wound infections, and urinary tract infections. Compared to other members of the Enterobacteriaceae family, the genetic factors that facilitate Serratia proliferation within the mammalian host are less well defined. An in vivo screen of transposon insertion mutants identified 212 S. marcescens fitness genes that contribute to bacterial survival in a murine model of bloodstream infection. Among those identified, 11 genes were located within an 18-gene cluster encoding predicted extracellular polysaccharide biosynthesis proteins. A mutation in the wzx gene contained within this locus conferred a loss of fitness in competition infections with the wild-type strain and a reduction in extracellular uronic acids correlating with capsule loss. A second gene, pgm, encoding a phosphoglucomutase exhibited similar capsule-deficient phenotypes, linking central glucose metabolism with capsule production and fitness of Serratia during mammalian infection. Further evidence of the importance of central metabolism was obtained with a pfkA glycolytic mutant that demonstrated reduced replication in human serum and during murine infection. An MgtB magnesium transporter homolog was also among the fitness factors identified, and an S. marcescens mgtB mutant exhibited decreased growth in defined medium containing low concentrations of magnesium and was outcompeted ~10-fold by wild-type bacteria in mice. Together, these newly identified genes provide a more complete understanding of the specific requirements for S. marcescens survival in the mammalian host and provide a framework for further investigation of the means by which S. marcescens causes opportunistic infections. PMID:28536292
The human enamel protein gene amelogenin is expressed from both the X and the Y chromosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Salido, E.C.; Yen, P.H.; Koprivnikar, K.
1992-02-01
Amelogenins, a family of extracellular matrix proteins of the dental enamel, are transiently but abundantly expressed by ameloblasts during tooth development. In this paper the authors report the characterization of the AMGX and AMGY genes on the short arms of the human X and Y chromosomes which encode the amelogenins. Their studies on the expression of the amelogenin genes in male developing tooth buds showed that both the AMGX and AMGY genes are transcriptionally active and encode potentially functional proteins. They have isolated genomic and cDNA clones form both the AMGX and AMGY loci and have studied the sequence organizationmore » of these two genes. Reverse transcriptase (RT)PCR amplification of the 5[prime] portion of the amelogenin transcripts revealed several alternatively spliced products. This information will be useful for studying the molecular basis of X-linked amelogenesis imperfecta, for understanding the evolution and regulation of gene expression on the mammalian sex chromosomes, and for investigating the role of amelogenin genes during tooth development.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamann, J.; Hamann, D.; Lier, R.A.W.
1995-08-15
CD97 is a monomeric glycoprotein of 75 to 85 kDa that is induced rapidly on the surface of most leukocytes upon activation. We herein report the isolation of a cDNA encoding human CD97 by expression cloning in COS cells. The 3-kb cDNA clone encodes a mature polypeptide chain of 722 amino acids with a predicted molecular mass of 79 kDa. Within the C-terminal part of the protein, a region with seven hydrophobic segments was identified, suggesting that CD97 is a seven-span transmembrane molecule. Sequence comparison indicates that CD97 is the first leukocyte Ag in a recently described superfamily that includesmore » the receptors for secretin, calcitonin, and other mammalian and insect peptide hormones. Different from these receptors, CD97 has an extended extracellular region of 433 amino acids that possesses three N-terminal epidermal growth factor-like domains, two of them with a calcium-binding site, and single Arg-Gly-Asp (RGD) motif. The existence of structural elements characteristic for extracellular matrix proteins in a seven-span transmembrane molecule makes CD97 a receptor potentially involved in both adhesion and signaling processes early after leukocyte activation. The gene encoding CD97 is localized on chromosome 19 (19p13.12-13.2).« less
A recombinant actinomycete, Streptomyces lividans TK23.1, expressing a pIJ702-encoded extracellular lignin peroxidase gene cloned from the chromosome of Streptomyces virodosporus T7A, was released into soil in flask- and microcosm-scale studies to determine its effects on humific...
Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P
1995-04-03
The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.
Transport and metabolism of glycerophosphodiesters produced through phospholipid deacylation.
Patton-Vogt, Jana
2007-03-01
Phospholipid deacylation results in the formation of glycerophosphodiesters and free fatty acids. In Saccharomyces cerevisiae, four gene products with phospholipase B (deacylating) activity have been characterized (PLB1, PLB2, PLB3, NTE1), and those activities account for most, if not all, of the glycerophosphodiester production observed to date. The glycerophosphodiesters themselves are hydrolyzed into glycerol-3-phosphate and the corresponding alcohol by glycerophosphodiester phosphodiesterases. Although only one glycerophosphodiester phosphodiesterase-encoding gene (GDE1) has been characterized in S. cerevisiae, others certainly exist. Both internal and external glycerophosphodiesters (primarily glycerophosphocholine and glycerophosphoinositol) are formed as a result of phospholipid turnover in S. cerevisiae. A permease encoded by the GIT1 gene imports extracellular glycerophosphodiesters across the plasma membrane, where their hydrolytic products can provide crucial nutrients such as inositol, choline, and phosphate to the cell. The importance of this metabolic pathway in various aspects of S. cerevisiae cell physiology is being explored.
Molecular Mechanisms of Neurodegenerative Diseases Induced by Human Retroviruses: A Review
Irish, Bryan P.; Khan, Zafar K.; Jain, Pooja; Nonnemacher, Michael R.; Pirrone, Vanessa; Rahman, Saifur; Rajagopalan, Nirmala; Suchitra, Joyce B.; Mostoller, Kate; Wigdahl, Brian
2010-01-01
Problem statement Infection with retroviruses such as human immunodeficiency virus type 1 (HIV-1) and human T cell leukemia virus type 1 (HTLV-1) have been shown to lead to neurodegenerative diseases such as HIV-associated dementia (HAD) or neuroAIDS and HTLV-1-Associated Myelopathy/Tropical Spastic Paraparesis (HAM/TSP), respectively. Approach HIV-1-induced neurologic disease is associated with an influx of HIV-infected monocytic cells across the blood-brain barrier. Following neuroinvasion, HIV-1 and viral proteins, in addition to cellular mediators released from infected and uninfected cells participate in astrocytic and neuronal dysregulation, leading to mild to severe neurocognitive disorders. Results The molecular architecture of viral regulatory components including the Long Terminal Repeat (LTR), genes encoding the viral proteins Tat, Vpr and Nef as well as the envelope gene encoding gp120 and gp41 have been implicated in ‘indirect’ mechanisms of neuronal injury, mechanisms which are likely responsible for the majority of CNS damage induced by HIV-1 infection. The neuropathogenesis of HAM/TSP is linked, in part, with both intra-and extracellular effectors functions of the viral transactivator protein Tax and likely other viral proteins. Tax is traditionally known to localize in the nucleus of infected cells serving as a regulator of both viral and cellular gene expression. Conclusion/Recommendations However, recent evidence has suggested that Tax may also accumulate in the cytoplasm and be released from the infected cell through regulated cellular secretion processes. Once in the extracellular environment, Tax may cause functional alterations in cells of the peripheral blood, lymphoid organs and the central nervous system. These extracellular biological activities of Tax are likely very relevant to the neuropathogenesis of HTLV-1 and represent attractive targets for therapeutic intervention. PMID:20352020
Xu, Jun; Saunders, Charles W; Hu, Ping; Grant, Raymond A; Boekhout, Teun; Kuramae, Eiko E; Kronstad, James W; Deangelis, Yvonne M; Reeder, Nancy L; Johnstone, Kevin R; Leland, Meredith; Fieno, Angela M; Begley, William M; Sun, Yiping; Lacey, Martin P; Chaudhary, Tanuja; Keough, Thomas; Chu, Lien; Sears, Russell; Yuan, Bo; Dawson, Thomas L
2007-11-20
Fungi in the genus Malassezia are ubiquitous skin residents of humans and other warm-blooded animals. Malassezia are involved in disorders including dandruff and seborrheic dermatitis, which together affect >50% of humans. Despite the importance of Malassezia in common skin diseases, remarkably little is known at the molecular level. We describe the genome, secretory proteome, and expression of selected genes of Malassezia globosa. Further, we report a comparative survey of the genome and secretory proteome of Malassezia restricta, a close relative implicated in similar skin disorders. Adaptation to the skin environment and associated pathogenicity may be due to unique metabolic limitations and capabilities. For example, the lipid dependence of M. globosa can be explained by the apparent absence of a fatty acid synthase gene. The inability to synthesize fatty acids may be complemented by the presence of multiple secreted lipases to aid in harvesting host lipids. In addition, an abundance of genes encoding secreted hydrolases (e.g., lipases, phospholipases, aspartyl proteases, and acid sphingomyelinases) was found in the M. globosa genome. In contrast, the phylogenetically closely related plant pathogen Ustilago maydis encodes a different arsenal of extracellular hydrolases with more copies of glycosyl hydrolase genes. M. globosa shares a similar arsenal of extracellular hydrolases with the phylogenetically distant human pathogen, Candida albicans, which occupies a similar niche, indicating the importance of host-specific adaptation. The M. globosa genome sequence also revealed the presence of mating-type genes, providing an indication that Malassezia may be capable of sex.
Xu, Jun; Saunders, Charles W.; Hu, Ping; Grant, Raymond A.; Boekhout, Teun; Kuramae, Eiko E.; Kronstad, James W.; DeAngelis, Yvonne M.; Reeder, Nancy L.; Johnstone, Kevin R.; Leland, Meredith; Fieno, Angela M.; Begley, William M.; Sun, Yiping; Lacey, Martin P.; Chaudhary, Tanuja; Keough, Thomas; Chu, Lien; Sears, Russell; Yuan, Bo; Dawson, Thomas L.
2007-01-01
Fungi in the genus Malassezia are ubiquitous skin residents of humans and other warm-blooded animals. Malassezia are involved in disorders including dandruff and seborrheic dermatitis, which together affect >50% of humans. Despite the importance of Malassezia in common skin diseases, remarkably little is known at the molecular level. We describe the genome, secretory proteome, and expression of selected genes of Malassezia globosa. Further, we report a comparative survey of the genome and secretory proteome of Malassezia restricta, a close relative implicated in similar skin disorders. Adaptation to the skin environment and associated pathogenicity may be due to unique metabolic limitations and capabilities. For example, the lipid dependence of M. globosa can be explained by the apparent absence of a fatty acid synthase gene. The inability to synthesize fatty acids may be complemented by the presence of multiple secreted lipases to aid in harvesting host lipids. In addition, an abundance of genes encoding secreted hydrolases (e.g., lipases, phospholipases, aspartyl proteases, and acid sphingomyelinases) was found in the M. globosa genome. In contrast, the phylogenetically closely related plant pathogen Ustilago maydis encodes a different arsenal of extracellular hydrolases with more copies of glycosyl hydrolase genes. M. globosa shares a similar arsenal of extracellular hydrolases with the phylogenetically distant human pathogen, Candida albicans, which occupies a similar niche, indicating the importance of host-specific adaptation. The M. globosa genome sequence also revealed the presence of mating-type genes, providing an indication that Malassezia may be capable of sex. PMID:18000048
Torres-Farradá, Giselle; Manzano León, Ana M.; Rineau, François; Ledo Alonso, Lucía L.; Sánchez-López, María I.; Thijs, Sofie; Colpaert, Jan; Ramos-Leal, Miguel; Guerra, Gilda; Vangronsveld, Jaco
2017-01-01
White-rot fungi (WRF) and their ligninolytic enzymes (laccases and peroxidases) are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba). All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR)-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains. PMID:28588565
Haney, Matthew J; Zhao, Yuling; Harrison, Emily B; Mahajan, Vivek; Ahmed, Shaheen; He, Zhijian; Suresh, Poornima; Hingtgen, Shawn D; Klyachko, Natalia L; Mosley, R Lee; Gendelman, Howard E; Kabanov, Alexander V; Batrakova, Elena V
2013-01-01
The ability to precisely upregulate genes in inflamed brain holds great therapeutic promise. Here we report a novel class of vectors, genetically modified macrophages that carry reporter and therapeutic genes to neural cells. Systemic administration of macrophages transfected ex vivo with a plasmid DNA (pDNA) encoding a potent antioxidant enzyme, catalase, produced month-long expression levels of catalase in the brain resulting in three-fold reductions in inflammation and complete neuroprotection in mouse models of Parkinson's disease (PD). This resulted in significant improvements in motor functions in PD mice. Mechanistic studies revealed that transfected macrophages secreted extracellular vesicles, exosomes, packed with catalase genetic material, pDNA and mRNA, active catalase, and NF-κb, a transcription factor involved in the encoded gene expression. Exosomes efficiently transfer their contents to contiguous neurons resulting in de novo protein synthesis in target cells. Thus, genetically modified macrophages serve as a highly efficient system for reproduction, packaging, and targeted gene and drug delivery to treat inflammatory and neurodegenerative disorders.
Kurusu, Mitsuhiko; Cording, Amy; Taniguchi, Misako; Menon, Kaushiki; Suzuki, Emiko; Zinn, Kai
2008-01-01
Summary In Drosophila embryos and larvae, a small number of identified motor neurons innervate body wall muscles in a highly stereotyped pattern. Although genetic screens have identified many proteins that are required for axon guidance and synaptogenesis in this system, little is known about the mechanisms by which muscle fibers are defined as targets for specific motor axons. To identify potential target labels, we screened 410 genes encoding cell-surface and secreted proteins, searching for those whose overexpression on all muscle fibers causes motor axons to make targeting errors. Thirty such genes were identified, and a number of these were members of a large gene family encoding proteins whose extracellular domains contain leucine-rich repeat (LRR) sequences, which are protein interaction modules. By manipulating gene expression in muscle 12, we showed that four LRR proteins participate in the selection of this muscle as the appropriate synaptic target for the RP5 motor neuron. PMID:18817735
Haney, Matthew J.; Zhao, Yuling; Harrison, Emily B.; Mahajan, Vivek; Ahmed, Shaheen; He, Zhijian; Suresh, Poornima; Hingtgen, Shawn D.; Klyachko, Natalia L.; Mosley, R. Lee; Gendelman, Howard E.; Kabanov, Alexander V.; Batrakova, Elena V.
2013-01-01
The ability to precisely upregulate genes in inflamed brain holds great therapeutic promise. Here we report a novel class of vectors, genetically modified macrophages that carry reporter and therapeutic genes to neural cells. Systemic administration of macrophages transfected ex vivo with a plasmid DNA (pDNA) encoding a potent antioxidant enzyme, catalase, produced month-long expression levels of catalase in the brain resulting in three-fold reductions in inflammation and complete neuroprotection in mouse models of Parkinson's disease (PD). This resulted in significant improvements in motor functions in PD mice. Mechanistic studies revealed that transfected macrophages secreted extracellular vesicles, exosomes, packed with catalase genetic material, pDNA and mRNA, active catalase, and NF-κb, a transcription factor involved in the encoded gene expression. Exosomes efficiently transfer their contents to contiguous neurons resulting in de novo protein synthesis in target cells. Thus, genetically modified macrophages serve as a highly efficient system for reproduction, packaging, and targeted gene and drug delivery to treat inflammatory and neurodegenerative disorders. PMID:23620794
He, S Y; Lindeberg, M; Chatterjee, A K; Collmer, A
1991-01-01
The out genes of the enterobacterial plant pathogen Erwinia chrysanthemi are responsible for the efficient extracellular secretion of multiple plant cell wall-degrading enzymes, including four isozymes of pectate lyase, exo-poly-alpha-D-galacturonosidase, pectin methylesterase, and cellulase. Out- mutants of Er. chrysanthemi are unable to export any of these proteins beyond the periplasm and are severely reduced in virulence. We have cloned out genes from Er. chrysanthemi in the stable, low-copy-number cosmid pCPP19 by complementing several transposon-induced mutations. The cloned out genes were clustered in a 12-kilobase chromosomal DNA region, complemented all existing out mutations in Er. chrysanthemi EC16, and enabled Escherichia coli strains to efficiently secrete the extracellular pectic enzymes produced from cloned Er. chrysanthemi genes, while retaining the periplasmic marker protein beta-lactamase. DNA sequencing of a 2.4-kilobase EcoRI fragment within the out cluster revealed four genes arranged colinearly and sharing substantial similarity with the Klebsiella pneumoniae genes pulH, pulI, pulJ, and pulK, which are necessary for pullulanase secretion. However, K. pneumoniae cells harboring the cloned Er. chrysanthemi pelE gene were unable to secrete the Erwinia pectate lyase. Furthermore, the Er. chrysanthemi Out system was unable to secrete an extracellular pectate lyase encoded by a gene from a closely related plant pathogen. Erwinia carotovora ssp. carotovora. The results suggest that these enterobacteria secrete polysaccharidases by a conserved mechanism whose protein-recognition capacities have diverged. Images PMID:1992458
Role of RNase Y in Clostridium perfringens mRNA Decay and Processing.
Obana, Nozomu; Nakamura, Kouji; Nomura, Nobuhiko
2017-01-15
RNase Y is a major endoribonuclease that plays a crucial role in mRNA degradation and processing. We study the role of RNase Y in the Gram-positive anaerobic pathogen Clostridium perfringens, which until now has not been well understood. Our study implies an important role for RNase Y-mediated RNA degradation and processing in virulence gene expression and the physiological development of the organism. We began by constructing an RNase Y conditional knockdown strain in order to observe the importance of RNase Y on growth and virulence. Our resulting transcriptome analysis shows that RNase Y affects the expression of many genes, including toxin-producing genes. We provide data to show that RNase Y depletion repressed several toxin genes in C. perfringens and involved the virR-virS two-component system. We also observe evidence that RNase Y is indispensable for processing and stabilizing the transcripts of colA (encoding a major toxin collagenase) and pilA2 (encoding a major pilin component of the type IV pili). Posttranscriptional regulation of colA is known to be mediated by cleavage in the 5' untranslated region (5'UTR), and we observe that RNase Y depletion diminishes colA 5'UTR processing. We show that RNase Y is also involved in the posttranscriptional stabilization of pilA2 mRNA, which is thought to be important for host cell adherence and biofilm formation. RNases have important roles in RNA degradation and turnover in all organisms. C. perfringens is a Gram-positive anaerobic spore-forming bacterial pathogen that produces numerous extracellular enzymes and toxins, and it is linked to digestive disorders and disease. A highly conserved endoribonuclease, RNase Y, affects the expression of hundreds of genes, including toxin genes, and studying these effects is useful for understanding C. perfringens specifically and RNases generally. Moreover, RNase Y is involved in processing specific transcripts, and we observed that this processing in C. perfringens results in the stabilization of mRNAs encoding a toxin and bacterial extracellular apparatus pili. Our study shows that RNase activity is associated with gene expression, helping to determine the growth, proliferation, and virulence of C. perfringens. Copyright © 2016 American Society for Microbiology.
Chen, C-M; Liu, J-J; Chou, C-W; Lai, C-H; Wu, L-T
2015-10-01
To investigate the biochemical and functional properties of an extracellular protease, RpA, in Ralstonia pickettii WP1 isolated from water supply systems. An extracellular protease was identified and characterized from R. pickettii WP1. A mutant strain WP1M2 was created from strain WP1 by mini-Tn5 transposition. The culture filtrates from WP1M2 had a lower cytotoxic effect than the parental WP1 on several mammalian cell lines. Cloning and sequence analysis revealed the Tn5 transposon inserted at a protease gene (rpA) which is 81% homologous to prtA and aprX genes of Pseudomonas fluorescens. The rpA gene encodes a 482-residue protein showing sequence similarity to metalloproteases of the serralysin family. The RpA protein was expressed in Escherichia coli using a pET expression vector and purified as a 55 kDa molecular weight protein. Furthermore, the protease activity of RpA was inhibited by protease inhibitor and heat treatment. The in vitro cytotoxic activity of R. pickettii culture filtrates was attributed to RpA protease. An extracellular protease, RpA, was identified from R. pickettii WP1 isolated from water supply system. The RpA metalloproteases is required for the pathogenicity of R. pickettii to mammalian cell lines. © 2015 The Society for Applied Microbiology.
Sagara, N; Kirikoshi, H; Terasaki, H; Yasuhiko, Y; Toda, G; Shiokawa, K; Katoh, M
2001-04-06
Frizzled-1 (FZD1)-FZD10 are seven-transmembrane-type WNT receptors, and SFRP1-SFRP5 are soluble-type WNT antagonists. These molecules are encoded by mutually distinct genes. We have previously isolated and characterized the 7.7-kb FZD4 mRNA, encoding a seven-transmembrane receptor with the extracellular cysteine-rich domain (CRD). Here, we have cloned and characterized FZD4S, a splicing variant of the FZD4 gene. FZD4S, corresponding to the 10.0-kb FZD4 mRNA, consisted of exon 1, intron 1, and exon 2 of the FZD4 gene. FZD4S encoded a soluble-type polypeptide with the N-terminal part of CRD, and was expressed in human fetal kidney. Injection of synthetic FZD4S mRNA into the ventral marginal zone of Xenopus embryos at the 4-cell stage did not induce axis duplication by itself, but augmented the axis duplication potential of coinjected Xwnt-8 mRNA. These results indicate that the FZD4 gene gives rise to soluble-type FZD4S as well as seven-transmembrane-type FZD4 due to alternative splicing, and strongly suggest that FZD4S plays a role as a positive regulator of the WNT signaling pathway. Copyright 2001 Academic Press.
Barret, Matthieu; Egan, Frank; Fargier, Emilie; Morrissey, John P; O'Gara, Fergal
2011-06-01
Bacteria encode multiple protein secretion systems that are crucial for interaction with the environment and with hosts. In recent years, attention has focused on type VI secretion systems (T6SSs), which are specialized transporters widely encoded in Proteobacteria. The myriad of processes associated with these secretion systems could be explained by subclasses of T6SS, each involved in specialized functions. To assess diversity and predict function associated with different T6SSs, comparative genomic analysis of 34 Pseudomonas genomes was performed. This identified 70 T6SSs, with at least one locus in every strain, except for Pseudomonas stutzeri A1501. By comparing 11 core genes of the T6SS, it was possible to identify five main Pseudomonas phylogenetic clusters, with strains typically carrying T6SSs from more than one clade. In addition, most strains encode additional vgrG and hcp genes, which encode extracellular structural components of the secretion apparatus. Using a combination of phylogenetic and meta-analysis of transcriptome datasets it was possible to associate specific subsets of VgrG and Hcp proteins with each Pseudomonas T6SS clade. Moreover, a closer examination of the genomic context of vgrG genes in multiple strains highlights a number of additional genes associated with these regions. It is proposed that these genes may play a role in secretion or alternatively could be new T6S effectors.
The Human Airway Epithelial Basal Cell Transcriptome
Wang, Rui; Zwick, Rachel K.; Ferris, Barbara; Witover, Bradley; Salit, Jacqueline; Crystal, Ronald G.
2011-01-01
Background The human airway epithelium consists of 4 major cell types: ciliated, secretory, columnar and basal cells. During natural turnover and in response to injury, the airway basal cells function as stem/progenitor cells for the other airway cell types. The objective of this study is to better understand human airway epithelial basal cell biology by defining the gene expression signature of this cell population. Methodology/Principal Findings Bronchial brushing was used to obtain airway epithelium from healthy nonsmokers. Microarrays were used to assess the transcriptome of basal cells purified from the airway epithelium in comparison to the transcriptome of the differentiated airway epithelium. This analysis identified the “human airway basal cell signature” as 1,161 unique genes with >5-fold higher expression level in basal cells compared to differentiated epithelium. The basal cell signature was suppressed when the basal cells differentiated into a ciliated airway epithelium in vitro. The basal cell signature displayed overlap with genes expressed in basal-like cells from other human tissues and with that of murine airway basal cells. Consistent with self-modulation as well as signaling to other airway cell types, the human airway basal cell signature was characterized by genes encoding extracellular matrix components, growth factors and growth factor receptors, including genes related to the EGF and VEGF pathways. Interestingly, while the basal cell signature overlaps that of basal-like cells of other organs, the human airway basal cell signature has features not previously associated with this cell type, including a unique pattern of genes encoding extracellular matrix components, G protein-coupled receptors, neuroactive ligands and receptors, and ion channels. Conclusion/Significance The human airway epithelial basal cell signature identified in the present study provides novel insights into the molecular phenotype and biology of the stem/progenitor cells of the human airway epithelium. PMID:21572528
USDA-ARS?s Scientific Manuscript database
Previously, twelve protease-deficient mutants of Xanthomonas oryzae pv. oryzicola (Xoc) RS105 strain were recovered from a Tn5-tagged mutant library. In the current study, the Tn5 insertion site in each mutant was mapped. Mutations in genes encoding components of the type II secretion apparatus, cAM...
ArcR modulates biofilm formation in the dental plaque colonizer Streptococcus gordonii.
Robinson, J C; Rostami, N; Casement, J; Vollmer, W; Rickard, A H; Jakubovics, N S
2018-04-01
Biofilm formation and cell-cell sensing by the pioneer dental plaque colonizer Streptococcus gordonii are dependent upon arginine. This study aimed to identify genetic factors linking arginine-dependent responses and biofilm formation in S. gordonii. Isogenic mutants disrupted in genes required for the biosynthesis or catabolism of arginine, or for arginine-dependent gene regulation, were screened for their ability to form biofilms in a static culture model. Biofilm formation by a knockout mutant of arcR, encoding an arginine-dependent regulator of transcription, was reduced to < 50% that of the wild-type whereas other strains were unaffected. Complementation of S. gordonii ∆arcR with a plasmid-borne copy of arcR restored the ability to develop biofilms. By DNA microarray analysis, 25 genes were differentially regulated in S. gordonii ∆arcR compared with wild-type under arginine-replete conditions including eight genes encoding components of phosphotransferase systems for sugar uptake. By contrast, disruption of argR or ahrC genes, which encode paralogous arginine-dependent regulators, each resulted in significant changes in the expression of more than 100 genes. Disruption of a gene encoding a putative extracellular protein that was strongly regulated in S. gordonii ∆arcR had a minor impact on biofilm formation. We hypothesize that genes regulated by ArcR form a critical pathway linking arginine sensing to biofilm formation in S. gordonii. Further elucidation of this pathway may provide new targets for the control of dental plaque formation by inhibiting biofilm formation by a key pioneer colonizer of tooth surfaces. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Clinical Utility of Urinary CD90 as a Biomarker for Prostate Cancer Detection — EDRN Public Portal
Tumor-associated stromal cells differ from normal gland-associated stromal cells in gene expression. Genes up-regulated in these stromal cells are potential cancer biomarkers, especially those encoding secreted or extracellular proteins. These proteins might be detected in urine. CD90/THY1 is one such candidate. A clinical test based on urinary CD90 would be useful in reducing the number of unnecessary biopsies done because of abnormal serum PSA and/or DRE finding. Elevated CD90 protein is found in tumor tissue and urine.
Leaphart, Adam B.; Thompson, Dorothea K.; Huang, Katherine; Alm, Eric; Wan, Xiu-Feng; Arkin, Adam; Brown, Steven D.; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Wickham, Gene S.; Zhou, Jizhong
2006-01-01
The molecular response of Shewanella oneidensis MR-1 to variations in extracellular pH was investigated based on genomewide gene expression profiling. Microarray analysis revealed that cells elicited both general and specific transcriptome responses when challenged with environmental acid (pH 4) or base (pH 10) conditions over a 60-min period. Global responses included the differential expression of genes functionally linked to amino acid metabolism, transcriptional regulation and signal transduction, transport, cell membrane structure, and oxidative stress protection. Response to acid stress included the elevated expression of genes encoding glycogen biosynthetic enzymes, phosphate transporters, and the RNA polymerase sigma-38 factor (rpoS), whereas the molecular response to alkaline pH was characterized by upregulation of nhaA and nhaR, which are predicted to encode an Na+/H+ antiporter and transcriptional activator, respectively, as well as sulfate transport and sulfur metabolism genes. Collectively, these results suggest that S. oneidensis modulates multiple transporters, cell envelope components, and pathways of amino acid consumption and central intermediary metabolism as part of its transcriptome response to changing external pH conditions. PMID:16452448
Focareta, T; Manning, P A
1987-01-01
The gene encoding the extracellular DNase of Vibrio cholerae was cloned into Escherichia coli K-12. A maximal coding region of 1.2 kb and a minimal region of 0.6 kb were determined by transposon mutagenesis and deletion analysis. The nucleotide sequence of this region contained a single open reading frame of 690 bp corresponding to a protein of Mr 26,389 with a typical N-terminal signal sequence of 18 aa which, when removed, would give a mature protein of Mr 24,163. This is in good agreement with the size of 24 kDa, calculated directly by Coomassie blue staining following sodium dodecyl sulphate-polyacrylamide gel electrophoresis and indirectly via a DNA-hydrolysis assay. The protein is located in the periplasmic space of E. coli K-12 unlike in V. cholerae where it is excreted into the extracellular medium. The introduction of the DNase gene into a periplasmic (tolA) leaky mutant of E. coli K-12 facilitates the release of the protein, further confirming the periplasmic location.
Smoot, L M; Smoot, J C; Graham, M R; Somerville, G A; Sturdevant, D E; Migliaccio, C A; Sylva, G L; Musser, J M
2001-08-28
Pathogens are exposed to different temperatures during an infection cycle and must regulate gene expression accordingly. However, the extent to which virulent bacteria alter gene expression in response to temperatures encountered in the host is unknown. Group A Streptococcus (GAS) is a human-specific pathogen that is responsible for illnesses ranging from superficial skin infections and pharyngitis to severe invasive infections such as necrotizing fasciitis and streptococcal toxic shock syndrome. GAS survives and multiplies at different temperatures during human infection. DNA microarray analysis was used to investigate the influence of temperature on global gene expression in a serotype M1 strain grown to exponential phase at 29 degrees C and 37 degrees C. Approximately 9% of genes were differentially expressed by at least 1.5-fold at 29 degrees C relative to 37 degrees C, including genes encoding transporter proteins, proteins involved in iron homeostasis, transcriptional regulators, phage-associated proteins, and proteins with no known homologue. Relatively few known virulence genes were differentially expressed at this threshold. However, transcription of 28 genes encoding proteins with predicted secretion signal sequences was altered, indicating that growth temperature substantially influences the extracellular proteome. TaqMan real-time reverse transcription-PCR assays confirmed the microarray data. We also discovered that transcription of genes encoding hemolysins, and proteins with inferred roles in iron regulation, transport, and homeostasis, was influenced by growth at 40 degrees C. Thus, GAS profoundly alters gene expression in response to temperature. The data delineate the spectrum of temperature-regulated gene expression in an important human pathogen and provide many unforeseen lines of pathogenesis investigation.
Hyytiäinen, H; Montesano, M; Palva, E T
2001-08-01
The production of the main virulence determinants, the extracellular plant cell wall-degrading enzymes, and hence virulence of Erwinia carotovora subsp. carotovora is controlled by a complex regulatory network. One of the global regulators, the response regulator ExpA, a GacA homolog, is required for transcriptional activation of the extracellular enzyme genes of this soft-rot pathogen. To elucidate the mechanism of ExpA control as well as interactions with other regulatory systems, we isolated second-site transposon mutants that would suppress the enzyme-negative phenotype of an expA (gacA) mutant. Inactivation of kdgR resulted in partial restoration of extracellular enzyme production and virulence to the expA mutant, suggesting an interaction between the two regulatory pathways. This interaction was mediated by the RsmA-rsmB system. Northern analysis was used to show that the regulatory rsmB RNA was under positive control of ExpA. Conversely, the expression of rsmA encoding a global repressor was under negative control of ExpA and positive control of KdgR. This study indicates a central role for the RsmA-rsmB regulatory system during pathogenesis, integrating signals from the ExpA (GacA) and KdgR global regulators of extracellular enzyme production in E. carotovora subsp. carotovora.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elias, Dwayne A; Zane, Mr. Grant M.; Auer, Dr. Manfred
2010-01-01
Extracellular electron transfer has been investigated over several decades via forms of soluble electron transfer proteins that are exported for extracellular reoxidation. More recently, several organisms have been shown to reduce extracellular metals via the direct transfer of electron through appendages; also known as nanowires. They have been reported most predominantly in Shewanella and Geobacter. While the relevancy and composition of these structures in each genus has been debated, both possess outer membrane cytochrome complexes that could theoretically come into direct contact with solid phase oxidized metals. Members of the genus Desulfovibrio apparently have no such cytochromes although similar appendagesmore » are present, are electrically conductive, and are different from flagella. Upon U(VI)-reduction, the structures in Desulfovibrio become coated with U(IV). Deletion of flagellar genes did not alter soluble or amorphous Fe(III) or U(VI) reduction, or appendage appearance. Removal of the chromosomal pilA gene hampered amorphous Fe(III)-reduction by ca. 25%, but cells lacking the native plasmid, pDV1, reduced soluble Fe(III) and U(VI) at ca. 50% of the wild type rate while amorphous Fe(III)-reduction slowed to ca. 20% of the wild type rate. Appendages were present in all deletions as well as pDV1, except pilA. Gene complementation restored all activities and morphologies to wild type levels. This suggests that pilA encodes the structural component, whereas genes within pDV1 may provide the reactive members. How such appendages function without outer membrane cytochromes is under investigation.« less
Zhang, Xiao-Wei; Jia, Lei-Jie; Zhang, Yan; Jiang, Gang; Li, Xuan; Zhang, Dong; Tang, Wei-Hua
2012-01-01
The ascomycete Fusarium graminearum is a destructive fungal pathogen of wheat (Triticum aestivum). To better understand how this pathogen proliferates within the host plant, we tracked pathogen growth inside wheat coleoptiles and then examined pathogen gene expression inside wheat coleoptiles at 16, 40, and 64 h after inoculation (HAI) using laser capture microdissection and microarray analysis. We identified 344 genes that were preferentially expressed during invasive growth in planta. Gene expression profiles for 134 putative plant cell wall–degrading enzyme genes suggest that there was limited cell wall degradation at 16 HAI and extensive degradation at 64 HAI. Expression profiles for genes encoding reactive oxygen species (ROS)–related enzymes suggest that F. graminearum primarily scavenges extracellular ROS before a later burst of extracellular ROS is produced by F. graminearum enzymes. Expression patterns of genes involved in primary metabolic pathways suggest that F. graminearum relies on the glyoxylate cycle at an early stage of plant infection. A secondary metabolite biosynthesis gene cluster was specifically induced at 64 HAI and was required for virulence. Our results indicate that F. graminearum initiates infection of coleoptiles using covert penetration strategies and switches to overt cellular destruction of tissues at an advanced stage of infection. PMID:23266949
Expression of Duplicate msa Genes in the Salmonid Pathogen Renibacterium salmoninarum
Rhodes, Linda D.; Coady, Alison M.; Strom, Mark S.
2002-01-01
Renibacterium salmoninarum is a gram-positive bacterium responsible for bacterial kidney disease of salmon and trout. R. salmoninarum has two identical copies of the gene encoding major soluble antigen (MSA), an immunodominant, extracellular protein. To determine whether one or both copies of msa are expressed, reporter plasmids encoding a fusion of MSA and green fluorescent protein controlled by 0.6 kb of promoter region from msa1 or msa2 were constructed and introduced into R. salmoninarum. Single copies of the reporter plasmids integrated into the chromosome by homologous recombination. Expression of mRNA and protein from the integrated plasmids was detected, and transformed cells were fluorescent, demonstrating that both msa1 and msa2 are expressed under in vitro conditions. This is the first report of successful transformation and homologous recombination in R. salmoninarum. PMID:12406741
Agarwal, Pragati; Singh, Jyoti; Singh, R P
2017-05-01
Aspergillus niger PA2, a novel strain isolated from waste effluents of food industry, is a potential extracellular tyrosinase producer. Enzyme activity and L-DOPA production were maximum when glucose and peptone were employed as C source and nitrogen source respectively in the medium and enhanced notably when the copper was supplemented, thus depicting the significance of copper in tyrosinase activity. Tyrosinase-encoding gene from the fungus was cloned, and amplification of the tyrosinase gene yielded a 1127-bp DNA fragment and 374 amino acid residue long product that encoded for a predicted protein of 42.3 kDa with an isoelectric point of 4.8. Primary sequence analysis of A. niger PA2 tyrosinase had shown that it had approximately 99% identity with that of A. niger CBS 513.88, which was further confirmed by phylogenetic analysis. The inferred amino acid sequence of A. niger tyrosinase contained two putative copper-binding sites comprising of six histidines, a characteristic feature for type-3 copper proteins, which were highly conserved in all tyrosinases throughout the Aspergillus species. When superimposed onto the tertiary structure of A. oryzae tyrosinase, the conserved residues from both the organisms occupied same spatial positions to provide a di-copper-binding peptide groove.
Sawada, Hitoshi; Satoh, Noriyuki
2016-01-01
Despite the importance of stony corals in many research fields related to global issues, such as marine ecology, climate change, paleoclimatogy, and metazoan evolution, very little is known about the evolutionary origin of coral skeleton formation. In order to investigate the evolution of coral biomineralization, we have identified skeletal organic matrix proteins (SOMPs) in the skeletal proteome of the scleractinian coral, Acropora digitifera, for which large genomic and transcriptomic datasets are available. Scrupulous gene annotation was conducted based on comparisons of functional domain structures among metazoans. We found that SOMPs include not only coral-specific proteins, but also protein families that are widely conserved among cnidarians and other metazoans. We also identified several conserved transmembrane proteins in the skeletal proteome. Gene expression analysis revealed that expression of these conserved genes continues throughout development. Therefore, these genes are involved not only skeleton formation, but also in basic cellular functions, such as cell-cell interaction and signaling. On the other hand, genes encoding coral-specific proteins, including extracellular matrix domain-containing proteins, galaxins, and acidic proteins, were prominently expressed in post-settlement stages, indicating their role in skeleton formation. Taken together, the process of coral skeleton formation is hypothesized as: 1) formation of initial extracellular matrix between epithelial cells and substrate, employing pre-existing transmembrane proteins; 2) additional extracellular matrix formation using novel proteins that have emerged by domain shuffling and rapid molecular evolution and; 3) calcification controlled by coral-specific SOMPs. PMID:27253604
Johnson, Brant R.
2016-01-01
ABSTRACT Autolysins, also known as peptidoglycan hydrolases, are enzymes that hydrolyze specific bonds within bacterial cell wall peptidoglycan during cell division and daughter cell separation. Within the genome of Lactobacillus acidophilus NCFM, there are 11 genes encoding proteins with peptidoglycan hydrolase catalytic domains, 9 of which are predicted to be functional. Notably, 5 of the 9 putative autolysins in L. acidophilus NCFM are S-layer-associated proteins (SLAPs) noncovalently colocalized along with the surface (S)-layer at the cell surface. One of these SLAPs, AcmB, a β-N-acetylglucosaminidase encoded by the gene lba0176 (acmB), was selected for functional analysis. In silico analysis revealed that acmB orthologs are found exclusively in S-layer- forming species of Lactobacillus. Chromosomal deletion of acmB resulted in aberrant cell division, autolysis, and autoaggregation. Complementation of acmB in the ΔacmB mutant restored the wild-type phenotype, confirming the role of this SLAP in cell division. The absence of AcmB within the exoproteome had a pleiotropic effect on the extracellular proteins covalently and noncovalently bound to the peptidoglycan, which likely led to the observed decrease in the binding capacity of the ΔacmB strain for mucin and extracellular matrices fibronectin, laminin, and collagen in vitro. These data suggest a functional association between the S-layer and the multiple autolysins noncovalently colocalized at the cell surface of L. acidophilus NCFM and other S-layer-producing Lactobacillus species. IMPORTANCE Lactobacillus acidophilus is one of the most widely used probiotic microbes incorporated in many dairy foods and dietary supplements. This organism produces a surface (S)-layer, which is a self-assembling crystalline array found as the outermost layer of the cell wall. The S-layer, along with colocalized associated proteins, is an important mediator of probiotic activity through intestinal adhesion and modulation of the mucosal immune system. However, there is still a dearth of information regarding the basic cellular and evolutionary function of S-layers. Here, we demonstrate that multiple autolysins, responsible for breaking down the cell wall during cell division, are associated with the S-layer. Deletion of the gene encoding one of these S-layer-associated autolysins confirmed its autolytic role and resulted in reduced binding capacity to mucin and intestinal extracellular matrices. These data suggest a functional association between the S-layer and autolytic activity through the extracellular presentation of autolysins. PMID:27422832
Johnson, Brant R; Klaenhammer, Todd R
2016-09-15
Autolysins, also known as peptidoglycan hydrolases, are enzymes that hydrolyze specific bonds within bacterial cell wall peptidoglycan during cell division and daughter cell separation. Within the genome of Lactobacillus acidophilus NCFM, there are 11 genes encoding proteins with peptidoglycan hydrolase catalytic domains, 9 of which are predicted to be functional. Notably, 5 of the 9 putative autolysins in L. acidophilus NCFM are S-layer-associated proteins (SLAPs) noncovalently colocalized along with the surface (S)-layer at the cell surface. One of these SLAPs, AcmB, a β-N-acetylglucosaminidase encoded by the gene lba0176 (acmB), was selected for functional analysis. In silico analysis revealed that acmB orthologs are found exclusively in S-layer- forming species of Lactobacillus Chromosomal deletion of acmB resulted in aberrant cell division, autolysis, and autoaggregation. Complementation of acmB in the ΔacmB mutant restored the wild-type phenotype, confirming the role of this SLAP in cell division. The absence of AcmB within the exoproteome had a pleiotropic effect on the extracellular proteins covalently and noncovalently bound to the peptidoglycan, which likely led to the observed decrease in the binding capacity of the ΔacmB strain for mucin and extracellular matrices fibronectin, laminin, and collagen in vitro These data suggest a functional association between the S-layer and the multiple autolysins noncovalently colocalized at the cell surface of L. acidophilus NCFM and other S-layer-producing Lactobacillus species. Lactobacillus acidophilus is one of the most widely used probiotic microbes incorporated in many dairy foods and dietary supplements. This organism produces a surface (S)-layer, which is a self-assembling crystalline array found as the outermost layer of the cell wall. The S-layer, along with colocalized associated proteins, is an important mediator of probiotic activity through intestinal adhesion and modulation of the mucosal immune system. However, there is still a dearth of information regarding the basic cellular and evolutionary function of S-layers. Here, we demonstrate that multiple autolysins, responsible for breaking down the cell wall during cell division, are associated with the S-layer. Deletion of the gene encoding one of these S-layer-associated autolysins confirmed its autolytic role and resulted in reduced binding capacity to mucin and intestinal extracellular matrices. These data suggest a functional association between the S-layer and autolytic activity through the extracellular presentation of autolysins. Copyright © 2016 Johnson and Klaenhammer.
Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O; Podbielski, Andreas
2007-12-01
Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known GAS growth phase-dependent regulatory network.
Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O.; Podbielski, Andreas
2007-01-01
Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known GAS growth phase-dependent regulatory network. PMID:17893125
Sebbane, Florent; Lemaître, Nadine; Sturdevant, Daniel E; Rebeil, Roberto; Virtaneva, Kimmo; Porcella, Stephen F; Hinnebusch, B Joseph
2006-08-01
Yersinia pestis causes bubonic plague, characterized by an enlarged, painful lymph node, termed a bubo, that develops after bacterial dissemination from a fleabite site. In susceptible animals, the bacteria rapidly escape containment in the lymph node, spread systemically through the blood, and produce fatal sepsis. The fulminant progression of disease has been largely ascribed to the ability of Y. pestis to avoid phagocytosis and exposure to antimicrobial effectors of innate immunity. In vivo microarray analysis of Y. pestis gene expression, however, revealed an adaptive response to nitric oxide (NO)-derived reactive nitrogen species and to iron limitation in the extracellular environment of the bubo. Polymorphonuclear neutrophils recruited to the infected lymph node expressed abundant inducible NO synthase, and several Y. pestis homologs of genes involved in the protective response to reactive nitrogen species were up-regulated in the bubo. Mutation of one of these genes, which encodes the Hmp flavohemoglobin that detoxifies NO, attenuated virulence. Thus, the ability of Y. pestis to destroy immune cells and remain extracellular in the bubo appears to limit exposure to some but not all innate immune effectors. High NO levels induced during plague may also influence the developing adaptive immune response and contribute to septic shock.
Selle, Kurt; Goh, Yong J.; Johnson, Brant R.; O’Flaherty, Sarah; Andersen, Joakim M.; Barrangou, Rodolphe; Klaenhammer, Todd R.
2017-01-01
Lactobacillus acidophilus NCFM is a well-characterized probiotic microorganism, supported by a decade of genomic and functional phenotypic investigations. L. acidophilus deficient in lipoteichoic acid (LTA), a major immunostimulant in Gram-positive bacteria, has been shown to shift immune system responses in animal disease models. However, the pleiotropic effects of removing LTA from the cell surface in lactobacilli are unknown. In this study, we surveyed the global transcriptional and extracellular protein profiles of two strains of L. acidophilus deficient in LTA. Twenty-four differentially expressed genes specific to the LTA-deficient strains were identified, including a predicted heavy metal resistance operon and several putative peptidoglycan hydrolases. Cell morphology and manganese sensitivity phenotypes were assessed in relation to the putative functions of differentially expressed genes. LTA-deficient L. acidophilus exhibited elongated cellular morphology and their growth was severely inhibited by elevated manganese concentrations. Exoproteomic surveys revealed distinct changes in the composition and relative abundances of several extracellular proteins and showed a bias of intracellular proteins in LTA-deficient strains of L. acidophilus. Taken together, these results elucidate the impact of ltaS deletion on the transcriptome and extracellular proteins of L. acidophilus, suggesting roles of LTA in cell morphology and ion homeostasis as a structural component of the Gram positive cell wall. PMID:28443071
Selle, Kurt; Goh, Yong J; Johnson, Brant R; O'Flaherty, Sarah; Andersen, Joakim M; Barrangou, Rodolphe; Klaenhammer, Todd R
2017-01-01
Lactobacillus acidophilus NCFM is a well-characterized probiotic microorganism, supported by a decade of genomic and functional phenotypic investigations. L. acidophilus deficient in lipoteichoic acid (LTA), a major immunostimulant in Gram-positive bacteria, has been shown to shift immune system responses in animal disease models. However, the pleiotropic effects of removing LTA from the cell surface in lactobacilli are unknown. In this study, we surveyed the global transcriptional and extracellular protein profiles of two strains of L. acidophilus deficient in LTA. Twenty-four differentially expressed genes specific to the LTA-deficient strains were identified, including a predicted heavy metal resistance operon and several putative peptidoglycan hydrolases. Cell morphology and manganese sensitivity phenotypes were assessed in relation to the putative functions of differentially expressed genes. LTA-deficient L. acidophilus exhibited elongated cellular morphology and their growth was severely inhibited by elevated manganese concentrations. Exoproteomic surveys revealed distinct changes in the composition and relative abundances of several extracellular proteins and showed a bias of intracellular proteins in LTA-deficient strains of L. acidophilus . Taken together, these results elucidate the impact of ltaS deletion on the transcriptome and extracellular proteins of L. acidophilus , suggesting roles of LTA in cell morphology and ion homeostasis as a structural component of the Gram positive cell wall.
de Vries, Ronald P.; Timonen, Sari; Hildén, Kristiina
2014-01-01
Oxalic acid is a prevalent fungal metabolite with versatile roles in growth and nutrition, including degradation of plant biomass. However, the toxicity of oxalic acid makes regulation of its intra- and extracellular concentration crucial. To increase the knowledge of fungal oxalate metabolism, a transcriptional level study on oxalate-catabolising genes was performed with an effective lignin-degrading white-rot fungus Dichomitus squalens, which has demonstrated particular abilities in production and degradation of oxalic acid. The expression of oxalic-acid decomposing oxalate decarboxylase (ODC) and formic-acid decomposing formate dehydrogenase (FDH) encoding genes was followed during the growth of D. squalens on its natural spruce wood substrate. The effect of high proton concentration on the regulation of the oxalate-catabolising genes was determined after addition of organic acid (oxalic acid) and inorganic acid (hydrochloric acid) to the liquid cultures of D. squalens. In order to evaluate the co-expression of oxalate-catabolising and manganese peroxidase (MnP) encoding genes, the expression of one MnP encoding gene, mnp1, of D. squalens was also surveyed in the solid state and liquid cultures. Sequential action of ODC and FDH encoding genes was detected in the studied cultivations. The odc1, fdh2 and fdh3 genes of D. squalens showed constitutive expression, whereas ODC2 and FHD1 most likely are the main responsible enzymes for detoxification of high concentrations of oxalic and formic acids. The results also confirmed the central role of ODC1 when D. squalens grows on coniferous wood. Phylogenetic analysis revealed that fungal ODCs have evolved from at least two gene copies whereas FDHs have a single ancestral gene. As a conclusion, the multiplicity of oxalate-catabolising genes and their differential regulation on wood and in acid-amended cultures of D. squalens point to divergent physiological roles for the corresponding enzymes. PMID:24505339
Liu, Yimo; Fredrickson, Jim K.; Zachara, John M.; ...
2015-10-01
The tandem gene clusters orfR-ombB-omaB-omcB and orfS-ombC-omaC-omcC of the metal-reducing bacterium Geobacter sulfurreducens PCA are responsible for trans-outer membrane electron transfer during extracellular reduction of Fe(III)-citrate and ferrihydrite [a poorly crystalline Fe(III) oxide]. Each gene cluster encodes a putative transcriptional factor (OrfR/OrfS), a porin-like outer-membrane protein (OmbB/OmbC), a periplasmic c-type cytochrome (c-Cyt, OmaB/OmaC) and an outer-membrane c-Cyt (OmcB/OmcC). The individual roles of OmbB, OmaB and OmcB in extracellular reduction of Fe(III), however, have remained either uninvestigated or controversial. Here, we showed that replacements of ombB, omaB, omcB and ombB-omaB with an antibiotic gene in the presence of ombC-omaC-omcC had nomore » impact on reduction of Fe(III)-citrate by G. sulfurreducens PCA. Disruption of ombB, omaB, omcB and ombB-omaB in the absence of ombC-omaC-omcC, however, severely impaired the bacterial ability to reduce Fe(III)-citrate as well as ferrihydrite. These results unequivocally demonstrate an overlapping role of ombB-omaB-omcB and ombC-omaC-omcC in extracellular Fe(III) reduction by G. sulfurreducens PCA. Involvement of both ombB-omaB-omcB and ombC-omaC-omcC in extracellular Fe(III) reduction reflects the importance of these trans-outer membrane protein complexes in the physiology of this bacterium. Moreover, the kinetics of Fe(III)-citrate and ferrihydrite reduction by these mutants in the absence of ombC-omaC-omcC were nearly identical, which clearly show that OmbB, OmaB and OmcB contribute equally to extracellular Fe(III) reduction. Finally, orfS was found to have a negative impact on the extracellular reduction of Fe(III)-citrate and ferrihydrite in G. sulfurreducens PCA probably by serving as a transcriptional repressor.« less
Chen, Tzu-Han; Shiau, Hsin-Chieh
2018-01-01
Single cell transcriptome (SCT) analysis provides superior resolution to illustrate tumor cell heterogeneity for clinical implications. We characterized four SCTs of MCF-7 using 143 housekeeping genes (HKGs) as control, of which lactate dehydrogenase B (LDHB) expression is silenced. These SCT libraries mapped to 11,423, 11,486, 10,380, and 11,306 RefSeq genes (UCSC), respectively. High consistency in HKG expression levels across all four SCTs, along with transcriptional silencing of LDHB, was observed, suggesting a high sensitivity and reproducibility of the SCT analysis. Cross-library comparison on expression levels by scatter plotting revealed a linear correlation and an 83–94% overlap in transcript isoforms and expressed genes were also observed. To gain insight of transcriptional diversity among the SCTs, expressed genes were split into consistently expressed (CE) (expressed in all SCTs) and inconsistently expressed (IE) (expressed in some but not all SCTs) genes for further characterization, along with the 142 expressed HKGs as a reference. Distinct transcriptional strengths were found among these groups, with averages of 1,612.0, 88.0 and 1.2 FPKM for HKGs, CE and IE, respectively. Comparison between CE and IE groups further indicated that expressions of CE genes vary more significantly than that of IE genes. Gene Ontology analysis indicated that proteins encoded by CE genes are mainly involved in fundamental intracellular activities, while proteins encoded by IE genes are mainly for extracellular activities, especially acting as receptors or ion channels. The diversified gene expressions, especially for those encoded by IE genes, may contribute to cancer drug resistance. PMID:29920548
Evidence for the evolution of tenascin and fibronectin early in the chordate lineage.
Tucker, Richard P; Chiquet-Ehrismann, Ruth
2009-02-01
Fibronectin and tenascin are extracellular matrix glycoproteins that play important roles in cell adhesion and motility. In a previous study we provided evidence that tenascin first appeared early in the chordate lineage. As tenascin has been proposed to act, in part, through modulation of cell-fibronectin interactions, we sought here to identify fibronectin genes in non-vertebrate chordates and other invertebrates to determine if tenascin and fibronectin evolved separately or together, and to identify phylogenetically conserved features of both proteins. We found that the genome of the urochordate Ciona savignyi contains both a tenascin gene and a gene encoding a fibronectin-like protein with fibronectin type 1, 2 and 3 repeats. The genome of the cephalochordate Branchiostoma floridae (amphioxus) also has a tenascin gene. However, we could not identify a fibronectin-like gene in B. floridae, nor could we identify fibronectin or tenascin genes in echinoderms, protostomes or cnidarians. If urochordates are more closely related to vertebrates, tenascin may have evolved before fibronectin in an ancestor common to tunicates and amphioxus. Alternatively, tenascin and fibronectin may have evolved in an ancestor common to B. floridae and C. savignyi and the fibronectin gene was subsequently lost in the cephalochordate lineage. The fibronectin-like gene from C. savignyi does not encode the RGD motif for integrin binding found in all vertebrate fibronectins, and it lacks most of the fibronectin type 1 domains believed to be critical for fibrillogenesis. In contrast, the tenascin gene in B. floridae encodes multiple RGD motifs, suggesting that integrin binding is fundamental to tenascin function.
Palma-Guerrero, Javier; Zhao, Jiuhai; Gonçalves, A. Pedro; Starr, Trevor L.
2015-01-01
The molecular mechanisms of membrane merger during somatic cell fusion in eukaryotic species are poorly understood. In the filamentous fungus Neurospora crassa, somatic cell fusion occurs between genetically identical germinated asexual spores (germlings) and between hyphae to form the interconnected network characteristic of a filamentous fungal colony. In N. crassa, two proteins have been identified to function at the step of membrane fusion during somatic cell fusion: PRM1 and LFD-1. The absence of either one of these two proteins results in an increase of germling pairs arrested during cell fusion with tightly appressed plasma membranes and an increase in the frequency of cell lysis of adhered germlings. The level of cell lysis in ΔPrm1 or Δlfd-1 germlings is dependent on the extracellular calcium concentration. An available transcriptional profile data set was used to identify genes encoding predicted transmembrane proteins that showed reduced expression levels in germlings cultured in the absence of extracellular calcium. From these analyses, we identified a mutant (lfd-2, for late fusion defect-2) that showed a calcium-dependent cell lysis phenotype. lfd-2 encodes a protein with a Fringe domain and showed endoplasmic reticulum and Golgi membrane localization. The deletion of an additional gene predicted to encode a low-affinity calcium transporter, fig1, also resulted in a strain that showed a calcium-dependent cell lysis phenotype. Genetic analyses showed that LFD-2 and FIG1 likely function in separate pathways to regulate aspects of membrane merger and repair during cell fusion. PMID:25595444
2010-01-01
Background Trichomonas vaginalis is the most common non-viral human sexually transmitted pathogen and importantly, contributes to facilitating the spread of HIV. Yet very little is known about its surface and secreted proteins mediating interactions with, and permitting the invasion and colonisation of, the host mucosa. Initial annotations of T. vaginalis genome identified a plethora of candidate extracellular proteins. Results Data mining of the T. vaginalis genome identified 911 BspA-like entries (TvBspA) sharing TpLRR-like leucine-rich repeats, which represent the largest gene family encoding potential extracellular proteins for the pathogen. A broad range of microorganisms encoding BspA-like proteins was identified and these are mainly known to live on mucosal surfaces, among these T. vaginalis is endowed with the largest gene family. Over 190 TvBspA proteins with inferred transmembrane domains were characterised by a considerable structural diversity between their TpLRR and other types of repetitive sequences and two subfamilies possessed distinct classic sorting signal motifs for endocytosis. One TvBspA subfamily also shared a glycine-rich protein domain with proteins from Clostridium difficile pathogenic strains and C. difficile phages. Consistent with the hypothesis that TvBspA protein structural diversity implies diverse roles, we demonstrated for several TvBspA genes differential expression at the transcript level in different growth conditions. Identified variants of repetitive segments between several TvBspA paralogues and orthologues from two clinical isolates were also consistent with TpLRR and other repetitive sequences to be functionally important. For one TvBspA protein cell surface expression and antibody responses by both female and male T. vaginalis infected patients were also demonstrated. Conclusions The biased mucosal habitat for microbial species encoding BspA-like proteins, the characterisation of a vast structural diversity for the TvBspA proteins, differential expression of a subset of TvBspA genes and the cellular localisation and immunological data for one TvBspA; all point to the importance of the TvBspA proteins to various aspects of T. vaginalis pathobiology at the host-pathogen interface. PMID:20144183
A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity
Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel
2003-01-01
Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2′-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 μM. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity. PMID:14532088
New genes and new biological roles for expansins
NASA Technical Reports Server (NTRS)
Cosgrove, D. J.
2000-01-01
Expansins are extracellular proteins that loosen plant cell walls in novel ways. They are thought to function in cell enlargement, pollen tube invasion of the stigma (in grasses), wall disassembly during fruit ripening, abscission and other cell separation events. Expansins are encoded by two multigene families and each gene is often expressed in highly specific locations and cell types. Structural analysis indicates that one expansin region resembles the catalytic domain of family-45 endoglucanases but glucanase activity has not been detected. The genome projects have revealed numerous expansin-related sequences but their putative wall-loosening functions remain to be assessed.
Matulova, Marta; Rajova, Jana; Vlasatikova, Lenka; Volf, Jiri; Stepanova, Hana; Havlickova, Hana; Sisak, Frantisek; Rychlik, Ivan
2012-01-01
In this study we were interested in identification of new markers of chicken response to Salmonella Enteritidis infection. To reach this aim, gene expression in the spleens of naive chickens and those intravenously infected with S. Enteritidis with or without previous oral vaccination was determined by 454 pyrosequencing of splenic mRNA/cDNA. Forty genes with increased expression at the level of transcription were identified. The most inducible genes encoded avidin (AVD), extracellular fatty acid binding protein (EXFABP), immune responsive gene 1 (IRG1), chemokine ah221 (AH221), trappin-6-like protein (TRAP6) and serum amyloid A (SAA). Using cDNA from sorted splenic B-lymphocytes, macrophages, CD4, CD8 and γδ T-lymphocytes, we found that the above mentioned genes were preferentially expressed in macrophages. AVD, EXFABP, IRG1, AH221, TRAP6 and SAA were induced also in the cecum of chickens orally infected with S. Enteritidis on day 1 of life or day 42 of life. Unusual results were obtained for the immunoglobulin encoding transcripts. Prior to the infection, transcripts coding for the constant parts of IgM, IgY, IgA and Ig light chain were detected in B-lymphocytes. However, after the infection, immunoglobulin encoding transcripts were expressed also by T-lymphocytes and macrophages. Expression of AVD, EXFABP, IRG1, AH221, TRAP6, SAA and all immunoglobulin genes can be therefore used for the characterization of the course of S. Enteritidis infection in chickens. PMID:23094107
Explosive cell lysis as a mechanism for the biogenesis of bacterial membrane vesicles and biofilms
Turnbull, Lynne; Toyofuku, Masanori; Hynen, Amelia L.; Kurosawa, Masaharu; Pessi, Gabriella; Petty, Nicola K.; Osvath, Sarah R.; Cárcamo-Oyarce, Gerardo; Gloag, Erin S.; Shimoni, Raz; Omasits, Ulrich; Ito, Satoshi; Yap, Xinhui; Monahan, Leigh G.; Cavaliere, Rosalia; Ahrens, Christian H.; Charles, Ian G.; Nomura, Nobuhiko; Eberl, Leo; Whitchurch, Cynthia B.
2016-01-01
Many bacteria produce extracellular and surface-associated components such as membrane vesicles (MVs), extracellular DNA and moonlighting cytosolic proteins for which the biogenesis and export pathways are not fully understood. Here we show that the explosive cell lysis of a sub-population of cells accounts for the liberation of cytosolic content in Pseudomonas aeruginosa biofilms. Super-resolution microscopy reveals that explosive cell lysis also produces shattered membrane fragments that rapidly form MVs. A prophage endolysin encoded within the R- and F-pyocin gene cluster is essential for explosive cell lysis. Endolysin-deficient mutants are defective in MV production and biofilm development, consistent with a crucial role in the biogenesis of MVs and liberation of extracellular DNA and other biofilm matrix components. Our findings reveal that explosive cell lysis, mediated through the activity of a cryptic prophage endolysin, acts as a mechanism for the production of bacterial MVs. PMID:27075392
Analyzing pERK Activation During Planarian Regeneration.
Fraguas, Susanna; Umesono, Yoshihiko; Agata, Kiyokazu; Cebrià, Francesc
2017-01-01
Planarians are an ideal model in which to study stem cell-based regeneration. After amputation, planarian pluripotent stem cells surrounding the wound proliferate to produce the regenerative blastema, in which they differentiate into the missing tissues and structures. Recent independent studies in planarians have shown that Smed-egfr-3, a gene encoding a homologue of epidermal growth factor (EGF) receptors, and DjerkA, which encodes an extracellular signal-regulated kinase (ERK), may control cell differentiation and blastema growth. However, because these studies were carried in two different planarian species, the relationship between these two genes remains unclear. We have optimized anti-pERK immunostaining in Schmidtea mediterranea using the original protocol developed in Dugesia japonica. Both protocols are reported here as most laboratories worldwide work with one of these two species. Using this protocol we have determined that Smed-egfr-3 appears to be necessary for pERK activation during planarian regeneration.
Cellular and molecular biology of orphan G protein-coupled receptors.
Oh, Da Young; Kim, Kyungjin; Kwon, Hyuk Bang; Seong, Jae Young
2006-01-01
The superfamily of G protein-coupled receptors (GPCRs) is the largest and most diverse group of membrane-spanning proteins. It plays a variety of roles in pathophysiological processes by transmitting extracellular signals to cells via heterotrimeric G proteins. Completion of the human genome project revealed the presence of approximately 168 genes encoding established nonsensory GPCRs, as well as 207 genes predicted to encode novel GPCRs for which the natural ligands remained to be identified, the so-called orphan GPCRs. Eighty-six of these orphans have now been paired to novel or previously known molecules, and 121 remain to be deorphaned. A better understanding of the GPCR structures and classification; knowledge of the receptor activation mechanism, either dependent on or independent of an agonist; increased understanding of the control of GPCR-mediated signal transduction; and development of appropriate ligand screening systems may improve the probability of discovering novel ligands for the remaining orphan GPCRs.
Stotz, Henrik U; Harvey, Pascoe J; Haddadi, Parham; Mashanova, Alla; Kukol, Andreas; Larkan, Nicholas J; Borhan, M Hossein; Fitt, Bruce D L
2018-01-01
Genes coding for nucleotide-binding leucine-rich repeat (LRR) receptors (NLRs) control resistance against intracellular (cell-penetrating) pathogens. However, evidence for a role of genes coding for proteins with LRR domains in resistance against extracellular (apoplastic) fungal pathogens is limited. Here, the distribution of genes coding for proteins with eLRR domains but lacking kinase domains was determined for the Brassica napus genome. Predictions of signal peptide and transmembrane regions divided these genes into 184 coding for receptor-like proteins (RLPs) and 121 coding for secreted proteins (SPs). Together with previously annotated NLRs, a total of 720 LRR genes were found. Leptosphaeria maculans-induced expression during a compatible interaction with cultivar Topas differed between RLP, SP and NLR gene families; NLR genes were induced relatively late, during the necrotrophic phase of pathogen colonization. Seven RLP, one SP and two NLR genes were found in Rlm1 and Rlm3/Rlm4/Rlm7/Rlm9 loci for resistance against L. maculans on chromosome A07 of B. napus. One NLR gene at the Rlm9 locus was positively selected, as was the RLP gene on chromosome A10 with LepR3 and Rlm2 alleles conferring resistance against L. maculans races with corresponding effectors AvrLm1 and AvrLm2, respectively. Known loci for resistance against L. maculans (extracellular hemi-biotrophic fungus), Sclerotinia sclerotiorum (necrotrophic fungus) and Plasmodiophora brassicae (intracellular, obligate biotrophic protist) were examined for presence of RLPs, SPs and NLRs in these regions. Whereas loci for resistance against P. brassicae were enriched for NLRs, no such signature was observed for the other pathogens. These findings demonstrate involvement of (i) NLR genes in resistance against the intracellular pathogen P. brassicae and a putative NLR gene in Rlm9-mediated resistance against the extracellular pathogen L. maculans.
NASA Astrophysics Data System (ADS)
Pereira, Sara B.; Mota, Rita; Vieira, Cristina P.; Vieira, Jorge; Tamagnini, Paula
2015-10-01
Many cyanobacteria produce extracellular polymeric substances (EPS) with particular characteristics (e.g. anionic nature and presence of sulfate) that make them suitable for industrial processes such as bioremediation of heavy metals or thickening, suspending or emulsifying agents. Nevertheless, their biosynthetic pathway(s) are still largely unknown, limiting their utilization. In this work, a phylum-wide analysis of genes/proteins putatively involved in the assembly and export of EPS in cyanobacteria was performed. Our results demonstrated that most strains harbor genes encoding proteins related to the three main pathways: Wzy-, ABC transporter-, and Synthase-dependent, but often not the complete set defining one pathway. Multiple gene copies are mainly correlated to larger genomes, and the strains with reduced genomes (e.g. the clade of marine unicellular Synechococcus and Prochlorococcus), seem to have lost most of the EPS-related genes. Overall, the distribution of the different genes/proteins within the cyanobacteria phylum raises the hypothesis that cyanobacterial EPS production may not strictly follow one of the pathways previously characterized. Moreover, for the proteins involved in EPS polymerization, amino acid patterns were defined and validated constituting a novel and robust tool to identify proteins with similar functions and giving a first insight to which polymer biosynthesis they are related to.
Positional signaling mediated by a receptor-like kinase in Arabidopsis.
Kwak, Su-Hwan; Shen, Ronglai; Schiefelbein, John
2005-02-18
The position-dependent specification of root epidermal cells in Arabidopsis provides an elegant paradigm for cell patterning during development. Here, we describe a new gene, SCRAMBLED (SCM), required for cells to appropriately interpret their location within the developing root epidermis. SCM encodes a receptor-like kinase protein with a predicted extracellular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain. SCM regulates the expression of the GLABRA2, CAPRICE, WEREWOLF, and ENHANCER OF GLABRA3 transcription factor genes that define the cell fates. Further, the SCM gene is expressed throughout the developing root. Therefore, SCM likely enables developing epidermal cells to detect positional cues and establish an appropriate cell-type pattern.
Guo, Jian; Wang, Yuanhua; Li, Baozhong; Huang, Siyao; Chen, Yefu; Guo, Xuewu; Xiao, Dongguang
2017-06-10
Aureobasidium pullulans is an increasingly attractive host for bio-production of pullulan, heavy oil, polymalic acid, and a large spectrum of extracellular enzymes. To date, genetic manipulation of A. pullulans mainly relies on time-consuming conventional restriction enzyme digestion and ligation methods. In this study, we present a one-step homologous recombination-based method for rapid genetic manipulation in A. pullulans. Overlaps measuring >40bp length and 10μg DNA segments for homologous recombination provided maximum benefits to transformation of A. pullulans. This optimized method was successfully applied to PKSIII gene (encodes polyketide synthase) knock-out and gltP gene (encodes glycolipid transfer protein) knock-in. After disruption of PKSIII gene, secretion of melanin decreased slightly. The melanin purified from disruptant showed lower reducing capacity compared with that of the parent strain, leading to a decrease in exopolysaccharide production. Knock-in of gltP gene resulted in at least 4.68-fold increase in heavy oil production depending on the carbon source used, indicating that gltP can regulate heavy oil synthesis in A. pullulans. Copyright © 2017 Elsevier B.V. All rights reserved.
Munfus, Delicia L; Haga, Christopher L; Burrows, Peter D; Cooper, Max D
2007-01-01
Background In mouse the cytokine interleukin-7 (IL-7) is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER). The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR), a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules. PMID:17854505
Johnson, Jeremiah G.; Clegg, Steven
2010-01-01
Klebsiella pneumoniae is an opportunistic pathogen that has been shown to adhere to human extracellular matrices using the type 3 fimbriae. Introduction of plasmids carrying genes known to alter intracellular cyclic-di-GMP pools in Vibrio parahaemolyticus revealed that these genes also altered type 3 fimbrial surface expression in K. pneumoniae. Immediately adjacent to the type 3 fimbrial gene cluster is a gene, mrkJ, that is related to a family of bacterial genes encoding phosphodiesterases. We identify here a role for MrkJ, a functional phosphodiesterase exhibiting homology to EAL domain-containing proteins, in controlling type 3 fimbria production and biofilm formation in K. pneumoniae. Deletion of mrkJ resulted in an increase in type 3 fimbria production and biofilm formation as a result of the accumulation of intracellular cyclic-di-GMP. This gene was shown to encode a functional phosphodiesterase via restoration of motility in a V. parahaemolyticus strain previously shown to accumulate cyclic-di-GMP and in vitro using phosphodiesterase activity assays. The effect of the mrkJ mutation on type 3 fimbrial expression was shown to be at the level of mrkA gene transcription by using quantitative reverse transcription-PCR. These results reveal a previously unknown role for cyclic-di-GMP in type 3 fimbrial production. PMID:20511505
Berka, Randy M.; Rey, Michael W.; Brown, Kimberly M.; Byun, Tony; Klotz, Alan V.
1998-01-01
The phyA gene encoding an extracellular phytase from the thermophilic fungus Thermomyces lanuginosus was cloned and heterologously expressed, and the recombinant gene product was biochemically characterized. The phyA gene encodes a primary translation product (PhyA) of 475 amino acids (aa) which includes a putative signal peptide (23 aa) and propeptide (10 aa). The deduced amino acid sequence of PhyA has limited sequence identity (ca. 47%) with Aspergillus niger phytase. The phyA gene was inserted into an expression vector under transcriptional control of the Fusarium oxysporum trypsin gene promoter and used to transform a Fusarium venenatum recipient strain. The secreted recombinant phytase protein was enzymatically active between pHs 3 and 7.5, with a specific activity of 110 μmol of inorganic phosphate released per min per mg of protein at pH 6 and 37°C. The Thermomyces phytase retained activity at assay temperatures up to 75°C and demonstrated superior catalytic efficiency to any known fungal phytase at 65°C (the temperature optimum). Comparison of this new Thermomyces catalyst with the well-known Aspergillus niger phytase reveals other favorable properties for the enzyme derived from the thermophilic gene donor, including catalytic activity over an expanded pH range. PMID:9797301
The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.
Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto
2010-08-01
Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.
Lugli, Gabriele Andrea; Mancino, Walter; Milani, Christian; Duranti, Sabrina; Turroni, Francesca; van Sinderen, Douwe; Ventura, Marco
2018-06-08
The repertoire of secreted proteins decoded by a microorganism represents proteins released from or associated with the cell's surface. In gut commensals, such as bifidobacteria, these proteins are perceived to be functionally relevant as they regulate the interaction with the gut environment. In the current study, we have screened the predicted proteome of over 300 bifidobacterial strains amongst the currently recognized bifidobacterial species to generate a comprehensive database encompassing bifidobacterial extracellular proteins. A glycobiome analysis of this predicted bifidobacterial secretome revealed that a correlation exists between particular bifidobacterial species and their capability to hydrolyze HMOs and intestinal glyconjugates such as mucin. Furthermore, exploration of metatranscriptomic datasets of the infant gut microbiota allowed the evaluation of the expression of bifidobacterial genes encoding extracellular proteins, represented by ABC transporter substrate-binding proteins and glycoside hydrolases enzymes involved in the degradation of human milk oligosaccharides and mucin. Overall, this study provides insights into how bifidobacteria interact with their natural yet highly complex environment, the infant gut. Importance The ecological success of bifidobacteria relies on the activity of extracellular proteins that are involved in the metabolism of nutrients and the interaction with the environment. To date, information on secreted proteins encoded by bifidobacteria are incomplete and just related to few species. In this study, we reconstructed the bifidobacterial pan-secretome, revealing extracellular proteins that modulate the interaction of bifidobacteria with their natural environment. Furthermore, a survey of secretion system between bifidobacterial genomes allowed the identification of a conserved Sec-dependent secretion machinery in all the analyzed genomes and the Tat protein translocation system in the chromosomes of 23 strains belonging to Bifidobacterium longum subsp. longum and Bifidobacterium aesculapii . Copyright © 2018 American Society for Microbiology.
Rose, Sasha J.
2016-01-01
ABSTRACT Extracellular DNA (eDNA) is an integral biofilm matrix component of numerous pathogens, including nontuberculous mycobacteria (NTM). Cell lysis is the source of eDNA in certain bacteria, but the source of eDNA remains unidentified for NTM, as well as for other eDNA-containing bacterial species. In this study, conditions affecting eDNA export were examined, and genes involved with the eDNA export mechanism were identified. After a method for monitoring eDNA in real time in undisturbed biofilms was established, different conditions affecting eDNA were investigated. Bicarbonate positively influenced eDNA export in a pH-independent manner in Mycobacterium avium, M. abscessus, and M. chelonae. The surface-exposed proteome of M. avium in eDNA-containing biofilms revealed abundant carbonic anhydrases. Chemical inhibition of carbonic anhydrases with ethoxzolamide significantly reduced eDNA export. An unbiased transposon mutant library screen for eDNA export in M. avium identified many severely eDNA-attenuated mutants, including one not expressing a unique FtsK/SpoIIIE-like DNA-transporting pore, two with inactivation of carbonic anhydrases, and nine with inactivation of genes belonging to a unique genomic region, as well as numerous mutants involved in metabolism and energy production. Complementation of nine mutants that included the FtsK/SpoIIIE and carbonic anhydrase significantly restored eDNA export. Interestingly, several attenuated eDNA mutants have mutations in genes encoding proteins that were found with the surface proteomics, and many more mutations are localized in operons potentially encoding surface proteins. Collectively, our data strengthen the evidence of eDNA export being an active mechanism that is activated by the bacterium responding to bicarbonate. PMID:27923918
Dolan, Jackie; Walshe, Karen; Alsbury, Samantha; Hokamp, Karsten; O'Keeffe, Sean; Okafuji, Tatsuya; Miller, Suzanne FC; Tear, Guy; Mitchell, Kevin J
2007-01-01
Background Leucine-rich repeats (LRRs) are highly versatile and evolvable protein-ligand interaction motifs found in a large number of proteins with diverse functions, including innate immunity and nervous system development. Here we catalogue all of the extracellular LRR (eLRR) proteins in worms, flies, mice and humans. We use convergent evidence from several transmembrane-prediction and motif-detection programs, including a customised algorithm, LRRscan, to identify eLRR proteins, and a hierarchical clustering method based on TribeMCL to establish their evolutionary relationships. Results This yields a total of 369 proteins (29 in worm, 66 in fly, 135 in mouse and 139 in human), many of them of unknown function. We group eLRR proteins into several classes: those with only LRRs, those that cluster with Toll-like receptors (Tlrs), those with immunoglobulin or fibronectin-type 3 (FN3) domains and those with some other domain. These groups show differential patterns of expansion and diversification across species. Our analyses reveal several clusters of novel genes, including two Elfn genes, encoding transmembrane proteins with eLRRs and an FN3 domain, and six genes encoding transmembrane proteins with eLRRs only (the Elron cluster). Many of these are expressed in discrete patterns in the developing mouse brain, notably in the thalamus and cortex. We have also identified a number of novel fly eLRR proteins with discrete expression in the embryonic nervous system. Conclusion This study provides the necessary foundation for a systematic analysis of the functions of this class of genes, which are likely to include prominently innate immunity, inflammation and neural development, especially the specification of neuronal connectivity. PMID:17868438
Pollen specific expression of maize genes encoding actin depolymerizing factor-like proteins.
Lopez, I; Anthony, R G; Maciver, S K; Jiang, C J; Khan, S; Weeds, A G; Hussey, P J
1996-01-01
In pollen development, a dramatic reorganization of the actin cytoskeleton takes place during the passage of the pollen grain into dormancy and on activation of pollen tube growth. A role for actin-binding proteins is implicated and we report here the identification of a small gene family in maize that encodes actin depolymerizing factor (ADF)-like proteins. The ADF group of proteins are believed to control actin polymerization and depolymerization in response to both intracellular and extracellular signals. Two of the maize genes ZmABP1 and ZmABP2 are expressed specifically in pollen and germinating pollen suggesting that the protein products may be involved in pollen actin reorganization. A third gene, ZmABP3, encodes a protein only 56% and 58% identical to ZmABP1 and ZmABP2, respectively, and its expression is suppressed in pollen and germinated pollen. The fundamental biochemical characteristics of the ZmABP proteins has been elucidated using bacterially expressed ZmABP3 protein. This has the ability to bind monomeric actin (G-actin) and filamentous actin (F-actin). Moreover, it decreases the viscosity of polymerized actin solutions consistent with an ability to depolymerize filaments. These biochemical characteristics, taken together with the sequence comparisons, support the inclusion of the ZmABP proteins in the ADF group. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8693008
Kindler surprise: mutations in a novel actin-associated protein cause Kindler syndrome.
White, Sharon J; McLean, W H Irwin
2005-06-01
Kindler syndrome is an autosomal recessive genodermatosis characterized by acral blistering in neonates and diffuse, progressive poikiloderma in later life. Other clinical features include photosensitivity, premature skin ageing and severe periodontal disease. Two groups have recently shown that the molecular basis of Kindler syndrome is loss of a novel epidermal protein, kindlin-1, encoded by the gene KIND1. Two additional kindlin proteins, kindlin-2 and kindlin-3, have also been described. Kindlin-1 is considered to be a component in the linkage of the actin cytoskeleton to the extracellular matrix and as such is proposed to have both structural and cell-signalling functions. Kindler syndrome is therefore the first skin fragility syndrome due to disruption of the actin-extracellular matrix system.
Properties of genes essential for mouse development
Kabir, Mitra; Barradas, Ana; Tzotzos, George T.; Hentges, Kathryn E.
2017-01-01
Essential genes are those that are critical for life. In the specific case of the mouse, they are the set of genes whose deletion means that a mouse is unable to survive after birth. As such, they are the key minimal set of genes needed for all the steps of development to produce an organism capable of life ex utero. We explored a wide range of sequence and functional features to characterise essential (lethal) and non-essential (viable) genes in mice. Experimental data curated manually identified 1301 essential genes and 3451 viable genes. Very many sequence features show highly significant differences between essential and viable mouse genes. Essential genes generally encode complex proteins, with multiple domains and many introns. These genes tend to be: long, highly expressed, old and evolutionarily conserved. These genes tend to encode ligases, transferases, phosphorylated proteins, intracellular proteins, nuclear proteins, and hubs in protein-protein interaction networks. They are involved with regulating protein-protein interactions, gene expression and metabolic processes, cell morphogenesis, cell division, cell proliferation, DNA replication, cell differentiation, DNA repair and transcription, cell differentiation and embryonic development. Viable genes tend to encode: membrane proteins or secreted proteins, and are associated with functions such as cellular communication, apoptosis, behaviour and immune response, as well as housekeeping and tissue specific functions. Viable genes are linked to transport, ion channels, signal transduction, calcium binding and lipid binding, consistent with their location in membranes and involvement with cell-cell communication. From the analysis of the composite features of essential and viable genes, we conclude that essential genes tend to be required for intracellular functions, and viable genes tend to be involved with extracellular functions and cell-cell communication. Knowledge of the features that are over-represented in essential genes allows for a deeper understanding of the functions and processes implemented during mammalian development. PMID:28562614
Hasegawa, Hiroaki; Lind, Erin J.; Boin, Markus A.; Häse, Claudia C.
2008-01-01
Vibrio tubiashii is a recently reemerging pathogen of larval bivalve mollusks, causing both toxigenic and invasive disease. Marine Vibrio spp. produce an array of extracellular products as potential pathogenicity factors. Culture supernatants of V. tubiashii have been shown to be toxic to oyster larvae and were reported to contain a metalloprotease and a cytolysin/hemolysin. However, the structural genes responsible for these proteins have yet to be identified, and it is uncertain which extracellular products play a role in pathogenicity. We investigated the effects of the metalloprotease and hemolysin secreted by V. tubiashii on its ability to kill Pacific oyster (Crassostrea gigas) larvae. While V. tubiashii supernatants treated with metalloprotease inhibitors severely reduced the toxicity to oyster larvae, inhibition of the hemolytic activity did not affect larval toxicity. We identified structural genes of V. tubiashii encoding a metalloprotease (vtpA) and a hemolysin (vthA). Sequence analyses revealed that VtpA shared high homology with metalloproteases from a variety of Vibrio species, while VthA showed high homology only to the cytolysin/hemolysin of Vibrio vulnificus. Compared to the wild-type strain, a VtpA mutant of V. tubiashii not only produced reduced amounts of protease but also showed decreased toxicity to C. gigas larvae. Vibrio cholerae strains carrying the vtpA or vthA gene successfully secreted the heterologous protein. Culture supernatants of V. cholerae carrying vtpA but not vthA were highly toxic to Pacific oyster larvae. Together, these results suggest that the V. tubiashii extracellular metalloprotease is important in its pathogenicity to C. gigas larvae. PMID:18456850
Morikawa, Yuka; Zhang, Min; Heallen, Todd; Leach, John; Tao, Ge; Xiao, Yang; Bai, Yan; Li, Wei; Willerson, James T.; Martin, James F.
2015-01-01
The mammalian heart regenerates poorly, and damage commonly leads to heart failure. Hippo signaling is an evolutionarily conserved kinase cascade that regulates organ size during development and prevents adult mammalian cardiomyocyte regeneration by inhibiting the transcriptional coactivator Yap, which also responds to mechanical signaling in cultured cells to promote cell proliferation. To identify Yap target genes that are activated during cardiomyocyte renewal and regeneration, we performed Yap chromatin immunoprecipitation sequencing (ChIP-Seq) and mRNA expression profiling in Hippo signaling-deficient mouse hearts. We found that Yap directly regulated genes encoding cell cycle progression proteins, as well as genes encoding proteins that promote F-actin polymerization and that link the actin cytoskeleton to the extracellular matrix. Included in the latter group were components of the dystrophin glycoprotein complex (DGC), a large molecular complex that, when defective, results in muscular dystrophy in humans. Cardiomyocytes near scar tissue of injured Hippo signaling-deficient mouse hearts showed cellular protrusions suggestive of cytoskeletal remodeling. The hearts of mdx mutant mice, which lack functional dystrophin and are a model for muscular dystrophy, showed impaired regeneration and cytoskeleton remodeling, but normal cardiomyocyte proliferation after injury. Our data showed that, in addition to genes encoding cell cycle progression proteins, Yap regulated genes that enhance cytoskeletal remodeling Thus, blocking the Hippo pathway input to Yap may tip the balance so that Yap responds to the mechanical changes associated with heart injury to promote repair. PMID:25943351
Nakajima, Keisuke; Tazawa, Ichiro; Yaoita, Yoshio
2018-02-01
Thyroid hormone (TH) binds TH receptor α (TRα) and β (TRβ) to induce amphibian metamorphosis. Whereas TH signaling has been well studied, functional differences between TRα and TRβ during this process have not been characterized. To understand how each TR contributes to metamorphosis, we generated TRα- and TRβ-knockout tadpoles of Xenopus tropicalis and examined developmental abnormalities, histology of the tail and intestine, and messenger RNA expression of genes encoding extracellular matrix-degrading enzymes. In TRβ-knockout tadpoles, tail regression was delayed significantly and a healthy notochord was observed even 5 days after the initiation of tail shortening (stage 62), whereas in the tails of wild-type and TRα-knockout tadpoles, the notochord disappeared after ∼1 day. The messenger RNA expression levels of genes encoding extracellular matrix-degrading enzymes (MMP2, MMP9TH, MMP13, MMP14, and FAPα) were obviously reduced in the tail tip of TRβ-knockout tadpoles, with the shortening tail. The reduction in olfactory nerve length and head narrowing by gill absorption were also affected. Hind limb growth and intestinal shortening were not compromised in TRβ-knockout tadpoles, whereas tail regression and olfactory nerve shortening appeared to proceed normally in TRα-knockout tadpoles, except for the precocious development of hind limbs. Our results demonstrated the distinct roles of TRα and TRβ in hind limb growth and tail regression, respectively. Copyright © 2018 Endocrine Society.
Comparative Analysis of Type IV Pilin in Desulfuromonadales
Shu, Chuanjun; Xiao, Ke; Yan, Qin; Sun, Xiao
2016-01-01
During anaerobic respiration, the bacteria Geobacter sulfurreducens can transfer electrons to extracellular electron accepters through its pilus. G. sulfurreducens pili have been reported to have metallic-like conductivity that is similar to doped organic semiconductors. To study the characteristics and origin of conductive pilin proteins found in the pilus structure, their genetic, structural, and phylogenetic properties were analyzed. The genetic relationships, and conserved structures and sequences that were obtained were used to predict the evolution of the pilins. Homologous genes that encode conductive pilin were found using PilFind and Cluster. Sequence characteristics and protein tertiary structures were analyzed with MAFFT and QUARK, respectively. The origin of conductive pilins was explored by building a phylogenetic tree. Truncation is a characteristic of conductive pilin. The structures of truncated pilins and their accompanying proteins were found to be similar to the N-terminal and C-terminal ends of full-length pilins respectively. The emergence of the truncated pilins can probably be ascribed to the evolutionary pressure of their extracellular electron transporting function. Genes encoding truncated pilins and proteins similar to the C-terminal of full-length pilins, which contain a group of consecutive anti-parallel beta-sheets, are adjacent in bacterial genomes. According to the genetic, structure, and phylogenetic analyses performed in this study, we inferred that the truncated pilins and their accompanying proteins probably evolved from full-length pilins by gene fission through duplication, degeneration, and separation. These findings provide new insights about the molecular mechanisms involved in long-range electron transport along the conductive pili of Geobacter species. PMID:28066394
Role of the Trichoderma harzianum Endochitinase Gene, ech42, in Mycoparasitism
Carsolio, Carolina; Benhamou, Nicole; Haran, Shoshan; Cortés, Carlos; Gutiérrez, Ana; Chet, Ilan; Herrera-Estrella, Alfredo
1999-01-01
The role of the Trichoderma harzianum endochitinase (Ech42) in mycoparasitism was studied by genetically manipulating the gene that encodes Ech42, ech42. We constructed several transgenic T. harzianum strains carrying multiple copies of ech42 and the corresponding gene disruptants. The level of extracellular endochitinase activity when T. harzianum was grown under inducing conditions increased up to 42-fold in multicopy strains as compared with the wild type, whereas gene disruptants exhibited practically no activity. The densities of chitin labeling of Rhizoctonia solani cell walls, after interactions with gene disruptants were not statistically significantly different than the density of chitin labeling after interactions with the wild type. Finally, no major differences in the efficacies of the strains generated as biocontrol agents against R. solani or Sclerotium rolfsii were observed in greenhouse experiments. PMID:10049844
Boháčová, Martina; Zdeňková, Kamila; Tomáštíková, Zuzana; Fuchsová, Viviana; Demnerová, Kateřina; Karpíšková, Renáta; Pazlarová, Jarmila
2018-04-21
The alarming occurrence of antibiotic resistance genes in food production demands continuous monitoring worldwide. One reservoir of resistance genes is thought to be eDNA. There is currently little available information in Europe about either the extracellular DNA distribution of the bacterium or the spread of resistance genes in L. monocytogenes. Therefore, our aims were to give insight into the Listeria monocytogenes resistance situation in the Czech Republic and assess the presence of resistance genes in their extracellular DNA (eDNA). First, susceptibility tests were performed on 49 isolates of L. monocytogenes with selected antibiotics. Next, we tested DNA of suspected isolates for the presence of resistance genes in both planktonic cells and the eDNA of biofilms. Finally, fluorescent confocal microscopy was used to observe the eDNA pattern of selected isolates under conditions that mimicked the food processing environment and the human body. Susceptibility tests found isolates intermediate resistant to chloramphenicol, tetracycline, and ciprofloxacin as well as isolates resistant to ciprofloxacin. For all suspected isolates, PCR confirmed the presence of the gene lde encoding efflux pump in both types of DNA. When the biofilm was observed using confocal laser scanning microscope, the eDNA distribution patterns varied considerably according to the culture conditions. Furthermore, the food and clinical isolates varied in terms of the amount of eDNA detected. The presence of an efflux pump in both types of DNA suggests that the eDNA might serve as a reservoir of resistance genes. Surprising differences were observed in the eDNA pattern. Our results suggest that the current risk of the spread of L. monocytogenes resistance genes is low in the Czech Republic, but they also indicate the need for continuous long-term monitoring of the situation.
Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A
1993-01-01
A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064
De Coi, Niccolò; Feuermann, Marc; Schmid-Siegert, Emanuel; Băguţ, Elena-Tatiana; Mignon, Bernard; Waridel, Patrice; Peter, Corinne; Pradervand, Sylvain
2016-01-01
ABSTRACT Dermatophytes are the most common agents of superficial mycoses in humans and animals. The aim of the present investigation was to systematically identify the extracellular, possibly secreted, proteins that are putative virulence factors and antigenic molecules of dermatophytes. A complete gene expression profile of Arthroderma benhamiae was obtained during infection of its natural host (guinea pig) using RNA sequencing (RNA-seq) technology. This profile was completed with those of the fungus cultivated in vitro in two media containing either keratin or soy meal protein as the sole source of nitrogen and in Sabouraud medium. More than 60% of transcripts deduced from RNA-seq data differ from those previously deposited for A. benhamiae. Using these RNA-seq data along with an automatic gene annotation procedure, followed by manual curation, we produced a new annotation of the A. benhamiae genome. This annotation comprised 7,405 coding sequences (CDSs), among which only 2,662 were identical to the currently available annotation, 383 were newly identified, and 15 secreted proteins were manually corrected. The expression profile of genes encoding proteins with a signal peptide in infected guinea pigs was found to be very different from that during in vitro growth when using keratin as the substrate. Especially, the sets of the 12 most highly expressed genes encoding proteases with a signal sequence had only the putative vacuolar aspartic protease gene PEP2 in common, during infection and in keratin medium. The most upregulated gene encoding a secreted protease during infection was that encoding subtilisin SUB6, which is a known major allergen in the related dermatophyte Trichophyton rubrum. IMPORTANCE Dermatophytoses (ringworm, jock itch, athlete’s foot, and nail infections) are the most common fungal infections, but their virulence mechanisms are poorly understood. Combining transcriptomic data obtained from growth under various culture conditions with data obtained during infection led to a significantly improved genome annotation. About 65% of the protein-encoding genes predicted with our protocol did not match the existing annotation for A. benhamiae. Comparing gene expression during infection on guinea pigs with keratin degradation in vitro, which is supposed to mimic the host environment, revealed the critical importance of using real in vivo conditions for investigating virulence mechanisms. The analysis of genes expressed in vivo, encoding cell surface and secreted proteins, particularly proteases, led to the identification of new allergen and virulence factor candidates. PMID:27822542
Tran, Van Du T; De Coi, Niccolò; Feuermann, Marc; Schmid-Siegert, Emanuel; Băguţ, Elena-Tatiana; Mignon, Bernard; Waridel, Patrice; Peter, Corinne; Pradervand, Sylvain; Pagni, Marco; Monod, Michel
2016-01-01
Dermatophytes are the most common agents of superficial mycoses in humans and animals. The aim of the present investigation was to systematically identify the extracellular, possibly secreted, proteins that are putative virulence factors and antigenic molecules of dermatophytes. A complete gene expression profile of Arthroderma benhamiae was obtained during infection of its natural host (guinea pig) using RNA sequencing (RNA-seq) technology. This profile was completed with those of the fungus cultivated in vitro in two media containing either keratin or soy meal protein as the sole source of nitrogen and in Sabouraud medium. More than 60% of transcripts deduced from RNA-seq data differ from those previously deposited for A. benhamiae . Using these RNA-seq data along with an automatic gene annotation procedure, followed by manual curation, we produced a new annotation of the A. benhamiae genome. This annotation comprised 7,405 coding sequences (CDSs), among which only 2,662 were identical to the currently available annotation, 383 were newly identified, and 15 secreted proteins were manually corrected. The expression profile of genes encoding proteins with a signal peptide in infected guinea pigs was found to be very different from that during in vitro growth when using keratin as the substrate. Especially, the sets of the 12 most highly expressed genes encoding proteases with a signal sequence had only the putative vacuolar aspartic protease gene PEP2 in common, during infection and in keratin medium. The most upregulated gene encoding a secreted protease during infection was that encoding subtilisin SUB6, which is a known major allergen in the related dermatophyte Trichophyton rubrum . IMPORTANCE Dermatophytoses (ringworm, jock itch, athlete's foot, and nail infections) are the most common fungal infections, but their virulence mechanisms are poorly understood. Combining transcriptomic data obtained from growth under various culture conditions with data obtained during infection led to a significantly improved genome annotation. About 65% of the protein-encoding genes predicted with our protocol did not match the existing annotation for A. benhamiae . Comparing gene expression during infection on guinea pigs with keratin degradation in vitro , which is supposed to mimic the host environment, revealed the critical importance of using real in vivo conditions for investigating virulence mechanisms. The analysis of genes expressed in vivo , encoding cell surface and secreted proteins, particularly proteases, led to the identification of new allergen and virulence factor candidates.
Parry, David A.; Brookes, Steven J.; Logan, Clare V.; Poulter, James A.; El-Sayed, Walid; Al-Bahlani, Suhaila; Al Harasi, Sharifa; Sayed, Jihad; Raïf, El Mostafa; Shore, Roger C.; Dashash, Mayssoon; Barron, Martin; Morgan, Joanne E.; Carr, Ian M.; Taylor, Graham R.; Johnson, Colin A.; Aldred, Michael J.; Dixon, Michael J.; Wright, J. Tim; Kirkham, Jennifer; Inglehearn, Chris F.; Mighell, Alan J.
2012-01-01
Autozygosity mapping and clonal sequencing of an Omani family identified mutations in the uncharacterized gene, C4orf26, as a cause of recessive hypomineralized amelogenesis imperfecta (AI), a disease in which the formation of tooth enamel fails. Screening of a panel of 57 autosomal-recessive AI-affected families identified eight further families with loss-of-function mutations in C4orf26. C4orf26 encodes a putative extracellular matrix acidic phosphoprotein expressed in the enamel organ. A mineral nucleation assay showed that the protein’s phosphorylated C terminus has the capacity to promote nucleation of hydroxyapatite, suggesting a possible function in enamel mineralization during amelogenesis. PMID:22901946
Potassium dynamics and seizures: Why is potassium ictogenic?
de Curtis, Marco; Uva, Laura; Gnatkovsky, Vadym; Librizzi, Laura
2018-07-01
Potassium channels dysfunction and altered genes encoding for molecules involved in potassium homeostasis have been associated with human epilepsy. These observations are in agreement with a control role of extracellular potassium on neuronal excitability and seizure generation. Epileptiform activity, in turn, regulates potassium homeostasis through mechanisms that are still not well established. We review here how potassium-associated processes are regulated in the brain and examine the mechanisms that support the role of potassium in triggering epileptiform activities. Copyright © 2018 Elsevier B.V. All rights reserved.
Minias, Piotr; Bateson, Zachary W.; Whittingham, Linda A.; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O.
2016-01-01
Genes of the major histocompatibility complex (MHC) encode receptor molecules that are responsible for recognition of intracellular and extracellular pathogens (class I and class II genes, respectively) in vertebrates. Given the different roles of class I and II MHC genes, one might expect the strength of selection to differ between these two classes. Different selective pressures may also promote different rates of gene conversion at each class. Despite these predictions, surprisingly few studies have looked at differences between class I and II genes in terms of both selection and gene conversion. Here, we investigated the molecular evolution of MHC class I and II genes in five closely related species of prairie grouse (Centrocercus and Tympanuchus) that possess one class I and two class II loci. We found striking differences in the strength of balancing selection acting on MHC class I versus class II genes. More than half of the putative antigen-binding sites (ABS) of class II were under positive or episodic diversifying selection, compared with only 10% at class I. We also found that gene conversion had a stronger role in shaping the evolution of MHC class II than class I. Overall, the combination of strong positive (balancing) selection and frequent gene conversion has maintained higher diversity of MHC class II than class I in prairie grouse. This is one of the first studies clearly demonstrating that macroevolutionary mechanisms can act differently on genes involved in the immune response against intracellular and extracellular pathogens.
Minias, P; Bateson, Z W; Whittingham, L A; Johnson, J A; Oyler-McCance, S; Dunn, P O
2016-01-01
Genes of the major histocompatibility complex (MHC) encode receptor molecules that are responsible for recognition of intracellular and extracellular pathogens (class I and class II genes, respectively) in vertebrates. Given the different roles of class I and II MHC genes, one might expect the strength of selection to differ between these two classes. Different selective pressures may also promote different rates of gene conversion at each class. Despite these predictions, surprisingly few studies have looked at differences between class I and II genes in terms of both selection and gene conversion. Here, we investigated the molecular evolution of MHC class I and II genes in five closely related species of prairie grouse (Centrocercus and Tympanuchus) that possess one class I and two class II loci. We found striking differences in the strength of balancing selection acting on MHC class I versus class II genes. More than half of the putative antigen-binding sites (ABS) of class II were under positive or episodic diversifying selection, compared with only 10% at class I. We also found that gene conversion had a stronger role in shaping the evolution of MHC class II than class I. Overall, the combination of strong positive (balancing) selection and frequent gene conversion has maintained higher diversity of MHC class II than class I in prairie grouse. This is one of the first studies clearly demonstrating that macroevolutionary mechanisms can act differently on genes involved in the immune response against intracellular and extracellular pathogens. PMID:26860199
Short genome report of cellulose-producing commensal Escherichia coli 1094.
Bernal-Bayard, Joaquin; Gomez-Valero, Laura; Wessel, Aimee; Khanna, Varun; Bouchier, Christiane; Ghigo, Jean-Marc
2018-01-01
Bacterial surface colonization and biofilm formation often rely on the production of an extracellular polymeric matrix that mediates cell-cell and cell-surface contacts. In Escherichia coli and many Betaproteobacteria and Gammaproteobacteria cellulose is often the main component of the extracellular matrix. Here we report the complete genome sequence of the cellulose producing strain E. coli 1094 and compare it with five other closely related genomes within E. coli phylogenetic group A. We present a comparative analysis of the regions encoding genes responsible for cellulose biosynthesis and discuss the changes that could have led to the loss of this important adaptive advantage in several E. coli strains. Data deposition: The annotated genome sequence has been deposited at the European Nucleotide Archive under the accession number PRJEB21000.
Isolation and analysis of lipase-overproducing mutants of Serratia marcescens.
Kawai, E; Akatsuka, H; Sakurai, N; Idei, A; Matsumae, H; Shibatani, T; Komatsubara, S; Omori, K
2001-01-01
We have isolated a lipase-overproducing mutant, GE14, from Serratia marcescens 8000 after three rounds of N-methyl-N'-nitro-N-nitrosoguanidine mutagenesis. The mutant GE14 produced 95 kU/ml of extracellular lipase in the lipase medium, which was about threefold higher than that of produced by the original strain 8000. Enzymatic characteristics including specific activity of purified lipases from culture supernatants of GE14 and 8000 were almost same. The lipase gene (lipA) of GE14 contained two base substitutions; one in the promoter region and another in the N-terminal region of the lipA gene without an amino acid substitution. Promoter analysis using lipA-lacZ fusion plasmids revealed that these substitutions were responsible for the increase in the lipA expression level, independently. In contrast, no base substitution was found in the genes encoding the lipase secretion device, the Lip system. In addition, the genes coding for metalloprotease and the cell surface layer protein which are both secreted through the Lip system and associated with extracellular lipase production, also contained no base substitution. The strain GE14 carrying a high-copy-number lipA plasmid produced a larger amount of the extracellular lipase than the recombinant strains of 8000 and other mutants also did, indicating that GE14 was not only a lipase-overproducing strain, but also an advantageous host strain for overproducing the lipase by a recombinant DNA technique. These results suggest that the lipase-overproducing mutant GE14 and its recombinant strains are promising candidates for the industrial production of the S. marcescens lipase.
Muhonen, Virpi; Narcisi, Roberto; Nystedt, Johanna; Korhonen, Matti; van Osch, Gerjo J V M; Kiviranta, Ilkka
2017-03-01
Recombinant human type II collagen (rhCII) hydrogel was tested as a xeno-free micro-environment for the chondrogenesis of human bone marrow-derived mesenchymal stromal cells (BM-MSCs). The rhCII hydrogels were seeded with BM-MSCs and cultured in a xeno-free chondro-inductive medium for 14, 28 and 84 days. High-density pellet cultures served as controls. The samples were subjected to biochemical, histological and gene expression analyses. Although the cells deposited glycosaminoglycans into the extracellular space significantly more slowly in the rhCII hydrogels compared to the high-density pellets, a similar potential of matrix deposition was reached by the end of the 84-day culture. At day 28 of culture, the gene expression level for cartilage marker genes (i.e. genes encoding for Sox9 transcription factor, Collagen type II and Aggrecan) were considerably lower in the rhCII hydrogels than in the high-density pellets, but at the end of the 84-day culture period, all the cartilage marker genes analysed were expressed at a similar level. Interestingly, the expression of the matrix metallopeptidases (MMP)-13, MMP-14 and MMP-8, i.e. extracellular collagen network-degrading enzymes, were transiently upregulated in the rhCII hydrogel, indicating active matrix reorganization. This study demonstrated that the rhCII hydrogel functions as a xeno-free platform for BM-MSC chondrogenesis, although the process is delayed. The reversible catabolic reaction evoked by the rhCII hydrogel might be beneficial in graft integration in vivo and pinpoints the need to further explore the use of hydrogels containing recombinant extracellular matrix (ECM) proteins to induce the chondrogenesis of MSCs. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.
Efficient production of artificially designed gelatins with a Bacillus brevis system.
Kajino, T; Takahashi, H; Hirai, M; Yamada, Y
2000-01-01
Artificially designed gelatins comprising tandemly repeated 30-amino-acid peptide units derived from human alphaI collagen were successfully produced with a Bacillus brevis system. The DNA encoding the peptide unit was synthesized by taking into consideration the codon usage of the host cells, but no clones having a tandemly repeated gene were obtained through the above-mentioned strategy. Minirepeat genes could be selected in vivo from a mixture of every possible sequence encoding an artificial gelatin by randomly ligating the mixed sequence unit and transforming it into Escherichia coli. Larger repeat genes constructed by connecting minirepeat genes obtained by in vivo selection were also stable in the expression host cells. Gelatins derived from the eight-unit and six-unit repeat genes were extracellularly produced at the level of 0.5 g/liter and easily purified by ammonium sulfate fractionation and anion-exchange chromatography. The purified artificial gelatins had the predicted N-terminal sequences and amino acid compositions and a solgel property similar to that of the native gelatin. These results suggest that the selection of a repeat unit sequence stable in an expression host is a shortcut for the efficient production of repetitive proteins and that it can conveniently be achieved by the in vivo selection method. This study revealed the possible industrial application of artificially designed repetitive proteins.
Plyuta, V A; Lipasova, V A; Koksharova, O A; Veselova, M A; Kuznetsov, A E; Khmel, I A
2015-08-01
To study the role of Quorum Sensing (QS) regulation in the control of the cellular processes of Burkholderia cenocepacia 370, plasmid pME6863 was transferred into its cells. The plasmid contains a heterologous gene encoding for AiiA N-acyl-homoserine lactonase, which degrades the signaling molecules of the QS system of N-acyl-homoserine lactones (AHL). An absence or reduction of AHL in the culture was revealed with the biosensors Chromobacterium violaceum CV026 and Agrobacterium tumifaciens NT1/pZLR4, respectively. The presence of the aiiA gene, which was cloned from Bacillus sp. A24 in the cells of B. cenocepacia 370, resulted in a lack of hemolytic activity, which reduced the extracellular proteolytic activity and decreased the cells' ability to migration in swarms on the surface of the agar medium. The introduction of the aiiA gene did not affect lipase activity, fatty acids synthesis, HCN synthesis, or biofilm formation. Hydrogen peroxide was shown to stimulate biofilm formation by B. cenocepacia 370 in concentrations that inhibited or weakly suppressed bacterial growth. The introduction of the aiiA gene into the cells did not eliminate this effect but it did reduce it.
Zhu, Jia-Ying; Ze, Sang-Zi; Stanley, David W; Yang, Bin
2014-09-01
Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor. The cDNAs for ecCuZnSOD, icCuZnSOD, and MnSOD, respectively, encode 24.55, 15.81, and 23.14 kDa polypeptides, which possess structural features typical of other insect SODs. They showed 20-94% identity to other known SOD sequences from Bombyx mori, Musca domestica, Nasonia vitripennis, Pediculus humanus corporis, and Tribolium castaneum. Expression of these genes was analyzed in selected tissues and developmental stages, and following exposure to Escherichia coli and parasitization by Scleroderma guani. We recorded expression of all three SODs in cuticle, fat body, and hemocytes and in the major developmental stages. Relatively higher expressions were detected in late-instar larvae and pupae, compared to other developmental stages. Transcriptional levels were upregulated following bacterial infection. Analysis of pupae parasitized by S. guani revealed that expression of T. molitor SOD genes was significantly induced following parasitization. We infer that these genes act in immune response and in host-parasitoid interactions. © 2014 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Chen, Xiwen; Cheng, Anchun; Wang, Mingshu; Xiang, Jun
2011-10-01
In this study, the predicted information about structures and functions of VP23 encoded by the newly identified DEV UL18 gene through bioinformatics softwares and tools. The DEV UL18 was predicted to encode a polypeptide with 322 amino acids, termed VP23, with a putative molecular mass of 35.250 kDa and a predicted isoelectric point (PI) of 8.37, no signal peptide and transmembrane domain in the polypeptide. The prediction of subcellular localization showed that the DEV-VP23 located at endoplasmic reticulum with 33.3%, mitochondrial with 22.2%, extracellular, including cell wall with 11.1%, vesicles of secretory system with 11.1%, Golgi with 11.1%, and plasma membrane with 11.1%. The acid sequence of analysis showed that the potential antigenic epitopes are situated in 45-47, 53-60, 102-105, 173-180, 185-189, 260-265, 267-271, and 292-299 amino acids. All the consequences inevitably provide some insights for further research about the DEV-VP23 and also provide a fundament for further study on the the new type clinical diagnosis of DEV and can be used for the development of new DEV vaccine.
Gleave, A P; Taylor, R K; Morris, B A; Greenwood, D R
1995-09-15
Janthinobacterium lividum secretes a major 56-kDa chitinase and a minor 69-kDa chitinase. A chitinase gene was defined on a 3-kb fragment of clone pRKT10, by virtue of fluorescent colonies in the presence of 4-methylumbelliferyl-beta-D-N,N',N"-chitotrioside. Nucleotide sequencing revealed an 1998-bp open reading frame with the potential to encode a 69,716-Da protein with amino acid sequences similar to those in other chitinases, suggesting it encodes the minor chitinase (Chi69). Chitinase activity of Escherichia coli (pRKT10) lysates was detected mainly in the periplasmic fraction and immunoblotting detected a 70-kDa protein in this fraction. Chi69 has an N-terminal secretory leader peptide preceding two probable chitin-binding domains and a catalytic domain. These functional domains are separated by linker regions of proline-threonine repeats. Amino acid sequencing of cyanogen bromide cleavage-derived peptides from the major 56-kDa chitinase suggested that Chi69 may be a precursor of Chi56. In addition, an N-terminally truncated version of Chi69 retained chitinase activity as expected if in vivo processing of Chi69 generates Chi56.
Gonçalves, A. P.; Monteiro, João; Lucchi, Chiara; Kowbel, David J.; Cordeiro, J. M.; Correia-de-Sá, Paulo; Rigden, Daniel J.; Glass, N. L.; Videira, Arnaldo
2014-01-01
Alterations in the intracellular levels of calcium are a common response to cell death stimuli in animals and fungi and, particularly, in the Neurospora crassa response to staurosporine. We highlight the importance of the extracellular availability of Ca2+ for this response. Limitation of the ion in the culture medium further sensitizes cells to the drug and results in increased accumulation of reactive oxygen species (ROS). Conversely, an approximately 30-fold excess of external Ca2+ leads to increased drug tolerance and lower ROS generation. In line with this, distinct staurosporine-induced cytosolic Ca2+ signaling profiles were observed in the absence or presence of excessive external Ca2+. High-throughput RNA sequencing revealed that different concentrations of extracellular Ca2+ define distinct transcriptional programs. Our transcriptional profiling also pointed to two putative novel Ca2+-binding proteins, encoded by the NCU08524 and NCU06607 genes, and provides a reference dataset for future investigations on the role of Ca2+ in fungal biology. PMID:28357255
Hemker, Michael; Stratmann, Ansgar; Goeke, Klaus; Schröder, Werner; Lenz, Jürgen; Piepersberg, Wolfgang; Pape, Hermann
2001-01-01
An extracellular enzyme activity in the culture supernatant of the acarbose producer Actinoplanes sp. strain SE50 catalyzes the transfer of the acarviosyl moiety of acarbose to malto-oligosaccharides. This acarviosyl transferase (ATase) is encoded by a gene, acbD, in the putative biosynthetic gene cluster for the α-glucosidase inhibitor acarbose. The acbD gene was cloned and heterologously produced in Streptomyces lividans TK23. The recombinant protein was analyzed by enzyme assays. The AcbD protein (724 amino acids) displays all of the features of extracellular α-glucosidases and/or transglycosylases of the α-amylase family and exhibits the highest similarities to several cyclodextrin glucanotransferases (CGTases). However, AcbD had neither α-amylase nor CGTase activity. The AcbD protein was purified to homogeneity, and it was identified by partial protein sequencing of tryptic peptides. AcbD had an apparent molecular mass of 76 kDa and an isoelectric point of 5.0 and required Ca2+ ions for activity. The enzyme displayed maximal activity at 30°C and between pH 6.2 and 6.9. The Km values of the ATase for acarbose (donor substrate) and maltose (acceptor substrate) are 0.65 and 0.96 mM, respectively. A wide range of additional donor and acceptor substrates were determined for the enzyme. Acceptors revealed a structural requirement for glucose-analogous structures conserving only the overall stereochemistry, except for the anomeric C atom, and the hydroxyl groups at positions 2, 3, and 4 of d-glucose. We discuss here the function of the enzyme in the extracellular formation of the series of acarbose-homologous compounds produced by Actinoplanes sp. strain SE50. PMID:11443082
Coletta, Dawn K.
2011-01-01
Insulin resistance in skeletal muscle is a prominent feature of obesity and type 2 diabetes. The association between mitochondrial changes and insulin resistance is well known. More recently, there is growing evidence of a relationship between inflammation, extracellular remodeling, and insulin resistance. The intent of this review is to propose a potentially novel mechanism for the development of insulin resistance, focusing on the underappreciated connections among inflammation, extracellular remodeling, cytoskeletal interactions, mitochondrial function, and insulin resistance in human skeletal muscle. Several sources of inflammation, including expansion of adipose tissue resulting in increased lipolysis and alterations in pro- and anti-inflammatory cytokines, contribute to the insulin resistance observed in obesity and type 2 diabetes. In the experimental model of lipid oversupply, an inflammatory response in skeletal muscle leads to altered expression extracellular matrix-related genes as well as nuclear encoded mitochondrial genes. A similar pattern also is observed in “naturally” occurring insulin resistance in muscle of obese nondiabetic individuals and patients with type 2 diabetes mellitus. More recently, alterations in proteins (including α-actinin-2, desmin, proteasomes, and chaperones) involved in muscle structure and function have been observed in insulin-resistant muscle. Some of these cytoskeletal proteins are mechanosignal transducers that allow muscle fibers to sense contractile activity and respond appropriately. The ensuing alterations in expression of genes coding for mitochondrial proteins and cytoskeletal proteins may contribute to the mitochondrial changes observed in insulin-resistant muscle. These changes in turn may lead to a reduction in fat oxidation and an increase in intramyocellular lipid, which contributes to the defects in insulin signaling in insulin resistance. PMID:21862724
Export of extracellular polysaccharides modulates adherence of the Cyanobacterium synechocystis.
Fisher, Michael L; Allen, Rebecca; Luo, Yingqin; Curtiss, Roy
2013-01-01
The field of cyanobacterial biofuel production is advancing rapidly, yet we know little of the basic biology of these organisms outside of their photosynthetic pathways. We aimed to gain a greater understanding of how the cyanobacterium Synechocystis PCC 6803 (Synechocystis, hereafter) modulates its cell surface. Such understanding will allow for the creation of mutants that autoflocculate in a regulated way, thus avoiding energy intensive centrifugation in the creation of biofuels. We constructed mutant strains lacking genes predicted to function in carbohydrate transport or synthesis. Strains with gene deletions of slr0977 (predicted to encode a permease component of an ABC transporter), slr0982 (predicted to encode an ATP binding component of an ABC transporter) and slr1610 (predicted to encode a methyltransferase) demonstrated flocculent phenotypes and increased adherence to glass. Upon bioinformatic inspection, the gene products of slr0977, slr0982, and slr1610 appear to function in O-antigen (OAg) transport and synthesis. However, the analysis provided here demonstrated no differences between OAg purified from wild-type and mutants. However, exopolysaccharides (EPS) purified from mutants were altered in composition when compared to wild-type. Our data suggest that there are multiple means to modulate the cell surface of Synechocystis by disrupting different combinations of ABC transporters and/or glycosyl transferases. Further understanding of these mechanisms may allow for the development of industrially and ecologically useful strains of cyanobacteria. Additionally, these data imply that many cyanobacterial gene products may possess as-yet undiscovered functions, and are meritorious of further study.
Jang, Ji-Woong; Jung, Hwi-Min; Im, Dae-Kyun; Jung, Moo-Young; Oh, Min-Kyu
2017-11-01
Enterobacter aerogenes was metabolically engineered for acetoin production. To remove the pathway enzymes that catalyzed the formation of by-products, the three genes encoding a lactate dehydrogenase (ldhA) and two 2,3-butanediol dehydrogenases (budC, and dhaD), respectively, were deleted from the genome. The acetoin production was higher under highly aerobic conditions. However, an extracellular glucose oxidative pathway in E. aerogenes was activated under the aerobic conditions, resulting in the accumulation of 2-ketogluconate. To decrease the accumulation of this by-product, the gene encoding a glucose dehydrogenase (gcd) was also deleted. The resulting strain did not produce 2-ketogluconate but produced significant amounts of acetoin, with concentration reaching 71.7g/L with 2.87g/L/h productivity in fed-batch fermentation. This result demonstrated the importance of blocking the glucose oxidative pathway under highly aerobic conditions for acetoin production using E. aerogenes. Copyright © 2017 Elsevier Inc. All rights reserved.
Verdon, Quentin; Boonen, Marielle; Ribes, Christopher; Jadot, Michel; Sagné, Corinne
2017-01-01
Lysosomes degrade cellular components sequestered by autophagy or extracellular material internalized by endocytosis and phagocytosis. The macromolecule building blocks released by lysosomal hydrolysis are then exported to the cytosol by lysosomal transporters, which remain undercharacterized. In this study, we designed an in situ assay of lysosomal amino acid export based on the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis that detects lysosomal storage. This assay was used to screen candidate lysosomal transporters, leading to the identification of sodium-coupled neutral amino acid transporter 7 (SNAT7), encoded by the SLC38A7 gene, as a lysosomal transporter highly selective for glutamine and asparagine. Cell fractionation confirmed the lysosomal localization of SNAT7, and flux measurements confirmed its substrate selectivity and showed a strong activation by the lysosomal pH gradient. Interestingly, gene silencing or editing experiments revealed that SNAT7 is the primary permeation pathway for glutamine across the lysosomal membrane and it is required for growth of cancer cells in a low free-glutamine environment, when macropinocytosis and lysosomal degradation of extracellular proteins are used as an alternative source of amino acids. SNAT7 may, thus, represent a novel target for glutamine-related anticancer therapies. PMID:28416685
Lee, Jeffrey C; Vivanco, Igor; Beroukhim, Rameen; Huang, Julie H. Y; Feng, Whei L; DeBiasi, Ralph M; Yoshimoto, Koji; King, Jennifer C; Nghiemphu, Phioanh; Yuza, Yuki; Xu, Qing; Greulich, Heidi; Thomas, Roman K; Paez, J. Guillermo; Peck, Timothy C; Linhart, David J; Glatt, Karen A; Getz, Gad; Onofrio, Robert; Ziaugra, Liuda; Levine, Ross L; Gabriel, Stacey; Kawaguchi, Tomohiro; O'Neill, Keith; Khan, Haumith; Liau, Linda M; Nelson, Stanley F; Rao, P. Nagesh; Mischel, Paul; Pieper, Russell O; Cloughesy, Tim; Leahy, Daniel J; Sellers, William R; Sawyers, Charles L; Meyerson, Matthew; Mellinghoff, Ingo K
2006-01-01
Background Protein tyrosine kinases are important regulators of cellular homeostasis with tightly controlled catalytic activity. Mutations in kinase-encoding genes can relieve the autoinhibitory constraints on kinase activity, can promote malignant transformation, and appear to be a major determinant of response to kinase inhibitor therapy. Missense mutations in the EGFR kinase domain, for example, have recently been identified in patients who showed clinical responses to EGFR kinase inhibitor therapy. Methods and Findings Encouraged by the promising clinical activity of epidermal growth factor receptor (EGFR) kinase inhibitors in treating glioblastoma in humans, we have sequenced the complete EGFR coding sequence in glioma tumor samples and cell lines. We identified novel missense mutations in the extracellular domain of EGFR in 13.6% (18/132) of glioblastomas and 12.5% (1/8) of glioblastoma cell lines. These EGFR mutations were associated with increased EGFR gene dosage and conferred anchorage-independent growth and tumorigenicity to NIH-3T3 cells. Cells transformed by expression of these EGFR mutants were sensitive to small-molecule EGFR kinase inhibitors. Conclusions Our results suggest extracellular missense mutations as a novel mechanism for oncogenic EGFR activation and may help identify patients who can benefit from EGFR kinase inhibitors for treatment of glioblastoma. PMID:17177598
Ivanov, Sergey V.; Kuzmin, Igor; Wei, Ming-Hui; Pack, Svetlana; Geil, Laura; Johnson, Bruce E.; Stanbridge, Eric J.; Lerman, Michael I.
1998-01-01
To discover genes involved in von Hippel-Lindau (VHL)-mediated carcinogenesis, we used renal cell carcinoma cell lines stably transfected with wild-type VHL-expressing transgenes. Large-scale RNA differential display technology applied to these cell lines identified several differentially expressed genes, including an alpha carbonic anhydrase gene, termed CA12. The deduced protein sequence was classified as a one-pass transmembrane CA possessing an apparently intact catalytic domain in the extracellular CA module. Reintroduced wild-type VHL strongly inhibited the overexpression of the CA12 gene in the parental renal cell carcinoma cell lines. Similar results were obtained with CA9, encoding another transmembrane CA with an intact catalytic domain. Although both domains of the VHL protein contribute to regulation of CA12 expression, the elongin binding domain alone could effectively regulate CA9 expression. We mapped CA12 and CA9 loci to chromosome bands 15q22 and 17q21.2 respectively, regions prone to amplification in some human cancers. Additional experiments are needed to define the role of CA IX and CA XII enzymes in the regulation of pH in the extracellular microenvironment and its potential impact on cancer cell growth. PMID:9770531
Turgeon, B; Saba-El-Leil, M K; Meloche, S
2000-02-15
MAP (mitogen-activated protein) kinases are a family of serine/threonine kinases that have a pivotal role in signal transduction. Here we report the cloning and characterization of a mouse homologue of extracellular-signal-regulated protein kinase (ERK)3. The mouse Erk3 cDNA encodes a predicted protein of 720 residues, which displays 94% identity with human ERK3. Transcription and translation of this cDNA in vitro generates a 100 kDa protein similar to the human gene product ERK3. Immunoblot analysis with an antibody raised against a unique sequence of ERK3 also recognizes a 100 kDa protein in mouse tissues. A single transcript of Erk3 was detected in every adult mouse tissue examined, with the highest expression being found in the brain. Interestingly, expression of Erk3 mRNA is acutely regulated during mouse development, with a peak of expression observed at embryonic day 11. The mouse Erk3 gene was mapped to a single locus on central mouse chromosome 9, adjacent to the dilute mutation locus and in a region syntenic to human chromosome 15q21. Finally, we provide several lines of evidence to support the existence of a unique Erk3 gene product of 100 kDa in mammalian cells.
Busch-Nentwich, Elisabeth; Söllner, Christian; Roehl, Henry; Nicolson, Teresa
2004-02-01
Over 30 genes responsible for human hereditary hearing loss have been identified during the last 10 years. The proteins encoded by these genes play roles in a diverse set of cellular functions ranging from transcriptional regulation to K(+) recycling. In a few cases, the genes are novel and do not give much insight into the cellular or molecular cause for the hearing loss. Among these poorly understood deafness genes is DFNA5. How the truncation of the encoded protein DFNA5 leads to an autosomal dominant form of hearing loss is not clear. In order to understand the biological role of Dfna5, we took a reversegenetic approach in zebrafish. Here we show that morpholino antisense nucleotide knock-down of dfna5 function in zebrafish leads to disorganization of the developing semicircular canals and reduction of pharyngeal cartilage. This phenotype closely resembles previously isolated zebrafish craniofacial mutants including the mutant jekyll. jekyll encodes Ugdh [uridine 5'-diphosphate (UDP)-glucose dehydrogenase], an enzyme that is crucial for production of the extracellular matrix component hyaluronic acid (HA). In dfna5 morphants, expression of ugdh is absent in the developing ear and pharyngeal arches, and HA levels are strongly reduced in the outgrowing protrusions of the developing semicircular canals. Previous studies suggest that HA is essential for differentiating cartilage and directed outgrowth of the epithelial protrusions in the developing ear. We hypothesize that the reduction of HA production leads to uncoordinated outgrowth of the canal columns and impaired facial cartilage differentiation.
Takaku, Hiroaki; Kimoto, Ayumi; Kodaira, Shoko; Nashimoto, Masayuki; Takagi, Masamichi
2006-11-01
A Gram-positive poly(3-hydroxybutyrate) (PHB)-degrading bacterial strain was isolated from compost. This organism, identified as Bacillus megaterium N-18-25-9, produced a clearing zone on opaque NB-PHB agar, indicating the presence of extracellular PHB depolymerase. A PHB depolymerase gene, PhaZ(Bm), of B. megaterium N-18-25-9 was cloned and sequenced, and the recombinant gene product was purified from Escherichia coli. The N-terminal half region of PhaZ(Bm) shared significant homologies with a catalytic domain of other PHB depolymerases. Although the C-terminal half region of PhaZ(Bm) showed no significant similarity with those of other PHB depolymerases, that region was necessary for the PHB depolymerase activity. Therefore, this enzyme's domain structure is unique among extracellular PHB depolymerase domain structures. The addition of PHB to the medium led to a sixfold increase in PhaZ(Bm) mRNA, while the presence of glucose repressed PhaZ(Bm) expression. The maximum activity was observed at pH 9.0 at 65 degrees C.
Noguchi, Yuji; Sano, Motoaki; Kanamaru, Kyoko; Ko, Taro; Takeuchi, Michio; Kato, Masashi; Kobayashi, Tetsuo
2009-11-01
XlnR is a Zn(II)2Cys6 transcriptional activator of xylanolytic and cellulolytic genes in Aspergillus. Overexpression of the aoxlnR gene in Aspergillus oryzae (A. oryzae xlnR gene) resulted in elevated xylanolytic and cellulolytic activities in the culture supernatant, in which nearly 40 secreted proteins were detected by two-dimensional electrophoresis. DNA microarray analysis to identify the transcriptional targets of AoXlnR led to the identification of 75 genes that showed more than fivefold increase in their expression in the AoXlnR overproducer than in the disruptant. Of these, 32 genes were predicted to encode a glycoside hydrolase, highlighting the biotechnological importance of AoXlnR in biomass degradation. The 75 genes included the genes previously identified as AoXlnR targets (xynF1, xynF3, xynG2, xylA, celA, celB, celC, and celD). Thirty-six genes were predicted to be extracellular, which was consistent with the number of proteins secreted, and 61 genes possessed putative XlnR-binding sites (5'-GGCTAA-3', 5'-GGCTAG-3', and 5'-GGCTGA-3') in their promoter regions. Functional annotation of the genes revealed that AoXlnR regulated the expression of hydrolytic genes for degradation of beta-1,4-xylan, arabinoxylan, cellulose, and xyloglucan and of catabolic genes for the conversion of D-xylose to xylulose-5-phosphate. In addition, genes encoding glucose-6-phosphate 1-dehydrogenase and L-arabinitol-4- dehydrogenase involved in D-glucose and L-arabinose catabolism also appeared to be targets of AoXlnR.
Pusztahelyi, T; Molnár, Z; Emri, T; Klement, E; Miskei, M; Kerékgyárto, J; Balla, J; Pócsi, I
2006-01-01
N-Acetyl-D-glucosamine, chito-oligomers and carbon starvation regulated chiA, chiB, and nagA gene expressions in Aspergillus nidulans cultures. The gene expression patterns of the main extracellular endochitinase ChiB and the N-acetyl-beta-D-glucosaminidase NagA were similar, and the ChiB-NagA enzyme system may play a morphological and/or nutritional role during autolysis. Alterations in the levels of reactive oxygen species or in the glutathione-glutathione disulfide redox balance, characteristic physiological changes developing in ageing and autolyzing fungal cultures, did not affect the regulation of either the growth-related chiA or the autolysis-coupled chiB genes although both of them were down-regulated under diamide stress. The transcription of the chiC gene with unknown physiological function was repressed by increased intracellular superoxide concentration.
Extracellular ATP Acts on Jasmonate Signaling to Reinforce Plant Defense.
Tripathi, Diwaker; Zhang, Tong; Koo, Abraham J; Stacey, Gary; Tanaka, Kiwamu
2018-01-01
Damaged cells send various signals to stimulate defense responses. Recent identification and genetic studies of the plant purinoceptor, P2K1 (also known as DORN1), have demonstrated that extracellular ATP is a signal involved in plant stress responses, including wounding, perhaps to evoke plant defense. However, it remains largely unknown how extracellular ATP induces plant defense responses. Here, we demonstrate that extracellular ATP induces plant defense mediated through activation of the intracellular signaling of jasmonate (JA), a well-characterized defense hormone. In Arabidopsis ( Arabidopsis thaliana ) leaves, ATP pretreatment induced resistance against the necrotrophic fungus, Botrytis cinerea The induced resistance was enhanced in the P2K1 receptor overexpression line, but reduced in the receptor mutant, dorn1 - 3 Mining the transcriptome data revealed that ATP induces a set of JA-induced genes. In addition, the P2K1-associated coexpression network contains defense-related genes, including those encoding jasmonate ZIM-domain (JAZ) proteins, which play key roles as repressors of JA signaling. We examined whether extracellular ATP impacts the stability of JAZ1 in Arabidopsis. The results showed that the JAZ1 stability decreased in response to ATP addition in a proteasome-dependent manner. This reduction required intracellular signaling via second messengers-cytosolic calcium, reactive oxygen species, and nitric oxide. Interestingly, the ATP-induced JAZ1 degradation was attenuated in the JA receptor mutant, coi1 , but not in the JA biosynthesis mutant, aos , or upon addition of JA biosynthesis inhibitors. Immunoprecipitation analysis demonstrated that ATP increases the interaction between COI1 and JAZ1, suggesting direct cross talk between extracellular ATP and JA in intracellular signaling events. Taken together, these results suggest that extracellular ATP signaling directly impacts the JA signaling pathway to maximize plant defense responses. © 2018 American Society of Plant Biologists. All Rights Reserved.
Tiaden, André; Spirig, Thomas; Sahr, Tobias; Wälti, Martin A; Boucke, Karin; Buchrieser, Carmen; Hilbi, Hubert
2010-05-01
The amoebae-resistant opportunistic pathogen Legionella pneumophila employs a biphasic life cycle to replicate in host cells and spread to new niches. Upon entering the stationary growth phase, the bacteria switch to a transmissive (virulent) state, which involves a complex regulatory network including the lqs gene cluster (lqsA-lqsR-hdeD-lqsS). LqsR is a putative response regulator that promotes host-pathogen interactions and represses replication. The autoinducer synthase LqsA catalyses the production of the diffusible signalling molecule 3-hydroxypentadecan-4-one (LAI-1) that is presumably recognized by the sensor kinase LqsS. Here, we analysed L. pneumophila strains lacking lqsA or lqsS. Compared with wild-type L. pneumophila, the DeltalqsS strain was more salt-resistant and impaired for the Icm/Dot type IV secretion system-dependent uptake by phagocytes. Legionella pneumophila strains lacking lqsS, lqsR or the alternative sigma factor rpoS sedimented more slowly and produced extracellular filaments. Deletion of lqsA moderately reduced the uptake of L. pneumophila by phagocytes, and the defect was complemented by expressing lqsA in trans. Unexpectedly, the overexpression of lqsA also restored the virulence defect and reduced filament production of L. pneumophila mutant strains lacking lqsS or lqsR, but not the phenotypes of strains lacking rpoS or icmT. These results suggest that LqsA products also signal through sensors not encoded by the lqs gene cluster. A transcriptome analysis of the DeltalqsA and DeltalqsS mutant strains revealed that under the conditions tested, lqsA regulated only few genes, whereas lqsS upregulated the expression of 93 genes at least twofold. These include 52 genes clustered in a 133 kb high plasticity genomic island, which is flanked by putative DNA-mobilizing genes and encodes multiple metal ion efflux pumps. Upon overexpression of lqsA, a cluster of 19 genes in the genomic island was also upregulated, suggesting that LqsA and LqsS participate in the same regulatory circuit.
Andersson, R A; Palva, E T; Pirhonen, M
1999-07-01
The main virulence factors of Erwinia carotovora subsp. carotovora, the secreted, extracellular cell-wall-degrading enzymes, are controlled by several regulatory mechanisms. We have isolated transposon mutants with reduced virulence on tobacco. One of these mutants, with a mutation in a gene designated expM, was characterized in this study. This mutant produces slightly reduced amounts of extracellular enzymes in vitro and the secretion of the enzymes is also affected. The expM wild-type allele was cloned together with an upstream gene, designated expL, that has an unknown function. The expM gene was sequenced and found to encode a protein with similarity to the RssB/SprE protein of Escherichia coli and the MviA protein of Salmonella typhimurium. These proteins belong to a new type of two-component response regulators that negatively regulate the stability of the Sigma factor RpoS (sigma s) at the protein level. The results of this study suggest that ExpM has a similar function in E. carotovora subsp. carotovora. We also provide evidence that the overproduction of RpoS in the expM mutant is an important factor for the reduced virulence phenotype and that it partly causes the observed phenotype seen in vitro. However, an expM/rpoS double mutant is still affected in secretion of extracellular enzymes, suggesting that ExpM in addition to RpoS also acts on other targets.
Imaging extracellular ATP with a genetically-encoded, ratiometric fluorescent sensor
Conley, Jason M.
2017-01-01
Extracellular adenosine triphosphate (ATP) is a key purinergic signal that mediates cell-to-cell communication both within and between organ systems. We address the need for a robust and minimally invasive approach to measuring extracellular ATP by re-engineering the ATeam ATP sensor to be expressed on the cell surface. Using this approach, we image real-time changes in extracellular ATP levels with a sensor that is fully genetically-encoded and does not require an exogenous substrate. In addition, the sensor is ratiometric to allow for reliable quantitation of extracellular ATP fluxes. Using live-cell microscopy, we characterize sensor performance when expressed on cultured Neuro2A cells, and we measure both stimulated release of ATP and its clearance by ectonucleotidases. Thus, this proof-of-principle demonstrates a first-generation sensor to report extracellular ATP dynamics that may be useful for studying purinergic signaling in living specimens. PMID:29121644
Salame, Tomer M; Knop, Doriv; Levinson, Dana; Mabjeesh, Sameer J; Yarden, Oded; Hadar, Yitzhak
2014-01-01
Lignin biodegradation by white-rot fungi is pivotal to the earth's carbon cycle. Manganese peroxidases (MnPs), the most common extracellular ligninolytic peroxidases produced by white-rot fungi, are considered key in ligninolysis. Pleurotus ostreatus, the oyster mushroom, is a preferential lignin degrader occupying niches rich in lignocellulose such as decaying trees. Here, we provide direct, genetically based proof for the functional significance of MnP to P. ostreatus ligninolytic capacity under conditions mimicking its natural habitat. When grown on a natural lignocellulosic substrate of cotton stalks under solid-state culture conditions, gene and isoenzyme expression profiles of its short MnP and versatile peroxidase (VP)-encoding gene family revealed that mnp2 was predominately expressed. mnp2, encoding the versatile short MnP isoenzyme 2 was disrupted. Inactivation of mnp2 resulted in three interrelated phenotypes, relative to the wild-type strain: (i) reduction of 14% and 36% in lignin mineralization of stalks non-amended and amended with Mn(2+), respectively; (ii) marked reduction of the bioconverted lignocellulose sensitivity to subsequent bacterial hydrolyses; and (iii) decrease in fungal respiration rate. These results may serve as the basis to clarify the roles of the various types of fungal MnPs and VPs in their contribution to white-rot decay of wood and lignocellulose in various ecosystems. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Kyöstiö, S R; Cramer, C L; Lacy, G H
1991-01-01
The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878
Kim, Jong-Hyun; Sunako, Michihiro; Ono, Hisayo; Murooka, Yoshikatsu; Fukusaki, Eiichiro; Yamashita, Mitsuo
2008-11-01
A starch-hydrolyzing lactic acid bacterium, Lactobacillus plantarum L137, was isolated from traditional fermented food made from fish and rice in the Philippines. A gene (apuA) encoding an amylolytic enzyme from Lactobacillus plantarum L137 was cloned, and its nucleotide sequence was determined. The apuA gene consisted of an open reading frame of 6171 bp encoding a protein of 2056 amino acids, the molecular mass of which was calculated to be 215,625 Da. The catalytic domains of amylase and pullulanase were located in the same region within the middle of the N-terminal region. The deduced amino acid sequence revealed four highly conserved regions that are common among amylolytic enzymes. In the N-terminal region, a six-amino-acid sequence (Asp-Ala/Thr-Ala-Asn-Ser-Thr) is repeated 39 times, and a three-amino-acid sequence (Gln-Pro-Thr) is repeated 50 times in the C-terminal region. The apuA gene was subcloned in L. plantarum NCL21, which is a plasmid-cured derivative of the wild-type L137 strain and has no amylopullulanase activity, and the gene was overexpressed under the control of its own promoter. The ApuA enzyme from this recombinant L. plantarum NCL21 harboring apuA gene was purified. The enzyme has both alpha-amylase and pullulanase activities. The N-terminal sequence of the purified enzyme showed that the signal peptide was cleaved at Ala(36) and the molecular mass of the mature extracellular enzyme is 211,537 Da. The major reaction products from soluble starch were maltotriose (G3) and maltotetraose (G4). Only maltotriose (G3) was produced from pullulan. From these results, we concluded that ApuA is an amylolytic enzyme belonging to the amylopullulanase family.
Solé, Magali; Müller, Ines; Pecyna, Marek J.; Fetzer, Ingo; Harms, Hauke
2012-01-01
To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 μM, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244
Lin, Michael K; Yang, Jin; Hsu, Chun Wei; Gore, Anuradha; Bassuk, Alexander G; Brown, Lewis M; Colligan, Ryan; Sengillo, Jesse D; Mahajan, Vinit B; Tsang, Stephen H
2018-05-05
High-temperature requirement protein A1 (HTRA1) is a serine protease secreted by a number of tissues including retinal pigment epithelium (RPE). A promoter variant of the gene encoding HTRA1 is part of a mutant allele that causes increased HTRA1 expression and contributed to age-related macular degeneration (AMD) in genomewide association studies. AMD is characterized by pathological development of drusen, extracellular deposits of proteins and lipids on the basal side of RPE. The molecular pathogenesis of AMD is not well understood, and understanding dysregulation of the extracellular matrix may be key. We assess the high-risk genotype at 10q26 by proteomic comparison of protein levels of RPE cells with and without the mutation. We show HTRA1 protein level is increased in high-risk RPE cells along with several extracellular matrix proteins, including known HTRA1 cleavage targets LTBP-1 and clusterin. In addition, two novel targets of HTRA1 have been identified: EFEMP1, an extracellular matrix protein mutated in Doyne honeycomb retinal dystrophy, a genetic eye disease similar to AMD, and thrombospondin 1 (TSP1), an inhibitor of angiogenesis. Our data support the role of RPE extracellular deposition with potential effects in compromised barrier to neovascularization in exudative AMD. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
The evolution of mollusc shells.
McDougall, Carmel; Degnan, Bernard M
2018-05-01
Molluscan shells are externally fabricated by specialized epithelial cells on the dorsal mantle. Although a conserved set of regulatory genes appears to underlie specification of mantle progenitor cells, the genes that contribute to the formation of the mature shell are incredibly diverse. Recent comparative analyses of mantle transcriptomes and shell proteomes of gastropods and bivalves are consistent with shell diversity being underpinned by a rapidly evolving mantle secretome (suite of genes expressed in the mantle that encode secreted proteins) that is the product of (a) high rates of gene co-option into and loss from the mantle gene regulatory network, and (b) the rapid evolution of coding sequences, particular those encoding repetitive low complexity domains. Outside a few conserved genes, such as carbonic anhydrase, a so-called "biomineralization toolkit" has yet to be discovered. Despite this, a common suite of protein domains, which are often associated with the extracellular matrix and immunity, appear to have been independently and often uniquely co-opted into the mantle secretomes of different species. The evolvability of the mantle secretome provides a molecular explanation for the evolution and diversity of molluscan shells. These genomic processes are likely to underlie the evolution of other animal biominerals, including coral and echinoderm skeletons. This article is categorized under: Comparative Development and Evolution > Regulation of Organ Diversity Comparative Development and Evolution > Evolutionary Novelties. © 2018 Wiley Periodicals, Inc.
Carbonic anhydrases, EPF2 and a novel protease mediate CO2 control of stomatal development.
Engineer, Cawas B; Ghassemian, Majid; Anderson, Jeffrey C; Peck, Scott C; Hu, Honghong; Schroeder, Julian I
2014-09-11
Environmental stimuli, including elevated carbon dioxide levels, regulate stomatal development; however, the key mechanisms mediating the perception and relay of the CO2 signal to the stomatal development machinery remain elusive. To adapt CO2 intake to water loss, plants regulate the development of stomatal gas exchange pores in the aerial epidermis. A diverse range of plant species show a decrease in stomatal density in response to the continuing rise in atmospheric CO2 (ref. 4). To date, one mutant that exhibits deregulation of this CO2-controlled stomatal development response, hic (which is defective in cell-wall wax biosynthesis, ref. 5), has been identified. Here we show that recently isolated Arabidopsis thaliana β-carbonic anhydrase double mutants (ca1 ca4) exhibit an inversion in their response to elevated CO2, showing increased stomatal development at elevated CO2 levels. We characterized the mechanisms mediating this response and identified an extracellular signalling pathway involved in the regulation of CO2-controlled stomatal development by carbonic anhydrases. RNA-seq analyses of transcripts show that the extracellular pro-peptide-encoding gene EPIDERMAL PATTERNING FACTOR 2 (EPF2), but not EPF1 (ref. 9), is induced in wild-type leaves but not in ca1 ca4 mutant leaves at elevated CO2 levels. Moreover, EPF2 is essential for CO2 control of stomatal development. Using cell-wall proteomic analyses and CO2-dependent transcriptomic analyses, we identified a novel CO2-induced extracellular protease, CRSP (CO2 RESPONSE SECRETED PROTEASE), as a mediator of CO2-controlled stomatal development. Our results identify mechanisms and genes that function in the repression of stomatal development in leaves during atmospheric CO2 elevation, including the carbonic-anhydrase-encoding genes CA1 and CA4 and the secreted protease CRSP, which cleaves the pro-peptide EPF2, in turn repressing stomatal development. Elucidation of these mechanisms advances the understanding of how plants perceive and relay the elevated CO2 signal and provides a framework to guide future research into how environmental challenges can modulate gas exchange in plants.
Carbonic anhydrases, EPF2 and a novel protease mediate CO2 control of stomatal development
Engineer, Cawas B.; Ghassemian, Majid; Anderson, Jeffrey C.; Peck, Scott C.; Hu, Honghong; Schroeder, Julian I.
2014-01-01
Environmental stimuli, including elevated carbon dioxide levels, regulate stomatal development1–3; however, the key mechanisms mediating the perception and relay of the CO2 signal to the stomatal development machinery remain elusive. To adapt CO2 intake to water loss, plants regulate the development of stomatal gas exchange pores in the aerial epidermis. A diverse range of plant species show a decrease in stomatal density in response to the continuing rise in atmospheric CO2 (ref. 4). To date, one mutant that exhibits deregulation of this CO2-controlled stomatal development response, hic (which is defective in cell-wall wax biosynthesis, ref. 5), has been identified. Here we show that recently isolated Arabidopsis thaliana β-carbonic anhydrase double mutants (ca1 ca4)6 exhibit aninversion in their response to elevated CO2, showing increased stomatal development at elevated CO2 levels. We characterized the mechanisms mediating this response and identified an extracellular signalling pathway involved in the regulation of CO2-controlled stomatal development by carbonic anhydrases. RNA-seq analyses of transcripts show that the extracellular pro-peptide-encoding gene EPIDERMAL PATTERNING FACTOR 2 (EPF2)7,8, but not EPF1 (ref. 9), is induced in wild-type leaves but not inca1 ca4 mutant leaves at elevated CO2 levels. Moreover, EPF2 is essential for CO2 control of stomatal development. Using cell-wall proteomic analyses and CO2-dependent transcriptomic analyses, we identified a novel CO2-induced extracellular protease, CRSP (CO2 RESPONSE SECRETED PROTEASE), as a mediator of CO2-controlled stomatal development. Our results identify mechanisms and genes that function in the repression of stomatal development in leaves during atmospheric CO2 elevation, including the carbonic-anhydrase-encoding genes CA1 and CA4 and the secreted protease CRSP, which cleaves the pro-peptide EPF2, in turn repressing stomatal development. Elucidation of these mechanisms advances the understanding of how plants perceive and relay the elevated CO2 signal and provides a framework to guide future research into how environmental challenges can modulate gas exchange in plants. PMID:25043023
Ecophysiology of Freshwater Verrucomicrobia Inferred from Metagenome-Assembled Genomes
He, Shaomei; Stevens, Sarah L. R.; Chan, Leong-Keat; Bertilsson, Stefan; Glavina del Rio, Tijana; Tringe, Susannah G.; Malmstrom, Rex R.
2017-01-01
ABSTRACT Microbes are critical in carbon and nutrient cycling in freshwater ecosystems. Members of the Verrucomicrobia are ubiquitous in such systems, and yet their roles and ecophysiology are not well understood. In this study, we recovered 19 Verrucomicrobia draft genomes by sequencing 184 time-series metagenomes from a eutrophic lake and a humic bog that differ in carbon source and nutrient availabilities. These genomes span four of the seven previously defined Verrucomicrobia subdivisions and greatly expand knowledge of the genomic diversity of freshwater Verrucomicrobia. Genome analysis revealed their potential role as (poly)saccharide degraders in freshwater, uncovered interesting genomic features for this lifestyle, and suggested their adaptation to nutrient availabilities in their environments. Verrucomicrobia populations differ significantly between the two lakes in glycoside hydrolase gene abundance and functional profiles, reflecting the autochthonous and terrestrially derived allochthonous carbon sources of the two ecosystems, respectively. Interestingly, a number of genomes recovered from the bog contained gene clusters that potentially encode a novel porin-multiheme cytochrome c complex and might be involved in extracellular electron transfer in the anoxic humus-rich environment. Notably, most epilimnion genomes have large numbers of so-called “Planctomycete-specific” cytochrome c-encoding genes, which exhibited distribution patterns nearly opposite to those seen with glycoside hydrolase genes, probably associated with the different levels of environmental oxygen availability and carbohydrate complexity between lakes/layers. Overall, the recovered genomes represent a major step toward understanding the role, ecophysiology, and distribution of Verrucomicrobia in freshwater. IMPORTANCE Freshwater Verrucomicrobia spp. are cosmopolitan in lakes and rivers, and yet their roles and ecophysiology are not well understood, as cultured freshwater Verrucomicrobia spp. are restricted to one subdivision of this phylum. Here, we greatly expanded the known genomic diversity of this freshwater lineage by recovering 19 Verrucomicrobia draft genomes from 184 metagenomes collected from a eutrophic lake and a humic bog across multiple years. Most of these genomes represent the first freshwater representatives of several Verrucomicrobia subdivisions. Genomic analysis revealed Verrucomicrobia to be potential (poly)saccharide degraders and suggested their adaptation to carbon sources of different origins in the two contrasting ecosystems. We identified putative extracellular electron transfer genes and so-called “Planctomycete-specific” cytochrome c-encoding genes and identified their distinct distribution patterns between the lakes/layers. Overall, our analysis greatly advances the understanding of the function, ecophysiology, and distribution of freshwater Verrucomicrobia, while highlighting their potential role in freshwater carbon cycling. PMID:28959738
Rather, P N; Parojcic, M M; Paradise, M R
1997-01-01
The chromosomal aac(2')-Ia gene in Providencia stuartii encodes a housekeeping 2'-N-acetyltransferase [AAC(2')-Ia] involved in the acetylation of peptidoglycan. In addition, the AAC(2')-Ia enzyme also acetylates and confers resistance to the clinically important aminoglycoside antibiotics gentamicin, tobramycin, and netilmicin. Expression of the aac(2')-Ia gene was found to be strongly influenced by cell density, with a sharp decrease in aac(2')-Ia mRNA accumulation as cells approached stationary phase. This decrease was mediated by the accumulation of an extracellular factor, designated AR (for acetyltransferase repressing)-factor. AR-factor was produced in both minimal and rich media and acted in a manner that was strongly dose dependent. The activity of AR-factor was also pH dependent, with optimal activity at pH 8.0 and above. Biochemical characterization of conditioned media from P. stuartii has shown that AR-factor is between 500 and 1,000 Da in molecular size and is heat stable. In addition, AR-factor was inactivated by a variety of proteases, suggesting that it may be a small peptide. PMID:9257754
Sharma, Vivek; Salwan, Richa; Sharma, Prem N
2016-09-01
In the present study, production of extracellular proteases by Trichoderma harzianum was evaluated based on the relative gene expression and spectrophotometric assay. The fungal isolates were grown in Czapek Dox Broth medium supplemented with deactivated mycelium of plant fungal pathogens such as Fusarium oxysporum, Colletotrichum capsici, Gloeocercospora sorghi, and Colletotrichum truncatum. The maximum protease activity was detected after 48 h of incubation against Colletotrichum spp. Similarly in qRT-PCR, the relative gene expression of four proteases varied from 48 to 96 h against host pathogens in a time-independent manner. Among proteases, statistically significant upregulation of asp, asp, and srp was observed against Colletotrichum spp., followed by F. oxysporum. But in the case of pepM22, maximum upregulation was observed against F. oxysporum. The variation in enzyme assay and qRT-PCR of proteases at different time intervals against various fungal phytopathogens could be due to the limitation of using casein as a substrate for all types of proteases or protease-encoding transcripts selected for qRT-PCR, which may not be true representative of total protease activity.
Molecular and functional characterization of an invertase secreted by Ashbya gossypii.
Aguiar, Tatiana Q; Dinis, Cláudia; Magalhães, Frederico; Oliveira, Carla; Wiebe, Marilyn G; Penttilä, Merja; Domingues, Lucília
2014-06-01
The repertoire of hydrolytic enzymes natively secreted by the filamentous fungus Ashbya (Eremothecium) gossypii has been poorly explored. Here, an invertase secreted by this flavinogenic fungus was for the first time molecularly and functionally characterized. Invertase activity was detected in A. gossypii culture supernatants and cell-associated fractions. Extracellular invertase migrated in a native polyacrylamide gel as diffuse protein bands, indicating the occurrence of at least two invertase isoforms. Hydrolytic activity toward sucrose was approximately 10 times higher than toward raffinose. Inulin and levan were not hydrolyzed. Production of invertase by A. gossypii was repressed by the presence of glucose in the culture medium. The A. gossypii invertase was demonstrated to be encoded by the AFR529W (AgSUC2) gene, which is highly homologous to the Saccharomyces cerevisiae SUC2 (ScSUC2) gene. Agsuc2 null mutants were unable to hydrolyze sucrose, proving that invertase is encoded by a single gene in A. gossypii. This mutation was functionally complemented by the ScSUC2 and AgSUC2 genes, when expressed from a 2-μm-plasmid. The signal sequences of both AgSuc2p and ScSuc2p were able to direct the secretion of invertase into the culture medium in A. gossypii.
NASA Technical Reports Server (NTRS)
Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.
2004-01-01
The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.
NASA Technical Reports Server (NTRS)
Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.
2004-01-01
The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.
MYB46 Modulates Disease Susceptibility to Botrytis cinerea in Arabidopsis12[W
Ramírez, Vicente; Agorio, Astrid; Coego, Alberto; García-Andrade, Javier; Hernández, M. José; Balaguer, Begoña; Ouwerkerk, Pieter B.F.; Zarra, Ignacio; Vera, Pablo
2011-01-01
In this study, we show that the Arabidopsis (Arabidopsis thaliana) transcription factor MYB46, previously described to regulate secondary cell wall biosynthesis in the vascular tissue of the stem, is pivotal for mediating disease susceptibility to the fungal pathogen Botrytis cinerea. We identified MYB46 by its ability to bind to a new cis-element located in the 5′ promoter region of the pathogen-induced Ep5C gene, which encodes a type III cell wall-bound peroxidase. We present genetic and molecular evidence indicating that MYB46 modulates the magnitude of Ep5C gene induction following pathogenic insults. Moreover, we demonstrate that different myb46 knockdown mutant plants exhibit increased disease resistance to B. cinerea, a phenotype that is accompanied by selective transcriptional reprogramming of a set of genes encoding cell wall proteins and enzymes, of which extracellular type III peroxidases are conspicuous. In essence, our results substantiate that defense-related signaling pathways and cell wall integrity are interconnected and that MYB46 likely functions as a disease susceptibility modulator to B. cinerea through the integration of cell wall remodeling and downstream activation of secondary lines of defense. PMID:21282403
Zhang, L; Guo, Z P; Ding, Z Y; Wang, Z X; Shi, G Y
2012-01-01
The gene mel1, encoding alpha-galactosidase in Schizosaccharomyces pombe, and the gene bgl2, encoding and beta-glucosidase in Trichoderma reesei, were isolated and co-expressed in the industrial ethanol-producing strain of Saccharomyces cerevisiae. The resulting strains were able to grow on cellobiose and melibiose through simultaneous production of sufficient extracellular alpha-galactosidase and beta-glucosidase activity. Under aerobic conditions, the growth rate of the recombinant strain GC 1 co-expressing 2 genes could achieve 0.29 OD600 h(-1) and a biomass yield up to 7.8 g l(-1) dry cell weight on medium containing 10.0 g l(-1) cellobiose and 10.0 g l(-1) melibiose as sole carbohydrate source. Meanwhile, the new strain of S. cerevisiae CG 1 demonstrated the ability to directly produce ethanol from microcrystalline cellulose during simultaneous saccharification and fermentation process. Approximately 36.5 g l(-1) ethanol was produced from 100 g of cellulose supplied with 5 g l(-1) melibose within 60 h. The yield (g of ethanol produced/g of carbohydrate consumed) was 0.44 g/g, which corresponds to 88.0% of the theoretical yield.
The Emerging Role of PEDF in Stem Cell Biology
Elahy, Mina; Baindur-Hudson, Swati; Dass, Crispin R.
2012-01-01
Encoded by a single gene, PEDF is a 50 kDa glycoprotein that is highly conserved and is widely expressed among many tissues. Most secreted PEDF deposits within the extracellular matrix, with cell-type-specific functions. While traditionally PEDF is known as a strong antiangiogenic factor, more recently, as this paper highlights, PEDF has been linked with stem cell biology, and there is now accumulating evidence demonstrating the effects of PEDF in a variety of stem cells, mainly in supporting stem cell survival and maintaining multipotency. PMID:22675247
van der Ven, Amelie T; Kobbe, Birgit; Kohl, Stefan; Shril, Shirlee; Pogoda, Hans-Martin; Imhof, Thomas; Ityel, Hadas; Vivante, Asaf; Chen, Jing; Hwang, Daw-Yang; Connaughton, Dervla M; Mann, Nina; Widmeier, Eugen; Taglienti, Mary; Schmidt, Johanna Magdalena; Nakayama, Makiko; Senguttuvan, Prabha; Kumar, Selvin; Tasic, Velibor; Kehinde, Elijah O; Mane, Shrikant M; Lifton, Richard P; Soliman, Neveen; Lu, Weining; Bauer, Stuart B; Hammerschmidt, Matthias; Wagener, Raimund; Hildebrandt, Friedhelm
2018-01-01
Congenital anomalies of the kidney and urinary tract (CAKUT) are the most common cause (40-50%) of chronic kidney disease (CKD) in children. About 40 monogenic causes of CAKUT have so far been discovered. To date less than 20% of CAKUT cases can be explained by mutations in these 40 genes. To identify additional monogenic causes of CAKUT, we performed whole exome sequencing (WES) and homozygosity mapping (HM) in a patient with CAKUT from Indian origin and consanguineous descent. We identified a homozygous missense mutation (c.1336C>T, p.Arg446Cys) in the gene Von Willebrand factor A domain containing 2 (VWA2). With immunohistochemistry studies on kidneys of newborn (P1) mice, we show that Vwa2 and Fraser extracellular matrix complex subunit 1 (Fras1) co-localize in the nephrogenic zone of the renal cortex. We identified a pronounced expression of Vwa2 in the basement membrane of the ureteric bud (UB) and derivatives of the metanephric mesenchyme (MM). By applying in vitro assays, we demonstrate that the Arg446Cys mutation decreases translocation of monomeric VWA2 protein and increases translocation of aggregated VWA2 protein into the extracellular space. This is potentially due to the additional, unpaired cysteine residue in the mutated protein that is used for intermolecular disulfide bond formation. VWA2 is a known, direct interactor of FRAS1 of the Fraser-Complex (FC). FC-encoding genes and interacting proteins have previously been implicated in the pathogenesis of syndromic and/or isolated CAKUT phenotypes in humans. VWA2 therefore constitutes a very strong candidate in the search for novel CAKUT-causing genes. Our results from in vitro experiments indicate a dose-dependent neomorphic effect of the Arg446Cys homozygous mutation in VWA2.
Tsoutsman, Tatiana; Wang, Xiaoyu; Garchow, Kendra; Riser, Bruce; Twigg, Stephen; Semsarian, Christopher
2013-09-01
Hypertrophic cardiomyopathy (HCM) is the most common inherited primary myocardial disorder. HCM is characterized by interstitial fibrosis and excessive accumulation of extracellular matrix (ECM) proteins. Fibrosis in HCM has been associated with impaired cardiac function and heart failure, and has been considered a key substrate for ventricular arrhythmias and sudden death. The molecular triggers underpinning ECM production are not well established. We have previously developed a double-mutant mouse model of HCM that recapitulates the phenotype seen in humans with multiple mutations, including earlier onset of the disease, progression to a dilated phenotype, severe heart failure and premature mortality. The present study investigated the expression of ECM-encoding genes in severe HCM and heart failure. Significant upregulation of structural Fn1, regulatory Mmp14, Timp1, Serpin3A, SerpinE1, SerpineE2, Tgfβ1, and Tgfβ2; and matricellular Ccn2, Postn, Spp1, Thbs1, Thbs4, and Tnc was evident from the early, pre-phenotype stage. Non-myocytes expressed ECM genes at higher levels than cardiomyocytes in normal and diseased hearts. Synchronous increase of secreted CCN2 and TIMP1 plasma levels and decrease of MMP3 levels were observed in end-stage disease. CCN2 protein expression was increased from early disease in double-mutant hearts and played an important role in ECM responses. It was a powerful modulator of ECM regulatory (Timp1 and SerpinE1) and matricellular protein-encoding (Spp1, Thbs1, Thbs4 and Tnc) gene expression in cardiomyocytes when added exogenously in vitro. Modulation of CCN2 (CTGF, connective tissue growth factor) and associated early ECM changes may represent a new therapeutic target in the treatment and prevention of heart failure in HCM. Copyright © 2013 Elsevier Ltd. All rights reserved.
Mitochondrial functions mediate cellulase gene expression in Trichoderma reesei.
Abrahão-Neto, J; Rossini, C H; el-Gogary, S; Henrique-Silva, F; Crivellaro, O; el-Dorry, H
1995-08-22
We examined the effects of inhibition of mitochondrial functions on the expression of two nuclear genes encoding the extracellular cellobiohydrolase I (cbh1) and endoglucanase I (egl1) of the cellulase system of the filamentous fungus Trichoderma reesei. The cbh1 and egl1 transcripts are repressed at a low oxygen tension, and by glucose at a concentration known to repress mitochondrial respiration. The transcripts are also down-regulated by chemical agents known to dissipate the proton electrochemical gradient of the inner mitochondrial membrane and blocking of the electron-transport chain, such as DNP and KCN, respectively. These results suggest that expression of those transcripts is influenced by the physiological state of the mitochondria. In addition, heterologous gene fusion shows that the sensitivity of the expression of those transcripts to the functional state of the mitochondria is transcriptionally controlled through the 5'-flanking DNA sequence of those genes.
Abnormal gene expression profiles in human ovaries from polycystic ovary syndrome patients.
Jansen, Erik; Laven, Joop S E; Dommerholt, Henri B R; Polman, Jan; van Rijt, Cindy; van den Hurk, Caroline; Westland, Jolanda; Mosselman, Sietse; Fauser, Bart C J M
2004-12-01
Polycystic ovary syndrome (PCOS) represents the most common cause of anovulatory infertility and affects 5-10% of women of reproductive age. The etiology of PCOS is still unknown. The current study is the first to describe consistent differences in gene expression profiles in human ovaries comparing PCOS patients vs. healthy normoovulatory individuals. The microarray analysis of PCOS vs. normal ovaries identifies dysregulated expression of genes encoding components of several biological pathways or systems such as Wnt signaling, extracellular matrix components, and immunological factors. Resulting data may provide novel clues for ovarian dysfunction in PCOS. Intriguingly, the gene expression profiles of ovaries from (long-term) androgen-treated female-to-male transsexuals (TSX) show considerable overlap with PCOS. This observation provides supportive evidence that androgens play a key role in the pathogenesis of PCOS. Presented data may contribute to a better understanding of dysregulated pathways in PCOS, which might ultimately reveal novel leads for therapeutic intervention.
Cysteine Biosynthesis Controls Serratia marcescens Phospholipase Activity.
Anderson, Mark T; Mitchell, Lindsay A; Mobley, Harry L T
2017-08-15
Serratia marcescens causes health care-associated opportunistic infections that can be difficult to treat due to a high incidence of antibiotic resistance. One of the many secreted proteins of S. marcescens is the PhlA phospholipase enzyme. Genes involved in the production and secretion of PhlA were identified by screening a transposon insertion library for phospholipase-deficient mutants on phosphatidylcholine-containing medium. Mutations were identified in four genes ( cyaA , crp , fliJ , and fliP ) that are involved in the flagellum-dependent PhlA secretion pathway. An additional phospholipase-deficient isolate harbored a transposon insertion in the cysE gene encoding a predicted serine O -acetyltransferase required for cysteine biosynthesis. The cysE requirement for extracellular phospholipase activity was confirmed using a fluorogenic phospholipase substrate. Phospholipase activity was restored to the cysE mutant by the addition of exogenous l-cysteine or O -acetylserine to the culture medium and by genetic complementation. Additionally, phlA transcript levels were decreased 6-fold in bacteria lacking cysE and were restored with added cysteine, indicating a role for cysteine-dependent transcriptional regulation of S. marcescens phospholipase activity. S. marcescens cysE mutants also exhibited a defect in swarming motility that was correlated with reduced levels of flhD and fliA flagellar regulator gene transcription. Together, these findings suggest a model in which cysteine is required for the regulation of both extracellular phospholipase activity and surface motility in S. marcescens IMPORTANCE Serratia marcescens is known to secrete multiple extracellular enzymes, but PhlA is unusual in that this protein is thought to be exported by the flagellar transport apparatus. In this study, we demonstrate that both extracellular phospholipase activity and flagellar function are dependent on the cysteine biosynthesis pathway. Furthermore, a disruption of cysteine biosynthesis results in decreased phlA and flagellar gene transcription, which can be restored by supplying bacteria with exogenous cysteine. These results identify a previously unrecognized role for CysE and cysteine in the secretion of S. marcescens phospholipase and in bacterial motility. Copyright © 2017 American Society for Microbiology.
Cysteine Biosynthesis Controls Serratia marcescens Phospholipase Activity
Anderson, Mark T.; Mitchell, Lindsay A.
2017-01-01
ABSTRACT Serratia marcescens causes health care-associated opportunistic infections that can be difficult to treat due to a high incidence of antibiotic resistance. One of the many secreted proteins of S. marcescens is the PhlA phospholipase enzyme. Genes involved in the production and secretion of PhlA were identified by screening a transposon insertion library for phospholipase-deficient mutants on phosphatidylcholine-containing medium. Mutations were identified in four genes (cyaA, crp, fliJ, and fliP) that are involved in the flagellum-dependent PhlA secretion pathway. An additional phospholipase-deficient isolate harbored a transposon insertion in the cysE gene encoding a predicted serine O-acetyltransferase required for cysteine biosynthesis. The cysE requirement for extracellular phospholipase activity was confirmed using a fluorogenic phospholipase substrate. Phospholipase activity was restored to the cysE mutant by the addition of exogenous l-cysteine or O-acetylserine to the culture medium and by genetic complementation. Additionally, phlA transcript levels were decreased 6-fold in bacteria lacking cysE and were restored with added cysteine, indicating a role for cysteine-dependent transcriptional regulation of S. marcescens phospholipase activity. S. marcescens cysE mutants also exhibited a defect in swarming motility that was correlated with reduced levels of flhD and fliA flagellar regulator gene transcription. Together, these findings suggest a model in which cysteine is required for the regulation of both extracellular phospholipase activity and surface motility in S. marcescens. IMPORTANCE Serratia marcescens is known to secrete multiple extracellular enzymes, but PhlA is unusual in that this protein is thought to be exported by the flagellar transport apparatus. In this study, we demonstrate that both extracellular phospholipase activity and flagellar function are dependent on the cysteine biosynthesis pathway. Furthermore, a disruption of cysteine biosynthesis results in decreased phlA and flagellar gene transcription, which can be restored by supplying bacteria with exogenous cysteine. These results identify a previously unrecognized role for CysE and cysteine in the secretion of S. marcescens phospholipase and in bacterial motility. PMID:28559296
Ji, Sen-Lin; Liu, Rui; Ren, Meng-Fei; Li, Huan-Jun; Xu, Jun-Wei
2015-01-01
This study aimed to improve polysaccharide production by engineering the biosynthetic pathway in Ganoderma lucidum through the overexpression of the homologous UDP glucose pyrophosphorylase (UGP) gene. The effects of UGP gene overexpression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production, and transcription levels of 3 genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), UGP, and α-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in G. lucidum overexpressing the UGP gene were 24.32 mg/100 mg dry weight and 1.66 g/L, respectively, which were higher by 42% and 36% than those of the wild-type strain. The transcription levels of PGM, UGP, and GLS were up-regulated by 1.6, 2.6, and 2.4-fold, respectively, in the engineered strain, suggesting that increased polysaccharide biosynthesis may result from a higher expression of those genes.
Export of Extracellular Polysaccharides Modulates Adherence of the Cyanobacterium Synechocystis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fisher, ML; Allen, R; Luo, YQ
2013-09-10
The field of cyanobacterial biofuel production is advancing rapidly, yet we know little of the basic biology of these organisms outside of their photosynthetic pathways. We aimed to gain a greater understanding of how the cyanobacterium Synechocystis PCC 6803 (Synechocystis, hereafter) modulates its cell surface. Such understanding will allow for the creation of mutants that autoflocculate in a regulated way, thus avoiding energy intensive centrifugation in the creation of biofuels. We constructed mutant strains lacking genes predicted to function in carbohydrate transport or synthesis. Strains with gene deletions of slr0977 (predicted to encode a permease component of an ABC transporter),more » slr0982 (predicted to encode an ATP binding component of an ABC transporter) and slr1610 (predicted to encode a methyltransferase) demonstrated flocculent phenotypes and increased adherence to glass. Upon bioinformatic inspection, the gene products of slr0977, slr0982, and slr1610 appear to function in O-antigen (OAg) transport and synthesis. However, the analysis provided here demonstrated no differences between OAg purified from wild-type and mutants. However, exopolysaccharides (EPS) purified from mutants were altered in composition when compared to wild-type. Our data suggest that there are multiple means to modulate the cell surface of Synechocystis by disrupting different combinations of ABC transporters and/or glycosyl transferases. Further understanding of these mechanisms may allow for the development of industrially and ecologically useful strains of cyanobacteria. Additionally, these data imply that many cyanobacterial gene products may possess as-yet undiscovered functions, and are meritorious of further study.« less
Youssef, Noha H; Blainey, Paul C; Quake, Stephen R; Elshahed, Mostafa S
2011-11-01
Members of candidate division OP11 are widely distributed in terrestrial and marine ecosystems, yet little information regarding their metabolic capabilities and ecological role within such habitats is currently available. Here, we report on the microfluidic isolation, multiple-displacement-amplification, pyrosequencing, and genomic analysis of a single cell (ZG1) belonging to candidate division OP11. Genome analysis of the ∼270-kb partial genome assembly obtained showed that it had no particular similarity to a specific phylum. Four hundred twenty-three open reading frames were identified, 46% of which had no function prediction. In-depth analysis revealed a heterotrophic lifestyle, with genes encoding endoglucanase, amylopullulanase, and laccase enzymes, suggesting a capacity for utilization of cellulose, starch, and, potentially, lignin, respectively. Genes encoding several glycolysis enzymes as well as formate utilization were identified, but no evidence for an electron transport chain was found. The presence of genes encoding various components of lipopolysaccharide biosynthesis indicates a Gram-negative bacterial cell wall. The partial genome also provides evidence for antibiotic resistance (β-lactamase, aminoglycoside phosphotransferase), as well as antibiotic production (bacteriocin) and extracellular bactericidal peptidases. Multiple mechanisms for stress response were identified, as were elements of type I and type IV secretion systems. Finally, housekeeping genes identified within the partial genome were used to demonstrate the OP11 affiliation of multiple hitherto unclassified genomic fragments from multiple database-deposited metagenomic data sets. These results provide the first glimpse into the lifestyle of a member of a ubiquitous, yet poorly understood bacterial candidate division.
Tomazetto, Geizecler; Hahnke, Sarah; Wibberg, Daniel; Pühler, Alfred; Klocke, Michael; Schlüter, Andreas
2018-06-01
Proteiniphilum saccharofermentans str. M3/6 T is a recently described species within the family Porphyromonadaceae (phylum Bacteroidetes ), which was isolated from a mesophilic laboratory-scale biogas reactor. The genome of the strain was completely sequenced and manually annotated to reconstruct its metabolic potential regarding biomass degradation and fermentation pathways. The P. saccharofermentans str. M3/6 T genome consists of a 4,414,963 bp chromosome featuring an average GC-content of 43.63%. Genome analyses revealed that the strain possesses 3396 protein-coding sequences. Among them are 158 genes assigned to the carbohydrate-active-enzyme families as defined by the CAZy database, including 116 genes encoding glycosyl hydrolases (GHs) involved in pectin, arabinogalactan, hemicellulose (arabinan, xylan, mannan, β-glucans), starch, fructan and chitin degradation. The strain also features several transporter genes, some of which are located in polysaccharide utilization loci (PUL). PUL gene products are involved in glycan binding, transport and utilization at the cell surface. In the genome of strain M3/6 T , 64 PUL are present and most of them in association with genes encoding carbohydrate-active enzymes. Accordingly, the strain was predicted to metabolize several sugars yielding carbon dioxide, hydrogen, acetate, formate, propionate and isovalerate as end-products of the fermentation process. Moreover, P. saccharofermentans str. M3/6 T encodes extracellular and intracellular proteases and transporters predicted to be involved in protein and oligopeptide degradation. Comparative analyses between P. saccharofermentans str. M3/6 T and its closest described relative P. acetatigenes str. DSM 18083 T indicate that both strains share a similar metabolism regarding decomposition of complex carbohydrates and fermentation of sugars.
Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H
2006-10-01
We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.
Blancher, C; Omri, B; Bidou, L; Pessac, B; Crisanti, P
1996-10-18
We report the isolation and characterization of a novel cDNA from quail neuroretina encoding a putative protein named nectinepsin. The nectinepsin cDNA identifies a major 2.2-kilobase mRNA that is detected from ED 5 in neuroretina and is increasingly abundant during embryonic development. A nectinepsin mRNA is also found in quail liver, brain, and intestine and in mouse retina. The deduced nectinepsin amino acid sequence contains the RGD cell binding motif of integrin ligands. Furthermore, nectinepsin shares substantial homologies with vitronectin and structural protein similarities with most of the matricial metalloproteases. However, the presence of a specific sequence and the lack of heparin and collagen binding domains of the vitronectin indicate that nectinepsin is a new extracellular matrix protein. Furthermore, genomic Southern blot studies suggest that nectinepsin and vitronectin are encoded by different genes. Western blot analysis with an anti-human vitronectin antiserum revealed, in addition to the 65- and 70-kDa vitronectin bands, an immunoreactive protein of about 54 kDa in all tissues containing nectinepsin mRNA. It seems likely that the form of vitronectin found in chick egg yolk plasma by Nagano et al. ((1992) J. Biol. Chem. 267, 24863-24870) is the protein that corresponds to the nectinepsin cDNA. This new protein could be an important molecule involved in the early steps of the development.
NASA Technical Reports Server (NTRS)
Biermann, B.; Johnson, E. M.; Feldman, L. J.
1990-01-01
Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.
Cui, Yanbing; Meng, Yiwei; Zhang, Juan; Cheng, Bin; Yin, Huijia; Gao, Chao; Xu, Ping; Yang, Chunyu
2017-01-01
In well-established heterologous hosts, such as Escherichia coli, recombinant proteins are usually intracellular and frequently found as inclusion bodies-especially proteins possessing high rare codon content. In this study, successful secretory expression of three hydrolases, in a constructed inducible or constitutive system, was achieved by fusion with a novel signal peptide (Kp-SP) from an actinomycete. The signal peptide efficiently enabled extracellular protein secretion and also contributed to the active expression of the intracellular recombinant proteins. The thermophilic α-amylase gene of Bacillus licheniformis was fused with Kp-SP. Both recombinants, carrying inducible and constitutive plasmids, showed remarkable increases in extracellular and intracellular amylolytic activity. Amylase activity was observed to be > 10-fold in recombinant cultures with the constitutive plasmid, pBSPPc, compared to that in recombinants lacking Kp-SP. Further, the signal peptide enabled efficient secretion of a thermophilic cellulase into the culture medium, as demonstrated by larger halo zones and increased enzymatic activities detected in both constructs from different plasmids. For heterologous proteins with a high proportion of rare codons, it is difficult to obtain high expression in E. coli owing to the codon bias. Here, the fusion of an archaeal homologue of the amylase encoding gene, FSA, with Kp-SP resulted in > 5-fold higher extracellular activity. The successful extracellular expression of the amylase indicated that the signal peptide also contributed significantly to its active expression and signified the potential value of this novel and versatile signal peptide in recombinant protein production. Copyright © 2016 Elsevier Inc. All rights reserved.
Characterization of a novel glycine-rich protein from the cell wall of maize silk tissues.
Tao, T Y; Ouellet, T; Dadej, K; Miller, S S; Johnson, D A; Singh, J
2006-08-01
The isolation, characterization and regulation of expression of a maize silk-specific gene is described. zmgrp5 (Zea mays glycine-rich protein 5) encodes a 187 amino acid glycine-rich protein that displays developmentally regulated silk-specific expression. Northern, Western, in situ mRNA hybridization and transient gene expression analyses indicate that zmgrp5 is expressed in silk hair and in cells of the vascular bundle and pollen tube transmitting tissue elements. The protein is secreted into the extracellular matrix and is localized in the cell wall fraction mainly through interactions mediated by covalent disulphide bridges. Taken together, these results suggest that the protein may play a role in maintaining silk structure during development. This is the first documented isolation of a stigma-specific gene from maize, an important agronomic member of the Poaceae family.
Distributed and dynamic intracellular organization of extracellular information.
Granados, Alejandro A; Pietsch, Julian M J; Cepeda-Humerez, Sarah A; Farquhar, Iseabail L; Tkačik, Gašper; Swain, Peter S
2018-06-05
Although cells respond specifically to environments, how environmental identity is encoded intracellularly is not understood. Here, we study this organization of information in budding yeast by estimating the mutual information between environmental transitions and the dynamics of nuclear translocation for 10 transcription factors. Our method of estimation is general, scalable, and based on decoding from single cells. The dynamics of the transcription factors are necessary to encode the highest amounts of extracellular information, and we show that information is transduced through two channels: Generalists (Msn2/4, Tod6 and Dot6, Maf1, and Sfp1) can encode the nature of multiple stresses, but only if stress is high; specialists (Hog1, Yap1, and Mig1/2) encode one particular stress, but do so more quickly and for a wider range of magnitudes. In particular, Dot6 encodes almost as much information as Msn2, the master regulator of the environmental stress response. Each transcription factor reports differently, and it is only their collective behavior that distinguishes between multiple environmental states. Changes in the dynamics of the localization of transcription factors thus constitute a precise, distributed internal representation of extracellular change. We predict that such multidimensional representations are common in cellular decision-making.
Comparative genomics of Lactobacillus salivarius strains focusing on their host adaptation.
Lee, Jun-Yeong; Han, Geon Goo; Kim, Eun Bae; Choi, Yun-Jaie
2017-12-01
Lactobacillus salivarius is an important member of the animal gut microflora and is a promising probiotic bacterium. However, there is a lack of research on the genomic diversity of L. salivarius species. In this study, we generated 21 L. salivarius draft genomes, and investigated the pan-genome of L. salivarius strains isolated from humans, pigs and chickens using all available genomes, focusing on host adaptation. Phylogenetic clustering showed a distinct categorization of L. salivarius strains depending on their hosts. In the pan-genome, 15 host-specific genes and 16 dual-host-shared genes that only one host isolate did not possess were identified. Comparison of 56 extracellular protein encoding genes and 124 orthologs related to exopolysaccharide production in the pan-genome revealed that extracellular components of the assayed bacteria have been globally acquired and mutated under the selection pressure for host adaptation. We also found the three host-specific genes that are responsible for energy production in L. salivarius. These results showed that L. salivarius has evolved to adapt to host habitats in two ways, by gaining the abilities for niche adhesion and efficient utilization of nutrients. Our study offers a deeper understanding of the probiotic species L. salivarius, and provides a basis for future studies on L. salivarius and other mutualistic bacteria. Copyright © 2017 Elsevier GmbH. All rights reserved.
ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.
Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver
2011-07-20
Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.
Effector-triggered defence against apoplastic fungal pathogens
Stotz, Henrik U.; Mitrousia, Georgia K.; de Wit, Pierre J.G.M.; Fitt, Bruce D.L.
2014-01-01
R gene-mediated host resistance against apoplastic fungal pathogens is not adequately explained by the terms pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) or effector-triggered immunity (ETI). Therefore, it is proposed that this type of resistance is termed ‘effector-triggered defence’ (ETD). Unlike PTI and ETI, ETD is mediated by R genes encoding cell surface-localised receptor-like proteins (RLPs) that engage the receptor-like kinase SOBIR1. In contrast to this extracellular recognition, ETI is initiated by intracellular detection of pathogen effectors. ETI is usually associated with fast, hypersensitive host cell death, whereas ETD often triggers host cell death only after an elapsed period of endophytic pathogen growth. In this opinion, we focus on ETD responses against foliar fungal pathogens of crops. PMID:24856287
Liu, Rui; Chen, Hao; Zhang, Ran; Zhou, Zhi; Hou, Zhanhui; Gao, Dahai; Zhang, Huan; Wang, Lingling
2016-01-01
Yesso scallop-pathogenic Vibrio splendidus strain JZ6 was found to have the highest virulence at 10°C, while its pathogenicity was significantly reduced with increased temperature and completely incapacitated at 28°C. In the present study, comparative transcriptome analyses of JZ6 and another nonpathogenic V. splendidus strain, TZ19, were conducted at two crucial culture temperatures (10°C and 28°C) in order to determine the possible mechanism of temperature regulation of virulence. Comparisons among four libraries, constructed from JZ6 and TZ19 cultured at 10°C and 28°C (designated JZ6_10, JZ6_28, TZ19_10, and TZ19_28), revealed that 241 genes were possibly related to the increased virulence of JZ6 at 10°C. There were 10 genes, including 2 encoding Flp pilus assembly proteins (FlhG and VS_2437), 6 encoding proteins of the “Vibrio cholerae pathogenic cycle” (ToxS, CqsA, CqsS, RpoS, HapR, and Vsm), and 2 encoding proteins in the Sec-dependent pathway (SecE and FtsY), that were significantly upregulated in JZ6_10 (P < 0.05) compared to those in JZ6_28, TZ19_10, and TZ19_28, which were supposed to be responsible for adhesion, quorum sensing, virulence, and protein secretion of V. splendidus. When cultured at 10°C, JZ6 cells were larger and tended to aggregate more than those cultured at 28°C. The virulence factor (extracellular metalloprotease) was also found to be highly expressed in the extracellular product (ECP) of JZ6 at 10°C, and this ECP exhibited obvious cytotoxicity to oyster primary hemocytes, A549 cells, and L929 cells. These results indicated that low temperatures (10°C) could enhance adhesion, activate the quorum sensing systems, upregulate virulence factor synthesis and secretion, and, lastly, increase the pathogenicity of JZ6. PMID:26801576
Disruption of the zinc metabolism in rat fœtal brain after prenatal exposure to cadmium.
Ben Mimouna, Safa; Boughammoura, Sana; Chemek, Marouane; Haouas, Zohra; Banni, Mohamed; Messaoudi, Imed
2018-04-25
This study was carried out to investigate the effects of maternal Cd and/or Zn exposure on some parameters of Zn metabolism in fetal brain of Wistar rats. Thus, female controls and other exposed by the oral route during the gestation period to Cd (50 mg CdCl 2 /L) and/or Zn (ZnCl 2 60 mg/L) were used. The male fetuses at age 20 days of gestation (GD20) were sacrificed and their brains were taken for histological, chemical and molecular analysis. Zn depletion was observed in the brains of fetuses issued from mothers exposed to Cd. Histological analysis showed that Cd exposure induces pyknosis in cortical region and CA1 region of the hippocampus compared to controls. Under Cd exposure, we noted an overexpression of the genes coding for membrane transporter involved in the intracellular incorporation of Zn (ZIP6) associated with inhibition of that encoding the transporters involved in the output of the Zn into the extracellular medium (ZnT1 and ZnT3). A decrease in the expression of the gene encoding the neuro-trophic factor (BDNF) associated with overexpression of the encoding the metal regulatory transcription factor 1 (MTF1), factor involved in the homeostasis of Zn, was also noted in Cd group. Interestingly, Zn supply provided a total or partial restauration of the changes induced by the Cd exposure. The depletion of brain Zn contents as well as the modification of the profile of expression of genes encoding membrane Zn transporters, suggest that the toxicity of Cd observed in fetal brain level are mediated, in part, by impairment of Zn metabolism. Copyright © 2018 Elsevier B.V. All rights reserved.
Parry, David A; Brookes, Steven J; Logan, Clare V; Poulter, James A; El-Sayed, Walid; Al-Bahlani, Suhaila; Al Harasi, Sharifa; Sayed, Jihad; Raïf, El Mostafa; Shore, Roger C; Dashash, Mayssoon; Barron, Martin; Morgan, Joanne E; Carr, Ian M; Taylor, Graham R; Johnson, Colin A; Aldred, Michael J; Dixon, Michael J; Wright, J Tim; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J
2012-09-07
Autozygosity mapping and clonal sequencing of an Omani family identified mutations in the uncharacterized gene, C4orf26, as a cause of recessive hypomineralized amelogenesis imperfecta (AI), a disease in which the formation of tooth enamel fails. Screening of a panel of 57 autosomal-recessive AI-affected families identified eight further families with loss-of-function mutations in C4orf26. C4orf26 encodes a putative extracellular matrix acidic phosphoprotein expressed in the enamel organ. A mineral nucleation assay showed that the protein's phosphorylated C terminus has the capacity to promote nucleation of hydroxyapatite, suggesting a possible function in enamel mineralization during amelogenesis. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Syed, Samreen K; Kauffman, Audra L; Beavers, Lisa S; Alston, James T; Farb, Thomas B; Ficorilli, James; Marcelo, Marialuisa C; Brenner, Martin B; Bokvist, Krister; Barrett, David G; Efanov, Alexander M
2013-11-15
Extracellular ATP released from pancreatic β-cells acts as a potent insulinotropic agent through activation of P2 purinergic receptors. Ectonucleotidases, a family of membrane-bound nucleotide-metabolizing enzymes, regulate extracellular ATP levels by degrading ATP and related nucleotides. Ectonucleotidase activity affects the relative proportion of ATP and its metabolites, which in turn will impact the level of purinergic receptor stimulation exerted by extracellular ATP. Therefore, we investigated the expression and role of ectonucleotidases in pancreatic β-cells. Of the ectonucleotidases studied, only ENTPD3 (gene encoding the NTPDase3 enzyme) mRNA was detected at fairly abundant levels in human and mouse pancreatic islets as well as in insulin-secreting MIN6 cells. ARL67156, a selective ectonucleotidase inhibitor, blocked degradation of extracellular ATP that was added to MIN6 cells. The compound also decreased degradation of endogenous ATP released from cells. Measurements of insulin secretion in MIN6 cells as well as in mouse and human pancreatic islets demonstrated that ARL67156 potentiated glucose-dependent insulin secretion. Downregulation of NTPDase3 expression in MIN6 cells with the specific siRNA replicated the effects of ARL67156 on extracellular ATP hydrolysis and insulin secretion. Our results demonstrate that NTPDase3 is the major ectonucleotidase in pancreatic β-cells in multiple species and that it modulates insulin secretion by controlling activation of purinergic receptors.
The Tcp conjugation system of Clostridium perfringens.
Wisniewski, Jessica A; Rood, Julian I
2017-05-01
The Gram-positive pathogen Clostridium perfringens possesses a family of large conjugative plasmids that is typified by the tetracycline resistance plasmid pCW3. Since these plasmids may carry antibiotic resistance genes or genes encoding extracellular or sporulation-associated toxins, the conjugative transfer of these plasmids appears to be important for the epidemiology of C. perfringens-mediated diseases. Sequence analysis of members of this plasmid family identified a highly conserved 35kb region that encodes proteins with various functions, including plasmid replication and partitioning. The tcp conjugation locus also was identified in this region, initially based on low-level amino acid sequence identity to conjugation proteins from the integrative conjugative element Tn916. Genetic studies confirmed that the tcp locus is required for conjugative transfer and combined with biochemical and structural analyses have led to the development of a functional model of the Tcp conjugation apparatus. This review summarises our current understanding of the Tcp conjugation system, which is now one of the best-characterized conjugation systems in Gram-positive bacteria. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhu, Lin; Zhang, Yongshu; Fan, Jingyuan; Herzberg, Mark C.; Kreth, Jens
2010-01-01
Streptococcus sanguinis is an oral commensal bacterium and endogenous pathogen in the blood, which generally is naturally competent to take up extracellular DNA. Regarded as a stress response, competence development enables S. sanguinis to acquire new genetic material. The sequenced reference strain SK36 encodes and expresses the genes required for competence (com) and uptake of DNA. Isolated from blood cultures of a confirmed case of infective endocarditis, strain 133–79 encodes all necessary com genes but is not transformable under conditions permissive for competence development in SK36. Using synthetic competence-stimulating peptides (sCSP) based on sequences of SK36 and 133–79 comC, both strains developed competence at similar frequencies in cross-transformation experiments. Furthermore, downstream response pathways are similar in strains SK36 and 133–79 since platelet aggregation and biofilm formation appeared unaffected by CSP. Collectively, the data indicate that strains SK36 and 133–79 respond to CSP similarly, strongly suggesting that endogenous production or release of CSP from 133–79 is impaired. PMID:21375702
Zhu, L; Zhang, Y; Fan, J; Herzberg, M C; Kreth, J
2011-04-01
Streptococcus sanguinis is an oral commensal bacterium and endogenous pathogen in the blood, which is generally naturally competent to take up extracellular DNA. Regarded as a stress response, competence development enables S. sanguinis to acquire new genetic material. The sequenced reference strain SK36 encodes and expresses the genes required for competence (com) and uptake of DNA. Isolated from blood cultures of a confirmed case of infective endocarditis, strain 133-79 encodes all necessary com genes but is not transformable under conditions permissive for competence development in SK36. Using synthetic competence-stimulating peptides (sCSP) based on sequences of SK36 and 133-79 comC, both strains developed competence at similar frequencies in cross-transformation experiments. Furthermore, downstream response pathways are similar in strains SK36 and 133-79 because platelet aggregation and biofilm formation appeared unaffected by CSP. Collectively, the data indicate that strains SK36 and 133-79 respond to CSP similarly, strongly suggesting that endogenous production or release of CSP from 133-79 is impaired. © 2011 John Wiley & Sons A/S.
Wu, Yichao; Arumugam, Krithika; Tay, Martin Qi Xiang; Seshan, Hari; Mohanty, Anee; Cao, Bin
2015-04-01
Comamonas testosteroni is an important environmental bacterium capable of degrading a variety of toxic aromatic pollutants and has been demonstrated to be a promising biocatalyst for environmental decontamination. This organism is often found to be among the primary surface colonizers in various natural and engineered ecosystems, suggesting an extraordinary capability of this organism in environmental adaptation and biofilm formation. The goal of this study was to gain genetic insights into the adaption of C. testosteroni to versatile environments and the importance of a biofilm lifestyle. Specifically, a draft genome of C. testosteroni I2 was obtained. The draft genome is 5,778,710 bp in length and comprises 110 contigs. The average G+C content was 61.88 %. A total of 5365 genes with 5263 protein-coding genes were predicted, whereas 4324 (80.60 % of total genes) protein-encoding genes were associated with predicted functions. The catabolic genes responsible for biodegradation of steroid and other aromatic compounds on draft genome were identified. Plasmid pI2 was found to encode a complete pathway for aniline degradation and a partial catabolic pathway for chloroaniline. This organism was found to be equipped with a sophisticated signaling system which helps it find ideal niches and switch between planktonic and biofilm lifestyles. A large number of putative multi-drug-resistant genes coding for abundant outer membrane transporters, chaperones, and heat shock proteins for the protection of cellular function were identified in the genome of strain I2. In addition, the genome of strain I2 was predicted to encode several proteins involved in producing, secreting, and uptaking siderophores under iron-limiting conditions. The genome of strain I2 contains a number of genes responsible for the synthesis and secretion of exopolysaccharides, an extracellular component essential for biofilm formation. Overall, our results reveal the genomic features underlying the adaption of C. testosteroni to versatile environments and highlighting the importance of its biofilm lifestyle.
Gene delivery for periodontal tissue engineering: current knowledge - future possibilities.
Chen, Fa-Ming; Ma, Zhi-Wei; Wang, Qin-Tao; Wu, Zhi-Fen
2009-08-01
The cellular and molecular events of periodontal healing are coordinated and regulated by an elaborate system of signaling molecules, pointing to a primary strategy for functional periodontal compartment regeneration to replicate components of the natural cellular microenvironment by providing an artificial extracellular matrix (ECM) and by delivering growth factors. However, even with optimal carriers, the localized delivery of growth factors often requires a large amount of protein to stimulate significant effects in vivo, which increases the risk and unwanted side effects. A simple and relatively new approach to bypassing this dilemma involves converting cells into protein producing factories. This is done by a so-called gene delivery method, where therapeutic agents to be delivered are DNA plasmids that include the gene encoding desired growth factors instead of recombinant proteins. As localized depots of genes, novel gene delivery systems have the potential to release their cargo in a sustained and controlled manner and finally provide time- and space- dependent levels of encoded proteins during all stages of tissue regrowth, offering great versatility in their application and prompting new tissue engineering strategy in periodontal regenerative medicine. However, gene therapy in Periodontology is clearly in its infancy. Significant efforts still need to be made in developing safe and effective delivery platforms and clarifying how gene delivery, in combination with tissue engineering, may mimic the critical aspects of natural biological processes occurring in periodontal development and repair. The aim of this review is to trace an outline of the state-of-the-art in the application of gene delivery and tissue engineering strategies for periodontal healing and regeneration.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Judy D. Wall
2011-06-09
Our findings demonstrated that D. vulgaris surface-adhered populations produce extracellular structures, and that that the cells have altered carbon and energy flux compared to planktonic cells. Biofilms did not have greatly increased carbohydrate accumulation. Interestingly genes present on the native plasmid found in D. vulgaris Hildenborough were necessary for wild type biofilm formation. In addition, extracellular appendages dependent on functions or proteins encoded by flaG or fliA also contributed to biofilm formation. Studies with SRB biofilms have indicated that the reduction and precipitation of metals can occur within the biofilm matrix; however, little work has been done to elucidate themore » physiological state of surface-adhered cells during metal reduction (Cr6+, U6+) and how this process is affected by nutrient feed levels (i.e., the stimulant).« less
Souffriau, Ben; den Abt, Tom; Thevelein, Johan M
2012-07-30
D-Galacturonic acid is a major component of pectins but cannot be metabolized by Saccharomyces cerevisiae. It is assumed not to be taken up. We show that yeast displays surprisingly rapid low-affinity uptake of D-galacturonic acid, strongly increasing with decreasing extracellular pH and without saturation up to 1.5 M. There was no intracellular concentration above the extracellular level and transport was reversible. Among more than 160 single and multiple deletion mutants in channels and transporters, no strain was affected in D-galacturonic acid uptake. The uptake was not inhibited by any compound tested as candidate competitive inhibitor, including D-glucuronic acid, which was also transported. The characteristics of D-galacturonic acid uptake are consistent with involvement of a channel-type system, probably encoded by multiple genes. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
PepJ is a new extracellular proteinase of Aspergillus nidulans.
Emri, T; Szilágyi, M; László, K; M-Hamvas, M; Pócsi, I
2009-01-01
Under carbon starvation, Aspergillus nidulans released a metallo-proteinase with activities comparable to those of PrtA, the major extracellular serine proteinase of the fungus. The relative molar mass of the enzyme was 19 kDa as determined with both denaturing and renaturing SDS PAGE, while its isoelectric point and pH and temperature optima were 8.6, 5.5 and 65 degrees C, respectively. The enzyme was stable at pH 3.5-10.5 and was still active at 95 degrees C in the presence of azocasein substrate. MALDI-TOF MS analysis demonstrated that the proteinase was encoded by the pepJ gene (locus ID AN7962.3), and showed high similarity to deuterolysin from Aspergillus oryzae. The size of the mature enzyme, its EDTA sensitivity and heat stability also supported the view that A. nidulans PepJ is a deuterolysin-type metallo-proteinase.
Effect of Mild Acid on Gene Expression in Staphylococcus aureus
Weinrick, Brian; Dunman, Paul M.; McAleese, Fionnuala; Murphy, Ellen; Projan, Steven J.; Fang, Yuan; Novick, Richard P.
2004-01-01
During staphylococcal growth in glucose-supplemented medium, the pH of a culture starting near neutrality typically decreases by about 2 units due to the fermentation of glucose. Many species can comfortably tolerate the resulting mildly acidic conditions (pH, ∼5.5) by mounting a cellular response, which serves to defend the intracellular pH and, in principle, to modify gene expression for optimal performance in a mildly acidic infection site. In this report, we show that changes in staphylococcal gene expression formerly thought to represent a glucose effect are largely the result of declining pH. We examine the cellular response to mild acid by microarray analysis and define the affected gene set as the mild acid stimulon. Many of the genes encoding extracellular virulence factors are affected, as are genes involved in regulation of virulence factor gene expression, transport of sugars and peptides, intermediary metabolism, and pH homeostasis. Key results are verified by gene fusion and Northern blot hybridization analyses. The results point to, but do not define, possible regulatory pathways by which the organism senses and responds to a pH stimulus. PMID:15576791
NASA Technical Reports Server (NTRS)
Everroad, R. Craig; Stuart, Rhona K.; Bebout, Brad M.; Detweiler, Angela M.; Lee, Jackson Zan; Woebken, Dagmar; Bebout, Leslie E.; Pett-Ridge, Jennifer
2016-01-01
The nonheterocystous filamentous cyanobacterium, strain ESFC-1, is a recently described member of the order Oscillatoriales within the Cyanobacteria. ESFC-1 has been shown to be a major diazotroph in the intertidal microbial mat system at Elkhorn Slough, CA, USA. Based on phylogenetic analyses of the 16S RNA gene, ESFC-1 appears to belong to a unique, genus-level divergence; the draft genome sequence of this strain has now been determined. Here we report features of this genome as they relate to the ecological functions and capabilities of strain ESFC-1. The 5,632,035 bp genome sequence encodes 4914 protein-coding genes and 92 RNA genes. One striking feature of this cyanobacterium is the apparent lack of either uptake or bi-directional hydrogenases typically expected within a diazotroph. Additionally, a large genomic island is found that contains numerous low GC-content genes and genes related to extracellular polysaccharide production and cell wall synthesis and maintenance.
Everroad, R. Craig; Stuart, Rhona K.; Bebout, Brad M.; ...
2016-08-24
The nonheterocystous filamentous cyanobacterium, strain ESFC-1, is a recently described member of the order Oscillatoriales within the Cyanobacteria. ESFC-1 has been shown to be a major diazotroph in the intertidal microbial mat system at Elkhorn Slough, CA, USA. Based on phylogenetic analyses of the 16S RNA gene, ESFC-1 appears to belong to a unique, genus-level divergence; the draft genome sequence of this strain has now been determined. Here we report features of this genome as they relate to the ecological functions and capabilities of strain ESFC-1. The 5,632,035 bp genome sequence encodes 4914 protein-coding genes and 92 RNA genes. Onemore » striking feature of this cyanobacterium is the apparent lack of either uptake or bi-directional hydrogenases typically expected within a diazotroph. In addition, a large genomic island is found that contains numerous low GC-content genes and genes related to extracellular polysaccharide production and cell wall synthesis and maintenance.« less
Su, Jianmin; Cole, James; Fox, Michael A
2017-02-01
Perineuronal nets (PNNs) are lattice-like supramolecular assemblies of extracellular glycoproteins that surround subsets of neuronal cell bodies in the mammalian telencephalon. PNNs emerge at the end of the critical period of brain development, limit neuronal plasticity in the adult brain, and are lost in a variety of complex brain disorders diseases, including schizophrenia. The link between PNNs and schizophrenia led us to question whether neuronally expressed extracellular matrix (ECM) molecules associated with schizophrenia contribute to the assembly of these specialized supramolecular ECM assemblies. We focused on collagen XIX-a minor, nonfibrillar collagen expressed by subsets of telencephalic interneurons. Genetic alterations in the region encoding collagen XIX have been associated with familial schizophrenia, and loss of this collagen in mice results in altered inhibitory synapses, seizures, and the acquisition of schizophrenia-related behaviors. Here, we demonstrate that loss of collagen XIX also results in a reduction of telencephalic PNNs. Loss of PNNs was accompanied with reduced levels of aggrecan (Acan), a major component of PNNs. Despite reduced levels of PNN constituents in collagen XIX-deficient mice ( col19a1 - / - ), we failed to detect reduced expression of genes encoding these ECM molecules. Instead, we discovered a widespread upregulation of extracellular proteases capable of cleaving Acan and other PNN constituents in col19a1 - / - brains. Taken together, these results suggest a mechanism by which the loss of collagen XIX speeds PNN degradation and they identify a novel mechanism by which the loss of collagen XIX may contribute to complex brain disorders.
Grichtchenko, I I; Choi, I; Zhong, X; Bray-Ward, P; Russell, J M; Boron, W F
2001-03-16
The electroneutral Na(+)-driven Cl-HCO3 exchanger is a key mechanism for regulating intracellular pH (pH(i)) in neurons, glia, and other cells. Here we report the cloning, tissue distribution, chromosomal location, and functional characterization of the cDNA of such a transporter (NDCBE1) from human brain (GenBank accession number AF069512). NDCBE1, which encodes 1044 amino acids, is 34% identical to the mammalian anion exchanger (AE2); approximately 50% to the electrogenic Na/HCO3 cotransporter (NBCe1) from salamander, rat, and humans; approximately 73% to mammalian electroneutral Na/HCO3 cotransporters (NBCn1); 71% to mouse NCBE; and 47% to a Na(+)-driven anion exchanger (NDAE1) from Drosophila. Northern blot analysis of NDCBE1 shows a robust approximately 12-kilobase signal in all major regions of human brain and in testis, and weaker signals in kidney and ovary. This human gene (SLC4A8) maps to chromosome 12q13. When expressed in Xenopus oocytes and running in the forward direction, NDCBE1 is electroneutral and mediates increases in both pH(i) and [Na(+)](i) (monitored with microelectrodes) that require HCO3(-) and are blocked by 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS). The pH(i) increase also requires extracellular Na(+). The Na(+):HCO3(-) stoichiometry is 1:2. Forward-running NDCBE1 mediates a 36Cl efflux that requires extracellular Na(+) and HCO3(-) and is blocked by DIDS. Running in reverse, NDCBE1 requires extracellular Cl(-). Thus, NDCBE1 encodes a human, electroneutral Na(+)-driven Cl-HCO3 exchanger.
Yasuhara, Fabiana; Gomes, Gisele Renata Oliveira; Siu, Erica Rosanna; Suenaga, Cláudia Igushi; Maróstica, Elisabeth; Porto, Catarina Segreti; Lazari, Maria Fatima Magalhaes
2008-09-01
The efferent ductules express the highest amount of estrogen receptors ESR1 (ERalpha) and ESR2 (ERbeta) within the male reproductive tract. Treatment of rats with the antiestrogen fulvestrant (ICI 182,780) causes inhibition of fluid reabsorption in the efferent ductules, leading to seminiferous tubule atrophy and infertility. To provide a more comprehensive knowledge about the molecular targets for estrogen in the rat efferent ductules, we investigated the effects of ICI 182,780 treatment on gene expression using a microarray approach. Treatment with ICI 182,780 increased or reduced at least 2-fold the expression of 263 and 98 genes, respectively. Not surprisingly, several genes that encode ion channels and macromolecule transporters were affected. Interestingly, treatment with ICI 182,780 markedly altered the expression of genes related to extracellular matrix organization. Matrix metalloproteinase 7 (Mmp7), osteopontin (Spp1), and neuronal pentraxin 1 (Nptx1) were among the most altered genes in this category. Upregulation of Mmp7 and Spp1 and downregulation of Nptx1 were validated by Northern blot. Increase in Mmp7 expression was further confirmed by immunohistochemistry and probably accounted for the decrease in collagen content observed in the efferent ductules of ICI 182,780-treated animals. Downregulation of Nptx1 probably contributed to the extracellular matrix changes and decreased amyloid deposition in the efferent ductules of ICI 182,780-treated animals. Identification of new molecular targets for estrogen action may help elucidate the regulatory role of this hormone in the male reproductive tract.
Cataldo, L R; Cortés, V A; Mizgier, M L; Aranda, E; Mezzano, D; Olmos, P; Galgani, J E; Suazo, J; Santos, J L
2015-09-01
Pancreatic β-cells synthetize and store Serotonin (5-Hydroxytriptamine, 5HT) which is co-released with insulin. It has been proposed that extracellular 5HT binds to specific cell surface receptors and modulate insulin secretion. On the other hand, Selective Serotonin Reuptake Inhibitor (SSRI) fluoxetine seems to reduce Glucose-Stimulated Insulin Secretion (GSIS). However, it is unknown whether this effect results from changes in extracellular 5HT concentration owed to the blockade of 5HT transporter (SERT) or from non-5HT dependent actions. The aims of this work were: 1) to quantify extracellular 5HT levels and GSIS in β-cell lines, 2) to determine whether extracellular 5HT levels and GSIS are changed by fluoxetine or 5-Hydroxytryptophan (5HTP, the immediate 5HT biosynthetic precursor), and 3) to quantify the expression of Slc6a4 gene (encoding SERT) in β-cell lines in relation to other genes involved in 5HT system. β-cell lines MIN6 and RINm5f were subjected to GSIS protocols, after treatment with fluoxetine, 5HTP or 5HT. Insulin and 5HT were quantified by ELISA and HPLC, respectively. Relative mRNA expression was quantified by RT-qPCR. MIN6 β-cells secretes 5HT in response to glucose, showing a sharp increase in 5HT release when cells were preloaded with 5HTP. Treatment with 5HT or fluoxetine reduces GSIS. Fluoxetine fails to further increases 5HTP-induced elevation of secreted 5HT. MIN6 β-cells express both isoforms of Tryptophan Hydroxylase (Tph1 and Tph2), and have high expression levels of L-Dopa decarboxylase (Ddc), both enzymes involved in 5HT biosynthetic pathway, but do not express the 5HT transporters Slc6a4 or Slc6a3 (the Dopamine-5HT transporter) genes. The inhibitory effect of fluoxetine on β-cell glucose stimulated insulin secretion is not mediated by blockage of 5HT transporter through SERT. © Georg Thieme Verlag KG Stuttgart · New York.
Extracellular proteases of Trichoderma species. A review.
Kredics, L; Antal, Zsuzsanna; Szekeres, A; Hatvani, L; Manczinger, L; Vágvölgyi, Cs; Nagy, Erzsébet
2005-01-01
Cellulolytic, xylanolytic, chitinolytic and beta-1,3-glucanolytic enzyme systems of species belonging to the filamentous fungal genus Trichoderma have been investigated in details and are well characterised. The ability of Trichoderma strains to produce extracellular proteases has also been known for a long time, however, the proteolytic enzyme system is relatively unknown in this genus. Fortunately, in the recent years more and more attention is focused on the research in this field. The role of Trichoderma proteases in the biological control of plant pathogenic fungi and nematodes has been demonstrated, and it is also suspected that they may be important for the competitive saprophytic ability of green mould isolates and may represent potential virulence factors of Trichoderma strains as emerging fungal pathogens of clinical importance. The aim of this review is to summarize the information available about the extracellular proteases of Trichoderma. Numerous studies are available about the extracellular proteolytic enzyme profiles of Trichoderma strains and about the effect of abiotic environmental factors on protease activities. A number of protease enzymes have been purified to homogeneity and some protease encoding genes have been cloned and characterized. These results will be reviewed and the role of Trichoderma proteases in biological control as well as their advantages and disadvantages in biotechnology will be discussed.
Genome-Wide Analyses Reveal Genes Subject to Positive Selection in Pasteurella multocida
Cao, Peili; Guo, Dongchun; Liu, Jiasen; Jiang, Qian; Xu, Zhuofei; Qu, Liandong
2017-01-01
Pasteurella multocida, a Gram-negative opportunistic pathogen, has led to a broad range of diseases in mammals and birds, including fowl cholera in poultry, pneumonia and atrophic rhinitis in swine and rabbit, hemorrhagic septicemia in cattle, and bite infections in humans. In order to better interpret the genetic diversity and adaptation evolution of this pathogen, seven genomes of P. multocida strains isolated from fowls, rabbit and pigs were determined by using high-throughput sequencing approach. Together with publicly available P. multocida genomes, evolutionary features were systematically analyzed in this study. Clustering of 70,565 protein-coding genes showed that the pangenome of 33 P. multocida strains was composed of 1,602 core genes, 1,364 dispensable genes, and 1,070 strain-specific genes. Of these, we identified a full spectrum of genes related to virulence factors and revealed genetic diversity of these potential virulence markers across P. multocida strains, e.g., bcbAB, fcbC, lipA, bexDCA, ctrCD, lgtA, lgtC, lic2A involved in biogenesis of surface polysaccharides, hsf encoding autotransporter adhesin, and fhaB encoding filamentous haemagglutinin. Furthermore, based on genome-wide positive selection scanning, a total of 35 genes were subject to strong selection pressure. Extensive analyses of protein subcellular location indicated that membrane-associated genes were highly abundant among all positively selected genes. The detected amino acid sites undergoing adaptive selection were preferably located in extracellular space, perhaps associated with bacterial evasion of host immune responses. Our findings shed more light on conservation and distribution of virulence-associated genes across P. multocida strains. Meanwhile, this study provides a genetic context for future researches on the mechanism of adaptive evolution in P. multocida. PMID:28611758
Mäkinen, Mari A; Risulainen, Netta; Mattila, Hans; Lundell, Taina K
2018-05-04
Previously identified twelve plant cell wall degradation-associated genes of the white rot fungus Phlebia radiata were studied by RT-qPCR in semi-aerobic solid-state cultures on lignocellulose waste material, and on glucose-containing reference medium. Wood-decay-involved enzyme activities and ethanol production were followed to elucidate both the degradative and fermentative processes. On the waste lignocellulose substrate, P. radiata carbohydrate-active enzyme (CAZy) genes encoding cellulolytic and hemicellulolytic activities were significantly upregulated whereas genes involved in lignin modification displayed a more complex response. Two lignin peroxidase genes were differentially expressed on waste lignocellulose compared to glucose medium, whereas three manganese peroxidase-encoding genes were less affected. On the contrary, highly significant difference was noticed for three cellulolytic genes (cbhI_1, eg1, bgl1) with higher expression levels on the lignocellulose substrate than on glucose. This indicates expression of the wood-attacking degradative enzyme system by the fungus also on the recycled, waste core board material. During the second week of cultivation, ethanol production increased on the core board to 0.24 g/L, and extracellular activities against cellulose, xylan, and lignin were detected. Sugar release from the solid lignocellulose resulted with concomitant accumulation of ethanol as fermentation product. Our findings confirm that the fungus activates its white rot decay system also on industrially processed lignocellulose adopted as growth substrate, and under semi-aerobic cultivation conditions. Thus, P. radiata is a good candidate for lignocellulose-based renewable biotechnology to make biofuels and biocompounds from materials with less value for recycling or manufacturing.
ten Have, Arjen; Dekkers, Ester; Kay, John; Phylip, Lowri H; van Kan, Jan A L
2004-07-01
Botrytis cinerea, an important fungal plant pathogen, secretes aspartic proteinase (AP) activity in axenic cultures. No cysteine, serine or metalloproteinase activity could be detected. Proteinase activity was higher in culture medium containing BSA or wheat germ extract, as compared to minimal medium. A proportion of the enzyme activity remained in the extracellular glucan sheath. AP was also the only type of proteinase activity in fluid obtained from B. cinerea-infected tissue of apple, pepper, tomato and zucchini. Five B. cinerea genes encoding an AP were cloned and denoted Bcap1-5. Features of the encoded proteins are discussed. BcAP1, especially, has novel characteristics. A phylogenetic analysis was performed comprising sequences originating from different kingdoms. BcAP1 and BcAP5 did not cluster in a bootstrap-supported clade. BcAP2 clusters with vacuolar APs. BcAP3 and BcAP4 cluster with secreted APs in a clade that also contains glycosylphosphatidylinositol-anchored proteinases from Saccharomyces cerevisiae and Candida albicans. All five Bcap genes are expressed in liquid cultures. Transcript levels of Bcap1, Bcap2, Bcap3 and Bcap4 are subject to glucose and peptone repression. Transcripts from all five Bcap genes were detected in infected plant tissue, indicating that at least part of the AP activity in planta originates from the pathogen.
Wiens, Gregory D.; Pascho, Ron; Winton, James R.
2002-01-01
The gram-positive bacterium Renibacterium salmoninarum produces relatively large amounts of a 57-kDa protein (p57) implicated in the pathogenesis of salmonid bacterial kidney disease. Antigenic variation in p57 was identified by using monoclonal antibody 4C11, which exhibited severely decreased binding to R. salmoninarum strain 684 p57 and bound robustly to the p57 proteins of seven other R. salmoninarum strains. This difference in binding was not due to alterations in p57 synthesis, secretion, or bacterial cell association. The molecular basis of the 4C11 epitope loss was determined by amplifying and sequencing the two identical genes encoding p57, msa1 and msa2. The 5′ and coding sequences of the 684 msa1 and msa2 genes were identical to those of the ATCC 33209 msa1and msa2 genes except for a single C-to-A nucleotide mutation. This mutation was identified in both the msa1 and msa2 genes of strain 684 and resulted in an Ala139-to-Glu substitution in the amino-terminal region of p57. We examined whether this mutation in p57 altered salmonid leukocyte and rabbit erythrocyte binding activities. R. salmoninarum strain 684 extracellular protein exhibited a twofold increase in agglutinating activity for chinook salmon leukocytes and rabbit erythrocytes compared to the activity of the ATCC 33209 extracellular protein. A specific and quantitative p57 binding assay confirmed the increased binding activity of 684 p57. Monoclonal antibody 4C11 blocked the agglutinating activity of the ATCC 33209 extracellular protein but not the agglutinating activity of the 684 extracellular protein. These results indicate that the Ala139-to-Glu substitution altered immune recognition and was associated with enhanced biological activity of R. salmoninarum 684 p57.
Cadherin genes and evolutionary novelties in the octopus.
Wang, Z Yan; Ragsdale, Clifton W
2017-09-01
All animals with large brains must have molecular mechanisms to regulate neuronal process outgrowth and prevent neurite self-entanglement. In vertebrates, two major gene families implicated in these mechanisms are the clustered protocadherins and the atypical cadherins. However, the molecular mechanisms utilized in complex invertebrate brains, such as those of the cephalopods, remain largely unknown. Recently, we identified protocadherins and atypical cadherins in the octopus. The octopus protocadherin expansion shares features with the mammalian clustered protocadherins, including enrichment in neural tissues, clustered head-to-tail orientations in the genome, and a large first exon encoding all cadherin domains. Other octopus cadherins, including a newly-identified cadherin with 77 extracellular cadherin domains, are elevated in the suckers, a striking cephalopod novelty. Future study of these octopus genes may yield insights into the general functions of protocadherins in neural wiring and cadherin-related proteins in complex morphogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis
Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-01-01
Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587
Amelogenesis Imperfecta; Genes, Proteins, and Pathways
Smith, Claire E. L.; Poulter, James A.; Antanaviciute, Agne; Kirkham, Jennifer; Brookes, Steven J.; Inglehearn, Chris F.; Mighell, Alan J.
2017-01-01
Amelogenesis imperfecta (AI) is the name given to a heterogeneous group of conditions characterized by inherited developmental enamel defects. AI enamel is abnormally thin, soft, fragile, pitted and/or badly discolored, with poor function and aesthetics, causing patients problems such as early tooth loss, severe embarrassment, eating difficulties, and pain. It was first described separately from diseases of dentine nearly 80 years ago, but the underlying genetic and mechanistic basis of the condition is only now coming to light. Mutations in the gene AMELX, encoding an extracellular matrix protein secreted by ameloblasts during enamel formation, were first identified as a cause of AI in 1991. Since then, mutations in at least eighteen genes have been shown to cause AI presenting in isolation of other health problems, with many more implicated in syndromic AI. Some of the encoded proteins have well documented roles in amelogenesis, acting as enamel matrix proteins or the proteases that degrade them, cell adhesion molecules or regulators of calcium homeostasis. However, for others, function is less clear and further research is needed to understand the pathways and processes essential for the development of healthy enamel. Here, we review the genes and mutations underlying AI presenting in isolation of other health problems, the proteins they encode and knowledge of their roles in amelogenesis, combining evidence from human phenotypes, inheritance patterns, mouse models, and in vitro studies. An LOVD resource (http://dna2.leeds.ac.uk/LOVD/) containing all published gene mutations for AI presenting in isolation of other health problems is described. We use this resource to identify trends in the genes and mutations reported to cause AI in the 270 families for which molecular diagnoses have been reported by 23rd May 2017. Finally we discuss the potential value of the translation of AI genetics to clinical care with improved patient pathways and speculate on the possibility of novel treatments and prevention strategies for AI. PMID:28694781
Amelogenesis Imperfecta; Genes, Proteins, and Pathways.
Smith, Claire E L; Poulter, James A; Antanaviciute, Agne; Kirkham, Jennifer; Brookes, Steven J; Inglehearn, Chris F; Mighell, Alan J
2017-01-01
Amelogenesis imperfecta (AI) is the name given to a heterogeneous group of conditions characterized by inherited developmental enamel defects. AI enamel is abnormally thin, soft, fragile, pitted and/or badly discolored, with poor function and aesthetics, causing patients problems such as early tooth loss, severe embarrassment, eating difficulties, and pain. It was first described separately from diseases of dentine nearly 80 years ago, but the underlying genetic and mechanistic basis of the condition is only now coming to light. Mutations in the gene AMELX , encoding an extracellular matrix protein secreted by ameloblasts during enamel formation, were first identified as a cause of AI in 1991. Since then, mutations in at least eighteen genes have been shown to cause AI presenting in isolation of other health problems, with many more implicated in syndromic AI. Some of the encoded proteins have well documented roles in amelogenesis, acting as enamel matrix proteins or the proteases that degrade them, cell adhesion molecules or regulators of calcium homeostasis. However, for others, function is less clear and further research is needed to understand the pathways and processes essential for the development of healthy enamel. Here, we review the genes and mutations underlying AI presenting in isolation of other health problems, the proteins they encode and knowledge of their roles in amelogenesis, combining evidence from human phenotypes, inheritance patterns, mouse models, and in vitro studies. An LOVD resource (http://dna2.leeds.ac.uk/LOVD/) containing all published gene mutations for AI presenting in isolation of other health problems is described. We use this resource to identify trends in the genes and mutations reported to cause AI in the 270 families for which molecular diagnoses have been reported by 23rd May 2017. Finally we discuss the potential value of the translation of AI genetics to clinical care with improved patient pathways and speculate on the possibility of novel treatments and prevention strategies for AI.
D'Ovidio, Renato; Raiola, Alessandro; Capodicasa, Cristina; Devoto, Alessandra; Pontiggia, Daniela; Roberti, Serena; Galletti, Roberta; Conti, Eric; O'Sullivan, Donal; De Lorenzo, Giulia
2004-01-01
Polygalacturonase-inhibiting proteins (PGIPs) are extracellular plant inhibitors of fungal endopolygalacturonases (PGs) that belong to the superfamily of Leu-rich repeat proteins. We have characterized the full complement of pgip genes in the bean (Phaseolus vulgaris) genotype BAT93. This comprises four clustered members that span a 50-kb region and, based on their similarity, form two pairs (Pvpgip1/Pvpgip2 and Pvpgip3/Pvpgip4). Characterization of the encoded products revealed both partial redundancy and subfunctionalization against fungal-derived PGs. Notably, the pair PvPGIP3/PvPGIP4 also inhibited PGs of two mirid bugs (Lygus rugulipennis and Adelphocoris lineolatus). Characterization of Pvpgip genes of Pinto bean showed variations limited to single synonymous substitutions or small deletions. A three-amino acid deletion encompassing a residue previously identified as crucial for recognition of PG of Fusarium moniliforme was responsible for the inability of BAT93 PvPGIP2 to inhibit this enzyme. Consistent with the large variations observed in the promoter sequences, reverse transcription-PCR expression analysis revealed that the different family members differentially respond to elicitors, wounding, and salicylic acid. We conclude that both biochemical and regulatory redundancy and subfunctionalization of pgip genes are important for the adaptation of plants to pathogenic fungi and phytophagous insects. PMID:15299124
D'Ovidio, Renato; Raiola, Alessandro; Capodicasa, Cristina; Devoto, Alessandra; Pontiggia, Daniela; Roberti, Serena; Galletti, Roberta; Conti, Eric; O'Sullivan, Donal; De Lorenzo, Giulia
2004-08-01
Polygalacturonase-inhibiting proteins (PGIPs) are extracellular plant inhibitors of fungal endopolygalacturonases (PGs) that belong to the superfamily of Leu-rich repeat proteins. We have characterized the full complement of pgip genes in the bean (Phaseolus vulgaris) genotype BAT93. This comprises four clustered members that span a 50-kb region and, based on their similarity, form two pairs (Pvpgip1/Pvpgip2 and Pvpgip3/Pvpgip4). Characterization of the encoded products revealed both partial redundancy and subfunctionalization against fungal-derived PGs. Notably, the pair PvPGIP3/PvPGIP4 also inhibited PGs of two mirid bugs (Lygus rugulipennis and Adelphocoris lineolatus). Characterization of Pvpgip genes of Pinto bean showed variations limited to single synonymous substitutions or small deletions. A three-amino acid deletion encompassing a residue previously identified as crucial for recognition of PG of Fusarium moniliforme was responsible for the inability of BAT93 PvPGIP2 to inhibit this enzyme. Consistent with the large variations observed in the promoter sequences, reverse transcription-PCR expression analysis revealed that the different family members differentially respond to elicitors, wounding, and salicylic acid. We conclude that both biochemical and regulatory redundancy and subfunctionalization of pgip genes are important for the adaptation of plants to pathogenic fungi and phytophagous insects.
Li, Qianhong; Bolli, Roberto; Qiu, Yumin; Tang, Xian-Liang; Guo, Yiru; French, Brent A.
2013-01-01
Background Extracellular superoxide dismutase (Ec-SOD) may protect the heart against myocardial infarction (MI) because of its extended half-life and capacity to bind heparan sulfate proteoglycans on cellular surfaces. Accordingly, we used direct gene transfer to increase systemic levels of Ec-SOD and determined whether this gene therapy could protect against MI. Methods and Results The cDNA for human Ec-SOD was incorporated into a replication-deficient adenovirus (Ad5/CMV/Ec-SOD). Injection of this virus produced a high level of Ec-SOD in the liver, which was redistributed to the heart and other organs by injection of heparin. Untreated rabbits (group I) underwent a 30-minute coronary occlusion and 3 days of reperfusion. For comparison, preconditioned rabbits (group II) underwent a sequence of six 4-minute-occlusion/4-minute-reperfusion cycles 24 hours before the 30-minute occlusion. Control-treated rabbits (group III) were injected intravenously with Ad5/CMV/nls-LacZ, and gene-therapy rabbits (group IV) were injected with Ad5/CMV/Ec-SOD 3 days before the 30-minute occlusion. Both groups treated with Ad5 received intravenous heparin 2 hours before the 30-minute occlusion. Infarct size (percent risk area) was similar in groups I (57±6%) and III (58±5%). Ec-SOD gene therapy markedly reduced infarct size to 25±4% (P<0.01, group IV versus group III), a protection comparable to that of the late phase of ischemic preconditioning (29±3%, P<0.01 group II versus group I). Conclusions Direct gene transfer of the cDNA encoding membrane-bound Ec-SOD affords powerful cardioprotection, providing proof of principle for the effectiveness of antioxidant gene therapy against MI. PMID:11294809
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahmad, Rumana; Nicora, Carrie D.; Shukla, Anil K.
Prostate cancer (CP) cells differ from their normal counterpart in gene expression. Genes encoding secreted or extracellular proteins with increased expression in CP may serve as potential biomarkers. For their detection and quantification, assays based on monoclonal antibodies are best suited for development in a clinical setting. One approach to obtain antibodies is to use recombinant proteins as immunogen. However, the synthesis of recombinant protein for each identified candidate is time-consuming and expensive. It is also not practical to generate high quality antibodies to all identified candidates individually. Furthermore, non-native forms (e.g., recombinant) of proteins may not always lead tomore » useful antibodies. Our approach was to purify a subset of proteins from CP tissue specimens for use as immunogen.« less
Sela, D. A.; Chapman, J.; Adeuya, A.; Kim, J. H.; Chen, F.; Whitehead, T. R.; Lapidus, A.; Rokhsar, D. S.; Lebrilla, C. B.; German, J. B.; Price, N. P.; Richardson, P. M.; Mills, D. A.
2008-01-01
Following birth, the breast-fed infant gastrointestinal tract is rapidly colonized by a microbial consortium often dominated by bifidobacteria. Accordingly, the complete genome sequence of Bifidobacterium longum subsp. infantis ATCC15697 reflects a competitive nutrient-utilization strategy targeting milk-borne molecules which lack a nutritive value to the neonate. Several chromosomal loci reflect potential adaptation to the infant host including a 43 kbp cluster encoding catabolic genes, extracellular solute binding proteins and permeases predicted to be active on milk oligosaccharides. An examination of in vivo metabolism has detected the hallmarks of milk oligosaccharide utilization via the central fermentative pathway using metabolomic and proteomic approaches. Finally, conservation of gene clusters in multiple isolates corroborates the genomic mechanism underlying milk utilization for this infant-associated phylotype. PMID:19033196
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wallis, G.A.; Rash, B.; Sweetman, W.A.
1994-02-01
Type X collagen is a homotrimeric, short-chain, nonfibrillar extracellular-matrix component that is specifically and transiently synthesized by hypertrophic chondrocytes at the site of endochondral ossification. The precise function of type X collagen is not known, but its specific pattern of expression suggests that mutations within the encoding gene (COL10A1) that alter the structure or synthesis of the protein may cause heritable forms of chondrodysplasia. The authors used the PCR and the SSCP techniques to analyze the coding and upstream promoter regions of the COL10A1 gene in a number of individuals with forms of chondrodysplasia. Using this approach, they identified twomore » individuals with metaphyseal chondrodysplasia type Schmid (MCDS) with SSCP changes in the region of the gene encoding the carboxyl-terminal domain. Sequence analysis demonstrated that the individuals were heterozygous for two unique single-base-pair transitions that led to the substitution of the highly conserved amino acid residue tyrosine at position 598 by aspartic acid in one person and of leucine at position 614 by proline in the other. The substitution at residue 598 segregated with the phenotype in a family of eight (five affected and three unaffected) related persons. The substitutions at residue 614 occurred in a sporadically affected individual but not in her unaffected mother and brother. Additional members of this family were not available for further study. These results suggest that certain amino acid substitutions within the carboxyl-terminal domain of the chains of the type X collagen molecule cause MCDS. These amino acid substitutions are likely to alter either chain recognition or assembly of the type X collagen molecule, thereby depleting the amount of normal type X collagen deposited in the extracellular matrix, with consequent aberrations in bone growth and development. 36 refs., 5 figs.« less
Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D
1996-01-01
The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231
Urra, Javier; Sandoval, Moisés; Cornejo, Isabel; Barros, L Felipe; Sepúlveda, Francisco V; Cid, L Pablo
2008-10-01
Extracellular pH, especially in relatively inaccessible microdomains between cells, affects transport membrane protein activity and might have an intercellular signaling role. We have developed a genetically encoded extracellular pH sensor capable of detecting pH changes in basolateral spaces of epithelial cells. It consists of a chimerical membrane protein displaying concatenated enhanced variants of cyan fluorescence protein (ECFP) and yellow fluorescence protein (EYFP) at the external aspect of the cell surface. The construct, termed pHCECSensor01, was targeted to basolateral membranes of Madin-Darby canine kidney (MDCK) cells by means of a sequence derived from the aquaporin AQP4. The fusion of pH-sensitive EYFP with pH-insensitive ECFP allows ratiometric pH measurements. The titration curve of pHCECSensor01 in vivo had a pK (a) value of 6.5 +/- 0.04. Only minor effects of extracellular chloride on pHCECSensor01 were observed around the physiological concentrations of this anion. In MDCK cells, the sensor was able to detect changes in pH secondary to H(+) efflux into the basolateral spaces elicited by an ammonium prepulse or lactate load. This genetically encoded sensor has the potential to serve as a noninvasive tool for monitoring changes in extracellular pH microdomains in epithelial and other tissues in vivo.
González, Alberto; Sáez, Claudio A; Morales, Bernardo; Moenne, Alejandra
2018-05-01
The existence of functional Transient Receptor Potential (TRP) channels was analyzed in Ectocarpus siliculosus using agonists of human TRPs and specific antagonists of TRPA1, TRPC5, TRPM8 and TRPV; intracellular calcium was detected for 60 min. Increases in intracellular calcium were observed at 13, 29, 39 and 50-52 min, which appeared to be mediated by the activation of TRPM8/V1 at 13 min, TRPV1 at 29 min, TRPA1/V1 at 39 min and TRPA1/C5 at 50-52 min. In addition, intracellular calcium increases appear to be due to extracellular calcium entry, not requiring protein kinase activation. On the other hand, 2.5 μM copper exposure induced increased intracellular calcium at 13, 29, 39 and 51 min, likely due to the activation of a TRPA1/V1 at 13 min, TRPA1/C5/M8 at 29 min, TRPC5/M8 at 39 min, and a TRPC5/V1 at 51 min. The increases in intracellular calcium induced by copper were due to extracellular calcium entry and required protein kinase activation. Furthermore, from 3 to 24 h, copper exposure induced an increase in the level of transcripts encoding antioxidant enzymes such as superoxide dismutase, ascorbate peroxidase, glutathione reductase and peroxiredoxin. The described upregulation decreased with inhibitors of CaMK, PKA, PKC, PKG and CBLPK, as well as with a mixture of TRP inhibitors. Thus, copper induces the activation of TRP channels allowing extracellular calcium entry as well as the activation of CaMK, PKA, PKC, PKG and CBLPK leading to increased expression of genes encoding antioxidant enzymes in E. siliculosus. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Functional Analysis of the p40 and p75 Proteins from Lactobacillus casei BL23
Bäuerl, Christine; Pérez-Martínez, Gaspar; Yan, Fang; Polk, D. Brent; Monedero, Vicente
2011-01-01
The genomes of Lactobacillus casei/paracasei and Lactobacillus rhamnosus strains carry two genes encoding homologues of p40 and p75 from L. rhamnosus GG, two secreted proteins which display anti-apoptotic and cell protective effects on human intestinal epithelial cells. p40 and p75 carry cysteine, histidine-dependent aminohydrolase/peptidase (CHAP) and NLPC/P60 domains, respectively, which are characteristic of proteins with cell-wall hydrolase activity. In L. casei BL23 both proteins were secreted to the growth medium and were also located at the bacterial cell surface. The genes coding for both proteins were inactivated in this strain. Inactivation of LCABL_00230 (encoding p40) did not result in a significant difference in phenotype, whereas a mutation in LCABL_02770 (encoding p75) produced cells that formed very long chains. Purified glutathione-S-transferase (GST)-p40 and -p75 fusion proteins were able to hydrolyze the muropeptides from L. casei cell walls. Both fusions bound to mucin, collagen and to intestinal epithelial cells and, similar to L. rhamnosus GG p40, stimulated epidermal growth factor receptor phosphorylation in mouse intestine ex vivo. These results indicate that extracellular proteins belonging to the machinery of cell-wall metabolism in the closely related L. casei/paracasei-L. rhamnosus group are most likely involved in the probiotic effects described for these bacteria PMID:21178363
Panus, Joanne Fanelli; Smith, Craig A.; Ray, Caroline A.; Smith, Terri Davis; Patel, Dhavalkumar D.; Pickup, David J.
2002-01-01
Cowpox virus (Brighton Red strain) possesses one of the largest genomes in the Orthopoxvirus genus. Sequence analysis of a region of the genome that is type-specific for cowpox virus identified a gene, vCD30, encoding a soluble, secreted protein that is the fifth member of the tumor necrosis factor receptor family known to be encoded by cowpox virus. The vCD30 protein contains 110 aa, including a 21-residue signal peptide, a potential O-linked glycosylation site, and a 58-aa sequence sharing 51–59% identity with highly conserved extracellular segments of both mouse and human CD30. A vCD30Fc fusion protein binds CD153 (CD30 ligand) specifically, and it completely inhibits CD153/CD30 interactions. Although the functions of CD30 are not well understood, the existence of vCD30 suggests that the cellular receptor plays a significant role in normal immune responses. Viral inhibition of CD30 also lends support to the potential therapeutic value of targeting CD30 in human inflammatory and autoimmune diseases. PMID:12034885
Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang
2005-11-01
A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.
Canseco-Pérez, Miguel Angel; Castillo-Avila, Genny Margarita; Islas-Flores, Ignacio; Apolinar-Hernández, Max M.; Rivera-Muñoz, Gerardo; Gamboa-Angulo, Marcela; Couoh-Uicab, Yeny
2018-01-01
A lipolytic screening with fungal strains isolated from lignocellulosic waste collected in banana plantation dumps was carried out. A Trichoderma harzianum strain (B13-1) showed good extracellular lipolytic activity (205 UmL−1). Subsequently, functional screening of the lipolytic activity on Rhodamine B enriched with olive oil as the only carbon source was performed. The successful growth of the strain allows us to suggest that a true lipase is responsible for the lipolytic activity in the B13-1 strain. In order to identify the gene(s) encoding the protein responsible for the lipolytic activity, in silico identification and characterization of triacylglycerol lipases from T. harzianum is reported for the first time. A survey in the genome of this fungus retrieved 50 lipases; however, bioinformatic analyses and putative functional descriptions in different databases allowed us to choose seven lipases as candidates. Suitability of the bioinformatic screening to select the candidates was confirmed by reverse transcription polymerase chain reaction (RT-PCR). The gene codifying 526309 was expressed when the fungus grew in a medium with olive oil as carbon source. This protein shares homology with commercial lipases, making it a candidate for further applications. The success in identifying a lipase gene inducible with olive oil and the suitability of the functional screening and bioinformatic survey carried out herein, support the premise that the strategy can be used in other microorganisms with sequenced genomes to search for true lipases, or other enzymes belonging to large protein families. PMID:29370083
Schulz, Wolfgang A; Ingenwerth, Marc; Djuidje, Carolle E; Hader, Christiane; Rahnenführer, Jörg; Engers, Rainer
2010-09-22
The cortical cytoskeleton network connects the actin cytoskeleton to various membrane proteins, influencing cell adhesion, polarity, migration and response to extracellular signals. Previous studies have suggested changes in the expression of specific components in prostate cancer, especially of 4.1 proteins (encoded by EPB41 genes) which form nodes in this network. Expression of EPB41L1, EPB41L2, EPB41L3 (protein: 4.1B), EPB41L4B (EHM2), EPB41L5, EPB49 (dematin), VIL2 (ezrin), and DLG1 (summarized as "cortical cytoskeleton" genes) as well as ERG was measured by quantitative RT-PCR in a well-characterized set of 45 M0 prostate adenocarcinoma and 13 benign tissues. Hypermethylation of EPB41L3 and GSTP1 was compared in 93 cancer tissues by methylation-specific PCR. Expression of 4.1B was further studied by immunohistochemistry. EPB41L1 and EPB41L3 were significantly downregulated and EPB41L4B was upregulated in cancer tissues. Low EPB41L1 or high EPB41L4B expression were associated with earlier biochemical recurrence. None of the other cortical cytoskeleton genes displayed expression changes, in particular EPB49 and VIL2, despite hints from previous studies. EPB41L3 downregulation was significantly associated with hypermethylation of its promoter and strongly correlated with GSTP1 hypermethylation. Protein 4.1B was detected most strongly in the basal cells of normal prostate epithelia. Its expression in carcinoma cells was similar to the weaker one in normal luminal cells. EPB41L3 downregulation and EPB41L4B upregulation were essentially restricted to the 22 cases with ERG overexpression. Expression changes in EPB41L3 and EPB41L4B closely paralleled those previously observed for the extracellular matrix genes FBLN1 and SPOCK1, respectively. Specific changes in the cortical cytoskeleton were observed during prostate cancer progression. They parallel changes in the expression of extracellular matrix components and all together appear to be associated with oncogenic ERG overexpression. We hypothesize that these alterations may contribute to the increased invasivity conferred to prostate cancer cells by ERG deregulation.
Genes and abdominal aortic aneurysm.
Hinterseher, Irene; Tromp, Gerard; Kuivaniemi, Helena
2011-04-01
Abdominal aortic aneurysm (AAA) is a multifactorial disease with a strong genetic component. Since the first candidate gene studies were published 20 years ago, approximately 100 genetic association studies using single nucleotide polymorphisms (SNPs) in biologically relevant genes have been reported on AAA. These studies investigated SNPs in genes of the extracellular matrix, the cardiovascular system, the immune system, and signaling pathways. Very few studies were large enough to draw firm conclusions and very few results could be replicated in another sample set. The more recent unbiased approaches are family-based DNA linkage studies and genome-wide genetic association studies, which have the potential of identifying the genetic basis for AAA, only when appropriately powered and well-characterized large AAA cohorts are used. SNPs associated with AAA have already been identified in these large multicenter studies. One significant association was of a variant in a gene called contactin-3, which is located on chromosome 3p12.3. However, two follow-up studies could not replicate this association. Two other SNPs, which are located on chromosome 9p21 and 9q33, were replicated in other samples. The two genes with the strongest supporting evidence of contribution to the genetic risk for AAA are the CDKN2BAS gene, also known as ANRIL, which encodes an antisense ribonucleic acid that regulates expression of the cyclin-dependent kinase inhibitors CDKN2A and CDKN2B, and DAB2IP, which encodes an inhibitor of cell growth and survival. Functional studies are now needed to establish the mechanisms by which these genes contribute toward AAA pathogenesis. Copyright © 2011 Annals of Vascular Surgery Inc. Published by Elsevier Inc. All rights reserved.
Rose, Sasha J; Bermudez, Luiz E
2016-12-06
Extracellular DNA (eDNA) is an integral biofilm matrix component of numerous pathogens, including nontuberculous mycobacteria (NTM). Cell lysis is the source of eDNA in certain bacteria, but the source of eDNA remains unidentified for NTM, as well as for other eDNA-containing bacterial species. In this study, conditions affecting eDNA export were examined, and genes involved with the eDNA export mechanism were identified. After a method for monitoring eDNA in real time in undisturbed biofilms was established, different conditions affecting eDNA were investigated. Bicarbonate positively influenced eDNA export in a pH-independent manner in Mycobacterium avium, M. abscessus, and M. chelonae The surface-exposed proteome of M. avium in eDNA-containing biofilms revealed abundant carbonic anhydrases. Chemical inhibition of carbonic anhydrases with ethoxzolamide significantly reduced eDNA export. An unbiased transposon mutant library screen for eDNA export in M. avium identified many severely eDNA-attenuated mutants, including one not expressing a unique FtsK/SpoIIIE-like DNA-transporting pore, two with inactivation of carbonic anhydrases, and nine with inactivation of genes belonging to a unique genomic region, as well as numerous mutants involved in metabolism and energy production. Complementation of nine mutants that included the FtsK/SpoIIIE and carbonic anhydrase significantly restored eDNA export. Interestingly, several attenuated eDNA mutants have mutations in genes encoding proteins that were found with the surface proteomics, and many more mutations are localized in operons potentially encoding surface proteins. Collectively, our data strengthen the evidence of eDNA export being an active mechanism that is activated by the bacterium responding to bicarbonate. Many bacteria contain extracellular DNA (eDNA) in their biofilm matrix, as it has various biological and physical functions. We recently reported that nontuberculous mycobacteria (NTM) can contain significant quantities of eDNA in their biofilms. In some bacteria, eDNA is derived from dead cells, but that does not appear to be the case for all eDNA-containing organisms, including NTM. In this study, we found that eDNA export in NTM is conditionally dependent on the molecules to which the bacteria are exposed and that bicarbonate positively influences eDNA export. We also identified genes and proteins important for eDNA export, which begins to piece together a description of a mechanism for eDNA. Better understanding of eDNA export can give new targets for the development of antivirulence drugs, which are attractive because resistance to classical antibiotics is currently a significant problem. Copyright © 2016 Rose and Bermudez.
Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme
2017-01-01
Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.
Expression, purification and characterization of a phyAm-phyCs fusion phytase*
Zou, Li-kou; Wang, Hong-ning; Pan, Xin; Tian, Guo-bao; Xie, Zi-wen; Wu, Qi; Chen, Hui; Xie, Tao; Yang, Zhi-rong
2008-01-01
The phyAm gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyAm-phyCs gene was successfully overexpressed in P. pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoHf), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyAm. PMID:18600783
Parsons, Joshua B.; Broussard, Tyler C.; Bose, Jeffrey L.; Rosch, Jason W.; Jackson, Pamela; Subramanian, Chitra; Rock, Charles O.
2014-01-01
Extracellular fatty acid incorporation into the phospholipids of Staphylococcus aureus occurs via fatty acid phosphorylation. We show that fatty acid kinase (Fak) is composed of two dissociable protein subunits encoded by separate genes. FakA provides the ATP binding domain and interacts with two distinct FakB proteins to produce acyl-phosphate. The FakBs are fatty acid binding proteins that exchange bound fatty acid/acyl-phosphate with fatty acid/acyl-phosphate presented in detergent micelles or liposomes. The ΔfakA and ΔfakB1 ΔfakB2 strains were unable to incorporate extracellular fatty acids into phospholipid. FakB1 selectively bound saturated fatty acids whereas FakB2 preferred unsaturated fatty acids. Affymetrix array showed a global perturbation in the expression of virulence genes in the ΔfakA strain. The severe deficiency in α-hemolysin protein secretion in ΔfakA and ΔfakB1 ΔfakB2 mutants coupled with quantitative mRNA measurements showed that fatty acid kinase activity was required to support virulence factor transcription. These data reveal the function of two conserved gene families, their essential role in the incorporation of host fatty acids by Gram-positive pathogens, and connects fatty acid kinase to the regulation of virulence factor transcription in S. aureus. PMID:25002480
Soule, Tanya; Shipe, Dexter; Lothamer, Justin
2016-10-01
Some cyanobacteria can protect themselves from ultraviolet radiation by producing sunscreen pigments. In particular, the sheath pigment scytonemin protects cells against long-wavelength UVA radiation and is only found in cyanobacteria which are capable of extracellular polysaccharide (EPS) production. The presence of a putative glycosyltransferase encoded within the scytonemin gene cluster, along with the localization of scytonemin and EPS to the extracellular sheath, prompted us to investigate the relationship between scytonemin and EPS production under UVA stress. In this study, it was hypothesized that there would be a relationship between the biosynthesis of scytonemin and EPS under both UVA and oxidative stress, since the latter is a by-product of UVA radiation. EPS production was measured following exposure of wild-type Nostoc punctiforme and the non-scytonemin-producing strain SCY59 to UVA and oxidative stress. Under UVA, SCY59 produced significantly more EPS than the unstressed controls and the wild type, while both strains produced more EPS under oxidative stress compared to the controls. The results suggest that EPS secretion occurs in response to the oxidative stress by-product of UVA rather than as a direct response to UVA radiation.
Inducible repression of multiple expansin genes leads to growth suppression during leaf development.
Goh, Hoe-Han; Sloan, Jennifer; Dorca-Fornell, Carmen; Fleming, Andrew
2012-08-01
Expansins are cell wall proteins implicated in the control of plant growth via loosening of the extracellular matrix. They are encoded by a large gene family, and data linked to loss of single gene function to support a role of expansins in leaf growth remain limited. Here, we provide a quantitative growth analysis of transgenics containing an inducible artificial microRNA construct designed to down-regulate the expression of a number of expansin genes that an expression analysis indicated are expressed during the development of Arabidopsis (Arabidopsis thaliana) leaf 6. The results support the hypothesis that expansins are required for leaf growth and show that decreased expansin gene expression leads to a more marked repression of growth during the later stage of leaf development. In addition, a histological analysis of leaves in which expansin gene expression was suppressed indicates that, despite smaller leaves, mean cell size was increased. These data provide functional evidence for a role of expansins in leaf growth, indicate the importance of tissue/organ developmental context for the outcome of altered expansin gene expression, and highlight the separation of the outcome of expansin gene expression at the cellular and organ levels.
Enamel formation and amelogenesis imperfecta.
Hu, Jan C-C; Chun, Yong-Hee P; Al Hazzazzi, Turki; Simmer, James P
2007-01-01
Dental enamel is the epithelial-derived hard tissue covering the crowns of teeth. It is the most highly mineralized and hardest tissue in the body. Dental enamel is acellular and has no physiological means of repair outside of the protective and remineralization potential provided by saliva. Enamel is comprised of highly organized hydroxyapatite crystals that form in a defined extracellular space, the contents of which are supplied and regulated by ameloblasts. The entire process is under genetic instruction. The genetic control of amelogenesis is poorly understood, but requires the activities of multiple components that are uniquely important for dental enamel formation. Amelogenesis imperfecta (AI) is a collective designation for the variety of inherited conditions displaying isolated enamel malformations, but the designation is also used to indicate the presence of an enamel phenotype in syndromes. Recently, genetic studies have demonstrated the importance of genes encoding enamel matrix proteins in the etiology of isolated AI. Here we review the essential elements of dental enamel formation and the results of genetic analyses that have identified disease-causing mutations in genes encoding enamel matrix proteins. In addition, we provide a fresh perspective on the roles matrix proteins play in catalyzing the biomineralization of dental enamel. Copyright 2007 S. Karger AG, Basel.
Hasan, S. Naimul; Mark, Brian; Harlalka, Gaurav V.; Patton, Michael A.; Ishida, Miho; Sharma, Sanjay; Faqeih, Eissa; Blakley, Brian; Jackson, Mike; Lees, Melissa; Dolinsky, Vernon; Cross, Leroy; Stanier, Philip; Salter, Claire; Baple, Emma L.; Crosby, Andrew H.
2017-01-01
Orofacial clefting is amongst the most common of birth defects, with both genetic and environmental components. Although numerous studies have been undertaken to investigate the complexities of the genetic etiology of this heterogeneous condition, this factor remains incompletely understood. Here, we describe mutations in the HYAL2 gene as a cause of syndromic orofacial clefting. HYAL2, encoding hyaluronidase 2, degrades extracellular hyaluronan, a critical component of the developing heart and palatal shelf matrix. Transfection assays demonstrated that the gene mutations destabilize the molecule, dramatically reducing HYAL2 protein levels. Consistent with the clinical presentation in affected individuals, investigations of Hyal2-/- mice revealed craniofacial abnormalities, including submucosal cleft palate. In addition, cor triatriatum sinister and hearing loss, identified in a proportion of Hyal2-/- mice, were also found as incompletely penetrant features in affected humans. Taken together our findings identify a new genetic cause of orofacial clefting in humans and mice, and define the first molecular cause of human cor triatriatum sinister, illustrating the fundamental importance of HYAL2 and hyaluronan turnover for normal human and mouse development. PMID:28081210
Novel TMEM67 Mutations and Genotype-phenotype Correlates in Meckelin-related Ciliopathies
Iannicelli, Miriam; Brancati, Francesco; Mougou-Zerelli, Soumaya; Mazzotta, Annalisa; Thomas, Sophie; Elkhartoufi, Nadia; Travaglini, Lorena; Gomes, Céline; Ardissino, Gian Luigi; Bertini, Enrico; Boltshauser, Eugen; Castorina, Pierangela; D'Arrigo, Stefano; Fischetto, Rita; Leroy, Brigitte; Loget, Philippe; Bonnière, Maryse; Starck, Lena; Tantau, Julia; Gentilin, Barbara; Majore, Silvia; Swistun, Dominika; Flori, Elizabeth; Lalatta, Faustina; Pantaleoni, Chiara; Johannes.Penzien; Grammatico, Paola; Dallapiccola, Bruno; Gleeson, Joseph G.; Attie-Bitach, Tania; Valente, Enza Maria
2010-01-01
Human ciliopathies are hereditary conditions caused by defects of proteins expressed at the primary cilium. Among ciliopathies, Joubert syndrome and related disorders (JSRD), Meckel syndrome (MKS) and nephronophthisis (NPH) present clinical and genetic overlap, being allelic at several loci. One of the most interesting gene is TMEM67, encoding the transmembrane protein meckelin. We performed mutation analysis of TMEM67 in 341 probands, including 265 JSRD representative of all clinical subgroups and 76 MKS fetuses. We identified 33 distinct mutations, of which 20 were novel, in 8/10 (80%) JS with liver involvement (COACH phenotype) and 12/76 (16%) MKS fetuses. No mutations were found in other JSRD subtypes, confirming the strong association between TMEM67 mutations and liver involvement. Literature review of all published TMEM67 mutated cases was performed to delineate genotype-phenotype correlates. In particular, comparison of the types of mutations and their distribution along the gene in lethal versus non lethal phenotypes showed in MKS patients a significant enrichment of missense mutations falling in TMEM67 exons 8 to 15, especially when in combination with a truncating mutation. These exons encode for a region of unknown function in the extracellular domain of meckelin. PMID:20232449
Gq/11-Dependent Changes in the Murine Ovarian Transcriptome at the End of Gestation1
Waite, Courtney; Mejia, Rachel; Ascoli, Mario
2016-01-01
Parturition in rodents is highly dependent on the engagement of the luteal prostaglandin F2 alpha receptor, which, through activation of the Gq/11 family of G proteins, increases the expression of Akr1c18, leading to an increase in progesterone catabolism. To further understand the involvement of Gq/11 on luteolysis and parturition, we used microarray analysis to compare the ovarian transcriptome of mice with a granulosa/luteal cell-specific deletion of Galphaq/11 with their control littermates on Day 18 of pregnancy, when mice from both genotypes are pregnant, and on Day 22, when mice with a granulosa/luteal cell-specific deletion of Galphaq/11 are still pregnant but their control littermates are 1–2 days postpartum. Ovarian genes up-regulated at the end of gestation in a Galphaq/11 -dependent fashion include genes involved in focal adhesion and extracellular matrix interactions. Genes down-regulated at the end of gestation in a Galphaq/11-dependent manner include Serpina6 (which encodes corticosteroid-binding globulin); Enpp2 (which encodes autotaxin, the enzyme responsible for the synthesis of lysophosphatidic acid); genes involved in protein processing and export; reproductive genes, such as Lhcgr; the three genes needed to convert progesterone to estradiol (Cyp17a1, Hsd17b7, and Cyp19a1); and Inha. Activation of ovarian Gq/11 by engagement of the prostaglandin F2 alpha receptor on Day 18 of pregnancy recapitulated the regulation of many but not all of these genes. Thus, although the ovarian transcriptome at the end of gestation is highly dependent on the activation of Gq/11, not all of these changes are dependent on the actions of prostaglandin F2 alpha. PMID:26843449
Gu, Chen; Wang, Jing; Guo, Mengfan; Sui, Meng; Lu, Hong; Liu, Guangfei
2018-06-07
Tetrabromobisphenol A (TBBPA) has attracted considerable attention due to its ubiquitous presence in different environmental compartments worldwide. However, information on its aerobic biodegradability in coastal environments remains unknown. Here, the aerobic biodegradation of TBBPA using a Pseudoalteromonas species commonly found in the marine environment was investigated. We found that extracellular biogenic siderophore, superoxide anion radical (O 2 •- ), hydrogen peroxide (H 2 O 2 ), and hydroxyl radical ( • OH) were involved in TBBPA degradation. Upregulation of genes (nqrA and lodA) encoding Na + -translocating NADH-quinone oxidoreductase and l-lysine-ε-oxidase supported the extracellular O 2 •- and H 2 O 2 production. The underlying mechanism of TBBPA biodegradation presumably involves both O 2 •- reduction and • OH-based advanced oxidation process (AOP). Furthermore, TBBPA intermediates of tribromobisphenol A, 4-isopropylene-2,6-dibromophenol, 4-(2-hydroxyisopropyl)-2,6-dibromophenol, 2,4,6-tribromophenol (TBP), 4-hydroxybenzoic acid, and 2-bromobenzoic acid were detected in the culture medium. Debromination and β-scission pathways of TBBPA biodegradation were proposed. Additionally, membrane integrity assays revealed that the increase of intracellular catalase (CAT) activity and the extracellular polymeric substances (EPS) might account for the alleviation of oxidative damage. These findings could deepen understanding of the biodegradation mechanism of TBBPA and other related organic pollutants in coastal and artificial bioremediation systems. Copyright © 2018 Elsevier Ltd. All rights reserved.
Bae, Gyu-Un; Yang, Youn-Joo; Jiang, Guoying; Hong, Mingi; Lee, Hye-Jin; Tessier-Lavigne, Marc
2009-01-01
A variety of signaling pathways participate in the development of skeletal muscle, but the extracellular cues that regulate such pathways in myofiber formation are not well understood. Neogenin is a receptor for ligands of the netrin and repulsive guidance molecule (RGM) families involved in axon guidance. We reported previously that neogenin promoted myotube formation by C2C12 myoblasts in vitro and that the related protein Cdo (also Cdon) was a potential neogenin coreceptor in myoblasts. We report here that mice homozygous for a gene-trap mutation in the Neo1 locus (encoding neogenin) develop myotomes normally but have small myofibers at embryonic day 18.5 and at 3 wk of age. Similarly, cultured myoblasts derived from such animals form smaller myotubes with fewer nuclei than myoblasts from control animals. These in vivo and in vitro defects are associated with low levels of the activated forms of focal adhesion kinase (FAK) and extracellular signal-regulated kinase (ERK), both known to be involved in myotube formation, and inefficient expression of certain muscle-specific proteins. Recombinant netrin-2 activates FAK and ERK in cultured myoblasts in a neogenin- and Cdo-dependent manner, whereas recombinant RGMc displays lesser ability to activate these kinases. Together, netrin-neogenin signaling is an important extracellular cue in regulation of myogenic differentiation and myofiber size. PMID:19812254
Kindler syndrome pathogenesis and fermitin family homologue 1 (kindlin-1) function.
D'Souza, Maria-Anna M A; Kimble, Roy M; McMillan, James R
2010-01-01
Kindler syndrome is caused by genetic defects in the focal contact-associated protein, fermitin family homologue 1 (FFH1), encoded by the gene FERMT1 (known as KIND1). Defects in FFH1 lead to abnormal integrin activation and loss of keratinocyte epidermal adhesion to the underlying basal lamina, disruption in normal cell cytoskeleton within keratinocytes, and altered signaling pathways, leading to increased extracellular matrix production. Null mutations in FERMT1 result in skin blistering from birth and early childhood progressive poikiloderma, mucosal fragility, and increased risk of cancer. The complete range of FFH1 functions in skin and other epithelia has yet to be determined.
Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis.
Niemietz, Christoph; Chandhok, Gursimran; Schmidt, Hartmut
2015-09-30
The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR), expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP). Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO) and small interfering RNA (siRNA) designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.
Yuliana, Tri; Nakajima, Nobuyoshi; Yamamura, Shigeki; Tomita, Masaru; Suzuki, Haruo; Amachi, Seigo
2017-01-01
Roseovarius sp. A-2 is a heterotrophic iodide (I - )-oxidizing bacterium isolated from iodide-rich natural gas brine water in Chiba, Japan. This strain oxidizes iodide to molecular iodine (I 2 ) by means of an extracellular multicopper oxidase. Here we report the draft genome sequence of strain A-2. The draft genome contained 46 tRNA genes, 1 copy of a 16S-23S-5S rRNA operon, and 4,514 protein coding DNA sequences, of which 1,207 (27%) were hypothetical proteins. The genome contained a gene encoding IoxA, a multicopper oxidase previously found to catalyze the oxidation of iodide in Iodidimonas sp. Q-1. This draft genome provides detailed insights into the metabolism and potential application of Roseovarius sp. A-2.
Zhao, Jinlei
2014-01-01
Monosaccharides available in the extracellular milieu of Agrobacterium tumefaciens can be transported into the cytoplasm, or via the periplasmic sugar binding protein, ChvE, play a critical role in controlling virulence gene expression. The ChvE-MmsAB ABC transporter is involved in the utilization of a wide range of monosaccharide substrates but redundant transporters are likely given the ability of a chvE-mmsAB deletion strain to grow, albeit more slowly, in the presence of particular monosaccharides. In this study, a putative ABC transporter encoded by the gxySBA operon is identified and shown to be involved in the utilization of glucose, xylose, fucose, and arabinose, which are also substrates for the ChvE-MmsAB ABC transporter. Significantly, GxySBA is also shown to be the first characterized glucosamine ABC transporter. The divergently transcribed gene gxyR encodes a repressor of the gxySBA operon, the function of which can be relieved by a subset of the transported sugars, including glucose, xylose, and glucosamine, and this substrate-induced expression can be repressed by glycerol. Furthermore, deletion of the transporter can increase the sensitivity of the virulence gene expression system to certain sugars that regulate it. Collectively, the results reveal a remarkably diverse set of substrates for the GxySBA transporter and its contribution to the repression of sugar sensitivity by the virulence-controlling system, thereby facilitating the capacity of the bacterium to distinguish between the soil and plant environments. PMID:24957625
Lin, Yang; Lewallen, Eric A.; Camilleri, Emily T.; Bonin, Carolina A.; Jones, Dakota L.; Dudakovic, Amel; Galeano-Garces, Catalina; Wang, Wei; Karperien, Marcel J.; Larson, Annalise N.; Dahm, Diane L.; Stuart, Michael J.; Levy, Bruce A.; Smith, Jay; Ryssman, Daniel B.; Westendorf, Jennifer J.; Im, Hee-Jeong; van Wijnen, Andre J.; Riester, Scott M.; Krych, Aaron J.
2016-01-01
Preservation of osteochondral allografts used for transplantation is critical to ensure favorable outcomes for patients after surgical treatment of cartilage defects. To study the biological effects of protocols currently used for cartilage storage, we investigated differences in gene expression between stored allograft cartilage and fresh cartilage from living donors using high throughput molecular screening strategies. We applied next generation RNA sequencing (RNA-seq) and real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) to assess genome-wide differences in mRNA expression between stored allograft cartilage and fresh cartilage tissue from living donors. Gene ontology analysis was used to characterize biological pathways associated with differentially expressed genes. Our studies establish reduced levels of mRNAs encoding cartilage related extracellular matrix (ECM) proteins (i.e., COL1A1, COL2A1, COL10A1, ACAN, DCN, HAPLN1, TNC, and COMP) in stored cartilage. These changes occur concomitantly with increased expression of “early response genes” that encode transcription factors mediating stress/cytoprotective responses (i.e., EGR1, EGR2, EGR3, MYC, FOS, FOSB, FOSL1, FOSL2, JUN, JUNB, and JUND). The elevated expression of “early response genes” and reduced levels of ECM-related mRNAs in stored cartilage allografts suggests that tissue viability may be maintained by a cytoprotective program that reduces cell metabolic activity. These findings have potential implications for future studies focused on quality assessment and clinical optimization of osteochondral allografts used for cartilage transplantation. PMID:26909883
Molecular defense mechanisms of Barrett's metaplasia estimated by an integrative genomics.
Ostrowski, Jerzy; Mikula, Michal; Karczmarski, Jakub; Rubel, Tymon; Wyrwicz, Lucjan S; Bragoszewski, Piotr; Gaj, Pawel; Dadlez, Michal; Butruk, Eugeniusz; Regula, Jaroslaw
2007-07-01
Barrett's esophagus is characterized by the replacement of squamous epithelium with specialized intestinal metaplastic mucosa. The exact mechanisms of initiation and development of Barrett's metaplasia remain unknown, but a hypothesis of "successful adaptation" against noxious reflux components has been proposed. To search for the repertoire of adaptation mechanisms of Barrett's metaplasia, we employed high-throughput functional genomic and proteomic methods that defined the molecular background of metaplastic mucosa resistance to reflux. Transcriptional profiling was established for 23 pairs of esophageal squamous epithelium and Barrett's metaplasia tissue samples using Affymetrix U133A 2.0 GeneChips and validated by quantitative real-time polymerase chain reaction. Differences in protein composition were assessed by electrophoretic and mass-spectrometry-based methods. Among 2,822 genes differentially expressed between Barrett's metaplasia and squamous epithelium, we observed significantly overexpressed metaplastic mucosa genes that encode cytokines and growth factors, constituents of extracellular matrix, basement membrane and tight junctions, and proteins involved in prostaglandin and phosphoinositol metabolism, nitric oxide production, and bioenergetics. Their expression likely reflects defense and repair responses of metaplastic mucosa, whereas overexpression of genes encoding heat shock proteins and several protein kinases in squamous epithelium may reflect lower resistance of normal esophageal epithelium than Barrett's metaplasia to reflux components. Despite the methodological and interpretative difficulties in data analyses discussed in this paper, our studies confirm that Barrett's metaplasia may be regarded as a specific microevolution allowing for accumulation of mucosal morphological and physiological changes that better protect against reflux injury.
Riekki, R; Palomäki, T; Virtaharju, O; Kokko, H; Romantschuk, M; Saarilahti, H T
2000-07-01
A cellulase-producing clone was isolated from a genomic library of the Erwinia rhapontici (Millard) Burkholder strain NCPPB2989. The corresponding gene, named celA, encodes an endoglucanase (EC 3.2.1.4) with the extremely low pH optimum of 3.4 and a temperature optimum between 40 and 50 degrees C. A single ORF of 999 nt was found to be responsible for the Cel activity. The corresponding protein, named CelA, showed 67% identity to the endoglucanase Y of E. chrysanthemi and 51.5% identity to the endoglucanase of Cellulomonas uda, and thus belongs to the glycosyl hydrolase family 8. The celA gene, or its homologue, was found to be present in all E. rhapontici isolates analysed, in E. chrysanthemi, and in E. amylovora. The presence of plant cell wall-degrading enzymes in the amylovora group of Erwinia spp. had not previously been established. Furthermore, the DNA of both E. rhapontici and E. amylovora was found to exhibit homology to genes encoding the type II (GSP) secretion pathway, which is known to be responsible for extracellular targeting of cellulases and pectinases in Erwinia spp. that cause soft rotting, such as E. carotovora and E. chrysanthemi. Secretion of the CelA protein by E. rhapontici could not be verified. However, the CelA protein itself was found to include the information necessary for heterologous secretion by E. chrysanthemi.
Elongator Plays a Positive Role in Exogenous NAD-Induced Defense Responses in Arabidopsis.
An, Chuanfu; Ding, Yezhang; Zhang, Xudong; Wang, Chenggang; Mou, Zhonglin
2016-05-01
Extracellular NAD is emerging as an important signal molecule in animal cells, but its role in plants has not been well-established. Although it has been shown that exogenous NAD(+) activates defense responses in Arabidopsis, components in the exogenous NAD(+)-activated defense pathway remain to be fully discovered. In a genetic screen for mutants insensitive to exogenous NAD(+) (ien), we isolated a mutant named ien2. Map-based cloning revealed that IEN2 encodes ELONGATA3 (ELO3)/AtELP3, a subunit of the Arabidopsis Elongator complex, which functions in multiple biological processes, including histone modification, DNA (de)methylation, and transfer RNA modification. Mutations in the ELO3/AtELP3 gene compromise exogenous NAD(+)-induced expression of pathogenesis-related (PR) genes and resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326, and transgenic expression of the coding region of ELO3/AtELP3 in elo3/Atelp3 restores NAD(+) responsiveness to the mutant plants, demonstrating that ELO3/AtELP3 is required for exogenous NAD(+)-induced defense responses. Furthermore, mutations in genes encoding the other five Arabidopsis Elongator subunits (ELO2/AtELP1, AtELP2, ELO1/AtELP4, AtELP5, and AtELP6) also compromise exogenous NAD(+)-induced PR gene expression and resistance to P. syringae pv. maculicola ES4326. These results indicate that the Elongator complex functions as a whole in exogenous NAD(+)-activated defense signaling in Arabidopsis.
The gene transfer agent-like particle of the marine phototrophic bacterium Rhodovulum sulfidophilum.
Nagao, Nobuyoshi; Yamamoto, Junya; Komatsu, Hiroyuki; Suzuki, Hiromichi; Hirose, Yuu; Umekage, So; Ohyama, Takashi; Kikuchi, Yo
2015-12-01
Gene transfer agents (GTAs) are shaped like bacteriophage particles but have many properties that distinguish them from bacteriophages. GTAs play a role in horizontal gene transfer in nature and thus affect the evolution of prokaryotic genomes. In the course of studies on the extracellular production of designed RNAs using the marine bacterium Rhodovulum sulfidophilum , we found that this bacterium produces a GTA-like particle. The particle contains DNA fragments of 4.5 kb, which consist of randomly fragmented genomic DNA from the bacterium. This 4.5-kb DNA production was prevented while quorum sensing was inhibited. Direct observation of the particle by transmission electron microscopy revealed that the particle resembles a tailed phage and has a head diameter of about 40 nm and a tail length of about 60 nm. We also identified the structural genes for the GTA in the genome. Translated amino acid sequences and gene positions are closely related to those of the genes that encode the Rhodobacter capsulatus GTA. This is the first report of a GTA-like particle from the genus Rhodovulum . However, gene transfer activity of this particle has not yet been confirmed. The differences between this particle and other GTAs are discussed.
Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.
Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y
1996-01-01
The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.
Béguel, Jean-Philippe; Huvet, Arnaud; Quillien, Virgile; Lambert, Christophe; Fabioux, Caroline
2013-01-01
Energy allocation principle is a core element of life-history theory in which "the cost of reproduction" corresponds to an acceleration of senescence caused by an increase in reproductive investment. In the "theory of aging", senescence is mainly due to the degradation of lipids, proteins and DNA by reactive oxygen species (ROS), by-products of oxidative metabolism. Some studies have shown that oxidative stress susceptibility could be a cost of reproduction. The present study investigates the effect of reproductive investment on antioxidant capacity in the gills of a species with a very high reproductive investment, the Pacific oyster Crassostrea gigas. We used RNA interference targeting the oyster vasa-like gene (Oyvlg) to produce oysters with contrasted reproductive investment. Antioxidant capacity was studied by measuring the mRNA levels of genes encoding major antioxidant enzymes, and the activity of these enzymes. The highest reproductive investment was associated with the highest transcript levels for glutathione peroxidase and extra-cellular and mitochondrial superoxide dismutase. In contrast, lipid peroxidation did not show any sign of oxidative damage whatever the reproductive investment. Up-regulation of certain genes encoding enzymes involved in the first step of ROS detoxification could therefore be a part of the organism's strategy for managing the pro-oxidant species produced by heavy reproductive investment. Copyright © 2012 Elsevier Inc. All rights reserved.
Pehlivan, Necla; Sun, Li; Jarrett, Philip; Yang, Xiaojie; Mishra, Neelam; Chen, Lin; Kadioglu, Asim; Shen, Guoxin; Zhang, Hong
2016-01-01
The Arabidopsis gene AtNHX1 encodes a vacuolar membrane-bound sodium/proton (Na+/H+) antiporter that transports Na+ into the vacuole and exports H+ into the cytoplasm. The Arabidopsis gene SOS1 encodes a plasma membrane-bound Na+/H+ antiporter that exports Na+ to the extracellular space and imports H+ into the plant cell. Plants rely on these enzymes either to keep Na+ out of the cell or to sequester Na+ into vacuoles to avoid the toxic level of Na+ in the cytoplasm. Overexpression of AtNHX1 or SOS1 could improve salt tolerance in transgenic plants, but the improved salt tolerance is limited. NaCl at concentration >200 mM would kill AtNHX1-overexpressing or SOS1-overexpressing plants. Here it is shown that co-overexpressing AtNHX1 and SOS1 could further improve salt tolerance in transgenic Arabidopsis plants, making transgenic Arabidopsis able to tolerate up to 250 mM NaCl treatment. Furthermore, co-overexpression of AtNHX1 and SOS1 could significantly reduce yield loss caused by the combined stresses of heat and salt, confirming the hypothesis that stacked overexpression of two genes could substantially improve tolerance against multiple stresses. This research serves as a proof of concept for improving salt tolerance in other plants including crops. PMID:26985021
Neisseria gonorrhoeae Modulates Iron-Limiting Innate Immune Defenses in Macrophages
Zughaier, Susu M.; Kandler, Justin L.; Shafer, William M.
2014-01-01
Neisseria gonorrhoeae is a strict human pathogen that causes the sexually transmitted infection termed gonorrhea. The gonococcus can survive extracellularly and intracellularly, but in both environments the bacteria must acquire iron from host proteins for survival. However, upon infection the host uses a defensive response by limiting the bioavailability of iron by a number of mechanisms including the enhanced expression of hepcidin, the master iron-regulating hormone, which reduces iron uptake from the gut and retains iron in macrophages. The host also secretes the antibacterial protein NGAL, which sequesters bacterial siderophores and therefore inhibits bacterial growth. To learn whether intracellular gonococci can subvert this defensive response, we examined expression of host genes that encode proteins involved in modulating levels of intracellular iron. We found that N. gonorrhoeae can survive in association (tightly adherent and intracellular) with monocytes and macrophages and upregulates a panel of its iron-responsive genes in this environment. We also found that gonococcal infection of human monocytes or murine macrophages resulted in the upregulation of hepcidin, NGAL, and NRAMP1 as well as downregulation of the expression of the gene encoding the short chain 3-hydroxybutyrate dehydrogenase (BDH2); BDH2 catalyzes the production of the mammalian siderophore 2,5-DHBA involved in chelating and detoxifying iron. Based on these findings, we propose that N. gonorrhoeae can subvert the iron-limiting innate immune defenses to facilitate iron acquisition and intracellular survival. PMID:24489950
Corinaldesi, Cinzia; Danovaro, Roberto; Dell'Anno, Antonio
2005-01-01
The occurrence of high extracellular DNA concentrations in aquatic sediments (concentrations that are 3 to 4 orders of magnitude greater than those in the water column) might play an important role in biogeochemical cycling, as well as in horizontal gene transfer through natural transformation. Since isolation of extracellular DNA from sediments is a difficult and unsolved task, in this study we developed an efficient procedure to recover simultaneously DNA associated with microbial cells and extracellular DNA from the same sediment sample. This procedure is specifically suitable for studying extracellular DNA because it avoids any contamination with DNA released by cell lysis during handling and extraction. Applying this procedure to different sediment types, we obtained extracellular DNA concentrations that were about 10 to 70 times higher than the intracellular DNA concentrations. Using specific targeted prokaryotic primers, we obtained evidence that extracellular DNA recovered from different sediments did not contain amplifiable 16S rRNA genes. By contrast, using DNA extracted from microbial cells as the template, we always amplified 16S rRNA genes. Although 16S rRNA genes were not detected in extracellular DNA, analyses of the sizes of extracellular DNA indicated the presence of high-molecular-weight fragments that might have contained other gene sequences. This protocol allows investigation of extracellular DNA and its possible participation in natural transformation processes. PMID:15640168
A provisional regulatory gene network for specification of endomesoderm in the sea urchin embryo
NASA Technical Reports Server (NTRS)
Davidson, Eric H.; Rast, Jonathan P.; Oliveri, Paola; Ransick, Andrew; Calestani, Cristina; Yuh, Chiou-Hwa; Minokawa, Takuya; Amore, Gabriele; Hinman, Veronica; Arenas-Mena, Cesar;
2002-01-01
We present the current form of a provisional DNA sequence-based regulatory gene network that explains in outline how endomesodermal specification in the sea urchin embryo is controlled. The model of the network is in a continuous process of revision and growth as new genes are added and new experimental results become available; see http://www.its.caltech.edu/mirsky/endomeso.htm (End-mes Gene Network Update) for the latest version. The network contains over 40 genes at present, many newly uncovered in the course of this work, and most encoding DNA-binding transcriptional regulatory factors. The architecture of the network was approached initially by construction of a logic model that integrated the extensive experimental evidence now available on endomesoderm specification. The internal linkages between genes in the network have been determined functionally, by measurement of the effects of regulatory perturbations on the expression of all relevant genes in the network. Five kinds of perturbation have been applied: (1) use of morpholino antisense oligonucleotides targeted to many of the key regulatory genes in the network; (2) transformation of other regulatory factors into dominant repressors by construction of Engrailed repressor domain fusions; (3) ectopic expression of given regulatory factors, from genetic expression constructs and from injected mRNAs; (4) blockade of the beta-catenin/Tcf pathway by introduction of mRNA encoding the intracellular domain of cadherin; and (5) blockade of the Notch signaling pathway by introduction of mRNA encoding the extracellular domain of the Notch receptor. The network model predicts the cis-regulatory inputs that link each gene into the network. Therefore, its architecture is testable by cis-regulatory analysis. Strongylocentrotus purpuratus and Lytechinus variegatus genomic BAC recombinants that include a large number of the genes in the network have been sequenced and annotated. Tests of the cis-regulatory predictions of the model are greatly facilitated by interspecific computational sequence comparison, which affords a rapid identification of likely cis-regulatory elements in advance of experimental analysis. The network specifies genomically encoded regulatory processes between early cleavage and gastrula stages. These control the specification of the micromere lineage and of the initial veg(2) endomesodermal domain; the blastula-stage separation of the central veg(2) mesodermal domain (i.e., the secondary mesenchyme progenitor field) from the peripheral veg(2) endodermal domain; the stabilization of specification state within these domains; and activation of some downstream differentiation genes. Each of the temporal-spatial phases of specification is represented in a subelement of the network model, that treats regulatory events within the relevant embryonic nuclei at particular stages. (c) 2002 Elsevier Science (USA).
Miras-Moreno, Begoña; Almagro, Lorena; Pedreño, María Angeles; Sabater-Jara, Ana Belén
2018-07-01
Terbinafine induced a significant increase of squalene production. Terbinafine increased the expression levels of squalene synthase. Cyclodextrins did not work as elicitors due to the gene expression levels obtained. Plant sterols are essential components of membrane lipids, which contributing to their fluidity and permeability. Besides their cholesterol-lowering properties, they also have anti-inflammatory, antidiabetic and anticancer activities. Squalene, which is phytosterol precursor, is widely used in medicine, foods and cosmetics due to its anti-tumor, antioxidant and anti-aging activities. Nowadays, vegetable oils constitute the main sources of phytosterols and squalene, but their isolation and purification involve complex extraction protocols and high costs. In this work, Daucus carota cell cultures were used to evaluate the effect of cyclodextrins and terbinafine on the production and accumulation of squalene and phytosterols as well as the expression levels of squalene synthase and cycloartenol synthase genes. D. carota cell cultures were able to produce high levels of extracellular being phytosterols in the presence of cyclodextrins (12 mg/L), these compounds able to increase both the secretion and accumulation of phytosterols in the culture medium. Moreover, terbinafine induced a significant increase in intracellular squalene production, as seen after 168 h of treatment (497.0 ± 23.5 µg g dry weight -1 ) while its extracellular production only increased in the presence of cyclodextrins.The analysis of sqs and cas gene expression revealed that cyclodextrins did not induce genes encoding enzymes involved in the phytosterol biosynthetic pathway since the expression levels of sqs and cas genes in cyclodextrin-treated cells were lower than in control cells. The results, therefore, suggest that cyclodextrins were only able to release phytosterols from the cells to the extracellular medium, thus contributing to their acumulation. To sum up, D. carota cell cultures treated with cyclodextrins or terbinafine were able to produce high levels of phytosterols and squalene, respectively, and, therefore, these suspension-cultured cells of carrot constitute an alternative biotechnological system, which is at the same time more sustainable, economic and ecological for the production of these bioactive compounds.
Diverse roles of integrin receptors in articular cartilage.
Shakibaei, M; Csaki, C; Mobasheri, A
2008-01-01
Integrins are heterodimeric integral membrane proteins made up of alpha and beta subunits. At least eighteen alpha and eight beta subunit genes have been described in mammals. Integrin family members are plasma membrane receptors involved in cell adhesion and active as intra- and extracellular signalling molecules in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic spread of tumour cells. Integrin beta 1 (beta1-integrin), the protein encoded by the ITGB1 gene (also known as CD29 and VLAB), is a multi-functional protein involved in cell-matrix adhesion, cell signalling, cellular defense, cell adhesion, protein binding, protein heterodimerisation and receptor-mediated activity. It is highly expressed in the human body (17.4 times higher than the average gene in the last updated revision of the human genome). The extracellular matrix (ECM) of articular cartilage is a unique environment. Interactions between chondrocytes and the ECM regulate many biological processes important to homeostasis and repair of articular cartilage, including cell attachment, growth, differentiation and survival. The beta1-integrin family of cell surface receptors appears to play a major role in mediating cell-matrix interactions that are important in regulating these fundamental processes. Chondrocyte mechanoreceptors have been proposed to incorporate beta1-integrins and mechanosensitive ion channels which link with key ECM, cytoskeletal and signalling proteins to maintain the chondrocyte phenotype, prevent chondrocyte apoptosis and regulate chondrocyte-specific gene expression. This review focuses on the expression and function of beta1-integrins in articular chondrocytes, its role in the unique biology of these cells and its distribution in cartilage.
Identification of a collagen type I adhesin of Bacteroides fragilis.
Galvão, Bruna P G V; Weber, Brandon W; Rafudeen, Mohamed S; Ferreira, Eliane O; Patrick, Sheila; Abratt, Valerie R
2014-01-01
Bacteroides fragilis is an opportunistic pathogen which can cause life threatening infections in humans and animals. The ability to adhere to components of the extracellular matrix, including collagen, is related to bacterial host colonisation. Collagen Far Western analysis of the B. fragilis outer membrane protein (OMP) fraction revealed the presence two collagen adhesin bands of ∼ 31 and ∼ 34 kDa. The collagen adhesins in the OMP fraction were separated and isolated by two-dimensional SDS-PAGE and also purified by collagen affinity chromatography. The collagen binding proteins isolated by both these independent methods were subjected to tandem mass spectroscopy for peptide identification and matched to a single hypothetical protein encoded by B. fragilis NCTC 9343 (BF0586), conserved in YCH46 (BF0662) and 638R (BF0633) and which is designated in this study as cbp1 (collagen binding protein). Functionality of the protein was confirmed by targeted insertional mutagenesis of the cbp1 gene in B. fragilis GSH18 which resulted in the specific loss of both the ∼ 31 kDa and the ∼ 34 kDa adhesin bands. Purified his-tagged Cbp1, expressed in a B. fragilis wild-type and a glycosylation deficient mutant, confirmed that the cbp1 gene encoded the observed collagen adhesin, and showed that the 34 kDa band represents a glycosylated version of the ∼ 31 kDa protein. Glycosylation did not appear to be required for binding collagen. This study is the first to report the presence of collagen type I adhesin proteins in B. fragilis and to functionally identify a gene encoding a collagen binding protein.
Identification of a Collagen Type I Adhesin of Bacteroides fragilis
Galvão, Bruna P. G. V.; Weber, Brandon W.; Rafudeen, Mohamed S.; Ferreira, Eliane O.; Patrick, Sheila; Abratt, Valerie R.
2014-01-01
Bacteroides fragilis is an opportunistic pathogen which can cause life threatening infections in humans and animals. The ability to adhere to components of the extracellular matrix, including collagen, is related to bacterial host colonisation. Collagen Far Western analysis of the B. fragilis outer membrane protein (OMP) fraction revealed the presence two collagen adhesin bands of ∼31 and ∼34 kDa. The collagen adhesins in the OMP fraction were separated and isolated by two-dimensional SDS-PAGE and also purified by collagen affinity chromatography. The collagen binding proteins isolated by both these independent methods were subjected to tandem mass spectroscopy for peptide identification and matched to a single hypothetical protein encoded by B. fragilis NCTC 9343 (BF0586), conserved in YCH46 (BF0662) and 638R (BF0633) and which is designated in this study as cbp1 (collagen binding protein). Functionality of the protein was confirmed by targeted insertional mutagenesis of the cbp1 gene in B. fragilis GSH18 which resulted in the specific loss of both the ∼31 kDa and the ∼34 kDa adhesin bands. Purified his-tagged Cbp1, expressed in a B. fragilis wild-type and a glycosylation deficient mutant, confirmed that the cbp1 gene encoded the observed collagen adhesin, and showed that the 34 kDa band represents a glycosylated version of the ∼31 kDa protein. Glycosylation did not appear to be required for binding collagen. This study is the first to report the presence of collagen type I adhesin proteins in B. fragilis and to functionally identify a gene encoding a collagen binding protein. PMID:24618940
Vanholme, Bartel; Vanholme, Ruben; Turumtay, Halbay; Goeminne, Geert; Cesarino, Igor; Goubet, Florence; Morreel, Kris; Rencoret, Jorge; Bulone, Vincent; Hooijmaijers, Cortwa; De Rycke, Riet; Gheysen, Godelieve; Ralph, John; De Block, Marc; Meulewaeter, Frank; Boerjan, Wout
2014-01-01
To study the effect of short N-acetylglucosamine (GlcNAc) oligosaccharides on the physiology of plants, N-ACETYLGLUCOSAMINYLTRANSFERASE (NodC) of Azorhizobium caulinodans was expressed in Arabidopsis (Arabidopsis thaliana). The corresponding enzyme catalyzes the polymerization of GlcNAc and, accordingly, β-1,4-GlcNAc oligomers accumulated in the plant. A phenotype characterized by difficulties in developing an inflorescence stem was visible when plants were grown for several weeks under short-day conditions before transfer to long-day conditions. In addition, a positive correlation between the oligomer concentration and the penetrance of the phenotype was demonstrated. Although NodC overexpression lines produced less cell wall compared with wild-type plants under nonpermissive conditions, no indications were found for changes in the amount of the major cell wall polymers. The effect on the cell wall was reflected at the transcriptome level. In addition to genes encoding cell wall-modifying enzymes, a whole set of genes encoding membrane-coupled receptor-like kinases were differentially expressed upon GlcNAc accumulation, many of which encoded proteins with an extracellular Domain of Unknown Function26. Although stress-related genes were also differentially expressed, the observed response differed from that of a classical chitin response. This is in line with the fact that the produced chitin oligomers were too small to activate the chitin receptor-mediated signal cascade. Based on our observations, we propose a model in which the oligosaccharides modify the architecture of the cell wall by acting as competitors in carbohydrate-carbohydrate or carbohydrate-protein interactions, thereby affecting noncovalent interactions in the cell wall or at the interface between the cell wall and the plasma membrane. PMID:24664205
The complete general secretory pathway in gram-negative bacteria.
Pugsley, A P
1993-01-01
The unifying feature of all proteins that are transported out of the cytoplasm of gram-negative bacteria by the general secretory pathway (GSP) is the presence of a long stretch of predominantly hydrophobic amino acids, the signal sequence. The interaction between signal sequence-bearing proteins and the cytoplasmic membrane may be a spontaneous event driven by the electrochemical energy potential across the cytoplasmic membrane, leading to membrane integration. The translocation of large, hydrophilic polypeptide segments to the periplasmic side of this membrane almost always requires at least six different proteins encoded by the sec genes and is dependent on both ATP hydrolysis and the electrochemical energy potential. Signal peptidases process precursors with a single, amino-terminal signal sequence, allowing them to be released into the periplasm, where they may remain or whence they may be inserted into the outer membrane. Selected proteins may also be transported across this membrane for assembly into cell surface appendages or for release into the extracellular medium. Many bacteria secrete a variety of structurally different proteins by a common pathway, referred to here as the main terminal branch of the GSP. This recently discovered branch pathway comprises at least 14 gene products. Other, simpler terminal branches of the GSP are also used by gram-negative bacteria to secrete a more limited range of extracellular proteins. PMID:8096622
Mhaske, Pallavi V.; Levit, Noah A.; Li, Leping; Wang, Hong-Zhan; Lee, Jack R.; Shuja, Zunaira; Brink, Peter R.
2013-01-01
Mutations in the human gene encoding connexin 26 (Cx26 or GJB2) cause either nonsyndromic deafness or syndromic deafness associated with skin diseases. That distinct clinical disorders can be caused by different mutations within the same gene suggests that different channel activities influence the ear and skin. Here we use three different expression systems to examine the functional characteristics of two Cx26 mutations causing either mild (Cx26-D50A) or lethal (Cx26-A88V) keratitis-ichthyosis-deafness (KID) syndrome. In either cRNA-injected Xenopus oocytes, transfected HeLa cells, or transfected primary human keratinocytes, we show that both Cx26-D50A and Cx26-A88V form active hemichannels that significantly increase membrane current flow compared with wild-type Cx26. This increased membrane current accelerated cell death in low extracellular calcium solutions and was not due to increased mutant protein expression. Elevated mutant hemichannel currents could be blocked by increased extracellular calcium concentration. These results show that these two mutations exhibit a shared gain of functional activity and support the hypothesis that increased hemichannel activity is a common feature of human Cx26 mutations responsible for KID syndrome. PMID:23447037
Cole, Stephanie J.; Records, Angela R.; Orr, Mona W.; Linden, Sara B.
2014-01-01
Pseudomonas aeruginosa is an opportunistic human pathogen that is especially adept at forming surface-associated biofilms. P. aeruginosa causes catheter-associated urinary tract infections (CAUTIs) through biofilm formation on the surface of indwelling catheters. P. aeruginosa encodes three extracellular polysaccharides, PEL, PSL, and alginate, and utilizes the PEL and PSL polysaccharides to form biofilms in vitro; however, the requirement of these polysaccharides during in vivo infections is not well understood. Here we show in a murine model of CAUTI that PAO1, a strain harboring pel, psl, and alg genes, and PA14, a strain harboring pel and alg genes, form biofilms on the implanted catheters. To determine the requirement of exopolysaccharide during in vivo biofilm infections, we tested isogenic mutants lacking the pel, psl, and alg operons and showed that PA14 mutants lacking these operons can successfully form biofilms on catheters in the CAUTI model. To determine the host factor(s) that induces the ΔpelD mutant to form biofilm, we tested mouse, human, and artificial urine and show that urine can induce biofilm formation by the PA14 ΔpelD mutant. By testing the major constituents of urine, we show that urea can induce a pel-, psl-, and alg-independent biofilm. These pel-, psl-, and alg-independent biofilms are mediated by the release of extracellular DNA. Treatment of biofilms formed in urea with DNase I reduced the biofilm, indicating that extracellular DNA supports biofilm formation. Our results indicate that the opportunistic pathogen P. aeruginosa utilizes a distinct program to form biofilms that are independent of exopolysaccharides during CAUTI. PMID:24595142
Cole, Christian; Kroboth, Karin; Schurch, Nicholas J; Sandilands, Aileen; Sherstnev, Alexander; O'Regan, Grainne M; Watson, Rosemarie M; McLean, W H Irwin; Barton, Geoffrey J; Irvine, Alan D; Brown, Sara J
2014-07-01
Atopic dermatitis (AD; eczema) is characterized by a widespread abnormality in cutaneous barrier function and propensity to inflammation. Filaggrin is a multifunctional protein and plays a key role in skin barrier formation. Loss-of-function mutations in the gene encoding filaggrin (FLG) are a highly significant risk factor for atopic disease, but the molecular mechanisms leading to dermatitis remain unclear. We sought to interrogate tissue-specific variations in the expressed genome in the skin of children with AD and to investigate underlying pathomechanisms in atopic skin. We applied single-molecule direct RNA sequencing to analyze the whole transcriptome using minimal tissue samples. Uninvolved skin biopsy specimens from 26 pediatric patients with AD were compared with site-matched samples from 10 nonatopic teenage control subjects. Cases and control subjects were screened for FLG genotype to stratify the data set. Two thousand four hundred thirty differentially expressed genes (false discovery rate, P < .05) were identified, of which 211 were significantly upregulated and 490 downregulated by greater than 2-fold. Gene ontology terms for "extracellular space" and "defense response" were enriched, whereas "lipid metabolic processes" were downregulated. The subset of FLG wild-type cases showed dysregulation of genes involved with lipid metabolism, whereas filaggrin haploinsufficiency affected global gene expression and was characterized by a type 1 interferon-mediated stress response. These analyses demonstrate the importance of extracellular space and lipid metabolism in atopic skin pathology independent of FLG genotype, whereas an aberrant defense response is seen in subjects with FLG mutations. Genotype stratification of the large data set has facilitated functional interpretation and might guide future therapy development. Copyright © 2014 The Authors. Published by Mosby, Inc. All rights reserved.
Lin, Yang; Lewallen, Eric A; Camilleri, Emily T; Bonin, Carolina A; Jones, Dakota L; Dudakovic, Amel; Galeano-Garces, Catalina; Wang, Wei; Karperien, Marcel J; Larson, Annalise N; Dahm, Diane L; Stuart, Michael J; Levy, Bruce A; Smith, Jay; Ryssman, Daniel B; Westendorf, Jennifer J; Im, Hee-Jeong; van Wijnen, Andre J; Riester, Scott M; Krych, Aaron J
2016-11-01
Preservation of osteochondral allografts used for transplantation is critical to ensure favorable outcomes for patients after surgical treatment of cartilage defects. To study the biological effects of protocols currently used for cartilage storage, we investigated differences in gene expression between stored allograft cartilage and fresh cartilage from living donors using high throughput molecular screening strategies. We applied next generation RNA sequencing (RNA-seq) and real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) to assess genome-wide differences in mRNA expression between stored allograft cartilage and fresh cartilage tissue from living donors. Gene ontology analysis was used to characterize biological pathways associated with differentially expressed genes. Our studies establish reduced levels of mRNAs encoding cartilage related extracellular matrix (ECM) proteins (i.e., COL1A1, COL2A1, COL10A1, ACAN, DCN, HAPLN1, TNC, and COMP) in stored cartilage. These changes occur concomitantly with increased expression of "early response genes" that encode transcription factors mediating stress/cytoprotective responses (i.e., EGR1, EGR2, EGR3, MYC, FOS, FOSB, FOSL1, FOSL2, JUN, JUNB, and JUND). The elevated expression of "early response genes" and reduced levels of ECM-related mRNAs in stored cartilage allografts suggests that tissue viability may be maintained by a cytoprotective program that reduces cell metabolic activity. These findings have potential implications for future studies focused on quality assessment and clinical optimization of osteochondral allografts used for cartilage transplantation. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:1950-1959, 2016. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Niu, Xiaofan; Ah-Fong, Audrey M V; Lopez, Lilianna A; Judelson, Howard S
2018-01-01
Sexual reproduction remains an understudied feature of oomycete biology. To expand our knowledge of this process, we used RNA-seq and quantitative proteomics to examine matings in Phytophthora infestans. Exhibiting significant changes in mRNA abundance in three matings between different A1 and A2 strains compared to nonmating controls were 1170 genes, most being mating-induced. Rising by >10-fold in at least one cross were 455 genes, and 182 in all three crosses. Most genes had elevated expression in a self-fertile strain. Many mating-induced genes were associated with cell wall biosynthesis, which may relate to forming the thick-walled sexual spore (oospore). Several gene families were induced during mating including one encoding histidine, serine, and tyrosine-rich putative wall proteins, and another encoding prolyl hydroxylases which may strengthen the extracellular matrix. The sizes of these families vary >10-fold between Phytophthora species and one exhibits concerted evolution, highlighting two features of genome dynamics within the genus. Proteomic analyses of mature oospores and nonmating hyphae using isobaric tags for quantification identified 835 shared proteins, with 5% showing >2-fold changes in abundance between the tissues. Enriched in oospores were β-glucanases potentially involved in digesting the oospore wall during germination. Despite being dormant, oospores contained a mostly normal complement of proteins required for core cellular functions. The RNA-seq data generated here and in prior studies were used to identify new housekeeping controls for gene expression studies that are more stable than existing normalization standards. We also observed >2-fold variation in the fraction of polyA+ RNA between life stages, which should be considered when quantifying transcripts and may also be relevant to understanding translational control during development.
Krupska, Izabela; Bruford, Elspeth A; Chaqour, Brahim
2015-09-23
"CCN" is an acronym referring to the first letter of each of the first three members of this original group of mammalian functionally and phylogenetically distinct extracellular matrix (ECM) proteins [i.e., cysteine-rich 61 (CYR61), connective tissue growth factor (CTGF), and nephroblastoma-overexpressed (NOV)]. Although "CCN" genes are unlikely to have arisen from a common ancestral gene, their encoded proteins share multimodular structures in which most cysteine residues are strictly conserved in their positions within several structural motifs. The CCN genes can be subdivided into members developmentally indispensable for embryonic viability (e.g., CCN1, 2 and 5), each assuming unique tissue-specific functions, and members not essential for embryonic development (e.g., CCN3, 4 and 6), probably due to a balance of functional redundancy and specialization during evolution. The temporo-spatial regulation of the CCN genes and the structural information contained within the sequences of their encoded proteins reflect diversity in their context and tissue-specific functions. Genetic association studies and experimental anomalies, replicated in various animal models, have shown that altered CCN gene structure or expression is associated with "injury" stimuli--whether mechanical (e.g., trauma, shear stress) or chemical (e.g., ischemia, hyperglycemia, hyperlipidemia, inflammation). Consequently, increased organ-specific susceptibility to structural damages ensues. These data underscore the critical functions of CCN proteins in the dynamics of tissue repair and regeneration and in the compensatory responses preceding organ failure. A better understanding of the regulation and mode of action of each CCN member will be useful in developing specific gain- or loss-of-function strategies for therapeutic purposes.
Altamirano, Francisco; Valladares, Denisse; Henríquez-Olguín, Carlos; Casas, Mariana; López, Jose R; Allen, Paul D; Jaimovich, Enrique
2013-01-01
Duchenne Muscular Dystrophy (DMD) is a recessive X-linked genetic disease, caused by mutations in the gene encoding dystrophin. DMD is characterized in humans and in mdx mice by a severe and progressive destruction of muscle fibers, inflammation, oxidative/nitrosative stress, and cell death. In mdx muscle fibers, we have shown that basal ATP release is increased and that extracellular ATP stimulation is pro-apoptotic. In normal fibers, depolarization-induced ATP release is blocked by nifedipine, leading us to study the potential therapeutic effect of nifedipine in mdx muscles and its relation with extracellular ATP signaling. Acute exposure to nifedipine (10 µM) decreased [Ca(2+)]r, NF-κB activity and iNOS expression in mdx myotubes. In addition, 6-week-old mdx mice were treated with daily intraperitoneal injections of nifedipine, 1 mg/Kg for 1 week. This treatment lowered the [Ca(2+)]r measured in vivo in the mdx vastus lateralis. We demonstrated that extracellular ATP levels were higher in adult mdx flexor digitorum brevis (FDB) fibers and can be significantly reduced after 1 week of treatment with nifedipine. Interestingly, acute treatment of mdx FDB fibers with apyrase, an enzyme that completely degrades extracellular ATP to AMP, reduced [Ca(2+)]r to a similar extent as was seen in FDB fibers after 1-week of nifedipine treatment. Moreover, we demonstrated that nifedipine treatment reduced mRNA levels of pro-oxidative/nitrosative (iNOS and gp91(phox)/p47(phox) NOX2 subunits) and pro-apoptotic (Bax) genes in mdx diaphragm muscles and lowered serum creatine kinase (CK) levels. In addition, nifedipine treatment increased muscle strength assessed by the inverted grip-hanging test and exercise tolerance measured with forced swimming test in mdx mice. We hypothesize that nifedipine reduces basal ATP release, thereby decreasing purinergic receptor activation, which in turn reduces [Ca(2+)]r in mdx skeletal muscle cells. The results in this work open new perspectives towards possible targets for pharmacological approaches to treat DMD.
Henríquez-Olguín, Carlos; Casas, Mariana; López, Jose R.; Allen, Paul D.; Jaimovich, Enrique
2013-01-01
Duchenne Muscular Dystrophy (DMD) is a recessive X-linked genetic disease, caused by mutations in the gene encoding dystrophin. DMD is characterized in humans and in mdx mice by a severe and progressive destruction of muscle fibers, inflammation, oxidative/nitrosative stress, and cell death. In mdx muscle fibers, we have shown that basal ATP release is increased and that extracellular ATP stimulation is pro-apoptotic. In normal fibers, depolarization-induced ATP release is blocked by nifedipine, leading us to study the potential therapeutic effect of nifedipine in mdx muscles and its relation with extracellular ATP signaling. Acute exposure to nifedipine (10 µM) decreased [Ca2+]r, NF-κB activity and iNOS expression in mdx myotubes. In addition, 6-week-old mdx mice were treated with daily intraperitoneal injections of nifedipine, 1 mg/Kg for 1 week. This treatment lowered the [Ca2+]r measured in vivo in the mdx vastus lateralis. We demonstrated that extracellular ATP levels were higher in adult mdx flexor digitorum brevis (FDB) fibers and can be significantly reduced after 1 week of treatment with nifedipine. Interestingly, acute treatment of mdx FDB fibers with apyrase, an enzyme that completely degrades extracellular ATP to AMP, reduced [Ca2+]r to a similar extent as was seen in FDB fibers after 1-week of nifedipine treatment. Moreover, we demonstrated that nifedipine treatment reduced mRNA levels of pro-oxidative/nitrosative (iNOS and gp91phox/p47phox NOX2 subunits) and pro-apoptotic (Bax) genes in mdx diaphragm muscles and lowered serum creatine kinase (CK) levels. In addition, nifedipine treatment increased muscle strength assessed by the inverted grip-hanging test and exercise tolerance measured with forced swimming test in mdx mice. We hypothesize that nifedipine reduces basal ATP release, thereby decreasing purinergic receptor activation, which in turn reduces [Ca2+]r in mdx skeletal muscle cells. The results in this work open new perspectives towards possible targets for pharmacological approaches to treat DMD. PMID:24349043
[Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].
Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V
2010-01-01
The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.
Genetic analysis of vertebrate sensory hair cell mechanosensation: the zebrafish circler mutants.
Nicolson, T; Rüsch, A; Friedrich, R W; Granato, M; Ruppersberg, J P; Nüsslein-Volhard, C
1998-02-01
The molecular basis of sensory hair cell mechanotransduction is largely unknown. In order to identify genes that are essential for mechanosensory hair cell function, we characterized a group of recently isolated zebrafish motility mutants. These mutants are defective in balance and swim in circles but have no obvious morphological defects. We examined the mutants using calcium imaging of acoustic-vibrational and tactile escape responses, high resolution microscopy of sensory neuroepithelia in live larvae, and recordings of extracellular hair cell potentials (microphonics). Based on the analyses, we have identified several classes of genes. Mutations in sputnik and mariner affect hair bundle integrity. Mutant astronaut and cosmonaut hair cells have relatively normal microphonics and thus appear to affect events downstream of mechanotransduction. Mutant orbiter, mercury, and gemini larvae have normal hair cell morphology and yet do not respond to acoustic-vibrational stimuli. The microphonics of lateral line hair cells of orbiter, mercury, and gemini larvae are absent or strongly reduced. Therefore, these genes may encode components of the transduction apparatus.
Woo, Yong H; Ansari, Hifzur; Otto, Thomas D; Klinger, Christen M; Kolisko, Martin; Michálek, Jan; Saxena, Alka; Shanmugam, Dhanasekaran; Tayyrov, Annageldi; Veluchamy, Alaguraj; Ali, Shahjahan; Bernal, Axel; del Campo, Javier; Cihlář, Jaromír; Flegontov, Pavel; Gornik, Sebastian G; Hajdušková, Eva; Horák, Aleš; Janouškovec, Jan; Katris, Nicholas J; Mast, Fred D; Miranda-Saavedra, Diego; Mourier, Tobias; Naeem, Raeece; Nair, Mridul; Panigrahi, Aswini K; Rawlings, Neil D; Padron-Regalado, Eriko; Ramaprasad, Abhinay; Samad, Nadira; Tomčala, Aleš; Wilkes, Jon; Neafsey, Daniel E; Doerig, Christian; Bowler, Chris; Keeling, Patrick J; Roos, David S; Dacks, Joel B; Templeton, Thomas J; Waller, Ross F; Lukeš, Julius; Oborník, Miroslav; Pain, Arnab
2015-07-15
The eukaryotic phylum Apicomplexa encompasses thousands of obligate intracellular parasites of humans and animals with immense socio-economic and health impacts. We sequenced nuclear genomes of Chromera velia and Vitrella brassicaformis, free-living non-parasitic photosynthetic algae closely related to apicomplexans. Proteins from key metabolic pathways and from the endomembrane trafficking systems associated with a free-living lifestyle have been progressively and non-randomly lost during adaptation to parasitism. The free-living ancestor contained a broad repertoire of genes many of which were repurposed for parasitic processes, such as extracellular proteins, components of a motility apparatus, and DNA- and RNA-binding protein families. Based on transcriptome analyses across 36 environmental conditions, Chromera orthologs of apicomplexan invasion-related motility genes were co-regulated with genes encoding the flagellar apparatus, supporting the functional contribution of flagella to the evolution of invasion machinery. This study provides insights into how obligate parasites with diverse life strategies arose from a once free-living phototrophic marine alga.
Nasser, Waleed; Beres, Stephen B; Olsen, Randall J; Dean, Melissa A; Rice, Kelsey A; Long, S Wesley; Kristinsson, Karl G; Gottfredsson, Magnus; Vuopio, Jaana; Raisanen, Kati; Caugant, Dominique A; Steinbakk, Martin; Low, Donald E; McGeer, Allison; Darenberg, Jessica; Henriques-Normark, Birgitta; Van Beneden, Chris A; Hoffmann, Steen; Musser, James M
2014-04-29
We sequenced the genomes of 3,615 strains of serotype Emm protein 1 (M1) group A Streptococcus to unravel the nature and timing of molecular events contributing to the emergence, dissemination, and genetic diversification of an unusually virulent clone that now causes epidemic human infections worldwide. We discovered that the contemporary epidemic clone emerged in stepwise fashion from a precursor cell that first contained the phage encoding an extracellular DNase virulence factor (streptococcal DNase D2, SdaD2) and subsequently acquired the phage encoding the SpeA1 variant of the streptococcal pyrogenic exotoxin A superantigen. The SpeA2 toxin variant evolved from SpeA1 by a single-nucleotide change in the M1 progenitor strain before acquisition by horizontal gene transfer of a large chromosomal region encoding secreted toxins NAD(+)-glycohydrolase and streptolysin O. Acquisition of this 36-kb region in the early 1980s into just one cell containing the phage-encoded sdaD2 and speA2 genes was the final major molecular event preceding the emergence and rapid intercontinental spread of the contemporary epidemic clone. Thus, we resolve a decades-old controversy about the type and sequence of genomic alterations that produced this explosive epidemic. Analysis of comprehensive, population-based contemporary invasive strains from seven countries identified strong patterns of temporal population structure. Compared with a preepidemic reference strain, the contemporary clone is significantly more virulent in nonhuman primate models of pharyngitis and necrotizing fasciitis. A key finding is that the molecular evolutionary events transpiring in just one bacterial cell ultimately have produced millions of human infections worldwide.
Nasser, Waleed; Beres, Stephen B.; Olsen, Randall J.; Dean, Melissa A.; Rice, Kelsey A.; Long, S. Wesley; Kristinsson, Karl G.; Gottfredsson, Magnus; Vuopio, Jaana; Raisanen, Kati; Caugant, Dominique A.; Steinbakk, Martin; Low, Donald E.; McGeer, Allison; Darenberg, Jessica; Henriques-Normark, Birgitta; Van Beneden, Chris A.; Hoffmann, Steen; Musser, James M.
2014-01-01
We sequenced the genomes of 3,615 strains of serotype Emm protein 1 (M1) group A Streptococcus to unravel the nature and timing of molecular events contributing to the emergence, dissemination, and genetic diversification of an unusually virulent clone that now causes epidemic human infections worldwide. We discovered that the contemporary epidemic clone emerged in stepwise fashion from a precursor cell that first contained the phage encoding an extracellular DNase virulence factor (streptococcal DNase D2, SdaD2) and subsequently acquired the phage encoding the SpeA1 variant of the streptococcal pyrogenic exotoxin A superantigen. The SpeA2 toxin variant evolved from SpeA1 by a single-nucleotide change in the M1 progenitor strain before acquisition by horizontal gene transfer of a large chromosomal region encoding secreted toxins NAD+-glycohydrolase and streptolysin O. Acquisition of this 36-kb region in the early 1980s into just one cell containing the phage-encoded sdaD2 and speA2 genes was the final major molecular event preceding the emergence and rapid intercontinental spread of the contemporary epidemic clone. Thus, we resolve a decades-old controversy about the type and sequence of genomic alterations that produced this explosive epidemic. Analysis of comprehensive, population-based contemporary invasive strains from seven countries identified strong patterns of temporal population structure. Compared with a preepidemic reference strain, the contemporary clone is significantly more virulent in nonhuman primate models of pharyngitis and necrotizing fasciitis. A key finding is that the molecular evolutionary events transpiring in just one bacterial cell ultimately have produced millions of human infections worldwide. PMID:24733896
Collins, P J; O'Brien, M M; Dobson, A D
1999-03-01
The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression.
Collins, Patrick J.; O’Brien, Margaret M.; Dobson, Alan D. W.
1999-01-01
The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression. PMID:10049906
Wang, Jing; Tergel, Tergel; Chen, Jianhua; Yang, Ju; Kang, Yan; Qi, Zhi
2015-02-01
Ecological evidence indicates a worldwide trend of dramatically decreased soil Ca(2+) levels caused by increased acid deposition and massive timber harvesting. Little is known about the genetic and cellular mechanism of plants' responses to Ca(2+) depletion. In this study, transcriptional profiling analysis helped identify multiple extracellular Ca(2+) ([Ca(2+) ]ext ) depletion-responsive genes in Arabidopsis thaliana L., many of which are involved in response to other environmental stresses. Interestingly, a group of genes encoding putative cytosolic Ca(2+) ([Ca(2+) ]cyt ) sensors were significantly upregulated, implying that [Ca(2+) ]cyt has a role in sensing [Ca(2+) ]ext depletion. Consistent with this observation, [Ca(2+) ]ext depletion stimulated a transient rise in [Ca(2+) ]cyt that was negatively influenced by [K(+) ]ext , suggesting the involvement of a membrane potential-sensitive component. The [Ca(2+) ]cyt response to [Ca(2+) ]ext depletion was significantly desensitized after the initial treatment, which is typical of a receptor-mediated signaling event. The response was insensitive to an animal Ca(2+) sensor antagonist, but was suppressed by neomycin, an inhibitor of phospholipase C. Gd(3+) , an inhibitor of Ca(2+) channels, suppressed the [Ca(2+) ]ext -triggered rise in [Ca(2+) ]cyt and downstream changes in gene expression. Taken together, this study demonstrates that [Ca(2+) ]cyt plays an important role in the putative receptor-mediated cellular and transcriptional response to [Ca(2+) ]ext depletion of plant cells. © 2014 Institute of Botany, Chinese Academy of Sciences.
Genomic analyses of Clostridium perfringens isolates from five toxinotypes.
Hassan, Karl A; Elbourne, Liam D H; Tetu, Sasha G; Melville, Stephen B; Rood, Julian I; Paulsen, Ian T
2015-05-01
Clostridium perfringens can be isolated from a range of environments, including soil, marine and fresh water sediments, and the gastrointestinal tracts of animals and humans. Some C. perfringens strains have attractive industrial applications, e.g., in the degradation of waste products or the production of useful chemicals. However, C. perfringens has been most studied as the causative agent of a range of enteric and soft tissue infections of varying severities in humans and animals. Host preference and disease type in C. perfringens are intimately linked to the production of key extracellular toxins and on this basis toxigenic C. perfringens strains have been classified into five toxinotypes (A-E). To date, twelve genome sequences have been generated for a diverse collection of C. perfringens isolates, including strains associated with human and animal infections, a human commensal strain, and a strain with potential industrial utility. Most of the sequenced strains are classified as toxinotype A. However, genome sequences of representative strains from each of the other four toxinotypes have also been determined. Analysis of this collection of sequences has highlighted a lack of features differentiating toxinotype A strains from the other isolates, indicating that the primary defining characteristic of toxinotype A strains is their lack of key plasmid-encoded extracellular toxin genes associated with toxinotype B to E strains. The representative B-E strains sequenced to date each harbour many unique genes. Additional genome sequences are needed to determine if these genes are characteristic of their respective toxinotypes. Copyright © 2014. Published by Elsevier Masson SAS.
A rapidly evolving secretome builds and patterns a sea shell
Jackson, Daniel J; McDougall, Carmel; Green, Kathryn; Simpson, Fiona; Wörheide, Gert; Degnan, Bernard M
2006-01-01
Background Instructions to fabricate mineralized structures with distinct nanoscale architectures, such as seashells and coral and vertebrate skeletons, are encoded in the genomes of a wide variety of animals. In mollusks, the mantle is responsible for the extracellular production of the shell, directing the ordered biomineralization of CaCO3 and the deposition of architectural and color patterns. The evolutionary origins of the ability to synthesize calcified structures across various metazoan taxa remain obscure, with only a small number of protein families identified from molluskan shells. The recent sequencing of a wide range of metazoan genomes coupled with the analysis of gene expression in non-model animals has allowed us to investigate the evolution and process of biomineralization in gastropod mollusks. Results Here we show that over 25% of the genes expressed in the mantle of the vetigastropod Haliotis asinina encode secreted proteins, indicating that hundreds of proteins are likely to be contributing to shell fabrication and patterning. Almost 85% of the secretome encodes novel proteins; remarkably, only 19% of these have identifiable homologues in the full genome of the patellogastropod Lottia scutum. The spatial expression profiles of mantle genes that belong to the secretome is restricted to discrete mantle zones, with each zone responsible for the fabrication of one of the structural layers of the shell. Patterned expression of a subset of genes along the length of the mantle is indicative of roles in shell ornamentation. For example, Has-sometsuke maps precisely to pigmentation patterns in the shell, providing the first case of a gene product to be involved in molluskan shell pigmentation. We also describe the expression of two novel genes involved in nacre (mother of pearl) deposition. Conclusion The unexpected complexity and evolvability of this secretome and the modular design of the molluskan mantle enables diversification of shell strength and design, and as such must contribute to the variety of adaptive architectures and colors found in mollusk shells. The composition of this novel mantle-specific secretome suggests that there are significant molecular differences in the ways in which gastropods synthesize their shells. PMID:17121673
Chen, Fei; Chen, Xiu-Zhen; Su, Xiao-Yun; Qin, Li-Na; Huang, Zhen-Bang; Tao, Yong; Dong, Zhi-Yang
2015-10-01
Eukaryotic mitogen-activated protein kinases (MAPKs) play crucial roles in transducing environmental and developmental signals inside the cell and regulating gene expression, however, the roles of MAPKs remain largely unknown in Trichoderma reesei. T. reesei ime2 (TrIme2) encodes an Ime2-like MAPK in T. reesei. The deletion of the TrIme2 gene led to 90% increase in cellulase activity against filter paper during earlier period time of cellulase induction as well as the extracellular protein production. Compared to the parent strain, the transcriptional levels of the three major cellulase genes cbh1,cbh2, egl1 were increased by about 9 times, 4 times, 2 times, respectively, at 8 h after cellulase induction in the ΔTrIme2 mutant. In addition, the disruption of TrIme2 caused over 50% reduction of the transcript levels of cellulase transcriptional regulators cre1 and xyr1. TrIme2 functions in regulation of the expression of cellulase gene in T.reesei, and is a good candidate for genetically engineering of T. reesei for higher cellulase production.
Construction and Screening of a Lentiviral Secretome Library.
Liu, Tao; Jia, Panpan; Ma, Huailei; Reed, Sean A; Luo, Xiaozhou; Larman, H Benjamin; Schultz, Peter G
2017-06-22
Over 2,000 human proteins are predicted to be secreted, but the biological function of the many of these proteins is still unknown. Moreover, a number of these proteins may act as new therapeutic agents or be targets for the development of therapeutic antibodies. To further explore the extracellular proteome, we have developed a secretome-enriched open reading frame (ORF) library that can be readily screened for autocrine activity in cell-based phenotypic or reporter assays. Next-generation sequencing (NGS) and database analysis predict that the library contains approximately 900 ORFs encoding known secreted proteins (accounting for 77.8% of the library), as well as genes encoding potentially unknown secreted proteins. In a proof-of-principle study, human TF-1 cells were screened for proliferative factors, and the known cytokine GMCSF was identified as a dominant hit. This library offers a relatively low-cost and straightforward approach for functional autocrine screens of secreted proteins. Copyright © 2017 Elsevier Ltd. All rights reserved.
Primary structure, expression and chromosomal locus of a human homolog of rat ERK3.
Meloche, S; Beatty, B G; Pellerin, J
1996-10-03
We report the cloning and characterization of a human cDNA encoding a novel homolog of rat extracellular signal-regulated kinase 3 (ERK3). The cDNA encodes a predicted protein of 721 amino acids which shares 92% amino acid identity with rat ERK3 over their shared length. Interestingly, the human protein contains a unique extension of 178 amino acids at its carboxy terminal extremity. The human ERK3 protein also displays various degrees of homology to other members of the MAP kinases family, but does not contain the typical TXY regulatory motif between subdomains VII and VIII. Northern blot analysis revealed that ERK3 mRNA is widely distributed in human tissues, with the highest expression detected in skeletal muscle. The human ERK3 gene was mapped by fluorescence in situ hybridization to chromosome 15q21, a region associated with chromosomal abnormalities in acute nonlymphoblastic leukemias. This information should prove valuable in designing studies to define the cellular function of the ERK3 protein kinase.
Expression profiling and pathway analysis of Krüppel-like factor 4 in mouse embryonic fibroblasts
Hagos, Engda G; Ghaleb, Amr M; Kumar, Amrita; Neish, Andrew S; Yang, Vincent W
2011-01-01
Background: Krüppel-like factor 4 (KLF4) is a zinc-finger transcription factor with diverse regulatory functions in proliferation, differentiation, and development. KLF4 also plays a role in inflammation, tumorigenesis, and reprogramming of somatic cells to induced pluripotent stem (iPS) cells. To gain insight into the mechanisms by which KLF4 regulates these processes, we conducted DNA microarray analyses to identify differentially expressed genes in mouse embryonic fibroblasts (MEFs) wild type and null for Klf4. Methods: Expression profiles of fibroblasts isolated from mouse embryos wild type or null for the Klf4 alleles were examined by DNA microarrays. Differentially expressed genes were subjected to the Database for Annotation, Visualization and Integrated Discovery (DAVID). The microarray data were also interrogated with the Ingenuity Pathway Analysis (IPA) and Gene Set Enrichment Analysis (GSEA) for pathway identification. Results obtained from the microarray analysis were confirmed by Western blotting for select genes with biological relevance to determine the correlation between mRNA and protein levels. Results: One hundred and sixty three up-regulated and 88 down-regulated genes were identified that demonstrated a fold-change of at least 1.5 and a P-value < 0.05 in Klf4-null MEFs compared to wild type MEFs. Many of the up-regulated genes in Klf4-null MEFs encode proto-oncogenes, growth factors, extracellular matrix, and cell cycle activators. In contrast, genes encoding tumor suppressors and those involved in JAK-STAT signaling pathways are down-regulated in Klf4-null MEFs. IPA and GSEA also identified various pathways that are regulated by KLF4. Lastly, Western blotting of select target genes confirmed the changes revealed by microarray data. Conclusions: These data are not only consistent with previous functional studies of KLF4's role in tumor suppression and somatic cell reprogramming, but also revealed novel target genes that mediate KLF4's functions. PMID:21892412
Coevolution of Siglec-11 and Siglec-16 via gene conversion in primates.
Hayakawa, Toshiyuki; Khedri, Zahra; Schwarz, Flavio; Landig, Corinna; Liang, Suh-Yuen; Yu, Hai; Chen, Xi; Fujito, Naoko T; Satta, Yoko; Varki, Ajit; Angata, Takashi
2017-11-23
Siglecs-11 and -16 are members of the sialic acid recognizing Ig-like lectin family, and expressed in same cells. Siglec-11 functions as an inhibitory receptor, whereas Siglec-16 exhibits activating properties. In humans, SIGLEC11 and SIGLEC16 gene sequences are extremely similar in the region encoding the extracellular domain due to gene conversions. Human SIGLEC11 was converted by the nonfunctional SIGLEC16P allele, and the converted SIGLEC11 allele became fixed in humans, possibly because it provides novel neuroprotective functions in brain microglia. However, the detailed evolutionary history of SIGLEC11 and SIGLEC16 in other primates remains unclear. We analyzed SIGLEC11 and SIGLEC16 gene sequences of multiple primate species, and examined glycan binding profiles of these Siglecs. The phylogenetic tree demonstrated that gene conversions between SIGLEC11 and SIGLEC16 occurred in the region including the exon encoding the sialic acid binding domain in every primate examined. Functional assays showed that glycan binding preference is similar between Siglec-11 and Siglec-16 in all analyzed hominid species. Taken together with the fact that Siglec-11 and Siglec-16 are expressed in the same cells, Siglec-11 and Siglec-16 are regarded as paired receptors that have maintained similar ligand binding preferences via gene conversions. Relaxed functional constraints were detected on the SIGLEC11 and SIGLEC16 exons that underwent gene conversions, possibly contributing to the evolutionary acceptance of repeated gene conversions. The frequency of nonfunctional SIGLEC16P alleles is much higher than that of SIGLEC16 alleles in every human population. Our findings indicate that Siglec-11 and Siglec-16 have been maintained as paired receptors by repeated gene conversions under relaxed functional constraints in the primate lineage. The high prevalence of the nonfunctional SIGLEC16P allele and the fixation of the converted SIGLEC11 imply that the loss of Siglec-16 and the gain of Siglec-11 in microglia might have been favored during the evolution of human lineage.
Regulation of xylose metabolism in recombinant Saccharomyces cerevisiae
Salusjärvi, Laura; Kankainen, Matti; Soliymani, Rabah; Pitkänen, Juha-Pekka; Penttilä, Merja; Ruohonen, Laura
2008-01-01
Background Considerable interest in the bioconversion of lignocellulosic biomass into ethanol has led to metabolic engineering of Saccharomyces cerevisiae for fermentation of xylose. In the present study, the transcriptome and proteome of recombinant, xylose-utilising S. cerevisiae grown in aerobic batch cultures on xylose were compared with those of glucose-grown cells both in glucose repressed and derepressed states. The aim was to study at the genome-wide level how signalling and carbon catabolite repression differ in cells grown on either glucose or xylose. The more detailed knowledge whether xylose is sensed as a fermentable carbon source, capable of catabolite repression like glucose, or is rather recognised as a non-fermentable carbon source is important for further engineering this yeast for more efficient anaerobic fermentation of xylose. Results Genes encoding respiratory proteins, proteins of the tricarboxylic acid and glyoxylate cycles, and gluconeogenesis were only partially repressed by xylose, similar to the genes encoding their transcriptional regulators HAP4, CAT8 and SIP1-2 and 4. Several genes that are repressed via the Snf1p/Mig1p-pathway during growth on glucose had higher expression in the cells grown on xylose than in the glucose repressed cells but lower than in the glucose derepressed cells. The observed expression profiles of the transcription repressor RGT1 and its target genes HXT2-3, encoding hexose transporters suggested that extracellular xylose was sensed by the glucose sensors Rgt2p and Snf3p. Proteome analyses revealed distinct patterns in phosphorylation of hexokinase 2, glucokinase and enolase isoenzymes in the xylose- and glucose-grown cells. Conclusion The results indicate that the metabolism of yeast growing on xylose corresponds neither to that of fully glucose repressed cells nor that of derepressed cells. This may be one of the major reasons for the suboptimal fermentation of xylose by recombinant S. cerevisiae strains. Phosphorylation of different isoforms of glycolytic enzymes suggests that regulation of glycolysis also occurred at a post-translational level, supporting prior findings. PMID:18533012
LMO1 Synergizes with MYCN to Promote Neuroblastoma Initiation and Metastasis.
Zhu, Shizhen; Zhang, Xiaoling; Weichert-Leahey, Nina; Dong, Zhiwei; Zhang, Cheng; Lopez, Gonzalo; Tao, Ting; He, Shuning; Wood, Andrew C; Oldridge, Derek; Ung, Choong Yong; van Ree, Janine H; Khan, Amish; Salazar, Brittany M; Lummertz da Rocha, Edroaldo; Zimmerman, Mark W; Guo, Feng; Cao, Hong; Hou, Xiaonan; Weroha, S John; Perez-Atayde, Antonio R; Neuberg, Donna S; Meves, Alexander; McNiven, Mark A; van Deursen, Jan M; Li, Hu; Maris, John M; Look, A Thomas
2017-09-11
A genome-wide association study identified LMO1, which encodes an LIM-domain-only transcriptional cofactor, as a neuroblastoma susceptibility gene that functions as an oncogene in high-risk neuroblastoma. Here we show that dβh promoter-mediated expression of LMO1 in zebrafish synergizes with MYCN to increase the proliferation of hyperplastic sympathoadrenal precursor cells, leading to a reduced latency and increased penetrance of neuroblastomagenesis. The transgenic expression of LMO1 also promoted hematogenous dissemination and distant metastasis, which was linked to neuroblastoma cell invasion and migration, and elevated expression levels of genes affecting tumor cell-extracellular matrix interaction, including loxl3, itga2b, itga3, and itga5. Our results provide in vivo validation of LMO1 as an important oncogene that promotes neuroblastoma initiation, progression, and widespread metastatic dissemination. Copyright © 2017 Elsevier Inc. All rights reserved.
Optimization of the expression of a laccase gene from Trametes versicolor in Pichia methanolica.
Guo, Mei; Lu, Fuping; Du, Lianxiang; Pu, Jun; Bai, Dongqing
2006-08-01
A cDNA encoding for laccase (Lcc1) was isolated from the ligninolytic fungus Trametes versicolor by reverse transcriptase polymerase chain reaction. The Lcc1 gene was subcloned into the Pichia methanolica expression vector pMETalphaA and transformed into the P. methanolica strains PMAD11 and PMAD16. The extracellular laccase activity of the PMAD11 recombinants was found to be 1.3-fold higher than that of the PMAD16 recombinants. The identity of the recombinant protein was further confirmed by immunodetection using the Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form. The effects of copper concentration, cultivation temperature, pH and methanol concentration in the BMMY on laccase expression were investigated. The laccase activity in the PMAD11 recombinant was up to 12.6 U ml(-1) by optimization.
Yanochko, Gina M.; Yool, Andrea J.
2004-01-01
Drosophila Big Brain (BIB) is a transmembrane protein encoded by the neurogenic gene big brain (bib), which is important for early development of the fly nervous system. BIB expressed in Xenopus oocytes is a monovalent cation channel modulated by tyrosine kinase signaling. Results here demonstrate that the BIB conductance shows voltage- and dose-dependent block by extracellular divalent cations Ca2+ and Ba2+ but not by Mg2+ in wild-type channels. Site-directed mutagenesis of negatively charged glutamate (Glu274) and aspartate (Asp253) residues had no effect on divalent cation block. However, mutation of a conserved glutamate at position 71 (Glu71) in the first transmembrane domain (M1) altered channel properties. Mutation of Glu71 to Asp introduced a new sensitivity to block by extracellular Mg2+; substitutions with asparagine or glutamine decreased whole-cell conductance; and substitution with lysine compromised plasma membrane expression. Block by divalent cations is important in other ion channels for voltage-dependent function, enhanced signal resolution, and feedback regulation. Our data show that the wild-type BIB conductance is attenuated by external Ca2+, suggesting that endogenous divalent cation block might be relevant for enhancing signal resolution or voltage dependence for the native signaling process in neuronal cell fate determination. PMID:14990474
Hong, S W; Jon, J H; Kwak, J M; Nam, H G
1997-01-01
A cDNA clone for a receptor-like protein kinase gene (RPK1) was isolated from Arabidopsis thaliana. The clone is 1952 bp long with 1623 bp of an open reading frame encoding a peptide of 540 amino acids. The deduced peptide (RPK1) contains four distinctive domains characteristic of receptor kinases: (a) a putative amino-terminal signal sequence domain; (b) a domain with five extracellular leucine-rich repeat sequences; (c) a membrane-spanning domain; and (d) a cytoplasmic protein kinase domain that contains all of the 11 subdomains conserved among protein kinases. The RPK1 gene is expressed in flowers, stems, leaves, and roots. Expression of the RPK1 gene is induced within 1 h after treatment with abscisic acid (ABA). The gene is also rapidly induced by several environmental stresses such as dehydration, high salt, and low temperature, suggesting that the gene is involved in a general stress response. The dehydration-induced expression is not impaired in aba-1, abi1-1, abi2-1, and abi3-1 mutants, suggesting that the dehydration-induced expression of the RPK1 gene is ABA-independent. A possible role of this gene in the signal transduction pathway of ABA and the environmental stresses is discussed. PMID:9112773
A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis
Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor
2014-01-01
BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552
Crystal structure of the extracellular domain of human myelin protein zero
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Zhigang; Wang, Yong; Yedidi, Ravikiran S.
2012-03-27
Charcot-Marie-Tooth disease (CMT), a hereditary motor and sensory neuropathy, is the most common genetic neuropathy with an incidence of 1 in 2600. Several forms of CMT have been identified arising from different genomic abnormalities such as CMT1 including CMT1A, CMT1B, and CMTX. CMT1 with associated peripheral nervous system (PNS) demyelination, the most frequent diagnosis, demonstrates slowed nerve conduction velocities and segmental demyelination upon nerve biopsy. One of its subtypes, CMT1A, presents a 1.5-Mb duplication in the p11-p12 region of the human chromosome 17 which encodes peripheral myelin protein 22 (PMP22). CMT1B, a less common form, arises from the mutations inmore » the myelin protein zero (MPZ) gene on chromosome 1, region q22-q23, which encodes the major structural component of the peripheral myelin. A rare type of CMT1 has been found recently and is caused by point mutations in early growth response gene 2 (EGR2), encoding a zinc finger transcription factor in Schwann cells. In addition, CMTX, an X-linked form of CMT, arises from a mutation in the connexin-32 gene. Myelin protein zero, associated with CMT1B, is a transmembrane protein of 219 amino acid residues. Human MPZ consists of three domains: 125 residues constitute the glycosylated immunoglobulin-like extracellular domain; 27 residues span the membrane; and 67 residues comprise the highly basic intracellular domain. MPZ makes up approximately 50% of the protein content of myelin, and is expressed predominantly in Schwann cells, the myelinating cell of the PNS. Myelin protein zero, a homophilic adhesion molecule, is a member of the immunoglobulin super-family and is essential for normal myelin structure and function. In addition, MPZ knockout mice displayed abnormal myelin that severely affects the myelination pathway, and overexpression of MPZ causes congenital hypomyelination of peripheral nerves. Myelin protein zero mutations account for {approx}5% of patients with CMT. To date, over 125 different mutations in the MPZ gene leading to peripheral neuropathy in patients have been reported worldwide (http://www.molgen. ua.ac.be/CMTMutations). All identified mutations resulting in a change or deletion of amino acid residues in MPZ give rise to neuropathy with the exception of R215L, which instead causes a benign polymorphism. Furthermore, more detailed analysis has classified the MPZ mutations into two major groups. In the first group, the mutations disrupt the intracellular processing of MPZ and are primarily associated with early onset neuropathy. It has been proposed that the mutated MPZ is trapped inside the cell rather than being transported to the plasma membrane. However, other evidence suggests that the mutated MPZ protein is expressed on the plasma membrane, but dominant-negatively disrupts the structure of myelin. In the second group, the MPZ mutations are associated with late onset neuropathy as these mutations cause only mild demyelination. The underlying mechanism is elusive with the hypothesis being that the second group of mutations cause minor abnormalities in the myelin sheath that over time may lead to aberrant Schwann cell-axon interactions and subsequently to axonal degeneration. The crystal structure of the extracellular domain of human MPZ (hP0ex) fused with maltose binding protein (MBP) is reported at 2.1 {angstrom} resolution. While the crystal structure of rat MPZ extracellular domain (rP0ex) is available, the crystal structure of the human counterpart is useful for the analysis of the two homologs as well as a comparison between the two species. The hP0ex molecule reveals subtle structural variations between two homologs allowing comparison of the human myelin protein zero to that of the rat protein. The alignment of these homologs is shown in Figure 1(a).« less
Molecular Basis of Latency in Pathogenic Human Viruses
NASA Astrophysics Data System (ADS)
Garcia-Blanco, Mariano A.; Cullen, Bryan R.
1991-11-01
Several human viruses are able to latently infect specific target cell populations in vivo. Analysis of the replication cycles of herpes simplex virus, Epstein-Barr virus, and human immunodeficiency virus suggests that the latent infections established by these human pathogens primarily result from a lack of host factors critical for the expression of viral early gene products. The subsequent activation of specific cellular transcription factors in response to extracellular stimuli can induce the expression of these viral regulatory proteins and lead to a burst of lytic viral replication. Latency in these eukaryotic viruses therefore contrasts with latency in bacteriophage, which is maintained primarily by the expression of virally encoded repressors of lytic replication.
Activating MAPK1 (ERK2) mutation in an aggressive case of disseminated juvenile xanthogranuloma
Chakraborty, Rikhia; Hampton, Oliver A.; Abhyankar, Harshal; Zinn, Daniel J.; Grimes, Amanda; Skull, Brooks; Eckstein, Olive; Mahmood, Nadia; Wheeler, David A.; Lopez-Terrada, Dolores; Peters, Tricia L.; Hicks, John M.; Elghetany, Tarek; Krance, Robert; Poulikakos, Poulikos I.; Merad, Miriam; McClain, Kenneth L.; Allen, Carl E.; Parsons, Donald W.
2017-01-01
Juvenile xanthogranuloma (JXG) is a rare histiocytic disorder that is usually benign and self-limiting. We present a case of atypical, aggressive JXG harboring a novel mitogen-activated protein kinase (MAPK) pathway mutation in the MAPK1 gene, which encodes mitogen-activated protein kinase 1 or extracellular signal-regulated 2 (ERK2). Our analysis revealed that the mutation results in constitutive ERK activation that is resistant to BRAF or MEK inhibitors but susceptible to an ERK inhibitor. These data highlight the importance of identifying specific MAPK pathway alterations as part of the diagnostic workup for patients with histiocytic disorders rather than initiating empiric treatment with MEK inhibitors. PMID:28512266
He, Shihan; Ni, Shuang; Hegde, Shailaja; Wang, Xin; Sharda, Daniel R.; August, Avery; Paulson, Robert F.; Hankey, Pamela A.
2010-01-01
Friend virus induces an erythroleukemia in susceptible mice that is initiated by the interaction of the Friend virus-encoded glycoprotein gp55 with the erythropoietin (Epo) receptor and the product of the host Fv2 gene, a naturally occurring truncated form of the Stk receptor tyrosine kinase (Sf-Stk). We have previously demonstrated that the activation of Sf-Stk, recruitment of a Grb2/Gab2/Stat3 signaling complex, and induction of Pu.1 expression by Stat3 are required for the development of the early stage of Friend disease both in vitro and in vivo. Here we demonstrate that the interaction of gp55 with Sf-Stk is dependent on cysteine residues in the ecotropic domain of gp55 and the extracellular domain of Sf-Stk. Point mutation of these cysteine residues or deletion of these domains inhibits the ability of gp55 to interact with Sf-Stk, resulting in the inability of these proteins to promote the Epo-independent growth of erythroid progenitor cells. We also demonstrate that the interaction of gp55 with Sf-Stk does not promote dimerization of Sf-Stk but results in enhanced phosphorylation of Sf-Stk and the relocalization of Sf-Stk from the cytosol to the plasma membrane. Finally, we demonstrate that a constitutively active form of Sf-Stk (Sf-StkM330T), as well as its human counterpart, Sf-Ron, promotes Epo-independent colony formation in the absence of gp55 and that this response is also dependent on the cysteines in the extracellular domains of Sf-StkM330T and Sf-Ron. These data suggest that the cysteines in the extracellular domains of Sf-Stk and Sf-Ron may also mediate the interaction of these truncated receptors with other cellular factors that regulate their ability to promote cytokine-independent growth. PMID:20016000
Mark, M R; Scadden, D T; Wang, Z; Gu, Q; Goddard, A; Godowski, P J
1994-04-08
We have isolated cDNA clones that encode the human and murine forms of a novel receptor-type tyrosine kinase termed Rse. Sequence analysis indicates that human Rse contains 890 amino acids, with an extracellular region composed of two immunoglobulin-like domains followed by two fibronectin type III domains. Murine Rse contains 880 amino acids and shares 90% amino acid identity with its human counterpart. Rse is structurally similar to the receptor-type tyrosine kinase Axl/Ufo, and the two proteins have 35 and 63% sequence identity in their extracellular and intracellular domains, respectively. To study the synthesis and activation of this putative receptor-type tyrosine kinase, we constructed a version of Rse (termed gD-Rse, where gD represents glycoprotein D) that contains an NH2-terminal epitope tag. NIH3T3 cells were engineered to express gD-Rse, which could be detected at the cell surface by fluorescence-activated cell sorting. Moreover, gD-Rse was rapidly phosphorylated on tyrosine residues upon incubation of the cells with an antibody directed against the epitope tag, suggesting that rse encodes an active tyrosine kinase. In the human tissues we examined, the highest level of expression of rse mRNA was observed in the brain; rse mRNA was also detected in the premegakaryocytopoietic cell lines CMK11-5 and Dami. The gene for rse was localized to human chromosome 15.
A Candida Biofilm-Induced Pathway for Matrix Glucan Delivery: Implications for Drug Resistance
Taff, Heather T.; Nett, Jeniel E.; Zarnowski, Robert; Ross, Kelly M.; Sanchez, Hiram; Cain, Mike T.; Hamaker, Jessica; Mitchell, Aaron P.; Andes, David R.
2012-01-01
Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics. PMID:22876186
Pal Roy, Moushree; Datta, Subhabrata; Ghosh, Shilpi
2017-05-01
Bacillus aryabhattai RS1 isolated from rhizosphere produced an extracellular, low temperature active phytase. The cultural conditions for enzyme production were optimized to obtain 35 U mL -1 of activity. Purified phytase had specific activity and molecular weight of 72.97 U mg -1 and ∼40 kDa, respectively. The enzyme was optimally active at pH 6.5 and 40°C and was highly specific to phytate. It exhibited higher catalytic activity at low temperature, retaining over 40% activity at 10°C. Phytase was more thermostable in presence of Ca 2+ ion and retained 100% residual activity on preincubation at 20-50°C for 30 min. Partial phytase encoding gene, phy B (816 bp) was cloned and sequenced. The encoded amino acid sequence (272 aa) contained two conserved motifs, DA[A/T/E]DDPA[I/L/V]W and NN[V/I]D[I/L/V]R[Y/D/Q] of β-propellar phytase and had lower sequence homology with other Bacillus phytases, indicating its novelty. Phytase and the bacterial inoculum were effective in improving germination and growth of chickpea seedlings under phosphate limiting condition. Moreover, the potential applications of the enzyme with relatively high activity at lower temperatures (20-30°C) could also be extended to aquaculture and food processing. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:633-641, 2017. © 2017 American Institute of Chemical Engineers.
Veana, Fabiola; Fuentes-Garibay, José Antonio; Aguilar, Cristóbal Noé; Rodríguez-Herrera, Raúl; Guerrero-Olazarán, Martha; Viader-Salvadó, José María
2014-09-01
β-Fructofuranosidases or invertases (EC 3.2.1.26) are enzymes that are widely used in the food industry, where fructose is preferred over sucrose, because it is sweeter and does not crystallize easily. Since Aspergillus niger GH1, an xerophilic fungus from the Mexican semi-desert, has been reported to be an invertase producer, and because of the need for new enzymes with biotechnological applications, in this work, we describe the gene and amino acid sequence of the invertase from A. niger GH1, and the use of a synthetic gene to produce the enzyme in the methylotrophic yeast Pichia pastoris. In addition, the produced invertase was characterized biochemically. The sequence of the invertase gene had a length of 1770 bp without introns, encodes a protein of 589 amino acids, and presented an identity of 93% and 97% with invertases from Aspergillus kawachi IFO 4308 and A. niger B60, respectively. A 4.2 L culture with the constructed recombinant P. pastoris strain showed an extracellular and periplasmic invertase production at 72 h induction of 498 and 3776 invertase units (U), respectively, which corresponds to 1018 U/L of culture medium. The invertase produced had an optimum pH of 5.0, optimum temperature of 60 °C, and specific activity of 3389 U/mg protein, and after storage for 96 h at 4 °C showed 93.7% of its activity. This invertase could be suitable for producing inverted sugar used in the food industry. Copyright © 2014 Elsevier Inc. All rights reserved.
Abdal Dayem, Ahmed; Lee, Soo Bin; Choi, Hye Yeon; Cho, Ssang-Goo
2018-05-15
We have previously demonstrated the potential of biologically synthesized silver nanoparticles (AgNP) in the induction of neuronal differentiation of human neuroblastoma, SH-SY5Y cells; we aimed herein to unveil its molecular mechanism in comparison to the well-known neuronal differentiation-inducing agent, all-trans-retinoic acid (RA). AgNP-treated SH-SY5Y cells showed significantly higher reactive oxygen species (ROS) generation, stronger mitochondrial membrane depolarization, lower dual-specificity phosphatase expression, higher extracellular-signal-regulated kinase (ERK) phosphorylation, lower AKT phosphorylation, and lower expression of the genes encoding the antioxidant enzymes than RA-treated cells. Notably, pretreatment with N -acetyl-l-cysteine significantly abolished AgNP-induced neuronal differentiation, but not in that induced by RA. ERK inhibition, but not AKT inhibition, suppresses neurite growth that is induced by AgNP. Taken together, our results uncover the pivotal contribution of ROS in the AgNP-induced neuronal differentiation mechanism, which is different from that of RA. However, the negative consequence of AgNP-induced neurite growth may be high ROS generation and the downregulation of the expression of the genes encoding the antioxidant enzymes, which prompts the future consideration and an in-depth study of the application of AgNP-differentiated cells in neurodegenerative disease therapy.
Faruque, Shah M.; Zhu, Jun; Asadulghani; Kamruzzaman, M.; Mekalanos, John J.
2003-01-01
The major virulence factors of toxigenic Vibrio cholerae are cholera toxin, which is encoded by a lysogenic filamentous bacteriophage (CTXΦ), and toxin-coregulated pilus (TCP), an essential colonization factor that is also the receptor for CTXΦ. The genes involved in the biosynthesis of TCP reside in a pathogenicity island, which has been reported to correspond to the genome of another filamentous phage (designated VPIΦ) and to encode functions necessary for the production of infectious VPIΦ particles. We examined 46 V. cholerae strains having diverse origins and carrying different genetic variants of the TCP island for the production of the VPIΦ and CTXΦ in different culture conditions, including induction of prophages with mitomycin C and UV irradiation. Although 9 of 10 V. cholerae O139 strains and 12 of 15 toxigenic El Tor strains tested produced extracellular CTXΦ, none of the 46 TCP-positive strains produced detectable VPIΦ in repeated assays, which detected as few as 10 particles of a control CTX phage per ml. These results contradict the previous report regarding VPIΦ-mediated horizontal transfer of the TCP genes and suggest that the TCP island is unable to support the production of phage particles. Further studies are necessary to understand the mechanism of horizontal transfer of the TCP island. PMID:12761075
l-Valine Production with Pyruvate Dehydrogenase Complex-Deficient Corynebacterium glutamicum▿
Blombach, Bastian; Schreiner, Mark E.; Holátko, Jiří; Bartek, Tobias; Oldiges, Marco; Eikmanns, Bernhard J.
2007-01-01
Corynebacterium glutamicum was engineered for the production of l-valine from glucose by deletion of the aceE gene encoding the E1p enzyme of the pyruvate dehydrogenase complex and additional overexpression of the ilvBNCE genes encoding the l-valine biosynthetic enzymes acetohydroxyacid synthase, isomeroreductase, and transaminase B. In the absence of cellular growth, C. glutamicum ΔaceE showed a relatively high intracellular concentration of pyruvate (25.9 mM) and produced significant amounts of pyruvate, l-alanine, and l-valine from glucose as the sole carbon source. Lactate or acetate was not formed. Plasmid-bound overexpression of ilvBNCE in C. glutamicum ΔaceE resulted in an approximately 10-fold-lower intracellular pyruvate concentration (2.3 mM) and a shift of the extracellular product pattern from pyruvate and l-alanine towards l-valine. In fed-batch fermentations at high cell densities and an excess of glucose, C. glutamicum ΔaceE(pJC4ilvBNCE) produced up to 210 mM l-valine with a volumetric productivity of 10.0 mM h−1 (1.17 g l−1 h−1) and a maximum yield of about 0.6 mol per mol (0.4 g per g) of glucose. PMID:17293513
The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus
Park, Jin Hwan; Jo, Youmi; Jang, Song Yee; Kwon, Haenaem; Irie, Yasuhiko; Parsek, Matthew R.; Kim, Myung Hee; Choi, Sang Ho
2015-01-01
A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3′,5′-cyclic diguanylic acid (c-di-GMP) and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose. PMID:26406498
A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.
Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T
2015-01-01
The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.
Ito, Kotaro; Matsushima, Kenichiro; Koyama, Yasuji
2012-08-01
Glutaminase is an enzyme that catalyzes the hydrolysis of l-glutamine to l-glutamate, and it plays an important role in the production of fermented foods by enhancing the umami taste. By using the genome sequence and expressed sequence tag data available for Aspergillus oryzae RIB40, we cloned a novel glutaminase gene (AsgahA) from Aspergillus sojae, which was similar to a previously described gene encoding a salt-tolerant, thermostable glutaminase of Cryptococcus nodaensis (CnGahA). The structural gene was 1,929 bp in length without introns and encoded a glutaminase, AsGahA, which shared 36% identity with CnGahA. The introduction of multiple copies of AsgahA into A. oryzae RIB40 resulted in the overexpression of glutaminase activity. AsGahA was subsequently purified from the overexpressing transformant and characterized. While AsGahA was located at the cell surface in submerged culture, it was secreted extracellularly in solid-state culture. The molecular mass of AsGahA was estimated to be 67 kDa and 135 kDa by SDS-PAGE and gel filtration chromatography, respectively, indicating that the native form of AsGahA was a dimer. The optimal pH of the enzyme was 9.5, and its optimal temperature was 50°C in sodium phosphate buffer (pH 7.0). Analysis of substrate specificity revealed that AsGahA deamidated not only free l-glutamine and l-asparagine but also C-terminal glutaminyl or asparaginyl residues in peptides. Collectively, our results indicate that AsGahA is a novel peptidoglutaminase-asparaginase. Moreover, this is the first report to describe the gene cloning and purification of a peptidoglutaminase-asparaginase.
Reyes-Bermudez, Alejandro; Lin, Zhiyi; Hayward, David C; Miller, David J; Ball, Eldon E
2009-01-01
Background The coral skeleton consists of CaCO3 deposited upon an organic matrix primarily as aragonite. Currently galaxin, from Galaxea fascicularis, is the only soluble protein component of the organic matrix that has been characterized from a coral. Three genes related to galaxin were identified in the coral Acropora millepora. Results One of the Acropora genes (Amgalaxin) encodes a clear galaxin ortholog, while the others (Amgalaxin-like 1 and Amgalaxin-like 2) encode larger and more divergent proteins. All three proteins are predicted to be extracellular and share common structural features, most notably the presence of repetitive motifs containing dicysteine residues. In situ hybridization reveals distinct, but partially overlapping, spatial expression of the genes in patterns consistent with distinct roles in calcification. Both of the Amgalaxin-like genes are expressed exclusively in the early stages of calcification, while Amgalaxin continues to be expressed in the adult, consistent with the situation in the coral Galaxea. Conclusion Comparisons with molluscs suggest functional convergence in the two groups; lustrin A/pearlin proteins may be the mollusc counterparts of galaxin, whereas the galaxin-like proteins combine characteristics of two distinct proteins involved in mollusc calcification. Database searches indicate that, although sequences with high similarity to the galaxins are restricted to the Scleractinia, more divergent members of this protein family are present in other cnidarians and some other metazoans. We suggest that ancestral galaxins may have been secondarily recruited to roles in calcification in the Triassic, when the Scleractinia first appeared. Understanding the evolution of the broader galaxin family will require wider sampling and expression analysis in a range of cnidarians and other animals. PMID:19638240
Laing, K.J.; Zou, J.J.; Purcell, M.K.; Phillips, R.; Secombes, C.J.; Hansen, J.D.
2006-01-01
The T cell coreceptor CD4 is a transmembrane glycoprotein belonging to the Ig superfamily and is essential for cell-mediated immunity. Two different genes were identified in rainbow trout that resemble mammalian CD4. One (trout CD4) encodes four extracellular Ig domains reminiscent off mammalian CD4, whereas the other (CD4REL) codes for two Ig domains. Structural motifs within the amino acid sequences suggest that the two Ig domains of CD4REL duplicated to generate the four-domain molecule of CD4 and the related gene, lymphocyte activation gene-3. Here we present evidence that both of these molecules in trout are homologous to mammalian CD4 and that teleosts encode an additional CD4 family member, lymphocyte activation gene-3, which is a marker for activated T cells. The syntenic relationships of similar genes in other teleost and non-fish genomes provide evidence for the likely evolution of CD4-related molecules in vertebrates, with CD4REL likely representing the primordial form in fish. Expression of both CD4 genes is highest in the thymus and spleen, and mRNA expression of these genes is limited to surface IgM- lymphocytes, consistent with a role for T cell functionality. Finally, the intracellular regions of both CD4 and CD4REL possess the canonical CXC motif involved in the interaction off CD4 with p56LCK, implying that similar mechanisms for CD4 + T cell activation are present in all vertebrates. Our results therefore raise new questions about T cell development and functionality in lower vertebrates that cannot be answered by current mammalian models and, thus, is of fundamental importance for understanding the evolution of cell-mediated immunity in gnathosomes. Copyright ?? 2006 by The American Association of Immunologists, Inc.
Molecular interactions between tomato and the leaf mold pathogen Cladosporium fulvum.
Rivas, Susana; Thomas, Colwyn M
2005-01-01
The interaction between tomato and the leaf mold pathogen Cladosporium fulvum is controlled in a gene-for-gene manner. This interaction has provided useful insights to the molecular basis of recognition specificity in plant disease resistance (R) proteins, disease resistance (R) gene evolution, R-protein mediated signaling, and cellular responses to pathogen attack. Tomato Cf genes encode type I membrane-associated receptor-like proteins (RLPs) comprised predominantly of extracellular leucine-rich repeats (eLRRs) and which are anchored in the plasma membrane. Cf proteins recognize fungal avirulence (Avr) peptides secreted into the leaf apoplast during infection. A direct interaction of Cf proteins with their cognate Avr proteins has not been demonstrated and the molecular mechanism of Avr protein perception is not known. Following ligand perception Cf proteins trigger a hypersensitive response (HR) and the arrest of pathogen development. Cf proteins lack an obvious signaling domain, suggesting that defense response activation is mediated through interactions with other partners. Avr protein perception results in the rapid accumulation of active oxygen species (AOS), changes in cellular ion fluxes, activation of protein kinase cascades, changes in gene expression and, possibly, targeted protein degradation. Here we review our current understanding of Cf-mediated responses in resistance to C. fulvum.
Late development of hagfish vertebral elements.
Ota, Kinya G; Fujimoto, Satoko; Oisi, Yasuhiro; Kuratani, Shigeru
2013-05-01
It has been demonstrated recently that hagfishes, one of two groups of extant jawless vertebrates, have cartilaginous vertebral elements. Embryological and gene expression analyses have also shown that this group of animals develops a sclerotome, the potential primordium of the axial skeleton. However, it has not been shown unequivocally that the hagfish sclerotome truly differentiates into cartilage, because access to late-stage embryos and information about the cartilaginous extracellular matrix (ECM) are lacking for these animals. Here we investigated the expression patterns of the biglycan/decorin (BGN/DCN) gene in the inshore hagfish, Eptatretus burgeri. The homologue of this gene encodes the major noncollagenous component of the cartilaginous ECM among gnathostomes. We clearly identified the expression of this gene in adult vertebral tissues and in embryonic mesenchymal cells on the ventral aspect of the notochord. Taking into account that the sclerotome in the gnathostomes expresses BGN/DCN gene during the chondrogenesis, it is highly expected the hagfish BGN/DCN-positive mesenchymal cells are derived from the sclerotomes. We propose that hagfishes and gnathostomes share conserved developmental mechanisms not only in their somite differentiation, but also in chondrogenesis of their vertebral elements. Copyright © 2013 Wiley Periodicals, Inc.
Kessler, Aline; Schell, Ursula; Sahr, Tobias; Tiaden, André; Harrison, Christopher; Buchrieser, Carmen; Hilbi, Hubert
2013-02-01
Legionella pneumophila is an amoeba-resistant opportunistic pathogen that performs cell-cell communication through the signalling molecule 3-hydroxypentadecane-4-one (LAI-1, Legionella autoinducer-1). The lqs (Legionella quorum sensing) gene cluster encodes the LAI-1 autoinducer synthase LqsA, the cognate sensor kinase LqsS and the response regulator LqsR. Here we show that the Lqs system includes an 'orphan' homologue of LqsS termed LqsT. Compared with wild-type L. pneumophila, strains lacking lqsT or both lqsS and lqsT show increased salt resistance, greatly enhanced natural competence for DNA acquisition and impaired uptake by phagocytes. Sensitive novel single round growth assays and competition experiments using Acanthamoeba castellanii revealed that ΔlqsT and ΔlqsS-ΔlqsT, as well as ΔlqsA and other lqs mutant strains are impaired for intracellular growth and cannot compete against wild-type bacteria upon co-infection. In contrast to the ΔlqsS strain, ΔlqsT does not produce extracellular filaments. The phenotypes of the ΔlqsS-ΔlqsT strain are partially complemented by either lqsT or lqsS, but are not reversed by overexpression of lqsA, suggesting that LqsT and LqsS are the sole LAI-1-responsive sensor kinases in L. pneumophila. In agreement with the different phenotypes of the ΔlqsT and ΔlqsS strains, lqsT and lqsS are differentially expressed in the post-exponential growth phase, and transcriptome studies indicated that 90% of the genes, which are downregulated in absence of lqsT, are upregulated in absence of lqsS. Reciprocally regulated genes encode components of a 133 kb genomic 'fitness island' or translocated effector proteins implicated in virulence. Together, these results reveal a unique organization of the L. pneumophila Lqs system comprising two partially antagonistic LAI-1-responsive sensor kinases, LqsT and LqsS, which regulate distinct pools of genes implicated in pathogen-host cell interactions, competence, expression of a genomic island or production of extracellular filaments. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Moen, Scott T.; Yeager, Linsey A.; Lawrence, William S.; Ponce, Cindy; Galindo, Cristi L.; Garner, Harold R.; Baze, Wallace B.; Suarez, Giovanni; Peterson, Johnny W.; Chopra, Ashok K.
2008-01-01
Bacillus anthracis is the gram positive, spore-forming etiological agent of anthrax, an affliction studied because of its importance as a potential bioweapon. Although in vitro transcriptional responses of macrophages to either spore or anthrax toxins have been previously reported, little is known regarding the impact of infection on gene expression in host tissues. We infected Swiss-Webster mice intranasally with 5 LD50 of B. anthracis virulent Ames spores and observed the global transcriptional profiles of various tissues over a 48 hr time period. RNA was extracted from spleen, lung, and heart tissues of infected and control mice and examined by Affymetrix GeneChip analysis. Approximately 580 host genes were significantly over or under expressed among the lung, spleen, and heart tissues at 8 hr and 48 hr time points. Expression of genes encoding for surfactant and major histocompatibility complex (MHC) presentation was diminished during the early phase of infection in lungs. By 48 hr, a significant number of genes were modulated in the heart, including up-regulation of calcium-binding related gene expression, and down-regulation of multiple genes related to cell adhesion, formation of the extracellular matrix, and the cell cytoskeleton. Interestingly, the spleen 8 hr post-infection showed striking increases in the expression of genes that encode hydrolytic enzymes, and these levels remained elevated throughout infection. Further, genes involving antigen presentation and interferon responses were down-regulated in the spleen at 8 hr. In late stages of infection, splenic genes related to the inflammatory response were up-regulated. This study is the first to describe the in vivo global transcriptional response of multiple organs during inhalational anthrax. Although numerous genes related to the host immunological response and certain protection mechanisms were up-regulated in these organs, a vast list of genes important for fully developing and maintaining this response were decreased. Additionally, the lung, spleen, and heart showed differential responses to the infection, further validating the demand for a better understanding of anthrax pathogenesis in order to design therapies against novel targets. PMID:18037264
Song, Wan; Nie, Yao; Mu, Xiao Qing; Xu, Yan
2016-08-01
Pullulanase plays an important role in industrial applications of starch processing. However, extracellular production of pullulanase from recombinant Bacillus subtilis is yet limited due to the issues on regulatory elements of B. subtilis expression system. In this study, the gene encoding B. naganoensis pullulanase (PUL) was expressed in B. subtilis WB800 under the promoter PHpaII in the shuttle vector pMA0911. The extracellular activity of expressed pullulanase was 3.9 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-PHpaII-pul. To further enhance the yield of PUL, the promoter PHpaII in pMA0911 was replaced by a stronger constitutive promoter P43. Then the activity was increased to 8.7 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-P43-pul. Effect of host on pullulanase expression was further investigated by comparison between B. subtilis WB600 and B. subtilis WB800. In addition to the available B. subtilis WB800 recombinants, the constructed plasmids pMA0911-PHpaII-pul and pMA0911-P43-pul were transformed into B. subtilis WB600, respectively. Consequently, the extracellular production of PUL was significantly enhanced by B. subtilis WB600/pMA0911-P43-pul, resulting in the extracellular pullulanase activity of 24.5 U ml(-1). Therefore, promoter and host had an impact on pullulanase expression and their optimization would be useful to improve heterologous protein expression in B. subtilis. Copyright © 2016 Elsevier Inc. All rights reserved.
Germic, Nina; Stojkov, Darko; Oberson, Kevin; Yousefi, Shida; Simon, Hans-Uwe
2017-11-01
The importance of extracellular traps (ETs) in innate immunity is well established, but the molecular mechanisms responsible for their formation remain unclear and in scientific dispute. ETs have been defined as extracellular DNA scaffolds associated with the granule proteins of eosinophils or neutrophils. They are capable of killing bacteria extracellularly. Based mainly on results with phosphoinositide 3-kinase (PI3K) inhibitors such as 3-methyladenine (3-MA) and wortmannin, which are commonly used to inhibit autophagy, several groups have reported that autophagy is required for neutrophil extracellular trap (NET) formation. We decided to investigate this apparent dependence on autophagy for ET release and generated genetically modified mice that lack, specifically in eosinophils or neutrophils, autophagy-related 5 (Atg5), a gene encoding a protein essential for autophagosome formation. Interestingly, neither eosinophils nor neutrophils from Atg5-deficient mice exhibited abnormalities in ET formation upon physiological activation or exposure to low concentrations of PMA, although we could confirm that human and mouse eosinophils and neutrophils, after pre-treatment with inhibitors of class III PI3K, show a block both in reactive oxygen species (ROS) production and in ET formation. The so-called late autophagy inhibitors bafilomycin A1 and chloroquine, on the other hand, were without effect. These data indicate that ET formation occurs independently of autophagy and that the inhibition of ROS production and ET formation in the presence of 3-MA and wortmannin is probably owing to their additional ability to block the class I PI3Ks, which are involved in signalling cascades initiated by triggers of ET formation. © 2017 John Wiley & Sons Ltd.
Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun
2013-01-01
Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305
He, Hanliang; Wang, Chunqing; Tang, Qifeng; Yang, Fan; Xu, Youjia
2018-06-01
Estrogen can affect the cartilage development of zebrafish; however, the mechanism underlying its effects is not completely understood. Four-day-old zebrafish larvae were treated with 0.8 μM estrogen, the 5 days post fertilization (dpf) zebrafish larvae did not demonstrate obvious abnormalities during development; however, the 6 dpf and 7 dpf larvae exhibited abnormal craniofacial bone development along with craniofacial bone degradation. RNA deep sequencing was performed to elucidate the mechanism involved. Gene Ontology functional and KEGG pathway enrichment analysis of differentially expressed genes (DEGs) showed that the extracellular matrix (ECM), extracellular region, ECM-interaction receptor, focal adhesion, cell cycle, apoptosis, and bone-related signaling pathways were disrupted. In these signaling pathways, the expressions of key genes, such as collagen encoded (col19a1a, col7a1, col7al, col18a1, and col9a3), MAPK signaling pathway (fgf19, fgf6a), TGF-beta signaling pathway (tgfbr1), and cell cycle (cdnk1a) genes were altered. The qRT-PCR results showed that after treatment with 0.8 μM 17-β estradiol (E2), col19a1a, col7a1, col7al, col18a1, col9a3, fgf6a, cdkn1a were downregulated, and fgf19, tgfr1 were upregulated, which were consistent with deep sequencing analysis. Therefore, the effect of estrogen on cartilage development might occur via multiple mechanisms. The study results demonstrate the mechanism underlying the effect of estrogen on cartilage development. Copyright © 2018 Elsevier B.V. All rights reserved.
Kelly, Steven; Ivens, Alasdair; Mott, G. Adam; O’Neill, Ellis; Emms, David; Macleod, Olivia; Voorheis, Paul; Tyler, Kevin; Clark, Matthew; Matthews, Jacqueline
2017-01-01
Abstract There are hundreds of Trypanosoma species that live in the blood and tissue spaces of their vertebrate hosts. The vast majority of these do not have the ornate system of antigenic variation that has evolved in the small number of African trypanosome species, but can still maintain long-term infections in the face of the vertebrate adaptive immune system. Trypanosoma theileri is a typical example, has a restricted host range of cattle and other Bovinae, and is only occasionally reported to cause patent disease although no systematic survey of the effect of infection on agricultural productivity has been performed. Here, a detailed genome sequence and a transcriptome analysis of gene expression in bloodstream form T. theileri have been performed. Analysis of the genome sequence and expression showed that T. theileri has a typical kinetoplastid genome structure and allowed a prediction that it is capable of meiotic exchange, gene silencing via RNA interference and, potentially, density-dependent growth control. In particular, the transcriptome analysis has allowed a comparison of two distinct trypanosome cell surfaces, T. brucei and T. theileri, that have each evolved to enable the maintenance of a long-term extracellular infection in cattle. The T. theileri cell surface can be modeled to contain a mixture of proteins encoded by four novel large and divergent gene families and by members of a major surface protease gene family. This surface composition is distinct from the uniform variant surface glycoprotein coat on African trypanosomes providing an insight into a second mechanism used by trypanosome species that proliferate in an extracellular milieu in vertebrate hosts to avoid the adaptive immune response. PMID:28903536
Maunsell, Bláithín; Adams, Claire; O'Gara, Fergal
2006-01-01
In the soil bacterium Pseudomonas fluorescens M114, extracellular proteolytic activity and fluorescent siderophore (pseudobactin M114) production were previously shown to be co-ordinately negatively regulated in response to environmental iron levels. An iron-starvation extracytoplasmic function sigma factor, PbrA, required for the transcription of siderophore biosynthetic genes, was also implicated in M114 protease regulation. The current study centred on the characterization and genetic regulation of the gene(s) responsible for protease production in M114. A serralysin-type metalloprotease gene, aprA, was identified and found to encode the major, if not only, extracellular protease produced by this strain. The expression of aprA and its protein product were found to be subject to complex regulation. Transcription analysis confirmed that PbrA was required for full aprA transcription under low iron conditions, while the ferric uptake regulator, Fur, was implicated in aprA repression under high iron conditions. Interestingly, the iron regulation of AprA was dependent on culture conditions, with PbrA-independent AprA-mediated proteolytic activity observed on skim milk agar supplemented with yeast extract, when supplied with iron or purified pseudobactin M114. These effects were not observed on skim milk agar without yeast extract. PbrA-independent aprA expression was also observed from a truncated transcriptional fusion when grown in sucrose asparagine tryptone broth supplied with iron or purified pseudobactin M114. Thus, experimental evidence suggested that iron mediated its effects via transcriptional activation by PbrA under low iron conditions, while an as-yet-unidentified sigma factor(s) may be required for the PbrA-independent aprA expression and AprA proteolytic activity induced by siderophore and iron.
Chen, Po Ting; Shaw, Jei-Fu; Chao, Yun-Peng; David Ho, Tuan-Hua; Yu, Su-May
2010-05-12
Bacillus subtilis is most commonly employed for secretion of recombinant proteins. To circumvent the problems caused by using plasmids, the T7 expression system known for its high efficiency was rebuilt in B. subtilis. Accordingly, a markerless and replicon-free method was developed for genomic insertion of DNAs. By the act of homologous recombination via the guide DNA, a suicidal vector carrying the gene of interest was integrated into genomic loci of bacteria. Removal of the inserted selection marker and replicon flanked by FRT sites was mediated by the FLP recombinase. By using the mentioned system, B. subtilis strain PT5 was constructed to harbor a genomic copy of the spac promoter-regulated T7 gene 1 located at wprA (encoding the cell wall-associated protease). Similarly, the T7 promoter-driven nattokinase or endoglucanase E1 of Thermomonospora fusca genes were also integrated into mpr (encoding an extracellular protease) of strain PT5. Consequently, the integrant PT5/Mmp-T7N or PT5/MT1-E1 resulted in a "clean" producer strain deprived of six proteases. After 24 h, the strain receiving induction was able to secret nattokinase and endoglucanase E1 with the volumetric activity reaching 10860 CU/mL and 8.4 U/mL, respectively. This result clearly indicates the great promise of the proposed approach for high secretion of recombinant proteins in B. subtilis.
Pehlivan, Necla; Sun, Li; Jarrett, Philip; Yang, Xiaojie; Mishra, Neelam; Chen, Lin; Kadioglu, Asim; Shen, Guoxin; Zhang, Hong
2016-05-01
The Arabidopsis gene AtNHX1 encodes a vacuolar membrane-bound sodium/proton (Na(+)/H(+)) antiporter that transports Na(+) into the vacuole and exports H(+) into the cytoplasm. The Arabidopsis gene SOS1 encodes a plasma membrane-bound Na(+)/H(+) antiporter that exports Na(+) to the extracellular space and imports H(+) into the plant cell. Plants rely on these enzymes either to keep Na(+) out of the cell or to sequester Na(+) into vacuoles to avoid the toxic level of Na(+) in the cytoplasm. Overexpression of AtNHX1 or SOS1 could improve salt tolerance in transgenic plants, but the improved salt tolerance is limited. NaCl at concentration >200 mM would kill AtNHX1-overexpressing or SOS1-overexpressing plants. Here it is shown that co-overexpressing AtNHX1 and SOS1 could further improve salt tolerance in transgenic Arabidopsis plants, making transgenic Arabidopsis able to tolerate up to 250 mM NaCl treatment. Furthermore, co-overexpression of AtNHX1 and SOS1 could significantly reduce yield loss caused by the combined stresses of heat and salt, confirming the hypothesis that stacked overexpression of two genes could substantially improve tolerance against multiple stresses. This research serves as a proof of concept for improving salt tolerance in other plants including crops. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
Marques, T; Patente, T A; Monteiro, M B; Cavaleiro, A M; Queiroz, M S; Nery, M; de Azevedo, M J; Canani, L H; Parisi, M C; Moura-Neto, A; Passarelli, M; Giannella-Neto, D; Machado, U F; Corrêa-Giannella, M L
2015-04-15
Mesangial cells subject to high extracellular glucose concentrations, as occur in hyperglycaemic states, are unable to down regulate glucose influx, resulting in intracellular activation of deleterious biochemical pathways. A high expression of GLUT1 participates in the development of diabetic glomerulopathy. Variants in the gene encoding GLUT1 (SLC2A1) have been associated to this diabetic complication. The aim of this study was to test whether polymorphisms in SLC2A1 confer susceptibility to diabetic nephropathy (DN) in Brazilian type 1 diabetes patients. Four polymorphisms (rs3820589, rs1385129, rs841847 and rs841848) were genotyped in a Brazilian cohort comprised of 452 patients. A prospective analysis was performed in 155 patients. Mean duration of follow-up was 5.6 ± 2.4 years and the incidence of renal events was 18.0%. The rs3820589 presented an inverse association with the prevalence of incipient DN (OR: 0.36, 95% CI: 0.16 - 0.80, p=0.01) and with progression to renal events (HR: 0.20; 95% CI: 0.03 - 0.70; p=0.009). AGGT and AGAC haplotypes were associated with the prevalence of incipient DN and the AGAC haplotype was also associated with the prevalence of established/advanced DN. In conclusion, rs3820589 in the SLC2A1 gene modulates the risk to DN in Brazilian patients with inadequate type 1 diabetes control. Copyright © 2015 Elsevier B.V. All rights reserved.
Non-coding landscapes of colorectal cancer
Ragusa, Marco; Barbagallo, Cristina; Statello, Luisa; Condorelli, Angelo Giuseppe; Battaglia, Rosalia; Tamburello, Lucia; Barbagallo, Davide; Di Pietro, Cinzia; Purrello, Michele
2015-01-01
For two decades Vogelstein’s model has been the paradigm for describing the sequence of molecular changes within protein-coding genes that would lead to overt colorectal cancer (CRC). This model is now too simplistic in the light of recent studies, which have shown that our genome is pervasively transcribed in RNAs other than mRNAs, denominated non-coding RNAs (ncRNAs). The discovery that mutations in genes encoding these RNAs [i.e., microRNAs (miRNAs), long non-coding RNAs, and circular RNAs] are causally involved in cancer phenotypes has profoundly modified our vision of tumour molecular genetics and pathobiology. By exploiting a wide range of different mechanisms, ncRNAs control fundamental cellular processes, such as proliferation, differentiation, migration, angiogenesis and apoptosis: these data have also confirmed their role as oncogenes or tumor suppressors in cancer development and progression. The existence of a sophisticated RNA-based regulatory system, which dictates the correct functioning of protein-coding networks, has relevant biological and biomedical consequences. Different miRNAs involved in neoplastic and degenerative diseases exhibit potential predictive and prognostic properties. Furthermore, the key roles of ncRNAs make them very attractive targets for innovative therapeutic approaches. Several recent reports have shown that ncRNAs can be secreted by cells into the extracellular environment (i.e., blood and other body fluids): this suggests the existence of extracellular signalling mechanisms, which may be exploited by cells in physiology and pathology. In this review, we will summarize the most relevant issues on the involvement of cellular and extracellular ncRNAs in disease. We will then specifically describe their involvement in CRC pathobiology and their translational applications to CRC diagnosis, prognosis and therapy. PMID:26556998
García-Hidalgo, Javier; Hormigo, Daniel; Arroyo, Miguel; de la Mata, Isabel
2013-01-01
The ascomycin-producer strain Streptomyces ascomycinicus has been proven to be an extracellular poly(R)-3-hydroxybutyrate (PHB) degrader. The fkbU gene, encoding a PHB depolymerase (PhaZSa), has been cloned in E. coli and Rhodococcus sp. T104 strains for gene expression. Gram-positive host Rhodococcus sp. T104 was able to produce and secrete to the extracellular medium an active protein form. PhaZSa was purified by two hydrophobic interaction chromatographic steps, and afterwards was biochemically as well as structurally characterized. The enzyme was found to be a monomer with a molecular mass of 48.4 kDa, and displayed highest activity at 45°C and pH 6, thus being the first PHB depolymerase from a gram-positive bacterium presenting an acidic pH optimum. The PHB depolymerase activity of PhaZSa was increased in the presence of divalent cations due to non-essential activation, and also in the presence of methyl-β-cyclodextrin and PEG 3350. Protein structure was analyzed, revealing a globular shape with an alpha-beta hydrolase fold. The amino acids comprising the catalytic triad, Ser131-Asp209-His269, were identified by multiple sequence alignment, chemical modification of amino acids and site-directed mutagenesis. These structural results supported the proposal of a three-dimensional model for this depolymerase. PhaZSa was able to degrade PHB, but also demonstrated its ability to degrade films made of PHB, PHBV copolymers and a blend of PHB and starch (7∶3 proportion wt/wt). The features shown by PhaZSa make it an interesting candidate for industrial applications involving PHB degradation. PMID:23951224
García-Hidalgo, Javier; Hormigo, Daniel; Arroyo, Miguel; de la Mata, Isabel
2013-01-01
The ascomycin-producer strain Streptomyces ascomycinicus has been proven to be an extracellular poly(R)-3-hydroxybutyrate (PHB) degrader. The fkbU gene, encoding a PHB depolymerase (PhaZ Sa ), has been cloned in E. coli and Rhodococcus sp. T104 strains for gene expression. Gram-positive host Rhodococcus sp. T104 was able to produce and secrete to the extracellular medium an active protein form. PhaZ Sa was purified by two hydrophobic interaction chromatographic steps, and afterwards was biochemically as well as structurally characterized. The enzyme was found to be a monomer with a molecular mass of 48.4 kDa, and displayed highest activity at 45°C and pH 6, thus being the first PHB depolymerase from a gram-positive bacterium presenting an acidic pH optimum. The PHB depolymerase activity of PhaZ Sa was increased in the presence of divalent cations due to non-essential activation, and also in the presence of methyl-β-cyclodextrin and PEG 3350. Protein structure was analyzed, revealing a globular shape with an alpha-beta hydrolase fold. The amino acids comprising the catalytic triad, Ser(131)-Asp(209)-His(269), were identified by multiple sequence alignment, chemical modification of amino acids and site-directed mutagenesis. These structural results supported the proposal of a three-dimensional model for this depolymerase. PhaZ Sa was able to degrade PHB, but also demonstrated its ability to degrade films made of PHB, PHBV copolymers and a blend of PHB and starch (7∶3 proportion wt/wt). The features shown by PhaZ Sa make it an interesting candidate for industrial applications involving PHB degradation.
Retinoschisin, a New Binding Partner for L-type Voltage-gated Calcium Channels in the Retina*
Shi, Liheng; Jian, Kuihuan; Ko, Michael L.; Trump, Dorothy; Ko, Gladys Y.-P.
2009-01-01
The L-type voltage-gated calcium channels (L-VGCCs) are activated under high depolarization voltages. They are vital for diverse biological events, including cell excitability, differentiation, and synaptic transmission. In retinal photoreceptors, L-VGCCs are responsible for neurotransmitter release and are under circadian influences. However, the mechanism of L-VGCC regulation in photoreceptors is not fully understood. Here, we show that retinoschisin, a highly conserved extracellular protein, interacts with the L-VGCCα1D subunit and regulates its activities in a circadian manner. Mutations in the gene encoding retinoschisin (RS1) cause retinal disorganization that leads to early onset of macular degeneration. Since ion channel activities can be modulated through interactions with extracellular proteins, disruption of these interactions can alter physiology and be the root cause of disease states. Co-immunoprecipitation and mammalian two-hybrid assays showed that retinoschisin and the N-terminal fragment of the L-VGCCα1 subunit physically interacted with one another. The expression and secretion of retinoschisin are under circadian regulation with a peak at night and nadir during the day. Inhibition of L-type VGCCs decreased membrane-bound retinoschisin at night. Overexpression of a missense RS1 mutant gene, R141G, into chicken cone photoreceptors caused a decrease of L-type VGCC currents at night. Our findings demonstrate a novel bidirectional relationship between an ion channel and an extracellular protein; L-type VGCCs regulate the circadian rhythm of retinoschisin secretion, whereas secreted retinoschisin feeds back to regulate L-type VGCCs. Therefore, physical interactions between L-VGCCα1 subunits and retinoschisin play an important role in the membrane retention of L-VGCCα1 subunits and photoreceptor-bipolar synaptic transmission. PMID:19074145
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome triplication analysis in B. oleracea, B. rapa and A. thaliana genomes, our study provides insight into the evolutionary history of NBS-encoding genes after divergence of A. thaliana and the Brassica lineage. These results together with expression pattern analysis of NBS-encoding orthologous genes provide useful resource for functional characterization of these genes and genetic improvement of relevant crops.
Exo-oligosaccharides of Rhizobium sp. strain NGR234 are required for symbiosis with various legumes.
Staehelin, Christian; Forsberg, Lennart S; D'Haeze, Wim; Gao, Mu-Yun; Carlson, Russell W; Xie, Zhi-Ping; Pellock, Brett J; Jones, Kathryn M; Walker, Graham C; Streit, Wolfgang R; Broughton, William J
2006-09-01
Rhizobia are nitrogen-fixing bacteria that establish endosymbiotic associations with legumes. Nodule formation depends on various bacterial carbohydrates, including lipopolysaccharides, K-antigens, and exopolysaccharides (EPS). An acidic EPS from Rhizobium sp. strain NGR234 consists of glucosyl (Glc), galactosyl (Gal), glucuronosyl (GlcA), and 4,6-pyruvylated galactosyl (PvGal) residues with beta-1,3, beta-1,4, beta-1,6, alpha-1,3, and alpha-1,4 glycoside linkages. Here we examined the role of NGR234 genes in the synthesis of EPS. Deletions within the exoF, exoL, exoP, exoQ, and exoY genes suppressed accumulation of EPS in bacterial supernatants, a finding that was confirmed by chemical analyses. The data suggest that the repeating subunits of EPS are assembled by an ExoQ/ExoP/ExoF-dependent mechanism, which is related to the Wzy polymerization system of group 1 capsular polysaccharides in Escherichia coli. Mutation of exoK (NGROmegaexoK), which encodes a putative glycanase, resulted in the absence of low-molecular-weight forms of EPS. Analysis of the extracellular carbohydrates revealed that NGROmegaexoK is unable to accumulate exo-oligosaccharides (EOSs), which are O-acetylated nonasaccharide subunits of EPS having the formula Gal(Glc)5(GlcA)2PvGal. When used as inoculants, both the exo-deficient mutants and NGROmegaexoK were unable to form nitrogen-fixing nodules on some hosts (e.g., Albizia lebbeck and Leucaena leucocephala), but they were able to form nitrogen-fixing nodules on other hosts (e.g., Vigna unguiculata). EOSs of the parent strain were biologically active at very low levels (yield in culture supernatants, approximately 50 microg per liter). Thus, NGR234 produces symbiotically active EOSs by enzymatic degradation of EPS, using the extracellular endo-beta-1,4-glycanase encoded by exoK (glycoside hydrolase family 16). We propose that the derived EOSs (and not EPS) are bacterial components that play a crucial role in nodule formation in various legumes.
Modulators of the extracellular matrix and risk of anterior cruciate ligament ruptures.
Rahim, Masouda; Mannion, Sasha; Klug, Blake; Hobbs, Hayden; van der Merwe, Willem; Posthumus, Michael; Collins, Malcolm; September, Alison V
2017-02-01
The extracellular matrix (ECM) of ligaments continuously undergoes remodelling in order to maintain tissue homeostasis. Several key mediators of ECM remodelling were chosen for investigation in the present study. It is thought that polymorphisms within genes encoding signalling molecules may contribute to inter-individual variation in the responses to mechanical loading, potentially altering risk of injury. A genetic association study was conducted on 232 asymptomatic controls (CON) and 234 participants with surgically diagnosed anterior cruciate ligament (ACL) ruptures; of which 135 participants reported a non-contact mechanism of injury (NON subgroup). All participants were genotyped for ten variants in eight genes encoding ECM remodelling proteins. Haplotypes and allele combinations were also inferred. The CASP8 rs3834129 ins allele was significantly over-represented in the male CON group compared to the male NON subgroup (p=0.047, OR: 1.46, 95% CI: 1.01-2.12). In female participants, the IL1B rs16944 TT genotype was significantly under-represented in the CON group compared to the NON subgroup (p=0.039, OR: 3.06, 95% CI: 1.09-8.64). Haplotype analysis revealed an under-representation of the CASP8 rs3834129-rs1045485 del-G haplotype in the CON group compared to both the ACL group (p=0.042; haplo.score:2.03) and the NON subgroup (p=0.037; haplo.score:2.09). Furthermore, following a pathway-based approach, genetic variants involved in the cell signalling cascade were associated with ACL injury risk. The novel independent associations and allele combinations observed implicate the apoptosis and cell signalling cascades as potential contributors to ACL injury susceptibility. Furthermore, these genetic variants may potentially modulate ECM remodelling in response to loading and ultimately contribute to ligament capacity. Copyright © 2016 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Exploiting algal NADPH oxidase for biophotovoltaic energy
Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...
2015-01-29
Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less
Vongsangnak, Wanwipa; Raethong, Nachon; Mujchariyakul, Warasinee; Nguyen, Nam Ninh; Leong, Hon Wai; Laoteng, Kobkul
2017-08-30
The first genome-scale metabolic network of Cordyceps militaris (iWV1170) was constructed representing its whole metabolisms, which consisted of 894 metabolites and 1,267 metabolic reactions across five compartments, including the plasma membrane, cytoplasm, mitochondria, peroxisome and extracellular space. The iWV1170 could be exploited to explain its phenotypes of growth ability, cordycepin and other metabolites production on various substrates. A high number of genes encoding extracellular enzymes for degradation of complex carbohydrates, lipids and proteins were existed in C. militaris genome. By comparative genome-scale analysis, the adenine metabolic pathway towards putative cordycepin biosynthesis was reconstructed, indicating their evolutionary relationships across eleven species of entomopathogenic fungi. The overall metabolic routes involved in the putative cordycepin biosynthesis were also identified in C. militaris, including central carbon metabolism, amino acid metabolism (glycine, l-glutamine and l-aspartate) and nucleotide metabolism (adenosine and adenine). Interestingly, a lack of the sequence coding for ribonucleotide reductase inhibitor was observed in C. militaris that might contribute to its over-production of cordycepin. Copyright © 2017. Published by Elsevier B.V.
Fernández, Ignacio; Darias, Maria; Andree, Karl B; Mazurais, David; Zambonino-Infante, Jose Luís; Gisbert, Enric
2011-02-09
Vitamin A (VA) has a key role in vertebrate morphogenesis, determining body patterning and growth through the control of cell proliferation and differentiation processes. VA regulates primary molecular pathways of those processes by the binding of its active metabolite (retinoic acid) to two types of specific nuclear receptors: retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which promote transcription of downstream target genes. This process is well known in most of higher vertebrates; however, scarce information is available regarding fishes. Therefore, in order to gain further knowledge of fish larval development and its disruption by nutritional VA imbalance, the relative expression of some RARs and RXRs, as well as several genes involved in morpho- and skeletogenesis such as peroxisome proliferator-activated receptors (PPARA, PPARB and PPARG); retinol-binding protein (RBP); insulin-like growth factors I and II (IGF1 and IGF2, respectively); bone morphogenetic protein 2 (Bmp2); transforming growth factor β-1 (TGFB1); and genes encoding different extracellular matrix (ECM) proteins such as matrix Gla protein (mgp), osteocalcin (bglap), osteopontin (SPP1), secreted protein acidic and rich in cysteine (SPARC) and type I collagen α1 chain (COL1A1) have been studied in gilthead sea bream. During gilthead sea bream larval development, specific expression profiles for each gene were tightly regulated during fish morphogenesis and correlated with specific morphogenetic events and tissue development. Dietary hypervitaminosis A during early larval development disrupted the normal gene expression profile for genes involved in RA signalling (RARA), VA homeostasis (RBP) and several genes encoding ECM proteins that are linked to skeletogenesis, such as bglap and mgp. Present data reflects the specific gene expression patterns of several genes involved in larval fish RA signalling and skeletogenesis; and how specific gene disruption induced by a nutritional VA imbalance underlie the skeletal deformities. Our results are of basic interest for fish VA signalling and point out some of the potential molecular players involved in fish skeletogenesis. Increased incidences of skeletal deformities in gilthead sea bream fed with hypervitaminosis A were the likely ultimate consequence of specific gene expression disruption at critical development stages.
2011-01-01
Background Vitamin A (VA) has a key role in vertebrate morphogenesis, determining body patterning and growth through the control of cell proliferation and differentiation processes. VA regulates primary molecular pathways of those processes by the binding of its active metabolite (retinoic acid) to two types of specific nuclear receptors: retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which promote transcription of downstream target genes. This process is well known in most of higher vertebrates; however, scarce information is available regarding fishes. Therefore, in order to gain further knowledge of fish larval development and its disruption by nutritional VA imbalance, the relative expression of some RARs and RXRs, as well as several genes involved in morpho- and skeletogenesis such as peroxisome proliferator-activated receptors (PPARA, PPARB and PPARG); retinol-binding protein (RBP); insulin-like growth factors I and II (IGF1 and IGF2, respectively); bone morphogenetic protein 2 (Bmp2); transforming growth factor β-1 (TGFB1); and genes encoding different extracellular matrix (ECM) proteins such as matrix Gla protein (mgp), osteocalcin (bglap), osteopontin (SPP1), secreted protein acidic and rich in cysteine (SPARC) and type I collagen α1 chain (COL1A1) have been studied in gilthead sea bream. Results During gilthead sea bream larval development, specific expression profiles for each gene were tightly regulated during fish morphogenesis and correlated with specific morphogenetic events and tissue development. Dietary hypervitaminosis A during early larval development disrupted the normal gene expression profile for genes involved in RA signalling (RARA), VA homeostasis (RBP) and several genes encoding ECM proteins that are linked to skeletogenesis, such as bglap and mgp. Conclusions Present data reflects the specific gene expression patterns of several genes involved in larval fish RA signalling and skeletogenesis; and how specific gene disruption induced by a nutritional VA imbalance underlie the skeletal deformities. Our results are of basic interest for fish VA signalling and point out some of the potential molecular players involved in fish skeletogenesis. Increased incidences of skeletal deformities in gilthead sea bream fed with hypervitaminosis A were the likely ultimate consequence of specific gene expression disruption at critical development stages. PMID:21306609
Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing
2009-03-11
Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene-encoded proteins are attached to the core at more peripheral positions of the networks.
Yassin, Atteyet F; Langenberg, Stefan; Huntemann, Marcel; Clum, Alicia; Pillay, Manoj; Palaniappan, Krishnaveni; Varghese, Neha; Mikhailova, Natalia; Mukherjee, Supratim; Reddy, T B K; Daum, Chris; Shapiro, Nicole; Ivanova, Natalia; Woyke, Tanja; Kyrpides, Nikos C
2017-01-01
The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA) pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS) were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM) systems, type II toxin-antitoxin (TA), CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA) and topisomerase IV (ParC) enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH-flavin oxidoreductase.
Klaubauf, Sylvia; Narang, Hari Mander; Post, Harm; Zhou, Miaomiao; Brunner, Kurt; Mach-Aigner, Astrid R; Mach, Robert L; Heck, Albert J R; Altelaar, A F Maarten; de Vries, Ronald P
2014-11-01
The transcriptional activator XlnR (Xlr1/Xyr1) is a major regulator in fungal xylan and cellulose degradation as well as in the utilization of d-xylose via the pentose catabolic pathway. XlnR homologs are commonly found in filamentous ascomycetes and often assumed to have the same function in different fungi. However, a comparison of the saprobe Aspergillus niger and the plant pathogen Magnaporthe oryzae showed different phenotypes for deletion strains of XlnR. In this study wild type and xlnR/xlr1/xyr1 mutants of five fungi were compared: Fusarium graminearum, M. oryzae, Trichoderma reesei, A. niger and Aspergillus nidulans. Growth profiling on relevant substrates and a detailed analysis of the secretome as well as extracellular enzyme activities demonstrated a common role of this regulator in activating genes encoding the main xylanolytic enzymes. However, large differences were found in the set of genes that is controlled by XlnR in the different species, resulting in the production of different extracellular enzyme spectra by these fungi. This comparison emphasizes the functional diversity of a fine-tuned (hemi-)cellulolytic regulatory system in filamentous fungi, which might be related to the adaptation of fungi to their specific biotopes. Data are available via ProteomeXchange with identifier PXD001190. Copyright © 2014 Elsevier Inc. All rights reserved.
Mechanism of abnormal growth in astrocytes derived from a mouse model of GM2 gangliosidosis.
Kawashima, Nagako; Tsuji, Daisuke; Okuda, Tetsuya; Itoh, Kohji; Nakayama, Ken-ichi
2009-11-01
Sandhoff disease is a progressive neurodegenerative disorder caused by mutations in the HEXB gene which encodes the beta-subunit of N-acetyl-beta-hexosaminidase A and B, resulting in the accumulation of the ganglioside GM2. We isolated astrocytes from the neonatal brain of Sandhoff disease model mice in which the N-acetyl-beta-hexosaminidase beta-subunit gene is genetically disrupted (ASD). Glycolipid profiles revealed that GM2/GA2 accumulated in the lysosomes and not on the cell surface of ASD astrocytes. In addition, GM3 was increased on the cell surface. We found remarkable differences in the cell proliferation of ASD astrocytes when compared with cells isolated from wild-type mice, with a faster growth rate of ASD cells. In addition, we observed increased extracellular, signal-regulated kinase (ERK) phosphorylation in ASD cells, but Akt phosphorylation was decreased. Furthermore, the phosphorylation of ERK in ASD cells was not dependent upon extracellular growth factors. Treatment of ASD astrocytes with recombinant N-acetyl-beta-hexosaminidase A resulted in a decrease of their growth rate and ERK phosphorylation. These results indicated that the up-regulation of ERK phosphorylation and the increase in proliferation of ASD astrocytes were dependent upon GM2/GA2 accumulation. These findings may represent a mechanism in linking the nerve cell death and reactive gliosis observed in Sandhoff disease.
Johnson, Linda J.; Koulman, Albert; Christensen, Michael; Lane, Geoffrey A.; Fraser, Karl; Forester, Natasha; Johnson, Richard D.; Bryan, Gregory T.; Rasmussen, Susanne
2013-01-01
We have identified from the mutualistic grass endophyte Epichloë festucae a non-ribosomal peptide synthetase gene (sidN) encoding a siderophore synthetase. The enzymatic product of SidN is shown to be a novel extracellular siderophore designated as epichloënin A, related to ferrirubin from the ferrichrome family. Targeted gene disruption of sidN eliminated biosynthesis of epichloënin A in vitro and in planta. During iron-depleted axenic growth, ΔsidN mutants accumulated the pathway intermediate N5-trans-anhydromevalonyl-N5-hydroxyornithine (trans-AMHO), displayed sensitivity to oxidative stress and showed deficiencies in both polarized hyphal growth and sporulation. Infection of Lolium perenne (perennial ryegrass) with ΔsidN mutants resulted in perturbations of the endophyte-grass symbioses. Deviations from the characteristic tightly regulated synchronous growth of the fungus with its plant partner were observed and infected plants were stunted. Analysis of these plants by light and transmission electron microscopy revealed abnormalities in the distribution and localization of ΔsidN mutant hyphae as well as deformities in hyphal ultrastructure. We hypothesize that lack of epichloënin A alters iron homeostasis of the symbiotum, changing it from mutually beneficial to antagonistic. Iron itself or epichloënin A may serve as an important molecular/cellular signal for controlling fungal growth and hence the symbiotic interaction. PMID:23658520
Lu, Xunli; Dittgen, Jan; Piślewska-Bednarek, Mariola; Molina, Antonio; Schneider, Bernd; Doubský, Jan; Schneeberger, Korbinian; Schulze-Lefert, Paul
2015-01-01
Arabidopsis (Arabidopsis thaliana) PENETRATION (PEN) genes quantitatively contribute to the execution of different forms of plant immunity upon challenge with diverse leaf pathogens. PEN3 encodes a plasma membrane-resident pleiotropic drug resistance-type ATP-binding cassette transporter and is thought to act in a pathogen-inducible and PEN2 myrosinase-dependent metabolic pathway in extracellular defense. This metabolic pathway directs the intracellular biosynthesis and activation of tryptophan-derived indole glucosinolates for subsequent PEN3-mediated efflux across the plasma membrane at pathogen contact sites. However, PEN3 also functions in abiotic stress responses to cadmium and indole-3-butyric acid (IBA)-mediated auxin homeostasis in roots, raising the possibility that PEN3 exports multiple functionally unrelated substrates. Here, we describe the isolation of a pen3 allele, designated pen3-5, that encodes a dysfunctional protein that accumulates in planta like wild-type PEN3. The specific mutation in pen3-5 uncouples PEN3 functions in IBA-stimulated root growth modulation, callose deposition induced with a conserved peptide epitope of bacterial flagellin (flg22), and pathogen-inducible salicylic acid accumulation from PEN3 activity in extracellular defense, indicating the engagement of multiple PEN3 substrates in different PEN3-dependent biological processes. We identified 4-O-β-d-glucosyl-indol-3-yl formamide (4OGlcI3F) as a pathogen-inducible, tryptophan-derived compound that overaccumulates in pen3 leaf tissue and has biosynthesis that is dependent on an intact PEN2 metabolic pathway. We propose that a precursor of 4OGlcI3F is the PEN3 substrate in extracellular pathogen defense. These precursors, the shared indole core present in IBA and 4OGlcI3F, and allele-specific uncoupling of a subset of PEN3 functions suggest that PEN3 transports distinct indole-type metabolites in distinct biological processes. PMID:26023163
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Juan; Wang, Zheming; Belchik, Sara M.
The Gram-negative bacterium Sideroxydans lithotrophicus ES-1 (ES-1) grows on FeCO{sub 3} or FeS at oxic-anoxic interfaces at circumneutral pH, and the ES-1-mediated Fe(II) oxidation occurs extracellularly. However, the molecular mechanisms underlying ES-1's ability to oxidize Fe(II) remain unknown. Survey of the ES-1 genome for the genes known for microbial extracellular Fe(II) oxidation revealed that it contained a three-gene cluster encoding an MtrA homologue, an MtrB homologue and a CymA homologue. The homologues of MtrA, MtrB and/or CymA were previously shown to be involved in extracellular Fe(II) oxidation by Rhodopseudomonas palustris TIE-1 and in extracellular Fe(III) reduction by Shewanella oneidensis MR-1more » (MR-1). To distinguish them from those found in MR-1, the identified homologues were named MtoAB and CymA{sub ES-1}, respectively. The gene for MtoA was cloned, and cloned mtoA partially complemented an MR-1 mutant without MtrA in ferrihydrite reduction. Following overexpression in MR-1 cells, recombinant MtoA was purified. Characterization of purified MtoA showed that it was a decaheme c-type cytochrome and oxidized soluble Fe(II). Oxidation of Fe(II) by MtoA was pH- and Fe(II)-complexing ligand-dependent. Under conditions tested, MtoA oxidized Fe(II) at pH ranging from 7-9, and optimal oxidation occurred at pH 9, possibly because of the attendant net increase of [Fe(OH){sup +}] at higher pH. MtoA oxidized Fe(II) complexed with different ligands at different rates. The reaction rates followed the order Fe(II)Cl2 > Fe(II)-citrate > Fe(III)-NTA > Fe(II)-EDTA with the second-order rate constants ranging from 5.5 x 10{sup -3} {micro}M{sup -1}s{sup -1} for oxidation of Fe(II)Cl{sub 2} to 1.0 x 10{sup -3} {micro}M{sup -1}s{sup -1} for oxidation of Fe(II)-EDTA. Thermodynamic modeling shows that redox reaction rate differences for the different Fe(II)-complexes correlated with estimated reaction-free energies. Collectively, these results suggest that MtoA is a functional Fe(II)-oxidizing protein that, by working in concert with MtoB and CymAES 1, may oxidize the Fe(II) on the bacterial surface and transfer released electrons across the bacterial cell envelope to the quinone pool in the inner membrane during extracellular Fe(II) oxidation by ES-1.« less
Sumby, Paul; Barbian, Kent D; Gardner, Donald J; Whitney, Adeline R; Welty, Diane M; Long, R Daniel; Bailey, John R; Parnell, Michael J; Hoe, Nancy P; Adams, Gerald G; Deleo, Frank R; Musser, James M
2005-02-01
Many pathogenic bacteria produce extracellular DNase, but the benefit of this enzymatic activity is not understood. For example, all strains of the human bacterial pathogen group A Streptococcus (GAS) produce at least one extracellular DNase, and most strains make several distinct enzymes. Despite six decades of study, it is not known whether production of DNase by GAS enhances virulence. To test the hypothesis that extracellular DNase is required for normal progression of GAS infection, we generated seven isogenic mutant strains in which the three chromosomal- and prophage-encoded DNases made by a contemporary serotype M1 GAS strain were inactivated. Compared to the wild-type parental strain, the isogenic triple-mutant strain was significantly less virulent in two mouse models of invasive infection. The triple-mutant strain was cleared from the skin injection site significantly faster than the wild-type strain. Preferential clearance of the mutant strain was related to the differential extracellular killing of the mutant and wild-type strains, possibly through degradation of neutrophil extracellular traps, innate immune structures composed of chromatin and granule proteins. The triple-mutant strain was also significantly compromised in its ability to cause experimental pharyngeal disease in cynomolgus macaques. Comparative analysis of the seven DNase mutant strains strongly suggested that the prophage-encoded SdaD2 enzyme is the major DNase that contributes to virulence in this clone. We conclude that extracellular DNase activity made by GAS contributes to disease progression, thereby resolving a long-standing question in bacterial pathogenesis research.
Yan, Qing; Hu, Xiufang; Wang, Nian
2012-10-01
Lipopolysaccharide (LPS) is an important virulence factor of Xanthomonas citri ssp. citri, the causative agent of citrus canker disease. In this research, a novel gene, designated as nlxA (novel LPS cluster gene of X. citri ssp. citri), in the LPS cluster of X. citri ssp. citri 306, was characterized. Our results indicate that nlxA is required for O-polysaccharide biosynthesis by encoding a putative rhamnosyltransferase. This is supported by several lines of evidence: (i) NlxA shares 40.14% identity with WsaF, which acts as a rhamnosyltransferase; (ii) sodium dodecylsulphate-polyacrylamide gel electrophoresis analysis showed that four bands of the O-antigen part of LPS were missing in the LPS production of the nlxA mutant; this is also consistent with a previous report that the O-antigen moiety of LPS of X. citri ssp. citri is composed of a rhamnose homo-oligosaccharide; (iii) mutation of nlxA resulted in a significant reduction in the resistance of X. citri ssp. citri to different stresses, including sodium dodecylsulphate, polymyxin B, H(2)O(2), phenol, CuSO(4) and ZnSO(4). In addition, our results indicate that nlxA plays an important role in extracellular polysaccharide production, biofilm formation, stress resistance, motility on semi-solid plates, virulence and in planta growth in the host plant grapefruit. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.
Microbe–microbe interactions trigger Mn(II)-oxidizing gene expression
Liang, Jinsong; Bai, Yaohui; Men, Yujie; Qu, Jiuhui
2017-01-01
Manganese (Mn) is an important metal in geochemical cycles. Some microorganisms can oxidize Mn(II) to Mn oxides, which can, in turn, affect the global cycles of other elements by strong sorption and oxidation effects. Microbe–microbe interactions have important roles in a number of biological processes. However, how microbial interactions affect Mn(II) oxidation still remains unknown. Here, we investigated the interactions between two bacteria (Arthrobacter sp. and Sphingopyxis sp.) in a co-culture, which exhibited Mn(II)-oxidizing activity, although neither were able to oxidize Mn(II) in isolation. We demonstrated that the Mn(II)-oxidizing activity in co-culture was most likely induced via contact-dependent interactions. The expressed Mn(II)-oxidizing protein in the co-culture was purified and identified as a bilirubin oxidase belonging to strain Arthrobacter. Full sequencing of the bilirubin oxidase-encoding gene (boxA) was performed. The Mn(II)-oxidizing protein and the transcripts of boxA were detected in the co-culture, but not in either of the isolated cultures. This indicate that boxA was silent in Arthrobacter monoculture, and was activated in response to presence of Sphingopyxis in the co-culture. Further, transcriptomic analysis by RNA-Seq, extracellular superoxide detection and cell density quantification by flow cytometry indicate induction of boxA gene expression in Arthrobacter was co-incident with a stress response triggered by co-cultivation with Sphingopyxis. Our findings suggest the potential roles of microbial physiological responses to stress induced by other microbes in Mn(II) oxidation and extracellular superoxide production. PMID:27518809
Pathogenic and host range determinants of the feline aplastic anemia retrovirus.
Riedel, N; Hoover, E A; Dornsife, R E; Mullins, J I
1988-01-01
Feline leukemia virus (FeLV) C-Sarma (or FSC) is a prototype of subgroup C FeLVs, which induce fatal aplastic anemia in outbred specific-pathogen-free (SPF) cats. FeLV C isolates also possess an extended host range in vitro, including an ability, unique among FeLVs, to replicate in guinea pig cells. To identify the viral determinants responsible for the pathogenicity and host range of FSC we constructed a series of proviral DNAs by exchanging gene fragments between FSC and FeLV-61E (or F6A), the latter of which is minimally pathogenic and whose host range in vitro is restricted to feline cells. Transfer of an 886-base-pair (bp) fragment of FSC, encompassing the codons for 73 amino acids at the 3' end of pol (the integrase/endonuclease gene) and the codons for 241 amino acids of the N-terminal portion of env [the extracellular glycoprotein (gp70) gene], into the F6A genome was sufficient to confer onto chimeric viruses the ability to induce fatal aplastic anemia in SPF cats. In contrast, no chimera lacking this sequence induced disease. When assayed in vitro, all chimeric viruses containing the 886-bp fragment of FSC acquired the ability to replicate in heterologous cells, including dog and guinea pig cells. Thus, the pathogenic and the host range determinants of the feline aplastic anemia retrovirus colocalize to a 3' pol-5' env region of the FSC genome and likely reside within a region encoding 241 amino acid residues of the N terminus of the extracellular glycoprotein. Images PMID:2833751
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Organization of the murine Cd22 locus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Law, Che-Leung; Torres, R.M.; Sundeberg, H.A.
1993-07-01
Murine CD22 (mCD22) is a B cell-associated adhesion protein with seven extracellular Ig-like domains that has 62% amino acid identify to its human homologue. Southern analysis on genomic DNA isolated from tissues and cell lines from several mouse strains using mCD22 cDNA demonstrated that the Cd22 locus encoding mCD22 is a single copy gene of [le]30 kb. Digestion of genomic DNA preparations with four restriction endonucleases revealed the presence of restriction fragment length polymorphisms (RFLP) in BALB/c, C57BL/6, and C3H strains vs DBA/2j, NZB, and NZC strains, suggesting the presence of two or more Cd22 alleles. Using a mCD22 cDNAmore » clone derived from the BALB/c strain, the authors isolated genomic clones from a DBA/2 genomic library that contained all the exons necessary to encode the full length mCD22 cDNA. Fifteen exons, including exon 3 that encodes the translation start codon, were identified. Each extracellular Ig-like domain of mCD22 is encoded by a single exon. A comparison between the nucleotide sequences of the BALB/c CD22 cDNA and the exons of the DBA/2j CD22 genomic clones revealed an 18-nucleotide deletion in exon 4 (encoding the most distal Ig-like domain 1 of mCD22) of the DBA/2j genomic sequence in addition to a number of substitutions, insertions, and deletions in other exons. These nucleotide differences were also present in a cDNA clone isolated from total RNA of LPS-activated DBA/2j splenocytes mosome 7, a region sytenic to human chromosome 19q, close to the previously reported loci, Lyb-8 and Mag (a homologue of Cd22). An antibody (CY34) against the Lyb-8.2 B cell marker reacted with a BHK transfectant expressing the full length mCd22 cDNA, thus demonstrating that Lyb-8 and Cd22 loci are identical. Furthermore, a rat anti-mCD22 mAb, NIM-R6, bound to slgM[sup +] DBA/2j B cells, confirming the expression of a CD22 protein by the Cd22[sup a]/lyb-8[sup a] allele. 63 refs., 7 figs., 1 tab.« less
Suárez-Vega, Aroa; Gutiérrez-Gil, Beatriz; Klopp, Christophe; Robert-Granie, Christèle; Tosser-Klopp, Gwenola; Arranz, Juan José
2015-12-18
This study presents a dynamic characterization of the sheep milk transcriptome aiming at achieving a better understanding of the sheep lactating mammary gland. Transcriptome sequencing (RNA-seq) was performed on total RNA extracted from milk somatic cells from ewes on days 10, 50, 120 and 150 after lambing. The experiment was performed in Spanish Churra and Assaf breeds, which differ in their milk production traits. Nearly 67% of the annotated genes in the reference genome (Oar_v3.1) were expressed in ovine milk somatic cells. For the two breeds and across the four lactation stages studied, the most highly expressed genes encoded caseins and whey proteins. We detected 573 differentially expressed genes (DEGs) across lactation points, with the largest differences being found, between day 10 and day 150. Upregulated GO terms at late lactation stages were linked mainly to developmental processes linked to extracellular matrix remodeling. A total of 256 annotated DEGs were detected in the Assaf and Churra comparison. Some genes selectively upregulated in the Churra breed grouped under the endopeptidase and channel activity GO terms. These genes could be related to the higher cheese yield of this breed. Overall, this study provides the first integrated overview on sheep milk gene expression.
Suárez-Vega, Aroa; Gutiérrez-Gil, Beatriz; Klopp, Christophe; Robert-Granie, Christèle; Tosser-Klopp, Gwenola; Arranz, Juan José
2015-01-01
This study presents a dynamic characterization of the sheep milk transcriptome aiming at achieving a better understanding of the sheep lactating mammary gland. Transcriptome sequencing (RNA-seq) was performed on total RNA extracted from milk somatic cells from ewes on days 10, 50, 120 and 150 after lambing. The experiment was performed in Spanish Churra and Assaf breeds, which differ in their milk production traits. Nearly 67% of the annotated genes in the reference genome (Oar_v3.1) were expressed in ovine milk somatic cells. For the two breeds and across the four lactation stages studied, the most highly expressed genes encoded caseins and whey proteins. We detected 573 differentially expressed genes (DEGs) across lactation points, with the largest differences being found, between day 10 and day 150. Upregulated GO terms at late lactation stages were linked mainly to developmental processes linked to extracellular matrix remodeling. A total of 256 annotated DEGs were detected in the Assaf and Churra comparison. Some genes selectively upregulated in the Churra breed grouped under the endopeptidase and channel activity GO terms. These genes could be related to the higher cheese yield of this breed. Overall, this study provides the first integrated overview on sheep milk gene expression. PMID:26677795
Gene Expression Profiling of Soft and Firm Atlantic Salmon Fillet
Larsson, Thomas; Mørkøre, Turid; Kolstad, Kari; Østbye, Tone-Kari; Afanasyev, Sergey; Krasnov, Aleksei
2012-01-01
Texture of salmon fillets is an important quality trait for consumer acceptance as well as for the suitability for processing. In the present work we measured fillet firmness in a population of farmed Atlantic salmon with known pedigree and investigated the relationship between this trait and gene expression. Transcriptomic analyses performed with a 21 K oligonucleotide microarray revealed strong correlations between firmness and a large number of genes. Highly similar expression profiles were observed in several functional groups. Positive regression was found between firmness and genes encoding proteasome components (41 genes) and mitochondrial proteins (129 genes), proteins involved in stress responses (12 genes), and lipid metabolism (30 genes). Coefficients of determination (R2) were in the range of 0.64–0.74. A weaker though highly significant negative regression was seen in sugar metabolism (26 genes, R2 = 0.66) and myofiber proteins (42 genes, R2 = 0.54). Among individual genes that showed a strong association with firmness, there were extracellular matrix proteins (negative correlation), immune genes, and intracellular proteases (positive correlation). Several genes can be regarded as candidate markers of flesh quality (coiled-coil transcriptional coactivator b, AMP deaminase 3, and oligopeptide transporter 15) though their functional roles are unclear. To conclude, fillet firmness of Atlantic salmon depends largely on metabolic properties of the skeletal muscle; where aerobic metabolism using lipids as fuel, and the rapid removal of damaged proteins, appear to play a major role. PMID:22745718
Gene expression profiling of soft and firm Atlantic salmon fillet.
Larsson, Thomas; Mørkøre, Turid; Kolstad, Kari; Østbye, Tone-Kari; Afanasyev, Sergey; Krasnov, Aleksei
2012-01-01
Texture of salmon fillets is an important quality trait for consumer acceptance as well as for the suitability for processing. In the present work we measured fillet firmness in a population of farmed Atlantic salmon with known pedigree and investigated the relationship between this trait and gene expression. Transcriptomic analyses performed with a 21 K oligonucleotide microarray revealed strong correlations between firmness and a large number of genes. Highly similar expression profiles were observed in several functional groups. Positive regression was found between firmness and genes encoding proteasome components (41 genes) and mitochondrial proteins (129 genes), proteins involved in stress responses (12 genes), and lipid metabolism (30 genes). Coefficients of determination (R(2)) were in the range of 0.64-0.74. A weaker though highly significant negative regression was seen in sugar metabolism (26 genes, R(2) = 0.66) and myofiber proteins (42 genes, R(2) = 0.54). Among individual genes that showed a strong association with firmness, there were extracellular matrix proteins (negative correlation), immune genes, and intracellular proteases (positive correlation). Several genes can be regarded as candidate markers of flesh quality (coiled-coil transcriptional coactivator b, AMP deaminase 3, and oligopeptide transporter 15) though their functional roles are unclear. To conclude, fillet firmness of Atlantic salmon depends largely on metabolic properties of the skeletal muscle; where aerobic metabolism using lipids as fuel, and the rapid removal of damaged proteins, appear to play a major role.
Mikus, Marianna; Hatvani, Lóránt; Neuhof, Torsten; Komoń-Zelazowska, Monika; Dieckmann, Ralf; Schwecke, Torsten; Druzhinina, Irina S.; von Döhren, Hans; Kubicek, Christian P.
2009-01-01
Hydrophobins are small extracellular proteins, unique to and ubiquitous in filamentous fungi, which mediate interactions between the fungus and environment. The mycoparasitic fungus Hypocrea atroviridis has recently been shown to possess 10 different class II hydrophobin genes, which is a much higher number than that of any other ascomycete investigated so far. In order to learn the potential advantage of this hydrophobin multiplicity for the fungus, we have investigated their expression patterns under different physiological conditions (e.g., vegetative growth), various conditions inducing sporulation (light, carbon starvation, and mechanical injury-induced stress), and confrontation with potential hosts for mycoparasitism. The results show that the 10 hydrophobins display different patterns of response to these conditions: one hydrophobin (encoded by hfb-2b) is constitutively induced under all conditions, whereas other hydrophobins were formed only under conditions of carbon starvation (encoded by hfb-1c and hfb-6c) or light plus carbon starvation (encoded by hfb-2c, hfb-6a, and hfb-6b). The hydrophobins encoded by hfb-1b and hfb-5a were primarily formed during vegetative growth and under mechanical injury-provoked stress. hfb-22a was not expressed under any conditions and is likely a pseudogene. None of the 10 genes showed a specific expression pattern during mycoparasitic interaction. Most, but not all, of the expression patterns under the three different conditions of sporulation were dependent on one or both of the two blue-light regulator proteins BLR1 and BLR2, as shown by the use of respective loss-of-function mutants. Matrix-assisted laser desorption ionization-time of flight mass spectrometry of mycelial solvent extracts provided sets of molecular ions corresponding to HFB-1b, HFB-2a, HFB-2b, and HFB-5a in their oxidized and processed forms. These in silico-deduced sequences of the hydrophobins indicate cleavages at known signal peptide sites as well as additional N- and C-terminal processing. Mass peaks observed during confrontation with plant-pathogenic fungi indicate further proteolytic attack on the hydrophobins. Our study illustrates both divergent and redundant functions of the 10 hydrophobins of H. atroviridis. PMID:19329667
Watts, Thomas D; Johanesen, Priscilla A; Lyras, Dena; Rood, Julian I; Adams, Vicki
2017-05-01
Clostridium perfringens produces an extensive repertoire of toxins and extracellular enzymes, many of which are intimately involved in the progression of disease and are encoded by genes on conjugative plasmids. In addition, many C. perfringens strains can carry up to five of these conjugative toxin or antimicrobial resistance plasmids, each of which has a similar 35kb backbone. This conserved backbone includes the tcp conjugation locus and the central control region (CCR), which encodes genes involved in plasmid regulation, replication and partitioning, including a parMRC partitioning locus. Most conjugative plasmids in C. perfringens have a conserved replication protein, raising questions as to how multiple, closely related plasmids are maintained within a single strain. Bioinformatics analysis has highlighted the presence of at least 10 different parMRC partitioning system families (parMRC A-J ) in these plasmids, with differences in amino acid sequence identity between each ParM family ranging from 15% to 54%. No two plasmids that encode genes belonging to the same partitioning family have been observed in a single strain, suggesting that these families represent the basis for plasmid incompatibility. In an attempt to validate the proposed parMRC incompatibility groups, genetically marked C. perfringens plasmids encoding identical parMRC C or parMRC D homologues or different combinations of parMRC A , parMRC C and parMRC D family homologues were introduced into a single strain via conjugation. The stability of each plasmid was determined using an incompatibility assay in which the plasmid profile of each strain was monitored over the course of two days in the absence of direct selection. The results showed that plasmids with identical parMRC C or parMRC D homologues were incompatible and could not coexist in the absence of external selection. By contrast, plasmids that encoded different parMRC homologues were compatible and could coexist in the same cell in the absence of selection, with the exception of strains housing parMRC C and parMRC D combinations, which showed a minor incompatibility phenotype. In conclusion, we have provided the first direct evidence of plasmid incompatibility in Clostridium spp. and have shown experimentally that the compatibility of conjugative C. perfringens plasmids correlates with the presence of parMRC-like partitioning systems of different phylogenetic subfamilies. Copyright © 2017 Elsevier Inc. All rights reserved.
Ma, Ran Jing; Wang, Yan Hong; Liu, Lu; Bai, Lei Lei; Ban, Rui
2018-02-01
Lipases are among the most versatile biocatalysts, and are used in a range of industrially relevant bioconversion reactions. However, the production of LipA in recombinant Bacillus subtilis is still limited, due to unresolved issues surrounding the regulation of the expression and secretion systems. In this study, the gene encoding LipA from B. subtilis 168 was expressed in BNA under the control of the P 43 and the P AE promoter. The extracellular lipase activity of the resulting strains BNACL and BNAAL was 7.8 U ml -1 and 12.6 U ml -1 , respectively. To further enhance the expression of LipA, pHP13L was constructed by inserting the P AE -lip into the shuttle vector pHP13, which produced an extracellular lipase activity of 180.5 U ml -1 of BNA/pHP13L. The strain BNAY8 described in Supplement data which lacks eight extracellular proteins was constructed and the deletion a few of the much weaker secreting proteins had no significant effect on the secretion of LipA. Moreover, the four Sec pathway components, secA-prfB, secDF, secYEG, prsA, were individually overexpressed in BNA. The overexpression of secDF and prsA enhanced the production of LipA by 28% and 49%, respectively. Furthermore, the co-overexpression of secDF with prsA improved the extracellular amount of LipA by 59% over that of BNA/pHP13L, reaching 287.8 U ml -1 . It can therefore be said that both regulatory elements and secretion pathway had an impact on the production of secreted LipA. Their optimization and modification is a useful strategy to improve the homologous overproduction of other extracellular proteins in B. subtilis. Copyright © 2017. Published by Elsevier Inc.
Woo, Yong H; Ansari, Hifzur; Otto, Thomas D; Klinger, Christen M; Kolisko, Martin; Michálek, Jan; Saxena, Alka; Shanmugam, Dhanasekaran; Tayyrov, Annageldi; Veluchamy, Alaguraj; Ali, Shahjahan; Bernal, Axel; del Campo, Javier; Cihlář, Jaromír; Flegontov, Pavel; Gornik, Sebastian G; Hajdušková, Eva; Horák, Aleš; Janouškovec, Jan; Katris, Nicholas J; Mast, Fred D; Miranda-Saavedra, Diego; Mourier, Tobias; Naeem, Raeece; Nair, Mridul; Panigrahi, Aswini K; Rawlings, Neil D; Padron-Regalado, Eriko; Ramaprasad, Abhinay; Samad, Nadira; Tomčala, Aleš; Wilkes, Jon; Neafsey, Daniel E; Doerig, Christian; Bowler, Chris; Keeling, Patrick J; Roos, David S; Dacks, Joel B; Templeton, Thomas J; Waller, Ross F; Lukeš, Julius; Oborník, Miroslav; Pain, Arnab
2015-01-01
The eukaryotic phylum Apicomplexa encompasses thousands of obligate intracellular parasites of humans and animals with immense socio-economic and health impacts. We sequenced nuclear genomes of Chromera velia and Vitrella brassicaformis, free-living non-parasitic photosynthetic algae closely related to apicomplexans. Proteins from key metabolic pathways and from the endomembrane trafficking systems associated with a free-living lifestyle have been progressively and non-randomly lost during adaptation to parasitism. The free-living ancestor contained a broad repertoire of genes many of which were repurposed for parasitic processes, such as extracellular proteins, components of a motility apparatus, and DNA- and RNA-binding protein families. Based on transcriptome analyses across 36 environmental conditions, Chromera orthologs of apicomplexan invasion-related motility genes were co-regulated with genes encoding the flagellar apparatus, supporting the functional contribution of flagella to the evolution of invasion machinery. This study provides insights into how obligate parasites with diverse life strategies arose from a once free-living phototrophic marine alga. DOI: http://dx.doi.org/10.7554/eLife.06974.001 PMID:26175406
de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H
2016-01-01
Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Meconium ileus caused by mutations in GUCY2C, encoding the CFTR-activating guanylate cyclase 2C.
Romi, Hila; Cohen, Idan; Landau, Daniella; Alkrinawi, Suliman; Yerushalmi, Baruch; Hershkovitz, Reli; Newman-Heiman, Nitza; Cutting, Garry R; Ofir, Rivka; Sivan, Sara; Birk, Ohad S
2012-05-04
Meconium ileus, intestinal obstruction in the newborn, is caused in most cases by CFTR mutations modulated by yet-unidentified modifier genes. We now show that in two unrelated consanguineous Bedouin kindreds, an autosomal-recessive phenotype of meconium ileus that is not associated with cystic fibrosis (CF) is caused by different homozygous mutations in GUCY2C, leading to a dramatic reduction or fully abrogating the enzymatic activity of the encoded guanlyl cyclase 2C. GUCY2C is a transmembrane receptor whose extracellular domain is activated by either the endogenous ligands, guanylin and related peptide uroguanylin, or by an external ligand, Escherichia coli (E. coli) heat-stable enterotoxin STa. GUCY2C is expressed in the human intestine, and the encoded protein activates the CFTR protein through local generation of cGMP. Thus, GUCY2C is a likely candidate modifier of the meconium ileus phenotype in CF. Because GUCY2C heterozygous and homozygous mutant mice are resistant to E. coli STa enterotoxin-induced diarrhea, it is plausible that GUCY2C mutations in the desert-dwelling Bedouin kindred are of selective advantage. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Wotton, Sandy; Terry, Anne; Kilbey, Anna; Jenkins, Alma; Herzyk, Pawel; Cameron, Ewan; Neil, James C.
2008-01-01
The Runx genes play divergent roles in development and cancer, where they can act either as oncogenes or tumour suppressors. We compared the effects of ectopic Runx expression in established fibroblasts, where all three genes produce an indistinguishable phenotype entailing epithelioid morphology and increased cell survival under stress conditions. Gene array analysis revealed a strongly overlapping transcriptional signature, with no examples of opposing regulation of the same target gene. A common set of 50 highly regulated genes was identified after further filtering on regulation by inducible RUNX1-ER. This set revealed a strong bias towards genes with annotated roles in cancer and development, and a preponderance of targets encoding extracellular or surface proteins, reflecting the marked effects of Runx on cell adhesion. Furthermore, in silico prediction of resistance to glucocorticoid growth inhibition was confirmed in fibroblasts and lymphoid cells expressing ectopic Runx. The effects of fibroblast expression of common RUNX1 fusion oncoproteins (RUNX1-ETO, TEL-RUNX1, CBFB-MYH11) were also tested. While two direct Runx activation target genes were repressed (Ncam1, Rgc32), the fusion proteins appeared to disrupt regulation of down-regulated targets (Cebpd, Id2, Rgs2) rather than impose constitutive repression. These results elucidate the oncogenic potential of the Runx family and reveal novel targets for therapeutic inhibition. PMID:18560354
Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E.; Dagnino, Lina
2012-01-01
Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function. PMID:22574216
Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina
2012-01-01
Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.
Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio
2004-06-23
Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.
Public antibodies to malaria antigens generated by two LAIR1 insertion modalities.
Pieper, Kathrin; Tan, Joshua; Piccoli, Luca; Foglierini, Mathilde; Barbieri, Sonia; Chen, Yiwei; Silacci-Fregni, Chiara; Wolf, Tobias; Jarrossay, David; Anderle, Marica; Abdi, Abdirahman; Ndungu, Francis M; Doumbo, Ogobara K; Traore, Boubacar; Tran, Tuan M; Jongo, Said; Zenklusen, Isabelle; Crompton, Peter D; Daubenberger, Claudia; Bull, Peter C; Sallusto, Federica; Lanzavecchia, Antonio
2017-08-31
In two previously described donors, the extracellular domain of LAIR1, a collagen-binding inhibitory receptor encoded on chromosome 19 (ref. 1), was inserted between the V and DJ segments of an antibody. This insertion generated, through somatic mutations, broadly reactive antibodies against RIFINs, a type of variant antigen expressed on the surface of Plasmodium falciparum-infected erythrocytes. To investigate how frequently such antibodies are produced in response to malaria infection, we screened plasma from two large cohorts of individuals living in malaria-endemic regions. Here we report that 5-10% of malaria-exposed individuals, but none of the European blood donors tested, have high levels of LAIR1-containing antibodies that dominate the response to infected erythrocytes without conferring enhanced protection against febrile malaria. By analysing the antibody-producing B cell clones at the protein, cDNA and gDNA levels, we characterized additional LAIR1 insertions between the V and DJ segments and discovered a second insertion modality whereby the LAIR1 exon encoding the extracellular domain and flanking intronic sequences are inserted into the switch region. By exon shuffling, this mechanism leads to the production of bispecific antibodies in which the LAIR1 domain is precisely positioned at the elbow between the VH and CH1 domains. Additionally, in one donor the genomic DNA encoding the VH and CH1 domains was deleted, leading to the production of a camel-like LAIR1-containing antibody. Sequencing of the switch regions of memory B cells from European blood donors revealed frequent templated inserts originating from transcribed genes that, in rare cases, comprised exons with orientations and frames compatible with expression. These results reveal different modalities of LAIR1 insertion that lead to public and dominant antibodies against infected erythrocytes and suggest that insertion of templated DNA represents an additional mechanism of antibody diversification that can be selected in the immune response against pathogens and exploited for B cell engineering.
Extracellular secretion of recombinant proteins
Linger, Jeffrey G.; Darzins, Aldis
2014-07-22
Nucleic acids encoding secretion signals, expression vectors containing the nucleic acids, and host cells containing the expression vectors are disclosed. Also disclosed are polypeptides that contain the secretion signals and methods of producing polypeptides, including methods of directing the extracellular secretion of the polypeptides. Exemplary embodiments include cellulase proteins fused to secretion signals, methods to produce and isolate these polypeptides, and methods to degrade lignocellulosic biomass.
Ben-Daniel, Bat-Hen; Bar-Zvi, Dudy; Tsror Lahkim, Leah
2012-02-01
Colletotrichum coccodes (Wallr.) S. Hughes, the causal agent of black dot on potato and anthracnose on tomato, reduces yield and crop quality. We explored the role of secreted pectate lyase (PL), a cell wall-degrading enzyme, in the aggressiveness of C. coccodes. In vitro-cultivated highly aggressive isolates secreted immunologically detectable PL levels 6 h after transfer to secondary medium versus 12 h for mildly aggressive isolates, suggesting that secreted PL is a virulence factor. The gene encoding PL, CcpelA, was cloned and used for the genetic manipulation of highly (US-41 and Si-72) and mildly (Si-60) aggressive isolates. CcpelA gene-disrupted mutants showed reduced aggressiveness towards tomato fruits and impaired PL secretion and extracellular activity. Conversely, overexpression of CcpelA in the Si-60 isolate increased its aggressiveness and PL secretion. Comparison of CcpelA cloned from isolates US-41 and Si-60 revealed that both encode identical proteins, but differ in their promoters. Bioinformatics analysis for cis-acting elements suggested that the promoters of the US-41 and Si-60 isolates contain one and no AreA-binding site (GATA box), respectively. AreA has been suggested to be involved in fungal aggressiveness; therefore, CcpelA may be a key virulence factor in C. coccodes pathogenicity, and the differences in isolate aggressiveness might result from promoter activity. Quantitative reverse transcriptase-polymerase chain reaction analyses confirmed the higher level of CcpelA transcript in isolate US-41 versus Si-60. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.
Kuuskeri, Jaana; Mäkelä, Miia R; Isotalo, Jarkko; Oksanen, Ilona; Lundell, Taina
2015-10-19
The fungal genus Phlebia consists of a number of species that are significant in wood decay. Biotechnological potential of a few species for enzyme production and degradation of lignin and pollutants has been previously studied, when most of the species of this genus are unknown. Therefore, we carried out a wider study on biochemistry and systematics of Phlebia species. Isolates belonging to the genus Phlebia were subjected to four-gene sequence analysis in order to clarify their phylogenetic placement at species level and evolutionary relationships of the genus among phlebioid Polyporales. rRNA-encoding (5.8S, partial LSU) and two protein-encoding gene (gapdh, rpb2) sequences were adopted for the evolutionary analysis, and ITS sequences (ITS1+5.8S+ITS2) were aligned for in-depth species-level phylogeny. The 49 fungal isolates were cultivated on semi-solid milled spruce wood medium for 21 days in order to follow their production of extracellular lignocellulose-converting oxidoreductases and carbohydrate active enzymes. Four-gene phylogenetic analysis confirmed the polyphyletic nature of the genus Phlebia. Ten species-level subgroups were formed, and their lignocellulose-converting enzyme activity profiles coincided with the phylogenetic grouping. The highest enzyme activities for lignin modification (manganese peroxidase activity) were obtained for Phlebia radiata group, which supports our previous studies on the enzymology and gene expression of this species on lignocellulosic substrates. Our study implies that there is a species-level connection of molecular systematics (genotype) to the efficiency in production of both lignocellulose-converting carbohydrate active enzymes and oxidoreductases (enzyme phenotype) on spruce wood. Thus, we may propose a similar phylogrouping approach for prediction of lignocellulose-converting enzyme phenotypes in new fungal species or genetically and biochemically less-studied isolates of the wood-decay Polyporales.
Böer, Erik; Bode, Rüdiger; Mock, Hans-Peter; Piontek, Michael; Kunze, Gotthard
2009-06-01
The tannase-encoding Arxula adeninivorans gene ATAN1 was isolated from genomic DNA by PCR, using as primers oligonucleotide sequences derived from peptides obtained after tryptic digestion of the purified tannase protein. The gene harbours an ORF of 1764 bp, encoding a 587-amino acid protein, preceded by an N-terminal secretion sequence comprising 28 residues. The deduced amino acid sequence was similar to those of tannases from Aspergillus oryzae (50% identity), A. niger (48%) and putative tannases from A. fumigatus (52%) and A. nidulans (50%). The sequence contains the consensus pentapeptide motif (-Gly-X-Ser-X-Gly-) which forms part of the catalytic centre of serine hydrolases. Expression of ATAN1 is regulated by the carbon source. Supplementation with tannic acid or gallic acid leads to induction of ATAN1, and accumulation of the native tannase enzyme in the medium. The enzymes recovered from both wild-type and recombinant strains were essentially indistinguishable. A molecular mass of approximately 320 kDa was determined, indicating that the native, glycosylated tannase consists of four identical subunits. The enzyme has a temperature optimum at 35-40 degrees C and a pH optimum at approximately 6.0. The enzyme is able to remove gallic acid from both condensed and hydrolysable tannins. The wild-type strain LS3 secreted amounts of tannase equivalent to 100 U/l under inducing conditions, while the transformant strain, which overexpresses the ATAN1 gene from the strong, constitutively active A. adeninivorans TEF1 promoter, produced levels of up to 400 U/l when grown in glucose medium in shake flasks. Copyright (c) 2009 John Wiley & Sons, Ltd.
Tolmachov, Oleg E
2015-01-01
Gene delivery in vivo that is tightly focused on the intended target cells is essential to maximize the benefits of gene therapy and to reduce unwanted side-effects. Cell surface markers are immediately available for probing by therapeutic gene vectors and are often used to direct gene transfer with these vectors to specific target cell populations. However, it is not unusual for the choice of available extra-cellular markers to be too scarce to provide a reliable definition of the desired therapeutically relevant set of target cells. Therefore, interrogation of intra-cellular determinants of cell-specificity, such as tissue-specific transcription factors, can be vital in order to provide detailed cell-guiding information to gene vector particles. An important improvement in cell-specific gene delivery can be achieved through auto-buildup in vector homing efficiency using intelligent 'self-focusing' of swarms of vector particles on target cells. Vector self-focusing was previously suggested to rely on the release of diffusible chemo-attractants after a successful target-specific hit by 'scout' vector particles. I hypothesize that intelligent self-focusing behaviour of swarms of cell-targeted therapeutic gene vectors can be accomplished without the employment of difficult-to-use diffusible chemo-attractants, instead relying on the intra-swarm signalling through cells expressing a non-diffusible extra-cellular receptor for the gene vectors. In the proposed model, cell-guiding information is gathered by the 'scout' gene vector particles, which: (1) attach to a variety of cells via a weakly binding (low affinity) receptor; (2) successfully facilitate gene transfer into these cells; (3) query intra-cellular determinants of cell-specificity with their transgene expression control elements and (4) direct the cell-specific biosynthesis of a vector-encoded strongly binding (high affinity) cell-surface receptor. Free members of the vector swarm loaded with therapeutic cargo are then attracted to and internalized into the intended target cells via the expressed cognate strongly binding extra-cellular receptor, causing escalation of gene transfer into these cells and increasing the copy number of the therapeutic gene expression modules. Such self-focusing swarms of gene vectors can be either homogeneous, with 'scout' and 'therapeutic' members of the swarm being structurally identical, or, alternatively, heterogeneous (split), with 'scout' and 'therapeutic' members of the swarm being structurally specialized. It is hoped that the proposed self-focusing cell-targeted gene vector swarms with receptor-mediated intra-swarm signalling could be particularly effective in 'top-up' gene delivery scenarios, achieving high-level and sustained expression of therapeutic transgenes that are prone to shut-down through degradation and silencing. Crucially, in contrast to low-precision 'general location' vector guidance by diffusible chemo-attractants, ear-marking non-diffusible receptors can provide high-accuracy targeting of therapeutic vector particles to the specific cell, which has undergone a 'successful cell-specific hit' by a 'scout' vector particle. Opportunities for cell targeting could be expanded, since in the proposed model of self-focusing it could be possible to probe a broad selection of intra-cellular determinants of cell-specificity and not just to rely exclusively on extra-cellular markers of cell-specificity. By employing such self-focusing gene vectors for the improvement of cell-targeted delivery of therapeutic genes, e.g., in cancer therapy or gene addition therapy of recessive genetic diseases, it could be possible to broaden a leeway for the reduction of the vector load and, consequently, to minimize undesired vector cytotoxicity, immune reactions, and the risk of inadvertent genetic modification of germline cells in genetic treatment in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Oby, Emily R.; Perel, Sagi; Sadtler, Patrick T.; Ruff, Douglas A.; Mischel, Jessica L.; Montez, David F.; Cohen, Marlene R.; Batista, Aaron P.; Chase, Steven M.
2016-06-01
Objective. A traditional goal of neural recording with extracellular electrodes is to isolate action potential waveforms of an individual neuron. Recently, in brain-computer interfaces (BCIs), it has been recognized that threshold crossing events of the voltage waveform also convey rich information. To date, the threshold for detecting threshold crossings has been selected to preserve single-neuron isolation. However, the optimal threshold for single-neuron identification is not necessarily the optimal threshold for information extraction. Here we introduce a procedure to determine the best threshold for extracting information from extracellular recordings. We apply this procedure in two distinct contexts: the encoding of kinematic parameters from neural activity in primary motor cortex (M1), and visual stimulus parameters from neural activity in primary visual cortex (V1). Approach. We record extracellularly from multi-electrode arrays implanted in M1 or V1 in monkeys. Then, we systematically sweep the voltage detection threshold and quantify the information conveyed by the corresponding threshold crossings. Main Results. The optimal threshold depends on the desired information. In M1, velocity is optimally encoded at higher thresholds than speed; in both cases the optimal thresholds are lower than are typically used in BCI applications. In V1, information about the orientation of a visual stimulus is optimally encoded at higher thresholds than is visual contrast. A conceptual model explains these results as a consequence of cortical topography. Significance. How neural signals are processed impacts the information that can be extracted from them. Both the type and quality of information contained in threshold crossings depend on the threshold setting. There is more information available in these signals than is typically extracted. Adjusting the detection threshold to the parameter of interest in a BCI context should improve our ability to decode motor intent, and thus enhance BCI control. Further, by sweeping the detection threshold, one can gain insights into the topographic organization of the nearby neural tissue.
Oby, Emily R; Perel, Sagi; Sadtler, Patrick T; Ruff, Douglas A; Mischel, Jessica L; Montez, David F; Cohen, Marlene R; Batista, Aaron P; Chase, Steven M
2018-01-01
Objective A traditional goal of neural recording with extracellular electrodes is to isolate action potential waveforms of an individual neuron. Recently, in brain–computer interfaces (BCIs), it has been recognized that threshold crossing events of the voltage waveform also convey rich information. To date, the threshold for detecting threshold crossings has been selected to preserve single-neuron isolation. However, the optimal threshold for single-neuron identification is not necessarily the optimal threshold for information extraction. Here we introduce a procedure to determine the best threshold for extracting information from extracellular recordings. We apply this procedure in two distinct contexts: the encoding of kinematic parameters from neural activity in primary motor cortex (M1), and visual stimulus parameters from neural activity in primary visual cortex (V1). Approach We record extracellularly from multi-electrode arrays implanted in M1 or V1 in monkeys. Then, we systematically sweep the voltage detection threshold and quantify the information conveyed by the corresponding threshold crossings. Main Results The optimal threshold depends on the desired information. In M1, velocity is optimally encoded at higher thresholds than speed; in both cases the optimal thresholds are lower than are typically used in BCI applications. In V1, information about the orientation of a visual stimulus is optimally encoded at higher thresholds than is visual contrast. A conceptual model explains these results as a consequence of cortical topography. Significance How neural signals are processed impacts the information that can be extracted from them. Both the type and quality of information contained in threshold crossings depend on the threshold setting. There is more information available in these signals than is typically extracted. Adjusting the detection threshold to the parameter of interest in a BCI context should improve our ability to decode motor intent, and thus enhance BCI control. Further, by sweeping the detection threshold, one can gain insights into the topographic organization of the nearby neural tissue. PMID:27097901
Oby, Emily R; Perel, Sagi; Sadtler, Patrick T; Ruff, Douglas A; Mischel, Jessica L; Montez, David F; Cohen, Marlene R; Batista, Aaron P; Chase, Steven M
2016-06-01
A traditional goal of neural recording with extracellular electrodes is to isolate action potential waveforms of an individual neuron. Recently, in brain-computer interfaces (BCIs), it has been recognized that threshold crossing events of the voltage waveform also convey rich information. To date, the threshold for detecting threshold crossings has been selected to preserve single-neuron isolation. However, the optimal threshold for single-neuron identification is not necessarily the optimal threshold for information extraction. Here we introduce a procedure to determine the best threshold for extracting information from extracellular recordings. We apply this procedure in two distinct contexts: the encoding of kinematic parameters from neural activity in primary motor cortex (M1), and visual stimulus parameters from neural activity in primary visual cortex (V1). We record extracellularly from multi-electrode arrays implanted in M1 or V1 in monkeys. Then, we systematically sweep the voltage detection threshold and quantify the information conveyed by the corresponding threshold crossings. The optimal threshold depends on the desired information. In M1, velocity is optimally encoded at higher thresholds than speed; in both cases the optimal thresholds are lower than are typically used in BCI applications. In V1, information about the orientation of a visual stimulus is optimally encoded at higher thresholds than is visual contrast. A conceptual model explains these results as a consequence of cortical topography. How neural signals are processed impacts the information that can be extracted from them. Both the type and quality of information contained in threshold crossings depend on the threshold setting. There is more information available in these signals than is typically extracted. Adjusting the detection threshold to the parameter of interest in a BCI context should improve our ability to decode motor intent, and thus enhance BCI control. Further, by sweeping the detection threshold, one can gain insights into the topographic organization of the nearby neural tissue.
Galloway-Peña, Jessica R.; Liang, Xiaowen; Singh, Kavindra V.; Yadav, Puja; Chang, Chungyu; La Rosa, Sabina Leanti; Shelburne, Samuel; Ton-That, Hung; Höök, Magnus
2014-01-01
The WxL domain recently has been identified as a novel cell wall binding domain found in numerous predicted proteins within multiple Gram-positive bacterial species. However, little is known about the function of proteins containing this novel domain. Here, we identify and characterize 6 Enterococcus faecium proteins containing the WxL domain which, by reverse transcription-PCR (RT-PCR) and genomic analyses, are located in three similarly organized operons, deemed WxL loci A, B, and C. Western blotting, electron microscopy, and enzyme-linked immunosorbent assays (ELISAs) determined that genes of WxL loci A and C encode antigenic, cell surface proteins exposed at higher levels in clinical isolates than in commensal isolates. Secondary structural analyses of locus A recombinant WxL domain-containing proteins found they are rich in β-sheet structure and disordered segments. Using Biacore analyses, we discovered that recombinant WxL proteins from locus A bind human extracellular matrix proteins, specifically type I collagen and fibronectin. Proteins encoded by locus A also were found to bind to each other, suggesting a novel cell surface complex. Furthermore, bile salt survival assays and animal models using a mutant from which all three WxL loci were deleted revealed the involvement of WxL operons in bile salt stress and endocarditis pathogenesis. In summary, these studies extend our understanding of proteins containing the WxL domain and their potential impact on colonization and virulence in E. faecium and possibly other Gram-positive bacterial species. PMID:25512313
Isolani, Maria Emilia; Abril, Josep F.; Saló, Emili; Deri, Paolo; Bianucci, Anna Maria; Batistoni, Renata
2013-01-01
Matrix metalloproteinases (MMPs) are major executors of extracellular matrix remodeling and, consequently, play key roles in the response of cells to their microenvironment. The experimentally accessible stem cell population and the robust regenerative capabilities of planarians offer an ideal model to study how modulation of the proteolytic system in the extracellular environment affects cell behavior in vivo. Genome-wide identification of Schmidtea mediterranea MMPs reveals that planarians possess four mmp-like genes. Two of them (mmp1 and mmp2) are strongly expressed in a subset of secretory cells and encode putative matrilysins. The other genes (mt-mmpA and mt-mmpB) are widely expressed in postmitotic cells and appear structurally related to membrane-type MMPs. These genes are conserved in the planarian Dugesia japonica. Here we explore the role of the planarian mmp genes by RNA interference (RNAi) during tissue homeostasis and regeneration. Our analyses identify essential functions for two of them. Following inhibition of mmp1 planarians display dramatic disruption of tissues architecture and significant decrease in cell death. These results suggest that mmp1 controls tissue turnover, modulating survival of postmitotic cells. Unexpectedly, the ability to regenerate is unaffected by mmp1(RNAi). Silencing of mt-mmpA alters tissue integrity and delays blastema growth, without affecting proliferation of stem cells. Our data support the possibility that the activity of this protease modulates cell migration and regulates anoikis, with a consequent pivotal role in tissue homeostasis and regeneration. Our data provide evidence of the involvement of specific MMPs in tissue homeostasis and regeneration and demonstrate that the behavior of planarian stem cells is critically dependent on the microenvironment surrounding these cells. Studying MMPs function in the planarian model provides evidence on how individual proteases work in vivo in adult tissues. These results have high potential to generate significant information for development of regenerative and anti cancer therapies. PMID:23405188
Salvesen, Øyvind; Reiten, Malin R; Kamstra, Jorke H; Bakkebø, Maren K; Espenes, Arild; Tranulis, Michael A; Ersdal, Cecilie
2017-01-01
A naturally occurring mutation in the PRNP gene of Norwegian dairy goats terminates synthesis of the cellular prion protein (PrP C ), rendering homozygous goats ( PRNP Ter/Ter ) devoid of the protein. Although PrP C has been extensively studied, particularly in the central nervous system, the biological role of PrP C remains incompletely understood. Here, we examined whether loss of PrP C affects the initial stage of lipopolysaccharide (LPS)-induced acute lung injury (ALI). Acute pulmonary inflammation was induced by intravenous injection of LPS ( Escherichia coli O26:B6) in 16 goats (8 PRNP Ter/Ter and 8 PRNP +/+ ). A control group of 10 goats (5 PRNP Ter/Ter and 5 PRNP +/+ ) received sterile saline. Systemic LPS challenge induced sepsis-like clinical signs including tachypnea and respiratory distress. Microscopic examination of lungs revealed multifocal areas with alveolar hemorrhages, edema, neutrophil infiltration, and higher numbers of alveolar macrophages, with no significant differences between PRNP genotypes. A total of 432 ( PRNP +/+ ) and 596 ( PRNP Ter/Ter ) genes were differentially expressed compared with the saline control of the matching genotype. When assigned to gene ontology categories, biological processes involved in remodeling of the extracellular matrix (ECM), were exclusively enriched in PrP C -deficient goats. These genes included a range of collagen-encoding genes, and proteases such as matrix metalloproteinases ( MMP1, MMP2, MMP14, ADAM15 ) and cathepsins. Several proinflammatory upstream regulators (TNF-α, interleukin-1β, IFN-γ) showed increased activation scores in goats devoid of PrP C . In conclusion, LPS challenge induced marked alterations in the lung tissue transcriptome that corresponded with histopathological and clinical findings in both genotypes. The increased activation of upstream inflammatory regulators and enrichment of ECM components could reflect increased inflammation in the absence of PrP C . Further studies are required to elucidate whether these alterations may affect the later reparative phase of ALI.
Molano, Eddy Patricia Lopez; Cabrera, Odalys García; Jose, Juliana; do Nascimento, Leandro Costa; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Alvarez, Javier Correa; Tiburcio, Ricardo Augusto; Tokimatu Filho, Paulo Massanari; de Lima, Gustavo Machado Alvares; Guido, Rafael Victório Carvalho; Corrêa, Thamy Lívia Ribeiro; Leme, Adriana Franco Paes; Mieczkowski, Piotr; Pereira, Gonçalo Amarante Guimarães
2018-01-17
The Ceratocystis genus harbors a large number of phytopathogenic fungi that cause xylem parenchyma degradation and vascular destruction on a broad range of economically important plants. Ceratocystis cacaofunesta is a necrotrophic fungus responsible for lethal wilt disease in cacao. The aim of this work is to analyze the genome of C. cacaofunesta through a comparative approach with genomes of other Sordariomycetes in order to better understand the molecular basis of pathogenicity in the Ceratocystis genus. We present an analysis of the C. cacaofunesta genome focusing on secreted proteins that might constitute pathogenicity factors. Comparative genome analyses among five Ceratocystidaceae species and 23 other Sordariomycetes fungi showed a strong reduction in gene content of the Ceratocystis genus. However, some gene families displayed a remarkable expansion, in particular, the Phosphatidylinositol specific phospholipases-C (PI-PLC) family. Also, evolutionary rate calculations suggest that the evolution process of this family was guided by positive selection. Interestingly, among the 82 PI-PLCs genes identified in the C. cacaofunesta genome, 70 genes encoding extracellular PI-PLCs are grouped in eight small scaffolds surrounded by transposon fragments and scars that could be involved in the rapid evolution of the PI-PLC family. Experimental secretome using LC-MS/MS validated 24% (86 proteins) of the total predicted secretome (342 proteins), including four PI-PLCs and other important pathogenicity factors. Analysis of the Ceratocystis cacaofunesta genome provides evidence that PI-PLCs may play a role in pathogenicity. Subsequent functional studies will be aimed at evaluating this hypothesis. The observed genetic arsenals, together with the analysis of the PI-PLC family shown in this work, reveal significant differences in the Ceratocystis genome compared to the classical vascular fungi, Verticillium and Fusarium. Altogether, our analyses provide new insights into the evolution and the molecular basis of plant pathogenicity.
Isolani, Maria Emilia; Abril, Josep F; Saló, Emili; Deri, Paolo; Bianucci, Anna Maria; Batistoni, Renata
2013-01-01
Matrix metalloproteinases (MMPs) are major executors of extracellular matrix remodeling and, consequently, play key roles in the response of cells to their microenvironment. The experimentally accessible stem cell population and the robust regenerative capabilities of planarians offer an ideal model to study how modulation of the proteolytic system in the extracellular environment affects cell behavior in vivo. Genome-wide identification of Schmidtea mediterranea MMPs reveals that planarians possess four mmp-like genes. Two of them (mmp1 and mmp2) are strongly expressed in a subset of secretory cells and encode putative matrilysins. The other genes (mt-mmpA and mt-mmpB) are widely expressed in postmitotic cells and appear structurally related to membrane-type MMPs. These genes are conserved in the planarian Dugesia japonica. Here we explore the role of the planarian mmp genes by RNA interference (RNAi) during tissue homeostasis and regeneration. Our analyses identify essential functions for two of them. Following inhibition of mmp1 planarians display dramatic disruption of tissues architecture and significant decrease in cell death. These results suggest that mmp1 controls tissue turnover, modulating survival of postmitotic cells. Unexpectedly, the ability to regenerate is unaffected by mmp1(RNAi). Silencing of mt-mmpA alters tissue integrity and delays blastema growth, without affecting proliferation of stem cells. Our data support the possibility that the activity of this protease modulates cell migration and regulates anoikis, with a consequent pivotal role in tissue homeostasis and regeneration. Our data provide evidence of the involvement of specific MMPs in tissue homeostasis and regeneration and demonstrate that the behavior of planarian stem cells is critically dependent on the microenvironment surrounding these cells. Studying MMPs function in the planarian model provides evidence on how individual proteases work in vivo in adult tissues. These results have high potential to generate significant information for development of regenerative and anti cancer therapies.
Chen, Wuyan; Perritt, Ashley F; Morissette, Rachel; Dreiling, Jennifer L; Bohn, Markus-Frederik; Mallappa, Ashwini; Xu, Zhi; Quezado, Martha; Merke, Deborah P
2016-09-01
Some variants that cause autosomal-recessive congenital adrenal hyperplasia (CAH) also cause hypermobility type Ehlers-Danlos syndrome (EDS) due to the monoallelic presence of a chimera disrupting two flanking genes: CYP21A2, encoding 21-hydroxylase, necessary for cortisol and aldosterone biosynthesis, and TNXB, encoding tenascin-X, an extracellular matrix protein. Two types of CAH tenascin-X (CAH-X) chimeras have been described with a total deletion of CYP21A2 and characteristic TNXB variants. CAH-X CH-1 has a TNXB exon 35 120-bp deletion resulting in haploinsufficiency, and CAH-X CH-2 has a TNXB exon 40 c.12174C>G (p.Cys4058Trp) variant resulting in a dominant-negative effect. We present here three patients with biallelic CAH-X and identify a novel dominant-negative chimera termed CAH-X CH-3. Compared with monoallelic CAH-X, biallelic CAH-X results in a more severe phenotype with skin features characteristic of classical EDS. We present evidence for disrupted tenascin-X function and computational data linking the type of TNXB variant to disease severity. © 2016 WILEY PERIODICALS, INC.
Vogel, Kevin J.; Brown, Mark R.; Strand, Michael R.
2015-01-01
Mosquitoes are major disease vectors because most species must feed on blood from a vertebrate host to produce eggs. Blood feeding by the vector mosquito Aedes aegypti triggers the release of two neurohormones, ovary ecdysteroidogenic hormone (OEH) and insulin-like peptides (ILPs), which activate multiple processes required for egg formation. ILPs function by binding to the insulin receptor, which activates downstream components in the canonical insulin signaling pathway. OEH in contrast belongs to a neuropeptide family called neuroparsins, whose receptor is unknown. Here we demonstrate that a previously orphanized receptor tyrosine kinase (RTK) from A. aegypti encoded by the gene AAEL001915 is an OEH receptor. Phylogenetic studies indicated that the protein encoded by this gene, designated AAEL001915, belongs to a clade of RTKs related to the insulin receptor, which are distinguished by an extracellular Venus flytrap module. Knockdown of AAEL001915 by RNAi disabled OEH-mediated egg formation in A. aegypti. AAEL001915 was primarily detected in the mosquito ovary in association with follicular epithelial cells. Both monomeric and dimeric AAEL001915 were detected in mosquito ovaries and transfected Drosophila S2 cells. Functional assays further indicated that OEH bound to dimeric AAEL001915, which resulted in downstream phosphorylation of Ak strain transforming factor (Akt). We hypothesize that orthologs of AAEL001915 in other insects are neuroparsin receptors. PMID:25848040
Vogel, Kevin J; Brown, Mark R; Strand, Michael R
2015-04-21
Mosquitoes are major disease vectors because most species must feed on blood from a vertebrate host to produce eggs. Blood feeding by the vector mosquito Aedes aegypti triggers the release of two neurohormones, ovary ecdysteroidogenic hormone (OEH) and insulin-like peptides (ILPs), which activate multiple processes required for egg formation. ILPs function by binding to the insulin receptor, which activates downstream components in the canonical insulin signaling pathway. OEH in contrast belongs to a neuropeptide family called neuroparsins, whose receptor is unknown. Here we demonstrate that a previously orphanized receptor tyrosine kinase (RTK) from A. aegypti encoded by the gene AAEL001915 is an OEH receptor. Phylogenetic studies indicated that the protein encoded by this gene, designated AAEL001915, belongs to a clade of RTKs related to the insulin receptor, which are distinguished by an extracellular Venus flytrap module. Knockdown of AAEL001915 by RNAi disabled OEH-mediated egg formation in A. aegypti. AAEL001915 was primarily detected in the mosquito ovary in association with follicular epithelial cells. Both monomeric and dimeric AAEL001915 were detected in mosquito ovaries and transfected Drosophila S2 cells. Functional assays further indicated that OEH bound to dimeric AAEL001915, which resulted in downstream phosphorylation of Ak strain transforming factor (Akt). We hypothesize that orthologs of AAEL001915 in other insects are neuroparsin receptors.
A newly identified protein of Leptospira interrogans mediates binding to laminin.
Longhi, Mariana T; Oliveira, Tatiane R; Romero, Eliete C; Gonçales, Amane P; de Morais, Zenaide M; Vasconcellos, Silvio A; Nascimento, Ana L T O
2009-10-01
Pathogenic Leptospira is the aetiological agent of leptospirosis, a life-threatening disease that affects populations worldwide. The search for novel antigens that could be relevant in host-pathogen interactions is being pursued. These antigens have the potential to elicit several activities, including adhesion. This study focused on a hypothetical predicted lipoprotein of Leptospira, encoded by the gene LIC12895, thought to mediate attachment to extracellular matrix (ECM) components. The gene was cloned and expressed in Escherichia coli BL21 Star (DE3)pLys by using the expression vector pAE. The recombinant protein tagged with N-terminal hexahistidine was purified by metal-charged chromatography and characterized by circular dichroism spectroscopy. The capacity of the protein to mediate attachment to ECM components was evaluated by binding assays. The leptospiral protein encoded by LIC12895, named Lsa27 (leptospiral surface adhesin, 27 kDa), bound strongly to laminin in a dose-dependent and saturable fashion. Moreover, Lsa27 was recognized by antibodies from serum samples of confirmed leptospirosis specimens in both the initial and the convalescent phases of the disease. Lsa27 is most likely a surface protein of Leptospira as revealed in liquid-phase immunofluorescence assays with living organisms. Taken together, these data indicate that this newly identified membrane protein is expressed during natural infection and may play a role in mediating adhesion of L. interrogans to its host.
Boukhris, Ines; Farhat-Khemakhem, Ameny; Bouchaala, Kameleddine; Virolle, Marie-Joëlle; Chouayekh, Hichem
2016-10-01
A gene encoding an extracellular phytase was cloned for the first time from an Actinomycete, Streptomyces sp. US42 and sequenced. The sequence of this gene revealed an encoded polypeptide (PHY US42) exhibiting one and six residues difference with the putative phytases of Streptomyces lividans TK24 and Streptomyces coelicolor A3(2), respectively. The molecular modeling of PHY US42 indicated that this phytase belongs to the group of β-propeller phytases that are usually calcium-dependent. PHY US42 was purified and characterized. Its activity was calcium-dependent and maximal at pH 7 and 65 °C. The enzyme was perfectly stable at pH ranging from 5 to 10 and its thermostability was greatly enhanced in the presence of calcium. Indeed, PHY US42 maintained 80% of activity after 10 min of incubation at 75 °C in the presence of 5 mM CaCl 2 . PHY US42 was also found to exhibit high stability after incubation at 37 °C for 1 h in the presence of bovine bile and digestive proteases like of pepsin, trypsin, and chymotrypsin. Considering its biochemical properties, PHY US42 could be used as feed additive in combination with an acid phytase for monogastric animals. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kropat, Janette; Gallaher, Sean D.; Urzica, Eugen I.; Nakamoto, Stacie S.; Strenkert, Daniela; Tottey, Stephen; Mason, Andrew Z.; Merchant, Sabeeha S.
2015-01-01
Inorganic elements, although required only in trace amounts, permit life and primary productivity because of their functions in catalysis. Every organism has a minimal requirement of each metal based on the intracellular abundance of proteins that use inorganic cofactors, but elemental sparing mechanisms can reduce this quota. A well-studied copper-sparing mechanism that operates in microalgae faced with copper deficiency is the replacement of the abundant copper protein plastocyanin with a heme-containing substitute, cytochrome (Cyt) c6. This switch, which is dependent on a copper-sensing transcription factor, copper response regulator 1 (CRR1), dramatically reduces the copper quota. We show here that in a situation of marginal copper availability, copper is preferentially allocated from plastocyanin, whose function is dispensable, to other more critical copper-dependent enzymes like Cyt oxidase and a ferroxidase. In the absence of an extracellular source, copper allocation to Cyt oxidase includes CRR1-dependent proteolysis of plastocyanin and quantitative recycling of the copper cofactor from plastocyanin to Cyt oxidase. Transcriptome profiling identifies a gene encoding a Zn-metalloprotease, as a candidate effecting copper recycling. One reason for the retention of genes encoding both plastocyanin and Cyt c6 in algal and cyanobacterial genomes might be because plastocyanin provides a competitive advantage in copper-depleted environments as a ready source of copper. PMID:25646490
McDonough, EmilyKate; Lazinski, David W.; Camilli, Andrew
2014-01-01
Summary Vibrio cholerae, the causative agent of cholera, remains a threat to public health in areas with inadequate sanitation. As a waterborne pathogen, V. cholerae moves between two dissimilar environments, aquatic reservoirs and the intestinal tract of humans. Accordingly, this pathogen undergoes adaptive shifts in gene expression throughout the different stages of its lifecycle. One particular gene, xds, encodes a secreted exonuclease that was previously identified as being induced during infection. Here we sought to identify regulators responsible for the in vivo-specific induction of xds. A transcriptional fusion of xds to two consecutive antibiotic resistance genes was used to select transposon mutants that had inserted within or adjacent to regulatory genes and thereby caused increased expression of the xds fusion under non-inducing conditions. Large pools of selected insertion sites were sequenced in a high throughput manner using Tn-seq to identify potential mechanisms of xds regulation. Our selection identified the two-component system PhoB/R as the dominant activator of xds expression. In vitro validation confirmed that PhoB, a protein which is only active during phosphate limitation, was responsible for xds activation. Using xds expression as a biosensor of the extracellular phosphate level, we observed that the mouse small intestine is a phosphate-limited environment. PMID:24673931
Xing, Zhuqing; Geng, Weitao; Li, Chao; Sun, Ye; Wang, Yanping
2017-10-09
It is important for probiotics that are currently utilized in the dairy industry to have clear genetic backgrounds. In this study, the genetic characteristics of Lactobacillus kefiranofaciens ZW3 were studied by undertaking a comparative genomics study, and key genes for adaptation to different environments were investigated and validated in vitro. Evidence for horizontal gene transfer resulting in strong self-defense mechanisms was detected in the ZW3 genome. We identified a series of genes relevant for dairy environments and the intestinal tract, particularly for extracellular polysaccharide (EPS) production. Reverse transcription-qPCR (RT-qPCR) revealed significant increases in the relative expression of pgm, ugp, and uge during the mid-logarithmic phase, whereas the expression of pgi was higher at the beginning of the stationary phase. The enzymes encoded by these four genes concertedly regulated carbon flux, which in turn modulated the production of EPS precursors. Moreover, ZW3 tolerated pH 3.5 and 3% bile salt and retained cell surface hydrophobicity and auto-aggregation. In conclusion, we explored the potential of ZW3 for utilization in both the dairy industry and in probiotic applications. Additionally, we elucidated the regulation of the relevant genes involved in EPS production.
Toncheva, D.; Mihailova-Hristova, M.; Vazharova, R.; Staneva, R.; Karachanak, S.; Dimitrov, P.; Simeonov, V.; Ivanov, S.; Balabanski, L.; Serbezov, D.; Malinov, M.; Stefanovic, V.; Čukuranović, R.; Polenakovic, M.; Jankovic-Velickovic, L.; Djordjevic, V.; Jevtovic-Stoimenov, T.; Plaseska-Karanfilska, D.; Galabov, A.; Djonov, V.; Dimova, I.
2014-01-01
Balkan endemic nephropathy (BEN) is a familial chronic tubulointerstitial disease with insidious onset and slow progression leading to terminal renal failure. The results of molecular biological investigations propose that BEN is a multifactorial disease with genetic predisposition to environmental risk agents. Exome sequencing of 22 000 genes with Illumina Nextera Exome Enrichment Kit was performed on 22 DNA samples (11 Bulgarian patients and 11 Serbian patients). Software analysis was performed via NextGene, Provean, and PolyPhen. The frequency of all annotated genetic variants with deleterious/damaging effect was compared with those of European populations. Then we focused on nonannotated variants (with no data available about them and not found in healthy Bulgarian controls). There is no statistically significant difference between annotated variants in BEN patients and European populations. From nonannotated variants with more than 40% frequency in both patients' groups, we nominated 3 genes with possible deleterious/damaging variants—CELA1, HSPG2, and KCNK5. Mutant genes (CELA1, HSPG2, and KCNK5) in BEN patients encode proteins involved in basement membrane/extracellular matrix and vascular tone, tightly connected to process of angiogenesis. We suggest that an abnormal process of angiogenesis plays a key role in the molecular pathogenesis of BEN. PMID:24949484
Capilla, Amalia; Karachentsev, Dmitry; Patterson, Rachel A.; Hermann, Anita; Juarez, Michelle T.; McGinnis, William
2017-01-01
The epidermis serves as a protective barrier in animals. After epidermal injury, barrier repair requires activation of many wound response genes in epidermal cells surrounding wound sites. Two such genes in Drosophila encode the enzymes dopa decarboxylase (Ddc) and tyrosine hydroxylase (ple). In this paper we explore the involvement of the Toll/NF-κB pathway in the localized activation of wound repair genes around epidermal breaks. Robust activation of wound-induced transcription from ple and Ddc requires Toll pathway components ranging from the extracellular ligand Spätzle to the Dif transcription factor. Epistasis experiments indicate a requirement for Spätzle ligand downstream of hydrogen peroxide and protease function, both of which are known activators of wound-induced transcription. The localized activation of Toll a few cell diameters from wound edges is reminiscent of local activation of Toll in early embryonic ventral hypoderm, consistent with the hypothesis that the dorsal–ventral patterning function of Toll arose from the evolutionary cooption of a morphogen-responsive function in wound repair. Furthermore, the combinatorial activity of Toll and other signaling pathways in activating epidermal barrier repair genes can help explain why developmental activation of the Toll, ERK, or JNK pathways alone fail to activate wound repair loci. PMID:28289197
Li, Huan-Jun; Zhang, De-Huai; Yue, Tong-Hui; Jiang, Lu-Xi; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2016-01-10
Expression of Vitreoscilla hemoglobin (VHb) gene was used to improve polysaccharide production in Ganoderma lucidum. The VHb gene, vgb, under the control of the constitutive glyceraldehyde-3-phosphate dehydrogenase gene promoter was introduced into G. lucidum. The activity of expressed VHb was confirmed by the observation of VHb specific CO-difference spectrum with a maximal absorption at 419 nm for the transformant. The effects of VHb expression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production and transcription levels of three genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), uridine diphosphate glucose pyrophosphorylase (UGP), and β-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in the vgb-bearing G. lucidum were 26.4 mg/100mg dry weight and 0.83 g/L, respectively, which were higher by 30.5% and 88.2% than those of the wild-type strain. The transcription levels of PGM, UGP and GLS were up-regulated by 1.51-, 1.55- and 3.83-fold, respectively, in the vgb-bearing G. lucidum. This work highlights the potential of VHb to enhance G. lucidum polysaccharide production by large scale fermentation. Copyright © 2015 Elsevier B.V. All rights reserved.
The miR-29 family: genomics, cell biology, and relevance to renal and cardiovascular injury.
Kriegel, Alison J; Liu, Yong; Fang, Yi; Ding, Xiaoqiang; Liang, Mingyu
2012-02-27
The human miR-29 family of microRNAs has three mature members, miR-29a, miR-29b, and miR-29c. miR-29s are encoded by two gene clusters. Binding sites for several transcriptional factors have been identified in the promoter regions of miR-29 genes. The miR-29 family members share a common seed region sequence and are predicted to target largely overlapping sets of genes. However, the miR-29 family members exhibit differential regulation in several cases and different subcellular distribution, suggesting their functional relevance may not be identical. miR-29s directly target at least 16 extracellular matrix genes, providing a dramatic example of a single microRNA targeting a large group of functionally related genes. Strong antifibrotic effects of miR-29s have been demonstrated in heart, kidney, and other organs. miR-29s have also been shown to be proapoptotic and involved in the regulation of cell differentiation. It remains to be explored how various cellular effects of miR-29s determine functional relevance of miR-29s to specific diseases and how the miR-29 family members may function cooperatively or separately.
Xiao, Fangming; Mark Goodwin, S; Xiao, Yanmei; Sun, Zhaoyu; Baker, Douglas; Tang, Xiaoyan; Jenks, Matthew A; Zhou, Jian-Min
2004-01-01
Pseudomonas syringae relies on type III secretion system to deliver effector proteins into the host cell for parasitism. Type III genes are induced in planta, but host factors affecting the induction are poorly understood. Here we report on the identification of an Arabidopsis mutant, att1 (for aberrant induction of type three genes), that greatly enhances the expression of bacterial type III genes avrPto and hrpL. att1 plants display enhanced disease severity to a virulent strain of P. syringae, suggesting a role of ATT1 in disease resistance. ATT1 encodes CYP86A2, a cytochrome P450 monooxygenase catalyzing fatty acid oxidation. The cutin content is reduced to 30% in att1, indicating that CYP86A2 plays a major role in the biosynthesis of extracellular lipids. att1 has a loose cuticle membrane ultrastructure and shows increased permeability to water vapor, demonstrating the importance of the cuticle membrane in controlling water loss. The enhanced avrPto-luc expression is specific to att1, but not another cuticle mutant, wax2. The results suggest that certain cutin-related fatty acids synthesized by CYP86A2 may repress bacterial type III gene expression in the intercellular spaces. PMID:15241470
Li, Lishu; Ikezono, Tetsuo; Sekine, Kuwon; Shindo, Susumu; Matsumura, Tomohiro; Pawankar, Ruby; Ichimiya, Issei; Yagi, Toshiaki
2010-08-01
We have cloned guinea pig Coch cDNA and the sequence information will be useful for future molecular study combined with physiological experiments. Proper Coch gene expression appears to be dependent on the unique extracellular micro-environment of the inner ear in vivo. These results provide insight into the Coch gene expression and its regulation. To characterize the guinea pig Coch gene, we performed molecular cloning and expression analysis in the inner ear and cultured fibrocytes of the spiral ligament. The Coch cDNA was isolated using RACE. Cochlin isofoms were studied by Western blot using three different types of mammalian inner ear. The cochlear fibrocytes were cultured and characterized by immunostaining. Coch gene expression in the fibrocytes was investigated and the influence of cytokine stimulation was evaluated. The full-length 1991 bp Coch cDNA that encodes a 553 amino acid protein was isolated. The sequence had significant homology with other mammals, and the sizes of the Cochlin isoforms were identical. In the cultured fibrocytes, Coch mRNA was expressed in a very small amount and the isoform production was different, compared with the results in vivo. Cytokine stimulation did not alter the level of mRNA expression or isoform formation.
NASA Astrophysics Data System (ADS)
de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.
2010-08-01
Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Ren; Boudreau, Aaron; Bissell, Mina J
Mammary gland development, functional differentiation, and homeostasis are orchestrated and sustained by a balance of biochemical and biophysical cues from the organ's microenvironment. The three-dimensional microenvironment of the mammary gland, predominantly 'encoded' by a collaboration between the extracellular matrix (ECM), hormones, and growth factors, sends signals from ECM receptors through the cytoskeletal intracellular matrix to nuclear and chromatin structures resulting in gene expression; the ECM in turn is regulated and remodeled by signals from the nucleus. In this chapter, we discuss how coordinated ECM deposition and remodeling is necessary for mammary gland development, how the ECM provides structural and biochemicalmore » cues necessary for tissue-specific function, and the role of the cytoskeleton in mediating the extra - to intracellular dialogue occurring between the nucleus and the microenvironment. When operating normally, the cytoskeletal-mediated dynamic and reciprocal integration of tissue architecture and function directs mammary gland development, tissue polarity, and ultimately, tissue-specific gene expression. Cancer occurs when these dynamic interactions go awry for an extended time.« less
Gujar, Vaibhav V; Fuke, Priya; Khardenavis, Anshuman A; Purohit, Hemant J
2018-02-01
In this study, we have characterized a novel set of extracellular enzymes produced by Penicillium chrysogenum strain HKF2. A draft genome data of 31.5 Mbp was generated and annotation suggested a total of 11,243 protein-coding genes out of which 609 were CAZymes, majority of which were found to have homology with Penicillium rubens, Penicillium chrysogenum followed by Penicillium expansum and Penicillium roqueforti . The prominent CAZyme genes identified in the draft genome encoded for enzymes involved in the production of prebiotics such as inulo-oligosaccharides and fructo-oligosaccharides. Corresponding enzyme assay indicated that the isolate possessed the potential to produce 11.8 and 3.8 U/mL of β-fructofuranosidase and inulinase, respectively. This study highlights the significance of Effluent Treatment Plants as novel and under-explored niche for isolation of fungi having the potential for production of prebiotics synthesizing enzymes.
Sullivan, Matthew J.; Gates, Andrew J.; Appia-Ayme, Corinne; Rowley, Gary; Richardson, David J.
2013-01-01
Global agricultural emissions of the greenhouse gas nitrous oxide (N2O) have increased by around 20% over the last 100 y, but regulation of these emissions and their impact on bacterial cellular metabolism are poorly understood. Denitrifying bacteria convert nitrate in soils to inert di-nitrogen gas (N2) via N2O and the biochemistry of this process has been studied extensively in Paracoccus denitrificans. Here we demonstrate that expression of the gene encoding the nitrous oxide reductase (NosZ), which converts N2O to N2, is regulated in response to the extracellular copper concentration. We show that elevated levels of N2O released as a consequence of decreased cellular NosZ activity lead to the bacterium switching from vitamin B12-dependent to vitamin B12-independent biosynthetic pathways, through the transcriptional modulation of genes controlled by vitamin B12 riboswitches. This inhibitory effect of N2O can be rescued by addition of exogenous vitamin B12. PMID:24248380
Baxter, Melissa A; Wynn, Robert F; Deakin, Jonathan A; Bellantuono, Ilaria; Edington, Kirsten G; Cooper, Alan; Besley, Guy T N; Church, Heather J; Wraith, J Ed; Carr, Trevor F; Fairbairn, Leslie J
2002-03-01
We have investigated the utility of bone marrow-derived mesenchymal stem cells (MSCs) as targets for gene therapy of the autosomal recessive disorder mucopolysaccharidosis type IH (MPS-IH, Hurler syndrome). Cultures of MSCs were initially exposed to a green fluorescent protein-expressing retrovirus. Green fluorescent protein-positive cells maintained their proliferative and differentiation capacity. Next we used a vector encoding alpha-L-iduronidase (IDUA), the enzyme that is defective in MPS-IH. Following transduction, MPS-IH MSCs expressed high levels of IDUA and secreted supernormal levels of this enzyme into the extracellular medium. Exogenous IDUA expression led to a normalization of glycosaminoglycan storage in MPS-IH cells, as evidenced by a dramatic decrease in the amount of (35)SO(4) sequestered within the heparan sulfate and dermatan sulfate compartments of these cells. Finally, gene-modified MSCs were able to cross-correct the enzyme defect in untransduced MPS-IH fibroblasts via protein transfer.
Schindelman, G; Morikami, A; Jung, J; Baskin, T I; Carpita, N C; Derbyshire, P; McCann, M C; Benfey, P N
2001-05-01
To control organ shape, plant cells expand differentially. The organization of the cellulose microfibrils in the cell wall is a key determinant of differential expansion. Mutations in the COBRA (COB) gene of Arabidopsis, known to affect the orientation of cell expansion in the root, are reported here to reduce the amount of crystalline cellulose in cell walls in the root growth zone. The COB gene, identified by map-based cloning, contains a sequence motif found in proteins that are anchored to the extracellular surface of the plasma membrane through a glycosylphosphatidylinositol (GPI) linkage. In animal cells, this lipid linkage is known to confer polar localization to proteins. The COB protein was detected predominately on the longitudinal sides of root cells in the zone of rapid elongation. Moreover, COB RNA levels are dramatically upregulated in cells entering the zone of rapid elongation. Based on these results, models are proposed for the role of COB as a regulator of oriented cell expansion.
Schindelman, Gary; Morikami, Atsushi; Jung, Jee; Baskin, Tobias I.; Carpita, Nicholas C.; Derbyshire, Paul; McCann, Maureen C.; Benfey, Philip N.
2001-01-01
To control organ shape, plant cells expand differentially. The organization of the cellulose microfibrils in the cell wall is a key determinant of differential expansion. Mutations in the COBRA (COB) gene of Arabidopsis, known to affect the orientation of cell expansion in the root, are reported here to reduce the amount of crystalline cellulose in cell walls in the root growth zone. The COB gene, identified by map-based cloning, contains a sequence motif found in proteins that are anchored to the extracellular surface of the plasma membrane through a glycosylphosphatidylinositol (GPI) linkage. In animal cells, this lipid linkage is known to confer polar localization to proteins. The COB protein was detected predominately on the longitudinal sides of root cells in the zone of rapid elongation. Moreover, COB RNA levels are dramatically upregulated in cells entering the zone of rapid elongation. Based on these results, models are proposed for the role of COB as a regulator of oriented cell expansion. PMID:11331607
Lyda, Todd A.; Joshi, Manju B.; Andersen, John F.; Kelada, Andrew Y.; Owings, Joshua P.; Bates, Paul A.; Dwyer, Dennis M.
2015-01-01
Leishmania are protozoan pathogens of humans that exist as extracellular promastigotes in the gut of their sand fly vectors and as obligate intracellular amastigotes within phagolysosomes of infected macrophages. Between infectious blood meal feeds, sand flies take plant juice meals that contain sucrose and store these sugars in their crop. Such sugars are regurgitated into the sand fly anterior midgut where they impact the developing promastigote parasite population. In this report we showed that promastigotes of all Leishmania species secreted an invertase/sucrase enzyme during their growth in vitro. In contrast, neither L. donovani nor L. mexicana amastigotes possessed any detectable invertase activity. Importantly, no released/secreted invertase activity was detected in culture supernatants from either Trypanosoma brucei or Trypanosoma cruzi. Using HPLC, the L. donovani secretory invertase was isolated and subjected to amino acid sequencing. Subsequently, we used a molecular approach to identify the LdINV and LmexINV genes encoding the ~72 kDa invertases produced by these organisms. Interestingly, we identified high fidelity LdINV-like homologs in the genomes of all Leishmania sp. but none were present in either T. brucei or T. cruzi. Northern blot and RT-PCR analyses showed that these genes were developmentally/differentially expressed in promastigotes but not amastigotes of these parasites. Homologous transfection studies demonstrated that these genes in fact encoded the functional secretory invertases produced by these parasites. Cumulatively, our results suggest that these secretory enzymes play critical roles in the survival/growth/development and transmission of all Leishmania parasites within their sand fly vector hosts. PMID:25763714
Lyda, Todd A; Joshi, Manju B; Andersen, John F; Kelada, Andrew Y; Owings, Joshua P; Bates, Paul A; Dwyer, Dennis M
2015-06-01
Leishmania are protozoan pathogens of humans that exist as extracellular promastigotes in the gut of their sand fly vectors and as obligate intracellular amastigotes within phagolysosomes of infected macrophages. Between infectious blood meal feeds, sand flies take plant juice meals that contain sucrose and store these sugars in their crop. Such sugars are regurgitated into the sand fly anterior midgut where they impact the developing promastigote parasite population. In this report we showed that promastigotes of all Leishmania species secreted an invertase/sucrase enzyme during their growth in vitro. In contrast, neither L. donovani nor L. mexicana amastigotes possessed any detectable invertase activity. Importantly, no released/secreted invertase activity was detected in culture supernatants from either Trypanosoma brucei or Trypanosoma cruzi. Using HPLC, the L. donovani secretory invertase was isolated and subjected to amino acid sequencing. Subsequently, we used a molecular approach to identify the LdINV and LmexINV genes encoding the ~72 kDa invertases produced by these organisms. Interestingly, we identified high fidelity LdINV-like homologs in the genomes of all Leishmania sp. but none were present in either T. brucei or T. cruzi. Northern blot and RT-PCR analyses showed that these genes were developmentally/differentially expressed in promastigotes but not amastigotes of these parasites. Homologous transfection studies demonstrated that these genes in fact encoded the functional secretory invertases produced by these parasites. Cumulatively, our results suggest that these secretory enzymes play critical roles in the survival/growth/development and transmission of all Leishmania parasites within their sand fly vector hosts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chan, Chi Ho; Levar, Caleb E.; Zacharoff, Lori
Metal reduction by members of the Geobacteraceae is encoded by multiple gene clusters, and the study of extracellular electron transfer often requires biofilm development on surfaces. Genetic tools that utilize polar antibiotic cassette insertions limit mutant construction and complementation. In addition, unstable plasmids create metabolic burdens that slow growth, and the presence of antibiotics such as kanamycin can interfere with the rate and extent of Geobacter biofilm growth. We report here genetic system improvements for the model anaerobic metal-reducing bacterium Geobacter sulfurreducens. A motile strain of G. sulfurreducens was constructed by precise removal of a transposon interrupting the fgrM flagellarmore » regulator gene using SacB/sucrose counterselection, and Fe(III) citrate reduction was eliminated by deletion of the gene encoding the inner membrane cytochrome imcH. We also show that RK2-based plasmids were maintained in G. sulfurreducens for over 15 generations in the absence of antibiotic selection in contrast to unstable pBBR1 plasmids. Therefore, we engineered a series of new RK2 vectors containing native constitutive Geobacter promoters, and modified one of these promoters for VanR-dependent induction by the small aromatic carboxylic acid vanillate. Inducible plasmids fully complemented Δ imcH mutants for Fe(III) reduction, Mn(IV) oxide reduction, and growth on poised electrodes. A real-time, high-throughput Fe(III) citrate reduction assay is described that can screen numerous G. sulfurreducens strain constructs simultaneously and shows the sensitivity of imcH expression by the vanillate system. Lastly, these tools will enable more sophisticated genetic studies in G. sulfurreducens without polar insertion effects or need for multiple antibiotics.« less
Gao, Wen; Yin, Jun; Bao, Lichen; Wang, Qun; Hou, Shan; Yue, Yali; Yao, Wenbing; Gao, Xiangdong
2018-05-18
Escherichia coli extracellular expression systems have a number of advantages over other systems, such as lower pyrogen levels and a simple purification process. Various approaches, such as the generation of leaky mutants via chromosomal engineering, have been explored for this expression system. However, extracellular protein yields in leaky mutants are relatively low compared to that in intracellular expression systems and therefore need to be improved. In this work, we describe the construction, characterization, and mechanism of enhanced extracellular expression in Escherichia coli. On the basis of the localizations, functions, and transcription levels of cell envelope proteins, we systematically elucidated the effects of multiple gene deletions on cell growth and extracellular expression using modified CRISPR/Cas9-based genome editing and a FlAsH labeling assay. High extracellular yields of heterologous proteins of different sizes were obtained by screening multiple gene mutations. The enhancement of extracellular secretion was associated with the derepression of translation and translocation. This work utilized universal methods in the design of extracellular expression systems for genes not directly associated with protein synthesis that were used to generate strains with higher protein expression capability. We anticipate that extracellular expression systems may help to shed light on the poorly understood aspects of these secretion processes as well as to further assist in the construction of engineered prokaryotic cells for efficient extracellular production of heterologous proteins.
Sztajer, Helena; Szafranski, Szymon P; Tomasch, Jürgen; Reck, Michael; Nimtz, Manfred; Rohde, Manfred; Wagner-Döbler, Irene
2014-01-01
Polymicrobial biofilms are of large medical importance, but relatively little is known about the role of interspecies interactions for their physiology and virulence. Here, we studied two human pathogens co-occuring in the oral cavity, the opportunistic fungus Candida albicans and the caries-promoting bacterium Streptococcus mutans. Dual-species biofilms reached higher biomass and cell numbers than mono-species biofilms, and the production of extracellular polymeric substances (EPSs) by S. mutans was strongly suppressed, which was confirmed by scanning electron microscopy, gas chromatography–mass spectrometry and transcriptome analysis. To detect interkingdom communication, C. albicans was co-cultivated with a strain of S. mutans carrying a transcriptional fusion between a green fluorescent protein-encoding gene and the promoter for sigX, the alternative sigma factor of S. mutans, which is induced by quorum sensing signals. Strong induction of sigX was observed in dual-species biofilms, but not in single-species biofilms. Conditioned media from mixed biofilms but not from C. albicans or S. mutans cultivated alone activated sigX in the reporter strain. Deletion of comS encoding the synthesis of the sigX-inducing peptide precursor abolished this activity, whereas deletion of comC encoding the competence-stimulating peptide precursor had no effect. Transcriptome analysis of S. mutans confirmed induction of comS, sigX, bacteriocins and the downstream late competence genes, including fratricins, in dual-species biofilms. We show here for the first time the stimulation of the complete quorum sensing system of S. mutans by a species from another kingdom, namely the fungus C. albicans, resulting in fundamentally changed virulence properties of the caries pathogen. PMID:24824668
López-Fernández, Loida; Ruiz-Roldán, Carmen; Pareja-Jaime, Yolanda; Prieto, Alicia; Khraiwesh, Husam; Roncero, M. Isabel G.
2013-01-01
With the aim to decipher the molecular dialogue and cross talk between Fusarium oxysporum f.sp. lycopersci and its host during infection and to understand the molecular bases that govern fungal pathogenicity, we analysed genes presumably encoding N-acetylglucosaminyl transferases, involved in glycosylation of glycoproteins, glycolipids, proteoglycans or small molecule acceptors in other microorganisms. In silico analysis revealed the existence of seven putative N-glycosyl transferase encoding genes (named gnt) in F. oxysporum f.sp. lycopersici genome. gnt2 deletion mutants showed a dramatic reduction in virulence on both plant and animal hosts. Δgnt2 mutants had αalterations in cell wall properties related to terminal αor β-linked N-acetyl glucosamine. Mutant conidia and germlings also showed differences in structure and physicochemical surface properties. Conidial and hyphal aggregation differed between the mutant and wild type strains, in a pH independent manner. Transmission electron micrographs of germlings showed strong cell-to-cell adherence and the presence of an extracellular chemical matrix. Δgnt2 cell walls presented a significant reduction in N-linked oligosaccharides, suggesting the involvement of Gnt2 in N-glycosylation of cell wall proteins. Gnt2 was localized in Golgi-like sub-cellular compartments as determined by fluorescence microscopy of GFP::Gnt2 fusion protein after treatment with the antibiotic brefeldin A or by staining with fluorescent sphingolipid BODIPY-TR ceramide. Furthermore, density gradient ultracentrifugation allowed co-localization of GFP::Gnt2 fusion protein and Vps10p in subcellular fractions enriched in Golgi specific enzymatic activities. Our results suggest that N-acetylglucosaminyl transferases are key components for cell wall structure and influence interactions of F. oxysporum with both plant and animal hosts during pathogenicity. PMID:24416097
Mollusk genes encoding lysine tRNA (UUU) contain introns.
Matsuo, M; Abe, Y; Saruta, Y; Okada, N
1995-11-20
New intron-containing genes encoding tRNAs were discovered when genomic DNA isolated from various animal species was amplified by the polymerase chain reaction (PCR) with primers based on sequences of rabbit tRNA(Lys). From sequencing analysis of the products of PCR, we found that introns are present in several genes encoding tRNA(Lys) in mollusks, such as Loligo bleekeri (squid) and Octopus vulgaris (octopus). These introns were specific to genes encoding tRNA(Lys)(CUU) and were not present in genes encoding tRNA(Lys)(CUU). In addition, the sequences of the introns were different from one another. To confirm the results of our initial experiments, we isolated and sequenced genes encoding tRNA(Lys)(CUU) and tRNA(Lys)(UUU). The gene for tRNA(Lys)(UUU) from squid contained an intron, whose sequence was the same as that identified by PCR, and the gene formed a cluster with a corresponding pseudogene. Several DNA regions of 2.1 kb containing this cluster appeared to be tandemly arrayed in the squid genome. By contrast, the gene encoding tRNA(Lys)(CUU) did not contain an intron, as shown also by PCR. The tRNA(Lys)(UUU) that corresponded to the analyzed gene was isolated and characterized. The present study provides the first example of an intron-containing gene encoding a tRNA in mollusks and suggests the universality of introns in such genes in higher eukaryotes.
Human AZU-1 gene, variants thereof and expressed gene products
Chen, Huei-Mei; Bissell, Mina
2004-06-22
A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Shen, Yun; Ruan, Qingxia; Chai, Haoxi; Yuan, Yongze; Yang, Wannian; Chen, Junping; Xin, Zhanguo; Shi, Huazhong
2016-12-01
Polyamines involve in gene regulation by interacting with and modulating the functions of various anionic macromolecules such as DNA, RNA and proteins. In this study, we identified an important function of the polyamine transporter LHR1 (LOWER EXPRESSION OF HEAT RESPONSIVE GENE1) in heat-inducible gene expression in Arabidopsis thaliana. The lhr1 mutant was isolated through a forward genetic screening for altered expression of the luciferase reporter gene driven by the promoter from the heat-inducible gene AtHSP18.2. The lhr1 mutant showed reduced induction of the luciferase gene in response to heat stress and was more sensitive to high temperature than the wild type. Map-based cloning identified that the LHR1 gene encodes the polyamine transporter PUT3 (POLYAMINE UPTAKE TRANSPORTER 3) localized in the plasma membrane. The LHR1/PUT3 is required for the uptake of extracellular polyamines and plays an important role in stabilizing the mRNAs of several crucial heat stress responsive genes under high temperature. Genome-wide gene expression analysis using RNA-seq identified an array of differentially expressed genes, among which the transcript levels of some of the heat shock protein genes significantly reduced in response to prolonged heat stress in the lhr1 mutant. Our findings revealed an important heat stress response and tolerance mechanism involving polyamine influx which modulates mRNA stability of heat-inducible genes under heat stress conditions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Chaillou, Thomas; Jackson, Janna R; England, Jonathan H; Kirby, Tyler J; Richards-White, Jena; Esser, Karyn A; Dupont-Versteegden, Esther E; McCarthy, John J
2015-01-01
The purpose of this study was to compare the gene expression profile of mouse skeletal muscle undergoing two forms of growth (hypertrophy and regrowth) with the goal of identifying a conserved set of differentially expressed genes. Expression profiling by microarray was performed on the plantaris muscle subjected to 1, 3, 5, 7, 10, and 14 days of hypertrophy or regrowth following 2 wk of hind-limb suspension. We identified 97 differentially expressed genes (≥2-fold increase or ≥50% decrease compared with control muscle) that were conserved during the two forms of muscle growth. The vast majority (∼90%) of the differentially expressed genes was upregulated and occurred at a single time point (64 out of 86 genes), which most often was on the first day of the time course. Microarray analysis from the conserved upregulated genes showed a set of genes related to contractile apparatus and stress response at day 1, including three genes involved in mechanotransduction and four genes encoding heat shock proteins. Our analysis further identified three cell cycle-related genes at day and several genes associated with extracellular matrix (ECM) at both days 3 and 10. In conclusion, we have identified a core set of genes commonly upregulated in two forms of muscle growth that could play a role in the maintenance of sarcomere stability, ECM remodeling, cell proliferation, fast-to-slow fiber type transition, and the regulation of skeletal muscle growth. These findings suggest conserved regulatory mechanisms involved in the adaptation of skeletal muscle to increased mechanical loading. Copyright © 2015 the American Physiological Society.
Chaillou, Thomas; Jackson, Janna R.; England, Jonathan H.; Kirby, Tyler J.; Richards-White, Jena; Esser, Karyn A.; Dupont-Versteegden, Esther E.
2014-01-01
The purpose of this study was to compare the gene expression profile of mouse skeletal muscle undergoing two forms of growth (hypertrophy and regrowth) with the goal of identifying a conserved set of differentially expressed genes. Expression profiling by microarray was performed on the plantaris muscle subjected to 1, 3, 5, 7, 10, and 14 days of hypertrophy or regrowth following 2 wk of hind-limb suspension. We identified 97 differentially expressed genes (≥2-fold increase or ≥50% decrease compared with control muscle) that were conserved during the two forms of muscle growth. The vast majority (∼90%) of the differentially expressed genes was upregulated and occurred at a single time point (64 out of 86 genes), which most often was on the first day of the time course. Microarray analysis from the conserved upregulated genes showed a set of genes related to contractile apparatus and stress response at day 1, including three genes involved in mechanotransduction and four genes encoding heat shock proteins. Our analysis further identified three cell cycle-related genes at day and several genes associated with extracellular matrix (ECM) at both days 3 and 10. In conclusion, we have identified a core set of genes commonly upregulated in two forms of muscle growth that could play a role in the maintenance of sarcomere stability, ECM remodeling, cell proliferation, fast-to-slow fiber type transition, and the regulation of skeletal muscle growth. These findings suggest conserved regulatory mechanisms involved in the adaptation of skeletal muscle to increased mechanical loading. PMID:25554798
Ríos-Fránquez, Francisco Javier; González-Bautista, Enrique; Ponce-Noyola, Teresa; Ramos-Valdivia, Ana Carmela; Poggi-Varaldo, Héctor Mario; García-Mena, Jaime; Martinez, Alfredo
2017-05-01
Bioethanol is one of the main biofuels produced from the fermentation of saccharified agricultural waste; however, this technology needs to be optimized for profitability. Because the commonly used ethanologenic yeast strains are unable to assimilate cellobiose, several efforts have been made to express cellulose hydrolytic enzymes in these yeasts to produce ethanol from lignocellulose. The C. flavigenabglA gene encoding β-glucosidase catalytic subunit was optimized for preferential codon usage in S. cerevisiae. The optimized gene, cloned into the episomal vector pRGP-1, was expressed, which led to the secretion of an active β-glucosidase in transformants of the S. cerevisiae diploid strain 2-24D. The volumetric and specific extracellular enzymatic activities using pNPG as substrate were 155 IU L -1 and 222 IU g -1 , respectively, as detected in the supernatant of the cultures of the S. cerevisiae RP2-BGL transformant strain growing in cellobiose (20 g L -1 ) as the sole carbon source for 48 h. Ethanol production was 5 g L -1 after 96 h of culture, which represented a yield of 0.41 g g -1 of substrate consumed (12 g L -1 ), equivalent to 76% of the theoretical yield. The S. cerevisiae RP2-BGL strain expressed the β-glucosidase extracellularly and produced ethanol from cellobiose, which makes this microorganism suitable for application in ethanol production processes with saccharified lignocellulose.
Fernando, Thilini; Flibotte, Stephane; Xiong, Sheng; Yin, Jianghua; Yzeiraj, Edlira; Moerman, Donald G.; Meléndez, Alicia; Savage-Dunn, Cathy
2011-01-01
Organismal growth and body size are influenced by both genetic and environmental factors. We have utilized the strong molecular genetic techniques available in the nematode C. elegans to identify genetic determinants of body size. In C. elegans, DBL-1, a member of the conserved family of secreted growth factors known as the Transforming Growth Factor β superfamily, is known to play a major role in growth control. The mechanisms by which other determinants of body size function, however, is less well understood. To identify additional genes involved in body size regulation, a genetic screen for small mutants was previously performed. One of the genes identified in that screen was sma-21. We now demonstrate that sma-21 encodes ADT-2, a member of the ADAMTS (a disintegrin and metalloprotease with thrombospondin motifs) family of secreted metalloproteases. ADAMTS proteins are believed to remodel the extracellular matrix and may modulate the activity of extracellular signals. Genetic interactions suggest that ADT-2 acts in parallel with or in multiple size regulatory pathways. We demonstrate that ADT-2 is required for normal levels of expression of a DBL-1-responsive transcriptional reporter. We further demonstrate that adt-2 regulatory sequences drive expression in glial-like and vulval cells, and that ADT-2 activity is required for normal cuticle collagen fibril organization. We therefore propose that ADT-2 regulates body size both by modulating TGFβ signaling activity and by maintaining normal cuticle structure. PMID:21256840
Garavaglia, Marco; Rossi, Elio; Landini, Paolo
2012-01-01
Bacteria are often found in multicellular communities known as biofilms, which constitute a resistance form against environmental stresses. Extracellular adhesion and cell aggregation factors, responsible for bacterial biofilm formation and maintenance, are tightly regulated in response to physiological and environmental cues. We show that, in Escherichia coli, inactivation of genes belonging to the de novo uridine monophosphate (UMP) biosynthetic pathway impairs production of curli fibers and cellulose, important components of the bacterial biofilm matrix, by inhibiting transcription of the csgDEFG operon, thus preventing production of the biofilm master regulator CsgD protein. Supplementing growth media with exogenous uracil, which can be converted to UMP through the pyrimidine nucleotide salvage pathway, restores csgDEFG transcription and curli production. In addition, however, exogenous uracil triggers cellulose production, particularly in strains defective in either carB or pyrB genes, which encode enzymes catalyzing the first steps of de novo UMP biosynthesis. Our results indicate the existence of tight and complex links between pyrimidine metabolism and curli/cellulose production: transcription of the csgDEFG operon responds to pyrimidine nucleotide availability, while cellulose production is triggered by exogenous uracil in the absence of active de novo UMP biosynthesis. We speculate that perturbations in the UMP biosynthetic pathways allow the bacterial cell to sense signals such as starvation, nucleic acids degradation, and availability of exogenous pyrimidines, and to adapt the production of the extracellular matrix to the changing environmental conditions.
Wei, Xuetuan; Zhou, Yinhua; Chen, Jingbang; Cai, Dongbo; Wang, Dan; Qi, Gaofu; Chen, Shouwen
2015-02-01
Nattokinase (NK) possesses the potential for prevention and treatment of thrombus-related diseases. In this study, high-level expression of nattokinase was achieved in Bacillus licheniformis WX-02 via host strain construction and signal peptides optimization. First, ten genes (mpr, vpr, aprX, epr, bpr, wprA, aprE, bprA, hag, amyl) encoding for eight extracellular proteases, a flagellin and an amylase were deleted to obtain B. licheniformis BL10, which showed no extracellular proteases activity in gelatin zymography. Second, the gene fragments of P43 promoter, Svpr, nattokinase and TamyL were combined into pHY300PLK to form the expression vector pP43SNT. In BL10 (pP43SNT), the fermentation activity and product activity per unit of biomass of nattokinase reached 14.33 FU/mL and 2,187.71 FU/g respectively, which increased by 39 and 156 % compared to WX-02 (pP43SNT). Last, Svpr was replaced with SsacC and SbprA, and the maximum fermentation activity (33.83 FU/mL) was achieved using SsacC, which was 229 % higher than that of WX-02 (pP43SNT). The maximum NK fermentation activity in this study reaches the commercial production level of solid state fermentation, and this study provides a promising engineered strain for industrial production of nattokinase, as well as a potential platform host for expression of other target proteins.
Nuclear localization of Klotho in brain: an anti-aging protein
German, Dwight C.; Khobahy, Ida; Pastor, Johanne; Kuro-o, Makoto; Liu, Xinran
2011-01-01
Klotho is a putative age-suppressing gene whose over-expression in mice results in extension of life span. The klotho gene encodes a single-pass transmembrane protein whose extracellular domain is shed and released into blood, urine, and cerebrospinal fluid, potentially functioning as a humoral factor. The extracellular domain of Klotho has an activity that increases the expression of anti-oxidant enzymes and confers resistance to oxidative stress in cultured cells and in whole animals. The transmembrane form of the Klotho protein directly binds to multiple fibroblast growth factor receptors and modifies their ligand affinity and specificity. The purpose of the present study was to determine the precise cellular localization of Klotho in the mouse brain. Using light microscopic immunohistochemical methods, we found the highest levels of Klotho immunoreactivity in two brain regions: the choroid plexus, and cerebellar Purkinje cells. In the choroid plexus cells, Klotho was found not only on the plasma membrane but also in large amounts near the nuclear membrane. Likewise, in the Purkinje cell Klotho was found throughout the cell including dendrites, axon and soma with large amounts near the nuclear membrane. Using immunoelectron microscopy, we found Klotho in the cell membrane, but the highest concentration was localized in the peripheral portion of the nucleus and the nucleolus in both cell types. This new finding suggests that in addition to Klotho being secreted from cells in brain, it also has a nuclear function. PMID:22245317
Hua, Chengwei; Yan, Qiaojuan; Jiang, Zhengqiang; Li, Yinan; Katrolia, Priti
2010-09-01
In this study, a novel beta-1,3-1,4-glucanase gene (designated as PtLic16A) from Paecilomyces thermophila was cloned and sequenced. PtLic16A has an open reading frame of 945 bp, encoding 314 amino acids. The deduced amino acid sequence shares the highest identity (61%) with the putative endo-1,3(4)-beta-glucanase from Neosartorya fischeri NRRL 181. PtLic16A was cloned into a vector pPIC9K and was expressed successfully in Pichia pastoris as active extracellular beta-1,3-1,4-glucanase. The recombinant beta-1,3-1,4-glucanase (PtLic16A) was secreted predominantly into the medium which comprised up to 85% of the total extracellular proteins and reached a protein concentration of 9.1 g l(-1) with an activity of 55,300 U ml(-1) in 5-l fermentor culture. The enzyme was then purified using two steps, ion exchange chromatography, and gel filtration chromatography. The purified enzyme had a molecular mass of 38.5 kDa on SDS-PAGE. It was optimally active at pH 7.0 and a temperature of 70 degrees C. Furthermore, the enzyme exhibited strict specificity for beta-1,3-1,4-D: -glucans. This is the first report on the cloning and expression of a beta-1,3-1,4-glucanase gene from Paecilomyces sp.
Yazicioglu, Mustafa N.; Monaldini, Luca; Chu, Kirk; Khazi, Fayaz R.; Murphy, Samuel L.; Huang, Heshu; Margaritis, Paris; High, Katherine A.
2013-01-01
The genes encoding a family of proteins termed proline-rich γ-carboxyglutamic acid (PRRG) proteins were identified and characterized more than a decade ago, but their functions remain unknown. These novel membrane proteins have an extracellular γ-carboxyglutamic acid (Gla) protein domain and cytosolic WW binding motifs. We screened WW domain arrays for cytosolic binding partners for PRRG4 and identified novel protein-protein interactions for the protein. We also uncovered a new WW binding motif in PRRG4 that is essential for these newly found protein-protein interactions. Several of the PRRG-interacting proteins we identified are essential for a variety of physiologic processes. Our findings indicate possible novel and previously unidentified functions for PRRG proteins. PMID:23873930
Solving the puzzles of cutin and suberin polymer biosynthesis.
Beisson, Fred; Li-Beisson, Yonghua; Pollard, Mike
2012-06-01
Cutin and suberin are insoluble lipid polymers that provide critical barrier functions to the cell wall of certain plant tissues, including the epidermis, endodermis and periderm. Genes that are specific to the biosynthesis of cutins and/or aliphatic suberins have been identified, mainly in Arabidopsis thaliana. They notably encode acyltransferases, oxidases and transporters, which may have either well-defined or more debatable biochemical functions. However, despite these advances, important aspects of cutin and suberin synthesis remain obscure. Central questions include whether fatty acyl monomers or oligomers are exported, and the extent of extracellular assembly and attachment to the cell wall. These issues are reviewed. Greater emphasis on chemistry and biochemistry will be required to solve these unknowns and link structure with function. Copyright © 2012 Elsevier Ltd. All rights reserved.
Shelburne, Samuel A.; Keith, David B.; Davenport, Michael T.; Beres, Stephen B.; Carroll, Ronan K.; Musser, James M.
2010-01-01
α-glucans such as starch and glycogen are abundant in the human oropharynx, the main site of group A Streptococcus (GAS) infection. However, the role in pathogenesis of GAS extracellular α-glucan binding and degrading enzymes is unknown. The serotype M1 GAS genome encodes two extracellular proteins putatively involved in α-glucan binding and degradation; pulA encodes a cell-wall anchored pullulanase and amyA encodes a freely secreted putative cyclomaltodextrin α-glucanotransferase. Genetic inactivation of amyA, but not pulA, abolished GAS α-glucan degradation. The ΔamyA strain had a slower rate of translocation across human pharyngeal epithelial cells. Consistent with this finding, the ΔamyA strain was less virulent following mouse mucosal challenge. Recombinant AmyA degraded α-glucans into β-cyclomaltodextrins that reduced pharyngeal cell transepithelial resistance, providing a physiologic explanation for the observed transepithelial migration phenotype. Higher amyA transcript levels were present in serotype M1 GAS strains causing invasive infection compared to strains causing pharyngitis. GAS proliferation in a defined α-glucan-containing medium was dependent on the presence of human salivary α-amylase. These data delineate the molecular mechanisms by which α-glucan degradation contributes to GAS host-pathogen interaction including how GAS employs human salivary α-amylase for its own metabolic benefit. PMID:19735442
Hogenkamp, David G; Arakane, Yasuyuki; Zimoch, Lars; Merzendorfer, Hans; Kramer, Karl J; Beeman, Richard W; Kanost, Michael R; Specht, Charles A; Muthukrishnan, Subbaratnam
2005-06-01
Chitin, the linear homopolymer of beta-1,4-linked N-acetylglucosamine, is produced by the enzyme chitin synthase (CHS). In general, this insoluble polysaccharide is found in two major extracellular structures in insects, the cuticle that overlays the epidermis and the peritrophic membrane (PM) that lines the midgut. Based on amino acid sequence similarities, insect CHSs are divided into two classes, A and B, and to date no more than two CHS genes have been identified in any single insect species. In species where both CHSs have been identified, one class A CHS and one class B CHS are always present. This finding suggests that these two genes may encode enzymes that synthesize chitin in different epithelial tissues. In our laboratory, we previously characterized transcripts for a class A CHS gene (MsCHS1) from the tobacco hornworm, Manduca sexta. We observed the expression of this gene in the larval epidermis, suggesting that the encoded enzyme functions to synthesize cuticular chitin. In this paper, we characterize a second chitin synthase gene (MsCHS2) belonging to class B and its cDNA from Manduca and show that it is expressed only in the midgut. This cDNA contains an open reading frame of 4575 nucleotides, which encodes a conceptual protein that is 1524 amino acids in length and is predicted to contain 16 transmembrane spans. Northern blot analysis of RNA isolated from anterior, medial, and posterior sections of the midgut from feeding larvae indicate that MsCHS2 is primarily expressed in the anterior midgut, with transcript levels tapering off in the medial and posterior midgut. Analysis of the MsCHS2 gene sequence indicates the absence of an alternate exon in contrast to the MsCHS1 gene, which yields two transcripts, MsCHS1a and MsCHS1b. RT-PCR analysis of the differential expression of these alternately spliced transcripts reveals that both splice variants are present in the epidermis. However, the ratio of the two alternately spliced transcripts varies during development, with MsCHS1a being generally more predominant. Southern blot analysis using a probe specific for CHS indicated that Manduca has only two CHS genes, akin to other insect species. Results from an analysis of expression of both genes in different tissues and developmental times indicate that the MsCHS1 enzyme is used for the synthesis of chitin in the cuticle and tracheae, whereas MsCHS2 is utilized exclusively for the synthesis of PM-associated chitin in the midgut.
Biomechanical cell regulatory networks as complex adaptive systems in relation to cancer.
Feller, Liviu; Khammissa, Razia Abdool Gafaar; Lemmer, Johan
2017-01-01
Physiological structure and function of cells are maintained by ongoing complex dynamic adaptive processes in the intracellular molecular pathways controlling the overall profile of gene expression, and by genes in cellular gene regulatory circuits. Cytogenetic mutations and non-genetic factors such as chronic inflammation or repetitive trauma, intrinsic mechanical stresses within extracellular matrix may induce redirection of gene regulatory circuits with abnormal reactivation of embryonic developmental programmes which can now drive cell transformation and cancer initiation, and later cancer progression and metastasis. Some of the non-genetic factors that may also favour cancerization are dysregulation in epithelial-mesenchymal interactions, in cell-to-cell communication, in extracellular matrix turnover, in extracellular matrix-to-cell interactions and in mechanotransduction pathways. Persistent increase in extracellular matrix stiffness, for whatever reason, has been shown to play an important role in cell transformation, and later in cancer cell invasion. In this article we review certain cell regulatory networks driving carcinogenesis, focussing on the role of mechanical stresses modulating structure and function of cells and their extracellular matrices.
Ito, Katsuhiko; Kidokoro, Kurako; Katsuma, Susumu; Sezutsu, Hideki; Uchino, Keiro; Kobayashi, Isao; Tamura, Toshiki; Yamamoto, Kimiko; Mita, Kazuei; Shimada, Toru; Kadono-Okuda, Keiko
2018-05-09
Bombyx mori densovirus type 1 (BmDV) is a pathogen that causes flacherie disease in the silkworm. The absolute nonsusceptibility to BmDV among certain silkworm strains is determined independently by two genes, nsd-1 and Nid-1. However, neither of these genes has been molecularly identified to date. Here, we isolated the nsd-1 gene by positional cloning and characterized the properties of its product, NSD-1. Sequence and biochemical analyses revealed that this gene encodes a Bombyx-specific mucin-like glycoprotein with a single transmembrane domain. The NSD-1 protein was specifically expressed in the larval midgut epithelium, the known infection site of BmDV. Sequence analysis of the nsd-1 gene from 13 resistant and 12 susceptible strains suggested that a specific arginine residue in the extracellular tail of the NSD-1 protein was common among susceptible strains. Germline transformation of the susceptible-type nsd-1 (with a single nucleotide substitution) conferred partial susceptibility to resistant larvae, indicating that the + nsd-1 gene is required for the susceptibility of B. mori larvae to BmDV and the susceptibility is solely a result of the substitution of a single amino acid with arginine. Taken together, our results provide striking evidence that a novel membrane-bound mucin-like protein functions as a cell-surface receptor for a densovirus.
Kindler syndrome: a focal adhesion genodermatosis.
Lai-Cheong, J E; Tanaka, A; Hawche, G; Emanuel, P; Maari, C; Taskesen, M; Akdeniz, S; Liu, L; McGrath, J A
2009-02-01
Kindler syndrome (OMIM 173650) is an autosomal recessive genodermatosis characterized by trauma-induced blistering, poikiloderma, skin atrophy, mucosal inflammation and varying degrees of photosensitivity. Although Kindler syndrome is classified as a subtype of epidermolysis bullosa, it has distinct clinicopathological and molecular abnormalities. The molecular pathology of Kindler syndrome involves loss-of-function mutations in a newly recognized actin cytoskeleton-associated protein, now known as fermitin family homologue 1, encoded by the gene FERMT1. This protein mediates anchorage between the actin cytoskeleton and the extracellular matrix via focal adhesions, and thus the structural pathology differs from other forms of epidermolysis bullosa in which there is a disruption of the keratin intermediate filament-hemidesmosome network and the extracellular matrix. In the skin, fermitin family homologue 1 is mainly expressed in basal keratinocytes and binds to the cytoplasmic tails of beta1 and beta3 integrins as well as to fermitin family homologue 2 and filamin-binding LIM protein 1. It also plays a crucial role in keratinocyte migration, proliferation and adhesion. In this report, we review the clinical, cellular and molecular pathology of Kindler syndrome and discuss the role of fermitin family homologue 1 in keratinocyte biology.
NASA Astrophysics Data System (ADS)
Neolaka, G. M. G.; Yustisia, I.; Sadikin, M.; Wanandi, S. I.
2017-08-01
Changes in the metabolic status of cancer cells are presumed to be correlated with the adjustment of these cells to extracellular changes. Cell glycolysis increases the production of intracellular lactate catalyzed by the lactate dehydrogenases, both LDH-A and LDH-B. An increase in intracellular lactate can affect extracellular pH balance through monocarboxylate transporters, particularly MCT1 and MCT4. This study aimed to analyze the effects of extracellular alkalinization on the lactate metabolism of human breast cancer stem cells (BCSCs). In this study, human primary BCSCs (CD24-/CD44+ cells) were treated with 100 mM sodium bicarbonate for 0.5, 24, and 48 h in DMEM F12/HEPES. After incubation, extracellular pH was measured and cells were harvested to extract the total RNA and protein. The expression of LDH-A, LDH-B, MCT1, and MCT4 mRNA genes were analyzed using qRT-PCR method. Our study shows that administration of sodium bicarbonate in the BCSC culture medium could increase extracellular pH. To balance the increase of extracellular pH, BCSCs regulated the expression of LDH-A, LDH-B, MCT1, and MCT4 genes. As the extracellular pH increases, the expression of LDH-A that converts pyruvate to lactate increased along with the increase of MCT 4 and MCT 1 expression, which act as lactate transporters. As the incubation time increases, the pH decreases, leading to the suppression of LDH-A and increase of LDH-B expression that converts lactate into pyruvate. Therefore, we suggest that the extracellular alkalinization by sodium bicarbonate in BCSCs affected the genes that regulate lactate metabolism.
Extracellular Identification of a Processed Type II ComR/ComS Pheromone of Streptococcus mutans
Khan, Rabia; Rukke, Håkon V.; Ricomini Filho, Antonio Pedro; Fimland, Gunnar; Arntzen, Magnus Ø.; Thiede, Bernd
2012-01-01
The competence-stimulating peptide (CSP) and the sigX-inducing peptide (XIP) are known to induce Streptococcus mutans competence for genetic transformation. For both pheromones, direct identification of the native peptides has not been accomplished. The fact that extracellular XIP activity was recently observed in a chemically defined medium devoid of peptides, as mentioned in an accompanying paper (K. Desai, L. Mashburn-Warren, M. J. Federle, and D. A. Morrison, J. Bacteriol. 194:3774–3780, 2012), provided ideal conditions for native XIP identification. To search for the XIP identity, culture supernatants were filtered to select for peptides of less than 3 kDa, followed by C18 extraction. One peptide, not detected in the supernatant of a comS deletion mutant, was identified by tandem mass spectrometry (MS/MS) fragmentation as identical to the ComS C-terminal sequence GLDWWSL. ComS processing did not require Eep, a peptidase involved in processing or import of bacterial small hydrophobic peptides, since eep deletion had no inhibitory effect on XIP production or on synthetic XIP response. We investigated whether extracellular CSP was also produced. A reporter assay for CSP activity detection, as well as MS analysis of supernatants, revealed that CSP was not present at detectable levels. In addition, a mutant with deletion of the CSP-encoding gene comC produced endogenous XIP levels similar to those of a nondeletion mutant. The results indicate that XIP pheromone production is a natural phenomenon that may occur in the absence of natural CSP pheromone activity and that the heptapeptide GLDWWSL is an extracellular processed form of ComS, possibly the active XIP pheromone. This is the first report of direct identification of a ComR/ComS pheromone. PMID:22609914
Dixit, Radhika; Arakane, Yasuyuki; Specht, Charles A; Richard, Chad; Kramer, Karl J; Beeman, Richard W; Muthukrishnan, Subbaratnam
2008-04-01
A bioinformatics investigation of four insect species with annotated genome sequences identified a family of genes encoding chitin deacetylase (CDA)-like proteins, with five to nine members depending on the species. CDAs (EC 3.5.1.41) are chitin-modifying enzymes that deacetylate the beta-1,4-linked N-acetylglucosamine homopolymer. Partial deacetylation forms a heteropolysaccharide that also contains some glucosamine residues, while complete deacetylation produces the homopolymer chitosan, consisting exclusively of glucosamine. The genomes of the red flour beetle, Tribolium castaneum, the fruit fly, Drosophila melanogaster, the malaria mosquito, Anopheles gambiae, and the honey bee, Apis mellifera contain 9, 6, 5 and 5 genes, respectively, that encode proteins with a chitin deacetylase motif. The presence of alternative exons in two of the genes, TcCDA2 and TcCDA5, increases the protein diversity further. Insect CDA-like proteins were classified into five orthologous groups based on phylogenetic analysis and the presence of additional motifs. Group I enzymes include CDA1 and isoforms of CDA2, each containing in addition to a polysaccharide deacetylase-like catalytic domain, a chitin-binding peritrophin-A domain (ChBD) and a low-density lipoprotein receptor class A domain (LDLa). Group II is composed of CDA3 orthologs from each insect species with the same domain organization as group I CDAs, but differing substantially in sequence. Group III includes CDA4s, which have the ChBD domain but do not have the LDLa domain. Group IV comprises CDA5s, which are the largest CDAs because of a very long intervening region separating the ChBD and catalytic domains. Among the four insect species, Tribolium is unique in having four CDA genes in group V, whereas the other insect genomes have either one or none. Most of the CDA-like proteins have a putative signal peptide consistent with their role in modifying extracellular chitin in both cuticle and peritrophic membrane during morphogenesis and molting.
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
Dietzmann, K; von Bossanyi, P; Krause, D; Wittig, H; Mawrin, C; Kirches, E
2000-01-01
Plasminogen activators as inducible extracellular serine proteases are involved in a variety of processes, such as the degradation of brain structures. In regions of brain degradation, an increase in the expression of genes encoding cytokines and proteinases has recently been demonstrated. We tested the hypothesis, whether the plasminogen activator system as well as the plasminogen activator inhibitors are expressed and possibly involved in a proteolytic cascade that breaks down the extracellular matrix as a result of ischemic or posttraumatic brain destructions. To study this supposition, we investigated immunohistochemically the expression of tPA, uPA and its receptor, the plasminogen activator inhibitors PAI-1 and PAI-2, tetranectin as well as the laminin breakdown as an event of secondary brain injury. Brain tissue from 21 autopsy cases with severe brain injuries, material from 14 ischemic infarcts and 11 controls with acute hypoxia were used. All components of the plasminogen activator system studied were over-expressed immunohistochemically in reactive astrocytes, microglia and endothelial cells around the lesion zone. Tetranectin showed an analogous distribution to the plasminogen activator system. A reduced immunoreactivity of laminin within the identical region of destruction was detected concomitant with laminin remnants in perivascular macrophages, so that a remarkable role of the plasmin cascade in the degradation of extracellular matrix proteins in the brain is taken into consideration.
Monteiro, Ricardo; Ageorges, Valentin; Rojas-Lopez, Maricarmen; Schmidt, Herbert; Weiss, Agnes; Bertin, Yolande; Forano, Evelyne; Jubelin, Grégory; Henderson, Ian R; Livrelli, Valérie; Gobert, Alain P; Rosini, Roberto; Soriani, Marco; Desvaux, Mickaël
2016-08-01
Shiga toxin-encoding Escherichia coli (STEC) regroup strains that carry genes encoding Shiga toxin (Stx). Among intestinal pathogenic E. coli, enterohaemorrhagic E. coli (EHEC) constitute the major subgroup of virulent STEC. EHEC cause serious human disease such as haemorrhagic colitis and haemolytic-uremic syndrome. While EHEC have evolved from enteropathogenic E. coli, hybrids with enteroaggregative E. coli have recently emerged. Of note, some enteroinvasive E. coli also belong to the STEC group. While the LEE (locus of enterocyte effacement) is a key and prominent molecular determinant in the pathogenicity, neither all EHEC nor STEC contain the LEE, suggesting that they possess additional virulence and colonisation factors. Currently, nine protein secretion systems have been described in diderm-lipopolysaccharide bacteria (archetypal Gram-negative) and can be involved in the secretion of extracellular effectors, cell-surface proteins or assembly of cell-surface organelles, such as flagella or pili. In this review, we focus on the secretome of STEC and related enteropathotypes, which are relevant to the colonisation of biotic and abiotic surfaces. Considering the wealth of potential protein trafficking mechanisms, the different combinations of colonisation factors and modulation of their expression is further emphasised with regard to the ecophysiology of STEC. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Improved annotation through genome-scale metabolic modeling of Aspergillus oryzae
Vongsangnak, Wanwipa; Olsen, Peter; Hansen, Kim; Krogsgaard, Steen; Nielsen, Jens
2008-01-01
Background Since ancient times the filamentous fungus Aspergillus oryzae has been used in the fermentation industry for the production of fermented sauces and the production of industrial enzymes. Recently, the genome sequence of A. oryzae with 12,074 annotated genes was released but the number of hypothetical proteins accounted for more than 50% of the annotated genes. Considering the industrial importance of this fungus, it is therefore valuable to improve the annotation and further integrate genomic information with biochemical and physiological information available for this microorganism and other related fungi. Here we proposed the gene prediction by construction of an A. oryzae Expressed Sequence Tag (EST) library, sequencing and assembly. We enhanced the function assignment by our developed annotation strategy. The resulting better annotation was used to reconstruct the metabolic network leading to a genome scale metabolic model of A. oryzae. Results Our assembled EST sequences we identified 1,046 newly predicted genes in the A. oryzae genome. Furthermore, it was possible to assign putative protein functions to 398 of the newly predicted genes. Noteworthy, our annotation strategy resulted in assignment of new putative functions to 1,469 hypothetical proteins already present in the A. oryzae genome database. Using the substantially improved annotated genome we reconstructed the metabolic network of A. oryzae. This network contains 729 enzymes, 1,314 enzyme-encoding genes, 1,073 metabolites and 1,846 (1,053 unique) biochemical reactions. The metabolic reactions are compartmentalized into the cytosol, the mitochondria, the peroxisome and the extracellular space. Transport steps between the compartments and the extracellular space represent 281 reactions, of which 161 are unique. The metabolic model was validated and shown to correctly describe the phenotypic behavior of A. oryzae grown on different carbon sources. Conclusion A much enhanced annotation of the A. oryzae genome was performed and a genome-scale metabolic model of A. oryzae was reconstructed. The model accurately predicted the growth and biomass yield on different carbon sources. The model serves as an important resource for gaining further insight into our understanding of A. oryzae physiology. PMID:18500999
Mercx, Sébastien; Smargiasso, Nicolas; Chaumont, François; De Pauw, Edwin; Boutry, Marc; Navarre, Catherine
2017-01-01
Plants or plant cells can be used to produce pharmacological glycoproteins such as antibodies or vaccines. However these proteins carry N-glycans with plant-typical residues [β(1,2)-xylose and core α(1,3)-fucose], which can greatly impact the immunogenicity, allergenicity, or activity of the protein. Two enzymes are responsible for the addition of plant-specific glycans: β(1,2)-xylosyltransferase (XylT) and α(1,3)-fucosyltransferase (FucT). Our aim consisted of knocking-out two XylT genes and four FucT genes (12 alleles altogether) in Nicotiana tabacum BY-2 suspension cells using CRISPR/Cas9. Three XylT and six FucT sgRNAs were designed to target conserved regions. After transformation of N. tabacum BY-2 cells with genes coding for sgRNAs, Cas9, and a selectable marker (bar), transgenic lines were obtained and their extracellular as well as intracellular protein complements were analyzed by Western blotting using antibodies recognizing β(1,2)-xylose and α(1,3)-fucose. Three lines showed a strong reduction of β(1,2)-xylose and α(1,3)-fucose, while two lines were completely devoid of them, indicating complete gene inactivation. The absence of these carbohydrates was confirmed by mass spectrometry analysis of the extracellular proteins. PCR amplification and sequencing of the targeted region indicated small INDEL and/or deletions between the target sites. The KO lines did not show any particular morphology and grew as the wild-type. One KO line was transformed with genes encoding a human IgG2 antibody. The IgG2 expression level was as high as in a control transformant which had not been glycoengineered. The IgG glycosylation profile determined by mass spectrometry confirmed that no β(1,2)-xylose or α(1,3)-fucose were present on the glycosylation moiety and that the dominant glycoform was the GnGn structure. These data represent an important step toward humanizing the glycosylation of pharmacological proteins expressed in N. tabacum BY-2 cells. PMID:28396675
Mercx, Sébastien; Smargiasso, Nicolas; Chaumont, François; De Pauw, Edwin; Boutry, Marc; Navarre, Catherine
2017-01-01
Plants or plant cells can be used to produce pharmacological glycoproteins such as antibodies or vaccines. However these proteins carry N -glycans with plant-typical residues [β(1,2)-xylose and core α(1,3)-fucose], which can greatly impact the immunogenicity, allergenicity, or activity of the protein. Two enzymes are responsible for the addition of plant-specific glycans: β(1,2)-xylosyltransferase (XylT) and α(1,3)-fucosyltransferase (FucT). Our aim consisted of knocking-out two XylT genes and four FucT genes (12 alleles altogether) in Nicotiana tabacum BY-2 suspension cells using CRISPR/Cas9. Three XylT and six FucT sgRNAs were designed to target conserved regions. After transformation of N. tabacum BY-2 cells with genes coding for sgRNAs, Cas9, and a selectable marker ( bar ), transgenic lines were obtained and their extracellular as well as intracellular protein complements were analyzed by Western blotting using antibodies recognizing β(1,2)-xylose and α(1,3)-fucose. Three lines showed a strong reduction of β(1,2)-xylose and α(1,3)-fucose, while two lines were completely devoid of them, indicating complete gene inactivation. The absence of these carbohydrates was confirmed by mass spectrometry analysis of the extracellular proteins. PCR amplification and sequencing of the targeted region indicated small INDEL and/or deletions between the target sites. The KO lines did not show any particular morphology and grew as the wild-type. One KO line was transformed with genes encoding a human IgG2 antibody. The IgG2 expression level was as high as in a control transformant which had not been glycoengineered. The IgG glycosylation profile determined by mass spectrometry confirmed that no β(1,2)-xylose or α(1,3)-fucose were present on the glycosylation moiety and that the dominant glycoform was the GnGn structure. These data represent an important step toward humanizing the glycosylation of pharmacological proteins expressed in N. tabacum BY-2 cells.
Chen, Y M; Zhu, Y; Lin, E C
1987-12-01
In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.
Xu, Aishi; Li, Guang; Yang, Dong; Wu, Songfeng; Ouyang, Hongsheng; Xu, Ping; He, Fuchu
2015-12-04
Although the "missing protein" is a temporary concept in C-HPP, the biological information for their "missing" could be an important clue in evolutionary studies. Here we classified missing-protein-encoding genes into two groups, the genes encoding PE2 proteins (with transcript evidence) and the genes encoding PE3/4 proteins (with no transcript evidence). These missing-protein-encoding genes distribute unevenly among different chromosomes, chromosomal regions, or gene clusters. In the view of evolutionary features, PE3/4 genes tend to be young, spreading at the nonhomology chromosomal regions and evolving at higher rates. Interestingly, there is a higher proportion of singletons in PE3/4 genes than the proportion of singletons in all genes (background) and OTCSGs (organ, tissue, cell type-specific genes). More importantly, most of the paralogous PE3/4 genes belong to the newly duplicated members of the paralogous gene groups, which mainly contribute to special biological functions, such as "smell perception". These functions are heavily restricted into specific type of cells, tissues, or specific developmental stages, acting as the new functional requirements that facilitated the emergence of the missing-protein-encoding genes during evolution. In addition, the criteria for the extremely special physical-chemical proteins were first set up based on the properties of PE2 proteins, and the evolutionary characteristics of those proteins were explored. Overall, the evolutionary analyses of missing-protein-encoding genes are expected to be highly instructive for proteomics and functional studies in the future.
Miao, Ting; Wan, Zixuan; Sun, Lina; Li, Xiaoni; Xing, Lili; Bai, Yucen; Wang, Fang; Yang, Hongsheng
2017-10-01
Remodeling of extracellular matrix (ECM) regulated by matrix metalloproteinases (MMPs) is essential for tissue regeneration. In the present study, we used immunohistochemistry (IHC) techniques against ECM components to reveal changes of ECM during intestine regeneration of Apostichopus japonicus. The expression of collagen I and laminin reduced apparently from the eviscerated intestine, while fibronectin exhibited continuous expression in all regeneration stages observed. Meanwhile, we cloned two MMP genes from A. japonicus by RACE PCR. The full-length cDNA of ajMMP-2 like is 2733bp and contains a predicted open reading frame (ORF) of 1716bp encoding 572 amino acids. The full-length cDNA of ajMMP-16 like is 2705bp and contains an ORF of 1452bp encoding 484 amino acids. The predicted protein sequences of each MMP contain two conserved domains, ZnMc_MMP and HX. Homology and phylogenetic analysis revealed that ajMMP-2 like and ajMMP-16 like share high sequence similarity with MMP-2 and MMP-16 from Strongylocentrotus purpuratus, respectively. Then we investigated spatio-temporal expression of ajMMP-2 like and ajMMP-16 like during different regeneration stages by qRT-PCR and IHC. The expression pattern of them showed a roughly opposite trend from that of ECM components. According to our results, a fibronectin-dominate temporary matrix is created in intestine regeneration, and it might provide structural integrity for matrix and promote cell movement. We also hypothesize that ajMMP-2 like and ajMMP-16 like could accelerate cell migration and regulate interaction between ECM components and growth factors. This work provides new evidence of ECM and MMPs involvement in sea cucumber regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.
Role for transforming growth factor-beta1 in alport renal disease progression.
Sayers, R; Kalluri, R; Rodgers, K D; Shield, C F; Meehan, D T; Cosgrove, D
1999-11-01
Alport syndrome results from mutations in either the alpha3(IV), alpha4(IV), or alpha5(IV) collagen genes. The disease is characterized by a progressive glomerulonephritis usually associated with a high-frequency sensorineural hearing loss. A mouse model for an autosomal form of Alport syndrome [collagen alpha3(IV) knockout] was produced and characterized. In this study, the model was exploited to demonstrate a potential role for transforming growth factor-beta1 (TGF-beta1) in Alport renal disease pathogenesis. Kidneys from normal and Alport mice, taken at different stages during the course of renal disease progression, were analyzed by Northern blot, in situ hybridization, and immunohistology for expression of TGF-beta1 and components of the extracellular matrix. Normal and Alport human kidney was examined for TGF-beta1 expression using RNase protection. The mRNAs encoding TGF-beta1 (in both mouse and human), entactin, fibronectin, and the collagen alpha1(IV) and alpha2(IV) chains were significantly induced in total kidney as a function of Alport renal disease progression. The induction of these specific mRNAs was observed in the glomerular podocytes of animals with advanced disease. Type IV collagen, laminin-1, and fibronectin were markedly elevated in the tubulointerstitium at 10 weeks, but not at 6 weeks, suggesting that elevated expression of specific mRNAs on Northern blots reflects events associated with tubulointerstitial fibrosis. The concomitant accumulation of mRNAs encoding TGF-beta1 and extracellular matrix components in the podocytes of diseased kidneys may reflect key events in Alport renal disease progression. These data suggest a role for TGF-beta1 in both glomerular and tubulointerstitial damage associated with Alport syndrome.
Frattini, Paola; Villa, Chiara; De Santis, Francesca; Meregalli, Mirella; Belicchi, Marzia; Erratico, Silvia; Bella, Pamela; Raimondi, Manuela Teresa; Lu, Qilong; Torrente, Yvan
2017-10-01
α-Dystroglycanopathies are a group of muscular dystrophies characterized by α-DG hypoglycosylation and reduced extracellular ligand-binding affinity. Among other genes involved in the α-DG glycosylation process, fukutin related protein (FKRP) gene mutations generate a wide range of pathologies from mild limb girdle muscular dystrophy 2I (LGMD2I), severe congenital muscular dystrophy 1C (MDC1C), to Walker-Warburg Syndrome and Muscle-Eye-Brain disease. FKRP gene encodes for a glycosyltransferase that in vivo transfers a ribitol phosphate group from a CDP -ribitol present in muscles to α-DG, while in vitro it can be secreted as monomer of 60kDa. Consistently, new evidences reported glycosyltransferases in the blood, freely circulating or wrapped within vesicles. Although the physiological function of blood stream glycosyltransferases remains unclear, they are likely released from blood borne or distant cells. Thus, we hypothesized that freely or wrapped FKRP might circulate as an extracellular glycosyltransferase, able to exert a "glycan remodelling" process, even at distal compartments. Interestingly, we firstly demonstrated a successful transduction of MDC1C blood-derived CD133+ cells and FKRP L276IKI mouse derived satellite cells by a lentiviral vector expressing the wild-type of human FKRP gene. Moreover, we showed that LV-FKRP cells were driven to release exosomes carrying FKRP. Similarly, we observed the presence of FKRP positive exosomes in the plasma of FKRP L276IKI mice intramuscularly injected with engineered satellite cells. The distribution of FKRP protein boosted by exosomes determined its restoration within muscle tissues, an overall recovery of α-DG glycosylation and improved muscle strength, suggesting a systemic supply of FKRP protein acting as glycosyltransferase. © The Author 2017. Published by Oxford University Press.
Mayuzumi, N; Ikeda, S; Kawada, H; Fan, P S; Ogawa, H
2005-04-01
Darier disease (DD) and Hailey-Hailey disease (HHD) are autosomal dominantly inherited skin disorders that histologically share the characteristics of suprabasal separation and acantholysis of epidermal keratinocytes. Various mutations in the DD gene (ATP2A2) and the HHD gene (ATP2C1) (respectively encoding the calcium pumps of the sarco/endoplasmic reticulum and the Golgi apparatus) have recently been described in multiple families with DD and HHD. Mutations in ATP2A2 or ATP2C1 have been suggested as causing the conditions via the mechanism of haploinsufficiency. Ultraviolet (UV) B irradiation is thought to be an aggravating factor in both diseases. To examine the effects of various stimuli on ATP2A2 and ATP2C1 mRNA expression, and to examine the role of calcium pumps during keratinocyte differentiation. The effects of UVB irradiation, of UVB-inducible inflammatory cytokines produced by keratinocytes and of high-calcium medium (1.8 mmol L(-1) as opposed to 0.08 mmol L(-1) Ca2+) on ATP2A2 and ATP2C1 mRNA expression were quantified in cultured normal human keratinocytes using reverse transcription-polymerase chain reaction. Expression of ATP2A2 and ATP2C1 mRNA was suppressed immediately after exposure to UVB irradiation, and modulation of mRNA expression was achieved in keratinocytes cultured with proinflammatory cytokines. The mRNA expression of both genes was increased significantly after the shift to high extracellular Ca2+ concentration. The results suggest that modulation of ATP2A2 and ATP2C1 mRNA expression by UV or cytokines might contribute to the clinical presentations unique to DD and HHD, and that the controlled expression of these genes plays an important role in keratinocyte homeostasis, function and differentiation.
Averina, O V; Nezametdinova, V Z; Alekseeva, M G; Danilenko, V N
2012-11-01
The stability of inheriting several genes in the Russian commercial strain Bifidobacterium longum subsp. longum B379M during cultivation and maintenance under laboratory conditions has been studied. The examined genes code for probiotic characteristics, such as utilization of several sugars (lacA2 gene, encoding beta-galactosidase; ara gene, encoding arabinosidase; and galA gene, encoding arabinogalactan endo-beta-galactosidase); synthesis of bacteriocins (lans gene, encoding lanthionine synthetase); and mobile gene tet(W), conferring resistance to the antibiotic tetracycline. The other gene families studied include the genes responsible for signal transduction and adaptation to stress conditions in the majority of bacteria (serine/threonine protein kinases and the toxin-antitoxin systems of MazEF and RelBE types) and transcription regulators (genes encoding WhiB family proteins). Genomic DNA was analyzed by PCR using specially selected primers. A loss of the genes galA and tet(W) has been shown. It is proposed to expand the requirements on probiotic strains, namely, to control retention of the key probiotic genes using molecular biological methods.
Salzmann, Julie; Canestrelli, Corinne; Noble, Florence; Marie-Claire, Cynthia
2006-01-01
3,4-methylenedioxymethamphetamine (MDMA, ecstasy), a widely used recreational drug with psychoactive properties, induces both serotonin (5-HT) and dopamine (DA) release in the brain. However, little is known about its intracellular effects. We previously showed that MDMA rewarding effects in mice were dependent upon ERK activation and that dorsal striatum was a critical region for mediating ERK-dependent Egr1 MDMA-induced transcription. Here, we extend these findings by showing that MDMA is indeed able to activate ERK within this structure. To identify genes regulated by acute MDMA in the mice dorsal striatum, and selectively controlled by this kinase, we performed microarray experiments by using a selective inhibitor of ERK activation, SL327. Of the ~24,000 genes from the microarray, 27 showed altered expression after exposure to MDMA, and among these, 59% were partially or totally inhibited by SL327 pretreatment. Our results showed that the genes regulated by MDMA encode proteins that belong to transcription factors family, signalling pathways (phosphatases, cytoskeleton regulation), and synaptic functions. These early changes, and especially those controlled by ERK activation might play significant roles in the expression of many of the behaviours that occur following MDMA taking. PMID:16289835
An, Soo Hyun; Sohn, Kee Hoon; Choi, Hyong Woo; Hwang, In Sun; Lee, Sung Chul; Hwang, Byung Kook
2008-06-01
Pectin is one of the main components of the plant cell wall that functions as the primary barrier against pathogens. Among the extracellular pectinolytic enzymes, pectin methylesterase (PME) demethylesterifies pectin, which is secreted into the cell wall in a highly methylesterified form. Here, we isolated and functionally characterized the pepper (Capsicum annuum L.) gene CaPMEI1, which encodes a pectin methylesterase inhibitor protein (PMEI), in pepper leaves infected by Xanthomonas campestris pv. vesicatoria (Xcv). CaPMEI1 transcripts are localized in the xylem of vascular bundles in leaf tissues, and pathogens and abiotic stresses can induce differential expression of this gene. Purified recombinant CaPMEI1 protein not only inhibits PME, but also exhibits antifungal activity against some plant pathogenic fungi. Virus-induced gene silencing of CaPMEI1 in pepper confers enhanced susceptibility to Xcv, accompanied by suppressed expression of some defense-related genes. Transgenic Arabidopsis CaPMEI1-overexpression lines exhibit enhanced resistance to Pseudomonas syringae pv. tomato, mannitol and methyl viologen, but not to the biotrophic pathogen Hyaloperonospora parasitica. Together, these results suggest that CaPMEI1, an antifungal protein, may be involved in basal disease resistance, as well as in drought and oxidative stress tolerance in plants.
Kcnh1 Voltage-gated Potassium Channels Are Essential for Early Zebrafish Development*
Stengel, Rayk; Rivera-Milla, Eric; Sahoo, Nirakar; Ebert, Christina; Bollig, Frank; Heinemann, Stefan H.; Schönherr, Roland; Englert, Christoph
2012-01-01
The Kcnh1 gene encodes a voltage-gated potassium channel highly expressed in neurons and involved in tumor cell proliferation, yet its physiological roles remain unclear. We have used the zebrafish as a model to analyze Kcnh1 function in vitro and in vivo. We found that the kcnh1 gene is duplicated in teleost fish (i.e. kcnh1a and kcnh1b) and that both genes are maternally expressed during early development. In adult zebrafish, kcnh1a and kcnh1b have distinct expression patterns but share expression in brain and testis. Heterologous expression of both genes in Xenopus oocytes revealed a strong conservation of characteristic functional properties between human and fish channels, including a unique sensitivity to intracellular Ca2+/calmodulin and modulation of voltage-dependent gating by extracellular Mg2+. Using a morpholino antisense approach, we demonstrate a strong kcnh1 loss-of-function phenotype in developing zebrafish, characterized by growth retardation, delayed hindbrain formation, and embryonic lethality. This late phenotype was preceded by transcriptional up-regulation of known cell-cycle inhibitors (p21, p27, cdh2) and down-regulation of pro-proliferative factors, including cyclin D1, at 70% epiboly. These results reveal an unanticipated basic activity of kcnh1 that is crucial for early embryonic development and patterning. PMID:22927438
Jarvis, Eric E.; Roessler, Paul G.
1999-01-01
The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.
Human Genomic Signatures of Brain Oscillations During Memory Encoding.
Berto, Stefano; Wang, Guang-Zhong; Germi, James; Lega, Bradley C; Konopka, Genevieve
2018-05-01
Memory encoding is an essential step for all learning. However, the genetic and molecular mechanisms underlying human memory encoding remain poorly understood, and how this molecular framework permits the emergence of specific patterns of brain oscillations observed during mnemonic processing is unknown. Here, we directly compare intracranial electroencephalography recordings from the neocortex in individuals performing an episodic memory task with human gene expression from the same areas. We identify genes correlated with oscillatory memory effects across 6 frequency bands. These genes are enriched for autism-related genes and have preferential expression in neurons, in particular genes encoding synaptic proteins and ion channels, supporting the idea that the genes regulating voltage gradients are involved in the modulation of oscillatory patterns during successful memory encoding across brain areas. Memory-related genes are distinct from those correlated with other forms of cognitive processing and resting state fMRI. These data are the first to identify correlations between gene expression and active human brain states as well as provide a molecular window into memory encoding oscillations in the human brain.
Exo-Oligosaccharides of Rhizobium sp. Strain NGR234 Are Required for Symbiosis with Various Legumes
Staehelin, Christian; Forsberg, Lennart S.; D'Haeze, Wim; Gao, Mu-Yun; Carlson, Russell W.; Xie, Zhi-Ping; Pellock, Brett J.; Jones, Kathryn M.; Walker, Graham C.; Streit, Wolfgang R.; Broughton, William J.
2006-01-01
Rhizobia are nitrogen-fixing bacteria that establish endosymbiotic associations with legumes. Nodule formation depends on various bacterial carbohydrates, including lipopolysaccharides, K-antigens, and exopolysaccharides (EPS). An acidic EPS from Rhizobium sp. strain NGR234 consists of glucosyl (Glc), galactosyl (Gal), glucuronosyl (GlcA), and 4,6-pyruvylated galactosyl (PvGal) residues with β-1,3, β-1,4, β-1,6, α-1,3, and α-1,4 glycoside linkages. Here we examined the role of NGR234 genes in the synthesis of EPS. Deletions within the exoF, exoL, exoP, exoQ, and exoY genes suppressed accumulation of EPS in bacterial supernatants, a finding that was confirmed by chemical analyses. The data suggest that the repeating subunits of EPS are assembled by an ExoQ/ExoP/ExoF-dependent mechanism, which is related to the Wzy polymerization system of group 1 capsular polysaccharides in Escherichia coli. Mutation of exoK (NGRΩexoK), which encodes a putative glycanase, resulted in the absence of low-molecular-weight forms of EPS. Analysis of the extracellular carbohydrates revealed that NGRΩexoK is unable to accumulate exo-oligosaccharides (EOSs), which are O-acetylated nonasaccharide subunits of EPS having the formula Gal(Glc)5(GlcA)2PvGal. When used as inoculants, both the exo-deficient mutants and NGRΩexoK were unable to form nitrogen-fixing nodules on some hosts (e.g., Albizia lebbeck and Leucaena leucocephala), but they were able to form nitrogen-fixing nodules on other hosts (e.g., Vigna unguiculata). EOSs of the parent strain were biologically active at very low levels (yield in culture supernatants, ∼50 μg per liter). Thus, NGR234 produces symbiotically active EOSs by enzymatic degradation of EPS, using the extracellular endo-β-1,4-glycanase encoded by exoK (glycoside hydrolase family 16). We propose that the derived EOSs (and not EPS) are bacterial components that play a crucial role in nodule formation in various legumes. PMID:16923883
Ito, Mikako; Ohno, Kinji
2018-02-20
Endplate acetylcholinesterase (AChE) deficiency is a form of congenital myasthenic syndrome (CMS) caused by mutations in COLQ, which encodes collagen Q (ColQ). ColQ is an extracellular matrix (ECM) protein that anchors AChE to the synaptic basal lamina. Biglycan, encoded by BGN, is another ECM protein that binds to the dystrophin-associated protein complex (DAPC) on skeletal muscle, which links the actin cytoskeleton and ECM proteins to stabilize the sarcolemma during repeated muscle contractions. Upregulation of biglycan stabilizes the DPAC. Gene therapy can potentially ameliorate any disease that can be recapitulated in cultured cells. However, the difficulty of tissue-specific and developmental stage-specific regulated expression of transgenes, as well as the difficulty of introducing a transgene into all cells in a specific tissue, prevents us from successfully applying gene therapy to many human diseases. In contrast to intracellular proteins, an ECM protein is anchored to the target tissue via its specific binding affinity for protein(s) expressed on the cell surface within the target tissue. Exploiting this unique feature of ECM proteins, we developed protein-anchoring therapy in which a transgene product expressed even in remote tissues can be delivered and anchored to a target tissue using specific binding signals. We demonstrate the application of protein-anchoring therapy to two disease models. First, intravenous administration of adeno-associated virus (AAV) serotype 8-COLQ to Colq-deficient mice, resulting in specific anchoring of ectopically expressed ColQ-AChE at the NMJ, markedly improved motor functions, synaptic transmission, and the ultrastructure of the neuromuscular junction (NMJ). In the second example, Mdx mice, a model for Duchenne muscular dystrophy, were intravenously injected with AAV8-BGN. The treatment ameliorated motor deficits, mitigated muscle histopathologies, decreased plasma creatine kinase activities, and upregulated expression of utrophin and DAPC component proteins. We propose that protein-anchoring therapy could be applied to hereditary/acquired defects in ECM and secreted proteins, as well as therapeutic overexpression of such factors. Copyright © 2017 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.
Ghosh, Arpan C.; O’Connor, Michael B.
2014-01-01
The ability to maintain cellular and physiological metabolic homeostasis is key for the survival of multicellular organisms in changing environmental conditions. However, our understanding of extracellular signaling pathways that modulate metabolic processes remains limited. In this study we show that the Activin-like ligand Dawdle (Daw) is a major regulator of systemic metabolic homeostasis and cellular metabolism in Drosophila. We find that loss of canonical Smad signaling downstream of Daw leads to defects in sugar and systemic pH homeostasis. Although Daw regulates sugar homeostasis by positively influencing insulin release, we find that the effect of Daw on pH balance is independent of its role in insulin signaling and is caused by accumulation of organic acids that are primarily tricarboxylic acid (TCA) cycle intermediates. RNA sequencing reveals that a number of TCA cycle enzymes and nuclear-encoded mitochondrial genes including genes involved in oxidative phosphorylation and β-oxidation are up-regulated in the daw mutants, indicating either a direct or indirect role of Daw in regulating these genes. These findings establish Activin signaling as a major metabolic regulator and uncover a functional link between TGF-β signaling, insulin signaling, and metabolism in Drosophila. PMID:24706779
Sethuraman, G; Fassihi, H; Ashton, G H S; Bansal, A; Kabra, M; Sharma, V K; McGrath, J A
2005-05-01
Kindler syndrome is an inherited skin condition that presents with blistering followed by photosensitivity and a progressive poikiloderma. The disorder results from mutations in the KIND1 gene, encoding the protein kindlin-1, a recently characterized 677-amino acid protein involved in anchorage of the actin cytoskeleton to the extracellular matrix. We report the clinical features of an 11-year-old boy with Kindler syndrome from a consanguineous Indian family and the identification of a homozygous nonsense mutation (C468X) in exon 12 of the KIND1 gene in his genomic DNA. This mutation has not been described previously but is similar to the 17 previously published KIND1 mutations that are all predicted to lead to loss of kindlin-1 protein expression and function. The clinical features in this boy highlight the relevance of kindlin-1 in skin biology, specifically to epidermal adhesion and response to acute and chronic sun exposure. Delineation of this new pathogenic mutation in KIND1 is also useful for genetic counselling in this family and in assessing carrier status in unaffected family members.
Couvigny, Benoit; Kulakauskas, Saulius; Pons, Nicolas; Quinquis, Benoit; Abraham, Anne-Laure; Meylheuc, Thierry; Delorme, Christine; Renault, Pierre; Briandet, Romain; Lapaque, Nicolas; Guédon, Eric
2018-01-01
Biofilm formation is crucial for bacterial community development and host colonization by Streptococcus salivarius, a pioneer colonizer and commensal bacterium of the human gastrointestinal tract. This ability to form biofilms depends on bacterial adhesion to host surfaces, and on the intercellular aggregation contributing to biofilm cohesiveness. Many S. salivarius isolates auto-aggregate, an adhesion process mediated by cell surface proteins. To gain an insight into the genetic factors of S. salivarius that dictate host adhesion and biofilm formation, we developed a screening method, based on the differential sedimentation of bacteria in semi-liquid conditions according to their auto-aggregation capacity, which allowed us to identify twelve mutations affecting this auto-aggregation phenotype. Mutations targeted genes encoding (i) extracellular components, including the CshA surface-exposed protein, the extracellular BglB glucan-binding protein, the GtfE, GtfG and GtfH glycosyltransferases and enzymes responsible for synthesis of cell wall polysaccharides (CwpB, CwpK), (ii) proteins responsible for the extracellular localization of proteins, such as structural components of the accessory SecA2Y2 system (Asp1, Asp2, SecA2) and the SrtA sortase, and (iii) the LiaR transcriptional response regulator. These mutations also influenced biofilm architecture, revealing that similar cell-to-cell interactions govern assembly of auto-aggregates and biofilm formation. We found that BglB, CshA, GtfH and LiaR were specifically associated with bacterial auto-aggregation, whereas Asp1, Asp2, CwpB, CwpK, GtfE, GtfG, SecA2 and SrtA also contributed to adhesion to host cells and host-derived components, or to interactions with the human pathogen Fusobacterium nucleatum. Our study demonstrates that our screening method could also be used to identify genes implicated in the bacterial interactions of pathogens or probiotics, for which aggregation is either a virulence trait or an advantageous feature, respectively. PMID:29515553
Burns, Jorge S.; Kristiansen, Malthe; Kristensen, Lars P.; Larsen, Kenneth H.; Nielsen, Maria O.; Christiansen, Helle; Nehlin, Jan; Andersen, Jens S.; Kassem, Moustapha
2011-01-01
Background Acquisition of a blood supply is fundamental for extensive tumor growth. We recently described vascular heterogeneity in tumours derived from cell clones of a human mesenchymal stem cell (hMSC) strain (hMSC-TERT20) immortalized by retroviral vector mediated human telomerase (hTERT) gene expression. Histological analysis showed that cells of the most vascularized tumorigenic clone, -BD11 had a pericyte-like alpha smooth muscle actin (ASMA+) and CD146+ positive phenotype. Upon serum withdrawal in culture, -BD11 cells formed cord-like structures mimicking capillary morphogenesis. In contrast, cells of the poorly tumorigenic clone, -BC8 did not stain for ASMA, tumours were less vascularized and serum withdrawal in culture led to cell death. By exploring the heterogeneity in hMSC-TERT20 clones we aimed to understand molecular mechanisms by which mesenchymal stem cells may promote neovascularization. Methodology/Principal Findings Quantitative qRT-PCR analysis revealed similar mRNA levels for genes encoding the angiogenic cytokines VEGF and Angiopoietin-1 in both clones. However, clone-BD11 produced a denser extracellular matrix that supported stable ex vivo capillary morphogenesis of human endothelial cells and promoted in vivo neovascularization. Proteomic characterization of the -BD11 decellularized matrix identified 50 extracellular angiogenic proteins, including galectin-1. siRNA knock down of galectin-1 expression abrogated the ex vivo interaction between decellularized -BD11 matrix and endothelial cells. More stable shRNA knock down of galectin-1 expression did not prevent -BD11 tumorigenesis, but greatly reduced endothelial migration into -BD11 cell xenografts. Conclusions Decellularized hMSC matrix had significant angiogenic potential with at least 50 angiogenic cell surface and extracellular proteins, implicated in attracting endothelial cells, their adhesion and activation to form tubular structures. hMSC -BD11 surface galectin-1 expression was required to bring about matrix-endothelial interactions and for xenografted hMSC -BD11 cells to optimally recruit host vasculature. PMID:21779348
Ceapa, Corina; Davids, Mark; Ritari, Jarmo; Lambert, Jolanda; Wels, Michiel; Douillard, François P.; Smokvina, Tamara; de Vos, Willem M.; Knol, Jan; Kleerebezem, Michiel
2016-01-01
Lactobacillus rhamnosus is a diverse Gram-positive species with strains isolated from different ecological niches. Here, we report the genome sequence analysis of 40 diverse strains of L. rhamnosus and their genomic comparison, with a focus on the variable genome. Genomic comparison of 40 L. rhamnosus strains discriminated the conserved genes (core genome) and regions of plasticity involving frequent rearrangements and horizontal transfer (variome). The L. rhamnosus core genome encompasses 2,164 genes, out of 4,711 genes in total (the pan-genome). The accessory genome is dominated by genes encoding carbohydrate transport and metabolism, extracellular polysaccharides (EPS) biosynthesis, bacteriocin production, pili production, the cas system, and the associated clustered regularly interspaced short palindromic repeat (CRISPR) loci, and more than 100 transporter functions and mobile genetic elements like phages, plasmid genes, and transposons. A clade distribution based on amino acid differences between core (shared) proteins matched with the clade distribution obtained from the presence–absence of variable genes. The phylogenetic and variome tree overlap indicated that frequent events of gene acquisition and loss dominated the evolutionary segregation of the strains within this species, which is paralleled by evolutionary diversification of core gene functions. The CRISPR-Cas system could have contributed to this evolutionary segregation. Lactobacillus rhamnosus strains contain the genetic and metabolic machinery with strain-specific gene functions required to adapt to a large range of environments. A remarkable congruency of the evolutionary relatedness of the strains’ core and variome functions, possibly favoring interspecies genetic exchanges, underlines the importance of gene-acquisition and loss within the L. rhamnosus strain diversification. PMID:27358423
Scarless genome editing and stable inducible expression vectors for Geobacter sulfurreducens
Chan, Chi Ho; Levar, Caleb E.; Zacharoff, Lori; ...
2015-08-07
Metal reduction by members of the Geobacteraceae is encoded by multiple gene clusters, and the study of extracellular electron transfer often requires biofilm development on surfaces. Genetic tools that utilize polar antibiotic cassette insertions limit mutant construction and complementation. In addition, unstable plasmids create metabolic burdens that slow growth, and the presence of antibiotics such as kanamycin can interfere with the rate and extent of Geobacter biofilm growth. We report here genetic system improvements for the model anaerobic metal-reducing bacterium Geobacter sulfurreducens. A motile strain of G. sulfurreducens was constructed by precise removal of a transposon interrupting the fgrM flagellarmore » regulator gene using SacB/sucrose counterselection, and Fe(III) citrate reduction was eliminated by deletion of the gene encoding the inner membrane cytochrome imcH. We also show that RK2-based plasmids were maintained in G. sulfurreducens for over 15 generations in the absence of antibiotic selection in contrast to unstable pBBR1 plasmids. Therefore, we engineered a series of new RK2 vectors containing native constitutive Geobacter promoters, and modified one of these promoters for VanR-dependent induction by the small aromatic carboxylic acid vanillate. Inducible plasmids fully complemented Δ imcH mutants for Fe(III) reduction, Mn(IV) oxide reduction, and growth on poised electrodes. A real-time, high-throughput Fe(III) citrate reduction assay is described that can screen numerous G. sulfurreducens strain constructs simultaneously and shows the sensitivity of imcH expression by the vanillate system. Lastly, these tools will enable more sophisticated genetic studies in G. sulfurreducens without polar insertion effects or need for multiple antibiotics.« less
Kruse, Thomas; van de Pas, Bram A; Atteia, Ariane; Krab, Klaas; Hagen, Wilfred R; Goodwin, Lynne; Chain, Patrick; Boeren, Sjef; Maphosa, Farai; Schraa, Gosse; de Vos, Willem M; van der Oost, John; Smidt, Hauke; Stams, Alfons J M
2015-03-01
Desulfitobacterium dehalogenans is able to grow by organohalide respiration using 3-chloro-4-hydroxyphenyl acetate (Cl-OHPA) as an electron acceptor. We used a combination of genome sequencing, biochemical analysis of redox active components, and shotgun proteomics to study elements of the organohalide respiratory electron transport chain. The genome of Desulfitobacterium dehalogenans JW/IU-DC1(T) consists of a single circular chromosome of 4,321,753 bp with a GC content of 44.97%. The genome contains 4,252 genes, including six rRNA operons and six predicted reductive dehalogenases. One of the reductive dehalogenases, CprA, is encoded by a well-characterized cprTKZEBACD gene cluster. Redox active components were identified in concentrated suspensions of cells grown on formate and Cl-OHPA or formate and fumarate, using electron paramagnetic resonance (EPR), visible spectroscopy, and high-performance liquid chromatography (HPLC) analysis of membrane extracts. In cell suspensions, these components were reduced upon addition of formate and oxidized after addition of Cl-OHPA, indicating involvement in organohalide respiration. Genome analysis revealed genes that likely encode the identified components of the electron transport chain from formate to fumarate or Cl-OHPA. Data presented here suggest that the first part of the electron transport chain from formate to fumarate or Cl-OHPA is shared. Electrons are channeled from an outward-facing formate dehydrogenase via menaquinones to a fumarate reductase located at the cytoplasmic face of the membrane. When Cl-OHPA is the terminal electron acceptor, electrons are transferred from menaquinones to outward-facing CprA, via an as-yet-unidentified membrane complex, and potentially an extracellular flavoprotein acting as an electron shuttle between the quinol dehydrogenase membrane complex and CprA. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
van de Pas, Bram A.; Atteia, Ariane; Krab, Klaas; Hagen, Wilfred R.; Goodwin, Lynne; Chain, Patrick; Boeren, Sjef; Maphosa, Farai; Schraa, Gosse; de Vos, Willem M.; van der Oost, John; Smidt, Hauke
2014-01-01
Desulfitobacterium dehalogenans is able to grow by organohalide respiration using 3-chloro-4-hydroxyphenyl acetate (Cl-OHPA) as an electron acceptor. We used a combination of genome sequencing, biochemical analysis of redox active components, and shotgun proteomics to study elements of the organohalide respiratory electron transport chain. The genome of Desulfitobacterium dehalogenans JW/IU-DC1T consists of a single circular chromosome of 4,321,753 bp with a GC content of 44.97%. The genome contains 4,252 genes, including six rRNA operons and six predicted reductive dehalogenases. One of the reductive dehalogenases, CprA, is encoded by a well-characterized cprTKZEBACD gene cluster. Redox active components were identified in concentrated suspensions of cells grown on formate and Cl-OHPA or formate and fumarate, using electron paramagnetic resonance (EPR), visible spectroscopy, and high-performance liquid chromatography (HPLC) analysis of membrane extracts. In cell suspensions, these components were reduced upon addition of formate and oxidized after addition of Cl-OHPA, indicating involvement in organohalide respiration. Genome analysis revealed genes that likely encode the identified components of the electron transport chain from formate to fumarate or Cl-OHPA. Data presented here suggest that the first part of the electron transport chain from formate to fumarate or Cl-OHPA is shared. Electrons are channeled from an outward-facing formate dehydrogenase via menaquinones to a fumarate reductase located at the cytoplasmic face of the membrane. When Cl-OHPA is the terminal electron acceptor, electrons are transferred from menaquinones to outward-facing CprA, via an as-yet-unidentified membrane complex, and potentially an extracellular flavoprotein acting as an electron shuttle between the quinol dehydrogenase membrane complex and CprA. PMID:25512312
Kerr, Christine L.; Huang, Jian; Williams, Trevor; West-Mays, Judith A.
2012-01-01
Purpose. The signaling pathways and transcriptional effectors responsible for directing mammalian lens development provide key regulatory molecules that can inform our understanding of human eye defects. The hedgehog genes encode extracellular signaling proteins responsible for patterning and tissue formation during embryogenesis. Signal transduction of this pathway is mediated through activation of the transmembrane proteins smoothened and patched, stimulating downstream signaling resulting in the activation or repression of hedgehog target genes. Hedgehog signaling is implicated in eye development, and defects in hedgehog signaling components have been shown to result in defects of the retina, iris, and lens. Methods. We assessed the consequences of constitutive hedgehog signaling in the developing mouse lens using Cre-LoxP technology to express the conditional M2 smoothened allele in the embryonic head and lens ectoderm. Results. Although initial lens development appeared normal, morphological defects were apparent by E12.5 and became more significant at later stages of embryogenesis. Altered lens morphology correlated with ectopic expression of FoxE3, which encodes a critical gene required for human and mouse lens development. Later, inappropriate expression of the epithelial marker Pax6, and as well as fiber cell markers c-maf and Prox1 also occurred, indicating a failure of appropriate lens fiber cell differentiation accompanied by altered lens cell proliferation and cell death. Conclusions. Our findings demonstrate that the ectopic activation of downstream effectors of the hedgehog signaling pathway in the mouse lens disrupts normal fiber cell differentiation by a mechanism consistent with a sustained epithelial cellular developmental program driven by FoxE3. PMID:22491411
Rizzo, Francesca; Coffman, James A; Arnone, Maria Ina
2016-08-01
Elk proteins are Ets family transcription factors that regulate cell proliferation, survival, and differentiation in response to ERK (extracellular-signal regulated kinase)-mediated phosphorylation. Here we report the embryonic expression and function of Sp-Elk, the single Elk gene of the sea urchin Strongylocentrotus purpuratus. Sp-Elk is zygotically expressed throughout the embryo beginning at late cleavage stage, with peak expression occurring at blastula stage. Morpholino antisense-mediated knockdown of Sp-Elk causes blastula-stage developmental arrest and embryo disintegration due to apoptosis, a phenotype that is rescued by wild-type Elk mRNA. Development is also rescued by Elk mRNA encoding a serine to aspartic acid substitution (S402D) that mimics ERK-mediated phosphorylation of a conserved site that enhances DNA binding, but not by Elk mRNA encoding an alanine substitution at the same site (S402A). This demonstrates both that the apoptotic phenotype of the morphants is specifically caused by Elk depletion, and that phosphorylation of serine 402 of Sp-Elk is critical for its anti-apoptotic function. Knockdown of Sp-Elk results in under-expression of several regulatory genes involved in cell fate specification, cell cycle control, and survival signaling, including the transcriptional regulator Sp-Runt-1 and its target Sp-PKC1, both of which were shown previously to be required for cell survival during embryogenesis. Both Sp-Runt-1 and Sp-PKC1 have sequences upstream of their transcription start sites that specifically bind Sp-Elk. These results indicate that Sp-Elk is the signal-dependent activator of a feed-forward gene regulatory circuit, consisting also of Sp-Runt-1 and Sp-PKC1, which actively suppresses apoptosis in the early embryo. Copyright © 2016 Elsevier Inc. All rights reserved.
Wilson, Marlena M; Anderson, D Eric; Bernstein, Harris D
2015-01-01
Bacteroides fragilis is a widely distributed member of the human gut microbiome and an opportunistic pathogen. Cell surface molecules produced by this organism likely play important roles in colonization, communication with other microbes, and pathogenicity, but the protein composition of the outer membrane (OM) and the mechanisms used to transport polypeptides into the extracellular space are poorly characterized. Here we used LC-MS/MS to analyze the OM proteome and secretome of B. fragilis NCTC 9343 grown under laboratory conditions. Of the 229 OM proteins that we identified, 108 are predicted to be lipoproteins, and 61 are predicted to be TonB-dependent transporters. Based on their proximity to genes encoding TonB-dependent transporters, many of the lipoprotein genes likely encode proteins involved in nutrient or small molecule uptake. Interestingly, protease accessibility and biotinylation experiments indicated that an unusually large fraction of the lipoproteins are cell-surface exposed. We also identified three proteins that are members of a novel family of autotransporters, multiple potential type I protein secretion systems, and proteins that appear to be components of a type VI secretion apparatus. The secretome consisted of lipoproteins and other proteins that might be substrates of the putative type I or type VI secretion systems. Our proteomic studies show that B. fragilis differs considerably from well-studied Gram-negative bacteria such as Escherichia coli in both the spectrum of OM proteins that it produces and the range of secretion strategies that it utilizes.
Monitoring the Assembly of a Secreted Bacterial Virulence Factor Using Site-specific Crosslinking
Pavlova, Olga; Ieva, Raffaele; Bernstein, Harris D
2013-01-01
This article describes a method to detect and analyze dynamic interactions between a protein of interest and other factors in vivo. Our method is based on the amber suppression technology that was originally developed by Peter Schultz and colleagues1. An amber mutation is first introduced at a specific codon of the gene encoding the protein of interest. The amber mutant is then expressed in E. coli together with genes encoding an amber suppressor tRNA and an amino acyl-tRNA synthetase derived from Methanococcus jannaschii. Using this system, the photo activatable amino acid analog p-benzoylphenylalanine (Bpa) is incorporated at the amber codon. Cells are then irradiated with ultraviolet light to covalently link the Bpa residue to proteins that are located within 3-8 Å. Photocrosslinking is performed in combination with pulse-chase labeling and immunoprecipitation of the protein of interest in order to monitor changes in protein-protein interactions that occur over a time scale of seconds to minutes. We optimized the procedure to study the assembly of a bacterial virulence factor that consists of two independent domains, a domain that is integrated into the outer membrane and a domain that is translocated into the extracellular space, but the method can be used to study many different assembly processes and biological pathways in both prokaryotic and eukaryotic cells. In principle interacting factors and even specific residues of interacting factors that bind to a protein of interest can be identified by mass spectrometry. PMID:24378574
Jarvis, E.E.; Roessler, P.G.
1999-07-27
The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities. 8 figs.
The transcriptomic fingerprint of glucoamylase over-expression in Aspergillus niger
2012-01-01
Background Filamentous fungi such as Aspergillus niger are well known for their exceptionally high capacity for secretion of proteins, organic acids, and secondary metabolites and they are therefore used in biotechnology as versatile microbial production platforms. However, system-wide insights into their metabolic and secretory capacities are sparse and rational strain improvement approaches are therefore limited. In order to gain a genome-wide view on the transcriptional regulation of the protein secretory pathway of A. niger, we investigated the transcriptome of A. niger when it was forced to overexpression the glaA gene (encoding glucoamylase, GlaA) and secrete GlaA to high level. Results An A. niger wild-type strain and a GlaA over-expressing strain, containing multiple copies of the glaA gene, were cultivated under maltose-limited chemostat conditions (specific growth rate 0.1 h-1). Elevated glaA mRNA and extracellular GlaA levels in the over-expressing strain were accompanied by elevated transcript levels from 772 genes and lowered transcript levels from 815 genes when compared to the wild-type strain. Using GO term enrichment analysis, four higher-order categories were identified in the up-regulated gene set: i) endoplasmic reticulum (ER) membrane translocation, ii) protein glycosylation, iii) vesicle transport, and iv) ion homeostasis. Among these, about 130 genes had predicted functions for the passage of proteins through the ER and those genes included target genes of the HacA transcription factor that mediates the unfolded protein response (UPR), e.g. bipA, clxA, prpA, tigA and pdiA. In order to identify those genes that are important for high-level secretion of proteins by A. niger, we compared the transcriptome of the GlaA overexpression strain of A. niger with six other relevant transcriptomes of A. niger. Overall, 40 genes were found to have either elevated (from 36 genes) or lowered (from 4 genes) transcript levels under all conditions that were examined, thus defining the core set of genes important for ensuring high protein traffic through the secretory pathway. Conclusion We have defined the A. niger genes that respond to elevated secretion of GlaA and, furthermore, we have defined a core set of genes that appear to be involved more generally in the intensified traffic of proteins through the secretory pathway of A. niger. The consistent up-regulation of a gene encoding the acetyl-coenzyme A transporter suggests a possible role for transient acetylation to ensure correct folding of secreted proteins. PMID:23237452
McDonough, Emilykate; Lazinski, David W; Camilli, Andrew
2014-04-01
Vibrio cholerae, the causative agent of cholera, remains a threat to public health in areas with inadequate sanitation. As a waterborne pathogen, V. cholerae moves between two dissimilar environments, aquatic reservoirs and the intestinal tract of humans. Accordingly, this pathogen undergoes adaptive shifts in gene expression throughout the different stages of its lifecycle. One particular gene, xds, encodes a secreted exonuclease that was previously identified as being induced during infection. Here we sought to identify regulators responsible for the in vivo-specific induction of xds. A transcriptional fusion of xds to two consecutive antibiotic resistance genes was used to select transposon mutants that had inserted within or adjacent to regulatory genes and thereby caused increased expression of the xds fusion under non-inducing conditions. Large pools of selected insertion sites were sequenced in a high throughput manner using Tn-seq to identify potential mechanisms of xds regulation. Our selection identified the two-component system PhoB/R as the dominant activator of xds expression. In vitro validation confirmed that PhoB, a protein which is only active during phosphate limitation, was responsible for xds activation. Using xds expression as a biosensor of the extracellular phosphate level, we observed that the mouse small intestine is a phosphate-limited environment. © 2014 John Wiley & Sons Ltd.
Janssen, Jacob; Soule, Tanya
2016-01-01
Long-wavelength ultraviolet radiation (UVA) can damage cells through photooxidative stress, leading to harmful photosensitized proteins and pigments in cyanobacteria. To mitigate damage, some cyanobacteria secrete the UVA-absorbing pigment scytonemin into their extracellular sheath. Comparative genomic analyses suggest that scytonemin biosynthesis is regulated by the two-component regulatory system (TCRS) proteins encoded by Npun_F1277 and Npun_F1278 in the cyanobacterium Nostoc punctiforme ATCC 29133. To understand the dynamics of these genes, their expression was measured following exposure to UVA, UVB, high visible (VIS) irradiance and oxidative stress for 20, 40 and 60 min. Overall, both genes had statistically similar patterns of expression for all four conditions and were generally upregulated, except for those exposed to UVB by 60 min and for the cells under oxidative stress. The greatest UVA response was an upregulation by 20 min, while the response to UVB was the most dramatic and persisted through 40 min. High VIS irradiance resulted in a modest upregulation, while oxidative stress caused a slight downregulation. Both genes were also found to occur on the same transcript. These results demonstrate that these genes are positively responding to several light-associated conditions, which suggests that this TCRS may regulate more than just scytonemin biosynthesis under UVA stress. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Research progress on human genes involved in the pathogenesis of glaucoma (Review).
Wang, Hong-Wei; Sun, Peng; Chen, Yao; Jiang, Li-Ping; Wu, Hui-Ping; Zhang, Wen; Gao, Feng
2018-05-23
Glaucoma is the leading cause of irreversible blindness globally. It is known that the incidence of glaucoma is closely associated with inheritance. A large number of studies have suggested that genetic factors are involved in the occurrence and development of glaucoma, and even affect the drug sensitivity and prognosis of glaucoma. In the present review, 22 loci of glaucoma are presented, including the relevant genes (myocilin, interleukin 20 receptor subunit B, optineurin, ankyrin repeat‑ and SOCS box‑containing protein 10, WD repeat‑containing protein 36, EGF‑containing fibulin‑like extracellular matrix protein 1, neurotrophin 4, TANK‑binding kinase 1, cytochrome P450 subfamily I polypeptide 1, latent transforming growth factor β binding protein 2 and TEK tyrosine kinase endothelial) and 74 other genes (including toll‑like receptor 4, sine oculis homeobox Drosophila homolog of 1, doublecortin‑like kinase 1, RE repeats‑encoding gene, retinitis pigmentosa GTPase regulator‑interacting protein, lysyl oxidase‑like protein 1, heat‑shock 70‑kDa protein 1A, baculoviral IAP repeat‑containing protein 6, 5,10‑methylenetetrahydrofolate reductase and nitric oxide synthase 3 and nanophthalmos 1) that are more closely associated with glaucoma. The pathogenesis of these glaucoma‑associated genes, glaucomatous genetics and genetic approaches, as well as glaucomatous risk factors, including increasing age, glaucoma family history, high myopia, diabetes, ocular trauma, smoking, intraocular pressure increase and/or fluctuation were also discussed.
Lin, Sue; Huang, Li; Yu, Xiaolin; Xiong, Xingpeng; Yue, Xiaoyan; Liu, Tingting; Liang, Ying; Lv, Meiling; Cao, Jiashu
2017-02-01
Two homologous genes, Brassica campestris Male Fertility 23a (BcMF23a) and Brassica campestris Male Fertility 23b (BcMF23b), encoding putative pectin methylesterases (PMEs) were isolated from Brassica campestris ssp. chinensis (syn. Brassica rapa ssp. chinensis). These two genes sharing high sequence identity with each other were highly expressed in the fertile flower buds but silenced in the sterile ones of genic male sterile line system ('Bcajh97-01A/B'). Results of RT-PCR and in situ hybridization suggested that BcMF23a and BcMF23b were pollen-expressed genes, whose transcripts were first detected at the binucleate pollen and maintained throughout to the mature pollen grains. Western blot indicated that both of the putative BcMF23a and BcMF23b proteins are approximately 40 kDa, which exhibited extracellular localization revealed by transient expression analysis in the onion epidermal cells. The promoter of BcMF23a was active specifically in pollen during the late pollen developmental stages, while, in addition to the pollen, BcMF23b promoter drove an extra gene expression in the valve margins, abscission layer at the base of the first true leaves, taproot and lateral roots in seedlings.
Isolation, phylogeny and evolution of the SymRK gene in the legume genus Lupinus L.
Mahé, Frédéric; Markova, Dragomira; Pasquet, Rémy; Misset, Marie-Thérèse; Aïnouche, Abdelkader
2011-07-01
SymRK is one of the key genes involved in initial steps of legume symbiotic association with fungi (mycorrhization) and nitrogen-fixing bacteria (nodulation). A large portion of the sequence encoding the extracellular domain of SYMRK was obtained for 38 lupine accessions and 2 outgroups in order to characterize this region, to evaluate its phylogenetic utility, and to examine whether its molecular evolutionary pattern is correlated with rhizobial diversity and specificity in Lupinus. The data suggested that, in Lupinus, SymRK is a single copy gene that shows good phylogenetic potential. Accordingly, SymRK provided additional support to previous molecular phylogenies, and shed additional light on relationships within the Old World group of Lupinus, especially among the African species. Similar to results of other studies, analyses of SymRK sequences were unable to resolve placement of the Florida unifoliolate lineage, whose relationship was weakly supported to either the Old or the New World lupines. Our data are consistent with strong purifying selection operating on SymRK in Lupinus, preserving rather than diversifying its function. Thus, although SymRK was demonstrated to be a vital gene in the early stages of the root-bacterial symbiotic associations, no evidence from present analyses indicate that this gene is involved in changes in rhizobial specificity in Lupinus. Copyright © 2011 Elsevier Inc. All rights reserved.
The Epidermis of Grhl3-Null Mice Displays Altered Lipid Processing and Cellular Hyperproliferation
Ting, Stephen B; Caddy, Jacinta; Wilanowski, Tomasz; Auden, Alana; Cunningham, John M; Elias, Peter M; Holleran, Walter M
2005-01-01
The presence of an impermeable surface barrier is an essential homeostatic mechanism in almost all living organisms. We have recently described a novel gene that is critical for the developmental instruction and repair of the integument in mammals. This gene, Grainy head-like 3 (Grhl3) is a member of a large family of transcription factors that are homologs of the Drosophila developmental gene grainy head (grh). Mice lacking Grhl3 fail to form an adequate skin barrier, and die at birth due to dehydration. These animals are also unable to repair the epidermis, exhibiting failed wound healing in both fetal and adult stages of development. These defects are due, in part, to diminished expression of a Grhl3 target gene, Transglutaminase 1 (TGase 1), which encodes a key enzyme involved in cross-linking of epidermal structural proteins and lipids into the cornified envelope (CE). Remarkably, the Drosophila grh gene plays an analogous role, regulating enzymes involved in the generation of quinones, which are essential for cross-linking structural components of the fly epidermis. In an extension of our initial analyses, we focus this report on additional defects observed in the Grhl3-null epidermis, namely defective extra-cellular lipid processing, altered lamellar lipid architecture and cellular hyperproliferation. These abnormalities suggest that Grhl3 plays diverse mechanistic roles in maintaining homeostasis in the skin. PMID:19521564
The epidermis of grhl3-null mice displays altered lipid processing and cellular hyperproliferation.
Ting, Stephen B; Caddy, Jacinta; Wilanowski, Tomasz; Auden, Alana; Cunningham, John M; Elias, Peter M; Holleran, Walter M; Jane, Stephen M
2005-04-01
The presence of an impermeable surface barrier is an essential homeostatic mechanism in almost all living organisms. We have recently described a novel gene that is critical for the developmental instruction and repair of the integument in mammals. This gene, Grainy head-like 3 (Grhl3) is a member of a large family of transcription factors that are homologs of the Drosophila developmental gene grainy head (grh). Mice lacking Grhl3 fail to form an adequate skin barrier, and die at birth due to dehydration. These animals are also unable to repair the epidermis, exhibiting failed wound healing in both fetal and adult stages of development. These defects are due, in part, to diminished expression of a Grhl3 target gene, Transglutaminase 1 (TGase 1), which encodes a key enzyme involved in cross-linking of epidermal structural proteins and lipids into the cornified envelope (CE). Remarkably, the Drosophila grh gene plays an analogous role, regulating enzymes involved in the generation of quinones, which are essential for cross-linking structural components of the fly epidermis. In an extension of our initial analyses, we focus this report on additional defects observed in the Grhl3-null epidermis, namely defective extra-cellular lipid processing, altered lamellar lipid architecture and cellular hyperproliferation. These abnormalities suggest that Grhl3 plays diverse mechanistic roles in maintaining homeostasis in the skin.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Tenascin-X, Collagen, Elastin and the Ehlers-Danlos Syndrome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bristow, James; Carey, William; Schalkwijk, Joost
2005-08-31
Tenascin-X is an extracellular matrix protein initially identified because of its overlap with the human CYP21B gene. Because studies of gene and protein function of other tenascins had been poorly predictive of essential functions in vivo, we used a genetic approach that critically relied on an understanding of the genomic locus to uncover an association between inactivating tenascin-X mutations and novel recessive and dominant forms of Ehlers-Danlos syndrome. Tenascin-X provides the first example of a gene outside of the fibrillar collagens and their processing enzymes that causes Ehlers-Danlos syndrome. Tenascin-X null mice recapitulate the skin findings of the human disease,more » confirming a causative role for this gene in Ehlers-Danlos syndrome. Further evaluation of these mice showed that tenascin-X is an important regulator of collagen deposition in vivo, suggesting a novel mechanism of disease in this form of Ehlers-Danlos syndrome. Further studies suggest that tenascin-X may do this through both direct and indirect interactions with the collagen fibril. Recent studies show that TNX effects on matrix extend beyond the collagen to the elastogenic pathway and matrix remodeling enzymes. Tenascin-X serves as a compelling example of how human experiments of nature can guide us to an understanding of genes whose function may not be evident from their sequence or in vitro studies of their encoded proteins.« less