Overexpression of gene encoding the key enzyme involved in proline-biosynthesis (PuP5CS) to improve salt tolerance in switchgrass (Panicum virgatum L.).

PubMed

Guan, Cong; Huang, Yan-Hua; Cui, Xin; Liu, Si-Jia; Zhou, Yun-Zhuan; Zhang, Yun-Wei

2018-05-25

Genetic improvement through overexpressing PuP5CS in switchgrass is feasible for enhancing plant salt stress tolerance. Switchgrass (Panicum virgatum L.) has developed into a dedicated bioenergy crop. To improve the biomass production of switchgrass grown on different types of soil, abiotic stress tolerance traits are considered for its genetic improvement. Proline accumulation is a widespread response when plants are subjected to abiotic stresses such as drought, cold and salinity. In plants, P5CS gene encodes the key regulatory enzyme that plays a crucial role in proline biosynthesis. Here, we introduced the PuP5CS gene (from Puccinellia chinampoensis) into switchgrass by Agrobacterium-mediated transformation. Transgenic lines overexpressing the PuP5CS gene showed phenotypic advantages, in leaf width, internode diameter, internode length, tiller numbers and precocious flowering under normal conditions, and the transgenic lines displayed better regenerative capacity in forming more tillers after harvest. Moreover, the PuP5CS gene enhanced the salt tolerance of transgenic switchgrass by altering a wide range of physiological responses. In accordance with the physiological results, histological analysis of cross sections through the leaf blade showed that the areas of bulliform cells and bundle sheath cells were significantly increased in PuP5CS-overexpressing leaves. The expression levels of ROS scavenging-associated genes in transgenic plants were higher than in control plants under salt stress. The results show that genetic improvement through overexpressing PuP5CS in switchgrass is feasible for enhancing plant stress tolerance.

Isolation of baker's yeast mutants with proline accumulation that showed enhanced tolerance to baking-associated stresses.

PubMed

Tsolmonbaatar, Ariunzaya; Hashida, Keisuke; Sugimoto, Yukiko; Watanabe, Daisuke; Furukawa, Shuhei; Takagi, Hiroshi

2016-12-05

During bread-making processes, yeast cells are exposed to baking-associated stresses such as freeze-thaw, air-drying, and high-sucrose concentrations. Previously, we reported that self-cloning diploid baker's yeast strains that accumulate proline retained higher-level fermentation abilities in both frozen and sweet doughs than the wild-type strain. Although self-cloning yeasts do not have to be treated as genetically modified yeasts, the conventional methods for breeding baker's yeasts are more acceptable to consumers than the use of self-cloning yeasts. In this study, we isolated mutants resistant to the proline analogue azetidine-2-carboxylate (AZC) derived from diploid baker's yeast of Saccharomyces cerevisiae. Some of the mutants accumulated a greater amount of intracellular proline, and among them, 5 mutants showed higher cell viability than that observed in the parent wild-type strain under freezing or high-sucrose stress conditions. Two of them carried novel mutations in the PRO1 gene encoding the Pro247Ser or Glu415Lys variant of γ-glutamyl kinase (GK), which is a key enzyme in proline biosynthesis in S. cerevisiae. Interestingly, we found that these mutations resulted in AZC resistance of yeast cells and desensitization to proline feedback inhibition of GK, leading to intracellular proline accumulation. Moreover, baker's yeast cells expressing the PRO1 P247S and PRO1 E415K gene were more tolerant to freezing stress than cells expressing the wild-type PRO1 gene. The approach described here could be a practical method for the breeding of proline-accumulating baker's yeasts with higher tolerance to baking-associated stresses. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification and Disruption of the proBA Locus in Listeria monocytogenes: Role of Proline Biosynthesis in Salt Tolerance and Murine Infection

PubMed Central

Sleator, Roy D.; Gahan, Cormac G. M.; Hill, Colin

2001-01-01

Intracellular accumulation of the amino acid proline has previously been linked to the salt tolerance and virulence potential of a number of bacteria. Taking advantage of the proBA mutant Escherichia coli CSH26, we identified a listerial proBA operon coding for enzymes functionally similar to the glutamyl kinase (GK) and glutamylphosphate reductase (GPR) enzyme complex which catalyzes the first and second steps of proline biosynthesis in E. coli. The first gene of the operon, proB, is predicted to encode GK, a 276-residue protein with a calculated molecular mass of 30.03 kDa and pl of 5.2. Distal to the promoter and overlapping the 3′ end of proB by 17 bp is proA, which encodes GPR, a 415-residue protein with a calculated molecular mass of 45.50 kDa (pl 5.3). Using this information, we created a chromosomal deletion mutant by allelic exchange which is auxotrophic for proline. This mutant was used to assess the contribution of proline anabolism to osmotolerance and virulence. While inactivation of proBA had no significant effect on virulence in mouse assays (either perorally or intraperitoneally), growth at low (2 to 4% NaCl) and high (>6% NaCl) salt concentrations in complex media was significantly reduced in the absence of efficient proline synthesis. We conclude that while proline biosynthesis plays little, if any, role in the intracellular life cycle and infectious nature of Listeria monocytogenes, it can play an important role in survival in osmolyte-depleted environments of elevated osmolarity. PMID:11375165

Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms.

PubMed

Iskandar, Hayati M; Casu, Rosanne E; Fletcher, Andrew T; Schmidt, Susanne; Xu, Jingsheng; Maclean, Donald J; Manners, John M; Bonnett, Graham D

2011-01-13

The ability of sugarcane to accumulate high concentrations of sucrose in its culm requires adaptation to maintain cellular function under the high solute load. We have investigated the expression of 51 genes implicated in abiotic stress to determine their expression in the context of sucrose accumulation by studying mature and immature culm internodes of a high sucrose accumulating sugarcane cultivar. Using a sub-set of eight genes, expression was examined in mature internode tissues of sugarcane cultivars as well as ancestral and more widely related species with a range of sucrose contents. Expression of these genes was also analysed in internode tissue from a high sucrose cultivar undergoing water deficit stress to compare effects of sucrose accumulation and water deficit. A sub-set of stress-related genes that are potentially associated with sucrose accumulation in sugarcane culms was identified through correlation analysis, and these included genes encoding enzymes involved in amino acid metabolism, a sugar transporter and a transcription factor. Subsequent analysis of the expression of these stress-response genes in sugarcane plants that were under water deficit stress revealed a different transcriptional profile to that which correlated with sucrose accumulation. For example, genes with homology to late embryogenesis abundant-related proteins and dehydrin were strongly induced under water deficit but this did not correlate with sucrose content. The expression of genes encoding proline biosynthesis was associated with both sucrose accumulation and water deficit, but amino acid analysis indicated that proline was negatively correlated with sucrose concentration, and whilst total amino acid concentrations increased about seven-fold under water deficit, the relatively low concentration of proline suggested that it had no osmoprotectant role in sugarcane culms. The results show that while there was a change in stress-related gene expression associated with sucrose accumulation, different mechanisms are responding to the stress induced by water deficit, because different genes had altered expression under water deficit.

Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms

PubMed Central

2011-01-01

Background The ability of sugarcane to accumulate high concentrations of sucrose in its culm requires adaptation to maintain cellular function under the high solute load. We have investigated the expression of 51 genes implicated in abiotic stress to determine their expression in the context of sucrose accumulation by studying mature and immature culm internodes of a high sucrose accumulating sugarcane cultivar. Using a sub-set of eight genes, expression was examined in mature internode tissues of sugarcane cultivars as well as ancestral and more widely related species with a range of sucrose contents. Expression of these genes was also analysed in internode tissue from a high sucrose cultivar undergoing water deficit stress to compare effects of sucrose accumulation and water deficit. Results A sub-set of stress-related genes that are potentially associated with sucrose accumulation in sugarcane culms was identified through correlation analysis, and these included genes encoding enzymes involved in amino acid metabolism, a sugar transporter and a transcription factor. Subsequent analysis of the expression of these stress-response genes in sugarcane plants that were under water deficit stress revealed a different transcriptional profile to that which correlated with sucrose accumulation. For example, genes with homology to late embryogenesis abundant-related proteins and dehydrin were strongly induced under water deficit but this did not correlate with sucrose content. The expression of genes encoding proline biosynthesis was associated with both sucrose accumulation and water deficit, but amino acid analysis indicated that proline was negatively correlated with sucrose concentration, and whilst total amino acid concentrations increased about seven-fold under water deficit, the relatively low concentration of proline suggested that it had no osmoprotectant role in sugarcane culms. Conclusions The results show that while there was a change in stress-related gene expression associated with sucrose accumulation, different mechanisms are responding to the stress induced by water deficit, because different genes had altered expression under water deficit. PMID:21226964

Screening for Novel Germline Rare Mutations Associated with Aggressive Prostate Cancer

DTIC Science & Technology

2015-12-01

amino acid substitution from Threonine (Thr) to Proline (Pro); while rs61756080 results to the amino acid substitution from Glycine (Gly) to Glutamic...Single nucleotide polymorphisms 20 in the gene encoding Krüppel-like factor 7 are associated with type 2 diabetes . Diabetologia. 2005 Jul;48(7

Self-cloning baker's yeasts that accumulate proline enhance freeze tolerance in doughs.

PubMed

Kaino, Tomohiro; Tateiwa, Tetsuya; Mizukami-Murata, Satomi; Shima, Jun; Takagi, Hiroshi

2008-09-01

We constructed self-cloning diploid baker's yeast strains by disrupting PUT1, encoding proline oxidase, and replacing the wild-type PRO1, encoding gamma-glutamyl kinase, with a pro1(D154N) or pro1(I150T) allele. The resultant strains accumulated intracellular proline and retained higher-level fermentation abilities in the frozen doughs than the wild-type strain. These results suggest that proline-accumulating baker's yeast is suitable for frozen-dough baking.

Genome-Wide Analyses and Functional Classification of Proline Repeat-Rich Proteins: Potential Role of eIF5A in Eukaryotic Evolution

PubMed Central

Mandal, Ajeet; Mandal, Swati; Park, Myung Hee

2014-01-01

The eukaryotic translation factor, eIF5A has been recently reported as a sequence-specific elongation factor that facilitates peptide bond formation at consecutive prolines in Saccharomyces cerevisiae, as its ortholog elongation factor P (EF-P) does in bacteria. We have searched the genome databases of 35 representative organisms from six kingdoms of life for PPP (Pro-Pro-Pro) and/or PPG (Pro-Pro-Gly)-encoding genes whose expression is expected to depend on eIF5A. We have made detailed analyses of proteome data of 5 selected species, Escherichia coli, Saccharomyces cerevisiae, Drosophila melanogaster, Mus musculus and Homo sapiens. The PPP and PPG motifs are low in the prokaryotic proteomes. However, their frequencies markedly increase with the biological complexity of eukaryotic organisms, and are higher in newly derived proteins than in those orthologous proteins commonly shared in all species. Ontology classifications of S. cerevisiae and human genes encoding the highest level of polyprolines reveal their strong association with several specific biological processes, including actin/cytoskeletal associated functions, RNA splicing/turnover, DNA binding/transcription and cell signaling. Previously reported phenotypic defects in actin polarity and mRNA decay of eIF5A mutant strains are consistent with the proposed role for eIF5A in the translation of the polyproline-containing proteins. Of all the amino acid tandem repeats (≥3 amino acids), only the proline repeat frequency correlates with functional complexity of the five organisms examined. Taken together, these findings suggest the importance of proline repeat-rich proteins and a potential role for eIF5A and its hypusine modification pathway in the course of eukaryotic evolution. PMID:25364902

Proline accumulation protects Saccharomyces cerevisiae cells in stationary phase from ethanol stress by reducing reactive oxygen species levels.

PubMed

Takagi, Hiroshi; Taguchi, Junpei; Kaino, Tomohiro

2016-08-01

During fermentation processes, Saccharomyces cerevisiae cells are exposed to multiple stresses, including a high concentration of ethanol that represents toxicity through intracellular reactive oxygen species (ROS) generation. We previously reported that proline protected yeast cells from damage caused by various stresses, such as freezing and ethanol. As an anti-oxidant, proline is suggested to scavenge intracellular ROS. In this study, we examined the role of intracellular proline during ethanol treatment in S. cerevisiae strains that accumulate different concentrations of proline. When cultured in YPD medium, there was a significant accumulation of proline in the put1 mutant strain, which is deficient in proline oxidase, in the stationary phase. Expression of the mutant PRO1 gene, which encodes the γ-glutamyl kinase variant (Asp154Asn or Ile150Thr) with desensitization to feedback inhibition by proline in the put1 mutant strain, showed a prominent increase in proline content as compared with that of the wild-type strain. The oxidation level was clearly increased in wild-type cells after exposure to ethanol, indicating that the generation of ROS occurred. Interestingly, proline accumulation significantly reduces the ROS level and increases the survival rate of yeast cells in the stationary phase under ethanol stress conditions. However, there was not a clear correlation between proline content and survival rate in yeast cells. An appropriate level of intracellular proline in yeast might be important for its stress-protective effect. Hence, the engineering of proline metabolism could be promising for breeding stress-tolerant industrial yeast strains. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Effect of l-Proline on Sake Brewing and Ethanol Stress in Saccharomyces cerevisiae

PubMed Central

Takagi, Hiroshi; Takaoka, Miki; Kawaguchi, Akari; Kubo, Yoshito

2005-01-01

During the fermentation of sake, cells of Saccharomyces cerevisiae are exposed to high concentrations of ethanol, thereby damaging the cell membrane and functional proteins. l-Proline protects yeast cells from damage caused by freezing or oxidative stress. In this study, we evaluated the role of intracellular l-proline in cells of S. cerevisiae grown under ethanol stress. An l-proline-accumulating laboratory strain carries a mutant allele of PRO1, pro1D154N, which encodes the Asp154Asn mutant γ-glutamyl kinase. This mutation increases the activity of γ-glutamyl kinase and γ-glutamyl phosphate reductase, which catalyze the first two steps of l-proline synthesis and which together may form a complex in vivo. When cultured in liquid medium in the presence of 9% and 18% ethanol under static conditions, the cell viability of the l-proline-accumulating laboratory strain is greater than the cell viability of the parent strain. This result suggests that intracellular accumulation of l-proline may confer tolerance to ethanol stress. We constructed a novel sake yeast strain by disrupting the PUT1 gene, which is required for l-proline utilization, and replacing the wild-type PRO1 allele with the pro1D154N allele. The resultant strain accumulated l-proline and was more tolerant to ethanol stress than was the control strain. We used the strain that could accumulate l-proline to brew sake containing five times more l-proline than what is found in sake brewed with the control strain, without affecting the fermentation profiles. PMID:16332860

Saccharomyces cerevisiae sigma 1278b has novel genes of the N-acetyltransferase gene superfamily required for L-proline analogue resistance.

PubMed

Takagi, H; Shichiri, M; Takemura, M; Mohri, M; Nakamori, S

2000-08-01

We discovered on the chromosome of Saccharomyces cerevisiae Sigma 1278b novel genes involved in L-proline analogue L-azetidine-2-carboxylic acid resistance which are not present in the standard laboratory strains. The 5.4 kb-DNA fragment was cloned from the genomic library of the L-azetidine-2-carboxylic acid-resistant mutant derived from a cross between S. cerevisiae strains S288C and Sigma 1278b. The nucleotide sequence of a 4.5-kb segment exhibited no identity with the sequence in the genome project involving strain S288C. Deletion analysis indicated that one open reading frame encoding a predicted protein of 229 amino acids is indispensable for L-azetidine-2-carboxylic acid resistance. The protein sequence was found to be a member of the N-acetyltransferase superfamily. Genomic Southern analysis and gene disruption showed that two copies of the novel gene with one amino acid change at position 85 required for L-azetidine-2-carboxylic acid resistance were present on chromosomes X and XIV of Sigma 1278b background strains. When this novel MPR1 or MPR2 gene (sigma 1278b gene for L-proline analogue resistance) was introduced into the other S. cerevisiae strains, all of the recombinants were resistant to L-azetidine-2-carboxylic acid, indicating that both MPR1 and MPR2 are expressed and have a global function in S. cerevisiae.

Inhibition of PKR Activation by the Proline-Rich RNA Binding Domain of the Herpes Simplex Virus Type 1 Us11 Protein

PubMed Central

Poppers, Jeremy; Mulvey, Matthew; Khoo, David; Mohr, Ian

2000-01-01

Upon activation by double-stranded RNA in virus-infected cells, the cellular PKR kinase phosphorylates the translation initiation factor eukaryotic initiation factor 2 (eIF2) and thereby inhibits protein synthesis. The γ34.5 and Us11 gene products encoded by herpes simplex virus type 1 (HSV-1) are dedicated to preventing the accumulation of phosphorylated eIF2. While the γ34.5 gene specifies a regulatory subunit for protein phosphatase 1α, the Us11 gene encodes an RNA binding protein that also prevents PKR activation. γ34.5 mutants fail to grow on a variety of human cells as phosphorylated eIF2 accumulates and protein synthesis ceases prior to the completion of the viral life cycle. We demonstrate that expression of a 68-amino-acid fragment of Us11 containing a novel proline-rich basic RNA binding domain allows for sustained protein synthesis and enhanced growth of γ34.5 mutants. Furthermore, this fragment is sufficient to inhibit activation of the cellular PKR kinase in a cell-free system, suggesting that the intrinsic activities of this small fragment, notably RNA binding and ribosome association, may be required to prevent PKR activation. PMID:11070019

Inhibition of PKR activation by the proline-rich RNA binding domain of the herpes simplex virus type 1 Us11 protein.

PubMed

Poppers, J; Mulvey, M; Khoo, D; Mohr, I

2000-12-01

Upon activation by double-stranded RNA in virus-infected cells, the cellular PKR kinase phosphorylates the translation initiation factor eukaryotic initiation factor 2 (eIF2) and thereby inhibits protein synthesis. The gamma 34.5 and Us11 gene products encoded by herpes simplex virus type 1 (HSV-1) are dedicated to preventing the accumulation of phosphorylated eIF2. While the gamma 34.5 gene specifies a regulatory subunit for protein phosphatase 1 alpha, the Us11 gene encodes an RNA binding protein that also prevents PKR activation. gamma 34.5 mutants fail to grow on a variety of human cells as phosphorylated eIF2 accumulates and protein synthesis ceases prior to the completion of the viral life cycle. We demonstrate that expression of a 68-amino-acid fragment of Us11 containing a novel proline-rich basic RNA binding domain allows for sustained protein synthesis and enhanced growth of gamma 34.5 mutants. Furthermore, this fragment is sufficient to inhibit activation of the cellular PKR kinase in a cell-free system, suggesting that the intrinsic activities of this small fragment, notably RNA binding and ribosome association, may be required to prevent PKR activation.

Identification of Novel Inherited Genetic Markers for Aggressive PCa in European and African Americans Using Whole Genome Sequencing

DTIC Science & Technology

2014-10-01

rs115393439 leads to the amino acid substitution from Threonine (Thr) to Proline (Pro); while rs61756080 results to the amino acid substitution from...gene encoding Krüppel-like factor 7 are associated with type 2 diabetes . Diabetologia. 2005 Jul;48(7):1315-22. Epub 2005 Jun 4. Karlsson R, Aly M

Role of proline and pyrroline-5-carboxylate metabolism in plant defense against invading pathogens

PubMed Central

Qamar, Aarzoo; Mysore, Kirankumar S.; Senthil-Kumar, Muthappa

2015-01-01

Pyrroline-5-carboxylate (P5C) is an intermediate product of both proline biosynthesis and catabolism. Recent evidences indicate that proline-P5C metabolism is tightly regulated in plants, especially during pathogen infection and abiotic stress. However, role of P5C and its metabolism in plants has not yet been fully understood. Studies indicate that P5C synthesized in mitochondria has a role in both resistance (R)-gene-mediated and non-host resistance against invading pathogens. Proline dehydrogenase and delta-ornithine amino transferase-encoding genes, both involved in P5C synthesis in mitochondria are implicated in defense response of Nicotiana benthamiana and Arabidopsis thaliana against bacterial pathogens. Such defense response is proposed to involve salicylic acid-dependent pathway, reactive oxygen species (ROS) and hypersensitive response (HR)-associated cell death. Recently HR, a form of programmed cell death (PCD), has been proposed to be induced by changes in mitochondrial P5C synthesis or the increase in P5C levels per se in plants inoculated with either a host pathogen carrying suitable avirulent (Avr) gene or a non-host pathogen. Consistently, A. thaliana mutant plants deficient in P5C catabolism showed HR like cell death when grown in external P5C or proline supplemented medium. Similarly, yeast and plant cells under oxidative stress were shown to increase ROS production and PCD due to increase in P5C levels. Similar mechanism has also been reported as one of the triggers for apoptosis in mammalian cells. This review critically analyzes results from various studies and enumerates the pathways for regulation of P5C levels in the plant cell, especially in mitochondria, during pathogen infection. Further, mechanisms regulating P5C- mediated defense responses, namely HR are outlined. This review also provides new insights into the differential role of proline-P5C metabolism in plants exposed to pathogen infection. PMID:26217357

Engineering of Glarea lozoyensis for Exclusive Production of the Pneumocandin B0 Precursor of the Antifungal Drug Caspofungin Acetate

PubMed Central

Chen, Li; Yue, Qun; Li, Yan; Niu, Xuemei; Xiang, Meichun; Wang, Wenzhao; Bills, Gerald F.

2014-01-01

Pneumocandins produced by the fungus Glarea lozoyensis are acylated cyclic hexapeptides of the echinocandin family. Pneumocandin B0 is the starting molecule for the first semisynthetic echinocandin antifungal drug, caspofungin acetate. In the wild-type strain, pneumocandin B0 is a minor fermentation product, and its industrial production was achieved by a combination of extensive mutation and medium optimization. The pneumocandin biosynthetic gene cluster was previously elucidated by a whole-genome sequencing approach. Knowledge of the biosynthetic cluster suggested an alternative way to produce exclusively pneumocandin B0. Disruption of GLOXY4, encoding a nonheme, α-ketoglutarate-dependent oxygenase, confirmed its involvement in l-leucine cyclization to form 4S-methyl-l-proline. The absence of 4S-methyl-l-proline abolishes pneumocandin A0 production, and 3S-hydroxyl-l-proline occupies the hexapeptide core's position 6, resulting in exclusive production of pneumocandin B0. Retrospective analysis of the GLOXY4 gene in a previously isolated pneumocandin B0-exclusive mutant (ATCC 74030) indicated that chemical mutagenesis disrupted the GLOXY4 gene function by introducing two amino acid mutations in GLOXY4. This one-step genetic manipulation can rationally engineer a high-yield production strain. PMID:25527531

Overexpression of GmHsp90s, a Heat Shock Protein 90 (Hsp90) Gene Family Cloning from Soybean, Decrease Damage of Abiotic Stresses in Arabidopsis thaliana

PubMed Central

Xue, Dong; Zhao, Jinming; Gai, Junyi; Guo, Na; Xing, Han

2013-01-01

Hsp90 is one of the most conserved and abundant molecular chaperones and is an essential component of the protective stress response; however, its roles in abiotic stress responses in soybean (Glycine max) remain obscure. Here, 12 GmHsp90 genes from soybean were identified and found to be expressed and to function differentially under abiotic stresses. The 12 GmHsp90 genes were isolated and named GmHsp90A1–GmHsp90A6, GmHsp90B1, GmHsp90B2, GmHsp90C1.1, GmHsp90C1.2, GmHsp90C2.1 and GmHsp90C2.2 based on their characteristics and high homology to other Hsp90s according to a new nomenclature system. Quantitative real-time PCR expression data revealed that all the genes exhibited higher transcript levels in leaves and could be strongly induced under heat, osmotic and salt stress but not cold stress. Overexpression of five typical genes (GmHsp90A2, GmHsp90A4, GmHsp90B1, GmHsp90C1.1 and GmHsp90C2.1) in Arabidopsis thaliana provided useful evidences that GmHsp90 genes can decrease damage of abiotic stresses. In addition, an abnormal accumulation of proline was detected in some transgenic Arabidopsis plants suggested overexpressing GmHsp90s may affect the synthesis and response system of proline. Our work represents a systematic determination of soybean genes encoding Hsp90s, and provides useful evidence that GmHsp90 genes function differently in response to abiotic stresses and may affect the synthesis and response system of proline. PMID:23936107

Discovery of new enzymes and metabolic pathways by using structure and genome context.

PubMed

Zhao, Suwen; Kumar, Ritesh; Sakai, Ayano; Vetting, Matthew W; Wood, B McKay; Brown, Shoshana; Bonanno, Jeffery B; Hillerich, Brandan S; Seidel, Ronald D; Babbitt, Patricia C; Almo, Steven C; Sweedler, Jonathan V; Gerlt, John A; Cronan, John E; Jacobson, Matthew P

2013-10-31

Assigning valid functions to proteins identified in genome projects is challenging: overprediction and database annotation errors are the principal concerns. We and others are developing computation-guided strategies for functional discovery with 'metabolite docking' to experimentally derived or homology-based three-dimensional structures. Bacterial metabolic pathways often are encoded by 'genome neighbourhoods' (gene clusters and/or operons), which can provide important clues for functional assignment. We recently demonstrated the synergy of docking and pathway context by 'predicting' the intermediates in the glycolytic pathway in Escherichia coli. Metabolite docking to multiple binding proteins and enzymes in the same pathway increases the reliability of in silico predictions of substrate specificities because the pathway intermediates are structurally similar. Here we report that structure-guided approaches for predicting the substrate specificities of several enzymes encoded by a bacterial gene cluster allowed the correct prediction of the in vitro activity of a structurally characterized enzyme of unknown function (PDB 2PMQ), 2-epimerization of trans-4-hydroxy-L-proline betaine (tHyp-B) and cis-4-hydroxy-D-proline betaine (cHyp-B), and also the correct identification of the catabolic pathway in which Hyp-B 2-epimerase participates. The substrate-liganded pose predicted by virtual library screening (docking) was confirmed experimentally. The enzymatic activities in the predicted pathway were confirmed by in vitro assays and genetic analyses; the intermediates were identified by metabolomics; and repression of the genes encoding the pathway by high salt concentrations was established by transcriptomics, confirming the osmolyte role of tHyp-B. This study establishes the utility of structure-guided functional predictions to enable the discovery of new metabolic pathways.

Reactive oxygen species dynamics in roots of salt sensitive and salt tolerant cultivars of rice.

PubMed

Saini, Shivani; Kaur, Navdeep; Pati, Pratap Kumar

2018-06-01

Salinity stress is one of the major constraints for growth and survival of plants that affects rice productivity worldwide. Hence, in the present study, roots of two contrasting salinity sensitive cultivars, IR64 (IR64, salt sensitive) and Luna Suvarna (LS, salt tolerant) were compared with regard to the levels of reactive oxygen species (ROS) to derive clues for their differential salt stress adaptation mechanisms. In our investigation, the tolerant cultivar exhibited longer primary roots, more lateral roots, higher root number leading to increased root biomass, with respect to IR64. It was observed that LS roots maintained higher level of H 2 O 2 in comparison to IR64. The activities of various enzymes involved in enzymatic antioxidant defense mechanism (SOD, CAT, GPX, DHAR and MDHAR) were found to be greater in LS roots. Further, the higher transcript level accumulation of genes encoding ROS generating (RbohA, RbohD and RbohE) and scavenging enzymes (Fe-SOD, Chloroplastic Cu/Zn-SOD, CAT and DHAR) were noticed in the roots of tolerant cultivar, LS. Moreover, the content of other stress markers such as total protein and proline were also elevated in LS roots. While, the expression of proline biosynthesis gene (P5CS) and proline catabolism gene (PDH) was observed to be lower in LS. Copyright © 2018. Published by Elsevier Inc.

Mutation in Pyrroline-5-Carboxylate Reductase 1 Gene in Families with Cutis Laxa Type 2

PubMed Central

Guernsey, Duane L.; Jiang, Haiyan; Evans, Susan C.; Ferguson, Meghan; Matsuoka, Makoto; Nightingale, Mathew; Rideout, Andrea L.; Provost, Sylvie; Bedard, Karen; Orr, Andrew; Dubé, Marie-Pierre; Ludman, Mark; Samuels, Mark E.

2009-01-01

Autosomal-recessive cutis laxa type 2 (ARCL2) is a multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin, joint laxity, and a general developmental delay. Cutis laxa includes a family of clinically overlapping conditions with confusing nomenclature, generally requiring molecular analyses for definitive diagnosis. Six genes are currently known to mutate to yield one of these related conditions. We ascertained a cohort of typical ARCL2 patients from a subpopulation isolate within eastern Canada. Homozygosity mapping with high-density SNP genotyping excluded all six known genes, and instead identified a single homozygous region near the telomere of chromosome 17, shared identically by state by all genotyped affected individuals from the families. A putative pathogenic variant was identified by direct DNA sequencing of genes within the region. The single nucleotide change leads to a missense mutation adjacent to a splice junction in the gene encoding pyrroline-5-carboxylate reductase 1 (PYCR1). Bioinformatic analysis predicted a pathogenic effect of the variant on splice donor site function. Skipping of the associated exon was confirmed in RNA from blood lymphocytes of affected homozygotes and heterozygous mutation carriers. Exon skipping leads to deletion of the reductase functional domain-coding region and an obligatory downstream frameshift. PYCR1 plays a critical role in proline biosynthesis. Pathogenicity of the genetic variant in PYCR1 is likely, given that a similar clinical phenotype has been documented for mutation carriers of another proline biosynthetic enzyme, pyrroline-5-carboxylate synthase. Our results support a significant role for proline in normal development. PMID:19576563

Prolidase is a critical enzyme for complete gliadin digestion in Tenebrio molitor larvae.

PubMed

Tereshchenkova, Valeriia F; Goptar, Irina A; Zhuzhikov, Dmitry P; Belozersky, Mikhail A; Dunaevsky, Yakov E; Oppert, Brenda; Filippova, Irina Yu; Elpidina, Elena N

2017-08-01

Prolidase is a proline-specific metallopeptidase that cleaves imidodipeptides with C-terminal Pro residue. Prolidase was purified and characterized from the Tenebrio molitor larval midgut. The enzyme was localized in the soluble fraction of posterior midgut tissues, corresponding to a predicted cytoplasmic localization of prolidase according to the structure of the mRNA transcript. Expression of genes encoding prolidase and the major digestive proline-specific peptidase (PSP)-dipeptidyl peptidase 4-were similar. The pH optimum of T. molitor prolidase was 7.5, and the enzyme was inhibited by Z-Pro, indicating that it belongs to type I prolidases. In mammals, prolidase is particularly important in the catabolism of a proline-rich protein-collagen. We propose that T. molitor larval prolidase is a critical enzyme for the final stages of digestion of dietary proline-rich gliadins, providing hydrolysis of imidodipeptides in the cytoplasm of midgut epithelial cells. We propose that the products of hydrolysis are absorbed from the luminal contents by peptide transporters, which we have annotated in the T. molitor larval gut transcriptome. The origin of prolidase substrates in the insect midgut is discussed in the context of overall success of grain feeding insects. © 2017 Wiley Periodicals, Inc.

DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

NASA Astrophysics Data System (ADS)

Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

1984-08-01

A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

PubMed Central

Wu, S; Kriz, A L; Widholm, J M

1994-01-01

The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490

A proline-to-histidine mutation in POU1F1 is associated with production traits in dairy cattle.

PubMed

Huang, W; Maltecca, C; Khatib, H

2008-10-01

POU class 1 homeobox 1 (POU1F1) is a member of the tissue-specific POU-containing transcription factor family. The expression of POU1F1 in mammalian pituitary gland controls the transcription of the genes encoding growth hormone, prolactin (PRL) and the subunits of thyroid-stimulating hormone. In addition, some genes in the JAK/STAT signalling pathway downstream of POU1F1 have been shown to be associated with different production traits in dairy cattle. To investigate whether the POU1F1 gene is associated with economically important traits in dairy cattle, a pooled DNA sequencing approach was used to identify single nucleotide polymorphisms (SNPs) in the gene. An SNP in exon 3 of POU1F1 that changes a proline to a histidine was identified. A total of 2141 individuals from two North American Holstein cattle resource populations were genotyped for this SNP using a modified PCR-RFLP method. Statistical analyses revealed significant association of POU1F1 variants with milk yield and productive life, which makes POU1F1 a possible candidate for marker-assisted selection in dairy cattle breeding programmes.

SlgA, encoded by the homolog of the human schizophrenia-associated gene PRODH, acts in clock neurons to regulate Drosophila aggression

PubMed Central

Zwarts, Liesbeth; Vulsteke, Veerle; Buhl, Edgar; Hodge, James J. L.

2017-01-01

ABSTRACT Mutations in the proline dehydrogenase gene PRODH are linked to behavioral alterations in schizophrenia and as part of DiGeorge and velo-cardio-facial syndromes, but the role of PRODH in their etiology remains unclear. Here, we establish a Drosophila model to study the role of PRODH in behavioral disorders. We determine the distribution of the Drosophila PRODH homolog slgA in the brain and show that knockdown and overexpression of human PRODH and slgA in the lateral neurons ventral (LNv) lead to altered aggressive behavior. SlgA acts in an isoform-specific manner and is regulated by casein kinase II (CkII). Our data suggest that these effects are, at least partially, due to effects on mitochondrial function. We thus show that precise regulation of proline metabolism is essential to drive normal behavior and we identify Drosophila aggression as a model behavior relevant for the study of the mechanisms that are impaired in neuropsychiatric disorders. PMID:28331058

Association of Circulating Transfer RNA fragments with antibody response to Mycoplasma bovis in beef cattle.

PubMed

Casas, Eduardo; Cai, Guohong; Kuehn, Larry A; Register, Karen B; McDaneld, Tara G; Neill, John D

2018-03-13

High throughput sequencing allows identification of small non-coding RNAs. Transfer RNA Fragments are a class of small non-coding RNAs, and have been identified as being involved in inhibition of gene expression. Given their role, it is possible they may be involved in mediating the infection-induced defense response in the host. Therefore, the objective of this study was to identify 5' transfer RNA fragments (tRF5s) associated with a serum antibody response to M. bovis in beef cattle. The tRF5s encoding alanine, glutamic acid, glycine, lysine, proline, selenocysteine, threonine, and valine were associated (P < 0.05) with antibody response against M. bovis. tRF5s encoding alanine, glutamine, glutamic acid, glycine, histidine, lysine, proline, selenocysteine, threonine, and valine were associated (P < 0.05) with season, which could be attributed to calf growth. There were interactions (P < 0.05) between antibody response to M. bovis and season for tRF5 encoding selenocysteine (anticodon UGA), proline (anticodon CGG), and glutamine (anticodon TTG). Selenocysteine is a rarely used amino acid that is incorporated into proteins by the opal stop codon (UGA), and its function is not well understood. Differential expression of tRF5s was identified between ELISA-positive and negative animals. Production of tRF5s may be associated with a host defense mechanism triggered by bacterial infection, or it may provide some advantage to a pathogen during infection of a host. Further studies are needed to establish if tRF5s could be used as a diagnostic marker of chronic exposure.

Production and characterization of two major Aspergillus oryzae secreted prolyl endopeptidases able to efficiently digest proline-rich peptides of gliadin.

PubMed

Eugster, Philippe J; Salamin, Karine; Grouzmann, Eric; Monod, Michel

2015-12-01

Prolyl endopeptidases are key enzymes in the digestion of proline-rich proteins. Fungal extracts rich in prolyl endopeptidases produced by a species such as Aspergillus oryzae used in food fermentation would be of particular interest for the development of an oral enzyme therapy product in patients affected by intolerance to gluten. Two major A. oryzae secreted prolyl endopeptidases of the MEROPS S28 peptidase family, AoS28A and AoS28B, were identified when this fungus was grown at acidic pH in a medium containing soy meal protein or wheat gliadin as the sole source of nitrogen. AoS28B was produced by 12 reference A. oryzae strains used in food fermentation. AoS28A was secreted by six of these 12 strains. This protease is the orthologue of the previously characterized Aspergillus fumigatus (AfuS28) and Aspergillus niger (AN-PEP) prolyl endopeptidases which are encoded by genes with a similar intron-exon structure. Large amounts of secreted AoS28A and AoS28B were obtained by gene overexpression in A. oryzae. AoS28A and AoS28B are endoproteases able to cleave N-terminally blocked proline substrates. Both enzymes very efficiently digested the proline-rich 33-mer of gliadin, the most representative immunotoxic peptide deriving from gliadin, with some differences in terms of specificity and optimal pH. Digestion of the gliadin peptide in short peptides with both enzymes was found to occur from its N terminus.

Calcium diacylglycerol guanine nucleotide exchange factor I (CalDAG-GEFI) gene mutations in a thrombopathic Simmental calf.

PubMed

Boudreaux, M K; Schmutz, S M; French, P S

2007-11-01

Simmental thrombopathia is an inherited platelet disorder that closely resembles the platelet disorders described in Basset Hounds and Eskimo Spitz dogs. Recently, two different mutations in the gene encoding calcium diacylglycerol guanine nucleotide exchange factor I (CalDAG-GEFI) were described to be associated with the Basset Hound and Spitz thrombopathia disorders, and a third distinct mutation was identified in CalDAG-GEFI in thrombopathic Landseers of European Continental Type. The gene encoding CalDAG-GEFI was sequenced using DNA obtained from normal cattle and from a thrombopathic calf studied in Canada. The affected calf was found to have a nucleotide change (c.701 T>C), which would result in the substitution of a proline for a leucine within structurally conserved region two (SCR2) of the catalytic domain of the protein. This change is likely responsible for the thrombopathic phenotype observed in Simmental cattle and underscores the critical nature of this signal transduction protein in platelets.

Two new mutations in the MTATP6 gene associated with Leigh syndrome.

PubMed

Moslemi, A-R; Darin, N; Tulinius, M; Oldfors, A; Holme, E

2005-10-01

In this study we have analyzed the mtDNA encoded ATPase 6 and 8 genes ( MTATP6 and MTATP8) in two children with Leigh syndrome (LS) and reduced Mg (2+) ATPase activity in muscle mitochondria. In patient 1, with a mild and reversible phenotype, mutational analysis revealed a heteroplasmic T --> C mutation at nt position 9185 (T9185C) in the MTATP6. The mutation resulted in substitution of a highly conserved leucine to proline at codon 220. The proportion of the mutation was > 97 % in the patient's blood and muscle and 85 % in blood of his asymptomatic mother. Patient 2, with severe clinical phenotype and death at 2 years of age, exhibited a novel heteroplasmic T9191C missense mutation in the MTATP6, which converted a highly conserved leucine to a proline at position 222 of the polypeptide. The proportion of the mutation was 90 % in fibroblasts and 94 % muscle tissue. This mutation was absent in the patient's parents and sister suggesting that the mutation was de novo. Our findings expand the spectrum of mutations causing LS and emphasize the role of MTATP6 gene mutations in pathogenesis of LS.

A R2R3-MYB transcription factor gene in common wheat (namely TaMYBsm1) involved in enhancement of drought tolerance in transgenic Arabidopsis.

PubMed

Li, Meng-Jun; Qiao, Yu; Li, Ya-Qing; Shi, Zhan-Liang; Zhang, Nan; Bi, Cai-Li; Guo, Jin-Kao

2016-11-01

We isolated the TaMYBsm1 genes, encoding R2R3-type MYB proteins in common wheat, aimed to uncover the possible molecular mechanisms related to drought response. The TaMYBsm1 genes, TaMYBsm1-A, TaMYBsm1-B and TaMYBsm1-D, were isolated and analyzed from the common wheat cultivar Shimai 15. Their expression patterns under PEG 6000 and mannitol were monitored by semi-quantitative RT-PCR and β-glucuronidase (Gus) assay. The function of TaMYBsm1-D under drought stress in transgenic Arabidopsis plants was investigated, and the germination rate, water loss rate, as well as the proline and malondialdehyde (MDA) content were compared with that in wild type (WT) plants. The expression of three downstream genes (DREB2A, P5CS1 and RD29A) in TaMYBsm1-D transgenic plants was analyzed. The R2R3-MYB domains of the MYBsm1 proteins were highly conserved in plants. In addition, the TaMYBsm1 proteins were targeted to the nucleus and contained transcriptional activation domains (TADs). Gus assay and semi-quantitative RT-PCR analysis demonstrated that the TaMYBsm1 genes were up-regulated when the wheat was treated by PEG and mannitol. Compared with WT plants, the germination rates were much higher, but the water loss rates were much lower in TaMYBsm1-D overexpression plants. TaMYBsm1-D transgenic plants showed distinct higher proline contents but a lower MDA content than the WT plants. The three downstream genes were highly expressed in TaMYBsm1-D transgenic plants. We concluded from these results that TaMYBsm1 genes play an important role in plant drought stress tolerance through up-regulation of DREB2A, P5CS1 and RD29A. The increase of proline content and decrease of MDA content may also be involved in the drought response.

Beta-keratins of differentiating epidermis of snake comprise glycine-proline-serine-rich proteins with an avian-like gene organization.

PubMed

Dalla Valle, Luisa; Nardi, Alessia; Belvedere, Paola; Toni, Mattia; Alibardi, Lorenzo

2007-07-01

Beta-keratins of reptilian scales have been recently cloned and characterized in some lizards. Here we report for the first time the sequence of some beta-keratins from the snake Elaphe guttata. Five different cDNAs were obtained using 5'- and 3'-RACE analyses. Four sequences differ by only few nucleotides in the coding region, whereas the last cDNA shows, in this region, only 84% of identity. The gene corresponding to one of the cDNA sequences has a single intron present in the 5'-untranslated region. This genomic organization is similar to that of birds' beta-keratins. Cloning and Southern blotting analysis suggest that snake beta-keratins belong to a family of high-related genes as for geckos. PCR analysis suggests a head-to-tail orientation of genes in the same chromosome. In situ hybridization detected beta-keratin transcripts almost exclusively in differentiating oberhautchen and beta-cells of the snake epidermis in renewal phase. This is confirmed by Northern blotting that showed, in this phase, a high expression of two different transcripts whereas only the longer transcript is expressed at a much lower level in resting skin. The cDNA coding sequences encoded putative glycine-proline-serine rich proteins containing 137-139 amino acids, with apparent isoelectric point at 7.5 and 8.2. A central region, rich in proline, shows over 50% homology with avian scale, claw, and feather keratins. The prediction of secondary structure shows mainly a random coil conformation and few beta-strand regions in the central region, likely involved in the formation of a fibrous framework of beta-keratins. This region was possibly present in basic reptiles that originated reptiles and birds. Copyright 2007 Wiley-Liss, Inc.

Mutations in PPIB (cyclophilin B) delay type I procollagen chain association and result in perinatal lethal to moderate osteogenesis imperfecta phenotypes.

PubMed

Pyott, Shawna M; Schwarze, Ulrike; Christiansen, Helena E; Pepin, Melanie G; Leistritz, Dru F; Dineen, Richard; Harris, Catharine; Burton, Barbara K; Angle, Brad; Kim, Katherine; Sussman, Michael D; Weis, Maryann; Eyre, David R; Russell, David W; McCarthy, Kevin J; Steiner, Robert D; Byers, Peter H

2011-04-15

Recessive mutations in the cartilage-associated protein (CRTAP), leucine proline-enriched proteoglycan 1 (LEPRE1) and peptidyl prolyl cis-trans isomerase B (PPIB) genes result in phenotypes that range from lethal in the perinatal period to severe deforming osteogenesis imperfecta (OI). These genes encode CRTAP (encoded by CRTAP), prolyl 3-hydroxylase 1 (P3H1; encoded by LEPRE1) and cyclophilin B (CYPB; encoded by PPIB), which reside in the rough endoplasmic reticulum (RER) and can form a complex involved in prolyl 3-hydroxylation in type I procollagen. CYPB, a prolyl cis-trans isomerase, has been thought to drive the prolyl-containing peptide bonds to the trans configuration needed for triple helix formation. Here, we describe mutations in PPIB identified in cells from three individuals with OI. Cultured dermal fibroblasts from the most severely affected infant make some overmodified type I procollagen molecules. Proα1(I) chains are slow to assemble into trimers, and abnormal procollagen molecules concentrate in the RER, and bind to protein disulfide isomerase (PDI) and prolyl 4-hydroxylase 1 (P4H1). These findings suggest that although CYPB plays a role in helix formation another effect is on folding of the C-terminal propeptide and trimer formation. The extent of procollagen accumulation and PDI/P4H1 binding differs among cells with mutations in PPIB, CRTAP and LEPRE1 with the greatest amount in PPIB-deficient cells and the least in LEPRE1-deficient cells. These findings suggest that prolyl cis-trans isomerase may be required to effectively fold the proline-rich regions of the C-terminal propeptide to allow proα chain association and suggest an order of action for CRTAP, P3H1 and CYPB in procollagen biosynthesis and pathogenesis of OI.

Mutations in PPIB (cyclophilin B) delay type I procollagen chain association and result in perinatal lethal to moderate osteogenesis imperfecta phenotypes

PubMed Central

Pyott, Shawna M.; Schwarze, Ulrike; Christiansen, Helena E.; Pepin, Melanie G.; Leistritz, Dru F.; Dineen, Richard; Harris, Catharine; Burton, Barbara K.; Angle, Brad; Kim, Katherine; Sussman, Michael D.; Weis, MaryAnn; Eyre, David R.; Russell, David W.; McCarthy, Kevin J.; Steiner, Robert D.; Byers, Peter H.

2011-01-01

Recessive mutations in the cartilage-associated protein (CRTAP), leucine proline-enriched proteoglycan 1 (LEPRE1) and peptidyl prolyl cis–trans isomerase B (PPIB) genes result in phenotypes that range from lethal in the perinatal period to severe deforming osteogenesis imperfecta (OI). These genes encode CRTAP (encoded by CRTAP), prolyl 3-hydroxylase 1 (P3H1; encoded by LEPRE1) and cyclophilin B (CYPB; encoded by PPIB), which reside in the rough endoplasmic reticulum (RER) and can form a complex involved in prolyl 3-hydroxylation in type I procollagen. CYPB, a prolyl cis–trans isomerase, has been thought to drive the prolyl-containing peptide bonds to the trans configuration needed for triple helix formation. Here, we describe mutations in PPIB identified in cells from three individuals with OI. Cultured dermal fibroblasts from the most severely affected infant make some overmodified type I procollagen molecules. Proα1(I) chains are slow to assemble into trimers, and abnormal procollagen molecules concentrate in the RER, and bind to protein disulfide isomerase (PDI) and prolyl 4-hydroxylase 1 (P4H1). These findings suggest that although CYPB plays a role in helix formation another effect is on folding of the C-terminal propeptide and trimer formation. The extent of procollagen accumulation and PDI/P4H1 binding differs among cells with mutations in PPIB, CRTAP and LEPRE1 with the greatest amount in PPIB-deficient cells and the least in LEPRE1-deficient cells. These findings suggest that prolyl cis–trans isomerase may be required to effectively fold the proline-rich regions of the C-terminal propeptide to allow proα chain association and suggest an order of action for CRTAP, P3H1 and CYPB in procollagen biosynthesis and pathogenesis of OI. PMID:21282188

Proline dehydrogenase promotes senescence through the generation of reactive oxygen species.

PubMed

Nagano, Taiki; Nakashima, Akio; Onishi, Kengo; Kawai, Kosuke; Awai, Yuto; Kinugasa, Mizuki; Iwasaki, Tetsushi; Kikkawa, Ushio; Kamada, Shinji

2017-04-15

Cellular senescence is a complex stress response characterized by permanent loss of proliferative capacity and is implicated in age-related disorders. Although the transcriptional activity of p53 (encoded by TP53 ) is known to be vital for senescence induction, the downstream effector genes critical for senescence remain unsolved. Recently, we have identified the proline dehydrogenase gene ( PRODH ) to be upregulated specifically in senescent cells in a p53-dependent manner, and the functional relevance of this to senescence is yet to be defined. Here, we conducted functional analyses to explore the relationship between PRODH and the senescence program. We found that genetic and pharmacological inhibition of PRODH suppressed senescent phenotypes induced by DNA damage. Furthermore, ectopic expression of wild-type PRODH, but not enzymatically inactive forms, induced senescence associated with the increase in reactive oxygen species (ROS) and the accumulation of DNA damage. Treatment with N-acetyl-L-cysteine, a ROS scavenger, prevented senescence induced by PRODH overexpression. These results indicate that PRODH plays a causative role in DNA damage-induced senescence through the enzymatic generation of ROS. © 2017. Published by The Company of Biologists Ltd.

SlgA, encoded by the homolog of the human schizophrenia-associated gene PRODH, acts in clock neurons to regulate Drosophila aggression.

PubMed

Zwarts, Liesbeth; Vulsteke, Veerle; Buhl, Edgar; Hodge, James J L; Callaerts, Patrick

2017-06-01

Mutations in the proline dehydrogenase gene PRODH are linked to behavioral alterations in schizophrenia and as part of DiGeorge and velo-cardio-facial syndromes, but the role of PRODH in their etiology remains unclear. Here, we establish a Drosophila model to study the role of PRODH in behavioral disorders. We determine the distribution of the Drosophila PRODH homolog slgA in the brain and show that knockdown and overexpression of human PRODH and slgA in the lateral neurons ventral (LNv) lead to altered aggressive behavior. SlgA acts in an isoform-specific manner and is regulated by casein kinase II (CkII). Our data suggest that these effects are, at least partially, due to effects on mitochondrial function. We thus show that precise regulation of proline metabolism is essential to drive normal behavior and we identify Drosophila aggression as a model behavior relevant for the study of the mechanisms that are impaired in neuropsychiatric disorders. © 2017. Published by The Company of Biologists Ltd.

Separable roles for Mycobacterium tuberculosis ESX-3 effectors in iron acquisition and virulence

PubMed Central

Tufariello, JoAnn M.; Chapman, Jessica R.; Kerantzas, Christopher A.; Wong, Ka-Wing; Vilchèze, Catherine; Jones, Christopher M.; Cole, Laura E.; Tinaztepe, Emir; Thompson, Victor; Fenyö, David; Niederweis, Michael; Ueberheide, Beatrix; Philips, Jennifer A.; Jacobs, William R.

2016-01-01

Mycobacterium tuberculosis (Mtb) encodes five type VII secretion systems (T7SS), designated ESX-1–ESX-5, that are critical for growth and pathogenesis. The best characterized is ESX-1, which profoundly impacts host cell interactions. In contrast, the ESX-3 T7SS is implicated in metal homeostasis, but efforts to define its function have been limited by an inability to recover deletion mutants. We overcame this impediment using medium supplemented with various iron complexes to recover mutants with deletions encompassing select genes within esx-3 or the entire operon. The esx-3 mutants were defective in uptake of siderophore-bound iron and dramatically accumulated cell-associated mycobactin siderophores. Proteomic analyses of culture filtrate revealed that secretion of EsxG and EsxH was codependent and that EsxG–EsxH also facilitated secretion of several members of the proline-glutamic acid (PE) and proline-proline-glutamic acid (PPE) protein families (named for conserved PE and PPE N-terminal motifs). Substrates that depended on EsxG–EsxH for secretion included PE5, encoded within the esx-3 locus, and the evolutionarily related PE15–PPE20 encoded outside the esx-3 locus. In vivo characterization of the mutants unexpectedly showed that the ESX-3 secretion system plays both iron-dependent and -independent roles in Mtb pathogenesis. PE5–PPE4 was found to be critical for the siderophore-mediated iron-acquisition functions of ESX-3. The importance of this iron-acquisition function was dependent upon host genotype, suggesting a role for ESX-3 secretion in counteracting host defense mechanisms that restrict iron availability. Further, we demonstrate that the ESX-3 T7SS secretes certain effectors that are important for iron uptake while additional secreted effectors modulate virulence in an iron-independent fashion. PMID:26729876

Recombinant Brucella abortus gene expressing immunogenic protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mayfield, J.E.; Tabatabai, L.B.

This patent describes a synthetic recombinant DNA molecule containing a DNA sequence. It comprises a gene of Brucella abortus encoding an immunogenic protein having a molecular weight of approximately 31,000 daltons as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis under denaturing conditions, the protein having an isoelectric point around 4.9, and containing a twenty-five amino acid sequence from its amino terminal end consisting of Gln-Ala-Pro-Thr-Phe-Phe-Arg-Ile-Gly-Thr-Gly-Gly-Thr-Ala-Gly-Thr-Tyr-Tyr-Pro-Ile-Gly-Gly-Leu-Ile-Ala, wherein Gln, Ala, Pro, Thr, Phe, Arg, Ile, Gly, Tyr, and Leu, respectively, represent glutamine, alanine, proline, threonine, phenylalanine, arginine, isolecuine, glycine, tyrosine, and leucine.

Genome-Wide Association Mapping Combined with Reverse Genetics Identifies New Effectors of Low Water Potential-Induced Proline Accumulation in Arabidopsis1[W][OPEN

PubMed Central

Verslues, Paul E.; Lasky, Jesse R.; Juenger, Thomas E.; Liu, Tzu-Wen; Kumar, M. Nagaraj

2014-01-01

Arabidopsis (Arabidopsis thaliana) exhibits natural genetic variation in drought response, including varying levels of proline (Pro) accumulation under low water potential. As Pro accumulation is potentially important for stress tolerance and cellular redox control, we conducted a genome-wide association (GWAS) study of low water potential-induced Pro accumulation using a panel of natural accessions and publicly available single-nucleotide polymorphism (SNP) data sets. Candidate genomic regions were prioritized for subsequent study using metrics considering both the strength and spatial clustering of the association signal. These analyses found many candidate regions likely containing gene(s) influencing Pro accumulation. Reverse genetic analysis of several candidates identified new Pro effector genes, including thioredoxins and several genes encoding Universal Stress Protein A domain proteins. These new Pro effector genes further link Pro accumulation to cellular redox and energy status. Additional new Pro effector genes found include the mitochondrial protease LON1, ribosomal protein RPL24A, protein phosphatase 2A subunit A3, a MADS box protein, and a nucleoside triphosphate hydrolase. Several of these new Pro effector genes were from regions with multiple SNPs, each having moderate association with Pro accumulation. This pattern supports the use of summary approaches that incorporate clusters of SNP associations in addition to consideration of individual SNP probability values. Further GWAS-guided reverse genetics promises to find additional effectors of Pro accumulation. The combination of GWAS and reverse genetics to efficiently identify new effector genes may be especially applicable for traits difficult to analyze by other genetic screening methods. PMID:24218491

Analysis of the core genome and pangenome of Pseudomonas putida.

PubMed

Udaondo, Zulema; Molina, Lázaro; Segura, Ana; Duque, Estrella; Ramos, Juan L

2016-10-01

Pseudomonas putida are strict aerobes that proliferate in a range of temperate niches and are of interest for environmental applications due to their capacity to degrade pollutants and ability to promote plant growth. Furthermore solvent-tolerant strains are useful for biosynthesis of added-value chemicals. We present a comprehensive comparative analysis of nine strains and the first characterization of the Pseudomonas putida pangenome. The core genome of P. putida comprises approximately 3386 genes. The most abundant genes within the core genome are those that encode nutrient transporters. Other conserved genes include those for central carbon metabolism through the Entner-Doudoroff pathway, the pentose phosphate cycle, arginine and proline metabolism, and pathways for degradation of aromatic chemicals. Genes that encode transporters, enzymes and regulators for amino acid metabolism (synthesis and degradation) are all part of the core genome, as well as various electron transporters, which enable aerobic metabolism under different oxygen regimes. Within the core genome are 30 genes for flagella biosynthesis and 12 key genes for biofilm formation. Pseudomonas putida strains share 85% of the coding regions with Pseudomonas aeruginosa; however, in P. putida, virulence factors such as exotoxins and type III secretion systems are absent. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

Cloning and sequencing of a gene encoding the 69-kDa extracellular chitinase of Janthinobacterium lividum.

PubMed

Gleave, A P; Taylor, R K; Morris, B A; Greenwood, D R

1995-09-15

Janthinobacterium lividum secretes a major 56-kDa chitinase and a minor 69-kDa chitinase. A chitinase gene was defined on a 3-kb fragment of clone pRKT10, by virtue of fluorescent colonies in the presence of 4-methylumbelliferyl-beta-D-N,N',N"-chitotrioside. Nucleotide sequencing revealed an 1998-bp open reading frame with the potential to encode a 69,716-Da protein with amino acid sequences similar to those in other chitinases, suggesting it encodes the minor chitinase (Chi69). Chitinase activity of Escherichia coli (pRKT10) lysates was detected mainly in the periplasmic fraction and immunoblotting detected a 70-kDa protein in this fraction. Chi69 has an N-terminal secretory leader peptide preceding two probable chitin-binding domains and a catalytic domain. These functional domains are separated by linker regions of proline-threonine repeats. Amino acid sequencing of cyanogen bromide cleavage-derived peptides from the major 56-kDa chitinase suggested that Chi69 may be a precursor of Chi56. In addition, an N-terminally truncated version of Chi69 retained chitinase activity as expected if in vivo processing of Chi69 generates Chi56.

Salt stress encourages proline accumulation by regulating proline biosynthesis and degradation in Jerusalem artichoke plantlets.

PubMed

Huang, Zengrong; Zhao, Long; Chen, Dandan; Liang, Mingxiang; Liu, Zhaopu; Shao, Hongbo; Long, Xiaohua

2013-01-01

Proline accumulation is an important mechanism for osmotic regulation under salt stress. In this study, we evaluated proline accumulation profiles in roots, stems and leaves of Jerusalem artichoke (Helianthus tuberosus L.) plantlets under NaCl stress. We also examined HtP5CS, HtOAT and HtPDH enzyme activities and gene expression patterns of putative HtP5CS1, HtP5CS2, HtOAT, HtPDH1, and HtPDH2 genes. The objective of our study was to characterize the proline regulation mechanisms of Jerusalem artichoke, a moderately salt tolerant species, under NaCl stress. Jerusalem artichoke plantlets were observed to accumulate proline in roots, stems and leaves during salt stress. HtP5CS enzyme activities were increased under NaCl stress, while HtOAT and HtPDH activities generally repressed. Transcript levels of HtP5CS2 increased while transcript levels of HtOAT, HtPDH1 and HtPDH2 generally decreased in response to NaCl stress. Our results supports that for Jerusalem artichoke, proline synthesis under salt stress is mainly through the Glu pathway, and HtP5CS2 is predominant in this process while HtOAT plays a less important role. Both HtPDH genes may function in proline degradation.

endAFS, a novel family E endoglucanase gene from Fibrobacter succinogenes AR1.

PubMed Central

Cavicchioli, R; East, P D; Watson, K

1991-01-01

The complete nucleotide sequence of endAFS, an endoglucanase gene isolated from the ruminal anaerobe Fibrobacter succinogenes AR1, was determined. endAFS encodes two overlapping open reading frames (ORF1 and ORF2), and it was proposed that a -1 ribosomal frameshift was required to allow contiguous synthesis of a 453-amino-acid endoglucanase. A proline- and threonine-rich region at the C terminus of ORF1 and rare codons for arginine and threonine were coincident with the proposed frameshift site. ENDAFS is proposed to be a member of subgroup 1 of family E endoglucanases, of which endoglucanases from Thermomonospora fusca and Persea americana (avocado) are also members. Endoglucanases from Clostridium thermocellum and Pseudomonas fluorescens form subgroup 2. Images PMID:1708767

Abscisic Acid- and Stress-Induced Highly Proline-Rich Glycoproteins Regulate Root Growth in Rice1[W][OPEN

PubMed Central

Tseng, I-Chieh; Hong, Chwan-Yang; Yu, Su-May; Ho, Tuan-Hua David

2013-01-01

In the root of rice (Oryza sativa), abscisic acid (ABA) treatment, salinity, or water deficit stress induces the expression of a family of four genes, REPETITIVE PROLINE-RICH PROTEIN (RePRP). These genes encode two subclasses of novel proline-rich glycoproteins with highly repetitive PX1PX2 motifs, RePRP1 and RePRP2. RePRP orthologs exist only in monocotyledonous plants, and their functions are virtually unknown. Rice RePRPs are heavily glycosylated with arabinose and glucose on multiple hydroxyproline residues. They are significantly different from arabinogalactan proteins that have glycan chains composed of arabinose and galactose. Transient and stable expressions of RePRP-green fluorescent protein reveal that a fraction of this protein is localized to the plasma membrane. In rice roots, ABA treatment increases RePRP expression preferentially in the elongation zone. Overexpression of RePRP in transgenic rice reduces root cell elongation in the absence of ABA, similar to the effect of ABA on wild-type roots. Conversely, simultaneous knockdown of the expression of RePRP1 and RePRP2 reduces the root sensitivity to ABA, indicating that RePRP proteins play an essential role in ABA/stress regulation of root growth and development. Moreover, rice RePRPs specifically interact with a polysaccharide, arabinogalactan, in a dosage-dependent manner. It is suggested that RePRP1 and RePRP2 are functionally redundant suppressors of root cell expansion and probably act through interactions with cell wall components near the plasma membrane. PMID:23886623

Effects of salt stress on the expression of antioxidant genes and proteins in the model legume Lotus japonicus.

PubMed

Rubio, Maria C; Bustos-Sanmamed, Pilar; Clemente, Maria R; Becana, Manuel

2009-03-01

Salt stress negatively affects many physiological processes in plants. Some of these effects may involve the oxidative damage of cellular components, which can be promoted by reactive oxygen species and prevented by antioxidants. The protective role of antioxidants was investigated in Lotus japonicus exposed to two salinization protocols: S1 (150 mM NaCl for 7 d) and S2 (50, 100 and 150 mM NaCl, each concentration for 6 d). Several markers of salt stress were measured and the expression of antioxidant genes was analyzed using quantitative reverse transcription–polymerase chain reaction and, in some cases, immunoblots and enzyme activity assays. Leaves of S1 plants suffered from mild osmotic stress, accumulated proline but noNa+, and showed induction of many superoxide dismutase and glutathione peroxidase genes. Leaves of S2 plants showed increases in Na+ and Ca2+, decreases in K+, and accumulation of proline and malondialdehyde. In leaves and roots of S1 and S2 plants, the mRNA, protein and activity levels of the ascorbate-glutathione enzymes remained constant, with a few exceptions. Notably, there was consistent up-regulation of the gene encoding cytosolic dehydroascorbate reductase, and this was possibly related to its role in ascorbate recycling in the apoplast. The overall results indicate that L. japonicus is more tolerant to salt stress than other legumes, which can be attributed to the capacity of the plant to prevent Na+reaching the shoot and to activate antioxidant defenses.

Analysis of the expression of putative heat-stress related genes in relation to thermotolerance of cork oak.

PubMed

Correia, Barbara; Rodriguez, José Luis; Valledor, Luis; Almeida, Tânia; Santos, Conceição; Cañal, Maria Jesús; Pinto, Glória

2014-03-15

Cork oak (Quercus suber L.) is a research priority in the Mediterranean area and because of cork oaks' distribution these stands are experiencing daily stress. Based on projections of intensifying climate change and considering the key role of exploring the recovery abilities, cork oak seedlings were subjected to a cumulative temperature increase from 25°C to 55°C and subsequent recovery. CO2 assimilation rate, chlorophyll fluorescence, anthocyanins, proline and lipid peroxidation were used to evaluate plant performance, while the relative abundance of seven genes encoding for proteins of cork oak with a putative role in thermal/stress regulation (POX1, POX2, HSP10.4, HSP17a.22, CHS, MTL and RBC) was analyzed by qPCR (quantitative Polymerase Chain Reaction). A temperature change to 35°C showed abundance alterations in the tested genes; at 45°C, the molecular changes were associated with an antioxidant response, possibly modulated by anthocyanins. At 55°C, HSP17a.22, MTL and proline accumulation were evident. After recovery, physiological balance was restored, whereas POX1, HSP10.4 and MTL abundances were suggested to be involved in increased thermotolerance. The data presented here are expected to pinpoint some pathways changes occurring during such stress and further recovery in this particular Mediterranean species. Copyright © 2013 Elsevier GmbH. All rights reserved.

Pnrc2 regulates 3'UTR-mediated decay of segmentation clock-associated transcripts during zebrafish segmentation.

PubMed

Gallagher, Thomas L; Tietz, Kiel T; Morrow, Zachary T; McCammon, Jasmine M; Goldrich, Michael L; Derr, Nicolas L; Amacher, Sharon L

2017-09-01

Vertebrate segmentation is controlled by the segmentation clock, a molecular oscillator that regulates gene expression and cycles rapidly. The expression of many genes oscillates during segmentation, including hairy/Enhancer of split-related (her or Hes) genes, which encode transcriptional repressors that auto-inhibit their own expression, and deltaC (dlc), which encodes a Notch ligand. We previously identified the tortuga (tor) locus in a zebrafish forward genetic screen for genes involved in cyclic transcript regulation and showed that cyclic transcripts accumulate post-splicing in tor mutants. Here we show that cyclic mRNA accumulation in tor mutants is due to loss of pnrc2, which encodes a proline-rich nuclear receptor co-activator implicated in mRNA decay. Using an inducible in vivo reporter system to analyze transcript stability, we find that the her1 3'UTR confers Pnrc2-dependent instability to a heterologous transcript. her1 mRNA decay is Dicer-independent and likely employs a Pnrc2-Upf1-containing mRNA decay complex. Surprisingly, despite accumulation of cyclic transcripts in pnrc2-deficient embryos, we find that cyclic protein is expressed normally. Overall, we show that Pnrc2 promotes 3'UTR-mediated decay of developmentally-regulated segmentation clock transcripts and we uncover an additional post-transcriptional regulatory layer that ensures oscillatory protein expression in the absence of cyclic mRNA decay. Copyright © 2017 Elsevier Inc. All rights reserved.

Cryptic Production of trans-3-Hydroxyproline in Echinocandin B Biosynthesis.

PubMed

Mattay, Johanna; Houwaart, Stefanie; Hüttel, Wolfgang

2018-04-01

Echinocandins are antifungal nonribosomal hexapeptides produced by fungi. Two of the amino acids are hydroxy-l-prolines: trans -4-hydroxy-l-proline and, in most echinocandin structures, ( trans -2,3)-3-hydroxy-( trans -2,4)-4-methyl-l-proline. In the case of echinocandin biosynthesis by Glarea lozoyensis , both amino acids are found in pneumocandin A 0 , while in pneumocandin B 0 the latter residue is replaced by trans -3-hydroxy-l-proline (3-Hyp). We have recently reported that all three amino acids are generated by the 2-oxoglutarate-dependent proline hydroxylase GloF. In echinocandin B biosynthesis by Aspergillus species, 3-Hyp derivatives have not been reported. Here we describe the heterologous production and kinetic characterization of HtyE, the 2-oxoglutarate-dependent proline hydroxylase from the echinocandin B biosynthetic cluster in Aspergillus pachycristatus Surprisingly, l-proline hydroxylation with HtyE resulted in an even higher proportion (∼30%) of 3-Hyp than that with GloF. This suggests that the selectivity for methylated 3-Hyp in echinocandin B biosynthesis is due solely to a substrate-specific adenylation domain of the nonribosomal peptide synthetase. Moreover, we observed that one product of HtyE catalysis, 3-hydroxy-4-methyl-l-proline, is slowly further oxidized at the methyl group, giving 3-hydroxy-4-hydroxymethyl-l-proline, upon prolonged incubation with HtyE. This dihydroxylated amino acid has been reported as a building block of cryptocandin, an echinocandin produced by Cryptosporiopsis IMPORTANCE Secondary metabolites from bacteria and fungi are often produced by sets of biosynthetic enzymes encoded in distinct gene clusters. Usually, each enzyme catalyzes one biosynthetic step, but multiple reactions are also possible. Pneumocandins A 0 and B 0 are produced by the fungus Glarea lozoyensis They belong to the echinocandin family, a group of nonribosomal cyclic lipopeptides that exhibit a strong antifungal activity. Chemical derivatives are important drugs for the treatment of systemic fungal infections. We have recently shown that in the biosynthesis of pneumocandins A 0 and B 0 , three hydroxyproline building blocks are provided by one proline hydroxylase. Here we demonstrate that the proline hydroxylase from echinocandin B biosynthesis in Aspergillus pachycristatus produces the same hydroxyprolines, with an increased proportion of trans -3-hydroxyproline. However, echinocandin B biosynthesis does not require trans -3-hydroxyproline; its formation remains cryptic. While one can only speculate on the evolutionary background of this unexpected finding, proline hydroxylation in G. lozoyensis and A. pachycristatus provides an unusual insight into peptide antibiotic biosynthesis-namely, the complex interplay between the selectivity of a hydroxylase and the substrate specificity of a nonribosomal peptide synthetase. Copyright © 2018 American Society for Microbiology.

The European Eel NCCβ Gene Encodes a Thiazide-resistant Na-Cl Cotransporter*

PubMed Central

Moreno, Erika; Plata, Consuelo; Rodríguez-Gama, Alejandro; Argaiz, Eduardo R.; Vázquez, Norma; Leyva-Ríos, Karla; Islas, León; Cutler, Christopher; Pacheco-Alvarez, Diana; Mercado, Adriana; Cariño-Cortés, Raquel; Castañeda-Bueno, María; Gamba, Gerardo

2016-01-01

The thiazide-sensitive Na-Cl cotransporter (NCC) is the major pathway for salt reabsorption in the mammalian distal convoluted tubule. NCC plays a key role in the regulation of blood pressure. Its inhibition with thiazides constitutes the primary baseline therapy for arterial hypertension. However, the thiazide-binding site in NCC is unknown. Mammals have only one gene encoding for NCC. The eel, however, contains a duplicate gene. NCCα is an ortholog of mammalian NCC and is expressed in the kidney. NCCβ is present in the apical membrane of the rectum. Here we cloned and functionally characterized NCCβ from the European eel. The cRNA encodes a 1043-amino acid membrane protein that, when expressed in Xenopus oocytes, functions as an Na-Cl cotransporter with two major characteristics, making it different from other known NCCs. First, eel NCCβ is resistant to thiazides. Single-point mutagenesis supports that the absence of thiazide inhibition is, at least in part, due to the substitution of a conserved serine for a cysteine at position 379. Second, NCCβ is not activated by low-chloride hypotonic stress, although the unique Ste20-related proline alanine-rich kinase (SPAK) binding site in the amino-terminal domain is conserved. Thus, NCCβ exhibits significant functional differences from NCCs that could be helpful in defining several aspects of the structure-function relationship of this important cotransporter. PMID:27587391

Screening and analysis of genes expressed upon infection of broad bean with Clover yellow vein virus causing lethal necrosis.

PubMed

Nakahara, Kenji S; Kitazawa, Hiroaki; Atsumi, Go; Choi, Sun Hee; Suzuki, Yuji; Uyeda, Ichiro

2011-07-18

Clover yellow vein virus (ClYVV) causes lethal systemic necrosis in legumes, including broad bean (Vicia faba) and pea (Pisum sativum). To identify host genes involved in necrotic symptom expression after ClYVV infection, we screened cDNA fragments in which expression was changed in advance of necrotic symptom expression in broad bean (V. faba cv. Wase) using the differential display technique and secondarily with Northern blot analysis. Expression changes were confirmed in 20 genes, and the six that exhibited the most change were analyzed further. These six genes included a gene that encodes a putative nitrate-induced NOI protein (VfNOI), and another was homologous to an Arabidopsis gene that encodes a glycine- and proline-rich protein GPRP (VfGPRP). We recently reported that necrotic symptom development in ClYVV-infected pea is associated with expression of salicylic acid (SA)-dependent pathogenesis-related (PR) proteins and requires SA-dependent host responses. Interestingly, VfNOI and VfGPRP expression was correlated with that of the putative SA-dependent PR proteins in ClYVV-infected broad bean. However, broad bean infected with a recombinant ClYVV expressing the VfGPRP protein showed weaker symptoms and less viral multiplication than that infected with ClYVV expressing the GFP protein. These results imply that VfGPRP plays a role in defense against ClYVV rather than in necrotic symptom expression.

Proline Availability Regulates Proline-4-Hydroxylase Synthesis and Substrate Uptake in Proline-Hydroxylating Recombinant Escherichia coli

PubMed Central

Falcioni, Francesco; Blank, Lars M.; Frick, Oliver; Karau, Andreas; Schmid, Andreas

2013-01-01

Microbial physiology plays a crucial role in whole-cell biotransformation, especially for redox reactions that depend on carbon and energy metabolism. In this study, regio- and enantio-selective proline hydroxylation with recombinant Escherichia coli expressing proline-4-hydroxylase (P4H) was investigated with respect to its interconnectivity to microbial physiology and metabolism. P4H production was found to depend on extracellular proline availability and on codon usage. Medium supplementation with proline did not alter p4h mRNA levels, indicating that P4H production depends on the availability of charged prolyl-tRNAs. Increasing the intracellular levels of soluble P4H did not result in an increase in resting cell activities above a certain threshold (depending on growth and assay temperature). Activities up to 5-fold higher were reached with permeabilized cells, confirming that host physiology and not the intracellular level of active P4H determines the achievable whole-cell proline hydroxylation activity. Metabolic flux analysis revealed that tricarboxylic acid cycle fluxes in growing biocatalytically active cells were significantly higher than proline hydroxylation rates. Remarkably, a catalysis-induced reduction of substrate uptake was observed, which correlated with reduced transcription of putA and putP, encoding proline dehydrogenase and the major proline transporter, respectively. These results provide evidence for a strong interference of catalytic activity with the regulation of proline uptake and metabolism. In terms of whole-cell biocatalyst efficiency, proline uptake and competition of P4H with proline catabolism are considered the most critical factors. PMID:23455348

OsACA6, a P-type IIB Ca²⁺ ATPase promotes salinity and drought stress tolerance in tobacco by ROS scavenging and enhancing the expression of stress-responsive genes.

PubMed

Huda, Kazi M K; Banu, M Sufara Akhter; Garg, Bharti; Tula, Suresh; Tuteja, Renu; Tuteja, Narendra

2013-12-01

Calcium (Ca²⁺) regulates several signalling pathways involved in growth, development and stress tolerance. Cellular Ca²⁺ homeostasis is achieved by the combined action of channels, pumps and antiporters, but direct evidence for a role of Ca²⁺ATPase pumps in stress tolerance is lacking. Here we report the characterization of a Ca²⁺ ATPase gene (OsACA6) from Oryza sativa, and elucidate its functions in stress tolerance. OsACA6 transcript levels are enhanced in response to salt, drought, abscisic acid and heat. In vivo localization identified plasma membranes as an integration site for the OsACA6-GFP fusion protein. Using transgenic tobacco lines, we demonstrate that over-expression of OsACA6 is triggered during salinity and drought stresses. The enhanced tolerance to these stresses was confirmed by changes in several physiological indices, including water loss rate, photosynthetic efficiency, cell membrane stability, germination, survival rate, malondialdehyde content, electrolyte leakage and increased proline accumulation. Furthermore, over-expressing lines also showed higher leaf chlorophyll and reduced accumulation of H₂O₂ and Na⁺ ions compared to the wild-type. Reduced accumulation of reactive oxygen species (ROS) was observed in transgenic lines. The increased proline accumulation and ROS scavenging enzyme activities in transgenic plants over-expressing OsACA6 efficiently modulate the ROS machinery and proline biosynthesis through an integrative mechanism. Transcriptional profiling of these plants revealed altered expression of genes encoding many transcription factors, stress- and disease-related proteins, as well as signalling components. These results suggest that Ca²⁺ ATPases have diverse roles as regulators of many stress signalling pathways, leading to plant growth, development and stress tolerance. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Nitrogen reserves, spring regrowth and winter survival of field-grown alfalfa (Medicago sativa) defoliated in the autumn.

PubMed

Dhont, Catherine; Castonguay, Yves; Nadeau, Paul; Bélanger, Gilles; Drapeau, Raynald; Laberge, Serge; Avice, Jean-Christophe; Chalifour, François-P

2006-01-01

The objective of the study was to characterize variations in proline, arginine, histidine, vegetative storage proteins, and cold-inducible gene expression in overwintering roots of field-grown alfalfa, in response to autumn defoliation, and in relation to spring regrowth and winter survival. Field trials, established in 1996 in eastern Canada, consisted of two alfalfa cultivars ('AC Caribou' and 'WL 225') defoliated in 1997 and 1998 either only twice during the summer or three times with the third defoliation taken 400, 500 or 600 growing degree days (basis 5 degrees C) after the second summer defoliation. The root accumulation of proline, arginine, histidine and soluble proteins of 32, 19 and 15 kDa, characterized as alfalfa vegetative storage proteins, was reduced the following spring by an early autumn defoliation at 400 or 500 growing degree days in both cultivars; the 600-growing-degree-days defoliation treatment had less or no effect. Transcript levels of the cold-inducible gene msaCIA, encoding a glycine-rich protein, were markedly reduced by autumn defoliation in 'WL 225', but remained unaffected in the more winter-hardy cultivar 'AC Caribou'. The expression of another cold-inducible gene, the dehydrin homologue msaCIG, was not consistently affected by autumn defoliation. Principal component analyses, including components of root organic reserves at the onset of winter, along with yield and plant density in the following spring, revealed that (a) amino acids and soluble proteins are positively related to the vigour of spring regrowth but poorly related to winter survival and (b) winter survival, as indicated by plant density in the spring, is associated with higher concentrations of cryoprotective sugars in alfalfa roots the previous autumn. An untimely autumn defoliation of alfalfa reduces root accumulation of specific N reserves such as proline, arginine, histidine and vegetative storage proteins that are positively related to the vigour of spring regrowth but poorly related to winter survival.

Functional analysis of a proline to serine mutation in codon 453 of the thyroid hormone receptor {beta}1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozata, M.; Suzuki, Satoru; Takeda, Teiji

Mutations in the gene encoding human thyroid hormone receptor {beta}(hTR{beta}) have been associated with generalized resistance to thyroid hormone (GRTH). This disorder is associated with significant behavoral abnormalities. We examined the hTR{beta} gene in a family with members who manifest inappropriately normal TSH, elevated free T{sub 4}, and free and total T{sub 3}. Sequence analysis showed a cytosine to thymine transition at nucleotide 1642 in one allele of the index patient`s genomic DNA. This altered proline to serine at codon 453. The resulting mutant receptor when expressed in vitro bound DNA with high affinity, but the T{sub 3} affinity ofmore » the receptor was impaired. The mutant TR demonstrated a dominant negative effect when cotransfected with two isoforms of wild-type receptor and also in the presence of TR variant {alpha}2 in COS-1 cells. Mutations of codon 453 occur more frequently than at other sites, and four different amino acid substitutions have been reported. Significant differences in phenotype occur among affected individuals, varying from normality to moderately severe GRTH. There is no clear correlation between K{sub a} or in vitro function of the mutant receptor, and phenotype. This study extends the association between GRTH and illness, and indicates that early diagnosis and counseling are needed in families with TR{beta}1 abnormalities. 34 refs., 5 figs., 2 tabs.« less

Shared and novel molecular responses of mandarin to drought.

PubMed

Gimeno, Jacinta; Gadea, José; Forment, Javier; Pérez-Valle, Jorge; Santiago, Julia; Martínez-Godoy, María A; Yenush, Lynne; Bellés, José M; Brumós, Javier; Colmenero-Flores, José M; Talón, Manuel; Serrano, Ramón

2009-07-01

Drought is the most important stress experienced by citrus crops. A citrus cDNA microarray of about 6.000 genes has been utilized to identify transcriptomic responses of mandarin to water stress. As observed in other plant species challenged with drought stress, key genes for lysine catabolism, proline and raffinose synthesis, hydrogen peroxide reduction, vacuolar malate transport, RCI2 proteolipids and defence proteins such as osmotin, dehydrins and heat-shock proteins are induced in mandarin. Also, some aquaporin genes are repressed. The osmolyte raffinose could be detected in stressed roots while the dehydrin COR15 protein only accumulated in stressed leaves but not in roots. Novel drought responses in mandarin include the induction of genes encoding a new miraculin isoform, chloroplast beta-carotene hydroxylase, oleoyl desaturase, ribosomal protein RPS13A and protein kinase CTR1. These results suggest that drought tolerance in citrus may benefit from inhibition of proteolysis, activation of zeaxanthin and linolenoyl synthesis, reinforcement of ribosomal structure and down-regulation of the ethylene response.

Proline biosynthesis genes and their regulation under salinity stress in the euryhaline copepod Tigriopus californicus.

PubMed

Willett, Christopher S; Burton, Ronald S

2002-08-01

Diverse organisms regulate concentrations of intracellular organic osmolytes in response to changes in environmental salinity or desiccation. In marine crustaceans, accumulation of high concentrations of proline is a dominant component of response to hyperosmotic stress. In the euryhaline copepod Tigriopus californicus, synthesis of proline from its metabolic precursor glutamate is tightly regulated by changes in environmental salinity. Here, for the first time in a marine invertebrate, the genes responsible for this pathway have been cloned and characterized. The two proteins display the sequence features of homologous enzymes identified from other eukaryotes. One of the cloned genes, delta1-pyrroline-5-carboxylase reductase (P5CR), is demonstrated to have the reductase enzyme activity when expressed in proline-auxotroph bacteria, while the second, delta1-pyrroline-5-carboxylase synthase (P5CS), does not rescue proline-auxotroph bacteria. In contrast to results from higher plants, neither levels of P5CS nor P5CR mRNAs increase in response to salinity stress in T. californicus. Hence, regulation of proline synthesis during osmotic stress in T. californicus is likely mediated by some form of post-transcriptional regulation of either P5CS or P5CR. Understanding the regulation this pathway may elucidate the mechanisms limiting the salinity ranges of marine taxa. Copyright 2002 Elsevier Science Inc.

The γ-Aminobutyrate Permease GabP Serves as the Third Proline Transporter of Bacillus subtilis

PubMed Central

Zaprasis, Adrienne; Hoffmann, Tamara; Stannek, Lorena; Gunka, Katrin; Commichau, Fabian M.

2014-01-01

PutP and OpuE serve as proline transporters when this imino acid is used by Bacillus subtilis as a nutrient or as an osmostress protectant, respectively. The simultaneous inactivation of the PutP and OpuE systems still allows the utilization of proline as a nutrient. This growth phenotype pointed to the presence of a third proline transport system in B. subtilis. We took advantage of the sensitivity of a putP opuE double mutant to the toxic proline analog 3,4-dehydro-dl-proline (DHP) to identify this additional proline uptake system. DHP-resistant mutants were selected and found to be defective in the use of proline as a nutrient. Whole-genome resequencing of one of these strains provided the lead that the inactivation of the γ-aminobutyrate (GABA) transporter GabP was responsible for these phenotypes. DNA sequencing of the gabP gene in 14 additionally analyzed DHP-resistant strains confirmed this finding. Consistently, each of the DHP-resistant mutants was defective not only in the use of proline as a nutrient but also in the use of GABA as a nitrogen source. The same phenotype resulted from the targeted deletion of the gabP gene in a putP opuE mutant strain. Hence, the GabP carrier not only serves as an uptake system for GABA but also functions as the third proline transporter of B. subtilis. Uptake studies with radiolabeled GABA and proline confirmed this conclusion and provided information on the kinetic parameters of the GabP carrier for both of these substrates. PMID:24142252

Generation of Hypertension-Associated STK39 Polymorphism Knockin Cell Lines With the Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 System.

PubMed

Mandai, Shintaro; Mori, Takayasu; Sohara, Eisei; Rai, Tatemitsu; Uchida, Shinichi

2015-12-01

Previous genome-wide association studies identified serine threonine kinase 39 (STK39), encoding STE20/SPS1-related proline/alanine-rich kinase, as one of a limited number of hypertension susceptibility genes. A recent meta-analysis confirmed the association of STK39 intronic polymorphism rs3754777 with essential hypertension, among previously reported hypertension-associated STK39 polymorphisms. However, the biochemical function of this polymorphism in the mechanism responsible for hypertension is yet to be clarified. We generated rs3754777G>A knockin human cell lines with clustered regularly interspaced short palindromic repeats-mediated genome engineering. Homozygous (A/A) and heterozygous (G/A) knockin human embryonic kidney cell lines were generated using a double nickase, single-guide RNAs targeting STK39 intron 5 around single-nucleotide polymorphism, and a 100-bp donor single-stranded DNA oligonucleotide. Reverse transcription polymerase chain reaction with sequencing analyses revealed the identical STK39 transcripts among the wild-type and both knockin cell lines. Quantitative reverse transcription polymerase chain reaction showed increased STK39 mRNA expression, and immunoblot analysis revealed increases in total and phosphorylated STE20/SPS1-related proline/alanine-rich kinase with increased phosphorylated Na-K-Cl cotransporter isoform 1 in both knockin cell lines. The largest increases in these molecules were observed in the homozygous cell line. These findings indicated that this intronic polymorphism increases STK39 transcription, leading to activation of the STE20/SPS1-related proline/alanine-rich kinase-solute carrier family 12A signaling cascade. Increased interactions between STE20/SPS1-related proline/alanine-rich kinase and the target cation-chloride cotransporters may be responsible for hypertension susceptibility in individuals with this polymorphism. © 2015 American Heart Association, Inc.

Cloning and characterization of an alternatively spliced gene in proximal Xq28 deleted in two patients with intersexual genitalia and myotubular myopathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laporte, J.; Hu, Ling-Jia; Kretz, C.

1997-05-01

We have identified a novel human gene that is entirely deleted in two boys with abnormal genital development and myotubular myopathy (MTM1). The gene, F18, is located in proximal Xq28, approximately 80 kb centromeric to the recently isolated MTM1 gene. Northern analysis of mRNA showed a ubiquitous pattern and suggested high levels of expression in skeletal muscle, brain, and heart. A transcript of 4.6 kb was detected in a range of tissues, and additional alternate forms of 3.8 and 2.6 kb were present in placenta and pancreas, respectively. The gene extends over 100 kb and is composed of at leastmore » seven exons, of which two are non-coding. Sequence analysis of a 4.6-kb cDNA contig revealed two overlapping open reading frames (ORFs) that encode putative proteins of 701 and 424 amino acids, respectively. Two alternative spliced transcripts affecting the large open reading frame were identified that, together with the Northern blot results, suggest that distinct proteins are derived from the gene. No significant homology to other known proteins was detected, but segments of the first ORF encode polyglutamine tracts and proline-rich domains, which are frequently observed in DNA-binding proteins. The F18 gene is a strong candidate for being implicated in the intersexual genitalia present in the two MTM1-deleted patients. The gene also serves as a candidate for other disorders that map to proximal Xq28. 15 refs., 3 figs., 1 tab.« less

Chromosomal localization and cDNA cloning of the human DBP and TEF genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khatib, Z.A.; Inaba, T.; Valentine, M.

1994-09-15

The authors have isolated cDNA and genomic clones and determined the human chromosome positions of two genes encoding transcription factors expressed in the liver and the pituitary gland: albumin D-site-binding protein (DBP) and thyrotroph embryonic factor (TEF). Both proteins have been identified as members of the PAR (proline and acidic amino acid-rich) subfamily of bZIP transcription factors in the rat, but human homologues have not been characterized. Using a fluorescence in situ hybridization technique, the DBP locus was assigned to chromosome 19q13, and TEF to chromosome 22q13. Each assignment was confirmed by means of human chromosome segregation in somatic cellmore » hybrids. Coding sequences of DBP and TEF, extending beyond the bZIP domain to the PAR region, were highly conserved in both human-human and interspecies comparisons. Conservation of the exon-intron boundaries of each bZIP domain-encoding exon suggested derivation from a common ancestral gene. DBP and TEF mRNAs were expressed in all tissues and cell lines examined, including brain, lung, liver, spleen, and kidney. Knowledge of the human chromosome locations of these PAR proteins will facilitate studies to assess their involvement in carcinogenesis and other fundamental biological processes. 37 refs., 5 figs., 1 tab.« less

Characterization and Expression of Glutamate Dehydrogenase in Response to Acute Salinity Stress in the Chinese Mitten Crab, Eriocheir sinensis

PubMed Central

Wang, Yueru; Li, Erchao; Yu, Na; Wang, Xiaodan; Cai, Chunfang; Tang, Boping; Chen, Liqiao; Van Wormhoudt, Alain

2012-01-01

Background Glutamate dehydrogenase (GDH) is a key enzyme for the synthesis and catabolism of glutamic acid, proline and alanine, which are important osmolytes in aquatic animals. However, the response of GDH gene expression to salinity alterations has not yet been determined in macro-crustacean species. Methodology/Principal Findings GDH cDNA was isolated from Eriocheir sinensis. Then, GDH gene expression was analyzed in different tissues from normal crabs and the muscle of crabs following transfer from freshwater (control) directly to water with salinities of 16‰ and 30‰, respectively. Full-length GDH cDNA is 2,349 bp, consisting of a 76 bp 5′- untranslated region, a 1,695 bp open reading frame encoding 564 amino acids and a 578 bp 3′- untranslated region. E. sinensis GDH showed 64–90% identity with protein sequences of mammalian and crustacean species. Muscle was the dominant expression source among all tissues tested. Compared with the control, GDH expression significantly increased at 6 h in crabs transferred to 16‰ and 30‰ salinity, and GDH expression peaked at 48 h and 12 h, respectively, with levels approximately 7.9 and 8.5 fold higher than the control. The free amino acid (FAA) changes in muscle, under acute salinity stress (16‰ and 30‰ salinities), correlated with GDH expression levels. Total FAA content in the muscle, which was based on specific changes in arginine, proline, glycine, alanine, taurine, serine and glutamic acid, tended to increase in crabs following transfer to salt water. Among these, arginine, proline and alanine increased significantly during salinity acclimation and accounted for the highest proportion of total FAA. Conclusions E. sinensis GDH is a conserved protein that serves important functions in controlling osmoregulation. We observed that higher GDH expression after ambient salinity increase led to higher FAA metabolism, especially the synthesis of glutamic acid, which increased the synthesis of proline and alanine to meet the demand of osmoregulation at hyperosmotic conditions. PMID:22615974

Molecular evolution and transcriptional regulation of the oilseed rape proline dehydrogenase genes suggest distinct roles of proline catabolism during development.

PubMed

Faës, Pascal; Deleu, Carole; Aïnouche, Abdelkader; Le Cahérec, Françoise; Montes, Emilie; Clouet, Vanessa; Gouraud, Anne-Marie; Albert, Benjamin; Orsel, Mathilde; Lassalle, Gilles; Leport, Laurent; Bouchereau, Alain; Niogret, Marie-Françoise

2015-02-01

Six BnaProDH1 and two BnaProDH2 genes were identified in Brassica napus genome. The BnaProDH1 genes are mainly expressed in pollen and roots' organs while BnaProDH2 gene expression is associated with leaf vascular tissues at senescence. Proline dehydrogenase (ProDH) catalyzes the first step in the catabolism of proline. The ProDH gene family in oilseed rape (Brassica napus) was characterized and compared to other Brassicaceae ProDH sequences to establish the phylogenetic relationships between genes. Six BnaProDH1 genes and two BnaProDH2 genes were identified in the B. napus genome. Expression of the three paralogous pairs of BnaProDH1 genes and the two homoeologous BnaProDH2 genes was measured by real-time quantitative RT-PCR in plants at vegetative and reproductive stages. The BnaProDH2 genes are specifically expressed in vasculature in an age-dependent manner, while BnaProDH1 genes are strongly expressed in pollen grains and roots. Compared to the abundant expression of BnaProDH1, the overall expression of BnaProDH2 is low except in roots and senescent leaves. The BnaProDH1 paralogs showed different levels of expression with BnaA&C.ProDH1.a the most strongly expressed and BnaA&C.ProDH1.c the least. The promoters of two BnaProDH1 and two BnaProDH2 genes were fused with uidA reporter gene (GUS) to characterize organ and tissue expression profiles in transformed B. napus plants. The transformants with promoters from different genes showed contrasting patterns of GUS activity, which corresponded to the spatial expression of their respective transcripts. ProDHs probably have non-redundant functions in different organs and at different phenological stages. In terms of molecular evolution, all BnaProDH sequences appear to have undergone strong purifying selection and some copies are becoming subfunctionalized. This detailed description of oilseed rape ProDH genes provides new elements to investigate the function of proline metabolism in plant development.

Pigeonpea Hybrid-Proline-Rich Protein (CcHyPRP) Confers Biotic and Abiotic Stress Tolerance in Transgenic Rice

PubMed Central

Mellacheruvu, Sunitha; Tamirisa, Srinath; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2016-01-01

In this study, we report the overexpression of Cajanus cajan hybrid-proline-rich protein encoding gene (CcHyPRP) in rice which resulted in increased tolerance to both abiotic and biotic stresses. Compared to the control plants, the transgenic rice lines, expressing CcHyPRP, exhibited high-level tolerance against major abiotic stresses, viz., drought, salinity, and heat, as evidenced by increased biomass, chlorophyll content, survival rate, root, and shoot growth. Further, transgenic rice lines showed increased panicle size and grain number compared to the control plants under different stress conditions. The CcHyPRP transgenics, as compared to the control, revealed enhanced activities of catalase and superoxide dismutase (SOD) enzymes and reduced malondialdehyde (MDA) levels. Expression pattern of CcHyPRP::GFP fusion-protein confirmed its predominant localization in cell walls. Moreover, the CcHyPRP transgenics, as compared to the control, exhibited increased resistance to the fungal pathogen Magnaporthe grisea which causes blast disease in rice. Higher levels of bZIP and endochitinase transcripts as well as endochitinase activity were observed in transgenic rice compared to the control plants. The overall results demonstrate the intrinsic role of CcHyPRP in conferring multiple stress tolerance at the whole-plant level. The multipotent CcHyPRP seems promising as a prime candidate gene to fortify crop plants for enhanced tolerance/resistance to different stress factors. PMID:26834756

Identification of mRNA transcript and screening of amino acids in response to interaction of salinity and nitrate in aquatic fern Azolla caroliniana.

PubMed

Tammam, A A; Mostafa, E M

2012-06-01

The mechanisms by which Azolla caroliniana respond to salt stress in absence and presence of nitrate is investigated. Screening of amino acid and differential display is used to compare overall differences in gene expression between salinity-stressed and unstressed Azolla caroliniana by quantitative reverse transcriptase polymerase chain reaction (RT-PC R). Results showed that under saline conditions, aspartic acid, glutamic acid, alanine and leucine were the amino acids found to be abundant in Azolla caroliniana, accounting for 11.26%, 8.66%, 9.43%, and 12.36%, respectively. Following salinity stress, a decrease in free glutamate concomitant with a parallel decrease in free proline was indeed evident. Interaction between nitrate and salinity stress increased proline content significantly. By screening a cDNA library, we have identified protein products by homology with known proteins. The RNA transcripts encoding protein influencing secondary metabolites and vacuolar Na+/H+ antiporter that facilitate the transport system. The databasematched under interaction of nitrate and 50 mM NaCl were associated with wall biosynthesis, disease resistance, metabolite transport and protein regulator, other gene for metabolism of steroids and secondary transport. Results obtained from this research could represent a key step in understanding the molecular mechanism of salt tolerance of Azolla caroliniana in the presence and absence of nitrate.

Tetramer-organizing polyproline-rich peptides differ in CHO cell-expressed and plasma-derived human butyrylcholinesterase tetramers.

PubMed

Schopfer, Lawrence M; Lockridge, Oksana

2016-06-01

Tetrameric butyrylcholinesterase (BChE) in human plasma is the product of multiple genes, namely one BCHE gene on chromosome 3q26.1 and multiple genes that encode polyproline-rich peptides. The function of the polyproline-rich peptides is to assemble BChE into tetramers. CHO cells transfected with human BChE cDNA express BChE monomers and dimers, but only low quantities of tetramers. Our goal was to identify the polyproline-rich peptides in CHO-cell derived human BChE tetramers. CHO cell-produced human BChE tetramers were purified from serum-free culture medium. Peptides embedded in the tetramerization domain were released from BChE tetramers by boiling and identified by liquid chromatography-tandem mass spectrometry. A total of 270 proline-rich peptides were sequenced, ranging in size from 6-41 residues. The peptides originated from 60 different proteins that reside in multiple cell compartments including the nucleus, cytoplasm, and endoplasmic reticulum. No single protein was the source of the polyproline-rich peptides in CHO cell-expressed human BChE tetramers. In contrast, 70% of the tetramer-organizing peptides in plasma-derived BChE tetramers originate from lamellipodin. No protein source was identified for polyproline peptides containing up to 41 consecutive proline residues. In conclusion, the use of polyproline-rich peptides as a tetramerization motif is documented only for the cholinesterases, but is expected to serve other tetrameric proteins as well. The CHO cell data suggest that the BChE tetramer-organizing peptide can arise from a variety of proteins. Copyright © 2016 Elsevier B.V. All rights reserved.

Evolution of sfbI Encoding Streptococcal Fibronectin-Binding Protein I: Horizontal Genetic Transfer and Gene Mosaic Structure

PubMed Central

Towers, Rebecca J.; Fagan, Peter K.; Talay, Susanne R.; Currie, Bart J.; Sriprakash, Kadaba S.; Walker, Mark J.; Chhatwal, Gursharan S.

2003-01-01

Streptococcal fibronectin-binding protein is an important virulence factor involved in colonization and invasion of epithelial cells and tissues by Streptococcus pyogenes. In order to investigate the mechanisms involved in the evolution of sfbI, the sfbI genes from 54 strains were sequenced. Thirty-four distinct alleles were identified. Three principal mechanisms appear to have been involved in the evolution of sfbI. The amino-terminal aromatic amino acid-rich domain is the most variable region and is apparently generated by intergenic recombination of horizontally acquired DNA cassettes, resulting in a genetic mosaic in this region. Two distinct and divergent sequence types that shared only 61 to 70% identity were identified in the central proline-rich region, while variation at the 3′ end of the gene is due to deletion or duplication of defined repeat units. Potential antigenic and functional variabilities in SfbI imply significant selective pressure in vivo with direct implications for the microbial pathogenesis of S. pyogenes. PMID:14662917

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Proline Dehydrogenase Regulates Redox State and Respiratory Metabolism in Trypanosoma cruzi

PubMed Central

Paes, Lisvane Silva; Suárez Mantilla, Brian; Zimbres, Flávia Menezes; Pral, Elisabeth Mieko Furusho; Diogo de Melo, Patrícia; Tahara, Erich B.; Kowaltowski, Alicia J.; Elias, Maria Carolina; Silber, Ariel Mariano

2013-01-01

Over the past three decades, L-proline has become recognized as an important metabolite for trypanosomatids. It is involved in a number of key processes, including energy metabolism, resistance to oxidative and nutritional stress and osmoregulation. In addition, this amino acid supports critical parasite life cycle processes by acting as an energy source, thus enabling host-cell invasion by the parasite and subsequent parasite differentiation. In this paper, we demonstrate that L-proline is oxidized to Δ1-pyrroline-5-carboxylate (P5C) by the enzyme proline dehydrogenase (TcPRODH, E.C. 1.5.99.8) localized in Trypanosoma cruzi mitochondria. When expressed in its active form in Escherichia coli, TcPRODH exhibits a Km of 16.58±1.69 µM and a Vmax of 66±2 nmol/min mg. Furthermore, we demonstrate that TcPRODH is a FAD-dependent dimeric state protein. TcPRODH mRNA and protein expression are strongly upregulated in the intracellular epimastigote, a stage which requires an external supply of proline. In addition, when Saccharomyces cerevisiae null mutants for this gene (PUT1) were complemented with the TcPRODH gene, diminished free intracellular proline levels and an enhanced sensitivity to oxidative stress in comparison to the null mutant were observed, supporting the hypothesis that free proline accumulation constitutes a defense against oxidative imbalance. Finally, we show that proline oxidation increases cytochrome c oxidase activity in mitochondrial vesicles. Overall, these results demonstrate that TcPRODH is involved in proline-dependant cytoprotection during periods of oxidative imbalance and also shed light on the participation of proline in energy metabolism, which drives critical processes of the T. cruzi life cycle. PMID:23894476

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Nitrogen Metabolite Repression of Metabolism and Virulence in the Human Fungal Pathogen Cryptococcus neoformans

PubMed Central

Lee, I. Russel; Chow, Eve W. L.; Morrow, Carl A.; Djordjevic, Julianne T.; Fraser, James A.

2011-01-01

Proper regulation of metabolism is essential to maximizing fitness of organisms in their chosen environmental niche. Nitrogen metabolite repression is an example of a regulatory mechanism in fungi that enables preferential utilization of easily assimilated nitrogen sources, such as ammonium, to conserve resources. Here we provide genetic, transcriptional, and phenotypic evidence of nitrogen metabolite repression in the human pathogen Cryptococcus neoformans. In addition to loss of transcriptional activation of catabolic enzyme-encoding genes of the uric acid and proline assimilation pathways in the presence of ammonium, nitrogen metabolite repression also regulates the production of the virulence determinants capsule and melanin. Since GATA transcription factors are known to play a key role in nitrogen metabolite repression, bioinformatic analyses of the C. neoformans genome were undertaken and seven predicted GATA-type genes were identified. A screen of these deletion mutants revealed GAT1, encoding the only global transcription factor essential for utilization of a wide range of nitrogen sources, including uric acid, urea, and creatinine—three predominant nitrogen constituents found in the C. neoformans ecological niche. In addition to its evolutionarily conserved role in mediating nitrogen metabolite repression and controlling the expression of catabolic enzyme and permease-encoding genes, Gat1 also negatively regulates virulence traits, including infectious basidiospore production, melanin formation, and growth at high body temperature (39°–40°). Conversely, Gat1 positively regulates capsule production. A murine inhalation model of cryptococcosis revealed that the gat1Δ mutant is slightly more virulent than wild type, indicating that Gat1 plays a complex regulatory role during infection. PMID:21441208

A novel cold-regulated gene from Camellia sinensis, CsCOR1, enhances salt- and dehydration-tolerance in tobacco

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xian-Wen, E-mail: xianwenli01@sina.com; College of Life Science, Xinyang Normal University, Xinyang 464000; Key Laboratory of Horticultural Plant Biology of the Ministry of Education, Huazhong Agricultural University, Wuhan 430070

In present research, the full-length cDNA and the genomic sequence of a novel cold-regulated gene, CsCOR1, were isolated from Camellia sinensis L. The deduced protein CsCOR1 contains a hydrophobic N-terminus as a signal peptide and a hydrophilic C-terminal domain that is rich in glycine, arginine and proline. Two internal repetitive tridecapeptide fragments (HSVTAGRGGYNRG) exist in the middle of the C-terminal domain and the two nucleotide sequences encoding them are identical. CsCOR1 was localized in the cell walls of transgenic-tobaccos via CsCOR1::GFP fusion approach. The expression of CsCOR1 in tea leaves was enhanced dramatically by both cold- and dehydration-stress. And overexpressionmore » of CsCOR1 in transgenic-tobaccos improved obviously the tolerance to salinity and dehydration.« less

Contribution of proline to the pre-structuring tendency of transient helical secondary structure elements in intrinsically disordered proteins.

PubMed

Lee, Chewook; Kalmar, Lajos; Xue, Bin; Tompa, Peter; Daughdrill, Gary W; Uversky, Vladimir N; Han, Kyou-Hoon

2014-03-01

IDPs function without relying on three-dimensional structures. No clear rationale for such a behavior is available yet. PreSMos are transient secondary structures observed in the target-free IDPs and serve as the target-binding "active" motifs in IDPs. Prolines are frequently found in the flanking regions of PreSMos. Contribution of prolines to the conformational stability of the helical PreSMos in IDPs is investigated. MD simulations are performed for several IDP segments containing a helical PreSMo and the flanking prolines. To measure the influence of flanking-prolines on the structural content of a helical PreSMo calculations were done for wild type as well as for mutant segments with Pro→Asp, His, Lys, or Ala. The change in the helicity due to removal of a proline was measured both for the PreSMo region and for the flanking regions. The α-helical content in ~70% of the helical PreSMos at the early stage of simulation decreases due to replacement of an N-terminal flanking proline by other residues whereas the helix content in nearly all PreSMos increases when the same replacements occur at the C-terminal flanking region. The helix destabilizing/terminating role of the C-terminal flanking prolines is more pronounced than the helix promoting effect of the N-terminal flanking prolines. This work represents a novel example demonstrating that a proline is encoded in an IDP with a defined purpose. The helical PreSMos presage their target-bound conformations. As they most likely mediate IDP-target binding via conformational selection their helical content can be an important feature for IDP function. Copyright © 2013 Elsevier B.V. All rights reserved.

Structural analysis of the RH-like blood group gene products in nonhuman primates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salvignol, I.; Calvas, P.; Blancher, A.

1995-03-01

Rh-related transcripts present in bone marrow samples from several species of nonhuman primates (chimpanzee, gorilla, gibbon, crab-eating macaque) have been amplified by RT-polymerase chain reaction using primers deduced from the sequence of human RH genes. Nucleotide sequence analysis of the nonhuman transcripts revealed a high degree of similarity to human blood group Rh sequences, suggesting a great conservation of the RH genes throughout evolution. Full-length transcripts, potentially encoding 417 amino acid long proteins homologous to Rh polypeptides, were characterized, as well as mRNA isoforms which harbored nucleotide deletions or insertions and potentially encode truncated proteins. Proteins of 30-40,000 M{sub r},more » immunologically related to human Rh proteins, were detected by western blot analysis with antipeptide antibodies, indicating that Rh-like transcripts are translated into membrane proteins. Comparison of human and nonhuman protein sequences was pivotal in clarifying the molecular basis of the blood group C/c polymorphism, showing that only the Pro103Ser substitution was correlated with C/c polymorphism. In addition, it was shown that a proline residue at position 102 was critical in the expression of C and c epitopes, most likely by providing an appropriate conformation of Rh polypeptides. From these data a phylogenetic reconstruction of the RH locus evolution has been calculated from which an unrooted phylogenetic tree could be proposed, indicating that African ape Rh-like genes would be closer to the human RhD gene than to the human RhCE gene. 55 refs., 4 figs., 1 tab.« less

Biosynthesis of the nargenicin A1 pyrrole moiety from Nocardia sp. CS682.

PubMed

Maharjan, Sushila; Aryal, Niraj; Bhattarai, Saurabh; Koju, Dinesh; Lamichhane, Janardan; Sohng, Jae Kyung

2012-01-01

A number of structurally diverse natural products harboring pyrrole moieties possess a wide range of biological activities. Studies on biosynthesis of pyrrole ring have shown that pyrrole moieties are derived from L-proline. Nargenicin A(1), a saturated alicyclic polyketide from Nocardia sp. CS682, is a pyrrole-2-carboxylate ester of nodusmicin. We cloned and identified a set of four genes from Nocardia sp. CS682 that show sequence similarity to the respective genes involved in the biosynthesis of the pyrrole moieties of pyoluteorin in Pseudomonas fluorescens, clorobiocin in Streptomyces roseochromogenes subsp. Oscitans, coumermycin A(1) in Streptomyces rishiriensis, one of the pyrrole rings of undecylprodigiosin in Streptomyces coelicolor, and leupyrrins in Sorangium cellulosum. These genes were designated as ngnN4, ngnN5, ngnN3, and ngnN2. In this study, we presented the evidences that the pyrrole moiety of nargenicin A(1) was also derived from L-proline by the coordinated action of three proteins, NgnN4 (proline adenyltransferase), NgnN5 (proline carrier protein), and NgnN3 (flavine-dependent acyl-coenzyme A dehydrogenases). Biosynthesis of pyrrole moiety in nargenicin A(1) is initiated by NgnN4 that catalyzes ATP-dependent activation of L-proline into L-prolyl-AMP, and the latter is transferred to NgnN5 to create prolyl-S-peptidyl carrier protein (PCP). Later, NgnN3 catalyzes the two-step oxidation of prolyl-S-PCP into pyrrole-2-carboxylate. Thus, this study presents another example of a pyrrole moiety biosynthetic pathway that uses a set of three genes to convert L-proline into pyrrole-2-carboxylic acid moiety.

A Plant Gene Up-Regulated at Rust Infection Sites

PubMed Central

Ayliffe, Michael A.; Roberts, James K.; Mitchell, Heidi J.; Zhang, Ren; Lawrence, Gregory J.; Ellis, Jeffrey G.; Pryor, Tony J.

2002-01-01

Expression of the fis1 gene from flax (Linum usitatissimum) is induced by a compatible rust (Melampsora lini) infection. Infection of transgenic plants containing a β-glucuronidase (GUS) reporter gene under the control of the fis1 promoter showed that induction is highly localized to those leaf mesophyll cells within and immediately surrounding rust infection sites. The level of induction reflects the extent of fungal growth. In a strong resistance reaction, such as the hypersensitive fleck mediated by the L6 resistance gene, there is very little fungal growth and a microscopic level of GUS expression. Partially resistant flax leaves show levels of GUS expression that were intermediate to the level observed in the fully susceptible infection. Sequence and deletion analysis using both transient Agrobacterium tumefaciens expression and stable transformation assays have shown that the rust-inducible fis1 promoter is contained within a 580-bp fragment. Homologs of fis1 were identified in expressed sequence tag databases of a range of plant species including dicots, monocots, and a gymnosperm. Homologous genes isolated from maize (Zea mays; mis1), barley (Hordeum vulgare; bis1), wheat (Triticum aestivum; wis1), and Arabidopsis encode proteins that are highly similar (76%–82%) to the FIS1 protein. The Arabidopsis homologue has been reported to encode a Δ1-pyrroline-5-carboxylate dehydrogenase that is involved in the catabolism of proline to glutamate. RNA-blot analysis showed that mis1 in maize and the bis1 homolog in barley are both up-regulated by a compatible infection with the corresponding species-specific rust. The rust-induced genes homologous to fis1 are present in many plants. The promoters of these genes have potential roles for the engineering of synthetic rust resistance genes by targeting transgene expression to the sites of rust infection. PMID:12011348

Overexpression of a Chimeric Gene, OsDST-SRDX, Improved Salt Tolerance of Perennial Ryegrass

PubMed Central

Cen, Huifang; Ye, Wenxing; Liu, Yanrong; Li, Dayong; Wang, Kexin; Zhang, Wanjun

2016-01-01

The Drought and Salt Tolerance gene (DST) encodes a C2H2 zinc finger transcription factor, which negatively regulates salt tolerance in rice (Oryza sativa). Phylogenetic analysis of six homologues of DST genes in different plant species revealed that DST genes were conserved evolutionarily. Here, the rice DST gene was linked to an SRDX domain for gene expression repression based on the Chimeric REpressor gene-Silencing Technology (CRES-T) to make a chimeric gene (OsDST-SRDX) construct and introduced into perennial ryegrass by Agrobacterium-mediated transformation. Integration and expression of the OsDST-SRDX in transgenic plants were tested by PCR and RT-PCR, respectively. Transgenic lines overexpressing the OsDST-SRDX fusion gene showed obvious phenotypic differences and clear resistance to salt-shock and to continuous salt stresses compared to non-transgenic plants. Physiological analyses including relative leaf water content, electrolyte leakage, proline content, malondialdehyde (MDA) content, H2O2 content and sodium and potassium accumulation indicated that the OsDST-SRDX fusion gene enhanced salt tolerance in transgenic perennial ryegrass by altering a wide range of physiological responses. To our best knowledge this study is the first report of utilizing Chimeric Repressor gene-Silencing Technology (CRES-T) in turfgrass and forage species for salt-tolerance improvement. PMID:27251327

[Agrobacterium-mediated sunflower transformation (Helianthus annuus L.) in vitro and in Planta using strain of LBA4404 harboring binary vector pBi2E with dsRNA-suppressor proline dehydrogenase gene].

PubMed

Tishchenko, E N; Komisarenko, A G; Mikhal'skaia, S I; Sergeeva, L E; Adamenko, N I; Morgun, B V; Kochetov, A V

2014-01-01

To estimate the efficiency of proline dehydrogenase gene suppression towards increasing of sunflower (Helianthus annuus L.) tolerance level to water deficit and salinity, we employed strain LBA4404 harboring pBi2E with double-stranded RNA-suppressor, which were prepared on basis arabidopsis ProDH1 gene. The techniques of Agrobacterium-mediated transformation in vitro and in planta during fertilization sunflower have been proposed. There was shown the genotype-depended integration of T-DNA in sunflower genome. PCR-analysis showed that ProDH1 presents in genome of inbred lines transformed in planta, as well as in T1- and T2-generations. In trans-genic regenerants the essential accumulation of free L-proline during early stages of in vitro cultivation under normal conditions was shown. There was established the essential accumulation of free proline in transgenic regenerants during cultivation under lethal stress pressure (0.4 M mannitol and 2.0% sea water salts) and its decline upon the recovery period. These data are declared about effectiveness of suppression of sunflower ProDH and gene participation in processes connected with osmotolerance.

Functional analysis of ars gene cluster of Pannonibacter indicus strain HT23(T) (DSM 23407(T)) and identification of a proline residue essential for arsenate reductase activity.

PubMed

Bandyopadhyay, Saumya; Das, Subrata K

2016-04-01

Arsenic is a naturally occurring ubiquitous highly toxic metalloid. In this study, we have identified ars gene cluster in Pannonibacter indicus strain HT23(T) (DSM 23407(T)), responsible for reduction of toxic pentavalent arsenate. The ars gene cluster is comprised of four non-overlapping open reading frames (ORFs) encoding a transcriptional regulator (ArsR), a low molecular weight protein tyrosine phosphatases (LMW-PTPase) with hypothetical function, an arsenite efflux pump (Acr3), and an arsenate reductase (ArsC). Heterologous expression of arsenic inducible ars gene cluster conferred arsenic resistance to Escherichia coli ∆ars mutant strain AW3110. The recombinant ArsC was purified and assayed. Site-directed mutagenesis was employed to ascertain the role of specific amino acids in ArsC catalysis. Pro94X (X = Ala, Arg, Cys, and His) amino acid substitutions led to enzyme inactivation. Circular dichroism spectra analysis suggested Pro94 as an essential amino acid for enzyme catalytic activity as it is indispensable for optimum protein folding in P. indicus Grx-coupled ArsC.

Development of a codon optimization strategy using the efor RED reporter gene as a test case

NASA Astrophysics Data System (ADS)

Yip, Chee-Hoo; Yarkoni, Orr; Ajioka, James; Wan, Kiew-Lian; Nathan, Sheila

2018-04-01

Synthetic biology is a platform that enables high-level synthesis of useful products such as pharmaceutically related drugs, bioplastics and green fuels from synthetic DNA constructs. Large-scale expression of these products can be achieved in an industrial compliant host such as Escherichia coli. To maximise the production of recombinant proteins in a heterologous host, the genes of interest are usually codon optimized based on the codon usage of the host. However, the bioinformatics freeware available for standard codon optimization might not be ideal in determining the best sequence for the synthesis of synthetic DNA. Synthesis of incorrect sequences can prove to be a costly error and to avoid this, a codon optimization strategy was developed based on the E. coli codon usage using the efor RED reporter gene as a test case. This strategy replaces codons encoding for serine, leucine, proline and threonine with the most frequently used codons in E. coli. Furthermore, codons encoding for valine and glycine are substituted with the second highly used codons in E. coli. Both the optimized and original efor RED genes were ligated to the pJS209 plasmid backbone using Gibson Assembly and the recombinant DNAs were transformed into E. coli E. cloni 10G strain. The fluorescence intensity per cell density of the optimized sequence was improved by 20% compared to the original sequence. Hence, the developed codon optimization strategy is proposed when designing an optimal sequence for heterologous protein production in E. coli.

An abundantly expressed mucin-like protein from Toxocara canis infective larvae: the precursor of the larval surface coat glycoproteins.

PubMed Central

Gems, D; Maizels, R M

1996-01-01

Evasion of host immunity by Toxocara canis infective larvae is mediated by the nematode surface coat, which is shed in response to binding by host antibody molecules or effector cells. The major constituent of the coat is the TES-120 glycoprotein series. We have isolated a 730-bp cDNA from the gene encoding the apoprotein precursor of TES-120. The mRNA is absent from T. canis adults but hyperabundant in larvae, making up approximately 10% of total mRNA, and is trans-spliced with the nematode 5' leader sequence SL1. It encodes a 15.8-kDa protein (after signal peptide removal) containing a typical mucin domain: 86 amino acid residues, 72.1% of which are Ser or Thr, organized into an array of heptameric repeats, interspersed with proline residues. At the C-terminal end of the putative protein are two 36-amino acid repeats containing six Cys residues, in a motif that can also be identified in several genes in Caenorhabditis elegans. Although TES-120 displays size and charge heterogeneity, there is a single copy gene and a homogeneous size of mRNA. The association of overexpression of some membrane-associated mucins with immunosuppression and tumor metastasis suggests a possible model for the role of the surface coat in immune evasion by parasitic nematodes. Images Fig. 1 Fig. 4 PMID:8643687

Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling

PubMed Central

Jiang, Shu-Ye; Ramachandran, Srinivasan

2016-01-01

DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3′-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix–hairpin–Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway. PMID:27026054

The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets

PubMed Central

Guzmán Prieto, Ana M.; Urbanus, Rolf T.; Zhang, Xinglin; Bierschenk, Damien; Koekman, C. Arnold; van Luit-Asbroek, Miranda; Ouwerkerk, Janneke P.; Pape, Marieke; Paganelli, Fernanda L.; Wobser, Dominique; Huebner, Johannes; Hendrickx, Antoni P. A.; Bonten, Marc J. M.; Willems, Rob J. L.; van Schaik, Willem

2015-01-01

Enterococcus faecium is a commensal of the mammalian gastrointestinal tract, but is also found in non-enteric environments where it can grow between 10 °C and 45 °C. E. faecium has recently emerged as a multi-drug resistant nosocomial pathogen. We hypothesized that genes involved in the colonization and infection of mammals exhibit temperature-regulated expression control and we therefore performed a transcriptome analysis of the clinical isolate E. faecium E1162, during mid-exponential growth at 25 °C and 37 °C. One of the genes that exhibited differential expression between 25 °C and 37 °C, was predicted to encode a peptidoglycan-anchored surface protein. The N-terminal domain of this protein is unique to E. faecium and closely related enterococci, while the C-terminal domain is homologous to the Streptococcus agalactiae surface protein BibA. This region of the protein contains proline-rich repeats, leading us to name the protein PrpA for proline-rich protein A. We found that PrpA is a surface-exposed protein which is most abundant during exponential growth at 37 °C in E. faecium E1162. The heterologously expressed and purified N-terminal domain of PrpA was able to bind to the extracellular matrix proteins fibrinogen and fibronectin. In addition, the N-terminal domain of PrpA interacted with both non-activated and activated platelets. PMID:26675410

The N-terminal domain of the thermo-regulated surface protein PrpA of Enterococcus faecium binds to fibrinogen, fibronectin and platelets.

PubMed

Guzmán Prieto, Ana M; Urbanus, Rolf T; Zhang, Xinglin; Bierschenk, Damien; Koekman, C Arnold; van Luit-Asbroek, Miranda; Ouwerkerk, Janneke P; Pape, Marieke; Paganelli, Fernanda L; Wobser, Dominique; Huebner, Johannes; Hendrickx, Antoni P A; Bonten, Marc J M; Willems, Rob J L; van Schaik, Willem

2015-12-17

Enterococcus faecium is a commensal of the mammalian gastrointestinal tract, but is also found in non-enteric environments where it can grow between 10 °C and 45 °C. E. faecium has recently emerged as a multi-drug resistant nosocomial pathogen. We hypothesized that genes involved in the colonization and infection of mammals exhibit temperature-regulated expression control and we therefore performed a transcriptome analysis of the clinical isolate E. faecium E1162, during mid-exponential growth at 25 °C and 37 °C. One of the genes that exhibited differential expression between 25 °C and 37 °C, was predicted to encode a peptidoglycan-anchored surface protein. The N-terminal domain of this protein is unique to E. faecium and closely related enterococci, while the C-terminal domain is homologous to the Streptococcus agalactiae surface protein BibA. This region of the protein contains proline-rich repeats, leading us to name the protein PrpA for proline-rich protein A. We found that PrpA is a surface-exposed protein which is most abundant during exponential growth at 37 °C in E. faecium E1162. The heterologously expressed and purified N-terminal domain of PrpA was able to bind to the extracellular matrix proteins fibrinogen and fibronectin. In addition, the N-terminal domain of PrpA interacted with both non-activated and activated platelets.

Modeling gene-environment interactions in oral cavity and esophageal cancers demonstrates a role for the p53 R72P polymorphism in modulating susceptibility.

PubMed

Sarkar, Jayanta; Dominguez, Emily; Li, Guojun; Kusewitt, Donna F; Johnson, David G

2014-08-01

A large number of epidemiological studies have linked a common single-nucleotide polymorphism (SNP) in the human p53 gene to risk for developing a variety of cancers. This SNP encodes either an arginine or proline at position 72 (R72P) of the p53 protein, which can alter the apoptotic activity of p53 via transcriptional and non-transcriptional mechanisms. This SNP has also been reported to modulate the development of human papilloma virus (HPV)-driven cancers through differential targeting of the p53 variant proteins by the E6 viral oncoprotein. Mouse models for the p53 R72P polymorphism have recently been developed but a role for this SNP in modifying cancer risk in response to viral and chemical carcinogens has yet to be established experimentally. Here, we demonstrate that the p53 R72P polymorphism modulates the hyperprolferative, apoptotic and inflammatory phenotypes caused by expression of the HPV16 E6 and E7 oncoproteins. Moreover, the R72P SNP also modifies the carcinogenic response to the chemical carcinogen 4NQO, in the presence and absence of the HPV16 transgene. Our findings confirm several human epidemiological studies associating the codon 72 proline variant with increased risk for certain cancers but also suggest that there are tissue-specific differences in how the R72P polymorphism influences the response to environmental carcinogens. © 2013 Wiley Periodicals, Inc.

Arabidopsis thaliana RALF1 opposes brassinosteroid effects on root cell elongation and lateral root formation

PubMed Central

Moura, Daniel S.

2014-01-01

Rapid alkalinization factor (RALF) is a peptide signal that plays a basic role in cell biology and most likely regulates cell expansion. In this study, transgenic Arabidopsis thaliana lines with high and low levels of AtRALF1 transcripts were used to investigate this peptide’s mechanism of action. Overexpression of the root-specific isoform AtRALF1 resulted in reduced cell size. Conversely, AtRALF1 silencing increased root length by increasing the size of root cells. AtRALF1-silenced plants also showed an increase in the number of lateral roots, whereas AtRALF1 overexpression produced the opposite effect. In addition, four AtRALF1-inducible genes were identified: two genes encoding proline-rich proteins (AtPRP1 and AtPRP3), one encoding a hydroxyproline-rich glycoprotein (AtHRPG2), and one encoding a xyloglucan endotransglucosylase (TCH4). These genes were expressed in roots and involved in cell-wall rearrangement, and their induction was concentration dependent. Furthermore, AtRALF1-overexpressing plants were less sensitive to exogenous brassinolide (BL); upon BL treatment, the plants showed no increase in root length and a compromised increase in hypocotyl elongation. In addition, the treatment had no effect on the number of emerged lateral roots. AtRALF1 also induces two brassinosteroid (BR)-downregulated genes involved in the BR biosynthetic pathway: the cytochrome P450 monooxygenases CONSTITUTIVE PHOTOMORPHISM AND DWARFISM (CPD) and DWARF4 (DWF4). Simultaneous treatment with both AtRALF1 and BL caused a reduction in AtRALF1-inducible gene expression levels, suggesting that these signals may compete for components shared by both pathways. Taken together, these results indicate an opposing effect of AtRALF1 and BL, and suggest that RALF’s mechanism of action could be to interfere with the BR signalling pathway. PMID:24620000

Kunitz Proteinase Inhibitors Limit Water Stress Responses in White Clover (Trifolium repens L.) Plants.

PubMed

Islam, Afsana; Leung, Susanna; Nikmatullah, Aluh; Dijkwel, Paul P; McManus, Michael T

2017-01-01

The response of plants to water deficiency or drought is a complex process, the perception of which is triggered at the molecular level before any visible morphological responses are detected. It was found that different groups of plant proteinase inhibitors (PIs) are induced and play an active role during abiotic stress conditions such as drought. Our previous work with the white clover ( Trifolium repens L.) Kunitz Proteinase Inhibitor ( Tr-KPI ) gene family showed that Tr-KPIs are differentially regulated to ontogenetic and biotic stress associated cues and that, at least some members of this gene family may be required to maintain cellular homeostasis. Altered cellular homeostasis may also affect abiotic stress responses and therefore, we aimed to understand if distinct Tr-PKI members function during drought stress. First, the expression level of three Tr-KPI genes, Tr-KPI1 , Tr-KPI2 , and Tr-KPI5 , was measured in two cultivars and one white clover ecotype with differing capacity to tolerate drought. The expression of Tr-KPI1 and Tr-KPI5 increased in response to water deficiency and this was exaggerated when the plants were treated with a previous period of water deficiency. In contrast, proline accumulation and increased expression of Tr-NCED1 , a gene encoding a protein involved in ABA biosynthesis, was delayed in plants that experienced a previous drought period. RNAi knock-down of Tr-KPI1 and Tr-KPI5 resulted in increased proline accumulation in leaf tissue of plants grown under both well-watered and water-deficit conditions. In addition, increased expression of genes involved in ethylene biosynthesis was found. The data suggests that Tr-KPIs , particularly Tr-KPI5 , have an explicit function during water limitation. The results also imply that the Tr-KPI family has different in planta proteinase targets and that the functions of this protein family are not solely restricted to one of storage proteins or in response to biotic stress.

Kunitz Proteinase Inhibitors Limit Water Stress Responses in White Clover (Trifolium repens L.) Plants

PubMed Central

Islam, Afsana; Leung, Susanna; Nikmatullah, Aluh; Dijkwel, Paul P.; McManus, Michael T.

2017-01-01

The response of plants to water deficiency or drought is a complex process, the perception of which is triggered at the molecular level before any visible morphological responses are detected. It was found that different groups of plant proteinase inhibitors (PIs) are induced and play an active role during abiotic stress conditions such as drought. Our previous work with the white clover (Trifolium repens L.) Kunitz Proteinase Inhibitor (Tr-KPI) gene family showed that Tr-KPIs are differentially regulated to ontogenetic and biotic stress associated cues and that, at least some members of this gene family may be required to maintain cellular homeostasis. Altered cellular homeostasis may also affect abiotic stress responses and therefore, we aimed to understand if distinct Tr-PKI members function during drought stress. First, the expression level of three Tr-KPI genes, Tr-KPI1, Tr-KPI2, and Tr-KPI5, was measured in two cultivars and one white clover ecotype with differing capacity to tolerate drought. The expression of Tr-KPI1 and Tr-KPI5 increased in response to water deficiency and this was exaggerated when the plants were treated with a previous period of water deficiency. In contrast, proline accumulation and increased expression of Tr-NCED1, a gene encoding a protein involved in ABA biosynthesis, was delayed in plants that experienced a previous drought period. RNAi knock-down of Tr-KPI1 and Tr-KPI5 resulted in increased proline accumulation in leaf tissue of plants grown under both well-watered and water-deficit conditions. In addition, increased expression of genes involved in ethylene biosynthesis was found. The data suggests that Tr-KPIs, particularly Tr-KPI5, have an explicit function during water limitation. The results also imply that the Tr-KPI family has different in planta proteinase targets and that the functions of this protein family are not solely restricted to one of storage proteins or in response to biotic stress. PMID:29046678

Susceptibility to Dental Caries and the Salivary Proline-Rich Proteins

PubMed Central

Levine, Martin

2011-01-01

Early childhood caries affects 28% of children aged 2–6 in the US and is not decreasing. There is a well-recognized need to identify susceptible children at birth. Caries-free adults neutralize bacterial acids in dental biofilms better than adults with severe caries. Saliva contains acidic and basic proline-rich proteins (PRPs) which attach to oral streptococci. The PRPs are encoded within a small region of chromosome 12. An acidic PRP allele (Db) protects Caucasian children from caries but is more common in African Americans. Some basic PRP allelic phenotypes have a three-fold greater frequency in caries-free adults than in those with severe caries. Early childhood caries may associate with an absence of certain basic PRP alleles which bind oral streptococci, neutralize biofilm acids, and are in linkage disequilibrium with Db in Caucasians. The encoding of basic PRP alleles is updated and a new technology for genotyping them is described. PMID:22190937

Distinct gene expression profiles characterize the histopathological stages of disease in Helicobacter-induced mucosa-associated lymphoid tissue lymphoma

PubMed Central

Mueller, Anne; O'Rourke, Jani; Grimm, Jan; Guillemin, Karen; Dixon, Michael F.; Lee, Adrian; Falkow, Stanley

2003-01-01

Long-term colonization of humans with Helicobacter pylori can cause the development of gastric B cell mucosa-associated lymphoid tissue lymphoma, yet little is known about the sequence of molecular steps that accompany disease progression. We used microarray analysis and laser microdissection to identify gene expression profiles characteristic and predictive of the various histopathological stages in a mouse model of the disease. The initial step in lymphoma development is marked by infiltration of reactive lymphocytes into the stomach and the launching of a mucosal immune response. Our analysis uncovered molecular markers of both of these processes, including genes coding for the immunoglobulins and the small proline-rich protein Sprr 2A. The subsequent step is characterized histologically by the antigen-driven proliferation and aggregation of B cells and the gradual appearance of lymphoepithelial lesions. In tissues of this stage, we observed increased expression of genes previously associated with malignancy, including the laminin receptor-1 and the multidrug-resistance channel MDR-1. Finally, we found that the transition to destructive lymphoepithelial lesions and malignant lymphoma is marked by an increase in transcription of a single gene encoding calgranulin A/Mrp-8. PMID:12552104

PPE Surface Proteins Are Required for Heme Utilization by Mycobacterium tuberculosis

PubMed Central

Mitra, Avishek; Speer, Alexander; Lin, Kan; Ehrt, Sabine

2017-01-01

ABSTRACT Iron is essential for replication of Mycobacterium tuberculosis, but iron is efficiently sequestered in the human host during infection. Heme constitutes the largest iron reservoir in the human body and is utilized by many bacterial pathogens as an iron source. While heme acquisition is well studied in other bacterial pathogens, little is known in M. tuberculosis. To identify proteins involved in heme utilization by M. tuberculosis, a transposon mutant library was screened for resistance to the toxic heme analog gallium(III)-porphyrin (Ga-PIX). Inactivation of the ppe36, ppe62, and rv0265c genes resulted in resistance to Ga-PIX. Growth experiments using isogenic M. tuberculosis deletion mutants showed that PPE36 is essential for heme utilization by M. tuberculosis, while the functions of PPE62 and Rv0265c are partially redundant. None of the genes restored growth of the heterologous M. tuberculosis mutants, indicating that the proteins encoded by the genes have separate functions. PPE36, PPE62, and Rv0265c bind heme as shown by surface plasmon resonance spectroscopy and are associated with membranes. Both PPE36 and PPE62 proteins are cell surface accessible, while the Rv0265c protein is probably located in the periplasm. PPE36 and PPE62 are, to our knowledge, the first proline-proline-glutamate (PPE) proteins of M. tuberculosis that bind small molecules and are involved in nutrient acquisition. The absence of a virulence defect of the ppe36 deletion mutant indicates that the different iron acquisition pathways of M. tuberculosis may substitute for each other during growth and persistence in mice. The emerging model of heme utilization by M. tuberculosis as derived from this study is substantially different from those of other bacteria. PMID:28119467

Phenotypic characterization, genetic mapping and candidate gene analysis of a source conferring reduced plant height in sunflower.

PubMed

Ramos, María Laura; Altieri, Emiliano; Bulos, Mariano; Sala, Carlos A

2013-01-01

Reduced height germplasm has the potential to increase stem strength, standability, and also yields potential of the sunflower crop (Helianthus annuus L. var. macrocarpus Ckll.). In this study, we report on the inheritance, mapping, phenotypic and molecular characterization of a reduced plant height trait in inbred lines derived from the source DDR. This trait is controlled by a semidominant allele, Rht1, which maps on linkage group 12 of the sunflower public consensus map. Phenotypic effects of this allele include shorter height and internode length, insensibility to exogenous gibberellin application, normal skotomorphogenetic response, and reduced seed set under self-pollination conditions. This later effect presumably is related to the reduced pollen viability observed in all DDR-derived lines studied. Rht1 completely cosegregated with a haplotype of the HaDella1 gene sequence. This haplotype consists of a point mutation converting a leucine residue in a proline within the conserved DELLA domain. Taken together, the phenotypic, genetic, and molecular results reported here indicate that Rht1 in sunflower likely encodes an altered DELLA protein. If the DELPA motif of the HaDELLA1 sequence in the Rht1-encoded protein determines by itself the observed reduction in height is a matter that remains to be investigated.

Osteogenesis imperfecta: recent findings shed new light on this once well-understood condition.

PubMed

Basel, Donald; Steiner, Robert D

2009-06-01

Osteogenesis imperfecta is a systemic heritable disorder of connective tissue whose cardinal manifestation is bone fragility. In approximately 90% of individuals with osteogenesis imperfecta, mutations in either of the genes encoding the pro-alpha1 or pro-alpha2 chains of type I collagen (COL1A1 or COL1A2) can be identified. Of those without collagen mutations, a number of them will have mutations involving the enzyme complex responsible for posttranslational hydroxylation of the position 3 proline residue of COL1A1. Two of the genes encoding proteins involved in that enzyme complex, LEPRE1 and cartilage-associated protein, when mutated have been shown to cause autosomal recessive osteogenesis imperfecta, which has a moderate to severe clinical phenotype, often indistinguishable from osteogenesis imperfecta types II or III. Mutations in COL1A1 or COL1A2 which result in an abnormal protein still capable of forming a triple helix cause a more severe phenotype than mutations that lead to decreased collagen production as a result of the dominant negative effect mediated by continuous protein turnover. The current standard of care includes a multidisciplinary approach with surgical intervention when necessary, proactive physiotherapy, and consideration for the use of bisphosphonates all in attempts to improve quality of life.

Four Japanese male patients with juvenile retinoschisis: only three have mutations in the RS1 gene.

PubMed

Hayashi, Takaaki; Omoto, Satoshi; Takeuchi, Tomokazu; Kozaki, Kenichi; Ueoka, Yasuo; Kitahara, Kenji

2004-11-01

To describe the clinical phenotypes of four unrelated Japanese male patients with juvenile retinoschisis and to investigate occurrences of mutations in the RS1 gene. Observational case series and experimental study. Fundus examinations, fluorescein angiography, and single-flash electroretinography (ERG) were carried out. In one patient, optical coherence tomography (OCT) was performed. The coding regions of the RS1 gene that encodes retinoschisin were amplified by polymerase chain reaction (PCR). The PCR products were purified and directly sequenced. The four affected patients showed cystoid- or wheel-like foveal changes with a little or no fluorescein leakage and negative b-wave patterns in both eyes. The OCT images of foveal retinoschisis disclosed that splitting occurs in the putative fibers of Henle. In three patients, we identified three different missense mutations (p.S73P, p.Y89C, p.R209C) in the functionally important discoidin domain of the RS1 gene. The p.S73P mutation has not been previously reported. In contrast, no nucleotide substitutions were detected in the fourth patient whose parents were unrelated and asymptomatic. No other member of this family for three generations has had juvenile retinoschisis. Because serine 73 is conserved in the mouse ortholog and other discoidin proteins, the proline 73 allele is therefore very likely to encode a defective retinoschisin. Although the inheritance pattern is uncertain in the patient without the RS1 mutation, the clinical and ERG findings were indistinguishable from those of patients with RS1 mutations. This finding points to the genetic heterogeneity of juvenile retinoschisis.

Cellular Localization and Characterization of Cytosolic Binding Partners for Gla Domain-containing Proteins PRRG4 and PRRG2*

PubMed Central

Yazicioglu, Mustafa N.; Monaldini, Luca; Chu, Kirk; Khazi, Fayaz R.; Murphy, Samuel L.; Huang, Heshu; Margaritis, Paris; High, Katherine A.

2013-01-01

The genes encoding a family of proteins termed proline-rich γ-carboxyglutamic acid (PRRG) proteins were identified and characterized more than a decade ago, but their functions remain unknown. These novel membrane proteins have an extracellular γ-carboxyglutamic acid (Gla) protein domain and cytosolic WW binding motifs. We screened WW domain arrays for cytosolic binding partners for PRRG4 and identified novel protein-protein interactions for the protein. We also uncovered a new WW binding motif in PRRG4 that is essential for these newly found protein-protein interactions. Several of the PRRG-interacting proteins we identified are essential for a variety of physiologic processes. Our findings indicate possible novel and previously unidentified functions for PRRG proteins. PMID:23873930

cDNA sequences and organization of IgM heavy chain genes in two holostean fish.

PubMed

Wilson, M R; van Ravenstein, E; Miller, N W; Clem, L W; Middleton, D L; Warr, G W

1995-01-01

Immunoglobulin M heavy chain (mu) sequences of two holostean fish, the bowfin, Amia calva, and the longnose gar, Lepisosteus osseus, were amplified from spleen mRNA by RACE-PCR, cloned, and sequenced. Each mu chain showed the conserved four constant domain structure typical of a secreted mu chain. Southern blot analyses with specific heavy chain variable (VH) and constant (CH) region probes suggest that both fish possess an IgH locus that resembles that of the teleosts, amphibians, and mammals in its organization. The overall sequence similarity of gar and bowfin mu chains was 60% and 48% at the nucleotide and amino acid levels, respectively, while similarity to the mu chains of teleosts and elasmobranchs was lower. The bowfin mu chain possesses a distinctive proline-rich sequence at the C mu 1/C mu 2 boundary; a shorter proline-rich sequence is present at this position in the gar mu chain. Both gar and bowfin show, in their C mu 4 sequences, motifs that could serve as cryptic splice donor sites for the production of mRNA encoding the membrane-bound form of the mu chains, and the bowfin also shows a potential cryptic splice donor site in the C mu 3 exon.

PPIB mutations cause severe osteogenesis imperfecta.

PubMed

van Dijk, Fleur S; Nesbitt, Isabel M; Zwikstra, Eline H; Nikkels, Peter G J; Piersma, Sander R; Fratantoni, Silvina A; Jimenez, Connie R; Huizer, Margriet; Morsman, Alice C; Cobben, Jan M; van Roij, Mirjam H H; Elting, Mariet W; Verbeke, Jonathan I M L; Wijnaendts, Liliane C D; Shaw, Nick J; Högler, Wolfgang; McKeown, Carole; Sistermans, Erik A; Dalton, Ann; Meijers-Heijboer, Hanne; Pals, Gerard

2009-10-01

Deficiency of cartilage-associated protein (CRTAP) or prolyl 3-hydroxylase 1(P3H1) has been reported in autosomal-recessive lethal or severe osteogenesis imperfecta (OI). CRTAP, P3H1, and cyclophilin B (CyPB) form an intracellular collagen-modifying complex that 3-hydroxylates proline at position 986 (P986) in the alpha1 chains of collagen type I. This 3-prolyl hydroxylation is decreased in patients with CRTAP and P3H1 deficiency. It was suspected that mutations in the PPIB gene encoding CyPB would also cause OI with decreased collagen 3-prolyl hydroxylation. To our knowledge we present the first two families with recessive OI caused by PPIB gene mutations. The clinical phenotype is compatible with OI Sillence type II-B/III as seen with COL1A1/2, CRTAP, and LEPRE1 mutations. The percentage of 3-hydroxylated P986 residues in patients with PPIB mutations is decreased in comparison to normal, but it is higher than in patients with CRTAP and LEPRE1 mutations. This result and the fact that CyPB is demonstrable independent of CRTAP and P3H1, along with reported decreased 3-prolyl hydroxylation due to deficiency of CRTAP lacking the catalytic hydroxylation domain and the known function of CyPB as a cis-trans isomerase, suggest that recessive OI is caused by a dysfunctional P3H1/CRTAP/CyPB complex rather than by the lack of 3-prolyl hydroxylation of a single proline residue in the alpha1 chains of collagen type I.

Regulation of osmoadaptation in the moderate halophile Halobacillus halophilus: chloride, glutamate and switching osmolyte strategies

PubMed Central

Saum, Stephan H; Müller, Volker

2008-01-01

The moderate halophile Halobacillus halophilus is the paradigm for chloride dependent growth in prokaryotes. Recent experiments shed light on the molecular basis of the chloride dependence that is reviewed here. In the presence of moderate salinities Halobacillus halophilus mainly accumulates glutamine and glutamate to adjust turgor. The transcription of glnA2 (encoding a glutamine synthetase) as well as the glutamine synthetase activity were identified as chloride dependent steps. Halobacillus halophilus switches its osmolyte strategy and produces proline as the main compatible solute at high salinities. Furthermore, Halobacillus halophilus also shifts its osmolyte strategy at the transition from the exponential to the stationary phase where proline is exchanged by ectoine. Glutamate was found as a “second messenger” essential for proline production. This observation leads to a new model of sensing salinity by sensing the physico-chemical properties of different anions. PMID:18442383

L-Proline uptake in Saccharomyces cerevisiae mitochondria can contribute to bioenergetics during nutrient stress as alternative mitochondrial fuel.

PubMed

Pallotta, Maria Luigia

2014-01-01

L-Proline (pyrrolidine-2-carboxylic acid) is a distinctive metabolite both biochemically and biotechnologically and is currently recognized to have a cardinal role in gene expression and cellular signaling pathways in stress response. Proline-fueled mitochondrial metabolism involves the oxidative conversion of L-Proline to L-Glutamate in two enzymatic steps by means of Put1p and Put2p that help Saccharomyces cerevisiae to respond to changes in the nutritional environment by initiating the breakdown of L-Proline as a source for nitrogen, carbon, and energy. Compartmentalization of L-Proline catabolic pathway implies that extensive L-Proline transport must take place between the cytosol where its biogenesis via Pro1p, Pro2p, Pro3p occurs and mitochondria. L-Proline uptake in S. cerevisiae purified and active mitochondria was investigated by swelling experiments, oxygen uptake and fluorimetric measurement of a membrane potential generation (ΔΨ). Our results strongly suggest that L-Proline uptake occurs via a carried-mediated process as demonstrated by saturation kinetics and experiments with N-ethylmaleimide, a pharmacological compound that is a cysteine-modifying reagent in hydrophobic protein domains and that inhibited mitochondrial transport. Plasticity of S. cerevisiae cell biochemistry according to background fluctuations is an important factor of adaptation to stress. Thus L-Proline → Glutamate route feeds Krebs cycle providing energy and anaplerotic carbon for yeast survival.

The Tomato Hybrid Proline-Rich Protein regulates the abcission zone competence to respond to ethylene signals

USDA-ARS?s Scientific Manuscript database

The Tomato Hybrid Proline-Rich Protein (THyPRP) gene was specifically expressed in the tomato (Solanum lycopersicum) flower abscission zone (FAZ), and its stable antisense silencing under the control of an abscission zone (AZ)-specific promoter, Tomato Abscission Polygalacturonase4,significantly inh...

A leucine-to-proline substitution causes a defective [alpha]-antichymotrypsin allele associated with familial obstructive lung disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poller, W.; Scholz, S.; Fischer, M.

1993-09-01

Using denaturing gradient gel electrophoresis and direct sequencing of amplified genomic DNA, the authors have identified two defective mutants of the human [alpha][sub 1]-antichymotrypsin (ACT) gene associated with chronic obstructive pulmonary disease (COPD). A leucine 55-to-proline substitution causing a defective ACT allele (Bochum-1) was observed in a family with COPD in three subsequent generations. Another mutation, proline 229-to-alanine (Bonn-1), was associated with ACT serum deficiency in four patients with a positive family history. These mutations were not detected among 100 healthy control subjects, suggesting a possible pathogenetic role of ACT gene defects in a subset of patients with COPD. 14more » refs., 1 fig., 1 tab.« less

Catalysis by the second class of tRNA(m1G37) methyl transferase requires a conserved proline.

PubMed

Christian, Thomas; Evilia, Caryn; Hou, Ya-Ming

2006-06-20

The enzyme tRNA(m1G37) methyl transferase catalyzes the transfer of a methyl group from S-adenosyl methionine (AdoMet) to the N1 position of G37, which is 3' to the anticodon sequence and whose modification is important for maintaining the reading frame fidelity. While the enzyme in bacteria is highly conserved and is encoded by the trmD gene, recent studies show that the counterpart of this enzyme in archaea and eukarya, encoded by the trm5 gene, is unrelated to trmD both in sequence and in structure. To further test this prediction, we seek to identify residues in the second class of tRNA(m1G37) methyl transferase that are required for catalysis. Such residues should provide mechanistic insights into the distinct structural origins of the two classes. Using the Trm5 enzyme of the archaeon Methanocaldococcus jannaschii (previously MJ0883) as an example, we have created mutants to test many conserved residues for their catalytic potential and substrate-binding capabilities with respect to both AdoMet and tRNA. We identified that the proline at position 267 (P267) is a critical residue for catalysis, because substitution of this residue severely decreases the kcat of the methylation reaction in steady-state kinetic analysis, and the k(chem) in single turnover kinetic analysis. However, substitution of P267 has milder effect on the Km and little effect on the Kd of either substrate. Because P267 has no functional side chain that can directly participate in the chemistry of methyl transfer, we suggest that its role in catalysis is to stabilize conformations of enzyme and substrates for proper alignment of reactive groups at the enzyme active site. Sequence analysis shows that P267 is embedded in a peptide motif that is conserved among the Trm5 family, but absent from the TrmD family, supporting the notion that the two families are descendants of unrelated protein structures.

The structural role of high molecular weight tropomyosins in dipteran indirect flight muscle and the effect of phosphorylation.

PubMed

Mateos, Jesús; Herranz, Raúl; Domingo, Alberto; Sparrow, John; Marco, Roberto

2006-01-01

In Drosophila melanogaster two high molecular weight tropomyosin isoforms, historically named heavy troponins (TnH-33 and TnH-34), are encoded by the Tm1 tropomyosin gene. They are specifically expressed in the indirect flight muscles (IFM). Their N-termini are conventional and complete tropomyosin sequences, but their C-termini consist of different IFM-specific domains that are rich in proline, alanine, glycine and glutamate. The evidence indicates that in Diptera these IFM-specific isoforms are conserved and are not troponins, but heavy tropomyosins (TmH). We report here that they are post-translationally modified by several phosphorylations in their C-termini in mature flies, but not in recently emerged flies that are incapable of flight. From stoichiometric measurements of thin filament proteins and interactions of the TmH isoforms with the standard Drosophila IFM tropomyosin isoform (protein 129), we propose that the TmH N-termini are integrated into the thin filament structural unit as tropomyosin dimers. The phosphorylated C-termini remain unlocated and may be important in IFM stretch-activation. Comparison of the Tm1 and Tm2 gene sequences shows a complete conservation of gene organisation in other Drosophilidae, such as Drosophila pseudoobscura, while in Anopheles gambiae only one exon encodes a single C-terminal domain, though overall gene organization is maintained. Interestingly, in Apis mellifera (hymenopteran), while most of the Tm1 and Tm2 gene features are conserved, the gene lacks any C-terminal exons. Instead these sequences are found at the 3' end of the troponin I gene. In this insect order, as in Lethocerus (hemipteran), the original designation of troponin H (TnH) should be retained. We discuss whether the insertion of the IFM-specific pro-ala-gly-glu-rich domain into the tropomyosin or troponin I genes in different insect orders may be related to proposals that the IFM stretch activation mechanism has evolved independently several times in higher insects.

Synteny between the Pro/sup +/ marker and human glutamate oxaloacetate transaminase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jones, C.

1975-01-01

Chinese hamster ovary cells with a specific auxotrophy for proline were fused with human cells from a variety of sources and the resulting hybrids analyzed for human genetic markers. Of 63 hybrid clones examined, 27 possessed both proline and cytoplasmic glutamate oxaloacetate transaminase markers; 36 had neither; and no clones were found possessing one and not the other. These results constitute evidence that the proline and glutamate oxaloacetate transaminase markers are syntenic. Evidence for absence of synteny between these and a variety of other human genes is presented. Biochemical tracer experiments established that the proline biosynthetic pathway through glutamate hasmore » been restored in the Pro/sup +/ hybrids.« less

Atf3 mutant mice show reduced axon regeneration and impaired regeneration-associated gene induction after peripheral nerve injury

PubMed Central

Gey, Manuel; Wanner, Renate; Schilling, Corinna; Pedro, Maria T.; Sinske, Daniela

2016-01-01

Axon injury in the peripheral nervous system (PNS) induces a regeneration-associated gene (RAG) response. Atf3 (activating transcription factor 3) is such a RAG and ATF3's transcriptional activity might induce ‘effector’ RAGs (e.g. small proline rich protein 1a (Sprr1a), Galanin (Gal), growth-associated protein 43 (Gap43)) facilitating peripheral axon regeneration. We provide a first analysis of Atf3 mouse mutants in peripheral nerve regeneration. In Atf3 mutant mice, facial nerve regeneration and neurite outgrowth of adult ATF3-deficient primary dorsal root ganglia neurons was decreased. Using genome-wide transcriptomics, we identified a neuropeptide-encoding RAG cluster (vasoactive intestinal peptide (Vip), Ngf, Grp, Gal, Pacap) regulated by ATF3. Exogenous administration of neuropeptides enhanced neurite growth of Atf3 mutant mice suggesting that these molecules might be effector RAGs of ATF3's pro-regenerative function. In addition to the induction of growth-promoting molecules, we present data that ATF3 suppresses growth-inhibiting molecules such as chemokine (C-C motif) ligand 2. In summary, we show a pro-regenerative ATF3 function during PNS nerve regeneration involving transcriptional activation of a neuropeptide-encoding RAG cluster. ATF3 is a general injury-inducible factor, therefore ATF3-mediated mechanisms identified herein might apply to other cell and injury types. PMID:27581653

Wheat bHLH-type transcription factor gene TabHLH1 is crucial in mediating osmotic stresses tolerance through modulating largely the ABA-associated pathway.

PubMed

Yang, Tongren; Yao, Sufei; Hao, Lin; Zhao, Yuanyuan; Lu, Wenjing; Xiao, Kai

2016-11-01

Wheat bHLH family gene TabHLH1 is responsive to drought and salt stresses, and it acts as one crucial regulator in mediating tolerance to aforementioned stresses largely through an ABA-associated pathway. Osmotic stresses are adverse factors for plant growth and crop productivity. In this study, we characterized TabHLH1, a gene encoding wheat bHLH-type transcription factor (TF) protein, in mediating plant adaptation to osmotic stresses. TabHLH1 protein contains a conserved basic-helix-loop-helix (bHLH) domain shared by its plant counterparts. Upon PEG-simulated drought stress, salt stress, and exogenous abscisic acid (ABA), the TabHLH1 transcripts in roots and leaves were induced. Under PEG-simulated drought stress and salt stress treatments, the tobacco seedlings with TabHLH1 overexpression exhibited improved growth and osmotic stress-associated traits, showing increased biomass and reduced leaf water loss rate (WLR) relative to wild type (WT). The transgenic lines also possessed promoted stomata closure under drought stress, salt stress, and exogenous ABA and increased proline and soluble sugar contents and reduced hydrogen peroxide (H 2 O 2 ) amount under osmotic stress conditions, indicating that TabHLH1-mediated osmolyte accumulation and cellular ROS homeostasis contributed to the drought stress and salt stress tolerance. NtPYL12 and NtSAPK2;1, the genes encoding ABA receptor and SnRK2 family kinase, respectively, showed up-regulated expression in lines overexpressing TabHLH1 under osmotic stress and exogenous ABA conditions; overexpression of them conferred plants modified stomata movement, leaf WLR, and growth feature under drought and high salinity, suggesting that these ABA-signaling genes are mediated by wheat TabHLH1 gene and involved in regulating plant responses to simulated drought and salt stresses. Our investigation indicates that the TabHLH1 gene plays critical roles in plant tolerance to osmotic stresses largely through an ABA-dependent pathway.

Alterations of the PPP2R1B gene located at 11q23 in human colorectal cancers

PubMed Central

Takagi, Y; Futamura, M; Yamaguchi, K; Aoki, S; Takahashi, T; Saji, S

2000-01-01

BACKGROUND/AIMS—In 1998 the PPP2R1B gene encoding the A subunit of the serine/threonine protein phosphatase was identified as a putative tumour suppressor gene in lung and colon cancer in the chromosome region 11q22-24. The aim of the present study was to determine the type of alterations in primary rectal cancers as well as colon cancers and the correlation between these alterations and clinicopathological data.
METHODS—Mutation analyses of the PPP2R1B gene sequence encoding the binding sites of the catalytic C subunit (Huntington elongation A subunit TOR (HEAT) repeats 11-15) and partial binding sites of the regulatory B subunit were carried out on cDNA samples from 30 primary colorectal cancer specimens and corresponding normal tissues using a combination of the polymerase chain reaction and subsequent direct DNA sequencing.
RESULTS—Five missense mutations producing amino acid substitutions were detected in the four colon cancer cases (13.3%; four of 30 colorectal cancers): 15glycine (GGT) to alanine (GCT) and 499leucine (TTA) to isoleucine (ATA) in the same case, and 498valine (GTG) to glutamic acid (GAG), 500valine (GTA) to glycine (GGA), and 365serine (TCT) to proline (CCT). Of these five mutations, three (60%) were located in HEAT repeat 13 and four (80%) showed T to other nucleotide substitutions. In addition, a normal polymorphism, 478leucine, was found. No correlation was found between these mutations and clinicopathological data.
CONCLUSION—Our results suggest that the PPP2R1B gene is one of the true targets at 11q23, and its inactivation is involved in the development of all types of colorectal cancers.


Keywords: PPP2R1B gene; colorectal cancer; tumour suppressor gene; protein phosphatase PMID:10896920

Identification of a Lytic-Cycle Epstein-Barr Virus Gene Product That Can Regulate PKR Activation

PubMed Central

Poppers, Jeremy; Mulvey, Matthew; Perez, Cesar; Khoo, David; Mohr, Ian

2003-01-01

The Epstein-Barr virus (EBV) SM protein is a posttranscriptional regulator of viral gene expression. Like many transactivators encoded by herpesviruses, SM transports predominantly unspliced viral mRNA cargo from the nucleus to the cytosol, where it is subsequently translated. This activity likely involves a region of the protein that has homology to the herpes simplex virus type 1 (HSV-1) ICP27 gene product, the first member of this class of regulators to be discovered. However, SM also contains a repetitive segment rich in arginine and proline residues that is dispensable for its effects on RNA transport and splicing. This portion of SM, comprised of RXP triplet repeats, shows homology to the carboxyl-terminal domain of Us11, a double-stranded RNA (dsRNA) binding protein encoded by HSV-1 that inhibits activation of the cellular PKR kinase. To evaluate the intrinsic ability of SM to regulate PKR, we expressed and purified several SM protein derivatives and examined their activity in a variety of biochemical assays. The full-length SM protein bound dsRNA, associated physically with PKR, and prevented PKR activation. Removal of the 37-residue RXP domain significantly compromised all of these activities. Furthermore, the SM RXP domain was itself sufficient to inhibit PKR activation and interact with the kinase. Relative to its Us11 counterpart, the SM RXP segment bound dsRNA with reduced affinity and responded differently to single-stranded competitor polynucleotides. Thus, SM represents the first EBV gene product expressed during the lytic cycle that can prevent PKR activation. In addition, the RXP repeat segment appears to be a conserved herpesvirus motif capable of associating with dsRNA and modulating activation of the PKR kinase, a molecule important for the control of translation and the cellular antiviral response. PMID:12477828

Identification of a lytic-cycle Epstein-Barr virus gene product that can regulate PKR activation.

PubMed

Poppers, Jeremy; Mulvey, Matthew; Perez, Cesar; Khoo, David; Mohr, Ian

2003-01-01

The Epstein-Barr virus (EBV) SM protein is a posttranscriptional regulator of viral gene expression. Like many transactivators encoded by herpesviruses, SM transports predominantly unspliced viral mRNA cargo from the nucleus to the cytosol, where it is subsequently translated. This activity likely involves a region of the protein that has homology to the herpes simplex virus type 1 (HSV-1) ICP27 gene product, the first member of this class of regulators to be discovered. However, SM also contains a repetitive segment rich in arginine and proline residues that is dispensable for its effects on RNA transport and splicing. This portion of SM, comprised of RXP triplet repeats, shows homology to the carboxyl-terminal domain of Us11, a double-stranded RNA (dsRNA) binding protein encoded by HSV-1 that inhibits activation of the cellular PKR kinase. To evaluate the intrinsic ability of SM to regulate PKR, we expressed and purified several SM protein derivatives and examined their activity in a variety of biochemical assays. The full-length SM protein bound dsRNA, associated physically with PKR, and prevented PKR activation. Removal of the 37-residue RXP domain significantly compromised all of these activities. Furthermore, the SM RXP domain was itself sufficient to inhibit PKR activation and interact with the kinase. Relative to its Us11 counterpart, the SM RXP segment bound dsRNA with reduced affinity and responded differently to single-stranded competitor polynucleotides. Thus, SM represents the first EBV gene product expressed during the lytic cycle that can prevent PKR activation. In addition, the RXP repeat segment appears to be a conserved herpesvirus motif capable of associating with dsRNA and modulating activation of the PKR kinase, a molecule important for the control of translation and the cellular antiviral response.

Expression of genes involved in energy mobilization and osmoprotectant synthesis during thermal and dehydration stress in the Antarctic midge, Belgica antarctica.

PubMed

Teets, Nicholas M; Kawarasaki, Yuta; Lee, Richard E; Denlinger, David L

2013-02-01

The Antarctic midge, Belgica antarctica, experiences sub-zero temperatures and desiccating conditions for much of the year, and in response to these environmental insults, larvae undergo rapid shifts in metabolism, mobilizing carbohydrate energy reserves to promote synthesis of low-molecular-mass osmoprotectants. In this study, we measured the expression of 11 metabolic genes in response to thermal and dehydration stress. During both heat and cold stress, we observed upregulation of phosphoenolpyruvate carboxykinase (pepck) and glycogen phosphorylase (gp) to support rapid glucose mobilization. In contrast, there was a general downregulation of pathways related to polyol, trehalose, and proline synthesis during both high- and low-temperature stress. Pepck was likewise upregulated in response to different types of dehydration stress; however, for many of the other genes, expression patterns depended on the nature of dehydration stress. Following fast dehydration, expression patterns were similar to those observed during thermal stress, i.e., upregulation of gp accompanied by downregulation of trehalose and proline synthetic genes. In contrast, gradual, prolonged dehydration (both at a constant temperature and in conjunction with chilling) promoted marked upregulation of genes responsible for trehalose and proline synthesis. On the whole, our data agree with known metabolic adaptations to stress in B. antarctica, although a few discrepancies between gene expression patterns and downstream metabolite contents point to fluxes that are not controlled at the level of transcription.

Exploiting Differential Gene Expression and Epistasis to Discover Candidate Genes for Drought-Associated QTLs in Arabidopsis thaliana.

PubMed

Lovell, John T; Mullen, Jack L; Lowry, David B; Awole, Kedija; Richards, James H; Sen, Saunak; Verslues, Paul E; Juenger, Thomas E; McKay, John K

2015-04-01

Soil water availability represents one of the most important selective agents for plants in nature and the single greatest abiotic determinant of agricultural productivity, yet the genetic bases of drought acclimation responses remain poorly understood. Here, we developed a systems-genetic approach to characterize quantitative trait loci (QTLs), physiological traits and genes that affect responses to soil moisture deficit in the TSUxKAS mapping population of Arabidopsis thaliana. To determine the effects of candidate genes underlying QTLs, we analyzed gene expression as a covariate within the QTL model in an effort to mechanistically link markers, RNA expression, and the phenotype. This strategy produced ranked lists of candidate genes for several drought-associated traits, including water use efficiency, growth, abscisic acid concentration (ABA), and proline concentration. As a proof of concept, we recovered known causal loci for several QTLs. For other traits, including ABA, we identified novel loci not previously associated with drought. Furthermore, we documented natural variation at two key steps in proline metabolism and demonstrated that the mitochondrial genome differentially affects genomic QTLs to influence proline accumulation. These findings demonstrate that linking genome, transcriptome, and phenotype data holds great promise to extend the utility of genetic mapping, even when QTL effects are modest or complex. © 2015 American Society of Plant Biologists. All rights reserved.

HR-MAS NMR metabolomics of 'Swingle' citrumelo rootstock genetically modified to overproduce proline.

PubMed

de Oliveira, Caroline S; Carlos, Eduardo F; Vieira, Luiz G E; Lião, Luciano M; Alcantara, Glaucia B

2014-08-01

The accumulation of proline is a typical physiological response to abiotic stresses in higher plants. 'Swingle' citrumelo, an important rootstock for citrus production, has been modified with a mutated Δ(1)-pyrroline-5-carboxylate synthetase gene (VaP5CSF129A) linked to the cauliflower mosaic virus 35S promoter to induce the overproduction of free proline. This paper presents a comparative metabolomic study of nontransgenic versus transgenic 'Swingle' citrumelo plants with high endogenous proline. (1)H high-resolution magic angle spinning nuclear magnetic resonance spectroscopy and multivariate analysis showed significant differences in some metabolites between the nontransgenic and transgenic leaves and roots. The overproduction of proline has reduced the sucrose content in transgenic leaves, revealing a metabolic cost for these plants. In roots, the high level of free proline acts for the adjustment of cation-anion balance, causing the reduction of acetic acid content. The same sucrose level in roots indicates that they can be considered as sucrose sink. Similar behavior may be waited for fruits produced on transgenic rootstock. Copyright © 2014 John Wiley & Sons, Ltd.

PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

PubMed Central

Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

2004-01-01

A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

Single base substitution causing the fragrant phenotype and development of a type-specific marker in aromatic coconut (Cocos nucifera).

PubMed

Vongvanrungruang, A; Mongkolsiriwatana, C; Boonkaew, T; Sawatdichaikul, O; Srikulnath, K; Peyachoknagul, S

2016-09-19

The fragrance gene, betaine aldehyde dehydrogenase 2 (Badh2), has been well studied in many plant species. The objectives of this study were to clone Badh2 and compare the sequences between aromatic and non-aromatic coconuts. The complete coding region was cloned from cDNA of both aromatic and non-aromatic coconuts. The nucleotide sequences were highly homologous to Badh2 genes of other plants. Badh2 consisted of a 1512-bp open reading frame encoding 503 amino acids. A single nucleotide difference between aromatic and non-aromatic coconuts resulted in the conversion of alanine (non-aromatic) to proline (aromatic) at position 442, which was the substrate binding site of BADH2. The ring side chain of proline could destabilize the structure leading to a non-functional enzyme. Badh2 genomic DNA was cloned from exon 1 to 4, and from exon 5 to 15 from the two coconut types, except for intron 4 that was very long. The intron sequences of the two coconut groups were highly homologous. No differences in Badh2 expression were found among the tissues of aromatic coconut or between aromatic and non-aromatic coconuts. The amino acid sequences of BADH2 from coconut and other plants were compared and the genetic relationship was analyzed using MEGA 7.0. The phylogenetic tree reconstructed by the Bayesian information criterion consisted of two distinct groups of monocots and dicots. Among the monocots, coconut (Cocos nucifera) and oil palm (Elaeis guineensis) were the most closely related species. A marker for coconut differentiation was developed from one-base substitution site and could be successfully used.

Gene Expression Profiling in Pachyonychia Congenita Skin

PubMed Central

Cao, Yu-An; Hickerson, Robyn P.; Seegmiller, Brandon L.; Grapov, Dmitry; Gross, Maren M.; Bessette, Marc R.; Phinney, Brett S.; Flores, Manuel A.; Speaker, Tycho J.; Vermeulen, Annaleen; Bravo, Albert A.; Bruckner, Anna L.; Milstone, Leonard M.; Schwartz, Mary E.; Rice, Robert H.; Kaspar, Roger L.

2015-01-01

Background Pachyonychia congenita (PC) is a skin disorder resulting from mutations in keratin (K) proteins including K6a, K6b, K16, and K17. One of the major symptoms is painful plantar keratoderma. The pathogenic sequelae resulting from the keratin mutations remain unclear. Objective To better understand PC pathogenesis. Methods RNA profiling was performed on biopsies taken from PC-involved and uninvolved plantar skin of seven genotyped PC patients (two K6a, one K6b, three K16, and one K17) as well as from control volunteers. Protein profiling was generated from tape-stripping samples. Results A comparison of PC-involved skin biopsies to adjacent uninvolved plantar skin identified 112 differentially-expressed mRNAs common to patient groups harboring K6 (i.e., both K6a and K6b) and K16 mutations. Among these mRNAs, 25 encode structural proteins including keratins, small proline-rich and late cornified envelope proteins, 20 are related to metabolism and 16 encode proteases, peptidases, and their inhibitors including kallikrein-related peptidases (KLKs), and serine protease inhibitors (SERPINs). mRNAs were also identified to be differentially expressed only in K6 (81) or K16 (141) patient samples. Furthermore, 13 mRNAs were identified that may be involved in pain including nociception and neuropathy. Protein profiling, comparing three K6a plantar tape-stripping samples to non-PC controls, showed changes in the PC corneocytes similar, but not identical, to the mRNA analysis. Conclusion Many differentially-expressed genes identified in PC-involved skin encode components critical for skin barrier homeostasis including keratinocyte proliferation, differentiation, cornification, and desquamation. The profiling data provide a foundation for unraveling the pathogenesis of PC and identifying targets for developing effective PC therapeutics. PMID:25656049

Proline Scan of the hERG Channel S6 Helix Reveals the Location of the Intracellular Pore Gate

PubMed Central

Thouta, Samrat; Sokolov, Stanislav; Abe, Yuki; Clark, Sheldon J.; Cheng, Yen M.; Claydon, Tom W.

2014-01-01

In Shaker-like channels, the activation gate is formed at the bundle crossing by the convergence of the inner S6 helices near a conserved proline-valine-proline motif, which introduces a kink that allows for electromechanical coupling with voltage sensor motions via the S4-S5 linker. Human ether-a-go-go-related gene (hERG) channels lack the proline-valine-proline motif and the location of the intracellular pore gate and how it is coupled to S4 movement is less clear. Here, we show that proline substitutions within the S6 of hERG perturbed pore gate closure, trapping channels in the open state. Performing a proline scan of the inner S6 helix, from Ile655 to Tyr667 revealed that gate perturbation occurred with proximal (I655P-Q664P), but not distal (R665P-Y667P) substitutions, suggesting that Gln664 marks the position of the intracellular gate in hERG channels. Using voltage-clamp fluorimetry and gating current analysis, we demonstrate that proline substitutions trap the activation gate open by disrupting the coupling between the voltage-sensing unit and the pore of the channel. We characterize voltage sensor movement in one such trapped-open mutant channel and demonstrate the kinetics of what we interpret to be intrinsic hERG voltage sensor movement. PMID:24606930

SlbZIP38, a Tomato bZIP Family Gene Downregulated by Abscisic Acid, Is a Negative Regulator of Drought and Salt Stress Tolerance

PubMed Central

Pan, Yanglu; Hu, Xin; Li, Chunyan; Xu, Xing; Su, Chenggang; Li, Jinhua; Song, Hongyuan; Zhang, Xingguo; Pan, Yu

2017-01-01

The basic leucine zipper (bZIP) transcription factors have crucial roles in plant stress responses. In this study, the bZIP family gene SlbZIP38 (GenBank accession No: XM004239373) was isolated from a tomato (Solanum lycopersicum cv. Ailsa Craig) mature leaf cDNA library. The DNA sequence of SlbZIP38 encodes a protein of 484 amino acids, including a highly conserved bZIP DNA-binding domain in the C-terminal region. We found that SlbZIP38 was differentially expressed in various organs of the tomato plant and was downregulated by drought, salt stress, and abscisic acid (ABA). However, overexpression of SlbZIP38 significantly decreased drought and salt stress tolerance in tomatoes (Ailsa Craig). The findings that SlbZIP38 overexpression reduced the chlorophyll and free proline content in leaves but increased the malondialdehyde content may explain the reduced drought and salt tolerance observed in these lines. These results suggest that SlbZIP38 is a negative regulator of drought and salt resistance that acts by modulating ABA signaling. PMID:29261143

Overexpression of EsMcsu1 from the halophytic plant Eutrema salsugineum promotes abscisic acid biosynthesis and increases drought resistance in alfalfa (Medicago sativa L.).

PubMed

Zhou, C; Ma, Z Y; Zhu, L; Guo, J S; Zhu, J; Wang, J F

2015-12-17

The stress phytohormone abscisic acid (ABA) plays pivotal roles in plants' adaptive responses to adverse environments. Molybdenum cofactor sulfurases influence aldehyde oxidase activity and ABA biosynthesis. In this study, we isolated a novel EsMcsu1 gene encoding a molybdenum cofactor sulfurase from Eutrema salsugineum. EsMcus1 transcriptional patterns varied between organs, and its expression was significantly upregulated by abiotic stress or ABA treatment. Alfalfa plants that overexpressed EsMcsu1 had a higher ABA content than wild-type (WT) plants under drought stress conditions. Furthermore, levels of reactive oxygen species (ROS), ion leakage, and malondialdehyde were lower in the transgenic plants than in the WT plants after drought treatment, suggesting that the transgenic plants experienced less ROS-mediated damage. However, the expression of several stress-responsive genes, antioxidant enzyme activity, and osmolyte (proline and total soluble sugar) levels in the transgenic plants were higher than those in the WT plants after drought treatment. Therefore, EsMcsu1 overexpression improved drought tolerance in alfalfa plants by activating a series of ABA-mediated stress responses.

BASH, a novel signaling molecule preferentially expressed in B cells of the bursa of Fabricius.

PubMed

Goitsuka, R; Fujimura, Y; Mamada, H; Umeda, A; Morimura, T; Uetsuka, K; Doi, K; Tsuji, S; Kitamura, D

1998-12-01

The bursa of Fabricius is a gut-associated lymphoid organ that is essential for the generation of a diversified B cell repertoire in the chicken. We describe here a novel gene preferentially expressed in bursal B cells. The gene encodes an 85-kDa protein, designated BASH (B cell adaptor containing SH2 domain), that contains N-terminal acidic domains with SH2 domain-binding phosphotyrosine-based motifs, a proline-rich domain, and a C-terminal SH2 domain. BASH shows a substantial sequence similarity to SLP-76, an adaptor protein functioning in TCR-signal transduction. BASH becomes tyrosine-phosphorylated with the B cell Ag receptor (BCR) cross-link or by coexpression with Syk and Lyn and associates with signaling molecules including Syk and a putative chicken Shc homologue. Overexpression of BASH results in suppression of the NF-AT activation induced by BCR-cross-linking. These findings suggest that BASH is involved in BCR-mediated signal transduction and could play a critical role in B cell development in the bursa.

Highly Effective Serodiagnosis for Chagas' Disease ▿

PubMed Central

Hernández, Pilar; Heimann, Michael; Riera, Cristina; Solano, Marco; Santalla, José; Luquetti, Alejandro O.; Beck, Ewald

2010-01-01

Many proteins of Trypanosoma cruzi, the causative agent of Chagas' disease, contain characteristic arrays of highly repetitive immunogenic amino acid motifs. Diagnostic tests using these motifs in monomeric or dimeric form have proven to provide markedly improved specificity compared to conventional tests based on crude parasite extracts. However, in many cases the available tests still suffer from limited sensitivity. In this study we produced stable synthetic genes with maximal codon variability for the four diagnostic antigens, B13, CRA, TcD, and TcE, each containing between three and nine identical amino acid repeats. These genes were combined by linker sequences encoding short proline-rich peptides, giving rise to a 24-kDa fusion protein which was used as a novel diagnostic antigen in an enzyme-linked immunosorbent assay setup. Validation of the assay with a large number of well-characterized patient sera from Bolivia and Brazil revealed excellent diagnostic performance. The high sensitivity of the new test may allow future studies to use blood collected by finger prick and dried on filter paper, thus dramatically reducing the costs and effort for the detection of T. cruzi infection. PMID:20668136

Duplication within the SEPT9 gene associated with a founder effect in North American families with hereditary neuralgic amyotrophy

PubMed Central

Landsverk, Megan L.; Ruzzo, Elizabeth K.; Mefford, Heather C.; Buysse, Karen; Buchan, Jillian G.; Eichler, Evan E.; Petty, Elizabeth M.; Peterson, Esther A.; Knutzen, Dana M.; Barnett, Karen; Farlow, Martin R.; Caress, Judy; Parry, Gareth J.; Quan, Dianna; Gardner, Kathy L.; Hong, Ming; Simmons, Zachary; Bird, Thomas D.; Chance, Phillip F.; Hannibal, Mark C.

2009-01-01

Hereditary neuralgic amyotrophy (HNA) is an autosomal dominant disorder associated with recurrent episodes of focal neuropathy primarily affecting the brachial plexus. Point mutations in the SEPT9 gene have been previously identified as the molecular basis of HNA in some pedigrees. However in many families, including those from North America demonstrating a genetic founder haplotype, no sequence mutations have been detected. We report an intragenic 38 Kb SEPT9 duplication that is linked to HNA in 12 North American families that share the common founder haplotype. Analysis of the breakpoints showed that the duplication is identical in all pedigrees, and molecular analysis revealed that the duplication includes the 645 bp exon in which previous HNA mutations were found. The SEPT9 transcript variants that span this duplication contain two in-frame repeats of this exon, and immunoblotting demonstrates larger molecular weight SEPT9 protein isoforms. This exon also encodes for a majority of the SEPT9 N-terminal proline rich region suggesting that this region plays a role in the pathogenesis of HNA. PMID:19139049

Duplication within the SEPT9 gene associated with a founder effect in North American families with hereditary neuralgic amyotrophy.

PubMed

Landsverk, Megan L; Ruzzo, Elizabeth K; Mefford, Heather C; Buysse, Karen; Buchan, Jillian G; Eichler, Evan E; Petty, Elizabeth M; Peterson, Esther A; Knutzen, Dana M; Barnett, Karen; Farlow, Martin R; Caress, Judy; Parry, Gareth J; Quan, Dianna; Gardner, Kathy L; Hong, Ming; Simmons, Zachary; Bird, Thomas D; Chance, Phillip F; Hannibal, Mark C

2009-04-01

Hereditary neuralgic amyotrophy (HNA) is an autosomal dominant disorder associated with recurrent episodes of focal neuropathy primarily affecting the brachial plexus. Point mutations in the SEPT9 gene have been previously identified as the molecular basis of HNA in some pedigrees. However in many families, including those from North America demonstrating a genetic founder haplotype, no sequence mutations have been detected. We report an intragenic 38 Kb SEPT9 duplication that is linked to HNA in 12 North American families that share the common founder haplotype. Analysis of the breakpoints showed that the duplication is identical in all pedigrees, and molecular analysis revealed that the duplication includes the 645 bp exon in which previous HNA mutations were found. The SEPT9 transcript variants that span this duplication contain two in-frame repeats of this exon, and immunoblotting demonstrates larger molecular weight SEPT9 protein isoforms. This exon also encodes for a majority of the SEPT9 N-terminal proline rich region suggesting that this region plays a role in the pathogenesis of HNA.

A maize spermine synthase 1 PEST sequence fused to the GUS reporter protein facilitates proteolytic degradation.

PubMed

Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco

2014-05-01

Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Cloning and characterization of the rat HIF-1 alpha prolyl-4-hydroxylase-1 gene.

PubMed

Cobb, Ronald R; McClary, John; Manzana, Warren; Finster, Silke; Larsen, Brent; Blasko, Eric; Pearson, Jennifer; Biancalana, Sara; Kauser, Katalin; Bringmann, Peter; Light, David R; Schirm, Sabine

2005-08-01

Prolyl-4-hydroxylase domain-containing enzymes (PHDs) mediate the oxygen-dependent regulation of the heterodimeric transcription factor hypoxia-inducible factor-1 (HIF-1). Under normoxic conditions, one of the subunits of HIF-1, HIF-1alpha, is hydroxylated on specific proline residues to target HIF-1alpha for degradation by the ubiquitin-proteasome pathway. Under hypoxic conditions, the hydroxylation by the PHDs is attenuated by lack of the oxygen substrate, allowing HIF-1 to accumulate, translocate to the nucleus, and mediate HIF-mediated gene transcription. In several mammalian species including humans, three PHDs have been identified. We report here the cloning of a full-length rat cDNA that is highly homologous to the human and murine PHD-1 enzymes and encodes a protein that is 416 amino acids long. Both cDNA and protein are widely expressed in rat tissues and cell types. We demonstrate that purified and crude baculovirus-expressed rat PHD-1 exhibits HIF-1alpha specific prolyl hydroxylase activity with similar substrate affinities and is comparable to human PHD-1 protein.

A Simplified Model of Local Structure in Aqueous Proline Amino Acid Revealed by First-Principles Molecular Dynamics Simulations

PubMed Central

Troitzsch, Raphael Z.; Tulip, Paul R.; Crain, Jason; Martyna, Glenn J.

2008-01-01

Aqueous proline solutions are deceptively simple as they can take on complex roles such as protein chaperones, cryoprotectants, and hydrotropic agents in biological processes. Here, a molecular level picture of proline/water mixtures is developed. Car-Parrinello ab initio molecular dynamics (CPAIMD) simulations of aqueous proline amino acid at the B-LYP level of theory, performed using IBM's Blue Gene/L supercomputer and massively parallel software, reveal hydrogen-bonding propensities that are at odds with the predictions of the CHARMM22 empirical force field but are in better agreement with results of recent neutron diffraction experiments. In general, the CPAIMD (B-LYP) simulations predict a simplified structural model of proline/water mixtures consisting of fewer distinct local motifs. Comparisons of simulation results to experiment are made by direct evaluation of the neutron static structure factor S(Q) from CPAIMD (B-LYP) trajectories as well as to the results of the empirical potential structure refinement reverse Monte Carlo procedure applied to the neutron data. PMID:18790850

A simplified model of local structure in aqueous proline amino acid revealed by first-principles molecular dynamics simulations.

PubMed

Troitzsch, Raphael Z; Tulip, Paul R; Crain, Jason; Martyna, Glenn J

2008-12-01

Aqueous proline solutions are deceptively simple as they can take on complex roles such as protein chaperones, cryoprotectants, and hydrotropic agents in biological processes. Here, a molecular level picture of proline/water mixtures is developed. Car-Parrinello ab initio molecular dynamics (CPAIMD) simulations of aqueous proline amino acid at the B-LYP level of theory, performed using IBM's Blue Gene/L supercomputer and massively parallel software, reveal hydrogen-bonding propensities that are at odds with the predictions of the CHARMM22 empirical force field but are in better agreement with results of recent neutron diffraction experiments. In general, the CPAIMD (B-LYP) simulations predict a simplified structural model of proline/water mixtures consisting of fewer distinct local motifs. Comparisons of simulation results to experiment are made by direct evaluation of the neutron static structure factor S(Q) from CPAIMD (B-LYP) trajectories as well as to the results of the empirical potential structure refinement reverse Monte Carlo procedure applied to the neutron data.

Vitamin D insufficiency and schizophrenia risk: evaluation of hyperprolinemia as a mediator of association.

PubMed

Clelland, James D; Read, Laura L; Drouet, Valérie; Kaon, Angela; Kelly, Alexandra; Duff, Karen E; Nadrich, Robert H; Rajparia, Amit; Clelland, Catherine L

2014-06-01

25-Hydroxyvitamin D (25(OH)D) deficits have been associated with schizophrenia susceptibility and supplementation has been recommended for those at-risk. Although the mechanism by which a deficit confers risk is unknown, vitamin D is a potent transcriptional modulator and can regulate proline dehydrogenase (PRODH) expression. PRODH maps to chromosome 22q11, a region conferring the highest known genetic risk of schizophrenia, and encodes proline oxidase, which catalyzes proline catabolism. l-Proline is a neuromodulator at glutamatergic synapses, and peripheral hyperprolinemia has been associated with decreased IQ, cognitive impairment, schizoaffective disorder, and schizophrenia. We investigated the relationship between 25(OH)D and schizophrenia, comparing fasting plasma 25(OH)D in 64 patients and 90 matched controls. We then tested for a mediating effect of hyperprolinemia on the association between 25(OH)D and schizophrenia. 25(OH)D levels were significantly lower in patients, and 25(OH)D insufficiency associated with schizophrenia (OR 2.1, adjusted p=0.044, 95% CI: 1.02-4.46). Moreover, 25(OH)D insufficient subjects had three times greater odds of hyperprolinemia than those with optimal levels (p=0.035, 95% CI: 1.08-8.91), and formal testing established that hyperprolinemia is a significantly mediating phenotype that may explain over a third of the effect of 25(OH)D insufficiency on schizophrenia risk. This study presents a mechanism by which 25(OH)D insufficiency confers risk of schizophrenia; via proline elevation due to reduced PRODH expression, and a concomitant dysregulation of neurotransmission. Although definitive causality cannot be confirmed, these findings strongly support vitamin D supplementation in patients, particularly for those with elevated proline, who may represent a large subgroup of the schizophrenia population. Copyright © 2014 Elsevier B.V. All rights reserved.

NOVEL ANTIBIOTIC RESISTANCE DETERMINANTS FROM AGRICULTURAL SOIL EXPOSED TO ANTIBIOTICS WIDELY USED IN HUMAN MEDICINE AND ANIMAL FARMING.

PubMed

Lau, Calvin Ho-Fung; van Engelen, Kalene; Gordon, Stephen; Renaud, Justin; Topp, Edward

2017-06-16

Antibiotic resistance has emerged globally as one of the biggest threats to human and animal health. Although the excessive use of antibiotics is recognized for accelerating the selection for resistance, there is a growing body of evidence suggesting that natural environments are "hotspots" for the development of both ancient and contemporary resistance mechanisms. Given that pharmaceuticals can be entrained onto agricultural land through anthropogenic activities, this could be a potential driver for the emergence and dissemination of resistance in soil bacteria. Using functional metagenomics, we interrogated the "resistome" of bacterial communities found in a collection of Canadian agricultural soil, some of which had been receiving antibiotics widely used in human medicine (macrolides) or food animal production (sulfamethazine, chlortetracycline and tylosin) for up to 16 years. Of the 34 new antibiotic resistance genes (ARGs) recovered, the majority were predicted to encode for (multi)drug efflux systems, while a few share little to no homology with established resistance determinants. We characterized several novel gene products, including putative enzymes that can confer high-level resistance against aminoglycosides, sulfonamides, and broad range of beta-lactams, with respect to their resistance mechanisms and clinical significance. By coupling high-resolution proteomics analysis with functional metagenomics, we discovered an unusual peptide, PPP AZI 4 , encoded within an alternative open-reading frame not predicted by bioinformatics tools. Expression of the proline-rich PPP AZI 4 can promote resistance against different macrolides but not other ribosomal-targeting antibiotics, implicating a new macrolide-specific resistance mechanism that could be fundamentally linked to the evolutionary design of this peptide. IMPORTANCE Antibiotic resistance is a clinical phenomenon with an evolutionary link to the microbial pangenome. Genes and protogenes encoding for specialized and potential resistance mechanisms are abundant in natural environments, but understanding of their identity and genomic context remain limited. Our discovery of several previously-unknown antibiotic resistance genes from uncultured soil microorganisms indicates that soil is a significant reservoir of resistance determinants, which, once acquired and "re-purposed" by pathogenic bacteria, can have serious impacts on therapeutic outcomes. This study provides valuable insights into the diversity and identity of resistance within the soil microbiome. The finding of a novel peptide-mediated resistance mechanism involving an unpredicted gene product also highlights the usefulness of integrating proteomics analysis into metagenomics-driven gene discovery. © Crown copyright 2017.

Vitamin B6 Generated by Obligate Symbionts Is Critical for Maintaining Proline Homeostasis and Fecundity in Tsetse Flies

PubMed Central

Michalkova, Veronika; Weiss, Brian L.; Attardo, Geoffrey M.; Aksoy, Serap

2014-01-01

The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. PMID:25038091

Vitamin B6 generated by obligate symbionts is critical for maintaining proline homeostasis and fecundity in tsetse flies.

PubMed

Michalkova, Veronika; Benoit, Joshua B; Weiss, Brian L; Attardo, Geoffrey M; Aksoy, Serap

2014-09-01

The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Toxicological and biochemical response of the entomopathogenic fungus Beauveria bassiana after exposure to deltamethrin.

PubMed

Forlani, Lucas; Juárez, M Patricia; Lavarías, Sabrina; Pedrini, Nicolás

2014-05-01

The chemical control of the Chagas disease vector Triatoma infestans is endangered by the emergence of pyrethroid resistance. An effective alternative control tool is the use of the entomopathogenic fungus Beauveria bassiana. The effect of deltamethrin on fungal growth, gene expression and enzyme activity in relation to detoxification, antioxidant response and oxidative stress levels was studied to evaluate fungal tolerance to deltamethrin. The mean inhibitory concentration (IC50 ) was 50 µg deltamethrin/cm(2). Cytochrome P450 genes were differentially expressed; cyp52X1 and cyp617N1 transcripts were > 2-fold induced, followed by cyp655C1 (1.8-fold). Minor effects were observed on genes encoding for other P450s, epoxide hydrolase and glutathione S-transferase (GST). Superoxide dismutase (SOD) genes showed induction levels ≤ 2, catalase (CAT) and glutathione peroxidase genes were also induced ∼ 2-3-fold and < 2-fold, respectively. The activities of enzymes participating in the antioxidant defense system and phase II detoxification were also evaluated; SOD, CAT and GST activity showed significant differences with deltamethrin concentration. Lipid peroxidation levels and free proline content were also altered. Beauveria bassiana GHA can be used combined with deltamethrin without significant metabolic detrimental effects. This combination will help optimizing the benefits and increasing the efficacy of vector control tools. © 2013 Society of Chemical Industry.

Use of proline mutants to help solve the NMR solution structure of type III antifreeze protein.

PubMed Central

Chao, H.; Davies, P. L.; Sykes, B. D.; Sönnichsen, F. D.

1993-01-01

To help understand the structure/function relationships in antifreeze proteins (AFP), and to define the motifs required for ice binding, a Type III AFP suitable for two-dimensional (2D) NMR studies was produced in Escherichia coli. A synthetic gene for one of the Type III AFP isoforms was assembled in a T7 polymerase-directed expression vector. The 67-amino acid-long gene product differed from the natural AFP by inclusion of an N-terminal methionine but was indistinguishable in activity. The NMR spectra of this AFP were complicated by cis-trans proline isomerization from the C-terminal sequence YPPA. Substitution of this sequence by YAA eliminated isomer signals without altering the activity or structure of the mutant AFP. This variant (rQAE m1.1) was selected for sequential assignment and the secondary structure determination using 2D 1H NMR spectroscopy. Nine beta-strands are paired to form two triple-stranded antiparallel sheets and one double-stranded antiparallel sheet. Two further proline replacements, P29A and P33A, were made to delineate the role of conserved prolines in Type III AFP. These mutants were valuable in clarifying ambiguous NMR spectral assignments amongst the remaining six prolines of rQAE m1.1. In contrast to the replacement of the C-terminal prolyl residues, the exchange of P29 and P33 caused some structural changes and significantly decreased protein solubility and antifreeze activity. PMID:8401227

Activation of the Lbc Rho Exchange Factor Proto-Oncogene by Truncation of an Extended C Terminus That Regulates Transformation and Targeting

PubMed Central

Sterpetti, Paola; Hack, Andrew A.; Bashar, Mariam P.; Park, Brian; Cheng, Sou-De; Knoll, Joan H. M.; Urano, Takeshi; Feig, Larry A.; Toksoz, Deniz

1999-01-01

The human lbc oncogene product is a guanine nucleotide exchange factor that specifically activates the Rho small GTP binding protein, thus resulting in biologically active, GTP-bound Rho, which in turn mediates actin cytoskeletal reorganization, gene transcription, and entry into the mitotic S phase. In order to elucidate the mechanism of onco-Lbc transformation, here we report that while proto- and onco-lbc cDNAs encode identical N-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains, proto-Lbc encodes a novel C terminus absent in the oncoprotein that includes a predicted α-helical region homologous to cyto-matrix proteins, followed by a proline-rich region. The lbc proto-oncogene maps to chromosome 15, and onco-lbc represents a fusion of the lbc proto-oncogene N terminus with a short, unrelated C-terminal sequence from chromosome 7. Both onco- and proto-Lbc can promote formation of GTP-bound Rho in vivo. Proto-Lbc transforming activity is much reduced compared to that of onco-Lbc, and a significant increase in transforming activity requires truncation of both the α-helical and proline-rich regions in the proto-Lbc C terminus. Deletion of the chromosome 7-derived C terminus of onco-Lbc does not destroy transforming activity, demonstrating that it is loss of the proto-Lbc C terminus, rather than gain of an unrelated C-terminus by onco-Lbc, that confers transforming activity. Mutations of onco-Lbc DH and PH domains demonstrate that both domains are necessary for full transforming activity. The proto-Lbc product localizes to the particulate (membrane) fraction, while the majority of the onco-Lbc product is cytosolic, and mutations of the PH domain do not affect this localization. The proto-Lbc C-terminus alone localizes predominantly to the particulate fraction, indicating that the C terminus may play a major role in the correct subcellular localization of proto-Lbc, thus providing a mechanism for regulating Lbc oncogenic potential. PMID:9891067

A complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus): an evolutionary history of camelidae

PubMed Central

Cui, Peng; Ji, Rimutu; Ding, Feng; Qi, Dan; Gao, Hongwei; Meng, He; Yu, Jun; Hu, Songnian; Zhang, Heping

2007-01-01

Background The family Camelidae that evolved in North America during the Eocene survived with two distinct tribes, Camelini and Lamini. To investigate the evolutionary relationship between them and to further understand the evolutionary history of this family, we determined the complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus), the only wild survivor of the Old World camel. Results The mitochondrial genome sequence (16,680 bp) from C. bactrianus ferus contains 13 protein-coding, two rRNA, and 22 tRNA genes as well as a typical control region; this basic structure is shared by all metazoan mitochondrial genomes. Its protein-coding region exhibits codon usage common to all mammals and possesses the three cryptic stop codons shared by all vertebrates. C. bactrianus ferus together with the rest of mammalian species do not share a triplet nucleotide insertion (GCC) that encodes a proline residue found only in the nd1 gene of the New World camelid Lama pacos. This lineage-specific insertion in the L. pacos mtDNA occurred after the split between the Old and New World camelids suggests that it may have functional implication since a proline insertion in a protein backbone usually alters protein conformation significantly, and nd1 gene has not been seen as polymorphic as the rest of ND family genes among camelids. Our phylogenetic study based on complete mitochondrial genomes excluding the control region suggested that the divergence of the two tribes may occur in the early Miocene; it is much earlier than what was deduced from the fossil record (11 million years). An evolutionary history reconstructed for the family Camelidae based on cytb sequences suggested that the split of bactrian camel and dromedary may have occurred in North America before the tribe Camelini migrated from North America to Asia. Conclusion Molecular clock analysis of complete mitochondrial genomes from C. bactrianus ferus and L. pacos suggested that the two tribes diverged from their common ancestor about 25 million years ago, much earlier than what was predicted based on fossil records. PMID:17640355

Polymorphisms of glutathione peroxidase 1 (GPX1 Pro198Leu) and catalase (CAT C-262T) in women with spontaneous abortion.

PubMed

Sabet, Eliza Eskafi; Salehi, Zivar; Khodayari, Siamak; Zarafshan, Samin Sabouhi; Zahiri, Ziba

2014-10-01

About 10%-15% of conceptions are lost spontaneously prior to 20 weeks. Apart from the clinical problems, genetic variations have also been proposed as a susceptibility factor to miscarriage. Glutathione peroxidase 1 (GPX1) and catalase (CAT) encode two antioxidant enzymes that detoxify H2O2 and protect the cells from oxidative damage. A functional polymorphism at codon 198 of the GPX1 gene causes a C/T substitution in exon 2, which encodes for either proline or leucine (Pro198Leu). The CAT gene has a polymorphic site in the promoter region at position -262 (C-262T) which alters the expression and enzyme blood levels, leading to some pathological clinical conditions. In this study, we evaluated the association of these two polymorphisms with the risk of spontaneous abortion. Genomic DNA from 105 cases with spontaneous abortion and 90 healthy women were genotyped using allele-specific PCR (AS-PCR) and polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP). The genetic distributions for GPX1 did not differ significantly between cases and controls (p = 0.680). However, C-262T polymorphism was significantly associated with the risk of the disease (OR, 5.50; 95% CI, 1.43-21.09; p = 0.012). In conclusion, this study indicates that CAT -262T/T genotype confers less susceptibility to spontaneous abortion, while GPX1 Pro198Leu polymorphism may not be correlated with the disease.

Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Zhenyu, E-mail: wzy72609@163.com; Zhao, Xiuyang, E-mail: xiuzh@psb.vib-ugent.be; Wang, Bing, E-mail: wangbing@ibcas.ac.cn

Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studiesmore » revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.« less

Comparative Genomics Identifies Epidermal Proteins Associated with the Evolution of the Turtle Shell

PubMed Central

Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A.; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

2016-01-01

The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. PMID:26601937

Role of the Putative Osmosensor Arabidopsis Histidine Kinase1 in Dehydration Avoidance and Low-Water-Potential Response1[W][OA

PubMed Central

Kumar, M. Nagaraj; Jane, Wann-Neng; Verslues, Paul E.

2013-01-01

The molecular basis of plant osmosensing remains unknown. Arabidopsis (Arabidopsis thaliana) Histidine Kinase1 (AHK1) can complement the osmosensitivity of yeast (Saccharomyces cerevisiae) osmosensor mutants lacking Synthetic Lethal of N-end rule1 and SH3-containing Osmosensor and has been proposed to act as a plant osmosensor. We found that ahk1 mutants in either the Arabidopsis Nossen-0 or Columbia-0 background had increased stomatal density and stomatal index consistent with greater transpirational water loss. However, the growth of ahk1 mutants was not more sensitive to controlled moderate low water potential (ψw) or to salt stress. Also, ahk1 mutants had increased, rather than reduced, solute accumulation across a range of low ψw severities. ahk1 mutants had reduced low ψw induction of Δ1-Pyrroline-5-Carboxylate Synthetase1 (P5CS1) and 9-cis-Epoxycarotenoid Dioxygenase3, which encode rate-limiting enzymes in proline and abscisic acid (ABA) synthesis, respectively. However, neither Pro nor ABA accumulation was reduced in ahk1 mutants at low ψw. P5CS1 protein level was not reduced in ahk1 mutants. This indicated that proline accumulation was regulated in part by posttranscriptional control of P5CS1 that was not affected by AHK1. Expression of AHK1 itself was reduced by low ψw, in contrast to previous reports. These results define a role of AHK1 in controlling stomatal density and the transcription of stress-responsive genes. These phenotypes may be mediated in part by reduced ABA sensitivity. More rapid transpiration and water depletion can also explain the previously reported sensitivity of ahk1 to uncontrolled soil drying. The unimpaired growth, ABA, proline, and solute accumulation of ahk1 mutants at low ψw suggest that AHK1 may not be the main plant osmosensor required for low ψw tolerance. PMID:23184230

Second-site changes affect viability of amphotropic/ecotropic chimeric enveloped murine leukemia viruses.

PubMed

O'Reilly, L; Roth, M J

2000-01-01

Chimeras were previously generated between the ecotropic (Moloney-MuLV) and amphotropic (4070A) SU and TM proteins of murine leukemia virus (MuLV). After passage in D17 cells, three chimeras with junctions in the C terminus of SU (AE5, AE6, and AE7), showed improved kinetics of viral spreading, suggesting that they had adapted. Sequencing of the viruses derived from the D17 cell lines revealed second-site changes within the env gene. Changes were detected in the receptor binding domain, the proline-rich region, the C terminus of SU, and the ectodomain of TM. Second-site changes were subcloned into the parental DNA, singly and in combination, and tested for viability. All viruses had maintained their original cloned mutations and junctions. Reconstruction and passage of AE7 or AE6 virus with single point mutations recovered the additional second-site changes identified in the parental population. The AE5 isolate required changes in the VRA, the VRC, the VRB-hinge region, and the C terminus of SU for efficient infection. Passage of virus, including the parental 4070A, in D17 cells resulted in a predominant G100R mutation within the receptor binding domain. Viruses were subjected to titer determination in three cell types, NIH 3T3, canine D17, and 293T. AE6 viruses with changes in the proline-rich region initially adapted for growth on D17 cells could infect all cell types tested. AE6-based chimeras with additional mutations in the C terminus of SU could infect D17 and 293T cells. Infection of NIH 3T3 cells was dependent on the proline-rich mutation. AE7-based chimeras encoding L538Q and G100R were impaired in infecting NIH 3T3 and 293T cells.

Second-Site Changes Affect Viability of Amphotropic/Ecotropic Chimeric Enveloped Murine Leukemia Viruses

PubMed Central

O'Reilly, Lucille; Roth, Monica J.

2000-01-01

Chimeras were previously generated between the ecotropic (Moloney-MuLV) and amphotropic (4070A) SU and TM proteins of murine leukemia virus (MuLV). After passage in D17 cells, three chimeras with junctions in the C terminus of SU (AE5, AE6, and AE7), showed improved kinetics of viral spreading, suggesting that they had adapted. Sequencing of the viruses derived from the D17 cell lines revealed second-site changes within the env gene. Changes were detected in the receptor binding domain, the proline-rich region, the C terminus of SU, and the ectodomain of TM. Second-site changes were subcloned into the parental DNA, singly and in combination, and tested for viability. All viruses had maintained their original cloned mutations and junctions. Reconstruction and passage of AE7 or AE6 virus with single point mutations recovered the additional second-site changes identified in the parental population. The AE5 isolate required changes in the VRA, the VRC, the VRB-hinge region, and the C terminus of SU for efficient infection. Passage of virus, including the parental 4070A, in D17 cells resulted in a predominant G100R mutation within the receptor binding domain. Viruses were subjected to titer determination in three cell types, NIH 3T3, canine D17, and 293T. AE6 viruses with changes in the proline-rich region initially adapted for growth on D17 cells could infect all cell types tested. AE6-based chimeras with additional mutations in the C terminus of SU could infect D17 and 293T cells. Infection of NIH 3T3 cells was dependent on the proline-rich mutation. AE7-based chimeras encoding L538Q and G100R were impaired in infecting NIH 3T3 and 293T cells. PMID:10623753

Overexpression of pigeonpea stress-induced cold and drought regulatory gene (CcCDR) confers drought, salt, and cold tolerance in Arabidopsis

PubMed Central

Tamirisa, Srinath; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2014-01-01

A potent cold and drought regulatory protein-encoding gene (CcCDR) was isolated from the subtractive cDNA library of pigeonpea plants subjected to drought stress. CcCDR was induced by different abiotic stress conditions in pigeonpea. Overexpression of CcCDR in Arabidopsis thaliana imparted enhanced tolerance against major abiotic stresses, namely drought, salinity, and low temperature, as evidenced by increased biomass, root length, and chlorophyll content. Transgenic plants also showed increased levels of antioxidant enzymes, proline, and reducing sugars under stress conditions. Furthermore, CcCDR-transgenic plants showed enhanced relative water content, osmotic potential, and cell membrane stability, as well as hypersensitivity to abscisic acid (ABA) as compared with control plants. Localization studies confirmed that CcCDR could enter the nucleus, as revealed by intense fluorescence, indicating its possible interaction with various nuclear proteins. Microarray analysis revealed that 1780 genes were up-regulated in CcCDR-transgenics compared with wild-type plants. Real-time PCR analysis on selected stress-responsive genes, involved in ABA-dependent and -independent signalling networks, revealed higher expression levels in transgenic plants, suggesting that CcCDR acts upstream of these genes. The overall results demonstrate the explicit role of CcCDR in conferring multiple abiotic stress tolerance at the whole-plant level. The multifunctional CcCDR seems promising as a prime candidate gene for enhancing abiotic stress tolerance in diverse plants. PMID:24868035

Importance of the High-Expression of Proline Transporter PutP to the Adaptation of Escherichia coli to High Salinity.

PubMed

Sasaki, Hideaki; Sato, Daichi; Oshima, Akinobu

2017-01-01

　The effect of the amount of the proline transporter PutP expression on the mechanism of adaptation of E. coli cells to high salinity was analyzed. The PutP gene derived from the E. coli expression plasmid was introduced into the E. coli cell, and a high PutP expression strain was developed. At 1.2 M NaCl culture condition, the growth of normal E. coli cells was inhibited, whereas high ProP expression cells showed growth under 2.5 M NaCl conditions. The uptake of proline by E. coli as a compatible solute and substrate for metabolization was in good accordance with those seen in cell growth. These data suggested that the amount of the proline transporter PutP expression played an important role in the adaptation of E. coli cells to high saline conditions.

Differential Evolution and Neofunctionalization of Snake Venom Metalloprotease Domains*

PubMed Central

Brust, Andreas; Sunagar, Kartik; Undheim, Eivind A.B.; Vetter, Irina; Yang, Daryl C.; Casewell, Nicholas R.; Jackson, Timothy N. W.; Koludarov, Ivan; Alewood, Paul F.; Hodgson, Wayne C.; Lewis, Richard J.; King, Glenn F.; Antunes, Agostinho; Hendrikx, Iwan; Fry, Bryan G.

2013-01-01

Snake venom metalloproteases (SVMP) are composed of five domains: signal peptide, propeptide, metalloprotease, disintegrin, and cysteine-rich. Secreted toxins are typically combinatorial variations of the latter three domains. The SVMP-encoding genes of Psammophis mossambicus venom are unique in containing only the signal and propeptide domains. We show that the Psammophis SVMP propeptide evolves rapidly and is subject to a high degree of positive selection. Unlike Psammophis, some species of Echis express both the typical multidomain and the unusual monodomain (propeptide only) SVMP, with the result that a lower level of variation is exerted upon the latter. We showed that most mutations in the multidomain Echis SVMP occurred in the protease domain responsible for proteolytic and hemorrhagic activities. The cysteine-rich and disintegrin-like domains, which are putatively responsible for making the P-III SVMPs more potent than the P-I and P-II forms, accumulate the remaining variation. Thus, the binding sites on the molecule's surface are evolving rapidly whereas the core remains relatively conserved. Bioassays conducted on two post-translationally cleaved novel proline-rich peptides from the P. mossambicus propeptide domain showed them to have been neofunctionalized for specific inhibition of mammalian a7 neuronal nicotinic acetylcholine receptors. We show that the proline rich postsynaptic specific neurotoxic peptides from Azemiops feae are the result of convergent evolution within the precursor region of the C-type natriuretic peptide instead of the SVMP. The results of this study reinforce the value of studying obscure venoms for biodiscovery of novel investigational ligands. PMID:23242553

Differential evolution and neofunctionalization of snake venom metalloprotease domains.

PubMed

Brust, Andreas; Sunagar, Kartik; Undheim, Eivind A B; Vetter, Irina; Yang, Daryl C; Yang, Dary C; Casewell, Nicholas R; Jackson, Timothy N W; Koludarov, Ivan; Alewood, Paul F; Hodgson, Wayne C; Lewis, Richard J; King, Glenn F; Antunes, Agostinho; Hendrikx, Iwan; Fry, Bryan G

2013-03-01

Snake venom metalloproteases (SVMP) are composed of five domains: signal peptide, propeptide, metalloprotease, disintegrin, and cysteine-rich. Secreted toxins are typically combinatorial variations of the latter three domains. The SVMP-encoding genes of Psammophis mossambicus venom are unique in containing only the signal and propeptide domains. We show that the Psammophis SVMP propeptide evolves rapidly and is subject to a high degree of positive selection. Unlike Psammophis, some species of Echis express both the typical multidomain and the unusual monodomain (propeptide only) SVMP, with the result that a lower level of variation is exerted upon the latter. We showed that most mutations in the multidomain Echis SVMP occurred in the protease domain responsible for proteolytic and hemorrhagic activities. The cysteine-rich and disintegrin-like domains, which are putatively responsible for making the P-III SVMPs more potent than the P-I and P-II forms, accumulate the remaining variation. Thus, the binding sites on the molecule's surface are evolving rapidly whereas the core remains relatively conserved. Bioassays conducted on two post-translationally cleaved novel proline-rich peptides from the P. mossambicus propeptide domain showed them to have been neofunctionalized for specific inhibition of mammalian a7 neuronal nicotinic acetylcholine receptors. We show that the proline rich postsynaptic specific neurotoxic peptides from Azemiops feae are the result of convergent evolution within the precursor region of the C-type natriuretic peptide instead of the SVMP. The results of this study reinforce the value of studying obscure venoms for biodiscovery of novel investigational ligands.

Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.

PubMed

Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q

2011-09-01

EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

Water deficit modulates gene expression in growing zones of soybean seedlings. Analysis of differentially expressed cDNAs, a new beta-tubulin gene, and expression of genes encoding cell wall proteins.

PubMed

Creelman, R A; Mullet, J E

1991-10-01

Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.

Genes Important for Catalase Activity in Enterococcus faecalis

PubMed Central

Baureder, Michael; Hederstedt, Lars

2012-01-01

Little in general is known about how heme proteins are assembled from their constituents in cells. The Gram-positive bacterium Enterococcus faecalis cannot synthesize heme and does not depend on it for growth. However, when supplied with heme in the growth medium the cells can synthesize two heme proteins; catalase (KatA) and cytochrome bd (CydAB). To identify novel factors important for catalase biogenesis libraries of E. faecalis gene insertion mutants were generated using two different types of transposons. The libraries of mutants were screened for clones deficient in catalase activity using a colony zymogram staining procedure. Analysis of obtained clones identified, in addition to katA (encoding the catalase enzyme protein), nine genes distributed over five different chromosomal loci. No factors with a dedicated essential role in catalase biogenesis or heme trafficking were revealed, but the results indicate the RNA degradosome (srmB, rnjA), an ABC-type oligopeptide transporter (oppBC), a two-component signal transducer (etaR), and NADH peroxidase (npr) as being important for expression of catalase activity in E. faecalis. It is demonstrated that catalase biogenesis in E. faecalis is independent of the CydABCD proteins and that a conserved proline residue in the N-terminal region of KatA is important for catalase assembly. PMID:22590595

Osmoprotection of Bacillus subtilis through Import and Proteolysis of Proline-Containing Peptides

PubMed Central

Zaprasis, Adrienne; Brill, Jeanette; Thüring, Marietta; Wünsche, Guido; Heun, Magnus; Barzantny, Helena; Hoffmann, Tamara

2013-01-01

Bacillus subtilis can attain cellular protection against the detrimental effects of high osmolarity through osmotically induced de novo synthesis and uptake of the compatible solute l-proline. We have now found that B. subtilis can also exploit exogenously provided proline-containing peptides of various lengths and compositions as osmoprotectants. Osmoprotection by these types of peptides is generally dependent on their import via the peptide transport systems (Dpp, Opp, App, and DtpT) operating in B. subtilis and relies on their hydrolysis to liberate proline. The effectiveness with which proline-containing peptides confer osmoprotection varies considerably, and this can be correlated with the amount of the liberated and subsequently accumulated free proline by the osmotically stressed cell. Through gene disruption experiments, growth studies, and the quantification of the intracellular proline pool, we have identified the PapA (YqhT) and PapB (YkvY) peptidases as responsible for the hydrolysis of various types of Xaa-Pro dipeptides and Xaa-Pro-Xaa tripeptides. The PapA and PapB peptidases possess overlapping substrate specificities. In contrast, osmoprotection by peptides of various lengths and compositions with a proline residue positioned at their N terminus was not affected by defects in the PapA and PapB peptidases. Taken together, our data provide new insight into the physiology of the osmotic stress response of B. subtilis. They illustrate the flexibility of this ubiquitously distributed microorganism to effectively exploit environmental resources in its acclimatization to sustained high-osmolarity surroundings through the accumulation of compatible solutes. PMID:23144141

Overexpression of the Arabidopsis CBF3 Transcriptional Activator Mimics Multiple Biochemical Changes Associated with Cold Acclimation1

PubMed Central

Gilmour, Sarah J.; Sebolt, Audrey M.; Salazar, Maite P.; Everard, John D.; Thomashow, Michael F.

2000-01-01

We further investigated the role of the Arabidopsis CBF regulatory genes in cold acclimation, the process whereby certain plants increase in freezing tolerance upon exposure to low temperature. The CBF genes, which are rapidly induced in response to low temperature, encode transcriptional activators that control the expression of genes containing the C-repeat/dehydration responsive element DNA regulatory element in their promoters. Constitutive expression of either CBF1 or CBF3 (also known as DREB1b and DREB1a, respectively) in transgenic Arabidopsis plants has been shown to induce the expression of target COR (cold-regulated) genes and to enhance freezing tolerance in nonacclimated plants. Here we demonstrate that overexpression of CBF3 in Arabidopsis also increases the freezing tolerance of cold-acclimated plants. Moreover, we show that it results in multiple biochemical changes associated with cold acclimation: CBF3-expressing plants had elevated levels of proline (Pro) and total soluble sugars, including sucrose, raffinose, glucose, and fructose. Plants overexpressing CBF3 also had elevated P5CS transcript levels suggesting that the increase in Pro levels resulted, at least in part, from increased expression of the key Pro biosynthetic enzyme Δ1-pyrroline-5-carboxylate synthase. These results lead us to propose that CBF3 integrates the activation of multiple components of the cold acclimation response. PMID:11115899

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leshinsky-Silver, E.; Mitochondrial Disease Center, Wolfson Medical Center, Holon; E-mail: leshinsky@wolfson.health.gov.il

Leigh syndrome can result from both nuclear and mitochondrial DNA defects. Mutations in complex V genes of the respiratory chain were considered until recently as the most frequent cause for mitochondrial inherited Leigh syndrome, while gene defects in complex I were related to recessive Leigh syndrome. Recently few reports of mutations in the mitochondrial-encoded complex I subunit genes causing Leigh syndrome have been reported. We describe a 1-month-old baby who acutely deteriorated, with abrupt onset of brainstem dysfunction, due to basal ganglia lesions extending to the brainstem. A muscle biopsy demonstrated complex I deficiency. Subsequent analysis of the mitochondrial genomemore » revealed a homoplastic T10191C mutation in the ND3 gene (in blood and muscle), resulting in a substitution of serine to proline. Hair root analysis revealed a 50% mutant load, reflecting heteroplasmy in early embryonic stages. The mutation was also detected in his mother (5%). Western blot analysis revealed a decrease of the 20 kDa subunit (likely ND6) and of the 30 kDa subunit (NDUFA9), which is probably due to instability attributed to the inability to form subcomplexes with ND3. This is the first description of infantile Leigh syndrome due to a maternally transmitted T10191C substitution in ND3 and not due to a de novo mutation. This mutation is age and tissue dependent and therefore may not be amenable to prenatal testing.« less

Genetic Variability in Energy Balance and Pancreatic Cancer Risk in a Population-Based Case-Control Study in Minnesota

PubMed Central

Zhang, Jianjun; Dhakal, Ishwori B.; Zhang, Xuemei; Prizment, Anna E.; Anderson, Kristin E.

2013-01-01

Objectives Accumulating evidence suggests that energy imbalance plays a role in pancreatic carcinogenesis. However, it remains unclear whether single nucleotide polymorphisms (SNPs) in genes regulating energy homeostasis influence pancreatic cancer risk. We investigated this question in a case-control study conducted from 1994 to 1998. Methods Cases (n=173) were ascertained from hospitals in the Twin Cities and Mayo Clinic, Minnesota. Controls (n=476) were identified from the general population and frequency matched to cases by age and sex. Seven SNPs were evaluated in relation to pancreatic cancer using unconditional logistic regression. Results After adjustment for confounders, the leucine/proline or proline/proline genotype of the neuropeptide Y (NPY) gene rs16139 was associated with a lower risk than the leucine/leucine genotype [odds ratio (OR) (95% confidence interval) (95% CI): 0.40 (0.15, 0.91)]. Conversely, an increased risk was observed for the glycine/arginine or arginine/arginine genotype of the adrenoceptor beta 2, surface (ADRB2) gene rs1042713 as compared with the glycine/glycine genotype [OR (95% CI): 1.52 (1.01, 2.31)]. Conclusions This study first reveals that SNPs in genes modulating energy intake (NPY) and energy expenditure (ADRB2) altered pancreatic cancer risk. If confirmed by other studies, our findings may shed new light on the etiology and prevention of pancreatic cancer. PMID:24201779

Genetic variability in energy balance and pancreatic cancer risk in a population-based case-control study in Minnesota.

PubMed

Zhang, Jianjun; Dhakal, Ishwori B; Zhang, Xuemei; Prizment, Anna E; Anderson, Kristin E

2014-03-01

Accumulating evidence suggests that energy imbalance plays a role in pancreatic carcinogenesis. However, it remains unclear whether single-nucleotide polymorphisms (SNPs) in genes regulating energy homeostasis influence pancreatic cancer risk. We investigated this question in a case-control study conducted from 1994 to 1998. Patients (n = 173) were ascertained from hospitals in the Twin Cities and Mayo Clinic, Minnesota. Control subjects (n = 476) were identified from the general population and frequency matched to patients by age and sex. Seven SNPs were evaluated in relation to pancreatic cancer using unconditional logistic regression. After adjustment for confounders, the leucine/proline or proline/proline genotype of the neuropeptide Y (NPY) gene rs16139 was associated with a lower risk than the leucine/leucine genotype (odds ratio, 0.40 [95% confidence interval, 0.15-0.91]). Conversely, an increased risk was observed for the glycine/arginine or arginine/arginine genotype of the adrenoceptor β2, surface (ADRB2) gene rs1042713 as compared with the glycine/glycine genotype (odds ratio, 1.52 [95% confidence interval, 1.01-2.31]). This study first reveals that SNPs in genes modulating energy intake (NPY) and energy expenditure (ADRB2) altered pancreatic cancer risk. If confirmed by other studies, our findings may shed new light on the etiology and prevention of pancreatic cancer.

Novel double-stranded RNA viruses of plant-feeding insects encode a serine-alanine-proline rich protein and a polymerase distantly related to fungal viruses

USDA-ARS?s Scientific Manuscript database

Novel double stranded RNAs (~8 kbp) were isolated from the three cornered alfalfa hopper (Spissistilus festinus) and beet leafhopper (Circulifer tenellus), two plant-feeding hemipteran insect pests. Genome organization of the two new viruses, designated as Spissistilus festinus virus 1 (SpFV1) and ...

Plant-feeding insects harbor double-stranded RNA viruses encoding a novel proline-alanine rich protein and a polymerase distantly related to that of fungal viruses

USDA-ARS?s Scientific Manuscript database

Novel double-stranded RNAs (~8 kbp) were isolated from three cornered alfalfa hopper (Spissistilus festinus) and beet leafhopper (Circulifer tenellus), two plant-feeding hemipteran insect pests. Genomes of the two new viruses, designated as Spissistilus festinus virus 1 (SpFV1) and Circulifer tenell...

Involvement of the C-terminal extension of the alpha polypeptide and of the PucC protein in LH2 complex biosynthesis in Rubrivivax gelatinosus.

PubMed

Steunou, Anne-Soisig; Ouchane, Soufian; Reiss-Husson, Françoise; Astier, Chantal

2004-05-01

The facultative phototrophic nonsulfur bacterium Rubrivivax gelatinosus exhibits several differences from other species of purple bacteria in the organization of its photosynthetic genes. In particular, the puc operon contains only the pucB and pucA genes encoding the beta and alpha polypeptides of the light-harvesting 2 (LH2) complex. Downstream of the pucBA operon is the pucC gene in the opposite transcriptional orientation. The transcription of pucBA and pucC has been studied. No pucC transcript was detected either by Northern blotting or by reverse transcription-PCR analysis. The initiation site of pucBA transcription was determined by primer extension, and Northern blot analysis revealed the presence of two transcripts of 0.8 and 0.65 kb. The half-lives of both transcripts are longer in cells grown semiaerobically than in photosynthetically grown cells, and the small transcript is the less stable. It was reported that the alpha polypeptide, encoded by the pucA gene, presents a C-terminal extension which is not essential for LH2 function in vitro. The biological role of this alanine- and proline-rich C-terminal extension in vivo has been investigated. Two mutants with C-terminal deletions of 13 and 18 residues have been constructed. Both present the two pucBA transcripts, while their phenotypes are, respectively, LH2+ and LH2-, suggesting that a minimal length of the C-terminal extension is required for LH2 biogenesis. Another important factor involved in the LH2 biogenesis is the PucC protein. To gain insight into the function of this protein in R. gelatinosus, we constructed and characterized a PucC mutant. The mutant is devoid of LH2 complex under semiaerobiosis but still produces a small amount of these antennae under photosynthetic growth conditions. This conditional phenotype suggests the involvement of another factor in LH2 biogenesis.

Genetic and physical mapping of 2q35 in the region of NRAMP and IL8R genes: Identification of a polymorphic repeat in exon 2 of NRAMP

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, J.K.; Shaw, M.A.; Barton, C.H.

1994-11-15

Recent interest has focused on the region of conserved synteny between mouse chromosome 1 and human 2q33-q37, particularly over the region encoding the murine macrophage resistance gene Ity/Lsh/Bcg (candidate Nramp) and members of the Il8r interleukin-8 (IL8) receptor gene cluster. In this paper, identification of a restriction fragment length polymorphism in the Il8RB gene in 35 pedigrees previously typed for markers in the 2q33-37 interval provided evidence (lod scores > 3) for linkage between Il8RB and the 2q34-135 markers FN1, TNP1, VIL1, and DES. Physical mapping, using yeast artificial chromosomes isolated with VIL1, confirmed that IL8RA, IL8RB and the IL8RBmore » pseudogene map within the NRAMP-VIL1 interval, with the physical distance (155 kb) from 5{prime} LSH to 3{prime} VIL1 representing {approx}3-fold that observed in the mouse. Partial sequencing of NRAMP confirmed the presence of the N-terminal proline/serine-rich putative SH3 binding domain in exon 2 of the human gene. Further analysis of Brazilian leprosy and visceral leishmaniasis pedigrees identified a rare second allele varying in a 9-nucleotide repeat motif of the exon 2 sequence but segregating independently of the disease phenotype. 38 refs., 4 figs., 3 tabs.« less

Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

PubMed Central

Pi, J; Wookey, P J; Pittard, A J

1991-01-01

The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

Fulminant neurological deterioration in a neonate with Leigh syndrome due to a maternally transmitted missense mutation in the mitochondrial ND3 gene.

PubMed

Leshinsky-Silver, E; Lev, D; Tzofi-Berman, Z; Cohen, S; Saada, A; Yanoov-Sharav, M; Gilad, E; Lerman-Sagie, T

2005-08-26

Leigh syndrome can result from both nuclear and mitochondrial DNA defects. Mutations in complex V genes of the respiratory chain were considered until recently as the most frequent cause for mitochondrial inherited Leigh syndrome, while gene defects in complex I were related to recessive Leigh syndrome. Recently few reports of mutations in the mitochondrial-encoded complex I subunit genes causing Leigh syndrome have been reported. We describe a 1-month-old baby who acutely deteriorated, with abrupt onset of brainstem dysfunction, due to basal ganglia lesions extending to the brainstem. A muscle biopsy demonstrated complex I deficiency. Subsequent analysis of the mitochondrial genome revealed a homoplastic T10191C mutation in the ND3 gene (in blood and muscle), resulting in a substitution of serine to proline. Hair root analysis revealed a 50% mutant load, reflecting heteroplasmy in early embryonic stages. The mutation was also detected in his mother (5%). Western blot analysis revealed a decrease of the 20 kDa subunit (likely ND6) and of the 30 kDa subunit (NDUFA9), which is probably due to instability attributed to the inability to form subcomplexes with ND3. This is the first description of infantile Leigh syndrome due to a maternally transmitted T10191C substitution in ND3 and not due to a de novo mutation. This mutation is age and tissue dependent and therefore may not be amenable to prenatal testing.

Comparative transcriptome analysis of isonuclear-alloplasmic lines unmask key transcription factor genes and metabolic pathways involved in sterility of maize CMS-C.

PubMed

Li, Chuan; Zhao, Zhuofan; Liu, Yongming; Liang, Bing; Guan, Shuxian; Lan, Hai; Wang, Jing; Lu, Yanli; Cao, Moju

2017-01-01

Although C-type cytoplasmic male sterility (CMS-C) is one of the most attractive tools for maize hybrid seed production, the detailed regulation network of the male sterility remains unclear. In order to identify the CMS-C sterility associated genes and/or pathways, the comparison of the transcriptomes between the CMS-C line C48-2 and its isonuclear-alloplasmic maintainer line N48-2 at pollen mother cell stage (PS), an early development stage of microspore, and mononuclear stage (MS), an abortive stage of microspore, were analyzed. 2,069 differentially expressed genes (DEGs) between the two stages were detected and thought to be essential for the spikelet development of N48-2. 453 of the 2,069 DEGs were differentially expressed at MS stage between the two lines and thought to be participated in the process or the causes of microspore abortion. Among the 453 DEGs, 385 (84.99%) genes were down-regulated and only 68 (15.01%) genes were up-regulated in C48-2 at MS stage. The dramatic decreased expression of the four DEGs encoding MYB transcription factors and the DEGs involved in "polyamine metabolic process", "Cutin, suberine and wax biosynthesis", "Fatty acid elongation", "Biosynthesis of unsaturated fatty acids" and "Proline metabolism" might play an important role in the sterility of C48-2. This study will point out some directions for detailed molecular analysis and better understanding of sterility of CMS-C in maize.

A missense mutation in ALDH18A1, encoding Delta1-pyrroline-5-carboxylate synthase (P5CS), causes an autosomal recessive neurocutaneous syndrome.

PubMed

Bicknell, Louise S; Pitt, James; Aftimos, Salim; Ramadas, Ram; Maw, Marion A; Robertson, Stephen P

2008-10-01

There are several rare syndromes combining wrinkled, redundant skin and neurological abnormalities. Although phenotypic overlap between conditions has suggested that some might be allelic to one another, the aetiology for many of them remains unknown. A consanguineous New Zealand Maori family has been characterised that segregates an autosomal recessive connective tissue disorder (joint dislocations, lax skin) associated with neurological abnormalities (severe global developmental delay, choreoathetosis) without metabolic abnormalities in four affected children. A genome-screen performed under a hypothesis of homozygosity by descent for an ancestral mutation, identified a locus at 10q23 (Z = 3.63). One gene within the candidate interval, ALDH18A1, encoding Delta1-pyrroline-5-carboxylate synthase (P5CS), was considered a plausible disease gene since a missense mutation had previously been shown to cause progressive neurodegeneration, cataracts, skin laxity, joint dislocations and metabolic derangement in a consanguineous Algerian family. A missense mutation, 2350C>T, was identified in ALDH18A1, which predicts the substitution H784Y. H784 is invariant across all phyla and lies within a previously unrecognised, conserved C-terminal motif in P5CS. In an in vivo assay of flux through this metabolic pathway using dermal fibroblasts obtained from an affected individual, proline and ornithine biosynthetic activity of P5CS was not affected by the H784Y substitution. These data suggest that P5CS may possess additional uncharacterised functions that affect connective tissue and central nervous system function.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

MFS Transporters and GABA Metabolism Are Involved in the Self-Defense Against DON in Fusarium graminearum

PubMed Central

Wang, Qinhu; Chen, Daipeng; Wu, Mengchun; Zhu, Jindong; Jiang, Cong; Xu, Jin-Rong; Liu, Huiquan

2018-01-01

Trichothecene mycotoxins, such as deoxynivalenol (DON) produced by the fungal pathogen, Fusarium graminearum, are not only important for plant infection but are also harmful to human and animal health. Trichothecene targets the ribosomal protein Rpl3 that is conserved in eukaryotes. Hence, a self-defense mechanism must exist in DON-producing fungi. It is reported that TRI (trichothecene biosynthesis) 101 and TRI12 are two genes responsible for self-defense against trichothecene toxins in Fusarium. In this study, however, we found that simultaneous disruption of TRI101 and TRI12 has no obvious influence on DON resistance upon exogenous DON treatment in F. graminearum, suggesting that other mechanisms may be involved in self-defense. By using RNA-seq, we identified 253 genes specifically induced in DON-treated cultures compared with samples from cultures treated or untreated with cycloheximide, a commonly used inhibitor of eukaryotic protein synthesis. We found that transporter genes are significantly enriched in this group of DON-induced genes. Of those genes, 15 encode major facilitator superfamily transporters likely involved in mycotoxin efflux. Significantly, we found that genes involved in the metabolism of gamma-aminobutyric acid (GABA), a known inducer of DON production in F. graminearum, are significantly enriched among the DON-induced genes. The GABA biosynthesis gene PROLINE UTILIZATION 2-2 (PUT2-2) is downregulated, while GABA degradation genes are upregulated at least twofold upon treatment with DON, resulting in decreased levels of GABA. Taken together, our results suggest that transporters influencing DON efflux are important for self-defense and that GABA mediates the balance of DON production and self-defense in F. graminearum. PMID:29706976

MFS Transporters and GABA Metabolism Are Involved in the Self-Defense Against DON in Fusarium graminearum.

PubMed

Wang, Qinhu; Chen, Daipeng; Wu, Mengchun; Zhu, Jindong; Jiang, Cong; Xu, Jin-Rong; Liu, Huiquan

2018-01-01

Trichothecene mycotoxins, such as deoxynivalenol (DON) produced by the fungal pathogen, Fusarium graminearum , are not only important for plant infection but are also harmful to human and animal health. Trichothecene targets the ribosomal protein Rpl3 that is conserved in eukaryotes. Hence, a self-defense mechanism must exist in DON-producing fungi. It is reported that TRI (trichothecene biosynthesis) 101 and TRI12 are two genes responsible for self-defense against trichothecene toxins in Fusarium . In this study, however, we found that simultaneous disruption of TRI101 and TRI12 has no obvious influence on DON resistance upon exogenous DON treatment in F. graminearum , suggesting that other mechanisms may be involved in self-defense. By using RNA-seq, we identified 253 genes specifically induced in DON-treated cultures compared with samples from cultures treated or untreated with cycloheximide, a commonly used inhibitor of eukaryotic protein synthesis. We found that transporter genes are significantly enriched in this group of DON-induced genes. Of those genes, 15 encode major facilitator superfamily transporters likely involved in mycotoxin efflux. Significantly, we found that genes involved in the metabolism of gamma-aminobutyric acid (GABA), a known inducer of DON production in F. graminearum , are significantly enriched among the DON-induced genes. The GABA biosynthesis gene PROLINE UTILIZATION 2-2 ( PUT2-2 ) is downregulated, while GABA degradation genes are upregulated at least twofold upon treatment with DON, resulting in decreased levels of GABA. Taken together, our results suggest that transporters influencing DON efflux are important for self-defense and that GABA mediates the balance of DON production and self-defense in F. graminearum .

Comparative Genomics Identifies Epidermal Proteins Associated with the Evolution of the Turtle Shell.

PubMed

Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

2016-03-01

The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

In planta Transformed Cumin (Cuminum cyminum L.) Plants, Overexpressing the SbNHX1 Gene Showed Enhanced Salt Endurance

PubMed Central

Pandey, Sonika; Patel, Manish Kumar; Jha, Bhavanath

2016-01-01

Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII) specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13), overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid), and lower electrolytic leakage, lipid peroxidation (MDA content) and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas. PMID:27411057

In planta Transformed Cumin (Cuminum cyminum L.) Plants, Overexpressing the SbNHX1 Gene Showed Enhanced Salt Endurance.

PubMed

Pandey, Sonika; Patel, Manish Kumar; Mishra, Avinash; Jha, Bhavanath

2016-01-01

Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII) specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13), overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid), and lower electrolytic leakage, lipid peroxidation (MDA content) and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas.

Transcriptional and metabolomic analysis of Ascophyllum nodosum mediated freezing tolerance in Arabidopsis thaliana

PubMed Central

2012-01-01

Background We have previously shown that lipophilic components (LPC) of the brown seaweed Ascophyllum nodosum (ANE) improved freezing tolerance in Arabidopsis thaliana. However, the mechanism(s) of this induced freezing stress tolerance is largely unknown. Here, we investigated LPC induced changes in the transcriptome and metabolome of A. thaliana undergoing freezing stress. Results Gene expression studies revealed that the accumulation of proline was mediated by an increase in the expression of the proline synthesis genes P5CS1 and P5CS2 and a marginal reduction in the expression of the proline dehydrogenase (ProDH) gene. Moreover, LPC application significantly increased the concentration of total soluble sugars in the cytosol in response to freezing stress. Arabidopsis sfr4 mutant plants, defective in the accumulation of free sugars, treated with LPC, exhibited freezing sensitivity similar to that of untreated controls. The 1H NMR metabolite profile of LPC-treated Arabidopsis plants exposed to freezing stress revealed a spectrum dominated by chemical shifts (δ) representing soluble sugars, sugar alcohols, organic acids and lipophilic components like fatty acids, as compared to control plants. Additionally, 2D NMR spectra suggested an increase in the degree of unsaturation of fatty acids in LPC treated plants under freezing stress. These results were supported by global transcriptome analysis. Transcriptome analysis revealed that LPC treatment altered the expression of 1113 genes (5%) in comparison with untreated plants. A total of 463 genes (2%) were up regulated while 650 genes (3%) were down regulated. Conclusion Taken together, the results of the experiments presented in this paper provide evidence to support LPC mediated freezing tolerance enhancement through a combination of the priming of plants for the increased accumulation of osmoprotectants and alteration of cellular fatty acid composition. PMID:23171218

Arabinosylation Modulates the Growth-Regulating Activity of the Peptide Hormone CLE40a from Soybean.

PubMed

Corcilius, Leo; Hastwell, April H; Zhang, Mengbai; Williams, James; Mackay, Joel P; Gresshoff, Peter M; Ferguson, Brett J; Payne, Richard J

2017-11-16

Small post-translationally modified peptide hormones mediate crucial developmental and regulatory processes in plants. CLAVATA/ENDOSPERM-SURROUNDING REGION (CLE) genes are found throughout the plant kingdom and encode for 12-13 amino acid peptides that must often undergo post-translational proline hydroxylation and glycosylation with O-β1,2-triarabinose moieties before they become functional. Apart from a few recent examples, a detailed understanding of the structure and function of most CLE hormones is yet to be uncovered. This is mainly owing to difficulties in isolating mature homogeneously modified CLE peptides from natural plant sources. In this study, we describe the efficient synthesis of a synthetic Araf 3 Hyp glycosylamino acid building block that was used to access a hitherto uninvestigated CLE hormone from soybean called GmCLE40a. Through the development and implementation of a novel in vivo root growth assay, we show that the synthetic triarabinosylated glycopeptide suppresses primary root growth in this important crop species. Copyright © 2017 Elsevier Ltd. All rights reserved.

Prediction and characterization of enzymatic activities guided by sequence similarity and genome neighborhood networks

DOE PAGES

Zhao, Suwen; Sakai, Ayano; Zhang, Xinshuai; ...

2014-06-30

Metabolic pathways in eubacteria and archaea often are encoded by operons and/or gene clusters (genome neighborhoods) that provide important clues for assignment of both enzyme functions and metabolic pathways. We describe a bioinformatic approach (genome neighborhood network; GNN) that enables large scale prediction of the in vitro enzymatic activities and in vivo physiological functions (metabolic pathways) of uncharacterized enzymes in protein families. We demonstrate the utility of the GNN approach by predicting in vitro activities and in vivo functions in the proline racemase superfamily (PRS; InterPro IPR008794). The predictions were verified by measuring in vitro activities for 51 proteins inmore » 12 families in the PRS that represent ~85% of the sequences; in vitro activities of pathway enzymes, carbon/nitrogen source phenotypes, and/or transcriptomic studies confirmed the predicted pathways. The synergistic use of sequence similarity networks3 and GNNs will facilitate the discovery of the components of novel, uncharacterized metabolic pathways in sequenced genomes.« less

Rapid evolutionary dynamics in a 2.8-Mb chromosomal region containing multiple prolamin and resistance gene families in Aegilops tauschii

USDA-ARS?s Scientific Manuscript database

The prolamin (seed storage proteins high in glutamine and proline) and resistance gene families are important in domesticated bread wheat (Triticum aestivum) food uses and in defense against pathogen attacks, respectively. To better understand the evolution of these multi-gene families, the DNA se...

A Novel WRKY Transcription Factor, MuWRKY3 (Macrotyloma uniflorum Lam. Verdc.) Enhances Drought Stress Tolerance in Transgenic Groundnut (Arachis hypogaea L.) Plants.

PubMed

Kiranmai, Kurnool; Lokanadha Rao, Gunupuru; Pandurangaiah, Merum; Nareshkumar, Ambekar; Amaranatha Reddy, Vennapusa; Lokesh, Uppala; Venkatesh, Boya; Anthony Johnson, A M; Sudhakar, Chinta

2018-01-01

Drought stress has adverse effects on growth, water relations, photosynthesis and yield of groundnut. WRKY transcription factors (TFs) are the plant-specific TFs which regulate several down-stream stress-responsive genes and play an essential role in plant biotic and abiotic stress responses. We found that WRKY3 gene is highly up-regulated under drought stress conditions and therefore isolated a new WRKY3TF gene from a drought-adapted horsegram ( Macrotyloma uniflorum Lam. Verdc.). Conserved domain studies revealed that protein encoded by this gene contains highly conserved regions of two WRKY domains and two C2H2 zinc-finger motifs. The fusion protein localization studies of transient MuWRKY 3-YFP revealed its nuclear localization. Overexpression of MuWRKY3 TF gene in groundnut ( Arachis hypogaea L.) showed increased tolerance to drought stress compared to wild-type (WT) plants. MuWRKY3 groundnut transgenics displayed lesser and delayed wilting symptoms than WT plants after 10-days of drought stress imposition. The transgenic groundnut plants expressing MuWRKY3 showed less accumulation of malondialdehyde, hydrogen peroxide (H 2 O 2 ), and superoxide anion (O 2 ∙- ), accompanied by more free proline, total soluble sugar content, and activities of antioxidant enzymes than WT plants under drought stress. Moreover, a series of stress-related LEA, HSP, MIPS, APX, SOD , and CAT genes found up-regulated in the transgenic groundnut plants. The study demonstrates that nuclear-localized MuWRKY3 TF regulates the expression of stress-responsive genes and the activity of ROS scavenging enzymes which results in improved drought tolerance in groundnut. We conclude that MuWRKY3 may serve as a new putative candidate gene for the improvement of stress resistance in plants.

A Novel WRKY Transcription Factor, MuWRKY3 (Macrotyloma uniflorum Lam. Verdc.) Enhances Drought Stress Tolerance in Transgenic Groundnut (Arachis hypogaea L.) Plants

PubMed Central

Kiranmai, Kurnool; Lokanadha Rao, Gunupuru; Pandurangaiah, Merum; Nareshkumar, Ambekar; Amaranatha Reddy, Vennapusa; Lokesh, Uppala; Venkatesh, Boya; Anthony Johnson, A. M.; Sudhakar, Chinta

2018-01-01

Drought stress has adverse effects on growth, water relations, photosynthesis and yield of groundnut. WRKY transcription factors (TFs) are the plant-specific TFs which regulate several down-stream stress-responsive genes and play an essential role in plant biotic and abiotic stress responses. We found that WRKY3 gene is highly up-regulated under drought stress conditions and therefore isolated a new WRKY3TF gene from a drought-adapted horsegram (Macrotyloma uniflorum Lam. Verdc.). Conserved domain studies revealed that protein encoded by this gene contains highly conserved regions of two WRKY domains and two C2H2 zinc-finger motifs. The fusion protein localization studies of transient MuWRKY3-YFP revealed its nuclear localization. Overexpression of MuWRKY3 TF gene in groundnut (Arachis hypogaea L.) showed increased tolerance to drought stress compared to wild-type (WT) plants. MuWRKY3 groundnut transgenics displayed lesser and delayed wilting symptoms than WT plants after 10-days of drought stress imposition. The transgenic groundnut plants expressing MuWRKY3 showed less accumulation of malondialdehyde, hydrogen peroxide (H2O2), and superoxide anion (O2∙-), accompanied by more free proline, total soluble sugar content, and activities of antioxidant enzymes than WT plants under drought stress. Moreover, a series of stress-related LEA, HSP, MIPS, APX, SOD, and CAT genes found up-regulated in the transgenic groundnut plants. The study demonstrates that nuclear-localized MuWRKY3 TF regulates the expression of stress-responsive genes and the activity of ROS scavenging enzymes which results in improved drought tolerance in groundnut. We conclude that MuWRKY3 may serve as a new putative candidate gene for the improvement of stress resistance in plants. PMID:29616059

Excystation of Eimeria tenella Sporozoites Impaired by Antibody Recognizing Gametocyte/Oocyst Antigens GAM22 and GAM56▿

PubMed Central

Krücken, Jürgen; Hosse, Ralf J.; Mouafo, Aimdip N.; Entzeroth, Rolf; Bierbaum, Stefan; Marinovski, Predrag; Hain, Karolina; Greif, Gisela; Wunderlich, Frank

2008-01-01

Eimeria tenella is the causative agent of coccidiosis in poultry. Infection of the chicken intestine begins with ingestion of sporulated oocysts releasing sporocysts, which in turn release invasive sporozoites. The monoclonal antibody E2E5 recognizes wall-forming body type II (WFBII) in gametocytes and the WFBII-derived inner wall of oocysts. Here we describe that this antibody also binds to the stieda body of sporocysts and significantly impairs in vitro excystation of sporozoites. Using affinity chromatography and protein sequence analysis, E2E5 is shown to recognize EtGAM56, the E. tenella ortholog of the Eimeria maxima gametocyte-specific GAM56 protein. In addition, this antibody was used to screen a genomic phage display library presenting E. tenella antigens as fusion proteins with the gene VIII product on the surfaces of phagemid particles and identified the novel 22-kDa histidine- and proline-rich protein EtGAM22. The Etgam22 mRNA is expressed predominantly at the gametocyte stage, as detected by Northern blotting. Southern blot analysis in combination with data from the E. tenella genome project revealed that Etgam22 is an intronless multicopy gene, with approximately 12 to 22 copies in head-to-tail arrangement. Conspicuously, Etgam56 is also intronless and is localized adjacent to another gam56-like gene, Etgam59. Our data suggest that amplification is common for genes encoding oocyst wall proteins. PMID:18083827

Excystation of Eimeria tenella sporozoites impaired by antibody recognizing gametocyte/oocyst antigens GAM22 and GAM56.

PubMed

Krücken, Jürgen; Hosse, Ralf J; Mouafo, Aimdip N; Entzeroth, Rolf; Bierbaum, Stefan; Marinovski, Predrag; Hain, Karolina; Greif, Gisela; Wunderlich, Frank

2008-02-01

Eimeria tenella is the causative agent of coccidiosis in poultry. Infection of the chicken intestine begins with ingestion of sporulated oocysts releasing sporocysts, which in turn release invasive sporozoites. The monoclonal antibody E2E5 recognizes wall-forming body type II (WFBII) in gametocytes and the WFBII-derived inner wall of oocysts. Here we describe that this antibody also binds to the stieda body of sporocysts and significantly impairs in vitro excystation of sporozoites. Using affinity chromatography and protein sequence analysis, E2E5 is shown to recognize EtGAM56, the E. tenella ortholog of the Eimeria maxima gametocyte-specific GAM56 protein. In addition, this antibody was used to screen a genomic phage display library presenting E. tenella antigens as fusion proteins with the gene VIII product on the surfaces of phagemid particles and identified the novel 22-kDa histidine- and proline-rich protein EtGAM22. The Etgam22 mRNA is expressed predominantly at the gametocyte stage, as detected by Northern blotting. Southern blot analysis in combination with data from the E. tenella genome project revealed that Etgam22 is an intronless multicopy gene, with approximately 12 to 22 copies in head-to-tail arrangement. Conspicuously, Etgam56 is also intronless and is localized adjacent to another gam56-like gene, Etgam59. Our data suggest that amplification is common for genes encoding oocyst wall proteins.

Expression of an Arabidopsis molybdenum cofactor sulphurase gene in soybean enhances drought tolerance and increases yield under field conditions.

PubMed

Li, Yajun; Zhang, Jiachang; Zhang, Juan; Hao, Ling; Hua, Jinping; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu

2013-08-01

LOS5/ABA3 gene encoding molybdenum cofactor sulphurase is involved in aldehyde oxidase (AO) activity in Arabidopsis, which indirectly regulates ABA biosynthesis and increased stress tolerance. Here, we used a constitutive super promoter to drive LOS5/ABA3 overexpression in soybean (Glycine max L.) to enhance drought tolerance in growth chamber and field conditions. Expression of LOS5/ABA3 was up-regulated by drought stress, which led to increasing AO activity and then a notable increase in ABA accumulation. Transgenic soybean under drought stress had reduced water loss by decreased stomatal aperture size and transpiration rate, which alleviated leaf wilting and maintained higher relative water content. Exposed to drought stress, transgenic soybean exhibited reduced cell membrane damage by reducing electrolyte leakage and production of malondialdehyde and promoting proline accumulation and antioxidant enzyme activities. Also, overexpression of LOS5/ABA3 enhanced expression of stress-up-regulated genes. Furthermore, the seed yield of transgenic plants is at least 21% higher than that of wide-type plants under drought stress conditions in the field. These data suggest that overexpression of LOS5/ABA3 could improve drought tolerance in transgenic soybean via enhanced ABA accumulation, which could activate expression of stress-up-regulated genes and cause a series of physiological and biochemical resistant responses. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

AZU-1: A Candidate Breast Tumor Suppressor and Biomarker for Tumor Progression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Huei-Mei; Schmeichel, Karen L; Mian, I. Saira

2000-02-04

To identify genes misregulated in the final stages of breast carcinogenesis, we performed differential display to compare the gene expression patterns of the human tumorigenic mammary epithelial cells, HMT-3522-T4-2, with those of their immediate premalignant progenitors, HMT-3522-S2. We identified a novel gene, called anti-zuai-1 (AZU-1), that was abundantly expressed in non- and premalignant cells and tissues but was appreciably reduced in breast tumor cell types and in primary tumors. The AZU-1 gene encodes an acidic 571-amino-acid protein containing at least two structurally distinct domains with potential protein-binding functions: an N-terminal serine and proline-rich domain with a predicted immunoglobulin-like fold andmore » a C-terminal coiled-coil domain. In HMT-3522 cells, the bulk of AZU-1 protein resided in a detergent-extractable cytoplasmic pool and was present at much lower levels in tumorigenic T4-2 cells than in their nonmalignant counterparts. Reversion of the tumorigenic phenotype of T4-2 cells, by means described previously, was accompanied by the up-regulation of AZU-1. In addition, reexpression of AZU-1 in T4-2 cells, using viral vectors, was sufficient to reduce their malignant phenotype substantially, both in culture and in vivo. These results indicate that AZU-1 is a candidate breast tumor suppressor that may exert its effects by promoting correct tissue morphogenesis.« less

Functional genomics of gam56: characterisation of the role of a 56 kilodalton sexual stage antigen in oocyst wall formation in Eimeria maxima.

PubMed

Belli, Sabina I; Witcombe, David; Wallach, Michael G; Smith, Nicholas C

2002-12-19

Gam56 (M(r) 56,000) is an antigen found in the sexual (macrogametocyte) stage of the intestinal parasite Eimeria maxima that is implicated in protective immunity. The gene (gam56) encoding this protein was cloned and sequenced. It is a single-copy, intronless gene, that localises to a 1,754 bp transcript, and is first detected at 120 h p.i. The gene predicts two distinct protein domains; a tyrosine-serine rich region, composed of amino acids implicated in oocyst wall formation in Eimeria spp., and a proline-methionine rich region often detected in extensins, protein components of plant cell walls. The tyrosine-serine rich region predicts a secondary structure commonly seen in the structural protein fibroin, a component of the cocoon of the caterpillar Bombyx mori. The inference that gam56 is a structural component of the oocyst wall was confirmed when a specific antibody to gam56 recognised the wall forming bodies in macrogametocytes, and the walls of oocysts and sporocysts. Together, these data identify a developmentally regulated, sexual stage gene in E. maxima that shares primary and secondary structure features in common with intrinsic structural proteins in other parasites such as Schistosoma mansoni and Fasciola hepatica, and other organisms across different phyla, including the caterpillar Bombyx mori. In addition, these findings provide evidence for the molecular mechanisms underlying oocyst wall formation in Eimeria and the role of gametocyte antigens in this process.

ABP9, a maize bZIP transcription factor, enhances tolerance to salt and drought in transgenic cotton.

PubMed

Wang, Chunling; Lu, Guoqing; Hao, Yuqiong; Guo, Huiming; Guo, Yan; Zhao, Jun; Cheng, Hongmei

2017-09-01

ABP9 , encoding a bZIP transcription factor from maize, enhances tolerance to multiple stresses and may participate in the ABA signaling pathway in transgenic cotton by altering physiological and biochemical processes and stress-related gene expression. Abiotic stresses, such as soil salinity and drought, negatively affect growth, development, and yield in cotton. Gene ABP9, which encodes a bZIP transcription factor, binds to the abscisic acid (ABA)-responsive-element (ABRE2) motif of the maize catalase1 gene. Its expression significantly improves tolerance in Arabidopsis to multiple abiotic stresses, but little is known about its role in cotton. In the present study, the ABP9 gene was introduced into upland cotton (Gossypium hirsutum L.) cultivar R15 by Agrobacterium tumefaciens-mediated transformation, and 12 independent transgenic cotton lines were obtained. Cotton plants over-expressing ABP9 have enhanced tolerance to salt and osmotic stress. Under stress, they developed better root systems in a greenhouse and higher germination, reduced stomatal aperture, and stomatal density in a growth chamber. Under drought conditions, survival rate and relative water content (RWC) of transgenic cotton were higher than those of R15 plants. Under salt and osmotic stresses, chlorophyll, proline, and soluble sugar contents significantly increased in transgenic cotton leaves and the malondialdehyde (MDA) content was lower than in R15. Overexpression of ABP9 also enhanced oxidative stress tolerance, reduced cellular levels of reactive oxygen species (ROS) through increased activities of antioxidative enzymes, and alleviated oxidative damage to cell. Interestingly, ABP9 over-expressing cotton was more sensitive to exogenous ABA than R15 at seed germination, root growth, stomatal aperture, and stomatal density. Moreover, ABP9 overexpression upregulated significantly the transcription levels of stress-related genes such as GhDBP2, GhNCED2, GhZFP1, GhERF1, GhHB1, and GhSAP1 under salt treatment. Conjointly, these results showed that overexpression of ABP9 conferred enhanced tolerance to multiple abiotic stresses in cotton. The stress-tolerant transgenic lines provide valuable resources for cotton breeding.

A 16 kb naturally occurring genomic deletion including mce and PPE genes in Mycobacterium avium subspecies paratuberculosis isolates from goats with Johne's disease.

PubMed

Castellanos, Elena; Aranaz, Alicia; de Juan, Lucia; Dominguez, Lucas; Linedale, Richard; Bull, Tim J

2012-09-14

In this study we characterise the genomic and transcriptomic variability of a natural deletion strain of Mycobacterium avium subspecies paratuberculosis (MAP) prevalent in Spanish Guadarrama goats. Using a pan-genome microarray including MAP and M. avium subspecies hominissuis 104 genomes (MAPAC) we demonstrate the genotype to be MAP Type II with a single deletion of 19 contiguous ORFs (16 kb) including a complete mammalian cell entry (mce7_1) operon and adjacent proline-glutamic acid (PE)/proline-proline-glutamic acid (PPE) genes. A deletion specific PCR test was developed and a subsequent screening identified four goat herds infected with the variant strain. Each was located in central Spain and showed epidemiological links suggestive of transmission between herds. A majority of animals infected with the variant manifested a paucibacillary form of the disease. Comparisons between virulent complete genome compliment strains isolated from multibacillary diseased goats and the MAP variant strain during entry into activated macrophages demonstrated an increased sensitivity in the variant to intracellular killing in human and ovine macrophages. As PPE and mce genes are associated with mycobacterial virulence and pathogenesis we investigated the interplay of these gene sets during cell entry using the MAPAC array. This showed significant differential transcriptome profiles compared to full genome complement MAP controls that included changes in other undeleted mce operons and PE/PPE genes, esx-like signalling operons and stress response/fatty acid metabolism pathways. This strain represents the first report of a MAP Type II genotype with significant natural genomic deletions which remains able to cause disease and is transmissible in goats. Copyright © 2012 Elsevier B.V. All rights reserved.

Physiological, biochemical and molecular responses in four Prunus rootstocks submitted to drought stress.

PubMed

Jiménez, Sergio; Dridi, Jihène; Gutiérrez, Diego; Moret, David; Irigoyen, Juan J; Moreno, María A; Gogorcena, Yolanda

2013-10-01

An understanding of the mechanisms that determine plant response to reduced water availability is essential to improve water-use efficiency (WUE) of stone fruit crops. The physiological, biochemical and molecular drought responses of four Prunus rootstocks (GF 677, Cadaman, ROOTPAC 20 and ROOTPAC(®) R) budded with 'Catherina' peach cultivar were studied. Trees were grown in 15-l containers and subjected to a progressive water stress for 26 days, monitoring soil moisture content by time domain reflectometry. Photosynthetic and gas exchange parameters were determined. Root and leaf soluble sugars and proline content were also measured. At the end of the experiment, stressed plants showed lower net photosynthesis rate, stomatal conductance and transpiration rate, and higher intrinsic leaf WUE (AN/gs). Soluble sugars and proline concentration changes were observed, in both root and leaf tissues, especially in an advanced state of stress. The accumulation of proline in roots and leaves with drought stress was related to the decrease in osmotic potential and increase in WUE, whereas the accumulation of sorbitol in leaves, raffinose in roots and proline in both tissues was related only to the increase in the WUE. Owing to the putative role of raffinose and proline as antioxidants and their low concentration, they could be ameliorating deleterious effects of drought-induced oxidative stress by protecting membranes and enzymes rather than acting as active osmolytes. Higher expression of P5SC gene in roots was also consistent with proline accumulation in the tolerant genotype GF 677. These results indicate that accumulation of sorbitol, raffinose and proline in different tissues and/or the increase in P5SC expression could be used as markers of drought tolerance in peach cultivars grafted on Prunus rootstocks.

Comparative transcriptome analysis of isonuclear-alloplasmic lines unmask key transcription factor genes and metabolic pathways involved in sterility of maize CMS-C

PubMed Central

Liu, Yongming; Liang, Bing; Guan, Shuxian; Lan, Hai; Wang, Jing; Lu, Yanli

2017-01-01

Although C-type cytoplasmic male sterility (CMS-C) is one of the most attractive tools for maize hybrid seed production, the detailed regulation network of the male sterility remains unclear. In order to identify the CMS-C sterility associated genes and/or pathways, the comparison of the transcriptomes between the CMS-C line C48-2 and its isonuclear-alloplasmic maintainer line N48-2 at pollen mother cell stage (PS), an early development stage of microspore, and mononuclear stage (MS), an abortive stage of microspore, were analyzed. 2,069 differentially expressed genes (DEGs) between the two stages were detected and thought to be essential for the spikelet development of N48-2. 453 of the 2,069 DEGs were differentially expressed at MS stage between the two lines and thought to be participated in the process or the causes of microspore abortion. Among the 453 DEGs, 385 (84.99%) genes were down-regulated and only 68 (15.01%) genes were up-regulated in C48-2 at MS stage. The dramatic decreased expression of the four DEGs encoding MYB transcription factors and the DEGs involved in “polyamine metabolic process”, “Cutin, suberine and wax biosynthesis”, “Fatty acid elongation”, “Biosynthesis of unsaturated fatty acids” and “Proline metabolism” might play an important role in the sterility of C48-2. This study will point out some directions for detailed molecular analysis and better understanding of sterility of CMS-C in maize. PMID:28584730

Prediction of cis/trans isomerization in proteins using PSI-BLAST profiles and secondary structure information.

PubMed

Song, Jiangning; Burrage, Kevin; Yuan, Zheng; Huber, Thomas

2006-03-09

The majority of peptide bonds in proteins are found to occur in the trans conformation. However, for proline residues, a considerable fraction of Prolyl peptide bonds adopt the cis form. Proline cis/trans isomerization is known to play a critical role in protein folding, splicing, cell signaling and transmembrane active transport. Accurate prediction of proline cis/trans isomerization in proteins would have many important applications towards the understanding of protein structure and function. In this paper, we propose a new approach to predict the proline cis/trans isomerization in proteins using support vector machine (SVM). The preliminary results indicated that using Radial Basis Function (RBF) kernels could lead to better prediction performance than that of polynomial and linear kernel functions. We used single sequence information of different local window sizes, amino acid compositions of different local sequences, multiple sequence alignment obtained from PSI-BLAST and the secondary structure information predicted by PSIPRED. We explored these different sequence encoding schemes in order to investigate their effects on the prediction performance. The training and testing of this approach was performed on a newly enlarged dataset of 2424 non-homologous proteins determined by X-Ray diffraction method using 5-fold cross-validation. Selecting the window size 11 provided the best performance for determining the proline cis/trans isomerization based on the single amino acid sequence. It was found that using multiple sequence alignments in the form of PSI-BLAST profiles could significantly improve the prediction performance, the prediction accuracy increased from 62.8% with single sequence to 69.8% and Matthews Correlation Coefficient (MCC) improved from 0.26 with single local sequence to 0.40. Furthermore, if coupled with the predicted secondary structure information by PSIPRED, our method yielded a prediction accuracy of 71.5% and MCC of 0.43, 9% and 0.17 higher than the accuracy achieved based on the singe sequence information, respectively. A new method has been developed to predict the proline cis/trans isomerization in proteins based on support vector machine, which used the single amino acid sequence with different local window sizes, the amino acid compositions of local sequence flanking centered proline residues, the position-specific scoring matrices (PSSMs) extracted by PSI-BLAST and the predicted secondary structures generated by PSIPRED. The successful application of SVM approach in this study reinforced that SVM is a powerful tool in predicting proline cis/trans isomerization in proteins and biological sequence analysis.

Characterisation of secretory calcium-binding phosphoprotein-proline-glutamine-rich 1: a novel basal lamina component expressed at cell-tooth interfaces.

PubMed

Moffatt, Pierre; Wazen, Rima M; Dos Santos Neves, Juliana; Nanci, Antonio

2014-12-01

Functional genomic screening of the rat enamel organ (EO) has led to the identification of a number of secreted proteins expressed during the maturation stage of amelogenesis, including amelotin (AMTN) and odontogenic ameloblast-associated (ODAM). In this study, we characterise the gene, protein and pattern of expression of a related protein called secretory calcium-binding phosphoprotein-proline-glutamine-rich 1 (SCPPPQ1). The Scpppq1 gene resides within the secretory calcium-binding phosphoprotein (Scpp) cluster. SCPPPQ1 is a highly conserved, 75-residue, secreted protein rich in proline, leucine, glutamine and phenylalanine. In silico data mining has revealed no correlation to any known sequences. Northern blotting of various rat tissues suggests that the expression of Scpppq1 is restricted to tooth and associated tissues. Immunohistochemical analyses show that the protein is expressed during the late maturation stage of amelogenesis and in the junctional epithelium where it localises to an atypical basal lamina at the cell-tooth interface. This discrete localisation suggests that SCPPPQ1, together with AMTN and ODAM, participates in structuring the basal lamina and in mediating attachment of epithelia cells to mineralised tooth surfaces.

Process optimization for enhancing production of cis-4-hydroxy-L-proline by engineered Escherichia coli.

PubMed

Chen, Kequan; Pang, Yang; Zhang, Bowen; Feng, Jiao; Xu, Sheng; Wang, Xin; Ouyang, Pingkai

2017-11-22

Understanding the bioprocess limitations is critical for the efficient design of biocatalysts to facilitate process feasibility and improve process economics. In this study, a proline hydroxylation process with recombinant Escherichia coli expressing L-proline cis-4-hydroxylase (SmP4H) was investigated. The factors that influencing the metabolism of microbial hosts and process economics were focused on for the optimization of cis-4-hydroxy-L-proline (CHOP) production. In recombinant E. coli, SmP4H synthesis limitation was observed. After the optimization of expression system, CHOP production was improved in accordance with the enhanced SmP4H synthesis. Furthermore, the effects of the regulation of proline uptake and metabolism on whole-cell catalytic activity were investigated. The improved CHOP production by repressing putA gene responsible for L-proline degradation or overexpressing L-proline transporter putP on CHOP production suggested the important role of substrate uptake and metabolism on the whole-cell biocatalyst efficiency. Through genetically modifying these factors, the biocatalyst activity was significantly improved, and CHOP production was increased by twofold. Meanwhile, to further improve process economics, a two-strain coupling whole-cell system was established to supply co-substrate (α-ketoglutarate, α-KG) with a cheaper chemical L-glutamate as a starting material, and 13.5 g/L of CHOP was successfully produced. In this study, SmP4H expression, and L-proline uptake and degradation, were uncovered as the hurdles for microbial production of CHOP. Accordingly, the whole-cell biocatalysts were metabolically engineered for enhancing CHOP production. Meanwhile, a two-strain biotransformation system for CHOP biosynthesis was developed aiming at supplying α-KG more economically. Our work provided valuable insights into the design of recombinant microorganism to improve the biotransformation efficiency that catalyzed by Fe(II)/α-KG-dependent dioxygenase.

Adaptation of an L-proline adenylation domain to use 4-propyl-L-proline in the evolution of lincosamide biosynthesis.

PubMed

Kadlčík, Stanislav; Kučera, Tomáš; Chalupská, Dominika; Gažák, Radek; Koběrská, Markéta; Ulanová, Dana; Kopecký, Jan; Kutejová, Eva; Najmanová, Lucie; Janata, Jiří

2013-01-01

Clinically used lincosamide antibiotic lincomycin incorporates in its structure 4-propyl-L-proline (PPL), an unusual amino acid, while celesticetin, a less efficient related compound, makes use of proteinogenic L-proline. Biochemical characterization, as well as phylogenetic analysis and homology modelling combined with the molecular dynamics simulation were employed for complex comparative analysis of the orthologous protein pair LmbC and CcbC from the biosynthesis of lincomycin and celesticetin, respectively. The analysis proved the compared proteins to be the stand-alone adenylation domains strictly preferring their own natural substrate, PPL or L-proline. The LmbC substrate binding pocket is adapted to accommodate a rare PPL precursor. When compared with L-proline specific ones, several large amino acid residues were replaced by smaller ones opening a channel which allowed the alkyl side chain of PPL to be accommodated. One of the most important differences, that of the residue corresponding to V306 in CcbC changing to G308 in LmbC, was investigated in vitro and in silico. Moreover, the substrate binding pocket rearrangement also allowed LmbC to effectively adenylate 4-butyl-L-proline and 4-pentyl-L-proline, substrates with even longer alkyl side chains, producing more potent lincosamides. A shift of LmbC substrate specificity appears to be an integral part of biosynthetic pathway adaptation to the PPL acquisition. A set of genes presumably coding for the PPL biosynthesis is present in the lincomycin--but not in the celesticetin cluster; their homologs are found in biosynthetic clusters of some pyrrolobenzodiazepines (PBD) and hormaomycin. Whereas in the PBD and hormaomycin pathways the arising precursors are condensed to another amino acid moiety, the LmbC protein is the first functionally proved part of a unique condensation enzyme connecting PPL to the specialized amino sugar building unit.

An Early Nodulin-Like Protein Accumulates in the Sieve Element Plasma Membrane of Arabidopsis1[OA

PubMed Central

Khan, Junaid A.; Wang, Qi; Sjölund, Richard D.; Schulz, Alexander; Thompson, Gary A.

2007-01-01

Membrane proteins within the sieve element-companion cell complex have essential roles in the physiological functioning of the phloem. The monoclonal antibody line RS6, selected from hybridomas raised against sieve elements isolated from California shield leaf (Streptanthus tortuosus; Brassicaceae) tissue cultures, recognizes an antigen in the Arabidopsis (Arabidopsis thaliana) ecotype Columbia that is associated specifically with the plasma membrane of sieve elements, but not companion cells, and accumulates at the earliest stages of sieve element differentiation. The identity of the RS6 antigen was revealed by reverse transcription-PCR of Arabidopsis leaf RNA using degenerate primers to be an early nodulin (ENOD)-like protein that is encoded by the expressed gene At3g20570. Arabidopsis ENOD-like proteins are encoded by a multigene family composed of several types of structurally related phytocyanins that have a similar overall domain structure of an amino-terminal signal peptide, plastocyanin-like copper-binding domain, proline/serine-rich domain, and carboxy-terminal hydrophobic domain. The amino- and carboxy-terminal domains of the 21.5-kD sieve element-specific ENOD are posttranslationally cleaved from the precursor protein, resulting in a mature peptide of approximately 15 kD that is attached to the sieve element plasma membrane via a carboxy-terminal glycosylphosphatidylinositol membrane anchor. Many of the Arabidopsis ENOD-like proteins accumulate in gametophytic tissues, whereas in both floral and vegetative tissues, the sieve element-specific ENOD is expressed only within the phloem. Members of the ENOD subfamily of the cupredoxin superfamily do not appear to bind copper and have unknown functions. Phenotypic analysis of homozygous T-DNA insertion mutants for the gene At3g20570 shows minimal alteration in vegetative growth but a significant reduction in the overall reproductive potential. PMID:17293437

An early nodulin-like protein accumulates in the sieve element plasma membrane of Arabidopsis.

PubMed

Khan, Junaid A; Wang, Qi; Sjölund, Richard D; Schulz, Alexander; Thompson, Gary A

2007-04-01

Membrane proteins within the sieve element-companion cell complex have essential roles in the physiological functioning of the phloem. The monoclonal antibody line RS6, selected from hybridomas raised against sieve elements isolated from California shield leaf (Streptanthus tortuosus; Brassicaceae) tissue cultures, recognizes an antigen in the Arabidopsis (Arabidopsis thaliana) ecotype Columbia that is associated specifically with the plasma membrane of sieve elements, but not companion cells, and accumulates at the earliest stages of sieve element differentiation. The identity of the RS6 antigen was revealed by reverse transcription-PCR of Arabidopsis leaf RNA using degenerate primers to be an early nodulin (ENOD)-like protein that is encoded by the expressed gene At3g20570. Arabidopsis ENOD-like proteins are encoded by a multigene family composed of several types of structurally related phytocyanins that have a similar overall domain structure of an amino-terminal signal peptide, plastocyanin-like copper-binding domain, proline/serine-rich domain, and carboxy-terminal hydrophobic domain. The amino- and carboxy-terminal domains of the 21.5-kD sieve element-specific ENOD are posttranslationally cleaved from the precursor protein, resulting in a mature peptide of approximately 15 kD that is attached to the sieve element plasma membrane via a carboxy-terminal glycosylphosphatidylinositol membrane anchor. Many of the Arabidopsis ENOD-like proteins accumulate in gametophytic tissues, whereas in both floral and vegetative tissues, the sieve element-specific ENOD is expressed only within the phloem. Members of the ENOD subfamily of the cupredoxin superfamily do not appear to bind copper and have unknown functions. Phenotypic analysis of homozygous T-DNA insertion mutants for the gene At3g20570 shows minimal alteration in vegetative growth but a significant reduction in the overall reproductive potential.

Amino acid substitutions of conserved residues in the carboxyl-terminal domain of the [alpha]I(X) chain of type X collagen occur in two unrelated families with metaphyseal chondrodysplasia type Schmid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallis, G.A.; Rash, B.; Sweetman, W.A.

1994-02-01

Type X collagen is a homotrimeric, short-chain, nonfibrillar extracellular-matrix component that is specifically and transiently synthesized by hypertrophic chondrocytes at the site of endochondral ossification. The precise function of type X collagen is not known, but its specific pattern of expression suggests that mutations within the encoding gene (COL10A1) that alter the structure or synthesis of the protein may cause heritable forms of chondrodysplasia. The authors used the PCR and the SSCP techniques to analyze the coding and upstream promoter regions of the COL10A1 gene in a number of individuals with forms of chondrodysplasia. Using this approach, they identified twomore » individuals with metaphyseal chondrodysplasia type Schmid (MCDS) with SSCP changes in the region of the gene encoding the carboxyl-terminal domain. Sequence analysis demonstrated that the individuals were heterozygous for two unique single-base-pair transitions that led to the substitution of the highly conserved amino acid residue tyrosine at position 598 by aspartic acid in one person and of leucine at position 614 by proline in the other. The substitution at residue 598 segregated with the phenotype in a family of eight (five affected and three unaffected) related persons. The substitutions at residue 614 occurred in a sporadically affected individual but not in her unaffected mother and brother. Additional members of this family were not available for further study. These results suggest that certain amino acid substitutions within the carboxyl-terminal domain of the chains of the type X collagen molecule cause MCDS. These amino acid substitutions are likely to alter either chain recognition or assembly of the type X collagen molecule, thereby depleting the amount of normal type X collagen deposited in the extracellular matrix, with consequent aberrations in bone growth and development. 36 refs., 5 figs.« less

Physiological and transcriptional responses of Catalpa bungei to drought stress under sufficient- and deficient-nitrogen conditions.

PubMed

Shi, Huili; Ma, Wenjun; Song, Junyu; Lu, Mei; Rahman, Siddiq Ur; Bui, Thi Tuyet Xuan; Vu, Dinh Duy; Zheng, Huifang; Wang, Junhui; Zhang, Yi

2017-11-01

Many semi-arid ecosystems are simultaneously limited by soil water and nitrogen (N). We conducted a greenhouse experiment to address how N availability impacts drought-resistant traits of Catalpa bungei C. A. Mey at the physiological and molecular level. A factorial design was used, consisting of sufficient-N and deficient-N combined with moderate drought and well-watered conditions. Seedling biomass and major root parameters were significantly suppressed by drought under the deficient-N condition, whereas N application mitigated the inhibiting effects of drought on root growth, particularly that of fine roots with a diameter <0.2 mm. Intrinsic water-use efficiency was promoted by N addition under both water conditions, whereas stable carbon isotope compositions (δ13C) was promoted by N addition only under the well-watered condition. Nitrogen application positively impacted drought adaptive responses including osmotic adjustment and homeostasis of reactive oxygen species, the content of free proline, soluble sugar and superoxide dismutase activity: all were increased upon drought under sufficient-N conditions but not under deficient-N conditions. The extent of abscisic acid (ABA) inducement upon drought was elevated by N application. Furthermore, an N-dependent crosstalk between ABA, jasmonic acid and indole acetic acid at the biosynthesis level contributed to better drought acclimation. Moreover, the transcriptional level of most genes responsible for the ABA signal transduction pathway, and genes encoding the antioxidant enzymes and plasma membrane intrinsic proteins, are elevated upon drought only under sufficient-N addition. These observations confirmed at the molecular level that major adaptive responses to drought are dependent on sufficient N nutrition. Although N uptake was decreased under drought, N-use efficiency and transcription of most genes encoding N metabolism enzymes were elevated, demonstrating that active N metabolism positively contributed drought resistance and growth of C. bungei under sufficient-N conditions. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Rare variant in scavenger receptor BI raises HDL cholesterol and increases risk of coronary heart disease.

PubMed

Zanoni, Paolo; Khetarpal, Sumeet A; Larach, Daniel B; Hancock-Cerutti, William F; Millar, John S; Cuchel, Marina; DerOhannessian, Stephanie; Kontush, Anatol; Surendran, Praveen; Saleheen, Danish; Trompet, Stella; Jukema, J Wouter; De Craen, Anton; Deloukas, Panos; Sattar, Naveed; Ford, Ian; Packard, Chris; Majumder, Abdullah al Shafi; Alam, Dewan S; Di Angelantonio, Emanuele; Abecasis, Goncalo; Chowdhury, Rajiv; Erdmann, Jeanette; Nordestgaard, Børge G; Nielsen, Sune F; Tybjærg-Hansen, Anne; Schmidt, Ruth Frikke; Kuulasmaa, Kari; Liu, Dajiang J; Perola, Markus; Blankenberg, Stefan; Salomaa, Veikko; Männistö, Satu; Amouyel, Philippe; Arveiler, Dominique; Ferrieres, Jean; Müller-Nurasyid, Martina; Ferrario, Marco; Kee, Frank; Willer, Cristen J; Samani, Nilesh; Schunkert, Heribert; Butterworth, Adam S; Howson, Joanna M M; Peloso, Gina M; Stitziel, Nathan O; Danesh, John; Kathiresan, Sekar; Rader, Daniel J

2016-03-11

Scavenger receptor BI (SR-BI) is the major receptor for high-density lipoprotein (HDL) cholesterol (HDL-C). In humans, high amounts of HDL-C in plasma are associated with a lower risk of coronary heart disease (CHD). Mice that have depleted Scarb1 (SR-BI knockout mice) have markedly elevated HDL-C levels but, paradoxically, increased atherosclerosis. The impact of SR-BI on HDL metabolism and CHD risk in humans remains unclear. Through targeted sequencing of coding regions of lipid-modifying genes in 328 individuals with extremely high plasma HDL-C levels, we identified a homozygote for a loss-of-function variant, in which leucine replaces proline 376 (P376L), in SCARB1, the gene encoding SR-BI. The P376L variant impairs posttranslational processing of SR-BI and abrogates selective HDL cholesterol uptake in transfected cells, in hepatocyte-like cells derived from induced pluripotent stem cells from the homozygous subject, and in mice. Large population-based studies revealed that subjects who are heterozygous carriers of the P376L variant have significantly increased levels of plasma HDL-C. P376L carriers have a profound HDL-related phenotype and an increased risk of CHD (odds ratio = 1.79, which is statistically significant). Copyright © 2016, American Association for the Advancement of Science.

Characterization of recombinant prolyl aminopeptidase from Aspergillus oryzae.

PubMed

Matsushita-Morita, M; Furukawa, I; Suzuki, S; Yamagata, Y; Koide, Y; Ishida, H; Takeuchi, M; Kashiwagi, Y; Kusumoto, K-I

2010-07-01

Prolyl aminopeptidase (PAP) degrades only amino-terminal proline from peptides. The food-grade fungus Aspergillus oryzae produces this enzyme only in small amounts. In this paper, we present efficient production of recombinant PAP with an overexpression system of A. oryzae and characterization of its biochemical properties. The gene encoding PAP was overexpressed as a His-tag fusion protein under a taka-amylase gene (amyB) promoter with a limited expressing condition in A. oryzae. The PAP activity in the mycelia grown in rich medium containing glucose (repressing condition) was twice that in starch (inducing condition). The enzyme prepared as cell-free extract was partially purified through two-step column chromatography. The PAP was estimated to be a hexameric protein and exhibited salt tolerance against NaCl of up to 4 mol l(-1). Aspergillus oryzae PAP was produced under the repressing condition of amyB promoter in a PAP-overexpressing strain and purified 1800-folds. Overproduction of PAP under promoter-inducing conditions led to an increase in inactive PAP, possibly because of irregular folding. PAP with a high specific activity and salt tolerance may be used effectively in the manufacturing processes of fermented foods. Journal compilation © 2009 The Society for Applied Microbiology. No claim to Japanese Government works.

A novel missense mutation p.L76P in the GJB2 gene causing nonsyndromic recessive deafness in a Brazilian family.

PubMed

Batissoco, A C; Auricchio, M T B M; Kimura, L; Tabith-Junior, A; Mingroni-Netto, R C

2009-02-01

Mutations in the GJB2 gene, encoding connexin 26 (Cx26), are a major cause of nonsyndromic recessive hearing loss in many countries. We report here on a novel point mutation in GJB2, p.L76P (c.227C>T), in compound heterozygosity with a c.35delG mutation, in two Brazilian sibs, one presenting mild and the other profound nonsyndromic neurosensorial hearing impairment. Their father, who carried a wild-type allele and a p.L76P mutation, had normal hearing. The mutation leads to the substitution of leucine (L) by proline (P) at residue 76, an evolutionarily conserved position in Cx26 as well as in other connexins. This mutation is predicted to affect the first extracellular domain (EC1) or the second transmembrane domain (TM2). EC1 is important for connexon-connexon interaction and for the control of channel voltage gating. The segregation of the c.227C>T (p.L76P) mutation together with c.35delG in this family indicates a recessive mode of inheritance. The association between the p.L76P mutation and hearing impairment is further supported by its absence in a normal hearing control group of 100 individuals, 50 European-Brazilians and 50 African-Brazilians.

A nonsense mutation of PEPD in four Amish children with prolidase deficiency.

PubMed

Wang, Heng; Kurien, Biji T; Lundgren, David; Patel, Nisha C; Kaufman, K M; Miller, David L; Porter, Andrew C; D'Souza, Anil; Nye, Leah; Tumbush, John; Hupertz, Vera; Kerr, Douglas S; Kurono, S; Matsumoto, H; Scofield, R Hal

2006-03-15

Encoded by the peptidase D (PEPD) gene located at 19q12-q13.11, prolidase is a ubiquitous cytosolic enzyme that catalyzes hydrolysis of oligopeptides with a C-terminal proline or hydroxyproline. We describe here four Amish children with a severe phenotype of prolidase deficiency in the Geauga settlements of Ohio as the first report of prolidase deficiency in the Amish population as well as in the United States. The patients presented with infection, hepatosplenomegaly, or thrombocytopenia, in contrast to most cases previously reported in the literature, presenting with skin ulcers. All four patients had typical facial features, classic skin ulcers, and multisystem involvement. Recurrent infections, asthma-like chronic reactive airway disease, hyperimmunoglobulins, hepatosplenomegaly with mildly elevated aspartate transaminase (AST), anemia, and thrombocytopenia were common and massive imidodipeptiduria was universal. Prolidase activity in our patients is nearly undetectable. Direct sequencing of PCR-amplified genomic DNA for all of the exons from the four patients revealed the same homozygous single nucleotide mutation c.793 T > C in exon 11, resulting in a premature stop-codon at amino acid residue 265 (p.R265X). It is speculated that the severe phenotype in these patients might be associated with the type of the PEPD gene mutation. 2006 Wiley-Liss, Inc.

Molecular cloning and characterization of an Hsp90/70 organizing protein gene from Frankliniella occidentalis (Insecta: Thysanoptera, Thripidae).

PubMed

Li, Hong-Bo; Du, Yu-Zhou

2013-05-15

The heat shock 90/70 organizing protein (Hop), also known as Sti-1 (stress-induced protein-1), is a co-chaperone that usually mediates the interaction of Hsp90 and Hsp70 and has been extensively characterized in mammals and plants. However, its role in insects remains unknown. In the present study, we isolated and characterized a Hop homologue gene from Frankliniella occidentalis (Fohop). The Fohop contains a 1659bp ORF encoding a protein of 552 amino acids with a caculated molecular mass of approximately 62.25kDa, which displays a reasonable degree of identity with the known Hops and shares several canonical motifs, including three tetratricopeptide repeated motif domains (TPR1, TPR2A and TPR2B) and two aspartic acid-proline (DP) repeat motifs (DP1 and DP2). As in other hops, Fohop contains introns, but the number and the position are quite variable. The mRNA expression patterns indicated that Fohop was constitutively expressed throughout the developmental stages, but was obviously upregulated by heat stress both in larvae and adults. Our studies imply that Hop, as in other Hsps, may play an important role in heat shock response of F. occidentalis. Copyright © 2013 Elsevier B.V. All rights reserved.

ThPP1 gene, encodes an inorganic pyrophosphatase in Thellungiella halophila, enhanced the tolerance of the transgenic rice to alkali stress.

PubMed

He, Rui; Yu, Guohong; Han, Xiaori; Han, Jiao; Li, Wei; Wang, Bing; Huang, Shengcai; Cheng, Xianguo

2017-12-01

An inorganic pyrophosphorylase gene, ThPP1 , modulated the accumulations of phosphate and osmolytes by up-regulating the differentially expression genes, thus enhancing the tolerance of the transgenic rice to alkali stress (AS). Inorganic pyrophosphorylase is essential in catalyzing the hydrolysis of pyrophosphate to inorganic phosphate during plant growth. Here, we report the changes of physiological osmolytes and differentially expression genes in the transgenic rice overexpressing a soluble inorganic pyrophosphatase gene ThPP1 of Thellungiella halophila in response to AS. Analyses showed that the ThPP1 gene was a PPase family I member which is located to the cytoplasm. Data showed that the transgenic lines revealed an enhanced tolerance to AS compared to the wild type, and effectively increased the accumulations of inorganic phosphate and organic small molecules starch, sucrose, proline and chlorophyll, and maintained the balance of osmotic potential by modulating the ratio of Na + /K + in plant cells. Under AS, total 379 of differentially expression genes were up-regulated in the leaves of the transgenic line compared with control, and the enhanced tolerance of the transgenic rice to the AS seemed to be associated with the up-regulations of the osmotic stress-related genes such as the L-type lectin-domain containing receptor kinase (L-type LecRK), the cation/H + antiporter gene and the vacuolar cation/proton exchanger 1 gene (CAX1), which conferred the involvements in the biosynthesis and metabolic pathways. Protein interaction showed that the ThPP1 protein specifically interacted with a 16# target partner of the photosystem II light-harvesting-Chl-binding protein. This study suggested that the ThPP1 gene plays an important regulatory role in conferring the tolerance of the transgenic rice to AS, and is an effective candidate in molecular breeding for crop cultivation of the alkali tolerance.

Draft genome sequence of Dethiosulfovibrio salsuginis DSM 21565T an anaerobic, slightly halophilic bacterium isolated from a Colombian saline spring.

PubMed

Díaz-Cárdenas, Carolina; López, Gina; Alzate-Ocampo, José David; González, Laura N; Shapiro, Nicole; Woyke, Tanja; Kyrpides, Nikos C; Restrepo, Silvia; Baena, Sandra

2017-01-01

A bacterium belonging to the phylum Synergistetes , genus Dethiosulfovibrio was isolated in 2007 from a saline spring in Colombia. Dethiosulfovibrio salsuginis USBA 82 T ( DSM 21565 T = KCTC 5659 T ) is a mesophilic, strictly anaerobic, slightly halophilic, Gram negative bacterium with a diderm cell envelope. The strain ferments peptides, amino acids and a few organic acids. Here we present the description of the complete genome sequencing and annotation of the type species Dethiosulfovibrio salsuginis USBA 82 T . The genome consisted of 2.68 Mbp with a 53.7% G + C . A total of 2609 genes were predicted and of those, 2543 were protein coding genes and 66 were RNA genes. We detected in USBA 82 T genome six Synergistetes conserved signature indels (CSIs), specific for Jonquetella, Pyramidobacter and Dethiosulfovibrio . The genome of D. salsuginis contained, as expected, genes related to amino acid transport, amino acid metabolism and thiosulfate reduction. These genes represent the major gene groups of Synergistetes , related with their phenotypic traits, and interestingly, 11.8% of the genes in the genome belonged to the amino acid fermentation COG category. In addition, we identified in the genome some ammonification genes such as nitrate reductase genes. The presence of proline operon genes could be related to de novo synthesis of proline to protect the cell in response to high osmolarity. Our bioinformatics workflow included antiSMASH and BAGEL3 which allowed us to identify bacteriocins genes in the genome.

Biosynthesis of coral settlement cue tetrabromopyrrole in marine bacteria by a uniquely adapted brominase–thioesterase enzyme pair

PubMed Central

El Gamal, Abrahim; Agarwal, Vinayak; Diethelm, Stefan; Rahman, Imran; Schorn, Michelle A.; Sneed, Jennifer M.; Louie, Gordon V.; Whalen, Kristen E.; Mincer, Tracy J.; Noel, Joseph P.; Paul, Valerie J.; Moore, Bradley S.

2016-01-01

Halogenated pyrroles (halopyrroles) are common chemical moieties found in bioactive bacterial natural products. The halopyrrole moieties of mono- and dihalopyrrole-containing compounds arise from a conserved mechanism in which a proline-derived pyrrolyl group bound to a carrier protein is first halogenated and then elaborated by peptidic or polyketide extensions. This paradigm is broken during the marine pseudoalteromonad bacterial biosynthesis of the coral larval settlement cue tetrabromopyrrole (1), which arises from the substitution of the proline-derived carboxylate by a bromine atom. To understand the molecular basis for decarboxylative bromination in the biosynthesis of 1, we sequenced two Pseudoalteromonas genomes and identified a conserved four-gene locus encoding the enzymes involved in its complete biosynthesis. Through total in vitro reconstitution of the biosynthesis of 1 using purified enzymes and biochemical interrogation of individual biochemical steps, we show that all four bromine atoms in 1 are installed by the action of a single flavin-dependent halogenase: Bmp2. Tetrabromination of the pyrrole induces a thioesterase-mediated offloading reaction from the carrier protein and activates the biosynthetic intermediate for decarboxylation. Insights into the tetrabrominating activity of Bmp2 were obtained from the high-resolution crystal structure of the halogenase contrasted against structurally homologous halogenase Mpy16 that forms only a dihalogenated pyrrole in marinopyrrole biosynthesis. Structure-guided mutagenesis of the proposed substrate-binding pocket of Bmp2 led to a reduction in the degree of halogenation catalyzed. Our study provides a biogenetic basis for the biosynthesis of 1 and sets a firm foundation for querying the biosynthetic potential for the production of 1 in marine (meta)genomes. PMID:27001835

Stability and function of interdomain linker variants of glucoamylase 1 from Aspergillus niger.

PubMed

Sauer, J; Christensen, T; Frandsen, T P; Mirgorodskaya, E; McGuire, K A; Driguez, H; Roepstorff, P; Sigurskjold, B W; Svensson, B

2001-08-07

Several variants of glucoamylase 1 (GA1) from Aspergillus niger were created in which the highly O-glycosylated peptide (aa 468--508) connecting the (alpha/alpha)(6)-barrel catalytic domain and the starch binding domain was substituted at the gene level by equivalent segments of glucoamylases from Hormoconis resinae, Humicola grisea, and Rhizopus oryzae encoding 5, 19, and 36 amino acid residues. Variants were constructed in which the H. resinae linker was elongated by proline-rich sequences as this linker itself apparently was too short to allow formation of the corresponding protein variant. Size and isoelectric point of GA1 variants reflected differences in linker length, posttranslational modification, and net charge. While calculated polypeptide chain molecular masses for wild-type GA1, a nonnatural proline-rich linker variant, H. grisea, and R. oryzae linker variants were 65,784, 63,777, 63,912, and 65,614 Da, respectively, MALDI-TOF-MS gave values of 82,042, 73,800, 73,413, and 90,793 Da, respectively, where the latter value could partly be explained by an N-glycosylation site introduced near the linker C-terminus. The k(cat) and K(m) for hydrolysis of maltooligodextrins and soluble starch, and the rate of hydrolysis of barley starch granules were essentially the same for the variants as for wild-type GA1. beta-Cyclodextrin, acarbose, and two heterobidentate inhibitors were found by isothermal titration calorimetry to bind to the catalytic and starch binding domains of the linker variants, indicating that the function of the active site and the starch binding site was maintained. The stability of GA1 linker variants toward GdnHCl and heat, however, was reduced compared to wild-type.

Physiological performance and differential expression profiling of genes associated with drought tolerance in contrasting varieties of two Gossypium species.

PubMed

Singh, Ruchi; Pandey, Neha; Naskar, Jishnu; Shirke, Pramod A

2015-03-01

Cotton is mostly cultivated under rain-fed conditions in India, thus faces frequent drought conditions during its life cycle. Drought being a major stress factor responsible for yield penalty, there has always been a high priority to generate knowledge on adaptation and tolerance of cotton. In the present study, four cotton varieties, JKC-770 and KC-2 (Gossypium hirsutum), and JKC-717 and RAHS-187(Gossypium herbaceum), were imposed to drought. Under drought condition, differential changes in physiological characters like net photosynthesis, transpiration, stomatal conductance, chlorophyll fluorescence, relative water content (RWC), and predawn water potential (ψ 0) showed a change. While proline, malondialdehyde (MDA), and glutathione-S-transferase (GST) content increased along with a concomitant change in the expression of their associated genes. Under moderate stress, tolerant varieties maintain lower ψ 0 probably due to higher proline content as compared to sensitive varieties. Cyclic electron flow (CEF) also plays an important role in tolerance under mild water stress in G. hirsutum varieties. CEF not only activates at high light but also initiates at a very low light intensity. Expression analysis of genes reveals that drought-tolerant varieties showed enhanced detoxifying mechanism by up-regulation of asparagine synthase (AS), glutathione-S-transferase (GST), and methyl glyoxalase (GlyI) genes under drought stress. Up-regulation of Δ(1)-pyrroline-5-carboxylase synthase (Δ(1)P5CS) enhanced accumulation of proline, an osmolyte, under drought in tolerant varieties. While the drought-sensitive varieties showed up-regulation of ethylene responsive factor (ERF) and down-regulation of WRKY70 responsible for senescence of the leaf which correlated well with the high rate of leaf fall in sensitive varieties under water stress.

Functional Characterization of Cotton GaMYB62L, a Novel R2R3 TF in Transgenic Arabidopsis

PubMed Central

Butt, Hamama Islam; Yang, Zhaoen; Chen, Eryong; Zhao, Ge; Gong, Qian; Yang, Zuoren; Zhang, Xueyan

2017-01-01

Drought stress can trigger the production of ABA in plants, in response to adverse conditions, which induces the transcript of stress-related marker genes. The R2R3 MYB TFs are implicated in regulation of various plants developmental, metabolic and multiple environmental stress responses. Here, a R2R3-MYB cloned gene, GaMYB62L, was transformed in Arabidopsis and was functionally characterized. The GaMYB62L protein contains two SANT domains with a conserved R2R3 imperfect repeats. The GaMYB62L cDNA is 1,017 bp with a CDS of 879, encodes a 292-residue polypeptide with MW of 38.78 kD and a pI value of 8.91. Overexpressed GaMYB62L transgenic Arabidopsis have increased proline and chlorophyll content, superior seed germination rate under salt and osmotic stress, less water loss rate with reduced stomatal apertures, high drought avoidance as compared to WT on water deprivation and also significant plant survival rates at low temperature. In addition, overexpressed GaMYB62L lines were more sensitive to ABA mediated germination and root elongation assay. Moreover, ABA induced GaMYB62L overexpression, enhanced the expression of ABA stress related marker genes like RD22, COR15A, ADH1, and RD29A. Together, overexpression of GaMYB62L suggested having developed better drought, salt and cold tolerance in transgenic Arabidopsis and thus presented it as a prospective candidate gene to achieve better abiotic stress tolerance in cotton crop. PMID:28125637

Pyoderma gangrenosum, acne and ulcerative colitis in a patient with a novel mutation in the PSTPIP1 gene.

PubMed

Zeeli, T; Padalon-Brauch, G; Ellenbogen, E; Gat, A; Sarig, O; Sprecher, E

2015-06-01

Pyogenic sterile arthritis, pyoderma gangrenosum and acne (PAPA) syndrome is a rare hereditary, autosomal dominant, auto-inflammatory disease caused by mutations in the PSTPIP1 gene, which encodes proline-serine-threonine phosphatase interacting protein 1. The fact that PSTPIP1 is involved in immune regulation provides a rationale for treatment of this rare disease with interleukin (IL)-1 signalling blocking agents. We investigated a 33-year-old man with a long-standing history of ulcerative colitis, severe acne and recurrent skin ulcerations, and a 3-year history of a recalcitrant pustular rash. We used direct sequencing to search for mutations in the PSTPIP1 gene. Examination of biopsies obtained from pustules and skin ulcers revealed folliculitis and ulceration with a diffuse neutrophilic dermal infiltrate, consistent with a diagnosis of pyoderma gangrenosum. Because of the known association of acne and pyoderma gangrenosum in PAPA syndrome, we determined the entire coding sequence of the PSTPIP1 gene, and identified a hitherto unreported heterozygous mutation predicted to alter a highly conserved residue (p.G403R) and to be damaging to the protein function. Based on this finding, we initiated treatment with a human IL-1 receptor antagonist, anakinra, which led to a dramatic improvement in the patient's condition. We describe a novel mutation in PSTPIP1 resulting in pyoderma gangrenosum, acne and ulcerative colitis. This novel constellation of clinical manifestations, which we term 'PAC syndrome', suggests the need to regroup all PSTPIP1-associated phenotypes under one aetiological group. © 2015 British Association of Dermatologists.

Organization of the qa Gene Cluster in NEUROSPORA CRASSA: Direction of Transcription of the qa-3 Gene

PubMed Central

Strøman, Per; Reinert, William; Case, Mary E.; Giles, Norman H.

1979-01-01

In Neurospora crassa, the enzyme quinate (shikimate) dehydrogenase catalyzes the first reaction in the inducible quinic acid catabolic pathway and is encoded in the qa-3 gene of the qa cluster. In this cluster, the order of genes has been established as qa-1 qa-3 qa-4 qa-2. Amino-terminal sequences have been determined for purified quinate dehydrogenase from wild type and from UV-induced revertants in two different qa-3 mutants. These two mutants (M16 and M45) map at opposite ends of the qa-3 locus. In addition, mapping data (Case et al. 1978) indicate that the end of the qa-3 gene specified by M45 is closer to the adjacent qa-1 gene than is the end specified by the M16 mutant site. In one of the revertants (R45 from qa-3 mutant M45), the aminoterminal sequence for the first ten amino acids is identical to that of wild type. The other revertant (R1 from qa-3 mutant M16) differs from wild type at the amino-terminal end by a single altered residue at position three in the sequence. The observed change involves the substitution of an isoleucine in M16-R1 for a proline in wild type. This substitution requires a two-nucleotide change in the corresponding wild-type codon.——The combined genetic and biochemical data indicate that the qa-3 mutants M16 and M45 carry amino acid substitutions near the amino-terminal and carboxyl-terminal ends of the quinate dehydrogenase enzyme, respectively. On this basis we conclude that transcription of the qa-3 gene proceeds from the end specified by the M16 mutant site in the direction of the qa-1 gene. It appears probable that transcription is initiated from a promoter site within the qa cluster, possibly immediately adjacent to the qa-3 gene. PMID:159203

Transplacental exposure to inorganic arsenic at a hepatocarcinogenic dose induces fetal gene expression changes in mice indicative of aberrant estrogen signaling and disrupted steroid metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Jie; Xie Yaxiong; Cooper, Ryan

Exposure to inorganic arsenic in utero in C3H mice produces hepatocellular carcinoma in male offspring when they reach adulthood. To help define the molecular events associated with the fetal onset of arsenic hepatocarcinogenesis, pregnant C3H mice were given drinking water containing 0 (control) or 85 ppm arsenic from day 8 to 18 of gestation. At the end of the arsenic exposure period, male fetal livers were removed and RNA isolated for microarray analysis using 22K oligo chips. Arsenic exposure in utero produced significant (p < 0.001) alterations in expression of 187 genes, with approximately 25% of aberrantly expressed genes relatedmore » to either estrogen signaling or steroid metabolism. Real-time RT-PCR on selected genes confirmed these changes. Various genes controlled by estrogen, including X-inactive-specific transcript, anterior gradient-2, trefoil factor-1, CRP-ductin, ghrelin, and small proline-rich protein-2A, were dramatically over-expressed. Estrogen-regulated genes including cytokeratin 1-19 and Cyp2a4 were over-expressed, although Cyp3a25 was suppressed. Several genes involved with steroid metabolism also showed remarkable expression changes, including increased expression of 17{beta}-hydroxysteroid dehydrogenase-7 (HSD17{beta}7; involved in estradiol production) and decreased expression of HSD17{beta}5 (involved in testosterone production). The expression of key genes important in methionine metabolism, such as methionine adenosyltransferase-1a, betaine-homocysteine methyltransferase and thioether S-methyltransferase, were suppressed. Thus, exposure of mouse fetus to inorganic arsenic during a critical period in development significantly alters the expression of various genes encoding estrogen signaling and steroid or methionine metabolism. These alterations could disrupt genetic programming at the very early life stage, which could impact tumor formation much later in adulthood.« less

A novel cold-adapted and highly salt-tolerant esterase from Alkalibacterium sp. SL3 from the sediment of a soda lake

PubMed Central

Wang, Guozeng; Wang, Qiaohuang; Lin, Xianju; Bun Ng, Tzi; Yan, Renxiang; Lin, Juan; Ye, Xiuyun

2016-01-01

A novel esterase gene (estSL3) was cloned from the Alkalibacterium sp. SL3, which was isolated from the sediment of soda lake Dabusu. The 636-bp full-length gene encodes a polypeptide of 211 amino acid residues that is closely related with putative GDSL family lipases from Alkalibacterium and Enterococcus. The gene was successfully expressed in E. coli, and the recombinant protein (rEstSL3) was purified to electrophoretic homogeneity and characterized. rEstSL3 exhibited the highest activity towards pNP-acetate and had no activity towards pNP-esters with acyl chains longer than C8. The enzyme was highly cold-adapted, showing an apparent temperature optimum of 30 °C and remaining approximately 70% of the activity at 0 °C. It was active and stable over the pH range from 7 to 10, and highly salt-tolerant up to 5 M NaCl. Moreover, rEstSL3 was strongly resistant to most tested metal ions, chemical reagents, detergents and organic solvents. Amino acid composition analysis indicated that EstSL3 had fewer proline residues, hydrogen bonds and salt bridges than mesophilic and thermophilic counterparts, but more acidic amino acids and less hydrophobic amino acids when compared with other salt-tolerant esterases. The cold active, salt-tolerant and chemical-resistant properties make it a promising enzyme for basic research and industrial applications. PMID:26915906

Mutational analysis of FUS gene and its structural and functional role in amyotrophic lateral sclerosis 6.

PubMed

Kamaraj, Balu; Rajendran, Vidya; Sethumadhavan, Rao; Kumar, Chundi Vinay; Purohit, Rituraj

2015-01-01

Amyotrophic lateral sclerosis 6 (ALS6) is an autosomal recessive disorder caused by heterozygous mutation in the Fused in Sarcoma (FUS) gene. ALS6 is a neurodegenerative disorder, which affects the upper and lower motor neurons in the brain and spinal cord, resulting in fatal paralysis. ALS6 is caused by the genetic mutation in the proline/tyrosine-nuclear localization signals of the Fused in sarcoma Protein (FUS). FUS gene also known as TLS (Translocated in liposarcoma), which encodes a protein called RNA-binding protein-Fus (FUS), has a molecular weight of 75 kDa. In this analysis, we applied computational approach to filter the most deleterious and neurodegenerative disease of ALS6-associated mutation on FUS protein. We found H517Q as most deleterious and disease associated using PolyPhen 2.0, I-Mutant 3.0, SIFT, SNPs&GO, PhD-SNP, Pmut, and Mutpred tools. Molecular dynamics simulation (MDS) approach was conducted to investigate conformational changes in the mutant protein structure with respect to its native conformation. MDS results showed the flexibility loss in mutant (H517Q) FUS protein. Due to mutation, FUS protein became more rigid in nature and might alter the structural and functional behavior of protein and play a major role in inducing ALS6. The results obtained from this investigation would help in the field of pharmacogenomics to develop a potent drug target against FUS-associated neurodegenerative diseases.

Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 1 Nef Proteins Show Distinct Patterns and Mechanisms of Src Kinase Activation

PubMed Central

Greenway, Alison L.; Dutartre, Hélène; Allen, Kelly; McPhee, Dale A.; Olive, Daniel; Collette, Yves

1999-01-01

The nef gene from human and simian immunodeficiency viruses (HIV and SIV) regulates cell function and viral replication, possibly through binding of the nef product to cellular proteins, including Src family tyrosine kinases. We show here that the Nef protein encoded by SIVmac239 interacts with and also activates the human Src kinases Lck and Hck. This is in direct contrast to the inhibitory effect of HIV type 1 (HIV-1) Nef on Lck catalytic activity. Unexpectedly, however, the interaction of SIV Nef with human Lck or Hck is not mediated via its consensus proline motif, which is known to mediate HIV-1 Nef binding to Src homology 3 (SH3) domains, and various experimental analyses failed to show significant interaction of SIV Nef with the SH3 domain of either kinase. Instead, SIV Nef can bind Lck and Hck SH2 domains, and its N-terminal 50 amino acid residues are sufficient for Src kinase binding and activation. Our results provide evidence for multiple mechanisms by which Nef binds to and regulates Src kinases. PMID:10364375

Co-expression of P173S Mutant Rice EPSPS and igrA Genes Results in Higher Glyphosate Tolerance in Transgenic Rice

PubMed Central

Fartyal, Dhirendra; Agarwal, Aakrati; James, Donald; Borphukan, Bhabesh; Ram, Babu; Sheri, Vijay; Yadav, Renu; Manna, Mrinalini; Varakumar, Panditi; Achary, V. Mohan M.; Reddy, Malireddy K.

2018-01-01

Weeds and their devastating effects have been a great threat since the start of agriculture. They compete with crop plants in the field and negatively influence the crop yield quality and quantity along with survival of the plants. Glyphosate is an important broad-spectrum systemic herbicide which has been widely used to combat various weed problems since last two decades. It is very effective even at low concentrations, and possesses low environmental toxicity and soil residual activity. However, the residual concentration of glyphosate inside the plant has been of major concern as it severely affects the important metabolic pathways, and results in poor plant growth and grain yield. In this study, we compared the glyphosate tolerance efficiency of two different transgenic groups over expressing proline/173/serine (P173S) rice EPSPS glyphosate tolerant mutant gene (OsmEPSPS) alone and in combination with the glyphosate detoxifying encoding igrA gene, recently characterized from Pseudomonas. The molecular analysis of all transgenic plant lines showed a stable integration of transgenes and their active expression in foliar tissues. The physiological analysis of glyphosate treated transgenic lines at seed germination and vegetative stages showed a significant difference in glyphosate tolerance between the two transgenic groups. The transgenic plants with OsmEPSPS and igrA genes, representing dual glyphosate tolerance mechanisms, showed an improved root-shoot growth, physiology, overall phenotype and higher level of glyphosate tolerance compared to the OsmEPSPS transgenic plants. This study highlights the advantage of igrA led detoxification mechanism as a crucial component of glyphosate tolerance strategy in combination with glyphosate tolerant OsmEPSPS gene, which offered a better option to tackle in vivo glyphosate accumulation and imparted more robust glyphosate tolerance in rice transgenic plants. PMID:29487608

Overexpression of a Cytosolic Abiotic Stress Responsive Universal Stress Protein (SbUSP) Mitigates Salt and Osmotic Stress in Transgenic Tobacco Plants

PubMed Central

Udawat, Pushpika; Jha, Rajesh K.; Sinha, Dinkar; Mishra, Avinash; Jha, Bhavanath

2016-01-01

The universal stress protein (USP) is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologs of intron less SbUSP gene which encodes for salt and osmotic responsive USP. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control [wild-type (WT) and vector control (VC)] plants under different abiotic stress condition. Transgenic lines (T1) exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability, and lower electrolyte leakage and lipid peroxidation (malondialdehyde content) under stress treatments than control (WT and VC) plants. Lower accumulation of H2O2 and O2− radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant. PMID:27148338

Expression of six peptidases from Lactobacillus helveticus in Lactococcus lactis.

PubMed

Luoma, S; Peltoniemi, K; Joutsjoki, V; Rantanen, T; Tamminen, M; Heikkinen, I; Palva, A

2001-03-01

For development of novel starter strains with improved proteolytic properties, the ability of Lactococcus lactis to produce Lactobacillus helveticus aminopeptidase N (PepN), aminopeptidase C (PepC), X-prolyl dipeptidyl aminopeptidase (PepX), proline iminopeptidase (PepI), prolinase (PepR), and dipeptidase (PepD) was studied by introducing the genes encoding these enzymes into L. lactis MG1363 and its derivatives. According to Northern analyses and enzyme activity measurements, the L. helveticus aminopeptidase genes pepN, pepC, and pepX are expressed under the control of their own promoters in L. lactis. The highest expression level, using a low-copy-number vector, was obtained with the L. helveticus pepN gene, which resulted in a 25-fold increase in PepN activity compared to that of wild-type L. lactis. The L. helveticus pepI gene, residing as a third gene in an operon in its host, was expressed in L. lactis under the control of the L. helveticus pepX promoter. The genetic background of the L. lactis derivatives tested did not affect the expression level of any of the L. helveticus peptidases studied. However, the growth medium used affected both the recombinant peptidase profiles in transformant strains and the resident peptidase activities. The levels of expression of the L. helveticus pepD and pepR clones under the control of their own promoters were below the detection limit in L. lactis. However, substantial amounts of recombinant pepD and PepR activities were obtained in L. lactis when pepD and pepR were expressed under the control of the inducible lactococcal nisA promoter at an optimized nisin concentration.

Expression of Six Peptidases from Lactobacillus helveticus in Lactococcus lactis

PubMed Central

Luoma, Susanna; Peltoniemi, Kirsi; Joutsjoki, Vesa; Rantanen, Terhi; Tamminen, Marja; Heikkinen, Inka; Palva, Airi

2001-01-01

For development of novel starter strains with improved proteolytic properties, the ability of Lactococcus lactis to produce Lactobacillus helveticus aminopeptidase N (PepN), aminopeptidase C (PepC), X-prolyl dipeptidyl aminopeptidase (PepX), proline iminopeptidase (PepI), prolinase (PepR), and dipeptidase (PepD) was studied by introducing the genes encoding these enzymes into L. lactis MG1363 and its derivatives. According to Northern analyses and enzyme activity measurements, the L. helveticus aminopeptidase genes pepN, pepC, and pepX are expressed under the control of their own promoters in L. lactis. The highest expression level, using a low-copy-number vector, was obtained with the L. helveticus pepN gene, which resulted in a 25-fold increase in PepN activity compared to that of wild-type L. lactis. The L. helveticus pepI gene, residing as a third gene in an operon in its host, was expressed in L. lactis under the control of the L. helveticus pepX promoter. The genetic background of the L. lactis derivatives tested did not affect the expression level of any of the L. helveticus peptidases studied. However, the growth medium used affected both the recombinant peptidase profiles in transformant strains and the resident peptidase activities. The levels of expression of the L. helveticus pepD and pepR clones under the control of their own promoters were below the detection limit in L. lactis. However, substantial amounts of recombinant pepD and PepR activities were obtained in L. lactis when pepD and pepR were expressed under the control of the inducible lactococcal nisA promoter at an optimized nisin concentration. PMID:11229915

Co-expression of P173S Mutant Rice EPSPS and igrA Genes Results in Higher Glyphosate Tolerance in Transgenic Rice.

PubMed

Fartyal, Dhirendra; Agarwal, Aakrati; James, Donald; Borphukan, Bhabesh; Ram, Babu; Sheri, Vijay; Yadav, Renu; Manna, Mrinalini; Varakumar, Panditi; Achary, V Mohan M; Reddy, Malireddy K

2018-01-01

Weeds and their devastating effects have been a great threat since the start of agriculture. They compete with crop plants in the field and negatively influence the crop yield quality and quantity along with survival of the plants. Glyphosate is an important broad-spectrum systemic herbicide which has been widely used to combat various weed problems since last two decades. It is very effective even at low concentrations, and possesses low environmental toxicity and soil residual activity. However, the residual concentration of glyphosate inside the plant has been of major concern as it severely affects the important metabolic pathways, and results in poor plant growth and grain yield. In this study, we compared the glyphosate tolerance efficiency of two different transgenic groups over expressing proline/173/serine (P173S) rice EPSPS glyphosate tolerant mutant gene ( OsmEPSPS ) alone and in combination with the glyphosate detoxifying encoding igrA gene, recently characterized from Pseudomonas . The molecular analysis of all transgenic plant lines showed a stable integration of transgenes and their active expression in foliar tissues. The physiological analysis of glyphosate treated transgenic lines at seed germination and vegetative stages showed a significant difference in glyphosate tolerance between the two transgenic groups. The transgenic plants with OsmEPSPS and igrA genes, representing dual glyphosate tolerance mechanisms, showed an improved root-shoot growth, physiology, overall phenotype and higher level of glyphosate tolerance compared to the OsmEPSPS transgenic plants. This study highlights the advantage of igrA led detoxification mechanism as a crucial component of glyphosate tolerance strategy in combination with glyphosate tolerant OsmEPSPS gene, which offered a better option to tackle in vivo glyphosate accumulation and imparted more robust glyphosate tolerance in rice transgenic plants.

The NtrY-NtrX two-component system is involved in controlling nitrate assimilation in Herbaspirillum seropedicae strain SmR1.

PubMed

Bonato, Paloma; Alves, Lysangela R; Osaki, Juliana H; Rigo, Liu U; Pedrosa, Fabio O; Souza, Emanuel M; Zhang, Nan; Schumacher, Jörg; Buck, Martin; Wassem, Roseli; Chubatsu, Leda S

2016-11-01

Herbaspirillum seropedicae is a diazotrophic β-Proteobacterium found endophytically associated with gramineae (Poaceae or graminaceous plants) such as rice, sorghum and sugar cane. In this work we show that nitrate-dependent growth in this organism is regulated by the master nitrogen regulatory two-component system NtrB-NtrC, and by NtrY-NtrX, which functions to specifically regulate nitrate metabolism. NtrY is a histidine kinase sensor protein predicted to be associated with the membrane and NtrX is the response regulator partner. The ntrYntrX genes are widely distributed in Proteobacteria. In α-Proteobacteria they are frequently located downstream from ntrBC, whereas in β-Proteobacteria these genes are located downstream from genes encoding an RNA methyltransferase and a proline-rich protein with unknown function. The NtrX protein of α-Proteobacteria has an AAA+ domain, absent in those from β-Proteobacteria. An ntrY mutant of H. seropedicae showed the wild-type nitrogen fixation phenotype, but the nitrate-dependent growth was abolished. Gene fusion assays indicated that NtrY is involved in the expression of genes coding for the assimilatory nitrate reductase as well as the nitrate-responsive two-component system NarX-NarL (narK and narX promoters, respectively). The purified NtrX protein was capable of binding the narK and narX promoters, and the binding site at the narX promoter for the NtrX protein was determined by DNA footprinting. In silico analyses revealed similar sequences in other promoter regions of H. seropedicae that are related to nitrate assimilation, supporting the role of the NtrY-NtrX system in regulating nitrate metabolism in H. seropedicae. © 2016 Federation of European Biochemical Societies.

Effect of Salt Stress on Growth, Na+ Accumulation and Proline Metabolism in Potato (Solanum tuberosum) Cultivars

PubMed Central

Jaarsma, Rinse; de Vries, Rozemarijn S. M.; de Boer, Albertus H.

2013-01-01

Potato (Solanum tuberosum) is a major crop world-wide and the productivity of currently used cultivars is strongly reduced at high soil salt levels. We compared the response of six potato cultivars to increased root NaCl concentrations. Cuttings were grown hydroponically and treated with 0 mM, 60 mM and 180 mM NaCl for one week. Growth reduction on salt was strongest for the cultivars Mozart and Mona Lisa with a severe senescence response at 180 mM NaCl and Mozart barely survived the treatment. The cultivars Desiree and Russett Burbank were more tolerant showing no senescence after salt treatment. A clear difference in Na+ homeostasis was observed between sensitive and tolerant cultivars. The salt sensitive cultivar Mozart combined low Na+ levels in root and stem with the highest leaf Na+ concentration of all cultivars, resulting in a high Na+ shoot distribution index (SDI) for Mozart as compared to Desiree. Overall, a positive correlation between salt tolerance and stem Na+ accumulation was found and the SDI for Na+ points to a role of stem Na+ accumulation in tolerance. In stem tissue, Mozart accumulated more H2O2 and less proline compared to the tolerant cultivars. Analysis of the expression of proline biosynthesis genes in Mozart and Desiree showed a clear reduction in proline dehydrogenase (PDH) expression in both cultivars and an increase in pyrroline-5-carboxylate synthetase 1 (P5CS1) gene expression in Desiree, but not in Mozart. Taken together, current day commercial cultivars show promising differences in salt tolerance and the results suggest that mechanisms of tolerance reside in the capacity of Na+ accumulation in stem tissue, resulting in reduced Na+ transport to the leaves. PMID:23533673

Differential effects of collagen prolyl 3-hydroxylation on skeletal tissues.

PubMed

Homan, Erica P; Lietman, Caressa; Grafe, Ingo; Lennington, Jennifer; Morello, Roy; Napierala, Dobrawa; Jiang, Ming-Ming; Munivez, Elda M; Dawson, Brian; Bertin, Terry K; Chen, Yuqing; Lua, Rhonald; Lichtarge, Olivier; Hicks, John; Weis, Mary Ann; Eyre, David; Lee, Brendan H L

2014-01-01

Mutations in the genes encoding cartilage associated protein (CRTAP) and prolyl 3-hydroxylase 1 (P3H1 encoded by LEPRE1) were the first identified causes of recessive Osteogenesis Imperfecta (OI). These proteins, together with cyclophilin B (encoded by PPIB), form a complex that 3-hydroxylates a single proline residue on the α1(I) chain (Pro986) and has cis/trans isomerase (PPIase) activity essential for proper collagen folding. Recent data suggest that prolyl 3-hydroxylation of Pro986 is not required for the structural stability of collagen; however, the absence of this post-translational modification may disrupt protein-protein interactions integral for proper collagen folding and lead to collagen over-modification. P3H1 and CRTAP stabilize each other and absence of one results in degradation of the other. Hence, hypomorphic or loss of function mutations of either gene cause loss of the whole complex and its associated functions. The relative contribution of losing this complex's 3-hydroxylation versus PPIase and collagen chaperone activities to the phenotype of recessive OI is unknown. To distinguish between these functions, we generated knock-in mice carrying a single amino acid substitution in the catalytic site of P3h1 (Lepre1(H662A) ). This substitution abolished P3h1 activity but retained ability to form a complex with Crtap and thus the collagen chaperone function. Knock-in mice showed absence of prolyl 3-hydroxylation at Pro986 of the α1(I) and α1(II) collagen chains but no significant over-modification at other collagen residues. They were normal in appearance, had no growth defects and normal cartilage growth plate histology but showed decreased trabecular bone mass. This new mouse model recapitulates elements of the bone phenotype of OI but not the cartilage and growth phenotypes caused by loss of the prolyl 3-hydroxylation complex. Our observations suggest differential tissue consequences due to selective inactivation of P3H1 hydroxylase activity versus complete ablation of the prolyl 3-hydroxylation complex.

Biochemical characterization, homology modeling and docking studies of ornithine delta-aminotransferase--an important enzyme in proline biosynthesis of plants.

PubMed

Sekhar, P Nataraj; Amrutha, R Naga; Sangam, Shubhada; Verma, D P S; Kishor, P B Kavi

2007-11-01

Ornithine delta-aminotransferase (OAT) is an important enzyme in proline biosynthetic pathway and is implicated in salt tolerance in higher plants. OAT transaminates ornithine to pyrroline 5-carboxylate, which is further catalyzed to proline by pyrroline 5-carboxylate reductase. The Vigna aconitifolia OAT cDNA, encoding a polypeptide of 48.1 kDa, was expressed in Escherichia coli and the enzyme was partially characterized following its purification using (NH(4))(2)SO(4) precipitation and gel filtration techniques. Optimal activity of the enzyme was observed at a temperature of 25 degrees C and pH 8.0. The enzyme appeared to be a monomer and exhibited high activity at 4mM ornithine. Proline did not show any apparent effect but isoleucine, valine and serine inhibited the activity when added into the assay mixture along with ornithine. Omission of pyridoxal 5'-phosphate from the reaction mixture reduced the activity of this enzyme by 60%. To further evaluate these biochemical observations, homology modeling of the OAT was performed based on the crystal structure of the ornithine delta-aminotransferase from humans (PDB code 1OAT) by using the software MODELLER6v2. With the aid of the molecular mechanics and dynamics methods, the final model was obtained and assessed subsequently by PROCHECK and VERIFY-3D graph. With this model, a flexible docking study with the substrate and inhibitors was performed and the results indicated that Gly106 and Lys256 in OAT are the important determinant residues in binding as they have strong hydrogen bonding contacts with the substrate and inhibitors. These observations are in conformity with the results obtained from experimental investigations.

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

PubMed Central

Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

2013-01-01

Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

Characterization of a cDNA encoding a protein involved in formation of the skeleton during development of the sea urchin Lytechinus pictus.

PubMed

Livingston, B T; Shaw, R; Bailey, A; Wilt, F

1991-12-01

In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

PubMed

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome triplication analysis in B. oleracea, B. rapa and A. thaliana genomes, our study provides insight into the evolutionary history of NBS-encoding genes after divergence of A. thaliana and the Brassica lineage. These results together with expression pattern analysis of NBS-encoding orthologous genes provide useful resource for functional characterization of these genes and genetic improvement of relevant crops.

Topological and organizational properties of the products of house-keeping and tissue-specific genes in protein-protein interaction networks.

PubMed

Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing

2009-03-11

Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene-encoded proteins are attached to the core at more peripheral positions of the networks.

Draft genome sequence of Actinotignum schaalii DSM 15541T: Genetic insights into the lifestyle, cell fitness and virulence.

PubMed

Yassin, Atteyet F; Langenberg, Stefan; Huntemann, Marcel; Clum, Alicia; Pillay, Manoj; Palaniappan, Krishnaveni; Varghese, Neha; Mikhailova, Natalia; Mukherjee, Supratim; Reddy, T B K; Daum, Chris; Shapiro, Nicole; Ivanova, Natalia; Woyke, Tanja; Kyrpides, Nikos C

2017-01-01

The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA) pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS) were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM) systems, type II toxin-antitoxin (TA), CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA) and topisomerase IV (ParC) enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH-flavin oxidoreductase.

PRELP (proline/arginine-rich end leucine-rich repeat protein) promotes osteoblastic differentiation of preosteoblastic MC3T3-E1 cells by regulating the β-catenin pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haiying; Cui, Yazhou; Luan, Jing

Proline/arginine-rich end leucine-rich repeat protein (PRELP) is a collagen-binding proteoglycan highly expressed in the developing bones. Recent studies indicated that PRELP could inhibit osteoclastogenesis as a NF-κB inhibitor. However, its role during osteoblast differentiation is still unclear. In this study, we confirmed that the expression of PRELP increased with the osteogenesis induction of preosteoblastic MC3T3-E1 cells. Down-regulation of PRELP expression by shRNA reduced ALP activity, mineralization and expression of osteogenic marker gene Runx2. Our microarray analysis data suggested that β-catenin may act as a hub gene in the PRELP-mediated gene network. We validated furtherly that PRELP knockdown could inhibit themore » level of connexin43, a key regulator of osteoblast differentiation by affecting β-catenin protein expression, and its nuclear translocation in MC3T3-E1 preosteoblasts. Therefore, this study established a new role of PRELP in modulating β-catenin/connexin43 pathway and osteoblast differentiation.« less

Regulation of tumor cell migration by protein tyrosine phosphatase (PTP)-proline-, glutamate-, serine-, and threonine-rich sequence (PEST)

PubMed Central

Zheng, Yanhua; Lu, Zhimin

2013-01-01

Protein tyrosine phosphatase (PTP)–proline-, glutamate-, serine-, and threonine-rich sequence (PEST) is ubiquitously expressed and is a critical regulator of cell adhesion and migration. PTP-PEST activity can be regulated transcriptionally via gene deletion or mutation in several types of human cancers or via post-translational modifications, including phosphorylation, oxidation, and caspase-dependent cleavage. PTP-PEST interacts with and dephosphorylates cytoskeletal and focal adhesion-associated proteins. Dephosphorylation of PTP-PEST substrates regulates their enzymatic activities and/or their interaction with other proteins and plays an essential role in the tumor cell migration process. PMID:23237212

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

PubMed

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Effect of water withdrawal on formation of free radical, proline accumulation and activities of antioxidant enzymes in ZAT12-transformed transgenic tomato plants.

PubMed

Chandra Rai, Avinash; Singh, Major; Shah, Kavita

2012-12-01

Water stress often leads to the accumulation of reactive oxygen species (ROS) and their excessive production alters the activities of enzymes involved in their removal. ZAT12 is a member of stress-responsive C(2)H(2) type Zinc Finger Protein (ZFP) reported to control the expression of several stress-activated genes in plants through ROS signaling. The ZAT12-transformed tomato lines (cv. H-86 variety Kashi Vishesh) when subjected to water withdrawal for 7, 14 and 21 days revealed significant and consistent changes in activities of enzymes SOD, CAT, APX, GR and POD paralleled with an increased proline levels. Unlike that in wild-type tomato, the leaf superoxide anion and hydrogen peroxide concentrations in the transformed tomato plants did not alter much, suggesting a well regulated formation of free radicals suppressing oxidative stress in the latter. Results suggest BcZAT12-transformed tomato lines ZT1, ZT2 and ZT6 to be better adapted to drought stress tolerance by accumulation of osmolyte proline and increased antioxidant response triggered by the ZAT12 gene. Therefore, the ZAT12-transformed tomato cv. H-86 lines will prove useful for higher yield of tomato crop in regions affected with severe drought stress. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rod, M.L. Alam, K.Y.; Cunningham, P.R.; Clark, D.P.

When grown at high osmotic pressure, some strains of Escherichia coli K-12 synthesized substantial levels of free sugar and accumulated proline if it was present in the growth medium. The sugar was identified as trehalose. Strains of E. coli K-12 could be divided into two major classes with respect of osmoregulation. Those of class A showed a large increase in trehalose levels with increasing medium osmolarity and also accumulated proline from the medium, whereas those in class B showed no accumulation of trehalose or proline. Most class A strains carried suppressor mutations which arose during their derivation from the wildmore » type, whereas the osmodefective strains of class B were suppressor free. When amber suppressor mutations at the supD, supE, or supF loci were introduced into such sup{sup o} osmodefective strains, they became osmotolerant and gained the ability to accumulate trehalose in response to elevated medium osmolarity. It appears that the original K-12 strain of E. coli carries an amber mutation in a gene affecting osmoregulation. Mutants lacking ADP-glucose synthetase (glgC) accumulated trehalose normally, whereas mutants lacking UDP-glucose synthetase (galU) did not make trehalose and grew poorly in medium of high osmolarity. Trehalose synthesis was repressed by exogenous glycine betaine but not by proline.« less

Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

PubMed

de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

2016-01-01

Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Spliced Leader RNAs, Mitochondrial Gene Frameshifts and Multi-Protein Phylogeny Expand Support for the Genus Perkinsus as a Unique Group of Alveolates

PubMed Central

Zhang, Huan; Campbell, David A.; Sturm, Nancy R.; Dungan, Christopher F.; Lin, Senjie

2011-01-01

The genus Perkinsus occupies a precarious phylogenetic position. To gain a better understanding of the relationship between perkinsids, dinoflagellates and other alveolates, we analyzed the nuclear-encoded spliced-leader (SL) RNA and mitochondrial genes, intron prevalence, and multi-protein phylogenies. In contrast to the canonical 22-nt SL found in dinoflagellates (DinoSL), P. marinus has a shorter (21-nt) and a longer (22-nt) SL with slightly different sequences than DinoSL. The major SL RNA transcripts range in size between 80–83 nt in P. marinus, and ∼83 nt in P. chesapeaki, significantly larger than the typical ≤56-nt dinoflagellate SL RNA. In most of the phylogenetic trees based on 41 predicted protein sequences, P. marinus branched at the base of the dinoflagellate clade that included the ancient taxa Oxyrrhis and Amoebophrya, sister to the clade of apicomplexans, and in some cases clustered with apicomplexans as a sister to the dinoflagellate clade. Of 104 Perkinsus spp. genes examined 69.2% had introns, a higher intron prevalence than in dinoflagellates. Examination of Perkinsus spp. mitochondrial cytochrome B and cytochrome C oxidase subunit I genes and their cDNAs revealed no mRNA editing, but these transcripts can only be translated when frameshifts are introduced at every AGG and CCC codon as if AGGY codes for glycine and CCCCU for proline. These results, along with the presence of the numerous uncharacterized ‘marine alveolate group I' and Perkinsus-like lineages separating perkinsids from core dinoflagellates, expand support for the affiliation of the genus Perkinsus with an independent lineage (Perkinsozoa) positioned between the phyla of Apicomplexa and Dinoflagellata. PMID:21629701

A novel OPA1 mutation in a Chinese family with autosomal dominant optic atrophy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Juanjuan; Yuan, Yimin; Lin, Bing

2012-03-23

Highlights: Black-Right-Pointing-Pointer We report the characterization of a four-generation large Chinese family with ADOA. Black-Right-Pointing-Pointer We find a new heterozygous mutation c.C1198G in OPA1 gene which may be a novel pathogenic mutation in this pedigree. Black-Right-Pointing-Pointer We do not find any mitochondrial DNA mutations associated with optic atrophy. Black-Right-Pointing-Pointer Other factors may also contribute to the phenotypic variability of ADOA in this pedigree. -- Abstract: A large four-generation Chinese family with autosomal dominant optic atrophy (ADOA) was investigated in the present study. Eight of the family members were affected in this pedigree. The affected family members exhibited early-onset and progressivemore » visual impairment, resulting in mild to profound loss of visual acuity. The average age-at-onset was 15.9 years. A new heterozygous mutation c.C1198G was identified by sequence analysis of the 12th exon of the OPA1 gene. This mutation resulted in a proline to alanine substitution at codon 400, which was located in an evolutionarily conserved region. This missense mutation in the GTPase domain was supposed to result in a loss of function for the encoded protein and act through a dominant negative effect. No other mutations associated with optic atrophy were found in our present study. The c.C1198G heterozygous mutation in the OPA1 gene may be a novel key pathogenic mutation in this pedigree with ADOA. Furthermore, additional nuclear modifier genes, environmental factors, and psychological factors may also contribute to the phenotypic variability of ADOA in this pedigree.« less

Resolving the cofactor-binding site in the proline biosynthetic enzyme human pyrroline-5-carboxylate reductase 1

PubMed Central

Christensen, Emily M.; Patel, Sagar M.; Korasick, David A.; Campbell, Ashley C.; Krause, Kurt L.; Becker, Donald F.; Tanner, John J.

2017-01-01

Pyrroline-5-carboxylate reductase (PYCR) is the final enzyme in proline biosynthesis, catalyzing the NAD(P)H-dependent reduction of Δ1-pyrroline-5-carboxylate (P5C) to proline. Mutations in the PYCR1 gene alter mitochondrial function and cause the connective tissue disorder cutis laxa. Furthermore, PYCR1 is overexpressed in multiple cancers, and the PYCR1 knock-out suppresses tumorigenic growth, suggesting that PYCR1 is a potential cancer target. However, inhibitor development has been stymied by limited mechanistic details for the enzyme, particularly in light of a previous crystallographic study that placed the cofactor-binding site in the C-terminal domain rather than the anticipated Rossmann fold of the N-terminal domain. To fill this gap, we report crystallographic, sedimentation-velocity, and kinetics data for human PYCR1. Structures of binary complexes of PYCR1 with NADPH or proline determined at 1.9 Å resolution provide insight into cofactor and substrate recognition. We see NADPH bound to the Rossmann fold, over 25 Å from the previously proposed site. The 1.85 Å resolution structure of a ternary complex containing NADPH and a P5C/proline analog provides a model of the Michaelis complex formed during hydride transfer. Sedimentation velocity shows that PYCR1 forms a concentration-dependent decamer in solution, consistent with the pentamer-of-dimers assembly seen crystallographically. Kinetic and mutational analysis confirmed several features seen in the crystal structure, including the importance of a hydrogen bond between Thr-238 and the substrate as well as limited cofactor discrimination. PMID:28258219

Identification of genes differentially expressed during interaction of Mexican lime tree infected with "Candidatus Phytoplasma aurantifolia"

PubMed Central

2011-01-01

Background "Candidatus Phytoplasma aurantifolia", is the causative agent of witches' broom disease in Mexican lime trees (Citrus aurantifolia L.), and is responsible for major losses of Mexican lime trees in Southern Iran and Oman. The pathogen is strictly biotrophic, and thus is completely dependent on living host cells for its survival. The molecular basis of compatibility and disease development in this system is poorly understood. Therefore, we have applied a cDNA- amplified fragment length polymorphism (AFLP) approach to analyze gene expression in Mexican lime trees infected by "Ca. Phytoplasma aurantifolia". Results We carried out cDNA-AFLP analysis on grafted infected Mexican lime trees of the susceptible cultivar at the representative symptoms stage. Selective amplifications with 43 primer combinations allowed the visualisation of 55 transcript-derived fragments that were expressed differentially between infected and non-infected leaves. We sequenced 51 fragments, 36 of which were identified as lime tree transcripts after homology searching. Of the 36 genes, 70.5% were down-regulated during infection and could be classified into various functional groups. We showed that Mexican lime tree genes that were homologous to known resistance genes tended to be repressed in response to infection. These included the genes for modifier of snc1 and autophagy protein 5. Furthermore, down-regulation of genes involved in metabolism, transcription, transport and cytoskeleton was observed, which included the genes for formin, importin β 3, transducin, L-asparaginase, glycerophosphoryl diester phosphodiesterase, and RNA polymerase β. In contrast, genes that encoded a proline-rich protein, ubiquitin-protein ligase, phosphatidyl glycerol specific phospholipase C-like, and serine/threonine-protein kinase were up-regulated during the infection. Conclusion The present study identifies a number of candidate genes that might be involved in the interaction of Mexican lime trees with "Candidatus Phytoplasma aurantifolia". These results should help to elucidate the molecular basis of the infection process and to identify genes that could be targeted to increase plant resistance and inhibit the growth and reproduction of the pathogen. PMID:21194490

Biosynthesis of the Osmoprotectant Ectoine, but Not Glycine Betaine, Is Critical for Survival of Osmotically Stressed Vibrio parahaemolyticus Cells

PubMed Central

Ongagna-Yhombi, Serge Y.

2013-01-01

Vibrio parahaemolyticus is a halophile present in marine and estuarine environments, ecosystems characterized by fluctuations in salinity and temperature. One strategy to thrive in such environments is the synthesis and/or uptake of compatible solutes. The V. parahaemolyticus genome contains biosynthesis systems for both ectoine and glycine betaine, which are known to act as compatible solutes in other species. We showed that V. parahaemolyticus had a 6% NaCl tolerance when grown in M9 minimal medium with 0.4% glucose (M9G) with a >5-h lag phase. By using 1H nuclear magnetic resonance spectroscopy (1H-NMR) analysis, we determined that cells synthesized ectoine and glutamate in a NaCl-dependent manner. The most effective compatible solutes as measured by a reduction in lag-phase growth in M9G with 6% NaCl (M9G 6% NaCl) were in the order glycine betaine > choline > proline = glutamate > ectoine. However, V. parahaemolyticus could use glutamate or proline as the sole carbon source, but not ectoine or glycine betaine, which suggests that these are bona fide compatible solutes. Expression analysis showed that the ectA and betA genes were more highly expressed in log-phase cells, and expression of both genes was induced by NaCl up-shock. Under all conditions examined, the ectA gene was more highly expressed than the betA gene. Analysis of in-frame deletions in betA and ectB and in a double mutant showed that the ectB mutant was defective for growth, and this defect was rescued by the addition of glycine betaine, proline, ectoine, and glutamate, indicating that these compounds are compatible solutes for this species. The presence of both synthesis systems was the predominant distribution pattern among members of the Vibrionaceae family, suggesting this is the ancestral state. PMID:23770911

Genetic variations of HvP5CS1 and their association with drought tolerance related traits in barley (Hordeum vulgare L.)

USDA-ARS?s Scientific Manuscript database

Delta-1-pyrroline-5-carboxylate synthase gene1 (P5CS1) is the key gene involved in the biosynthesis of proline and is significantly induced by drought stress. The exploration of genetic variation in HvP5CS1 may facilitate a better understanding of the mechanism of drought adaptation in barley. In th...

A novel mutation of the high-temperature requirement A serine peptidase 1 (HTRA1) gene in a Chinese family with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL).

PubMed

Chen, Yan; He, Zhiyi; Meng, Su; Li, Lei; Yang, Hua; Zhang, Xiaotang

2013-10-01

Mutations in the high-temperature requirement A serine peptidase 1 (HTRA1) gene were studied in a Chinese family with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL). Exons 1-9 of the HTRA1 gene were amplified and bidirectionally sequenced in a Chinese family with CARASIL. Mutation effects were analysed by three-dimensional modelling of the serine protease HTRA1 protein. The proband was found to be homozygous for a novel missense mutation (c.854 C > T) identified in exon 4 of the HTRA1 gene; the parents of the proband were heterozygous for the same missense mutation. This c.854 C > T mutation resulted in a change from proline to leucine (p.P285L) in serine protease HTRA1, and was absent in 260 control chromosomes. Three-dimensional models showed that the change from proline to leucine (p.P285L) could attenuate the hydrogen bond between S284 and S287 residues, which might affect function of serine protease HTRA1. Discovery of a novel missense mutation (c.854C>T) associated with CARASIL expands the known CARASIL-related mutations in HTRA1.

Exogenous glutathione improves high root-zone temperature tolerance by modulating photosynthesis, antioxidant and osmolytes systems in cucumber seedlings

PubMed Central

Ding, Xiaotao; Jiang, Yuping; He, Lizhong; Zhou, Qiang; Yu, Jizhu; Hui, Dafeng; Huang, Danfeng

2016-01-01

To investigate the physiological responses of plants to high root-zone temperature (HT, 35 °C) stress mitigated by exogenous glutathione (GSH), cucumber (Cucumis sativus L.) seedlings were exposed to HT with or without GSH treatment for 4 days and following with 4 days of recovery. Plant physiological variables, growth, and gene expression related to antioxidant enzymes and Calvin cycle were quantified. The results showed that HT significantly decreased GSH content, the ratio of reduced to oxidized glutathione (GSH/GSSG), chlorophyll content, photosynthesis and related gene expression, shoot height, stem diameter, as well as dry weight. The exogenous GSH treatment clearly lessened the HT stress by increasing the above variables. Meanwhile, HT significantly increased soluble protein content, proline and malondialdehyde (MDA) content as well as O2•− production rate, the gene expression and activities of antioxidant enzymes. The GSH treatment remarkably improved soluble protein content, proline content, antioxidant enzymes activities, and antioxidant enzymes related gene expression, and reduced the MDA content and O2•− production rate compared to no GSH treatment in the HT condition. Our results suggest that exogenous GSH enhances cucumber seedling tolerance of HT stress by modulating the photosynthesis, antioxidant and osmolytes systems to improve physiological adaptation. PMID:27752105

Antioxidant N-acetyltransferase Mpr1/2 of industrial baker's yeast enhances fermentation ability after air-drying stress in bread dough.

PubMed

Sasano, Yu; Takahashi, Shunsuke; Shima, Jun; Takagi, Hiroshi

2010-03-31

During bread-making processes, yeast cells are exposed to multiple stresses. Air-drying stress is one of the most harmful stresses by generation of reactive oxygen species (ROS). Previously, we discovered that the novel N-acetyltransferase Mpr1/2 confers oxidative stress tolerance by reducing intracellular ROS level in Saccharomyces cerevisiae Sigma1278b strain. In this study, we revealed that Japanese industrial baker's yeast possesses one MPR gene. The nucleotide sequence of the MPR gene in industrial baker's yeast was identical to the MPR2 gene in Sigma1278b strain. Gene disruption analysis showed that the MPR2 gene in industrial baker's yeast is involved in air-drying stress tolerance by reducing the intracellular oxidation levels. We also found that expression of the Lys63Arg and Phe65Leu variants with enhanced enzymatic activity and stability, respectively, increased the fermentation ability of bread dough after exposure to air-drying stress compared with the wild-type Mpr1. In addition, our recent study showed that industrial baker's yeast cells accumulating proline exhibited enhanced freeze tolerance in bread dough. Proline accumulation also enhanced the fermentation ability after air-drying stress treatment in industrial baker's yeast. Hence, the antioxidant enzyme Mpr1/2 could be promising for breeding novel yeast strains that are tolerant to air-drying stress. Copyright 2010 Elsevier B.V. All rights reserved.

Chloroplast proteome response to drought stress and recovery in tomato (Solanum lycopersicum L.).

PubMed

Tamburino, Rachele; Vitale, Monica; Ruggiero, Alessandra; Sassi, Mauro; Sannino, Lorenza; Arena, Simona; Costa, Antonello; Batelli, Giorgia; Zambrano, Nicola; Scaloni, Andrea; Grillo, Stefania; Scotti, Nunzia

2017-02-10

Drought is a major constraint for plant growth and crop productivity that is receiving an increased attention due to global climate changes. Chloroplasts act as environmental sensors, however, only partial information is available on stress-induced mechanisms within plastids. Here, we investigated the chloroplast response to a severe drought treatment and a subsequent recovery cycle in tomato through physiological, metabolite and proteomic analyses. Under stress conditions, tomato plants showed stunted growth, and elevated levels of proline, abscisic acid (ABA) and late embryogenesis abundant gene transcript. Proteomics revealed that water deficit deeply affects chloroplast protein repertoire (31 differentially represented components), mainly involving energy-related functional species. Following the rewatering cycle, physiological parameters and metabolite levels indicated a recovery of tomato plant functions, while proteomics revealed a still ongoing adjustment of the chloroplast protein repertoire, which was even wider than during the drought phase (54 components differentially represented). Changes in gene expression of candidate genes and accumulation of ABA suggested the activation under stress of a specific chloroplast-to-nucleus (retrograde) signaling pathway and interconnection with the ABA-dependent network. Our results give an original overview on the role of chloroplast as enviromental sensor by both coordinating the expression of nuclear-encoded plastid-localised proteins and mediating plant stress response. Although our data suggest the activation of a specific retrograde signaling pathway and interconnection with ABA signaling network in tomato, the involvement and fine regulation of such pathway need to be further investigated through the development and characterization of ad hoc designed plant mutants.

Molecular cloning and characterization of the MsHSP17.7 gene from Medicago sativa L.

PubMed

Li, Zhen-Yi; Long, Rui-Cai; Zhang, Tie-Jun; Yang, Qing-Chuan; Kang, Jun-Mei

2016-08-01

Heat shock proteins (HSPs) are ubiquitous protective proteins that play crucial roles in plant development and adaptation to stress, and the aim of this study is to characterize the HSP gene in alfalfa. Here we isolated a small heat shock protein gene (MsHSP17.7) from alfalfa by homology-based cloning. MsHSP17.7 contains a 477-bp open reading frame and encodes a protein of 17.70-kDa. The amino acid sequence shares high identity with MtHSP (93.98 %), PsHSP17.1 (83.13 %), GmHSP17.9 (74.10 %) and SlHSP17.6 (79.25 %). Phylogenetic analysis revealed that MsHSP17.7 belongs to the group of cytosolic class II small heat shock proteins (sHSP), and likely localizes to the cytoplasm. Quantitative RT-PCR indicated that MsHSP17.7 was induced by heat shock, high salinity, peroxide and drought stress. Prokaryotic expression indicated that the salt and peroxide tolerance of Escherichia coli was remarkably enhanced. Transgenic Arabidopsis plants overexpressing MsHSP17.7 exhibited increased root length of transgenic Arabidopsis lines under salt stress compared to the wild-type line. The malondialdehyde (MDA) levels in the transgenic lines were significantly lower than in wild-type, although proline levels were similar between transgenic and wild-type lines. MsHSP17.7 was induced by heat shock, high salinity, oxidative stress and drought stress. Overexpression analysis suggests that MsHSP17.7 might play a key role in response to high salinity stress.

Whole Adult Organism Transcriptional Profiling of Acute Metal Exposures in Male Zebrafish

DTIC Science & Technology

2014-03-10

metabolism arginine & proline metabolism tyrosine metabolism glycine, serine & threonine metabolism tryptophan metabolism histidine metabolism nicotinate...gene locus - Associations with obesity indices in middle-aged women. Diabetes 2002, 51(4):1281–1286. 85. Inoue I, Shinoda Y, Ikeda M, Hayashi K

Introgression of the SbASR-1 Gene Cloned from a Halophyte Salicornia brachiata Enhances Salinity and Drought Endurance in Transgenic Groundnut (Arachis hypogaea) and Acts as a Transcription Factor

PubMed Central

Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath

2015-01-01

The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2 .- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

DNA sequence analysis, expression, distribution, and physiological role of the Xaa-prolyldipeptidyl aminopeptidase gene from Lactobacillus helveticus CNRZ32.

PubMed

Yüksel, G U; Steele, J L

1996-02-01

Lactobacillus helveticus CNRZ32 possesses an Xaa-prolyldipeptidyl aminopeptidase (PepX), which releases amino-terminal dipeptides from peptides containing proline residues in the penultimate position. The PepX gene, designated pepX, from Lb. helveticus CNRZ32 was sequenced. Analysis of the sequence identified a putative 2379-bp pepX open-reading frame, which encodes a polypeptide of 793 amino acid residues with a deduced molecular mass of 88,111 Da. The gene shows significant sequence identity with sequenced pepX genes from lactic acid bacteria. The product of the gene contains a motif that is almost identical with the active-site motif of the serine-dependent PepX from lactococci. The introduction of pepX into Lactococcus lactis LM0230 on either pGK12 (a low-copy-number plasmid vector) or pIL253 (a high-copy-number plasmid vector) did not result in a significant increase in PepX activity, while the introduction of pepX into CNRZ32 on pGK12 resulted in a four-fold increase in PepX activity. Southern hybridization experiments revealed that the pepX gene from CNRZ32 is well conserved in lactobacilli, pediococci and streptococci. The physiological role of PepX during growth in lactobacillus MRS (a rich medium containing protein hydrolysates along with other ingredients) and milk was examined by comparing growth of CNRZ32 and a CNRZ32 PepX-negative derivative. No difference in growth rate or acid production was observed between CNRZ32 and its PepX-negative derivative in MRS. However, the CNRZ32 PepX-negative derivative grew in milk at a reduced specific growth rate when compared to wild-type CNRZ32. Introduction of the cloned PepX determinant into the CNRZ32 PepX-negative derivative resulted in a construct with a specific growth rate similar to that of wild-type CNRZ32.

Mollusk genes encoding lysine tRNA (UUU) contain introns.

PubMed

Matsuo, M; Abe, Y; Saruta, Y; Okada, N

1995-11-20

New intron-containing genes encoding tRNAs were discovered when genomic DNA isolated from various animal species was amplified by the polymerase chain reaction (PCR) with primers based on sequences of rabbit tRNA(Lys). From sequencing analysis of the products of PCR, we found that introns are present in several genes encoding tRNA(Lys) in mollusks, such as Loligo bleekeri (squid) and Octopus vulgaris (octopus). These introns were specific to genes encoding tRNA(Lys)(CUU) and were not present in genes encoding tRNA(Lys)(CUU). In addition, the sequences of the introns were different from one another. To confirm the results of our initial experiments, we isolated and sequenced genes encoding tRNA(Lys)(CUU) and tRNA(Lys)(UUU). The gene for tRNA(Lys)(UUU) from squid contained an intron, whose sequence was the same as that identified by PCR, and the gene formed a cluster with a corresponding pseudogene. Several DNA regions of 2.1 kb containing this cluster appeared to be tandemly arrayed in the squid genome. By contrast, the gene encoding tRNA(Lys)(CUU) did not contain an intron, as shown also by PCR. The tRNA(Lys)(UUU) that corresponded to the analyzed gene was isolated and characterized. The present study provides the first example of an intron-containing gene encoding a tRNA in mollusks and suggests the universality of introns in such genes in higher eukaryotes.

Human AZU-1 gene, variants thereof and expressed gene products

DOEpatents

Chen, Huei-Mei; Bissell, Mina

2004-06-22

A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

PubMed Central

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

GhABF2, a bZIP transcription factor, confers drought and salinity tolerance in cotton (Gossypium hirsutum L.).

PubMed

Liang, Chengzhen; Meng, Zhaohong; Meng, Zhigang; Malik, Waqas; Yan, Rong; Lwin, Khin Myat; Lin, Fazhuang; Wang, Yuan; Sun, Guoqing; Zhou, Tao; Zhu, Tao; Li, Jianying; Jin, Shuangxia; Guo, Sandui; Zhang, Rui

2016-10-07

The bZIP transcription factor (TF) act as an important regulator for the abscisic acid (ABA) mediated abiotic stresses signaling pathways in plants. Here, we reported the cloning and characterization of GhABF2, encoding for typical cotton bZIP TF. Overexpression of GhABF2 significantly improved drought and salt stress tolerance both in Arabidopsis and cotton. However, silencing of GhABF2 made transgenic cotton sensitive to PEG osmotic and salt stress. Expression of GhABF2 was induced by drought and ABA treatments but repressed by high salinity. Transcriptome analysis indicated that GhABF2 increases drought and salt tolerance by regulating genes related to ABA, drought and salt response. The proline contents, activity of superoxide dismutase (SOD) and catalase (CAT) were also significantly increased in GhABF2-overexpression cottons in comparison to wild type after drought and salt treatment. Further, an increase in fiber yield under drought and saline-alkali wetland exhibited the important role of GhABF2 in enhancing the drought and salt tolerance in transgenic lines. In conclusion, manipulation of GhABF2 by biotechnological tools could be a sustainable strategy to deploy drought and salt tolerance in cotton.

Roles of conserved proline and glycosyltransferase motifs of EmbC in biosynthesis of lipoarabinomannan.

PubMed

Berg, Stefan; Starbuck, James; Torrelles, Jordi B; Vissa, Varalakshmi D; Crick, Dean C; Chatterjee, Delphi; Brennan, Patrick J

2005-02-18

D-Arabinans, composed of D-arabinofuranose (D-Araf), dominate the structure of mycobacterial cell walls in two settings, as part of lipoarabinomannan (LAM) and arabinogalactan, each with markedly different structures and functions. Little is known of the complexity of their biosynthesis. beta-D-Arabinofuranosyl-1-monophosphoryldecaprenol is the only known sugar donor. EmbA, EmbB, and EmbC, products of the paralogous genes embA, embB, and embC, the sites of resistance to the anti-tuberculosis drug ethambutol (EMB), are the only known implicated enzymes. EmbA and -B apparently contribute to the synthesis of arabinogalactan, whereas EmbC is reserved for the synthesis of LAM. The Emb proteins show no overall similarity to any known proteins beyond Mycobacterium and related genera. However, functional motifs, equivalent to a proline-rich motif of several bacterial polysaccharide co-polymerases and a superfamily of glycosyltransferases, were found. Site-directed mutagenesis in glycosyltransferase superfamily C resulted in complete ablation of LAM synthesis. Point mutations in three amino acids of the proline motif of EmbC resulted in marked reduction of LAM-arabinan synthesis and accumulation of an unknown intermediate and of the known precursor lipomannan. Yet the pattern of the differently linked d-Araf units observed in wild type LAM-arabinan was largely retained in the proline motif mutants. The results allow for the presentation of a unique model of arabinan synthesis.

Proline Restricts Loop I Conformation of the High Affinity WW Domain from Human Nedd4-1 to a Ligand Binding-Competent Type I β-Turn.

PubMed

Schulte, Marianne; Panwalkar, Vineet; Freischem, Stefan; Willbold, Dieter; Dingley, Andrew J

2018-04-19

Sequence alignment of the four WW domains from human Nedd4-1 (neuronal precursor cell expressed developmentally down-regulated gene 4-1) reveals that the highest sequence diversity exists in loop I. Three residues in this type I β-turn interact with the PPxY motif of the human epithelial Na + channel (hENaC) subunits, indicating that peptide affinity is defined by the loop I sequence. The third WW domain (WW3*) has the highest ligand affinity and unlike the other three hNedd4-1 WW domains or other WW domains studied contains the highly statistically preferred proline at the ( i + 1) position found in β-turns. In this report, molecular dynamics simulations and experimental data were combined to characterize loop I stability and dynamics. Exchange of the proline to the equivalent residue in WW4 (Thr) results in the presence of a predominantly open seven residue Ω loop rather than the type I β-turn conformation for the wild-type apo-WW3*. In the presence of the ligand, the structure of the mutated loop I is locked into a type I β-turn. Thus, proline in loop I ensures a stable peptide binding-competent β-turn conformation, indicating that amino acid sequence modulates local flexibility to tune binding preferences and stability of dynamic interaction motifs.

Structure of the prolyl-tRNA synthetase from the eukaryotic pathogen Giardia lamblia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larson, Eric T.; Kim, Jessica E.; Napuli, Alberto J.

2012-09-01

The structure of Giardia prolyl-tRNA synthetase cocrystallized with proline and ATP shows evidence for half-of-the-sites activity, leading to a corresponding mixture of reaction substrates and product (prolyl-AMP) in the two active sites of the dimer. The genome of the human intestinal parasite Giardia lamblia contains only a single aminoacyl-tRNA synthetase gene for each amino acid. The Giardia prolyl-tRNA synthetase gene product was originally misidentified as a dual-specificity Pro/Cys enzyme, in part owing to its unexpectedly high off-target activation of cysteine, but is now believed to be a normal representative of the class of archaeal/eukaryotic prolyl-tRNA synthetases. The 2.2 Å resolutionmore » crystal structure of the G. lamblia enzyme presented here is thus the first structure determination of a prolyl-tRNA synthetase from a eukaryote. The relative occupancies of substrate (proline) and product (prolyl-AMP) in the active site are consistent with half-of-the-sites reactivity, as is the observed biphasic thermal denaturation curve for the protein in the presence of proline and MgATP. However, no corresponding induced asymmetry is evident in the structure of the protein. No thermal stabilization is observed in the presence of cysteine and ATP. The implied low affinity for the off-target activation product cysteinyl-AMP suggests that translational fidelity in Giardia is aided by the rapid release of misactivated cysteine.« less

Effect of proline on biochemical and molecular mechanisms in lettuce (Lactuca sativa L.) exposed to UV-B radiation.

PubMed

Aksakal, Ozkan; Tabay, Dilruba; Esringu, Aslıhan; Icoglu Aksakal, Feyza; Esim, Nevzat

2017-02-15

The purpose of the present study was to evaluate the role of proline (Pro) in relieving UV-B radiation-induced oxidative stress in lettuce. Lettuce seedlings were exposed to 3.3 W m -2 UV-B radiation for 12 h after pre-treatment sprayed with 20 mM Pro. The data for malondialdehyde (MDA), hydrogen peroxide (H 2 O 2 ), endogenous Pro level, the activities of antioxidant enzymes [superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and peroxidase (POD)], total phenolic concentration, antioxidant capacity, expression of phenylalanine ammonia lyase (PAL), γ-tocopherol methyltransferase (γ-TMT) and proline dehydrogenase (ProDH) genes, phytohormone levels such as abscisic acid (ABA), gibberellic acid (GA), indole acetic acid (IAA) and salicylic acid (SA), soluble sugars and organic acids were recorded. It was found that Pro alleviated the oxidative damage in the seedlings of lettuce as demonstrated by lower lipid peroxidation and H 2 O 2 content, increasing the endogenous Pro level, the activity of antioxidant enzymes, total phenolic concentration and the antioxidant capacity. Additionally, it was revealed that exogenous application of Pro enhanced the levels of GA, IAA, the concentrations of soluble sugars and organic acids and expressions of PAL, γ-TMT and ProDH genes as compared to the control. The results obtained in this study suggest that pre-treatment with exogenous Pro provides important contributions to the increase in the UV-B tolerance of lettuce by regulating the biochemical mechanisms of UV-B response.

The A31P missense mutation in cardiac myosin binding protein C alters protein structure but does not cause haploinsufficiency.

PubMed

van Dijk, Sabine J; Bezold Kooiker, Kristina; Mazzalupo, Stacy; Yang, Yuanzhang; Kostyukova, Alla S; Mustacich, Debbie J; Hoye, Elaine R; Stern, Joshua A; Kittleson, Mark D; Harris, Samantha P

2016-07-01

Mutations in MYBPC3, the gene encoding cardiac myosin binding protein C (cMyBP-C), are a major cause of hypertrophic cardiomyopathy (HCM). While most mutations encode premature stop codons, missense mutations causing single amino acid substitutions are also common. Here we investigated effects of a single proline for alanine substitution at amino acid 31 (A31P) in the C0 domain of cMyBP-C, which was identified as a natural cause of HCM in cats. Results using recombinant proteins showed that the mutation disrupted C0 structure, altered sensitivity to trypsin digestion, and reduced recognition by an antibody that preferentially recognizes N-terminal domains of cMyBP-C. Western blots detecting A31P cMyBP-C in myocardium of cats heterozygous for the mutation showed a reduced amount of A31P mutant protein relative to wild-type cMyBP-C, but the total amount of cMyBP-C was not different in myocardium from cats with or without the A31P mutation indicating altered rates of synthesis/degradation of A31P cMyBP-C. Also, the mutant A31P cMyBP-C was properly localized in cardiac sarcomeres. These results indicate that reduced protein expression (haploinsufficiency) cannot account for effects of the A31P cMyBP-C mutation and instead suggest that the A31P mutation causes HCM through a poison polypeptide mechanism that disrupts cMyBP-C or myocyte function. Copyright © 2016 Elsevier Inc. All rights reserved.

Influence of NaCl on Growth, Proline, and Phosphoenolpyruvate Carboxylase Levels in Mesembryanthemum crystallinum Suspension Cultures 1

PubMed Central

Thomas, John C.; De Armond, Richard L.; Bohnert, Hans J.

1992-01-01

The facultative halophyte Mesembryanthemum crystallinum responds to salt stress by increasing the levels of phosphoenolpyruvate carboxylase (PEPCase) and other enzymes associated with Crassulacean acid metabolism. A more common response to salt stress in sensitive and tolerant species, including M. crystallinum, is the accumulation of proline. We have established M. crystallinum suspension cultures to investigate whether both these salt-induced responses occur at the cellular level. Leaf-and root-derived cultures maintain 5% of the total soluble amino acids as proline. Cell culture growth slows upon addition of 400 millimolar NaCl, and proline levels increase to 40% of the total soluble amino acids. These results suggest a functional salt-stress and response program in Mesembryanthemum cells. Suspension cultures grown with or without 400 millimolar NaCl have PEPCase levels that compare with those from roots and unstressed leaves. The predominant protein cross-reacting with an anti-PEPCase antibody corresponds to 105 kilodaltons (apparent molecular mass), whereas a second species of approximately 110 kilodaltons is present at low levels. In salt-stressed leaves, the 110 kilodalton protein is more prevalent. Levels of mRNA for both ppc1 (salt stress induced in leaves) and ppc2 (constitutive) genes in salt-treated suspensions cultures are equal to unstressed leaves, and only twice the levels found in untreated suspension cultures. Whereas cells accumulate proline in response to NaCl, PEPCase protein amounts remain similar in salt-treated and untreated cultures. The induction upon salt stress of the 110 kilodalton PEPCase protein and other Crassulacean acid metabolism enzymes in organized tissues is not observed in cell culture and may depend on tissue-dependent or photoautotrophy-dependent programs. ImagesFigure 4Figure 5 PMID:16668687

Transcriptomic and metabolomic analysis of Yukon Thellungiella plants grown in cabinets and their natural habitat show phenotypic plasticity

PubMed Central

2012-01-01

Background Thellungiella salsuginea is an important model plant due to its natural tolerance to abiotic stresses including salt, cold, and water deficits. Microarray and metabolite profiling have shown that Thellungiella undergoes stress-responsive changes in transcript and organic solute abundance when grown under controlled environmental conditions. However, few reports assess the capacity of plants to display stress-responsive traits in natural habitats where concurrent stresses are the norm. Results To determine whether stress-responsive changes observed in cabinet-grown plants are recapitulated in the field, we analyzed leaf transcript and metabolic profiles of Thellungiella growing in its native Yukon habitat during two years of contrasting meteorological conditions. We found 673 genes showing differential expression between field and unstressed, chamber-grown plants. There were comparatively few overlaps between genes expressed under field and cabinet treatment-specific conditions. Only 20 of 99 drought-responsive genes were expressed both in the field during a year of low precipitation and in plants subjected to drought treatments in cabinets. There was also a general pattern of lower abundance among metabolites found in field plants relative to control or stress-treated plants in growth cabinets. Nutrient availability may explain some of the observed differences. For example, proline accumulated to high levels in cold and salt-stressed cabinet-grown plants but proline content was, by comparison, negligible in plants at a saline Yukon field site. We show that proline accumulated in a stress-responsive manner in Thellungiella plants salinized in growth cabinets and in salt-stressed seedlings when nitrogen was provided at 1.0 mM. In seedlings grown on 0.1 mM nitrogen medium, the proline content was low while carbohydrates increased. The relatively higher content of sugar-like compounds in field plants and seedlings on low nitrogen media suggests that Thellungiella shows metabolic plasticity in response to environmental stress and that resource availability can influence the expression of stress tolerance traits under field conditions. Conclusion Comparisons between Thellungiella plants responding to stress in cabinets and in their natural habitats showed differences but also overlap between transcript and metabolite profiles. The traits in common offer potential targets for improving crops that must respond appropriately to multiple, concurrent stresses. PMID:23025749

Physiological and Molecular Responses to Excess Boron in Citrus macrophylla W.

PubMed

Martínez-Cuenca, Mary-Rus; Martínez-Alcántara, Belén; Quiñones, Ana; Ruiz, Marta; Iglesias, Domingo J; Primo-Millo, Eduardo; Forner-Giner, M Ángeles

2015-01-01

This work provides insight into several mechanisms involved in boron (B) regulation pathway in response to high B conditions in Citrus. The study was carried out in Citrus macrophylla W. (Cm) seedlings cultured "in vitro" in media with 50 or 400 μM H3BO3 (control, Ct, and B-excess, +B, plants, respectively). Growth parameters, B concentration, leaf chlorophyll (Chl) concentration, the expression of the main putative genes involved in B transport and distribution, and leaf and root proline and malonaldehyde (MDA) concentrations, were assessed. Excess B led to high B concentration in +B plants (3.8- and 1.4-fold in leaves and roots, respectively) when compared with Ct ones. However, a minor effect was recorded in the plant (incipient visual symptoms, less than 27% reduction in root growth and 26% decrease in Chl b concentration). B toxicity down-regulated by half the expression level of putative B transporter genes NIP5 and PIP1. CmBOR1 gene was not repressed in +B plants and B accumulated in the shoots. High B level increased the transcripts of putative gene TIP5, involved in B transport across the tonoplast, by 3.3- and 2.4-fold in leaves and roots, respectively. The activity of V-PPiase proton pump, related with the electrochemical gradient in the vacuole, was also enhanced in +B organs. B toxicity up-regulated putative BOR4 gene (2.1- and 2.7-fold in roots and leaves, respectively), which codifies for an active efflux B transporter. Accordingly, B was located in +B plants preferently in an insoluble form on cell walls. Finally, excess B caused a significant rise in proline concentration (51% and 34% in roots and leaves, respectively), while the MDA level did not exceed 20%. In conclusion, Cm tolerance to a high B level is likely based on the synergism of several specific mechanisms against B toxicity, including: 1/ down-regulation of NIP5 and PIP1 boron transporters; 2/ activation of B efflux from cells due to the up-regulation of putative BOR4 gene; 3/ compartmentation of B in the vacuole through TIP5 transporter activation and the acidification of the organelle; 4/ insolubilisation of B and deposition in cell walls preventing from cytoplasm damage; and, 5/ induction of an efficient antioxidant system through proline accumulation.

Physiological and Molecular Responses to Excess Boron in Citrus macrophylla W

PubMed Central

Martínez-Cuenca, Mary-Rus; Martínez-Alcántara, Belén; Quiñones, Ana; Ruiz, Marta; Iglesias, Domingo J.; Primo-Millo, Eduardo; Forner-Giner, M. Ángeles

2015-01-01

This work provides insight into several mechanisms involved in boron (B) regulation pathway in response to high B conditions in Citrus. The study was carried out in Citrus macrophylla W. (Cm) seedlings cultured “in vitro” in media with 50 or 400 μM H3BO3 (control, Ct, and B-excess, +B, plants, respectively). Growth parameters, B concentration, leaf chlorophyll (Chl) concentration, the expression of the main putative genes involved in B transport and distribution, and leaf and root proline and malonaldehyde (MDA) concentrations, were assessed. Excess B led to high B concentration in +B plants (3.8- and 1.4-fold in leaves and roots, respectively) when compared with Ct ones. However, a minor effect was recorded in the plant (incipient visual symptoms, less than 27% reduction in root growth and 26% decrease in Chl b concentration). B toxicity down-regulated by half the expression level of putative B transporter genes NIP5 and PIP1. CmBOR1 gene was not repressed in +B plants and B accumulated in the shoots. High B level increased the transcripts of putative gene TIP5, involved in B transport across the tonoplast, by 3.3- and 2.4-fold in leaves and roots, respectively. The activity of V-PPiase proton pump, related with the electrochemical gradient in the vacuole, was also enhanced in +B organs. B toxicity up-regulated putative BOR4 gene (2.1- and 2.7-fold in roots and leaves, respectively), which codifies for an active efflux B transporter. Accordingly, B was located in +B plants preferently in an insoluble form on cell walls. Finally, excess B caused a significant rise in proline concentration (51% and 34% in roots and leaves, respectively), while the MDA level did not exceed 20%. In conclusion, Cm tolerance to a high B level is likely based on the synergism of several specific mechanisms against B toxicity, including: 1/ down-regulation of NIP5 and PIP1 boron transporters; 2/ activation of B efflux from cells due to the up-regulation of putative BOR4 gene; 3/ compartmentation of B in the vacuole through TIP5 transporter activation and the acidification of the organelle; 4/ insolubilisation of B and deposition in cell walls preventing from cytoplasm damage; and, 5/ induction of an efficient antioxidant system through proline accumulation. PMID:26225859

A mutational analysis of the cytosolic domain of the tomato Cf-9 disease-resistance protein shows that membrane-proximal residues are important for Avr9-dependent necrosis.

PubMed

Chakrabarti, Apratim; Velusamy, Thilaga; Tee, Choon Yang; Jones, David A

2016-05-01

The tomato Cf-9 gene encodes a membrane-anchored glycoprotein that imparts race-specific resistance against the tomato leaf mould fungus Cladosporium fulvum in response to the avirulence protein Avr9. Although the N-terminal half of the extracellular leucine-rich repeat (eLRR) domain of the Cf-9 protein determines its specificity for Avr9, the C-terminal half, including its small cytosolic domain, is postulated to be involved in signalling. The cytosolic domain of Cf-9 carries several residues that are potential sites for ubiquitinylation or phosphorylation, or signals for endocytic uptake. A targeted mutagenesis approach was employed to investigate the roles of these residues and cellular processes in Avr9-dependent necrosis triggered by Cf-9. Our results indicate that the membrane-proximal region of the cytosolic domain of Cf-9 plays an important role in Cf-9-mediated necrosis, and two amino acids within this region, a threonine (T835) and a proline (P838), are particularly important for Cf-9 function. An alanine mutation of T835 had no effect on Cf-9 function, but an aspartic acid mutation, which mimics phosphorylation, reduced Cf-9 function. We therefore postulate that phosphorylation/de-phosphorylation of T835 could act as a molecular switch to determine whether Cf-9 is in a primed or inactive state. Yeast two-hybrid analysis was used to show that the cytosolic domain of Cf-9 interacts with the cytosolic domain of tomato VAP27. This interaction could be disrupted by an alanine mutation of P838, whereas interaction with CITRX remained unaffected. We therefore postulate that a proline-induced kink in the membrane-proximal region of the cytosolic domain of Cf-9 may be important for interaction with VAP27, which may, in turn, be important for Cf-9 function. © 2015 BSPP AND JOHN WILEY & SONS LTD.

“Slow VISA,” a Novel Phenotype of Vancomycin Resistance, Found In Vitro in Heterogeneous Vancomycin-Intermediate Staphylococcus aureus Strain Mu3

PubMed Central

Saito, Michie; Katayama, Yuki; Hishinuma, Tomomi; Iwamoto, Akira; Aiba, Yoshifumi; Kuwahara-Arai, Kyoko; Cui, Longzhu; Matsuo, Miki; Aritaka, Nanae

2014-01-01

Heterogeneous vancomycin-intermediate Staphylococcus aureus (hVISA) clinical strain Mu3 spontaneously generates VISA strains at an extremely high frequency (≥1 × 10−6). The generated VISA strains usually grow more slowly than does the parent hVISA strain, but they form colonies on vancomycin-containing agar plates before 48 h of incubation. However, we noticed a curious group of VISA strains, designated “slow VISA” (sVISA), whose colonies appear only after 72 h of incubation. They have extremely prolonged doubling times but have vancomycin MICs of 8 to ∼24 mg/liter when determined after 72 to ∼144 h of incubation. We established strain Mu3-6R-P (6R-P), which has a vancomycin MIC of 16 mg/liter (at 72 h), as a representative sVISA strain. Its cell wall was thickened and autolytic activity was decreased compared to the respective qualities of the parent hVISA strain Mu3. Whole-genome sequencing of 6R-P revealed only one mutation, encoded by rpoB (R512P), which replaced the 512th arginine of the RNA polymerase β-subunit with proline. Its VISA phenotype was unstable, and the strain frequently reverted to hVISA with concomitant losses of pinpoint colony morphology and cell wall thickness and reduced autolytic activity. Sequencing of the rpoB genes of the phenotypic revertant strains revealed mutations affecting the 512th codon, where the proline of 6R-P was replaced with leucine, serine, or histidine. Slow VISA generated in the tissues of an infected patient serves as a temporary shelter for hVISA to survive vancomycin therapy. The sVISA strain spontaneously returns to hVISA when the threat of vancomycin is lifted. The rpoB(R512P) mutation may be regarded as a regulatory mutation that switches the reversible phenotype of sVISA on and off. PMID:24841271

"Slow VISA," a novel phenotype of vancomycin resistance, found in vitro in heterogeneous vancomycin-intermediate Staphylococcus aureus strain Mu3.

PubMed

Saito, Michie; Katayama, Yuki; Hishinuma, Tomomi; Iwamoto, Akira; Aiba, Yoshifumi; Kuwahara-Arai, Kyoko; Cui, Longzhu; Matsuo, Miki; Aritaka, Nanae; Hiramatsu, Keiichi

2014-09-01

Heterogeneous vancomycin-intermediate Staphylococcus aureus (hVISA) clinical strain Mu3 spontaneously generates VISA strains at an extremely high frequency (≥1×10(-6)). The generated VISA strains usually grow more slowly than does the parent hVISA strain, but they form colonies on vancomycin-containing agar plates before 48 h of incubation. However, we noticed a curious group of VISA strains, designated "slow VISA" (sVISA), whose colonies appear only after 72 h of incubation. They have extremely prolonged doubling times but have vancomycin MICs of 8 to ∼24 mg/liter when determined after 72 to ∼144 h of incubation. We established strain Mu3-6R-P (6R-P), which has a vancomycin MIC of 16 mg/liter (at 72 h), as a representative sVISA strain. Its cell wall was thickened and autolytic activity was decreased compared to the respective qualities of the parent hVISA strain Mu3. Whole-genome sequencing of 6R-P revealed only one mutation, encoded by rpoB (R512P), which replaced the 512th arginine of the RNA polymerase β-subunit with proline. Its VISA phenotype was unstable, and the strain frequently reverted to hVISA with concomitant losses of pinpoint colony morphology and cell wall thickness and reduced autolytic activity. Sequencing of the rpoB genes of the phenotypic revertant strains revealed mutations affecting the 512th codon, where the proline of 6R-P was replaced with leucine, serine, or histidine. Slow VISA generated in the tissues of an infected patient serves as a temporary shelter for hVISA to survive vancomycin therapy. The sVISA strain spontaneously returns to hVISA when the threat of vancomycin is lifted. The rpoB(R512P) mutation may be regarded as a regulatory mutation that switches the reversible phenotype of sVISA on and off. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

PubMed

Chen, Y M; Zhu, Y; Lin, E C

1987-12-01

In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

R521C and R521H mutations in FUS result in weak binding with Karyopherinβ2 leading to Amyotrophic lateral sclerosis: a molecular docking and dynamics study.

PubMed

Swetha, Rayapadi G; Ramaiah, Sudha; Anbarasu, Anand

2017-08-01

Fused in sarcoma (FUS) gene encodes the RNA binding protein FUS. This gene is mapped to chromosome 16p11.2. The FUS protein binds with karyopherineβ2 (Kapβ2) through its proline/tyrosine nuclear localization signal (PY-NLS) that helps in the localization of FUS protein within the nucleus. Arginine residue in 521 position (R521) of PY-NLS plays a vital role in the binding of FUS protein with Kapβ2. Mutations in this position (R521C and R521H) are the most predominant mutations associated with amyotrophic lateral sclerosis (ALS). However, the mechanism by which these mutations lead to ALS is poorly understood. We examined the binding behaviour of the mutants FUS (R521C) and FUS (R521H) with Kapβ2 through protein-protein docking and molecular dynamics simulation. The binding patterns of mutants were compared with the binding behaviour of wild FUS-Kapβ2. Our results suggest that these mutants have relatively weak binding affinity with Kapβ2 when compared with wild FUS-Kapβ2 as indicated by the lesser number of interactions found between the mutant FUS and Kapβ2. Hence, these mutations weakens the binding and this results in the cytoplasmic mislocalization of mutant FUS; and thereby it increases the severity of ALS.

Evolutionary Characteristics of Missing Proteins: Insights into the Evolution of Human Chromosomes Related to Missing-Protein-Encoding Genes.

PubMed

Xu, Aishi; Li, Guang; Yang, Dong; Wu, Songfeng; Ouyang, Hongsheng; Xu, Ping; He, Fuchu

2015-12-04

Although the "missing protein" is a temporary concept in C-HPP, the biological information for their "missing" could be an important clue in evolutionary studies. Here we classified missing-protein-encoding genes into two groups, the genes encoding PE2 proteins (with transcript evidence) and the genes encoding PE3/4 proteins (with no transcript evidence). These missing-protein-encoding genes distribute unevenly among different chromosomes, chromosomal regions, or gene clusters. In the view of evolutionary features, PE3/4 genes tend to be young, spreading at the nonhomology chromosomal regions and evolving at higher rates. Interestingly, there is a higher proportion of singletons in PE3/4 genes than the proportion of singletons in all genes (background) and OTCSGs (organ, tissue, cell type-specific genes). More importantly, most of the paralogous PE3/4 genes belong to the newly duplicated members of the paralogous gene groups, which mainly contribute to special biological functions, such as "smell perception". These functions are heavily restricted into specific type of cells, tissues, or specific developmental stages, acting as the new functional requirements that facilitated the emergence of the missing-protein-encoding genes during evolution. In addition, the criteria for the extremely special physical-chemical proteins were first set up based on the properties of PE2 proteins, and the evolutionary characteristics of those proteins were explored. Overall, the evolutionary analyses of missing-protein-encoding genes are expected to be highly instructive for proteomics and functional studies in the future.

Stress-tolerance of baker's-yeast (Saccharomyces cerevisiae) cells: stress-protective molecules and genes involved in stress tolerance.

PubMed

Shima, Jun; Takagi, Hiroshi

2009-05-29

During the fermentation of dough and the production of baker's yeast (Saccharomyces cerevisiae), cells are exposed to numerous environmental stresses (baking-associated stresses) such as freeze-thaw, high sugar concentrations, air-drying and oxidative stresses. Cellular macromolecules, including proteins, nucleic acids and membranes, are seriously damaged under stress conditions, leading to the inhibition of cell growth, cell viability and fermentation. To avoid lethal damage, yeast cells need to acquire a variety of stress-tolerant mechanisms, for example the induction of stress proteins, the accumulation of stress protectants, changes in membrane composition and repression of translation, and by regulating the corresponding gene expression via stress-triggered signal-transduction pathways. Trehalose and proline are considered to be critical stress protectants, as is glycerol. It is known that these molecules are effective for providing protection against various types of environmental stresses. Modifications of the metabolic pathways of trehalose and proline by self-cloning methods have significantly increased tolerance to baking-associated stresses. To clarify which genes are required for stress tolerance, both a comprehensive phenomics analysis and a functional genomics analysis were carried out under stress conditions that simulated those occurring during the commercial baking process. These analyses indicated that many genes are involved in stress tolerance in yeast. In particular, it was suggested that vacuolar H+-ATPase plays important roles in yeast cells under stress conditions.

Overexpression of a Plasma Membrane-Localized SbSRP-Like Protein Enhances Salinity and Osmotic Stress Tolerance in Transgenic Tobacco

PubMed Central

Udawat, Pushpika; Jha, Rajesh K.; Mishra, Avinash; Jha, Bhavanath

2017-01-01

An obligate halophyte, Salicornia brachiata grows in salt marshes and is considered to be a potential resource of salt- and drought-responsive genes. It is important to develop an understanding of the mechanisms behind enhanced salt tolerance. To increase this understanding, a novel SbSRP gene was cloned, characterized, over-expressed, and functionally validated in the model plant Nicotiana tabacum. The genome of the halophyte S. brachiata contains two homologs of an intronless SbSRP gene of 1,262 bp in length that encodes for a stress-related protein. An in vivo localization study confirmed that SbSRP is localized on the plasma membrane. Transgenic tobacco plants (T1) that constitutively over-express the SbSRP gene showed improved salinity and osmotic stress tolerance. In comparison to Wild Type (WT) and Vector Control (VC) plants, transgenic lines showed elevated relative water and chlorophyll content, lower malondialdehyde content, lower electrolyte leakage and higher accumulation of proline, free amino acids, sugars, polyphenols, and starch under abiotic stress treatments. Furthermore, a lower build-up of H2O2 content and superoxide-radicals was found in transgenic lines compared to WT and VC plants under stress conditions. Transcript expression of Nt-APX (ascorbate peroxidase), Nt-CAT (catalase), Nt-SOD (superoxide dismutase), Nt-DREB (dehydration responsive element binding factor), and Nt-AP2 (apetala2) genes was higher in transgenic lines under stress compared to WT and VC plants. The results suggested that overexpression of membrane-localized SbSRP mitigates salt and osmotic stress in the transgenic tobacco plant. It was hypothesized that SbSRP can be a transporter protein to transmit the environmental stimuli downward through the plasma membrane. However, a detailed study is required to ascertain its exact role in the abiotic stress tolerance mechanism. Overall, SbSRP is a potential candidate to be used for engineering salt and osmotic tolerance in crops. PMID:28473839

Stress Inducible Expression of AtDREB1A Transcription Factor in Transgenic Peanut (Arachis hypogaea L.) Conferred Tolerance to Soil-Moisture Deficit Stress

PubMed Central

Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P.; Dobaria, Jentilal R.

2016-01-01

Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity. PMID:27446163

Proline: The Distribution, Frequency, Positioning, and Common Functional Roles of Proline and Polyproline Sequences in the Human Proteome

PubMed Central

Morgan, Alexander A.; Rubenstein, Edward

2013-01-01

Proline is an anomalous amino acid. Its nitrogen atom is covalently locked within a ring, thus it is the only proteinogenic amino acid with a constrained phi angle. Sequences of three consecutive prolines can fold into polyproline helices, structures that join alpha helices and beta pleats as architectural motifs in protein configuration. Triproline helices are participants in protein-protein signaling interactions. Longer spans of repeat prolines also occur, containing as many as 27 consecutive proline residues. Little is known about the frequency, positioning, and functional significance of these proline sequences. Therefore we have undertaken a systematic bioinformatics study of proline residues in proteins. We analyzed the distribution and frequency of 687,434 proline residues among 18,666 human proteins, identifying single residues, dimers, trimers, and longer repeats. Proline accounts for 6.3% of the 10,882,808 protein amino acids. Of all proline residues, 4.4% are in trimers or longer spans. We detected patterns that influence function based on proline location, spacing, and concentration. We propose a classification based on proline-rich, polyproline-rich, and proline-poor status. Whereas singlet proline residues are often found in proteins that display recurring architectural patterns, trimers or longer proline sequences tend be associated with the absence of repetitive structural motifs. Spans of 6 or more are associated with DNA/RNA processing, actin, and developmental processes. We also suggest a role for proline in Kruppel-type zinc finger protein control of DNA expression, and in the nucleation and translocation of actin by the formin complex. PMID:23372670

[Genetic instability of probiotic characteristics in the Bifidobacterium longum subsp. longum B379M strain during cultivation and maintenance].

PubMed

Averina, O V; Nezametdinova, V Z; Alekseeva, M G; Danilenko, V N

2012-11-01

The stability of inheriting several genes in the Russian commercial strain Bifidobacterium longum subsp. longum B379M during cultivation and maintenance under laboratory conditions has been studied. The examined genes code for probiotic characteristics, such as utilization of several sugars (lacA2 gene, encoding beta-galactosidase; ara gene, encoding arabinosidase; and galA gene, encoding arabinogalactan endo-beta-galactosidase); synthesis of bacteriocins (lans gene, encoding lanthionine synthetase); and mobile gene tet(W), conferring resistance to the antibiotic tetracycline. The other gene families studied include the genes responsible for signal transduction and adaptation to stress conditions in the majority of bacteria (serine/threonine protein kinases and the toxin-antitoxin systems of MazEF and RelBE types) and transcription regulators (genes encoding WhiB family proteins). Genomic DNA was analyzed by PCR using specially selected primers. A loss of the genes galA and tet(W) has been shown. It is proposed to expand the requirements on probiotic strains, namely, to control retention of the key probiotic genes using molecular biological methods.

Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

DOEpatents

Jarvis, Eric E.; Roessler, Paul G.

1999-01-01

The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

Human Genomic Signatures of Brain Oscillations During Memory Encoding.

PubMed

Berto, Stefano; Wang, Guang-Zhong; Germi, James; Lega, Bradley C; Konopka, Genevieve

2018-05-01

Memory encoding is an essential step for all learning. However, the genetic and molecular mechanisms underlying human memory encoding remain poorly understood, and how this molecular framework permits the emergence of specific patterns of brain oscillations observed during mnemonic processing is unknown. Here, we directly compare intracranial electroencephalography recordings from the neocortex in individuals performing an episodic memory task with human gene expression from the same areas. We identify genes correlated with oscillatory memory effects across 6 frequency bands. These genes are enriched for autism-related genes and have preferential expression in neurons, in particular genes encoding synaptic proteins and ion channels, supporting the idea that the genes regulating voltage gradients are involved in the modulation of oscillatory patterns during successful memory encoding across brain areas. Memory-related genes are distinct from those correlated with other forms of cognitive processing and resting state fMRI. These data are the first to identify correlations between gene expression and active human brain states as well as provide a molecular window into memory encoding oscillations in the human brain.

Alteration of lysine 178 in the hinge region of the Escherichia coli ada protein interferes with activation of ada, but not alkA, transcription.

PubMed

Saget, B M; Shevell, D E; Walker, G C

1995-03-01

The ada gene of Escherichia coli K-12 encodes the 39-kDa Ada protein, which consists of two domains joined by a hinge region that is sensitive to proteolytic cleavage in vitro. The amino-terminal domain has a DNA methyltransferase activity that repairs the S-diastereoisomer of methylphosphotriesters while the carboxyl-terminal domain has a DNA methyltransferase activity that repairs O6-methylguanine and O4-methylthymine lesions. Transfer of a methyl group to Cys-69 by repair of a methylphosphotriester lesion converts Ada into a transcriptional activator of the ada and alkA genes. Activation of ada, but not alkA, requires elements contained within the carboxyl-terminal domain of Ada. In addition, physiologically relevant concentrations of the unmethylated form of Ada specifically inhibit methylated Ada-promoted ada transcription both in vitro and in vivo and it has been suggested that this phenomenon plays a pivotal role in the down-regulation of the adaptive response. A set of site-directed mutations were generated within the hinge region, changing the lysine residue at position 178 to leucine, valine, glycine, tyrosine, arginine, cysteine, proline, and serine. All eight mutant proteins have deficiencies in their ability to activate ada transcription in the presence or absence of a methylating agent but are proficient in alkA activation. AdaK178P (lysine 178 changed to proline) is completely defective for the transcriptional activation function of ada while it is completely proficient for transcriptional activation of alkA. In addition, AdaK178P possesses both classes of DNA repair activities both in vitro and in vivo. Transcriptional activation of ada does not occur if both the amino- and carboxyl-terminal domains are produced separately within the same cell. The mutation at position 178 might interfere with activation of ada transcription by changing a critical contact with RNA polymerase, by causing a conformational change of Ada, or by interfering with the communication of conformational information between the amino- and the carboxyl-terminal domains. These results indicate that the hinge region of Ada is important for ada but not alkA transcription and further support the notion that the mechanism(s) by which Ada activates ada transcription differs from that by which it activates transcription at alkA.

Proline puckering parameters for collagen structure simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Di, E-mail: diwu@fudan.edu.cn

Collagen is made of triple helices rich in proline residues, and hence is influenced by the conformational motions of prolines. Because the backbone motions of prolines are restricted by the helical structures, the only side chain motion—proline puckering—becomes an influential factor that may affect the stability of collagen structures. In molecular simulations, a proper proline puckering population is desired so to yield valid results of the collagen properties. Here we design the proline puckering parameters in order to yield suitable proline puckering populations as demonstrated in the experimental results. We test these parameters in collagen and the proline dipeptide simulations.more » Compared with the results of the PDB and the quantum calculations, we propose the proline puckering parameters for the selected collagen model simulations.« less

Proline: Mother Nature’s cryoprotectant applied to protein crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.

The amino acid l-proline is shown to be a good cryoprotectant for protein crystals. Four examples are provided; the range of proline used for cryoprotection is 2.0–3.0 M. l-Proline is one of Mother Nature’s cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that l-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included themore » commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6–8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0–3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that l-proline is an effective cryoprotectant for protein crystallography.« less

Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

DOEpatents

Jarvis, E.E.; Roessler, P.G.

1999-07-27

The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities. 8 figs.

Comparative Analysis of the Regulation of Expression and Structures of Two Evolutionarily Divergent Genes for Δ1-Pyrroline-5-Carboxylate Synthetase from Tomato1

PubMed Central

Fujita, Tomomichi; Maggio, Albino; Garcia-Rios, Mario; Bressan, Ray A.; Csonka, Laszlo N.

1998-01-01

We isolated two tomato (Lycopersicon esculentum) cDNA clones, tomPRO1 and tomPRO2, specifying Δ1-pyrroline-5-carboxylate synthetase (P5CS), the first enzyme of proline (Pro) biosynthesis. tomPRO1 is unusual because it resembles prokaryotic polycistronic operons (M.G. García-Ríos, T. Fujita, P.C. LaRosa, R.D. Locy, J.M. Clithero, R.A. Bressan, L.N. Csonka [1997] Proc Natl Acad Sci USA 94: 8249–8254), whereas tomPRO2 encodes a full-length P5CS. We analyzed the accumulation of Pro and the tomPRO1 and tomPRO2 messages in response to NaCl stress and developmental signals. Treatment with 200 mm NaCl resulted in a >60-fold increase in Pro levels in roots and leaves. However, there was a <3-fold increase in the accumulation of the tomPRO2 message and no detectable induction in the level of the tomPRO1 message in response to NaCl stress. Although pollen contained approximately 100-fold higher levels of Pro than other plant tissues, there was no detectable increase in the level of either message in pollen. We conclude that transcriptional regulation of these genes for P5CS is probably not important for the osmotic or pollen-specific regulation of Pro synthesis in tomato. Using restriction fragment-length polymorphism mapping, we determined the locations of tomPRO1 and tomPRO2 loci in the tomato nuclear genome. Sequence comparison suggested that tomPRO1 is similar to prokaryotic P5CS loci, whereas tomPRO2 is closely related to other eukaryotic P5CS genes. PMID:9765552

Multiple functions of the SNARE protein Snap29 in autophagy, endocytic, and exocytic trafficking during epithelial formation in Drosophila.

PubMed

Morelli, Elena; Ginefra, Pierpaolo; Mastrodonato, Valeria; Beznoussenko, Galina V; Rusten, Tor Erik; Bilder, David; Stenmark, Harald; Mironov, Alexandre A; Vaccari, Thomas

2014-01-01

How autophagic degradation is linked to endosomal trafficking routes is little known. Here we screened a collection of uncharacterized Drosophila mutants affecting membrane transport to identify new genes that also have a role in autophagy. We isolated a loss of function mutant in Snap29 (Synaptosomal-associated protein 29 kDa), the gene encoding the Drosophila homolog of the human protein SNAP29 and have characterized its function in vivo. Snap29 contains 2 soluble NSF attachment protein receptor (SNARE) domains and a asparagine-proline-phenylalanine (NPF motif) at its N terminus and rescue experiments indicate that both SNARE domains are required for function, whereas the NPF motif is in part dispensable. We find that Snap29 interacts with SNARE proteins, localizes to multiple trafficking organelles, and is required for protein trafficking and for proper Golgi apparatus morphology. Developing tissue lacking Snap29 displays distinctive epithelial architecture defects and accumulates large amounts of autophagosomes, highlighting a major role of Snap29 in autophagy and secretion. Mutants for autophagy genes do not display epithelial architecture or secretion defects, suggesting that the these alterations of the Snap29 mutant are unlikely to be caused by the impairment of autophagy. In contrast, we find evidence of elevated levels of hop-Stat92E (hopscotch-signal transducer and activator of transcription protein at 92E) ligand, receptor, and associated signaling, which might underlie the epithelial defects. In summary, our findings support a role of Snap29 at key steps of membrane trafficking, and predict that signaling defects may contribute to the pathogenesis of cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma (CEDNIK), a human congenital syndrome due to loss of Snap29.

Tocopherol deficiency reduces sucrose export from salt-stressed potato leaves independently of oxidative stress and symplastic obstruction by callose

PubMed Central

Asensi-Fabado, María Amparo; Ammon, Alexandra; Sonnewald, Uwe; Munné-Bosch, Sergi; Voll, Lars M.

2015-01-01

Tocopherol cyclase, encoded by the gene SUCROSE EXPORT DEFECTIVE1, catalyses the second step in the synthesis of the antioxidant tocopherol. Depletion of SXD1 activity in maize and potato leaves leads to tocopherol deficiency and a ‘sugar export block’ phenotype that comprises massive starch accumulation and obstruction of plasmodesmata in paraveinal tissue by callose. We grew two transgenic StSXD1:RNAi potato lines with severe tocopherol deficiency under moderate light conditions and subjected them to salt stress. After three weeks of salt exposure, we observed a strongly reduced sugar exudation rate and a lack of starch mobilization in leaves of salt-stressed transgenic plants, but not in wild-type plants. However, callose accumulation in the vasculature declined upon salt stress in all genotypes, indicating that callose plugging of plasmodesmata was not the sole cause of the sugar export block phenotype in tocopherol-deficient leaves. Based on comprehensive gene expression analyses, we propose that enhanced responsiveness of SnRK1 target genes in mesophyll cells and altered redox regulation of phloem loading by SUT1 contribute to the attenuation of sucrose export from salt-stressed SXD:RNAi source leaves. Furthermore, we could not find any indication that elevated oxidative stress may have served as a trigger for the salt-induced carbohydrate phenotype of SXD1:RNAi transgenic plants. In leaves of the SXD1:RNAi plants, sodium accumulation was diminished, while proline accumulation and pools of soluble antioxidants were increased. As supported by phytohormone contents, these differences seem to increase longevity and prevent senescence of SXD:RNAi leaves under salt stress. PMID:25428995

Allelic variation of the Tas1r3 taste receptor gene selectively affects taste responses to sweeteners: evidence from 129.B6-Tas1r3 congenic mice

PubMed Central

Inoue, Masashi; Glendinning, John I.; Theodorides, Maria L.; Harkness, Sarah; Li, Xia; Bosak, Natalia; Beauchamp, Gary K.; Bachmanov, Alexander A.

2008-01-01

The Tas1r3 gene encodes the T1R3 receptor protein, which is involved in sweet taste transduction. To characterize ligand specificity of the T1R3 receptor and the genetic architecture of sweet taste responsiveness, we analyzed taste responses of 129.B6-Tas1r3 congenic mice to a variety of chemically diverse sweeteners and glucose polymers with three different measures: consumption in 48-h two-bottle preference tests, initial licking responses, and responses of the chorda tympani nerve. The results were generally consistent across the three measures. Allelic variation of the Tas1r3 gene influenced taste responsiveness to nonnutritive sweeteners (saccharin, acesulfame-K, sucralose, SC-45647), sugars (sucrose, maltose, glucose, fructose), sugar alcohols (erythritol, sorbitol), and some amino acids (d-tryptophan, d-phenylalanine, l-proline). Tas1r3 genotype did not affect taste responses to several sweet-tasting amino acids (l-glutamine, l-threonine, l-alanine, glycine), glucose polymers (Polycose, maltooligosaccharide), and nonsweet NaCl, HCl, quinine, monosodium glutamate, and inosine 5′-monophosphate. Thus Tas1r3 polymorphisms affect taste responses to many nutritive and nonnutritive sweeteners (all of which must interact with a taste receptor involving T1R3), but not to all carbohydrates and amino acids. In addition, we found that the genetic architecture of sweet taste responsiveness changes depending on the measure of taste response and the intensity of the sweet taste stimulus. Variation in the T1R3 receptor influenced peripheral taste responsiveness over a wide range of sweetener concentrations, but behavioral responses to higher concentrations of some sweeteners increasingly depended on mechanisms that could override input from the peripheral taste system. PMID:17911381

Allelic Variation of the Tas1r3 Taste Receptor Gene Selectively Affects Behavioral and Neural Taste Responses to Sweeteners in the F2 Hybrids between C57BL/6ByJ and 129P3/J Mice

PubMed Central

Inoue, Masashi; Reed, Danielle R.; Li, Xia; Tordoff, Michael G.; Beauchamp, Gary K.; Bachmanov, Alexander A.

2006-01-01

Recent studies have shown that the T1R3 receptor protein encoded by the Tas1r3 gene is involved in transduction of sweet taste. To assess ligand specificity of the T1R3 receptor, we analyzed the association of Tas1r3 allelic variants with taste responses in mice. In the F2 hybrids between the C57BL/6ByJ (B6) and 129P3/J (129) inbred mouse strains, we determined genotypes of markers on chromosome 4, where Tas1r3 resides, measured consumption of taste solutions presented in two-bottle preference tests, and recorded integrated responses of the chorda tympani gustatory nerve to lingual application of taste stimuli. For intakes and preferences, significant linkages to Tas1r3 were found for the sweeteners sucrose, saccharin, and d-phenylalanine but not glycine. For chorda tympani responses, significant linkages to Tas1r3 were found for the sweeteners sucrose, saccharin, d-phenylalanine, d-tryptophan, and SC-45647 but not glycine, l-proline, l-alanine, or l-glutamine. No linkages to distal chromosome 4 were detected for behavioral or neural responses to non-sweet quinine, citric acid, HCl, NaCl, KCl, monosodium glutamate, inosine 5′-monophosphate, or ammonium glutamate. These results demonstrate that allelic variation of the Tas1r3 gene affects gustatory neural and behavioral responses to some, but not all, sweeteners. This study describes the range of ligand sensitivity of the T1R3 receptor using an in vivo approach and, to our knowledge, is the first genetic mapping study of activity in gustatory nerves. PMID:14999080

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

Evolutionary analysis of hydrophobin gene family in two wood-degrading basidiomycetes, Phlebia brevispora and Heterobasidion annosum s.l.

PubMed Central

2013-01-01

Background Hydrophobins are small secreted cysteine-rich proteins that play diverse roles during different phases of fungal life cycle. In basidiomycetes, hydrophobin-encoding genes often form large multigene families with up to 40 members. The evolutionary forces driving hydrophobin gene expansion and diversification in basidiomycetes are poorly understood. The functional roles of individual genes within such gene families also remain unclear. The relationship between the hydrophobin gene number, the genome size and the lifestyle of respective fungal species has not yet been thoroughly investigated. Here, we present results of our survey of hydrophobin gene families in two species of wood-degrading basidiomycetes, Phlebia brevispora and Heterobasidion annosum s.l. We have also investigated the regulatory pattern of hydrophobin-encoding genes from H. annosum s.s. during saprotrophic growth on pine wood as well as on culture filtrate from Phlebiopsis gigantea using micro-arrays. These data are supplemented by results of the protein structure modeling for a representative set of hydrophobins. Results We have identified hydrophobin genes from the genomes of two wood-degrading species of basidiomycetes, Heterobasidion irregulare, representing one of the microspecies within the aggregate H. annosum s.l., and Phlebia brevispora. Although a high number of hydrophobin-encoding genes were observed in H. irregulare (16 copies), a remarkable expansion of these genes was recorded in P. brevispora (26 copies). A significant expansion of hydrophobin-encoding genes in other analyzed basidiomycetes was also documented (1–40 copies), whereas contraction through gene loss was observed among the analyzed ascomycetes (1–11 copies). Our phylogenetic analysis confirmed the important role of gene duplication events in the evolution of hydrophobins in basidiomycetes. Increased number of hydrophobin-encoding genes appears to have been linked to the species’ ecological strategy, with the non-pathogenic fungi having increased numbers of hydrophobins compared with their pathogenic counterparts. However, there was no significant relationship between the number of hydrophobin-encoding genes and genome size. Furthermore, our results revealed significant differences in the expression levels of the 16 H. annosum s.s. hydrophobin-encoding genes which suggest possible differences in their regulatory patterns. Conclusions A considerable expansion of the hydrophobin-encoding genes in basidiomycetes has been observed. The distribution and number of hydrophobin-encoding genes in the analyzed species may be connected to their ecological preferences. Results of our analysis also have shown that H. annosum s.l. hydrophobin-encoding genes may be under positive selection. Our gene expression analysis revealed differential expression of H. annosum s.s. hydrophobin genes under different growth conditions, indicating their possible functional diversification. PMID:24188142

Glutathione S-transferase-encoding gene as a potential probe for environmental bacterial isolates capable of degrading polycyclic aromatic hydrocarbons.

PubMed Central

Lloyd-Jones, G; Lau, P C

1997-01-01

Homologs of the glutathione S-transferase (GST)-encoding gene were identified in a collection of aromatic hydrocarbon-degrading Sphingomonas spp. isolated from New Zealand, Antarctica, and the United States by using PCR primers designed from the GST-encoding gene of Sphingomonas paucimobilis EPA505. Sequence analysis of PCR fragments generated from these isolates and of the GST gene amplified from DNA extracted from polycyclic aromatic hydrocarbon (PAH)-contaminated soil revealed a high degree of conservation, which may make the GST-encoding gene a potentially useful marker for PAH-degrading bacteria. PMID:9251217

Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

PubMed

Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

2013-02-01

Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

Proline derivatives in fruits of bergamot (Citrus bergamia Risso et Poit): presence of N-methyl-L-proline and 4-hydroxy-L-prolinebetaine.

PubMed

Servillo, Luigi; Giovane, Alfonso; Balestrieri, Maria Luisa; Cautela, Domenico; Castaldo, Domenico

2011-01-12

The content of proline and various compounds deriving from its metabolism (4-hydroxy-L-proline, N-methyl-L-proline, N,N-dimethylproline, and 4-hydroxy-L-prolinebetaine) was determined in fruits and seeds of Bergamot (Citrus bergamia Risso et Poit), growing in the Calabria region (South Italy). A HPLC-ESI-tandem mass spectrometry method, which allowed rapid determination of L-proline, 4-hydroxy-L-proline, N-methyl-L-proline, N,N-dimethylproline, and 4-hydroxy-L-prolinebetaine in juice and extracts of bergamot fruit with minimum sample preparation and short analysis time (about 10 min), is presented. Proline and 4-hydroxy-L-proline levels in the samples were also determined by HPLC analysis with fluorescence detection and the results compared to those obtained with HPLC-ESI-tandem mass spectrometry. For the first time, the presence of N-methyl-L-proline and 4-hydroxy-L-prolinebetaine in the fruits of a plant of the Citrus genus is reported.

Proline: Mother Nature;s cryoprotectant applied to protein crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.

L-Proline is one of Mother Nature's cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that L-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6-8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration neededmore » for cryoprotection of these crystals is in the range 2.0-3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that L-proline is an effective cryoprotectant for protein crystallography.« less

Proline: Mother Nature’s cryoprotectant applied to protein crystallography

PubMed Central

Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.; Singh, Harkewal; Srivastava, Dhiraj; Tanner, John J.

2012-01-01

l-Proline is one of Mother Nature’s cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that l-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6–8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0–3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that l-proline is an effective cryoprotectant for protein crystallography. PMID:22868767

Expression profiling of Ribosomal Protein gene family in dehydration stress responses and characterization of transgenic rice plants overexpressing RPL23A for water-use efficiency and tolerance to drought and salt stresses

NASA Astrophysics Data System (ADS)

Moin, Mazahar; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

2017-11-01

Our previous findings on the screening of a large-pool of activation tagged rice plants grown under limited water conditions revealed the activation of Ribosomal Protein Large (RPL) subunit genes, RPL6 and RPL23A in two mutants that exhibited high water-use efficiency (WUE) with the genes getting activated by the integrated 4x enhancers (Moin et al., 2016a). In continuation of these findings, we have comprehensively characterized the Ribosomal Protein (RP) gene family including both small (RPS) and large (RPL) subunits, which have been identified to be encoded by at least 70 representative genes; RP-genes exist as multiple expressed copies with high nucleotide and amino acid sequence similarity. The differential expression of all the representative genes in rice was performed under limited water and drought conditions at progressive time intervals in the present study. More than 50% of the RP genes were upregulated in both shoot and root tissues. Some of them exhibited an overlap in the upregulation under both the treatments indicating that they might have a common role in inducing tolerance under limited water and drought conditions. Among the genes that became significantly upregulated in both the tissues and under both the treatments are RPL6, 7, 23A, 24 and 31 and RPS4, 10 and 18a. To further validate the role of RP genes in WUE and inducing tolerance to other stresses, we have raised transgenic plants overexpressing RPL23A in rice. The high expression lines of RPL23A exhibited low Δ13C, increased quantum efficiency along with suitable growth and yield parameters with respect to negative control under the conditions of limited water availability. The constitutive expression of RPL23A was also associated with transcriptional upregulation of many other RPL and RPS genes. The seedlings of RPL23A high expression lines also showed a significant increase in fresh weight, root length, proline and chlorophyll contents under simulated drought and salt stresses. Taken together, our findings provide a secure basis for the RPL gene family expression as a potential resource for exploring abiotic stress tolerant properties in rice.

Recessive constitutive mutant Chinese hamster ovary cells (CHO-K1) with an altered A system for amino acid transport and the mechanism of gene regulation of the A system.

PubMed Central

Moffett, J; Englesberg, E

1984-01-01

Chinese hamster ovary cells (CHO-K1) starved for 24 h for amino acids show a severalfold increase in velocity of proline transport through the A system (Vmax is five times that of unstarved cells). This increase is inhibited by cycloheximide, actinomycin D, N-methyl-alpha-amino isobutyric acid (MeAIB, a non-metabolizable specific A system amino acid analog), and by other amino acids that are generally transported by the A system. However, transport by the A system is not a prerequisite for this repression, and all compounds that have affinity for the A system do not necessarily act as "co-repressors." The addition of proline, MeAIB, or other amino acids, as described above, to derepressed cells results in a rapid decrease in A system activity. As shown with proline and MeAIB, this decrease in activity is in part due to a rapid trans-inhibition and a slow, irreversible inactivation of the A system. Neither process is inhibited by cycloheximide or actinomycin D. Alanine antagonizes the growth of CHO-K1 pro cells by preventing proline transport, and alanine-resistant mutants (alar) have been isolated (Moffett et al., Somatic Cell Genet. 9:189-213, 1983). alar2 and alar4 are partial and full constitutive mutants for the A system and have two and six times the Vmax for proline uptake by the A system, respectively. The A system in alar4 is also immune to the co-repressor-induced inactivation. Both alar2 and alar4 phenotypes are recessive. Alar3 shows an increase in Vmax and Km for proline transport through the A system, and this phenotype is codominant. All three mutants have a pleiotropic effect, producing increases in activity of the ASC and P systems of amino acid transport. This increase is not due to an increase in the Na+ gradient. The ASC and P phenotypes behave similarly to the A system in hybrids. A model has been proposed incorporating these results. PMID:6538929

Three copies of a single protein II-encoding sequence in the genome of Neisseria gonorrhoeae JS3: evidence for gene conversion and gene duplication.

PubMed

van der Ley, P

1988-11-01

Gonococci express a family of related outer membrane proteins designated protein II (P.II). These surface proteins are subject to both phase variation and antigenic variation. The P.II gene repertoire of Neisseria gonorrhoeae strain JS3 was found to consist of at least ten genes, eight of which were cloned. Sequence analysis and DNA hybridization studies revealed that one particular P.II-encoding sequence is present in three distinct, but almost identical, copies in the JS3 genome. These genes encode the P.II protein that was previously identified as P.IIc. Comparison of their sequences shows that the multiple copies of this P.IIc-encoding gene might have been generated by both gene conversion and gene duplication.

The puckering free-energy surface of proline

NASA Astrophysics Data System (ADS)

Wu, Di

2013-03-01

Proline has two preferred puckering states, which are often characterized by the pseudorotation phase angle and amplitude. Although proline's five endocyclic torsion angles can be utilized to calculate the phase angle and amplitude, it is not clear if there is any direct correlation between each torsion angle and the proline-puckering pathway. Here we have designed five proline puckering pathways utilizing each torsion angle χj (j = 1˜5) as the reaction coordinate. By examining the free-energy surfaces of the five puckering pathways, we find they can be categorized into two groups. The χ2 pathway (χ2 is about the Cβ—Cγ bond) is especially meaningful in describing proline puckering: it changes linearly with the puckering amplitude and symmetrically with the phase angle. Our results show that this conclusion applies to both trans and cis proline conformations. We have also analyzed the correlations of proline puckering and its backbone torsion angles ϕ and ψ. We show proline has preferred puckering states at the specific regions of ϕ, ψ angles. Interestingly, the shapes of ψ-χ2 free-energy surfaces are similar among the trans proline in water, cis proline in water and cis proline in the gas phase, but they differ substantially from that of the trans proline in the gas phase. Our calculations are conducted using molecular simulations; we also verify our results using the proline conformations selected from the Protein Data Bank. In addition, we have compared our results with those calculated by the quantum mechanical methods.

[Expression changes of major outer membrane protein antigens in Leptospira interrogans during infection and its mechanism].

PubMed

Zheng, Linli; Ge, Yumei; Hu, Weilin; Yan, Jie

2013-03-01

To determine expression changes of major outer membrane protein(OMP) antigens of Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai strain Lai during infection of human macrophages and its mechanism. OmpR encoding genes and OmpR-related histidine kinase (HK) encoding gene of L.interrogans strain Lai and their functional domains were predicted using bioinformatics technique. mRNA level changes of the leptospiral major OMP-encoding genes before and after infection of human THP-1 macrophages were detected by real-time fluorescence quantitative RT-PCR. Effects of the OmpR-encoding genes and HK-encoding gene on the expression of leptospiral OMPs during infection were determined by HK-peptide antiserum block assay and closantel inhibitive assays. The bioinformatics analysis indicated that LB015 and LB333 were referred to OmpR-encoding genes of the spirochete, while LB014 might act as a OmpR-related HK-encoding gene. After the spirochete infecting THP-1 cells, mRNA levels of leptospiral lipL21, lipL32 and lipL41 genes were rapidly and persistently down-regulated (P <0.01), whereas mRNA levels of leptospiral groEL, mce, loa22 and ligB genes were rapidly but transiently up-regulated (P<0.01). The treatment with closantel and HK-peptide antiserum partly reversed the infection-based down-regulated mRNA levels of lipL21 and lipL48 genes (P <0.01). Moreover, closantel caused a decrease of the infection-based up-regulated mRNA levels of groEL, mce, loa22 and ligB genes (P <0.01). Expression levels of L.interrogans strain Lai major OMP antigens present notable changes during infection of human macrophages. There is a group of OmpR-and HK-encoding genes which may play a major role in down-regulation of expression levels of partial OMP antigens during infection.

Transcriptomic analysis of Arabidopsis developing stems: a close-up on cell wall genes

PubMed Central

Minic, Zoran; Jamet, Elisabeth; San-Clemente, Hélène; Pelletier, Sandra; Renou, Jean-Pierre; Rihouey, Christophe; Okinyo, Denis PO; Proux, Caroline; Lerouge, Patrice; Jouanin, Lise

2009-01-01

Background Different strategies (genetics, biochemistry, and proteomics) can be used to study proteins involved in cell biogenesis. The availability of the complete sequences of several plant genomes allowed the development of transcriptomic studies. Although the expression patterns of some Arabidopsis thaliana genes involved in cell wall biogenesis were identified at different physiological stages, detailed microarray analysis of plant cell wall genes has not been performed on any plant tissues. Using transcriptomic and bioinformatic tools, we studied the regulation of cell wall genes in Arabidopsis stems, i.e. genes encoding proteins involved in cell wall biogenesis and genes encoding secreted proteins. Results Transcriptomic analyses of stems were performed at three different developmental stages, i.e., young stems, intermediate stage, and mature stems. Many genes involved in the synthesis of cell wall components such as polysaccharides and monolignols were identified. A total of 345 genes encoding predicted secreted proteins with moderate or high level of transcripts were analyzed in details. The encoded proteins were distributed into 8 classes, based on the presence of predicted functional domains. Proteins acting on carbohydrates and proteins of unknown function constituted the two most abundant classes. Other proteins were proteases, oxido-reductases, proteins with interacting domains, proteins involved in signalling, and structural proteins. Particularly high levels of expression were established for genes encoding pectin methylesterases, germin-like proteins, arabinogalactan proteins, fasciclin-like arabinogalactan proteins, and structural proteins. Finally, the results of this transcriptomic analyses were compared with those obtained through a cell wall proteomic analysis from the same material. Only a small proportion of genes identified by previous proteomic analyses were identified by transcriptomics. Conversely, only a few proteins encoded by genes having moderate or high level of transcripts were identified by proteomics. Conclusion Analysis of the genes predicted to encode cell wall proteins revealed that about 345 genes had moderate or high levels of transcripts. Among them, we identified many new genes possibly involved in cell wall biogenesis. The discrepancies observed between results of this transcriptomic study and a previous proteomic study on the same material revealed post-transcriptional mechanisms of regulation of expression of genes encoding cell wall proteins. PMID:19149885

Heterologous expression and structure-function relationship of low-temperature and alkaline active protease from Acinetobacter sp. IHB B 5011(MN12).

PubMed

Salwan, Richa; Sharma, Vivek; Pal, Mohinder; Kasana, Ramesh Chand; Yadav, Sudesh Kumar; Gulati, Arvind

2018-02-01

The gene encoding protease from Acinetobacter sp. IHB B 5011(MN12) was cloned and expressed in Escherichia coli BL21(DE3). The nucleotide sequence revealed 1323bp ORF encoding 441 amino acids protein with molecular weight 47.2kDa. The phylogenetic analysis showed clustering of Alp protease with subtilisin-like serine proteases of S8 family. The amino acid sequence was comprised of N-terminal signal peptide 1-21 amino acids, pre-peptide 22-143 amino acids, peptidase S8 domain 144-434 amino acids, and pro-peptide 435-441 amino acids at C-terminus. Three constructs with signal peptide pET-Alp, without signal peptide pET-Alp1 and peptidase S8 domain pET-Alp2 were prepared for expression in E. coli BL21(DE3). The recombinant proteins Alp1 and Alp2 expressed as inclusion bodies showed ∼50kDa and ∼40kDa bands, respectively. The pre-propeptide ∼11kDa removed from Alp1 resulted in mature protein of ∼35kDa with 1738Umg -1 specific activity. The recombinant protease was optimally active at 40°C and pH 9, and stable over 10-70°C and 6-12pH. The activity at low-temperature and alkaline pH was supported by high R/(R+K) ratio, more glycine, less proline, negatively charged amino acids, less salt bridges and longer loops. These properties suggested the suitability of Alp as additive in the laundry. Copyright © 2017. Published by Elsevier B.V.

Similarities and differences in the biochemical and enzymological properties of the four isomaltases from Saccharomyces cerevisiae

PubMed Central

Deng, Xu; Petitjean, Marjorie; Teste, Marie-Ange; Kooli, Wafa; Tranier, Samuel; François, Jean Marie; Parrou, Jean-Luc

2014-01-01

The yeast Saccharomyces cerevisiae IMA multigene family encodes four isomaltases sharing high sequence identity from 65% to 99%. Here, we explore their functional diversity, with exhaustive in-vitro characterization of their enzymological and biochemical properties. The four isoenzymes exhibited a preference for the α-(1,6) disaccharides isomaltose and palatinose, with Michaëlis–Menten kinetics and inhibition at high substrates concentration. They were also able to hydrolyze trisaccharides bearing an α-(1,6) linkage, but also α-(1,2), α-(1,3) and α-(1,5) disaccharides including sucrose, highlighting their substrate ambiguity. While Ima1p and Ima2p presented almost identical characteristics, our results nevertheless showed many singularities within this protein family. In particular, Ima3p presented lower activities and thermostability than Ima2p despite only three different amino acids between the sequences of these two isoforms. The Ima3p_R279Q variant recovered activity levels of Ima2p, while the Leu-to-Pro substitution at position 240 significantly increased the stability of Ima3p and supported the role of prolines in thermostability. The most distant protein, Ima5p, presented the lowest optimal temperature and was also extremely sensitive to temperature. Isomaltose hydrolysis by Ima5p challenged previous conclusions about the requirement of specific amino acids for determining the specificity for α-(1,6) substrates. We finally found a mixed inhibition by maltose for Ima5p while, contrary to a previous work, Ima1p inhibition by maltose was competitive at very low isomaltose concentrations and uncompetitive as the substrate concentration increased. Altogether, this work illustrates that a gene family encoding proteins with strong sequence similarities can lead to enzyme with notable differences in biochemical and enzymological properties. PMID:24649402

Similarities and differences in the biochemical and enzymological properties of the four isomaltases from Saccharomyces cerevisiae.

PubMed

Deng, Xu; Petitjean, Marjorie; Teste, Marie-Ange; Kooli, Wafa; Tranier, Samuel; François, Jean Marie; Parrou, Jean-Luc

2014-01-01

The yeast Saccharomyces cerevisiae IMA multigene family encodes four isomaltases sharing high sequence identity from 65% to 99%. Here, we explore their functional diversity, with exhaustive in-vitro characterization of their enzymological and biochemical properties. The four isoenzymes exhibited a preference for the α-(1,6) disaccharides isomaltose and palatinose, with Michaëlis-Menten kinetics and inhibition at high substrates concentration. They were also able to hydrolyze trisaccharides bearing an α-(1,6) linkage, but also α-(1,2), α-(1,3) and α-(1,5) disaccharides including sucrose, highlighting their substrate ambiguity. While Ima1p and Ima2p presented almost identical characteristics, our results nevertheless showed many singularities within this protein family. In particular, Ima3p presented lower activities and thermostability than Ima2p despite only three different amino acids between the sequences of these two isoforms. The Ima3p_R279Q variant recovered activity levels of Ima2p, while the Leu-to-Pro substitution at position 240 significantly increased the stability of Ima3p and supported the role of prolines in thermostability. The most distant protein, Ima5p, presented the lowest optimal temperature and was also extremely sensitive to temperature. Isomaltose hydrolysis by Ima5p challenged previous conclusions about the requirement of specific amino acids for determining the specificity for α-(1,6) substrates. We finally found a mixed inhibition by maltose for Ima5p while, contrary to a previous work, Ima1p inhibition by maltose was competitive at very low isomaltose concentrations and uncompetitive as the substrate concentration increased. Altogether, this work illustrates that a gene family encoding proteins with strong sequence similarities can lead to enzyme with notable differences in biochemical and enzymological properties.

Inactivation of agmatinase expressed in vegetative cells alters arginine catabolism and prevents diazotrophic growth in the heterocyst-forming cyanobacterium Anabaena.

PubMed

Burnat, Mireia; Flores, Enrique

2014-10-01

Arginine decarboxylase produces agmatine, and arginase and agmatinase are ureohydrolases that catalyze the production of ornithine and putrescine from arginine and agmatine, respectively, releasing urea. In the genome of the filamentous, heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, ORF alr2310 putatively encodes an ureohydrolase. Cells of Anabaena supplemented with [(14) C]arginine took up and catabolized this amino acid generating a set of labeled amino acids that included ornithine, proline, and glutamate. In an alr2310 deletion mutant, an agmatine spot appeared and labeled glutamate increased with respect to the wild type, suggesting that Alr2310 is an agmatinase rather than an arginase. As determined in cell-free extracts, agmatinase activity could be detected in the wild type but not in the mutant. Thus, alr2310 is the Anabaena speB gene encoding agmatinase. The ∆alr2310 mutant accumulated large amounts of cyanophycin granule polypeptide, lacked nitrogenase activity, and did not grow diazotrophically. Growth tests in solid media showed that agmatine is inhibitory for Anabaena, especially under diazotrophic conditions, suggesting that growth of the mutant is inhibited by non-metabolized agmatine. Measurements of incorporation of radioactivity from [(14) C]leucine into macromolecules showed, however, a limited inhibition of protein synthesis in the ∆alr2310 mutant. Analysis of an Anabaena strain producing an Alr2310-GFP (green fluorescent protein) fusion showed expression in vegetative cells but much less in heterocysts, implying compartmentalization of the arginine decarboxylation pathway in the diazotrophic filaments of this heterocyst-forming cyanobacterium. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

A rapid, ideal, and eco-friendlier protocol for quantifying proline.

PubMed

Shabnam, Nisha; Tripathi, Indu; Sharmila, P; Pardha-Saradhi, P

2016-11-01

Proline, a stress marker, is routinely quantified by a protocol that essentially uses hazardous toluene. Negative impacts of toluene on human health prompted us to develop a reliable alternate protocol for proline quantification. Absorbance of the proline-ninhydrin condensation product formed by reaction of proline with ninhydrin at 100 °C in the reaction mixture was significantly higher than that recorded after its transfer to toluene, revealing that toluene lowers sensitivity of this assay. λ max of the proline-ninhydrin complex in the reaction mixture and toluene were 508 and 513 nm, respectively. Ninhydrin in glacial acetic acid yielded higher quantity of the proline-ninhydrin condensation product compared to ninhydrin in mixture of glacial acetic acid and H 3 PO 4 , indicating negative impact of H 3 PO 4 on proline quantification. Further, maximum yield of the proline-ninhydrin complex with ninhydrin in glacial acetic acid and ninhydrin in mixture of glacial acetic acid and H 3 PO 4 was achieved within 30 and 60 min, respectively. This revealed that H 3 PO 4 has negative impact on the reaction rate and quantity of the proline-ninhydrin complex formed. In brief, our proline quantification protocol involves reaction of a 1-ml proline sample with 2 ml of 1.25 % ninhydrin in glacial acetic acid at 100 °C for 30 min, followed by recording absorbance of the proline-ninhydrin condensation product in the reaction mixture itself at 508 nm. Amongst proline quantification protocols known till date, our protocol is the most simple, rapid, reliable, cost-effective, and eco-friendlier.

Trichoderma genes

DOEpatents

Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

2012-06-19

Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

The rice blast resistance gene Ptr encodes an atypical protein required for broad spectrum disease resistance

USDA-ARS?s Scientific Manuscript database

Plant resistance (R) genes typically encode proteins with nucleotide binding site-leucine rich repeat (NLR) domains. We identified a novel, broad-spectrum rice blast R gene, Ptr, encoding a non-NLR protein with four Armadillo repeats. Ptr was originally identified by fast neutron mutagenesis as a ...

Synthesis and structure-activity relationships of novel lincomycin derivatives. Part 4: synthesis of novel lincomycin analogs modified at the 6- and 7-positions and their potent antibacterial activities.

PubMed

Wakiyama, Yoshinari; Kumura, Ko; Umemura, Eijiro; Ueda, Kazutaka; Watanabe, Takashi; Yamada, Keiko; Okutomi, Takafumi; Ajito, Keiichi

2017-07-01

To modify lincomycin (LCM) at the C-6 and the C-7 positions, we firstly prepared various substituted proline intermediates (7, 11-15 and 17). These proline intermediates were coupled with methyl 1-thio-α-lincosamide and tetrakis-O-trimethylsilylation followed by selective deprotection of the TMS group at the 7-position gave a wide variety of key intermediates (23-27, 47 and 50). Then, we synthesized a variety of novel LCM analogs modified at the 7-position in application of the Mitsunobu reaction, an S N 2 reaction, and a Pd-catalyzed cross-coupling reaction. Compounds 34 and 35 (1'-NH derivatives) exhibited enhanced antibacterial activities against resistant pathogens with erm gene compared with the corresponding 1'-N-methyl derivatives (3 and 37). On the basis of reported SAR, we modified the 4'-position of LCM derivatives possessing a 5-(2-nitrophenyl)-1,3,4-thiadiazol-2-yl group at the C-7 position. Compound 56 showed significantly potent antibacterial activities against S. pneumoniae and S. pyogenes with erm gene, and its activities against S. pneumoniae with erm gene were improved compared with those of 34 and 57. Although we synthesized novel analogs by transformation of a C-7 substituent focusing on the 1'-demethyl framework to prepare very potent analogs 73 and 75, it was impossible to generate novel derivatives exhibiting stronger antibacterial activities against S. pneumoniae with erm gene compared with 56.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

PubMed

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P < 0.05) mRNA profiles of 9 inflammation-related genes in cells, while short-time Se pretreatment modestly reversed (P < 0.05) the LPS-induced upregulation of 7 genes (COX-2, ICAM-1, IL-1β, IL-6, IL-10, iNOS, and MCP-1) and further increased (P < 0.05) expression of IFN-β and TNF-α in stressed cells. Meanwhile, LPS decreased (P < 0.05) mRNA levels of 18 selenoprotein encoding genes and upregulated mRNA levels of TXNRD1 and TXNRD3 in cells. Se pretreatment recovered (P < 0.05) expression of 3 selenoprotein encoding genes (GPX1, SELENOH, and SELENOW) in a dose-dependent manner and increased (P < 0.05) expression of another 5 selenoprotein encoding genes (SELENOK, SELENOM, SELENOS, SELENOT, and TXNRD2) only at a high level (2.0 μmol Se/L). Taken together, LPS-induced immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Disruption of the psbA gene by the copy correction mechanism reveals that the expression of plastid-encoded genes is regulated by photosynthesis activity.

PubMed

Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi

2007-05-01

The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.

Exploring the Roles of Proline in Three-Dimensional Domain Swapping from Structure Analysis and Molecular Dynamics Simulations.

PubMed

Huang, Yongqi; Gao, Meng; Su, Zhengding

2018-02-01

Three-dimensional (3D) domain swapping is a mechanism to form protein oligomers. It has been proposed that several factors, including proline residues in the hinge region, may affect the occurrence of 3D domain swapping. Although introducing prolines into the hinge region has been found to promote domain swapping for some proteins, the opposite effect has also been observed in several studies. So far, how proline affects 3D domain swapping remains elusive. In this work, based on a large set of 3D domain-swapped structures, we performed a systematic analysis to explore the correlation between the presence of proline in the hinge region and the occurrence of 3D domain swapping. We further analyzed the conformations of proline and pre-proline residues to investigate the roles of proline in 3D domain swapping. We found that more than 40% of the domain-swapped structures contained proline residues in the hinge region. Unexpectedly, conformational transitions of proline residues were rarely observed upon domain swapping. Our analyses showed that hinge regions containing proline residues preferred more extended conformations, which may be beneficial for the occurrence of domain swapping by facilitating opening of the exchanged segments.

Structural and functional analysis of the yeast N-acetyltransferase Mpr1 involved in oxidative stress tolerance via proline metabolism

PubMed Central

Nasuno, Ryo; Hirano, Yoshinori; Itoh, Takafumi; Hakoshima, Toshio; Hibi, Takao; Takagi, Hiroshi

2013-01-01

Mpr1 (sigma1278b gene for proline-analog resistance 1), which was originally isolated as N-acetyltransferase detoxifying the proline analog l-azetidine-2-carboxylate, protects yeast cells from various oxidative stresses. Mpr1 mediates the l-proline and l-arginine metabolism by acetylating l-Δ1-pyrroline-5-carboxylate, leading to the l-arginine–dependent production of nitric oxide, which confers oxidative stress tolerance. Mpr1 belongs to the Gcn5-related N-acetyltransferase (GNAT) superfamily, but exhibits poor sequence homology with the GNAT enzymes and unique substrate specificity. Here, we present the X-ray crystal structure of Mpr1 and its complex with the substrate cis-4-hydroxy-l-proline at 1.9 and 2.3 Å resolution, respectively. Mpr1 is folded into α/β-structure with eight-stranded mixed β-sheets and six α-helices. The substrate binds to Asn135 and the backbone amide of Asn172 and Leu173, and the predicted acetyl-CoA–binding site is located near the backbone amide of Phe138 and the side chain of Asn178. Alanine substitution of Asn178, which can interact with the sulfur of acetyl-CoA, caused a large reduction in the apparent kcat value. The replacement of Asn135 led to a remarkable increase in the apparent Km value. These results indicate that Asn178 and Asn135 play an important role in catalysis and substrate recognition, respectively. Such a catalytic mechanism has not been reported in the GNAT proteins. Importantly, the amino acid substitutions in these residues increased the l-Δ1-pyrroline-5-carboxylate level in yeast cells exposed to heat stress, indicating that these residues are also crucial for its physiological functions. These studies provide some benefits of Mpr1 applications, such as the breeding of industrial yeasts and the development of antifungal drugs. PMID:23818613

Genome-Wide Identification and Mapping of NBS-Encoding Resistance Genes in Solanum tuberosum Group Phureja

PubMed Central

Lozano, Roberto; Ponce, Olga; Ramirez, Manuel; Mostajo, Nelly; Orjeda, Gisella

2012-01-01

The majority of disease resistance (R) genes identified to date in plants encode a nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domain containing protein. Additional domains such as coiled-coil (CC) and TOLL/interleukin-1 receptor (TIR) domains can also be present. In the recently sequenced Solanum tuberosum group phureja genome we used HMM models and manual curation to annotate 435 NBS-encoding R gene homologs and 142 NBS-derived genes that lack the NBS domain. Highly similar homologs for most previously documented Solanaceae R genes were identified. A surprising ∼41% (179) of the 435 NBS-encoding genes are pseudogenes primarily caused by premature stop codons or frameshift mutations. Alignment of 81.80% of the 577 homologs to S. tuberosum group phureja pseudomolecules revealed non-random distribution of the R-genes; 362 of 470 genes were found in high density clusters on 11 chromosomes. PMID:22493716

Overexpression of the Wheat Expansin Gene TaEXPA2 Improved Seed Production and Drought Tolerance in Transgenic Tobacco Plants.

PubMed

Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei

2016-01-01

Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants.

Overexpression of the Wheat Expansin Gene TaEXPA2 Improved Seed Production and Drought Tolerance in Transgenic Tobacco Plants

PubMed Central

Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei

2016-01-01

Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants. PMID:27073898

A small multigene hydroxyproline-O-galactosyltransferase family functions in arabinogalactan-protein glycosylation, growth and development in Arabidopsis.

PubMed

Basu, Debarati; Tian, Lu; Wang, Wuda; Bobbs, Shauni; Herock, Hayley; Travers, Andrew; Showalter, Allan M

2015-12-21

Arabinogalactan-proteins (AGPs) are ubiquitous components of cell walls throughout the plant kingdom and are extensively post translationally modified by conversion of proline to hydroxyproline (Hyp) and by addition of arabinogalactan polysaccharides (AG) to Hyp residues. AGPs are implicated to function in various aspects of plant growth and development, but the functional contributions of AGP glycans remain to be elucidated. Hyp glycosylation is initiated by the action of a set of Hyp-O-galactosyltransferase (Hyp-O-GALT) enzymes that remain to be fully characterized. Three members of the GT31 family (GALT3-At3g06440, GALT4-At1g27120, and GALT6-At5g62620) were identified as Hyp-O-GALT genes by heterologous expression in tobacco leaf epidermal cells and examined along with two previously characterized Hyp-O-GALT genes, GALT2 and GALT5. Transcript profiling by real-time PCR of these five Hyp-O-GALTs revealed overlapping but distinct expression patterns. Transiently expressed GALT3, GALT4 and GALT6 fluorescent protein fusions were localized within Golgi vesicles. Biochemical analysis of knock-out mutants for the five Hyp-O-GALT genes revealed significant reductions in both AGP-specific Hyp-O-GALT activity and β-Gal-Yariv precipitable AGPs. Further phenotypic analysis of these mutants demonstrated reduced root hair growth, reduced seed coat mucilage, reduced seed set, and accelerated leaf senescence. The mutants also displayed several conditional phenotypes, including impaired root growth, and defective anisotropic growth of root tips under salt stress, as well as less sensitivity to the growth inhibitory effects of β-Gal-Yariv reagent in roots and pollen tubes. This study provides evidence that all five Hyp-O-GALT genes encode enzymes that catalyze the initial steps of AGP galactosylation and that AGP glycans play essential roles in both vegetative and reproductive plant growth.

Mutation for nonsyndromic mental retardation in the trans-2-enoyl-CoA reductase TER gene involved in fatty acid elongation impairs the enzyme activity and stability, leading to change in sphingolipid profile.

PubMed

Abe, Kensuke; Ohno, Yusuke; Sassa, Takayuki; Taguchi, Ryo; Çalışkan, Minal; Ober, Carole; Kihara, Akio

2013-12-20

Very long-chain fatty acids (VLCFAs, chain length >C20) exist in tissues throughout the body and are synthesized by repetition of the fatty acid (FA) elongation cycle composed of four successive enzymatic reactions. In mammals, the TER gene is the only gene encoding trans-2-enoyl-CoA reductase, which catalyzes the fourth reaction in the FA elongation cycle. The TER P182L mutation is the pathogenic mutation for nonsyndromic mental retardation. This mutation substitutes a leucine for a proline residue at amino acid 182 in the TER enzyme. Currently, the mechanism by which the TER P182L mutation causes nonsyndromic mental retardation is unknown. To understand the effect of this mutation on the TER enzyme and VLCFA synthesis, we have biochemically characterized the TER P182L mutant enzyme using yeast and mammalian cells transfected with the TER P182L mutant gene and analyzed the FA elongation cycle in the B-lymphoblastoid cell line with the homozygous TER P182L mutation (TER(P182L/P182L) B-lymphoblastoid cell line). We have found that TER P182L mutant enzyme exhibits reduced trans-2-enoyl-CoA reductase activity and protein stability, thereby impairing VLCFA synthesis and, in turn, altering the sphingolipid profile (i.e. decreased level of C24 sphingomyelin and C24 ceramide) in the TER(P182L/P182L) B-lymphoblastoid cell line. We have also found that in addition to the TER enzyme-catalyzed fourth reaction, the third reaction in the FA elongation cycle is affected by the TER P182L mutation. These findings provide new insight into the biochemical defects associated with this genetic mutation.

Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krauthammer, Michael; Kong, Yong; Ha, Byung Hak

We characterized the mutational landscape of melanoma, the form of skin cancer with the highest mortality rate, by sequencing the exomes of 147 melanomas. Sun-exposed melanomas had markedly more ultraviolet (UV)-like C>T somatic mutations compared to sun-shielded acral, mucosal and uveal melanomas. Among the newly identified cancer genes was PPP6C, encoding a serine/threonine phosphatase, which harbored mutations that clustered in the active site in 12% of sun-exposed melanomas, exclusively in tumors with mutations in BRAF or NRAS. Notably, we identified a recurrent UV-signature, an activating mutation in RAC1 in 9.2% of sun-exposed melanomas. This activating mutation, the third most frequentmore » in our cohort of sun-exposed melanoma after those of BRAF and NRAS, changes Pro29 to serine (RAC1{sup P29S}) in the highly conserved switch I domain. Crystal structures, and biochemical and functional studies of RAC1{sup P29S} showed that the alteration releases the conformational restraint conferred by the conserved proline, causes an increased binding of the protein to downstream effectors, and promotes melanocyte proliferation and migration. These findings raise the possibility that pharmacological inhibition of downstream effectors of RAC1 signaling could be of therapeutic benefit.« less

Hermes Transposon Distribution and Structure in Musca domestica

PubMed Central

Subramanian, Ramanand A.; Cathcart, Laura A.; Krafsur, Elliot S.; Atkinson, Peter W.

2009-01-01

Hermes are hAT transposons from Musca domestica that are very closely related to the hobo transposons from Drosophila melanogaster and are useful as gene vectors in a wide variety of organisms including insects, planaria, and yeast. hobo elements show distinct length variations in a rapidly evolving region of the transposase-coding region as a result of expansions and contractions of a simple repeat sequence encoding 3 amino acids threonine, proline, and glutamic acid (TPE). These variations in length may influence the function of the protein and the movement of hobo transposons in natural populations. Here, we determine the distribution of Hermes in populations of M. domestica as well as whether Hermes transposase has undergone similar sequence expansions and contractions during its evolution in this species. Hermes transposons were found in all M. domestica individuals sampled from 14 populations collected from 4 continents. All individuals with Hermes transposons had evidence for the presence of intact transposase open reading frames, and little sequence variation was observed among Hermes elements. A systematic analysis of the TPE-homologous region of the Hermes transposase-coding region revealed no evidence for length variation. The simple sequence repeat found in hobo elements is a feature of this transposon that evolved since the divergence of hobo and Hermes. PMID:19366812

Over-expression of TaMYB33 encoding a novel wheat MYB transcription factor increases salt and drought tolerance in Arabidopsis.

PubMed

Qin, Yuxiang; Wang, Mengcheng; Tian, Yanchen; He, Wenxing; Han, Lu; Xia, Guangmin

2012-06-01

Salt and drought stresses often adversely affect plant growth and productivity, MYB transcription factors have been shown to participate in the response to these stresses. Here we identified a new R2R3-type MYB transcription factor gene TaMYB33 from wheat (Triticum aestivum). TaMYB33 was induced by NaCl, PEG and ABA treatments, and its promoter sequence contains putative ABRE, MYB and other abiotic stress related cis-elements. Ectopic over-expression of TaMYB33 in Arabidopsis thaliana remarkably enhanced its tolerance to drought and NaCl stresses, but not to LiCl and KCl treatments. The expressions of AtP5CS and AtZAT12 which mirror the activities of proline and ascorbate peroxidase synthesis respectively were induced in TaMYB33 over-expression lines, indicating TaMYB33 promotes the ability for osmotic pressure balance-reconstruction and reactive oxidative species (ROS) scavenging. The up-regulation of AtAAO3 along with down-regulation of AtABF3, AtABI1 in TaMYB33 over-expression lines indicated that ABA synthesis was elevated while its signaling was restricted. These results suggest that TaMYB33 enhances salt and drought tolerance partially through superior ability for osmotic balance reconstruction and ROS detoxification.

Courtship and other behaviors affected by a heat-sensitive, molecularly novel mutation in the cacophony calcium-channel gene of Drosophila.

PubMed Central

Chan, Betty; Villella, Adriana; Funes, Pablo; Hall, Jeffrey C

2002-01-01

The cacophony (cac) locus of Drosophila melanogaster, which encodes a calcium-channel subunit, has been mutated to cause courtship-song defects or abnormal responses to visual stimuli. However, the most recently isolated cac mutant was identified as an enhancer of a comatose mutation's effects on general locomotion. We analyzed the cac(TS2) mutation in terms of its intragenic molecular change and its effects on behaviors more complex than the fly's elementary ability to move. The molecular etiology of this mutation is a nucleotide substitution that causes a proline-to-serine change in a region of the polypeptide near its EF hand. Given that this motif is involved in channel inactivation, it was intriguing that cac(TS2) males generate song pulses containing larger-than-normal numbers of cycles--provided that such males are exposed to an elevated temperature. Similar treatments caused only mild visual-response abnormalities and generic locomotor sluggishness. These results are discussed in the context of calcium-channel functions that subserve certain behaviors and of defects exhibited by the original cacophony mutant. Despite its different kind of amino-acid substitution, compared with that of cac(TS2), cac(S) males sing abnormally in a manner that mimics the new mutant's heat-sensitive song anomaly. PMID:12242229

Characterization of thimet- and neurolysin-like activities in Escherichia coli M 3 A peptidases and description of a specific substrate.

PubMed

Paschoalin, Thaysa; Carmona, Adriana K; Oliveira, Vitor; Juliano, Luiz; Travassos, Luiz R

2005-09-01

M 3 A oligopeptidases from Escherichia coli, with hydrolytic properties similar to Zn-dependent mammalian thimet oligopeptidase (EP 24.15) and neurolysin (EP 24.16), were studied aiming at identification of comparative enzyme and substrate specificity, hydrolytic products, and susceptibility to inhibitors. Fluorescent peptides, neurotensin (NT) and bradykinin (BK), were used as substrates for bacterial lysates. Bacterial enzymes were totally inhibited by o-phenanthrolin, JA-2 and partially by Pro-Ile, but not by leupeptin, PMSF, E-64, and Z-Pro-Prolinal, using internally quenched Abz-GFSPFRQ-EDDnp as substrate. The molecular mass of the bacterial oligopeptidase activity (77--78 kDa) was determined by gel filtration, and the effect of inhibitors, including captopril, suggested that it results from a combination of oligopeptidase A (OpdA) and peptidyl dipeptidase Dcp (77.1 and 77.5 kDa, respectively). Recombinant OpdA cloned from the same E. coli strain entirely reproduced the primary cleavage of fluorescent peptides, NT and BK, by the bacterial lysate. Genes encoding these M 3 A enzymes were those recognized in E. coli genome, bearing identity at the amino acid level (25--31%) with mammalian Zn-dependent oligopeptidases. We also describe a substrate, Abz-GFSPFRQ-EDDnp, that differentiates bacterial and mammalian oligopeptidases.

A DNA-Encoded Library of Chemical Compounds Based on Common Scaffolding Structures Reveals the Impact of Ligand Geometry on Protein Recognition.

PubMed

Favalli, Nicholas; Biendl, Stefan; Hartmann, Marco; Piazzi, Jacopo; Sladojevich, Filippo; Gräslund, Susanne; Brown, Peter J; Näreoja, Katja; Schüler, Herwig; Scheuermann, Jörg; Franzini, Raphael; Neri, Dario

2018-06-01

A DNA-encoded chemical library (DECL) with 1.2 million compounds was synthesized by combinatorial reaction of seven central scaffolds with two sets of 343×492 building blocks. Library screening by affinity capture revealed that for some target proteins, the chemical nature of building blocks dominated the selection results, whereas for other proteins, the central scaffold also crucially contributed to ligand affinity. Molecules based on a 3,5-bis(aminomethyl)benzoic acid core structure were found to bind human serum albumin with a K d value of 6 nm, while compounds with the same substituents on an equidistant but flexible l-lysine scaffold showed 140-fold lower affinity. A 18 nm tankyrase-1 binder featured l-lysine as linking moiety, while molecules based on d-Lysine or (2S,4S)-amino-l-proline showed no detectable binding to the target. This work suggests that central scaffolds which predispose the orientation of chemical building blocks toward the protein target may enhance the screening productivity of encoded libraries. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Forlani, Giuseppe; Bertazzini, Michele; Zarattini, Marco

The majority of plant species accumulate high intracellular levels of proline to cope with hyperosmotic stress conditions. Proline synthesis from glutamate is tightly regulated at both the transcriptional and the translational levels, yet little is known about the mechanisms for post-translational regulation of the enzymatic activities involved. The gene coding in rice ( Oryza sativa L.) for δ 1-pyrroline-5-carboxylate (P5C) reductase, the enzyme that catalyzes the second and final step in this pathway, was isolated and expressed in Escherichia coli. The structural and functional properties of the affinity-purified protein were characterized. As for most species, rice P5C reductase was ablemore » to use in vitro either NADH or NADPH as the electron donor. However, strikingly different effects of cations and anions were found depending on the pyridine nucleotide used, namely inhibition of NADH-dependent activity and stimulation of NADPH-dependent activity. Moreover, physiological concentrations of proline and NADP + were strongly inhibitory for the NADH-dependent reaction, whereas the NADPH-dependent activity was mildly affected. Our results suggest that only NADPH may be used in vivo and that stress-dependent variations in ion homeostasis and NADPH/NADP + ratio could modulate enzyme activity, being functional in promoting proline accumulation and potentially also adjusting NADPH consumption during the defense against hyperosmotic stress. The apparent molecular weight of the native protein observed in size exclusion chromatography indicated a high oligomerization state. We also report the first crystal structure of a plant P5C reductase at 3.40-Å resolution, showing a decameric quaternary assembly. It was possible to identify dynamic structural differences among rice, human, and bacterial enzymes.« less

The proline metabolism intermediate Δ1-pyrroline-5-carboxylate directly inhibits the mitochondrial respiration in budding yeast.

PubMed

Nishimura, Akira; Nasuno, Ryo; Takagi, Hiroshi

2012-07-30

The proline metabolism intermediate Δ(1)-pyrroline-5-carboxylate (P5C) induces cell death in animals, plants and yeasts. To elucidate how P5C triggers cell death, we analyzed P5C metabolism, mitochondrial respiration and superoxide anion generation in the yeast Saccharomyces cerevisiae. Gene disruption analysis revealed that P5C-mediated cell death was not due to P5C metabolism. Interestingly, deficiency in mitochondrial respiration suppressed the sensitivity of yeast cells to P5C. In addition, we found that P5C inhibits the mitochondrial respiration and induces a burst of superoxide anions from the mitochondria. We propose that P5C regulates cell death via the inhibition of mitochondrial respiration. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

The candidate histocompatibility locus of a Basal chordate encodes two highly polymorphic proteins.

PubMed

Nydam, Marie L; Netuschil, Nikolai; Sanders, Erin; Langenbacher, Adam; Lewis, Daniel D; Taketa, Daryl A; Marimuthu, Arumugapradeep; Gracey, Andrew Y; De Tomaso, Anthony W

2013-01-01

The basal chordate Botryllus schlosseri undergoes a natural transplantation reaction governed by a single, highly polymorphic locus called the fuhc. Our initial characterization of this locus suggested it encoded a single gene alternatively spliced into two transcripts: a 555 amino acid-secreted form containing the first half of the gene, and a full-length, 1008 amino acid transmembrane form, with polymorphisms throughout the ectodomain determining outcome. We have now found that the locus encodes two highly polymorphic genes which are separated by a 227 bp intergenic region: first, the secreted form as previously described, and a second gene encoding a 531 amino acid membrane-bound gene containing three extracellular immunoglobulin domains. While northern blotting revealed only these two mRNAs, both PCR and mRNA-seq detect a single capped and polyadenylated transcript that encodes processed forms of both genes linked by the intergenic region, as well as other transcripts in which exons of the two genes are spliced together. These results might suggest that the two genes are expressed as an operon, during which both genes are co-transcribed and then trans-spliced into two separate messages. This type of transcriptional regulation has been described in tunicates previously; however, the membrane-bound gene does not encode a typical Splice Leader (SL) sequence at the 5' terminus that usually accompanies trans-splicing. Thus, the presence of stable transcripts encoding both genes may suggest a novel mechanism of regulation, or conversely may be rare but stable transcripts in which the two mRNAs are linked due to a small amount of read-through by RNA polymerase. Both genes are highly polymorphic and co-expressed on tissues involved in histocompatibility. In addition, polymorphisms on both genes correlate with outcome, although we have found a case in which it appears that the secreted form may be major allorecognition determinant.

Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins.

PubMed

Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

2016-12-01

Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.

Comprehensive search for accessory proteins encoded with archaeal and bacterial type III CRISPR-cas gene cassettes reveals 39 new cas gene families.

PubMed

Shah, Shiraz A; Alkhnbashi, Omer S; Behler, Juliane; Han, Wenyuan; She, Qunxin; Hess, Wolfgang R; Garrett, Roger A; Backofen, Rolf

2018-06-19

A study was undertaken to identify conserved proteins that are encoded adjacent to cas gene cassettes of Type III CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats - CRISPR associated) interference modules. Type III modules have been shown to target and degrade dsDNA, ssDNA and ssRNA and are frequently intertwined with cofunctional accessory genes, including genes encoding CRISPR-associated Rossman Fold (CARF) domains. Using a comparative genomics approach, and defining a Type III association score accounting for coevolution and specificity of flanking genes, we identified and classified 39 new Type III associated gene families. Most archaeal and bacterial Type III modules were seen to be flanked by several accessory genes, around half of which did not encode CARF domains and remain of unknown function. Northern blotting and interference assays in Synechocystis confirmed that one particular non-CARF accessory protein family was involved in crRNA maturation. Non-CARF accessory genes were generally diverse, encoding nuclease, helicase, protease, ATPase, transporter and transmembrane domains with some encoding no known domains. We infer that additional families of non-CARF accessory proteins remain to be found. The method employed is scalable for potential application to metagenomic data once automated pipelines for annotation of CRISPR-Cas systems have been developed. All accessory genes found in this study are presented online in a readily accessible and searchable format for researchers to audit their model organism of choice: http://accessory.crispr.dk .

Assessment of the influence of different sample processing and cold storage duration on plant free proline content analyses.

PubMed

Teklić, Tihana; Spoljarević, Marija; Stanisavljević, Aleksandar; Lisjak, Miroslav; Vinković, Tomislav; Parađiković, Nada; Andrić, Luka; Hancock, John T

2010-01-01

A method which is widely accepted for the analysis of free proline content in plant tissues is based on the use of 3% sulfosalicylic acid as an extractant, followed by spectrophotometric quantification of a proline-ninhydrin complex in toluene. However, sample preparation and storage may influence the proline actually measured. This may give misleading or difficult to compare data. To evaluate free proline levels fresh and frozen strawberry (Fragaria × ananassa Duch.) leaves and soybean [Glycine max (L.) Merr.] hypocotyl tissues were used. These were ground with or without liquid nitrogen and proline extracted with sulfosalicylic acid. A particular focus was the influence of plant sample cold storage duration (1, 4 and 12 weeks at -20°C) on tissue proline levels measured. The free proline content analyses, carried out in leaves of Fragaria × ananassa Duch. as well as in hypocotyls of Glycine max (L.) Merr., showed a significant influence of the sample preparation method and cold storage period. Long-term storage of up to 12 weeks at -20°C led to a significant increase in the measured proline in all samples analysed. The observed changes in proline content in plant tissue samples stored at -20°C indicate the likelihood of the over-estimation of the proline content if the proline analyses are delayed. Plant sample processing and cold storage duration seem to have an important influence on results of proline analyses. Therefore it is recommended that samples should be ground fresh and analysed immediately. Copyright © 2010 John Wiley & Sons, Ltd.

Modularity of Plant Metabolic Gene Clusters: A Trio of Linked Genes That Are Collectively Required for Acylation of Triterpenes in Oat[W][OA

PubMed Central

Mugford, Sam T.; Louveau, Thomas; Melton, Rachel; Qi, Xiaoquan; Bakht, Saleha; Hill, Lionel; Tsurushima, Tetsu; Honkanen, Suvi; Rosser, Susan J.; Lomonossoff, George P.; Osbourn, Anne

2013-01-01

Operon-like gene clusters are an emerging phenomenon in the field of plant natural products. The genes encoding some of the best-characterized plant secondary metabolite biosynthetic pathways are scattered across plant genomes. However, an increasing number of gene clusters encoding the synthesis of diverse natural products have recently been reported in plant genomes. These clusters have arisen through the neo-functionalization and relocation of existing genes within the genome, and not by horizontal gene transfer from microbes. The reasons for clustering are not yet clear, although this form of gene organization is likely to facilitate co-inheritance and co-regulation. Oats (Avena spp) synthesize antimicrobial triterpenoids (avenacins) that provide protection against disease. The synthesis of these compounds is encoded by a gene cluster. Here we show that a module of three adjacent genes within the wider biosynthetic gene cluster is required for avenacin acylation. Through the characterization of these genes and their encoded proteins we present a model of the subcellular organization of triterpenoid biosynthesis. PMID:23532069

Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

PubMed Central

Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

1989-01-01

We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

Overexpression of GsZFP1 enhances salt and drought tolerance in transgenic alfalfa (Medicago sativa L.).

PubMed

Tang, Lili; Cai, Hua; Ji, Wei; Luo, Xiao; Wang, Zhenyu; Wu, Jing; Wang, Xuedong; Cui, Lin; Wang, Yang; Zhu, Yanming; Bai, Xi

2013-10-01

GsZFP1 encodes a Cys2/His2-type zinc-finger protein. In our previous study, when GsZFP1 was heterologously expressed in Arabidopsis, the transgenic Arabidopsis plants exhibited enhanced drought and cold tolerance. However, it is still unknown whether GsZFP1 is also involved in salt stress. GsZFP1 is from the wild legume Glycine soja. Therefore, the aims of this study were to further elucidate the functions of the GsZFP1 gene under salt and drought stress in the forage legume alfalfa and to investigate its biochemical and physiological functions under these stress conditions. Our data showed that overexpression of GsZFP1 in alfalfa resulted in enhanced salt tolerance. Under high salinity stress, greater relative membrane permeability and malondialdehyde (MDA) content were observed and more free proline and soluble sugars accumulated in transgenic alfalfa than in the wild-type (WT) plants; in addition, the transgenic lines accumulated less Na(+) and more K(+) in both the shoots and roots. Overexpression of GsZFP1 also enhanced the drought tolerance of alfalfa. The fold-inductions of stress-responsive marker gene expression, including MtCOR47, MtRAB18, MtP5CS, and MtRD2, were greater in transgenic alfalfa than those of WT under drought stress conditions. In conclusion, the transgenic alfalfa plants generated in this study could be used for farming in salt-affected as well as arid and semi-arid areas. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

DrsG from Streptococcus dysgalactiae subsp. equisimilis Inhibits the Antimicrobial Peptide LL-37

PubMed Central

Smyth, Danielle; Cameron, Ainslie; Davies, Mark R.; McNeilly, Celia; Hafner, Louise; Sriprakash, Kadaba S.

2014-01-01

SIC and DRS are related proteins present in only 4 of the >200 Streptococcus pyogenes emm types. These proteins inhibit complement-mediated lysis and/or the activity of certain antimicrobial peptides (AMPs). A gene encoding a homologue of these proteins, herein called DrsG, has been identified in the related bacterium Streptococcus dysgalactiae subsp. equisimilis. Here we show that geographically dispersed isolates representing 14 of 50 emm types examined possess variants of drsG. However, not all isolates within the drsG-positive emm types possess the gene. Sequence comparisons also revealed a high degree of conservation in different S. dysgalactiae subsp. equisimilis emm types. To examine the biological activity of DrsG, recombinant versions of two major DrsG variants, DrsGS and DrsGL, were expressed and purified. Western blot analysis using antisera raised to these proteins demonstrated both variants to be expressed and secreted into culture supernatants. Unlike SIC, but similar to DRS, DrsG does not inhibit complement-mediated lysis. However, like both SIC and DRS, DrsG is a ligand of the cathelicidin LL-37 and is inhibitory to its bactericidal activity in in vitro assays. Conservation of prolines in the C-terminal region also suggests that these residues are important in the biology of this family of proteins. This is the first report demonstrating the activity of an AMP-inhibitory protein in S. dysgalactiae subsp. equisimilis and suggests that inhibition of AMP activity is the primary function of this family of proteins. The acquisition of the complement-inhibitory activity of SIC may reflect its continuing evolution. PMID:24664506

Resolving the role of plant glutamate dehydrogenase: II. Physiological characterization of plants overexpressing the two enzyme subunits individually or simultaneously.

PubMed

Tercé-Laforgue, Thérèse; Bedu, Magali; Dargel-Grafin, Céline; Dubois, Frédéric; Gibon, Yves; Restivo, Francesco M; Hirel, Bertrand

2013-10-01

Glutamate dehydrogenase (GDH; EC 1.4.1.2) is able to carry out the deamination of glutamate in higher plants. In order to obtain a better understanding of the physiological function of GDH in leaves, transgenic tobacco (Nicotiana tabacum L.) plants were constructed that overexpress two genes from Nicotiana plumbaginifolia (GDHA and GDHB under the control of the Cauliflower mosiac virus 35S promoter), which encode the α- and β-subunits of GDH individually or simultaneously. In the transgenic plants, the GDH protein accumulated in the mitochondria of mesophyll cells and in the mitochondria of the phloem companion cells (CCs), where the native enzyme is normally expressed. Such a shift in the cellular location of the GDH enzyme induced major changes in carbon and nitrogen metabolite accumulation and a reduction in growth. These changes were mainly characterized by a decrease in the amount of sucrose, starch and glutamine in the leaves, which was accompanied by an increase in the amount of nitrate and Chl. In addition, there was an increase in the content of asparagine and a decrease in proline. Such changes may explain the lower plant biomass determined in the GDH-overexpressing lines. Overexpressing the two genes GDHA and GDHB individually or simultaneously induced a differential accumulation of glutamate and glutamine and a modification of the glutamate to glutamine ratio. The impact of the metabolic changes occurring in the different types of GDH-overexpressing plants is discussed in relation to the possible physiological function of each subunit when present in the form of homohexamers or heterohexamers.

Imp2, the PSTPIP homolog in fission yeast, affects sensitivity to the immunosuppressant FK506 and membrane trafficking in fission yeast

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kita, Ayako; Higa, Mari; Doi, Akira

Cytokinesis is a highly ordered process that divides one cell into two cells, which is functionally linked to the dynamic remodeling of the plasma membrane coordinately with various events such as membrane trafficking. Calcineurin is a highly conserved serine/threonine protein phosphatase, which regulates multiple biological functions, such as membrane trafficking and cytokinesis. Here, we isolated imp2-c3, a mutant allele of the imp2{sup +} gene, encoding a homolog of the mouse PSTPIP1 (proline-serine-threonine phosphatase interacting protein 1), using a genetic screen for mutations that are synthetically lethal with calcineurin deletion in fission yeast. The imp2-c3 mutants showed a defect in cytokinesis withmore » multi-septated phenotypes, which was further enhanced upon treatment with the calcineurin inhibitor FK506. Notably, electron micrographs revealed that the imp2-c3 mutant cells accumulated aberrant multi-lamella Golgi structures and putative post-Golgi secretory vesicles, and exhibited fragmented vacuoles in addition to thickened septa. Consistently, imp2-c3 mutants showed a reduced secretion of acid phosphatase and defects in vacuole fusion. The imp2-c3 mutant cells exhibited a weakened cell wall, similar to the membrane trafficking mutants identified in the same genetic screen such as ypt3-i5. These findings implicate the PSTPIP1 homolog Imp2 in Golgi/vacuole function, thereby affecting various cellular processes, including cytokinesis and cell integrity. - Highlights: • We isolated imp2-c3, in a synthetic lethal screen with calcineurin in fission yeast. • The imp2{sup +} gene encodes a component of the actin contractile ring similar to Cdc15. • The imp2-c3 mutants showed defects in cytokinesis, which were exacerbated by FK506. • The imp2-c3 mutants were defective in membrane trafficking and cell wall integrity. • Our study revealed a novel role for Imp2 in the Golgi/vacuolar membrane trafficking.« less

Cyclic stretch-induced the cytoskeleton rearrangement and gene expression of cytoskeletal regulators in human periodontal ligament cells.

PubMed

Wu, Yaqin; Zhuang, Jiabao; Zhao, Dan; Zhang, Fuqiang; Ma, Jiayin; Xu, Chun

2017-10-01

This study aimed to explore the mechanism of the stretch-induced cell realignment and cytoskeletal rearrangement by identifying several mechanoresponsive genes related to cytoskeletal regulators in human PDL cells. After the cells were stretched by 1, 10 and 20% strains for 0.5, 1, 2, 4, 6, 12 or 24 h, the changes of the morphology and content of microfilaments were recorded and calculated. Meanwhile, the expression of 84 key genes encoding cytoskeletal regulators after 6 and 24 h stretches with 20% strain was detected by using real-time PCR array. Western blot was applied to identify the protein expression level of several cytoskeletal regulators encoded by these differentially expressed genes. The confocal fluorescent staining results confirmed that stretch-induced realignment of cells and rearrangement of microfilaments. Among the 84 genes screened, one gene was up-regulated while two genes were down-regulated after 6 h stretch. Meanwhile, three genes were up-regulated while two genes were down-regulated after 24 h stretch. These genes displaying differential expression included genes regulating polymerization/depolymerization of microfilaments (CDC42EP2, FNBP1L, NCK2, PIKFYVE, WASL), polymerization/depolymerization of microtubules (STMN1), interacting between microfilaments and microtubules (MACF1), as well as a phosphatase (PPP1R12B). Among the proteins encoded by these genes, the protein expression level of Cdc42 effector protein-2 (encoded by CDC42EP2) and Stathmin-1 (encoded by STMN1) was down-regulated, while the protein expression level of N-WASP (encoded by WASL) was up-regulated. The present study confirmed the cyclic stretch-induced cellular realignment and rearrangement of microfilaments in the human PDL cells and indicated several force-sensitive genes with regard to cytoskeletal regulators.

A High-Resolution Gene Map of the Chloroplast Genome of the Red Alga Porphyra purpurea.

PubMed Central

Reith, M; Munholland, J

1993-01-01

Extensive DNA sequencing of the chloroplast genome of the red alga Porphyra purpurea has resulted in the detection of more than 125 genes. Fifty-eight (approximately 46%) of these genes are not found on the chloroplast genomes of land plants. These include genes encoding 17 photosynthetic proteins, three tRNAs, and nine ribosomal proteins. In addition, nine genes encoding proteins related to biosynthetic functions, six genes encoding proteins involved in gene expression, and at least five genes encoding miscellaneous proteins are among those not known to be located on land plant chloroplast genomes. The increased coding capacity of the P. purpurea chloroplast genome, along with other characteristics such as the absence of introns and the conservation of ancestral operons, demonstrate the primitive nature of the P. purpurea chloroplast genome. In addition, evidence for a monophyletic origin of chloroplasts is suggested by the identification of two groups of genes that are clustered in chloroplast genomes but not in cyanobacteria. PMID:12271072

Genome-Wide Architecture of Disease Resistance Genes in Lettuce

PubMed Central

Christopoulou, Marilena; Wo, Sebastian Reyes-Chin; Kozik, Alex; McHale, Leah K.; Truco, Maria-Jose; Wroblewski, Tadeusz; Michelmore, Richard W.

2015-01-01

Genome-wide motif searches identified 1134 genes in the lettuce reference genome of cv. Salinas that are potentially involved in pathogen recognition, of which 385 were predicted to encode nucleotide binding-leucine rich repeat receptor (NLR) proteins. Using a maximum-likelihood approach, we grouped the NLRs into 25 multigene families and 17 singletons. Forty-one percent of these NLR-encoding genes belong to three families, the largest being RGC16 with 62 genes in cv. Salinas. The majority of NLR-encoding genes are located in five major resistance clusters (MRCs) on chromosomes 1, 2, 3, 4, and 8 and cosegregate with multiple disease resistance phenotypes. Most MRCs contain primarily members of a single NLR gene family but a few are more complex. MRC2 spans 73 Mb and contains 61 NLRs of six different gene families that cosegregate with nine disease resistance phenotypes. MRC3, which is 25 Mb, contains 22 RGC21 genes and colocates with Dm13. A library of 33 transgenic RNA interference tester stocks was generated for functional analysis of NLR-encoding genes that cosegregated with disease resistance phenotypes in each of the MRCs. Members of four NLR-encoding families, RGC1, RGC2, RGC21, and RGC12 were shown to be required for 16 disease resistance phenotypes in lettuce. The general composition of MRCs is conserved across different genotypes; however, the specific repertoire of NLR-encoding genes varied particularly of the rapidly evolving Type I genes. These tester stocks are valuable resources for future analyses of additional resistance phenotypes. PMID:26449254

A Comprehensive Genetic Study of Streptococcal Immunoglobulin A1 Proteases: Evidence for Recombination within and between Species

PubMed Central

Poulsen, Knud; Reinholdt, Jesper; Jespersgaard, Christina; Boye, Kit; Brown, Thomas A.; Hauge, Majbritt; Kilian, Mogens

1998-01-01

An analysis of 13 immunoglobulin A1 (IgA1) protease genes (iga) of strains of Streptococcus pneumoniae, Streptococcus oralis, Streptococcus mitis, and Streptococcus sanguis was carried out to obtain information on the structure, polymorphism, and phylogeny of this specific protease, which enables bacteria to evade functions of the predominant Ig isotype on mucosal surfaces. The analysis included cloning and sequencing of iga genes from S. oralis and S. mitis biovar 1, sequencing of an additional seven iga genes from S. sanguis biovars 1 through 4, and restriction fragment length polymorphism (RFLP) analyses of iga genes of another 10 strains of S. mitis biovar 1 and 6 strains of S. oralis. All 13 genes sequenced had the potential of encoding proteins with molecular masses of approximately 200 kDa containing the sequence motif HEMTH and an E residue 20 amino acids downstream, which are characteristic of Zn metalloproteinases. In addition, all had a typical gram-positive cell wall anchor motif, LPNTG, which, in contrast to such motifs in other known streptococcal and staphylococcal proteins, was located in their N-terminal parts. Repeat structures showing variation in number and sequence were present in all strains and may be of relevance to the immunogenicities of the enzymes. Protease activities in cultures of the streptococcal strains were associated with species of different molecular masses ranging from 130 to 200 kDa, suggesting posttranslational processing possibly as a result of autoproteolysis at post-proline peptide bonds in the N-terminal parts of the molecules. Comparison of deduced amino acid sequences revealed a 94% similarity between S. oralis and S. mitis IgA1 proteases and a 75 to 79% similarity between IgA1 proteases of these species and those of S. pneumoniae and S. sanguis, respectively. Combined with the results of RFLP analyses using different iga gene fragments as probes, the results of nucleotide sequence comparisons provide evidence of horizontal transfer of iga gene sequences among individual strains of S. sanguis as well as among S. mitis and the two species S. pneumoniae and S. oralis. While iga genes of S. sanguis and S. oralis were highly homogeneous, the genes of S. pneumoniae and S. mitis showed extensive polymorphism reflected in different degrees of antigenic diversity. PMID:9423856

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

USDA-ARS?s Scientific Manuscript database

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

Hybrid proline-rich proteins: novel players in plant cell elongation?

PubMed Central

Dvořáková, Lenka; Srba, Miroslav; Opatrny, Zdenek; Fischer, Lukas

2012-01-01

Background and Aims Hybrid proline-rich proteins (HyPRPs) represent a large family of putative cell-wall proteins characterized by the presence of a variable N-terminal domain and a conserved C-terminal domain that is related to non-specific lipid transfer proteins. The function of HyPRPs remains unclear, but their widespread occurrence and abundant expression patterns indicate that they may be involved in a basic cellular process. Methods To elucidate the cellular function of HyPRPs, we modulated the expression of three HyPRP genes in tobacco (Nicotiana tabacum) BY-2 cell lines and in potato (Solanum tuberosum) plants. Key Results In BY-2 lines, over-expression of the three HyPRP genes with different types of N-terminal domains resulted in similar phenotypic changes, namely increased cell elongation, both in suspension culture and on solid media where the over-expression resulted in enhanced calli size. The over-expressing cells showed increased plasmolysis in a hypertonic mannitol solution and accelerated rate of protoplast release, suggesting loosening of the cell walls. In contrast to BY-2 lines, no phenotypic changes were observed in potato plants over-expressing the same or analogous HyPRP genes, presumably due to more complex compensatory mechanisms in planta. Conclusions Based on the results from BY-2 lines, we propose that HyPRPs, more specifically their C-terminal domains, represent a novel group of proteins involved in cell expansion. PMID:22028464

Cytochrome b5 gene and protein of Candida tropicalis and methods relating thereto

DOEpatents

Craft, David L.; Madduri, Krishna M.; Loper, John C.

2003-01-01

A novel gene has been isolated which encodes cytochrome b5 (CYTb5) protein of the .omega.-hydroxylase complex of C. tropicalis 20336. Vectors including this gene, and transformed host cells are provided. Methods of increasing the production of a CYTb5 protein are also provided which involve transforming a host cell with a gene encoding this protein and culturing the cells. Methods of increasing the production of a dicarboxylic acid are also provided which involve increasing in the host cell the number of genes encoding this protein.

The long-term effect of zinc soil contamination on selected free amino acids playing an important role in plant adaptation to stress and senescence.

PubMed

Pavlíková, Daniela; Zemanová, Veronika; Procházková, Dagmar; Pavlík, Milan; Száková, Jiřina; Wilhelmová, Naďa

2014-02-01

Increased endogenous plant cytokinin (CK) content through transformation with an isopentyl transferase (ipt) gene has been associated with improved plant stress tolerance. The objective of this study is to determine amino acid changes associated with elevated CK production in ipt transgenic tobacco (Nicotiana tabacum L., cv. Wisconsin 38). Nontransformed (WT) and transformed tobacco plants with ipt gene controlled by senescence-activated promoter (SAG) were exposed to zinc soil contamination (tested levels Zn1=250, Zn2=500, Zn3=750 mg kg(-1) soil). The Zn effect on plant stress metabolism resulted in changes in levels of selected free amino acids playing an important role in adaptation to stress and plant senescence (alanine, leucine, proline, methionine and γ-aminobutyrate) and differed for transformed and nontransformed tobacco plants. Analyses of amino acids confirmed that SAG tobacco plants had improved zinc tolerance compared with the WT plants. The enhanced Zn tolerance of SAG plants was associated with the maintenance of accumulation of proline, methionine and γ-aminobutyrate. The concentrations of leucine and alanine did not show significant differences between plant lines. © 2013 Published by Elsevier Inc.

Purification, cDNA cloning, and characterization of LysM-containing plant chitinase from horsetail (Equisetum arvense).

PubMed

Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki

2015-01-01

Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.

Mycorrhizal-Mediated Lower Proline Accumulation in Poncirus trifoliata under Water Deficit Derives from the Integration of Inhibition of Proline Synthesis with Increase of Proline Degradation

PubMed Central

Zou, Ying-Ning; Wu, Qiang-Sheng; Huang, Yong-Ming; Ni, Qiu-Dan; He, Xin-Hua

2013-01-01

Proline accumulation was often correlated with drought tolerance of plants infected by arbuscular mycorrhizal fungi (AMF), whereas lower proline in some AM plants including citrus was also found under drought stress and the relevant mechanisms have not been fully elaborated. In this study proline accumulation and activity of key enzymes relative to proline biosynthesis (▵1-pyrroline-5-carboxylate synthetase, P5CS; ornithine-δ-aminotransferase, OAT) and degradation (proline dehydrogenase, ProDH) were determined in trifoliate orange (Poncirus trifoliata, a widely used citrus rootstock) inoculated with or without Funneliformis mosseae and under well-watered (WW) or water deficit (WD). AMF colonization significantly increased plant height, stem diameter, leaf number, root volume, biomass production of both leaves and roots and leaf relative water content, irrespectively of water status. Water deficit induced more tissue proline accumulation, in company with an increase of P5CS activity, but a decrease of OAT and ProDH activity, no matter whether under AM or no-AM. Compared with no-AM treatment, AM treatment resulted in lower proline concentration and content in leaf, root, and total plant under both WW and WD. The AMF colonization significantly decreased the activity of both P5CS and OAT in leaf, root, and total plant under WW and WD, except for an insignificant difference of root OAT under WD. The AMF inoculation also generally increased tissue ProDH activity under WW and WD. Plant proline content significantly positively correlated with plant P5CS activity, negatively with plant ProDH activity, but not with plant OAT activity. These results suggest that AM plants may suffer less from WD, thereby inducing lower proline accumulation, which derives from the integration of an inhibition of proline synthesis with an enhancement of proline degradation. PMID:24260421

Cooperative Formation of Icosahedral Proline Clusters from Dimers

NASA Astrophysics Data System (ADS)

Jacobs, Alexander D.; Jovan Jose, K. V.; Horness, Rachel; Raghavachari, Krishnan; Thielges, Megan C.; Clemmer, David E.

2018-01-01

Ion mobility spectrometry-mass spectrometry and Fourier transform infrared spectroscopy (FTIR) techniques were combined with quantum chemical calculations to examine the origin of icosahedral clusters of the amino acid proline. When enantiopure proline solutions are electrosprayed (using nanospray) from 100 mM ammonium acetate, only three peaks are observed in the mass spectrum across a concentration range of five orders of magnitude: a monomer [Pro+H]+ species, favored from 0.001 to 0.01 mM proline concentrations; a dimer [2Pro+H]+ species, the most abundant species for proline concentrations above 0.01 mM; and, the dimer and dodecamer [12Pro+2H]2+ for 1.0 mM and more concentrated proline solutions. Electrospraying racemic D/ L-proline solutions from 100 mM ammonium acetate leads to a monomer at low proline concentrations (0.001 to 0.1 mM), and a dimer at higher concentrations (>0.09 mM), as well as a very small population of 8 to 15 Pro clusters that comprise <0.1% of the total ion signals even at the highest proline concentration. Solution FTIR studies show unique features that increase in intensity in the enantiopure proline solutions, consistent with clustering, presumably from the icosahedral geometry in bulk solution. When normalized for the total proline, these results are indicative of a cooperative formation of the enantiopure 12Pro species from 2Pro. [Figure not available: see fulltext.

Molecular analysis of the NDP gene in two families with Norrie disease.

PubMed

Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

2005-04-01

To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

β-Sheet Containment by Flanking Prolines: Molecular Dynamic Simulations of the Inhibition of β-Sheet Elongation by Proline Residues in Human Prion Protein

PubMed Central

Shamsir, Mohd S.; Dalby, Andrew R.

2007-01-01

Previous molecular dynamic simulations have reported elongation of the existing β-sheet in prion proteins. Detailed examination has shown that these elongations do not extend beyond the proline residues flanking these β-sheets. In addition, proline has also been suggested to possess a possible structural role in preserving protein interaction sites by preventing invasion of neighboring secondary structures. In this work, we have studied the possible structural role of the flanking proline residues by simulating mutant structures with alternate substitution of the proline residues with valine. Simulations showed a directional inhibition of elongation, with the elongation progressing in the direction of valine including evident inhibition of elongation by existing proline residues. This suggests that the flanking proline residues in prion proteins may have a containment role and would confine the β-sheet within a specific length. PMID:17172295

Genome complexity in the coelacanth is reflected in its adaptive immune system

USGS Publications Warehouse

Saha, Nil Ratan; Ota, Tatsuya; Litman, Gary W.; Hansen, John; Parra, Zuly; Hsu, Ellen; Buonocore, Francesco; Canapa, Adriana; Cheng, Jan-Fang; Amemiya, Chris T.

2014-01-01

We have analyzed the available genome and transcriptome resources from the coelacanth in order to characterize genes involved in adaptive immunity. Two highly distinctive IgW-encoding loci have been identified that exhibit a unique genomic organization, including a multiplicity of tandemly repeated constant region exons. The overall organization of the IgW loci precludes typical heavy chain class switching. A locus encoding IgM could not be identified either computationally or by using several different experimental strategies. Four distinct sets of genes encoding Ig light chains were identified. This includes a variant sigma-type Ig light chain previously identified only in cartilaginous fishes and which is now provisionally denoted sigma-2. Genes encoding α/β and γ/δ T-cell receptors, and CD3, CD4, and CD8 co-receptors also were characterized. Ig heavy chain variable region genes and TCR components are interspersed within the TCR α/δ locus; this organization previously was reported only in tetrapods and raises questions regarding evolution and functional cooption of genes encoding variable regions. The composition, organization and syntenic conservation of the major histocompatibility complex locus have been characterized. We also identified large numbers of genes encoding cytokines and their receptors, and other genes associated with adaptive immunity. In terms of sequence identity and organization, the adaptive immune genes of the coelacanth more closely resemble orthologous genes in tetrapods than those in teleost fishes, consistent with current phylogenomic interpretations. Overall, the work reported described herein highlights the complexity inherent in the coelacanth genome and provides a rich catalog of immune genes for future investigations.

The Bacillus subtilis ywjI (glpX) gene encodes a class II fructose-1,6-bisphosphatase, functionally equivalent to the class III Fbp enzyme.

PubMed

Jules, Matthieu; Le Chat, Ludovic; Aymerich, Stéphane; Le Coq, Dominique

2009-05-01

We present here experimental evidence that the Bacillus subtilis ywjI gene encodes a class II fructose-1,6-bisphosphatase, functionally equivalent to the fbp-encoded class III enzyme, and constitutes with the upstream gene, murAB, an operon transcribed at the same level under glycolytic or gluconeogenic conditions.

The Bacillus subtilis ywjI (glpX) Gene Encodes a Class II Fructose-1,6-Bisphosphatase, Functionally Equivalent to the Class III Fbp Enzyme▿

PubMed Central

Jules, Matthieu; Le Chat, Ludovic; Aymerich, Stéphane; Le Coq, Dominique

2009-01-01

We present here experimental evidence that the Bacillus subtilis ywjI gene encodes a class II fructose-1,6-bisphosphatase, functionally equivalent to the fbp-encoded class III enzyme, and constitutes with the upstream gene, murAB, an operon transcribed at the same level under glycolytic or gluconeogenic conditions. PMID:19270101

Salivary proline-rich proteins and gluten: Do structural similarities suggest a role in celiac disease?

PubMed

Tian, Na; Messana, Irene; Leffler, Daniel A; Kelly, Ciaran P; Hansen, Joshua; Cabras, Tiziana; D'Alessandro, Alfredo; Schuppan, Detlef; Castagnola, Massimo; Helmerhorst, Eva J

2015-10-01

Gluten proteins, the culprits in celiac disease (CD), show striking similarities in primary structure with human salivary proline-rich proteins (PRPs). Both are enriched in proline and glutamine residues that often occur consecutively in their sequences. We investigated potential differences in the spectrum of salivary PRPs in health and CD. Stimulated salivary secretions were collected from CD patients, patients with refractory CD, patients with gastrointestinal complaints but no CD, and healthy controls. PRP isoforms/peptides were characterized by anionic and SDS-PAGE, PCR, and LC-ESI-MS. The gene frequencies of the acidic PRP isoforms PIF, Db, Pa, PRP1, and PRP2 did not differ between groups. At the protein level, PRPs peptides showed minor group differences, but these could not differentiate the CD and/or refractory CDs groups from the controls. This extensive study established that salivary PRPs, despite similarity to gluten proteins, show no apparent correlation with CD and thus will not serve as diagnostic markers for the disease. The structural basis for the tolerance to the gluten-like PRP proteins in CD is worthy of further exploration and may lead to the development of gluten-like analogs lacking immunogenicity that could be used therapeutically. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Draft genome sequence of Micrococcus luteus strain O'Kane implicates metabolic versatility and the potential to degrade polyhydroxybutyrates.

PubMed

Hanafy, Radwa A; Couger, M B; Baker, Kristina; Murphy, Chelsea; O'Kane, Shannon D; Budd, Connie; French, Donald P; Hoff, Wouter D; Youssef, Noha

2016-09-01

Micrococcus luteus is a predominant member of skin microbiome. We here report on the genomic analysis of Micrococcus luteus strain O'Kane that was isolated from an elevator. The partial genome assembly of Micrococcus luteus strain O'Kane is 2.5 Mb with 2256 protein-coding genes and 62 RNA genes. Genomic analysis revealed metabolic versatility with genes involved in the metabolism and transport of glucose, galactose, fructose, mannose, alanine, aspartate, asparagine, glutamate, glutamine, glycine, serine, cysteine, methionine, arginine, proline, histidine, phenylalanine, and fatty acids. Genomic comparison to other M. luteus representatives identified the potential to degrade polyhydroxybutyrates, as well as several antibiotic resistance genes absent from other genomes.

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

PubMed Central

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

PubMed Central

Fisher, Susan H.; Wray, Lewis V.

2002-01-01

Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.

PubMed

Fisher, Susan H; Wray, Lewis V

2002-04-01

Expression of the two Bacillus subtilis genes encoding L-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional L-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second L-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.

1994-01-01

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.

Role of proline under changing environments

PubMed Central

Hayat, Shamsul; Hayat, Qaiser; Alyemeni, Mohammed Nasser; Wani, Arif Shafi; Pichtel, John; Ahmad, Aqil

2012-01-01

When exposed to stressful conditions, plants accumulate an array of metabolites, particularly amino acids. Amino acids have traditionally been considered as precursors to and constituents of proteins, and play an important role in plant metabolism and development. A large body of data suggests a positive correlation between proline accumulation and plant stress. Proline, an amino acid, plays a highly beneficial role in plants exposed to various stress conditions. Besides acting as an excellent osmolyte, proline plays three major roles during stress, i.e., as a metal chelator, an antioxidative defense molecule and a signaling molecule. Review of the literature indicates that a stressful environment results in an overproduction of proline in plants which in turn imparts stress tolerance by maintaining cell turgor or osmotic balance; stabilizing membranes thereby preventing electrolyte leakage; and bringing concentrations of reactive oxygen species (ROS) within normal ranges, thus preventing oxidative burst in plants. Reports indicate enhanced stress tolerance when proline is supplied exogenously at low concentrations. However, some reports indicate toxic effects of proline when supplied exogenously at higher concentrations. In this article, we review and discuss the effects of exogenous proline on plants exposed to various abiotic stresses. Numerous examples of successful application of exogenous proline to improve stress tolerance are presented. The roles played by exogenous proline under varying environments have been critically examined and reviewed. PMID:22951402

A highly divergent gene cluster in honey bees encodes a novel silk family.

PubMed

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Photocontrol of the expression of genes encoding chlorophyll a/b binding proteins and small subunit of ribulose-1,5-bisphosphate carboxylase in etiolated seedlings of Lycopersicon esculentum (L. ) and Nicotiana tabacum (L. )

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wehmeyer, B.; Cashmore, A.R.; Schaefer, E.

Phytochrome and the blue ultraviolet-A photoreceptor control light-induced expression of genes encoding the chlorophyll a/b binding protein of photosystem II and photosystem I and the genes for the small subunit of the ribulose-1,5-bisphosphate carboxylase in etiolated seedlings of Lycopersicon esculentum (tomato) and Nicotiana tabacum (tobacco). A high irradiance response also controls the induction of these genes. Genes encoding photosystem II- and I-associated chlorophyll a/b binding proteins both exhibit a transient rapid increase in expression in response to light pulse or to continuous irradiation. In contrast, genes encoding the small subunit exhibit a continuous increase in expression in response to light.more » These distinct expression characteristics are shown to reflect differences at the level of transcription.« less

The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

NASA Astrophysics Data System (ADS)

Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

2016-06-01

Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

2000-08-08

The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

A novel zinc-finger protein with a proline-rich domain mediates ABA-regulated seed dormancy in Arabidopsis.

PubMed

He, Yuehui; Gan, Susheng

2004-01-01

Seed dormancy is an important developmental process that prevents pre-harvest sprouting in many grains and other seeds. Abscisic acid (ABA), a plant hormone, plays a crucial role in regulating dormancy but the underlying molecular regulatory mechanisms are not fully understood. An Arabidopsis zinc-finger gene, MEDIATOR OF ABA-REGULATED DORMANCY 1 ( MARD1 ) was identified and functionally analyzed. MARD1 expression is up-regulated by ABA. A T-DNA insertion in the promoter region downstream of two ABA-responsive elements (ABREs) renders MARD1 unable to respond to ABA. The mard1 seeds are less dormant and germinate in total darkness; their germination is resistant to external ABA at the stage of radicle protrusion. These results suggest that this novel zinc-finger protein with a proline-rich N-terminus is an important downstream component of the ABA signaling pathway that mediates ABA-regulated seed dormancy in Arabidopsis.

Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells

PubMed Central

Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy

2018-01-01

Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

1994-10-18

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

Structure, Function, Interaction, Co-evolution of Rice Blast Resistance Genes

USDA-ARS?s Scientific Manuscript database

Rice blast disease caused by the fungal pathogen Magnaporthe oryzae is one of the most destructive rice diseases worldwide. Resistance (R) genes to blast encode proteins that detect pathogen signaling molecules encoded by M. oryzae avirulence (AVR) genes. R genes can be a single or a member of clu...

Frameshift Suppression in SACCHAROMYCES CEREVISIAE VI. Complete Genetic Map of Twenty-Five Suppressor Genes

PubMed Central

Gaber, Richard F.; Mathison, Lorilee; Edelman, Irv; Culbertson, Michael R.

1983-01-01

Five previously unmapped frameshift suppressor genes have been located on the yeast genetic map. In addition, we have further characterized the map positions of two suppressors whose approximate locations were determined in an earlier study. These results represent the completion of genetic mapping studies on all 25 of the known frameshift suppressor genes in yeast.—The approximate location of each suppressor gene was initially determined through the use of a set of mapping strains containing 61 signal markers distributed throughout the yeast genome. Standard meiotic linkage was assayed in crosses between strains carrying the suppressors and the mapping strains. Subsequent to these approximate linkage determinations, each suppressor gene was more precisely located in multi-point crosses. The implications of these mapping results for the genomic distribution of frameshift suppressor genes, which include both glycine and proline tRNA genes, are discussed. PMID:17246112

Molecular genetics of Erwinia amylovora involved in the development of fire blight.

PubMed

Oh, Chang-Sik; Beer, Steven V

2005-12-15

The bacterial plant pathogen, Erwinia amylovora, causes the devastating disease known as fire blight in some Rosaceous plants like apple, pear, quince, raspberry and several ornamentals. Knowledge of the factors affecting the development of fire blight has mushroomed in the last quarter century. On the molecular level, genes encoding a Hrp type III secretion system, genes encoding enzymes involved in synthesis of extracellular polysaccharides and genes facilitating the growth of E. amylovora in its host plants have been characterized. The Hrp pathogenicity island, delimited by genes suggesting horizontal gene transfer, is composed of four distinct regions, the hrp/hrc region, the HEE (Hrp effectors and elicitors) region, the HAE (Hrp-associated enzymes) region, and the IT (Island transfer) region. The Hrp pathogenicity island encodes a Hrp type III secretion system (TTSS), which delivers several proteins from bacteria to plant apoplasts or cytoplasm. E. amylovora produces two exopolysaccharides, amylovoran and levan, which cause the characteristic fire blight wilting symptom in host plants. In addition, other genes, and their encoded proteins, have been characterized as virulence factors of E. amylovora that encode enzymes facilitating sorbitol metabolism, proteolytic activity and iron harvesting. This review summarizes our understanding of the genes and gene products of E. amylovora that are involved in the development of the fire blight disease.

The Drosophila pigmentation gene pink (p) encodes a homologue of human Hermansky-Pudlak syndrome 5 (HPS5).

PubMed

Falcón-Pérez, Juan M; Romero-Calderón, Rafael; Brooks, Elizabeth S; Krantz, David E; Dell'Angelica, Esteban C

2007-02-01

Lysosome-related organelles comprise a group of specialized intracellular compartments that include melanosomes and platelet dense granules (in mammals) and eye pigment granules (in insects). In humans, the biogenesis of these organelles is defective in genetic disorders collectively known as Hermansky-Pudlak syndrome (HPS). Patients with HPS-2, and two murine HPS models, carry mutations in genes encoding subunits of adaptor protein (AP)-3. Other genes mutated in rodent models include those encoding VPS33A and Rab38. Orthologs of all of these genes in Drosophila melanogaster belong to the 'granule group' of eye pigmentation genes. Other genes associated with HPS encode subunits of three complexes of unknown function, named biogenesis of lysosome-related organelles complex (BLOC)-1, -2 and -3, for which the Drosophila counterparts had not been characterized. Here, we report that the gene encoding the Drosophila ortholog of the HPS5 subunit of BLOC-2 is identical to the granule group gene pink (p), which was first studied in 1910 but had not been identified at the molecular level. The phenotype of pink mutants was exacerbated by mutations in AP-3 subunits or in the orthologs of VPS33A and Rab38. These results validate D. melanogaster as a genetic model to study the function of the BLOCs.

Pin1 promotes transforming growth factor-beta-induced migration and invasion.

PubMed

Matsuura, Isao; Chiang, Keng-Nan; Lai, Chen-Yu; He, Dongming; Wang, Guannan; Ramkumar, Romila; Uchida, Takafumi; Ryo, Akihide; Lu, Kunping; Liu, Fang

2010-01-15

Transforming growth factor-beta (TGF-beta) regulates a wide variety of biological activities. It induces potent growth-inhibitory responses in normal cells but promotes migration and invasion of cancer cells. Smads mediate the TGF-beta responses. TGF-beta binding to the cell surface receptors leads to the phosphorylation of Smad2/3 in their C terminus as well as in the proline-rich linker region. The serine/threonine phosphorylation sites in the linker region are followed by the proline residue. Pin1, a peptidyl-prolyl cis/trans isomerase, recognizes phosphorylated serine/threonine-proline motifs. Here we show that Smad2/3 interacts with Pin1 in a TGF-beta-dependent manner. We further show that the phosphorylated threonine 179-proline motif in the Smad3 linker region is the major binding site for Pin1. Although epidermal growth factor also induces phosphorylation of threonine 179 and other residues in the Smad3 linker region the same as TGF-beta, Pin1 is unable to bind to the epidermal growth factor-stimulated Smad3. Further analysis suggests that phosphorylation of Smad3 in the C terminus is necessary for the interaction with Pin1. Depletion of Pin1 by small hairpin RNA does not significantly affect TGF-beta-induced growth-inhibitory responses and a number of TGF-beta/Smad target genes analyzed. In contrast, knockdown of Pin1 in human PC3 prostate cancer cells strongly inhibited TGF-beta-mediated migration and invasion. Accordingly, TGF-beta induction of N-cadherin, which plays an important role in migration and invasion, is markedly reduced when Pin1 is depleted in PC3 cells. Because Pin1 is overexpressed in many cancers, our findings highlight the importance of Pin1 in TGF-beta-induced migration and invasion of cancer cells.

Functional Characterization of Four Putative δ1-Pyrroline-5-Carboxylate Reductases from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Forlani, Giuseppe; Nocek, Boguslaw; Chakravarthy, Srinivas

In most living organisms, the amino acid proline is synthesized starting from both glutamate and ornithine. In prokaryotes, in the absence of an ornithine cyclodeaminase that has been identified to date only in a small number of soil and plant bacteria, these pathways share the last step, the reduction of delta(1)-pyrroline-5-carboxylate (P5C) catalyzed by P5C reductase (EC 1.5.1.2). In several species, multiple forms of P5C reductase have been reported, possibly reflecting the dual function of proline. Aside from its common role as a building block of proteins, proline is indeed also involved in the cellular response to osmotic and oxidativemore » stress conditions. Genome analysis of Bacillus subtilis identifies the presence of four genes (ProH, ProI, ProG, and ComER) that, based on bioinformatic and phylogenic studies, were defined as respectively coding a putative P5C reductase. Here we describe the cloning, heterologous expression, functional analysis and small-angle X-ray scattering studies of the four affinity-purified proteins. Results showed that two of them, namely ProI and ComER, lost their catalytic efficiency or underwent subfunctionalization. In the case of ComER, this could be likely explained by the loss of the ability to form a dimer, which has been previously shown to be an essential structural feature of the catalytically active P5C reductase. The properties of the two active enzymes are consistent with a constitutive role for ProG, and suggest that ProH expression may be beneficial to satisfy an increased need for proline.« less

Functional Characterization of Four Putative δ1-Pyrroline-5-Carboxylate Reductases from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Forlani, Giuseppe; Nocek, Boguslaw; Chakravarthy, Srinivas

In most living organisms, the amino acid proline is synthesized starting from both glutamate and ornithine. In prokaryotes, in the absence of an ornithine cyclodeaminase that has been identified to date only in a small number of soil and plant bacteria, these pathways share the last step, the reduction of δ1-pyrroline-5-carboxylate (P5C) catalyzed by P5C reductase (EC 1.5.1.2). In several species, multiple forms of P5C reductase have been reported, possibly reflecting the dual function of proline. Aside from its common role as a building block of proteins, proline is indeed also involved in the cellular response to osmotic and oxidativemore » stress conditions. Genome analysis of Bacillus subtilis identifies the presence of four genes (ProH, ProI, ProG, and ComER) that, based on bioinformatic and phylogenic studies, were defined as respectively coding a putative P5C reductase. Here we describe the cloning, heterologous expression, functional analysis and small-angle X-ray scattering studies of the four affinity-purified proteins. Results showed that two of them, namely ProI and ComER, lost their catalytic efficiency or underwent subfunctionalization. In the case of ComER, this could be likely explained by the loss of the ability to form a dimer, which has been previously shown to be an essential structural feature of the catalytically active P5C reductase. The properties of the two active enzymes are consistent with a constitutive role for ProG, and suggest that ProH expression may be beneficial to satisfy an increased need for proline.« less

Functional properties and structural characterization of rice δ 1-pyrroline-5-carboxylate reductase

DOE PAGES

Forlani, Giuseppe; Bertazzini, Michele; Zarattini, Marco; ...

2015-07-28

The majority of plant species accumulate high intracellular levels of proline to cope with hyperosmotic stress conditions. Proline synthesis from glutamate is tightly regulated at both the transcriptional and the translational levels, yet little is known about the mechanisms for post-translational regulation of the enzymatic activities involved. The gene coding in rice ( Oryza sativa L.) for δ 1-pyrroline-5-carboxylate (P5C) reductase, the enzyme that catalyzes the second and final step in this pathway, was isolated and expressed in Escherichia coli. The structural and functional properties of the affinity-purified protein were characterized. As for most species, rice P5C reductase was ablemore » to use in vitro either NADH or NADPH as the electron donor. However, strikingly different effects of cations and anions were found depending on the pyridine nucleotide used, namely inhibition of NADH-dependent activity and stimulation of NADPH-dependent activity. Moreover, physiological concentrations of proline and NADP + were strongly inhibitory for the NADH-dependent reaction, whereas the NADPH-dependent activity was mildly affected. Our results suggest that only NADPH may be used in vivo and that stress-dependent variations in ion homeostasis and NADPH/NADP + ratio could modulate enzyme activity, being functional in promoting proline accumulation and potentially also adjusting NADPH consumption during the defense against hyperosmotic stress. The apparent molecular weight of the native protein observed in size exclusion chromatography indicated a high oligomerization state. We also report the first crystal structure of a plant P5C reductase at 3.40-Å resolution, showing a decameric quaternary assembly. It was possible to identify dynamic structural differences among rice, human, and bacterial enzymes.« less

Non-Targeted Metabolomics Analysis of Golden Retriever Muscular Dystrophy-Affected Muscles Reveals Alterations in Arginine and Proline Metabolism, and Elevations in Glutamic and Oleic Acid In Vivo.

PubMed

Abdullah, Muhammad; Kornegay, Joe N; Honcoop, Aubree; Parry, Traci L; Balog-Alvarez, Cynthia J; O'Neal, Sara K; Bain, James R; Muehlbauer, Michael J; Newgard, Christopher B; Patterson, Cam; Willis, Monte S

2017-07-29

Like Duchenne muscular dystrophy (DMD), the Golden Retriever Muscular Dystrophy (GRMD) dog model of DMD is characterized by muscle necrosis, progressive paralysis, and pseudohypertrophy in specific skeletal muscles. This severe GRMD phenotype includes moderate atrophy of the biceps femoris (BF) as compared to unaffected normal dogs, while the long digital extensor (LDE), which functions to flex the tibiotarsal joint and serves as a digital extensor, undergoes the most pronounced atrophy. A recent microarray analysis of GRMD identified alterations in genes associated with lipid metabolism and energy production. We, therefore, undertook a non-targeted metabolomics analysis of the milder/earlier stage disease GRMD BF muscle versus the more severe/chronic LDE using GC-MS to identify underlying metabolic defects specific for affected GRMD skeletal muscle. Untargeted metabolomics analysis of moderately-affected GRMD muscle (BF) identified eight significantly altered metabolites, including significantly decreased stearamide (0.23-fold of controls, p = 2.89 × 10 -3 ), carnosine (0.40-fold of controls, p = 1.88 × 10 -2 ), fumaric acid (0.40-fold of controls, p = 7.40 × 10 -4 ), lactamide (0.33-fold of controls, p = 4.84 × 10 -2 ), myoinositol-2-phosphate (0.45-fold of controls, p = 3.66 × 10 -2 ), and significantly increased oleic acid (1.77-fold of controls, p = 9.27 × 10 -2 ), glutamic acid (2.48-fold of controls, p = 2.63 × 10 -2 ), and proline (1.73-fold of controls, p = 3.01 × 10 -2 ). Pathway enrichment analysis identified significant enrichment for arginine/proline metabolism (p = 5.88 × 10 -4 , FDR 4.7 × 10 -2 ), where alterations in L-glutamic acid, proline, and carnosine were found. Additionally, multiple Krebs cycle intermediates were significantly decreased (e.g., malic acid, fumaric acid, citric/isocitric acid, and succinic acid), suggesting that altered energy metabolism may be underlying the observed GRMD BF muscle dysfunction. In contrast, two pathways, inosine-5'-monophosphate (VIP Score 3.91) and 3-phosphoglyceric acid (VIP Score 3.08) mainly contributed to the LDE signature, with two metabolites (phosphoglyceric acid and inosine-5'-monophosphate) being significantly decreased. When the BF and LDE were compared, the most significant metabolite was phosphoric acid, which was significantly less in the GRMD BF compared to control and GRMD LDE groups. The identification of elevated BF oleic acid (a long-chain fatty acid) is consistent with recent microarray studies identifying altered lipid metabolism genes, while alterations in arginine and proline metabolism are consistent with recent studies identifying elevated L-arginine in DMD patient sera as a biomarker of disease. Together, these studies demonstrate muscle-specific alterations in GRMD-affected muscle, which illustrate previously unidentified metabolic changes.

Proline Editing: A General and Practical Approach to the Synthesis of Functionally and Structurally Diverse Peptides. Analysis of Steric versus Stereoelectronic Effects of 4-Substituted Prolines on Conformation within Peptides

PubMed Central

Pandey, Anil K.; Naduthambi, Devan; Thomas, Krista M.; Zondlo, Neal J.

2013-01-01

Functionalized proline residues have diverse applications. Herein we describe a practical approach, proline editing, for the synthesis of peptides with stereospecifically modified proline residues. Peptides are synthesized by standard solid-phase-peptide-synthesis to incorporate Fmoc-Hydroxyproline (4R-Hyp). In an automated manner, the Hyp hydroxyl is protected and the remainder of the peptide synthesized. After peptide synthesis, the Hyp protecting group is orthogonally removed and Hyp selectively modified to generate substituted proline amino acids, with the peptide main chain functioning to “protect” the proline amino and carboxyl groups. In a model tetrapeptide (Ac-TYPN-NH2), 4R-Hyp was stereospecifically converted to 122 different 4-substituted prolyl amino acids, with 4R or 4S stereochemistry, via Mitsunobu, oxidation, reduction, acylation, and substitution reactions. 4-Substituted prolines synthesized via proline editing include incorporated structured amino acid mimetics (Cys, Asp/Glu, Phe, Lys, Arg, pSer/pThr), recognition motifs (biotin, RGD), electron-withdrawing groups to induce stereoelectronic effects (fluoro, nitrobenzoate), handles for heteronuclear NMR (19F:fluoro; pentafluorophenyl or perfluoro-tert-butyl ether; 4,4-difluoro; 77SePh) and other spectroscopies (fluorescence, IR: cyanophenyl ether), leaving groups (sulfonate, halide, NHS, bromoacetate), and other reactive handles (amine, thiol, thioester, ketone, hydroxylamine, maleimide, acrylate, azide, alkene, alkyne, aryl halide, tetrazine, 1,2-aminothiol). Proline editing provides access to these proline derivatives with no solution phase synthesis. All peptides were analyzed by NMR to identify stereoelectronic and steric effects on conformation. Proline derivatives were synthesized to permit bioorthogonal conjugation reactions, including azide-alkyne, tetrazinetrans-cyclooctene, oxime, reductive amination, native chemical ligation, Suzuki, Sonogashira, cross-metathesis, and Diels-Alder reactions. These proline derivatives allowed three parallel bioorthogonal reactions to be conducted in one solution. PMID:23402492

Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

PubMed Central

Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

2007-01-01

Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

A Comprehensive Analysis of Nuclear-Encoded Mitochondrial Genes in Schizophrenia.

PubMed

Gonçalves, Vanessa F; Cappi, Carolina; Hagen, Christian M; Sequeira, Adolfo; Vawter, Marquis P; Derkach, Andriy; Zai, Clement C; Hedley, Paula L; Bybjerg-Grauholm, Jonas; Pouget, Jennie G; Cuperfain, Ari B; Sullivan, Patrick F; Christiansen, Michael; Kennedy, James L; Sun, Lei

2018-05-01

The genetic risk factors of schizophrenia (SCZ), a severe psychiatric disorder, are not yet fully understood. Multiple lines of evidence suggest that mitochondrial dysfunction may play a role in SCZ, but comprehensive association studies are lacking. We hypothesized that variants in nuclear-encoded mitochondrial genes influence susceptibility to SCZ. We conducted gene-based and gene-set analyses using summary association results from the Psychiatric Genomics Consortium Schizophrenia Phase 2 (PGC-SCZ2) genome-wide association study comprising 35,476 cases and 46,839 control subjects. We applied the MAGMA method to three sets of nuclear-encoded mitochondrial genes: oxidative phosphorylation genes, other nuclear-encoded mitochondrial genes, and genes involved in nucleus-mitochondria crosstalk. Furthermore, we conducted a replication study using the iPSYCH SCZ sample of 2290 cases and 21,621 control subjects. In the PGC-SCZ2 sample, 1186 mitochondrial genes were analyzed, among which 159 had p values < .05 and 19 remained significant after multiple testing correction. A meta-analysis of 818 genes combining the PGC-SCZ2 and iPSYCH samples resulted in 104 nominally significant and nine significant genes, suggesting a polygenic model for the nuclear-encoded mitochondrial genes. Gene-set analysis, however, did not show significant results. In an in silico protein-protein interaction network analysis, 14 mitochondrial genes interacted directly with 158 SCZ risk genes identified in PGC-SCZ2 (permutation p = .02), and aldosterone signaling in epithelial cells and mitochondrial dysfunction pathways appeared to be overrepresented in this network of mitochondrial and SCZ risk genes. This study provides evidence that specific aspects of mitochondrial function may play a role in SCZ, but we did not observe its broad involvement even using a large sample. Copyright © 2018 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

SNPing at the Epidermal Barrier.

PubMed

Kelsell, David P; Byrne, Carolyn

2011-08-01

Filaggrin variants are well-established risk factors for atopic eczema (AE). Recent studies suggest additional epidermal differentiation complex (EDC) gene associations with AE. In this issue, Marenholz and colleagues confirm this prediction and show that a small proline-rich protein 3 (SPRR3) variant confers susceptibility to AE. This finding suggests that further genetic and functional characterization of SPRR3 should be performed in patients with AE.

Casein Kinase I Isoform Hrr25 Is a Negative Regulator of Haa1 in the Weak Acid Stress Response Pathway in Saccharomyces cerevisiae

PubMed Central

Collins, Morgan E.; Black, Joshua J.

2017-01-01

ABSTRACT Haa1 is a transcription factor that adapts Saccharomyces cerevisiae cells to weak organic acid stresses by activating the expression of various genes. Many of these genes encode membrane proteins, such as TPO2 and YRO2. How Haa1 is activated by weak acids is not clear. Here, we show that casein kinase I isoform Hrr25 is an important negative regulator of Haa1. Haa1 is known to be multiply phosphorylated. We found that mutations in HRR25 lead to reduced Haa1 phosphorylation and increased expression of Haa1 target genes and that Hrr25 interacts with Haa1. The other three casein kinase I isoforms, Yck1, Yck2, and Yck3, do not seem to play critical roles in Haa1 regulation. Hrr25 has a 200-residue C-terminal region, including a proline- and glutamine-rich domain. Our data suggest that the C-terminal region of Hrr25 is required for normal inhibition of expression of Haa1 target genes TPO2 and YRO2 and is important for cell growth but is not required for cell morphogenesis. We propose that Hrr25 is an important regulator of cellular adaptation to weak acid stress by inhibiting Haa1 through phosphorylation. IMPORTANCE Our study has revealed the casein kinase I protein Hrr25 to be a negative regulator of Haa1, a transcription factor mediating the cellular response to stresses caused by weak acids. Many studies have focused on the target genes of Haa1 and their roles in weak acid stress responses, but little has been reported on the regulatory mechanism of Haa1. Weak acids, such as acetic acid, have long been used for food preservation by slowing down the growth of fungal species, including S. cerevisiae. In the biofuel industry, acetic acid in the lignocellulosic hydrolysates limits the production of ethanol, which is undesirable. By understanding how Haa1 is regulated, we can make advances in the field of food sciences to better preserve food and engineer acetic acid-resistant strains that will increase productivity in the biofuel industry. PMID:28432100

The ribosomal protein genes and Minute loci of Drosophila melanogaster

PubMed Central

Marygold, Steven J; Roote, John; Reuter, Gunter; Lambertsson, Andrew; Ashburner, Michael; Millburn, Gillian H; Harrison, Paul M; Yu, Zhan; Kenmochi, Naoya; Kaufman, Thomas C; Leevers, Sally J; Cook, Kevin R

2007-01-01

Background Mutations in genes encoding ribosomal proteins (RPs) have been shown to cause an array of cellular and developmental defects in a variety of organisms. In Drosophila melanogaster, disruption of RP genes can result in the 'Minute' syndrome of dominant, haploinsufficient phenotypes, which include prolonged development, short and thin bristles, and poor fertility and viability. While more than 50 Minute loci have been defined genetically, only 15 have so far been characterized molecularly and shown to correspond to RP genes. Results We combined bioinformatic and genetic approaches to conduct a systematic analysis of the relationship between RP genes and Minute loci. First, we identified 88 genes encoding 79 different cytoplasmic RPs (CRPs) and 75 genes encoding distinct mitochondrial RPs (MRPs). Interestingly, nine CRP genes are present as duplicates and, while all appear to be functional, one member of each gene pair has relatively limited expression. Next, we defined 65 discrete Minute loci by genetic criteria. Of these, 64 correspond to, or very likely correspond to, CRP genes; the single non-CRP-encoding Minute gene encodes a translation initiation factor subunit. Significantly, MRP genes and more than 20 CRP genes do not correspond to Minute loci. Conclusion This work answers a longstanding question about the molecular nature of Minute loci and suggests that Minute phenotypes arise from suboptimal protein synthesis resulting from reduced levels of cytoribosomes. Furthermore, by identifying the majority of haplolethal and haplosterile loci at the molecular level, our data will directly benefit efforts to attain complete deletion coverage of the D. melanogaster genome. PMID:17927810

Role of proline and GABA in sexual reproduction of angiosperms

PubMed Central

Biancucci, Marco; Mattioli, Roberto; Forlani, Giuseppe; Funck, Dietmar; Costantino, Paolo; Trovato, Maurizio

2015-01-01

Two glutamate derivatives, proline and γ-aminobutyric acid (GABA), appear to play pivotal roles in different aspects of sexual reproduction in angiosperms, although their precise function in plant reproduction and the molecular basis of their action are not yet fully understood. Proline and GABA have long been regarded as pivotal amino acids in pollen vitality and fertility. Proline may constitute up to 70% of the free amino acid pool in pollen grains and it has been recently shown that Arabidopsis mutants affected in the first and rate-limiting step in proline synthesis produce aberrant and infertile pollen grains, indicating that proline synthesis is required for pollen development and fertility. Concerning GABA, a large body of evidence points to this glutamate derivative as a key determinant of post-pollination fertilization. Intriguingly, proline has also been associated with pollination, another aspect of sexual reproduction, since honeybees were reported to show a strong preference for proline-enriched nectars. In this review, we survey current knowledge on the roles of proline and GABA in plant fertility, and discuss future perspectives potentially capable to improve our understanding on the functions of these amino acids in pollen development, pollination, and pollen tube guidance. PMID:26388884

Poly-proline-based chiral stationary phases: a molecular dynamics study of triproline, tetraproline, pentaproline and hexaproline interfaces.

PubMed

Ashtari, M; Cann, N M

2012-11-23

Poly-proline chains and derivatives have been recently examined as the basis for new chiral stationary phases in high performance liquid chromatography. The selectivity of poly-proline has been measured for peptides with up to ten proline units. In this article, we employ molecular dynamics simulations to examine the interfacial structure and solvation of surface-bound poly-proline chiral selectors. Specifically, we study the interfacial structure of trimethylacetyl-terminated poly-proline chains with three-to-six prolines. The surface includes silanol groups and end-caps, to better capture the characteristics of the stationary phase, and the solvent is either a polar water/methanol or a relatively apolar n-hexane/2-propanol mixture. We begin with a comprehensive ab initio study of the conformers, their energies, and an assessment of conformer flexibility. Force fields have been developed for each poly-proline selector. Molecular dynamics simulations are employed to study the preferred backbone conformations and solvent hydrogen bonding for different poly-proline/solvent interfaces. For triproline, the effect of two different terminal groups, trimethylacetyl and t-butyl carbamate are compared. Copyright © 2012 Elsevier B.V. All rights reserved.

Proteomic analysis reveals diverse proline hydroxylation-mediated oxygen-sensing cellular pathways in cancer cells

PubMed Central

Liu, Bing; Gao, Yankun; Ruan, Hai-Bin; Chen, Yue

2016-01-01

Proline hydroxylation is a critical cellular mechanism regulating oxygen-response pathways in tumor initiation and progression. Yet, its substrate diversity and functions remain largely unknown. Here, we report a system-wide analysis to characterize proline hydroxylation substrates in cancer cells using an immunoaffinity-purification assisted proteomics strategy. We identified 562 sites from 272 proteins in HeLa cells. Bioinformatic analysis revealed that proline hydroxylation substrates are significantly enriched with mRNA processing and stress-response cellular pathways with canonical and diverse flanking sequence motifs. Structural analysis indicates a significant enrichment of proline hydroxylation participating in the secondary structure of substrate proteins. Our study identified and validated Brd4, a key transcription factor, as a novel proline hydroxylation substrate. Functional analysis showed that the inhibition of proline hydroxylation pathway significantly reduced the proline hydroxylation abundance on Brd4 and affected Brd4-mediated transcriptional activity as well as cell proliferation in AML leukemia cells. Taken together, our study identified a broad regulatory role of proline hydroxylation in cellular oxygen-sensing pathways and revealed potentially new targets that dynamically respond to hypoxia microenvironment in tumor cells. PMID:27764789

Identifying metabolic enzymes with multiple types of association evidence

PubMed Central

Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M

2006-01-01

Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130

Nitrogen availability regulates proline and ethylene production and alleviates salinity stress in mustard (Brassica juncea).

PubMed

Iqbal, Noushina; Umar, Shahid; Khan, Nafees A

2015-04-15

Proline content and ethylene production have been shown to be involved in salt tolerance mechanisms in plants. To assess the role of nitrogen (N) in the protection of photosynthesis under salt stress, the effect of N (0, 5, 10, 20 mM) on proline and ethylene was studied in mustard (Brassica juncea). Sufficient N (10 mM) optimized proline production under non-saline conditions through an increase in proline-metabolizing enzymes, leading to osmotic balance and protection of photosynthesis through optimal ethylene production. Excess N (20 mM), in the absence of salt stress, inhibited photosynthesis and caused higher ethylene evolution but lower proline production compared to sufficient N. In contrast, under salt stress with an increased demand for N, excess N optimized ethylene production, which regulates the proline content resulting in recovered photosynthesis. The effect of excess N on photosynthesis under salt stress was further substantiated by the application of the ethylene biosynthesis inhibitor, 1-aminoethoxy vinylglycine (AVG), which inhibited proline production and photosynthesis. Without salt stress, AVG promoted photosynthesis in plants receiving excess N by inhibiting stress ethylene production. The results suggest that a regulatory interaction exists between ethylene, proline and N for salt tolerance. Nitrogen differentially regulates proline production and ethylene formation to alleviate the adverse effect of salinity on photosynthesis in mustard. Copyright © 2015 Elsevier GmbH. All rights reserved.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

PubMed

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Proline supplementation to parenteral nutrition results in greater rates of protein synthesis in the muscle, skin, and small intestine in neonatal Yucatan miniature piglets.

PubMed

Brunton, Janet A; Baldwin, Mark P; Hanna, Rodney A; Bertolo, Robert F

2012-06-01

Proline and arginine are each indispensable during parenteral feeding due to limited interconversion by an atrophied gut. Commercial amino acid parenteral products designed for neonates contain proline concentrations that differ by almost 4-fold. To assess the adequacy of the lowest concentration of proline provided in commercial total parenteral nutrition (TPN) products, we compared rates of tissue-specific protein synthesis and nitrogen balance in neonatal piglets provided TPN at 2 different proline concentrations. Yucatan miniature piglets (9-11 d old, n = 12) were randomized to complete isonitrogenous TPN diets with low proline (LP; L-proline as 3% of amino acids) or proline supplemented (PS; 9%). After 7 d of receiving TPN, rates of protein synthesis in liver, gastrocnemius muscle, jejunal mucosa, and skin were determined by the flooding dose technique and tissue free amino acids were measured. Nitrogen balance was assessed during the last 3 d. The LP TPN resulted in lower free proline concentrations in plasma, muscle, and skin (P < 0.05) and lower rates of protein synthesis in the jejunum (by 25%; P = 0.02), muscle (by 45%; P = 0.015), and skin (by 60%; P = 0.01); there was no difference in liver. Nitrogen retention was 20% lower in the LP group (P = 0.01). In conclusion, muscle and skin protein synthesis was profoundly sensitive to parenteral proline supply and the reduced protein synthesis in the intestine could affect intestinal integrity. Low-proline TPN solutions that are currently in wide use in neonatal care may result in impaired tissue growth.

Secretion Trap Tagging of Secreted and Membrane-Spanning Proteins Using Arabidopsis Gene Traps

Treesearch

Andrew T. Groover; Joseph R. Fontana; Juana M. Arroyo; Cristina Yordan; W. Richard McCombie; Robert A. Martienssen

2003-01-01

Secreted and membrane-spanning proteins play fundamental roles in plant development but pose challenges for genetic identification and characterization. We describe a "secretion trap" screen for gene trap insertions in genes encoding proteins routed through the secretory pathway. The gene trap transposon encodes a ß-glucuronidase reporter enzyme...

A deep auto-encoder model for gene expression prediction.

PubMed

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Prediction and Biochemical Demonstration of a Catabolic Pathway for the Osmoprotectant Proline Betaine

PubMed Central

Kumar, Ritesh; Zhao, Suwen; Vetting, Matthew W.; Wood, B. McKay; Sakai, Ayano; Cho, Kyuil; Solbiati, José; Almo, Steven C.; Sweedler, Jonathan V.; Jacobson, Matthew P.; Gerlt, John A.; Cronan, John E.

2014-01-01

ABSTRACT Through the use of genetic, enzymatic, metabolomic, and structural analyses, we have discovered the catabolic pathway for proline betaine, an osmoprotectant, in Paracoccus denitrificans and Rhodobacter sphaeroides. Genetic and enzymatic analyses showed that several of the key enzymes of the hydroxyproline betaine degradation pathway also function in proline betaine degradation. Metabolomic analyses detected each of the metabolic intermediates of the pathway. The proline betaine catabolic pathway was repressed by osmotic stress and cold stress, and a regulatory transcription factor was identified. We also report crystal structure complexes of the P. denitrificans HpbD hydroxyproline betaine epimerase/proline betaine racemase with l-proline betaine and cis-hydroxyproline betaine. PMID:24520058

Unusual properties of aqueous solutions of L-proline: A molecular dynamics study

NASA Astrophysics Data System (ADS)

Civera, Monica; Sironi, Maurizio; Fornili, Sandro L.

2005-11-01

Aqueous solutions of the bioprotectant proline are simulated for solute molar fractions ranging from 2.0 × 10 -3 to 2.3 × 10 -1. Statistical analyses show that proline affects the water structure more strongly than glycine betaine and trimethylamine- N-oxide, two of the most effective bioprotectants widely diffuse in nature, and as strongly as tert-butyl alcohol, a protein denaturant which at high concentration self-aggregates. No evidence is found, however, that proline self-aggregates as it has been previously suggested to explain experimental findings on concentrated proline solutions. Nevertheless, the behavior of the diffusion coefficients of proline and water vs. solute concentration qualitatively agrees with such results.

Molecular evolution of nitrogen assimilatory enzymes in marine prasinophytes.

PubMed

Ghoshroy, Sohini; Robertson, Deborah L

2015-01-01

Nitrogen assimilation is a highly regulated process requiring metabolic coordination of enzymes and pathways in the cytosol, chloroplast, and mitochondria. Previous studies of prasinophyte genomes revealed that genes encoding nitrate and ammonium transporters have a complex evolutionary history involving both vertical and horizontal transmission. Here we examine the evolutionary history of well-conserved nitrogen-assimilating enzymes to determine if a similar complex history is observed. Phylogenetic analyses suggest that genes encoding glutamine synthetase (GS) III in the prasinophytes evolved by horizontal gene transfer from a member of the heterokonts. In contrast, genes encoding GSIIE, a canonical vascular plant and green algal enzyme, were found in the Micromonas genomes but have been lost from Ostreococcus. Phylogenetic analyses placed the Micromonas GSIIs in a larger chlorophyte/vascular plant clade; a similar topology was observed for ferredoxin-dependent nitrite reductase (Fd-NiR), indicating the genes encoding GSII and Fd-NiR in these prasinophytes evolved via vertical transmission. Our results show that genes encoding the nitrogen-assimilating enzymes in Micromonas and Ostreococcus have been differentially lost and as well as recruited from different evolutionary lineages, suggesting that the regulation of nitrogen assimilation in prasinophytes will differ from other green algae.

Living colors in the gray mold pathogen Botrytis cinerea: codon-optimized genes encoding green fluorescent protein and mCherry, which exhibit bright fluorescence.

PubMed

Leroch, Michaela; Mernke, Dennis; Koppenhoefer, Dieter; Schneider, Prisca; Mosbach, Andreas; Doehlemann, Gunther; Hahn, Matthias

2011-05-01

The green fluorescent protein (GFP) and its variants have been widely used in modern biology as reporters that allow a variety of live-cell imaging techniques. So far, GFP has rarely been used in the gray mold fungus Botrytis cinerea because of low fluorescence intensity. The codon usage of B. cinerea genes strongly deviates from that of commonly used GFP-encoding genes and reveals a lower GC content than other fungi. In this study, we report the development and use of a codon-optimized version of the B. cinerea enhanced GFP (eGFP)-encoding gene (Bcgfp) for improved expression in B. cinerea. Both the codon optimization and, to a smaller extent, the insertion of an intron resulted in higher mRNA levels and increased fluorescence. Bcgfp was used for localization of nuclei in germinating spores and for visualizing host penetration. We further demonstrate the use of promoter-Bcgfp fusions for quantitative evaluation of various toxic compounds as inducers of the atrB gene encoding an ABC-type drug efflux transporter of B. cinerea. In addition, a codon-optimized mCherry-encoding gene was constructed which yielded bright red fluorescence in B. cinerea.

Meta-omic signatures of microbial metal and nitrogen cycling in marine oxygen minimum zones

PubMed Central

Glass, Jennifer B.; Kretz, Cecilia B.; Ganesh, Sangita; Ranjan, Piyush; Seston, Sherry L.; Buck, Kristen N.; Landing, William M.; Morton, Peter L.; Moffett, James W.; Giovannoni, Stephen J.; Vergin, Kevin L.; Stewart, Frank J.

2015-01-01

Iron (Fe) and copper (Cu) are essential cofactors for microbial metalloenzymes, but little is known about the metalloenyzme inventory of anaerobic marine microbial communities despite their importance to the nitrogen cycle. We compared dissolved O2, NO3−, NO2−, Fe and Cu concentrations with nucleic acid sequences encoding Fe and Cu-binding proteins in 21 metagenomes and 9 metatranscriptomes from Eastern Tropical North and South Pacific oxygen minimum zones and 7 metagenomes from the Bermuda Atlantic Time-series Station. Dissolved Fe concentrations increased sharply at upper oxic-anoxic transition zones, with the highest Fe:Cu molar ratio (1.8) occurring at the anoxic core of the Eastern Tropical North Pacific oxygen minimum zone and matching the predicted maximum ratio based on data from diverse ocean sites. The relative abundance of genes encoding Fe-binding proteins was negatively correlated with O2, driven by significant increases in genes encoding Fe-proteins involved in dissimilatory nitrogen metabolisms under anoxia. Transcripts encoding cytochrome c oxidase, the Fe- and Cu-containing terminal reductase in aerobic respiration, were positively correlated with O2 content. A comparison of the taxonomy of genes encoding Fe- and Cu-binding vs. bulk proteins in OMZs revealed that Planctomycetes represented a higher percentage of Fe genes while Thaumarchaeota represented a higher percentage of Cu genes, particularly at oxyclines. These results are broadly consistent with higher relative abundance of genes encoding Fe-proteins in the genome of a marine planctomycete vs. higher relative abundance of genes encoding Cu-proteins in the genome of a marine thaumarchaeote. These findings highlight the importance of metalloenzymes for microbial processes in oxygen minimum zones and suggest preferential Cu use in oxic habitats with Cu > Fe vs. preferential Fe use in anoxic niches with Fe > Cu. PMID:26441925

Meta-omic signatures of microbial metal and nitrogen cycling in marine oxygen minimum zones.

PubMed

Glass, Jennifer B; Kretz, Cecilia B; Ganesh, Sangita; Ranjan, Piyush; Seston, Sherry L; Buck, Kristen N; Landing, William M; Morton, Peter L; Moffett, James W; Giovannoni, Stephen J; Vergin, Kevin L; Stewart, Frank J

2015-01-01

Iron (Fe) and copper (Cu) are essential cofactors for microbial metalloenzymes, but little is known about the metalloenyzme inventory of anaerobic marine microbial communities despite their importance to the nitrogen cycle. We compared dissolved O2, NO[Formula: see text], NO[Formula: see text], Fe and Cu concentrations with nucleic acid sequences encoding Fe and Cu-binding proteins in 21 metagenomes and 9 metatranscriptomes from Eastern Tropical North and South Pacific oxygen minimum zones and 7 metagenomes from the Bermuda Atlantic Time-series Station. Dissolved Fe concentrations increased sharply at upper oxic-anoxic transition zones, with the highest Fe:Cu molar ratio (1.8) occurring at the anoxic core of the Eastern Tropical North Pacific oxygen minimum zone and matching the predicted maximum ratio based on data from diverse ocean sites. The relative abundance of genes encoding Fe-binding proteins was negatively correlated with O2, driven by significant increases in genes encoding Fe-proteins involved in dissimilatory nitrogen metabolisms under anoxia. Transcripts encoding cytochrome c oxidase, the Fe- and Cu-containing terminal reductase in aerobic respiration, were positively correlated with O2 content. A comparison of the taxonomy of genes encoding Fe- and Cu-binding vs. bulk proteins in OMZs revealed that Planctomycetes represented a higher percentage of Fe genes while Thaumarchaeota represented a higher percentage of Cu genes, particularly at oxyclines. These results are broadly consistent with higher relative abundance of genes encoding Fe-proteins in the genome of a marine planctomycete vs. higher relative abundance of genes encoding Cu-proteins in the genome of a marine thaumarchaeote. These findings highlight the importance of metalloenzymes for microbial processes in oxygen minimum zones and suggest preferential Cu use in oxic habitats with Cu > Fe vs. preferential Fe use in anoxic niches with Fe > Cu.

The Yersinia pestis gcvB gene encodes two small regulatory RNA molecules

PubMed Central

McArthur, Sarah D; Pulvermacher, Sarah C; Stauffer, George V

2006-01-01

Background In recent years it has become clear that small non-coding RNAs function as regulatory elements in bacterial virulence and bacterial stress responses. We tested for the presence of the small non-coding GcvB RNAs in Y. pestis as possible regulators of gene expression in this organism. Results In this study, we report that the Yersinia pestis KIM6 gcvB gene encodes two small RNAs. Transcription of gcvB is activated by the GcvA protein and repressed by the GcvR protein. The gcvB-encoded RNAs are required for repression of the Y. pestis dppA gene, encoding the periplasmic-binding protein component of the dipeptide transport system, showing that the GcvB RNAs have regulatory activity. A deletion of the gcvB gene from the Y. pestis KIM6 chromosome results in a decrease in the generation time of the organism as well as a change in colony morphology. Conclusion The results of this study indicate that the Y. pestis gcvB gene encodes two small non-coding regulatory RNAs that repress dppA expression. A gcvB deletion is pleiotropic, suggesting that the sRNAs are likely involved in controlling genes in addition to dppA. PMID:16768793

A novel nonsteroidal antifibrotic oligo decoy containing the TGF-beta element found in the COL1A1 gene which regulates murine schistosomiasis liver fibrosis.

PubMed

Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R

2005-08-01

Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.

Metabolomic Response to Huanglongbing: Role of Carboxylic Compounds in Citrus sinensis Response to 'Candidatus Liberibacter asiaticus' and Its Vector, Diaphorina citri.

PubMed

Killiny, Nabil; Nehela, Yasser

2017-08-01

Huanglongbing, a destructive disease of citrus, is caused by the fastidious bacterium 'Candidatus Liberibacter asiaticus' and transmitted by Asian citrus psyllid, Diaphorina citri. The impact of 'Ca. L. asiaticus' infection or D. citri infestation on Valencia sweet orange (Citrus sinensis) leaf metabolites was investigated using gas chromatography mass spectrometry, followed by gene expression analysis for 37 genes involved in jasmonic acid (JA), salicylic acid (SA), and proline-glutamine pathways. The total amino acid abundance increased after 'Ca. L. asiaticus' infection, while the total fatty acids increased dramatically after infestation with D. citri, compared with control plants. Seven amino acids (glycine, l-isoleucine, l-phenylalanine, l-proline, l-serine, l-threonine, and l-tryptophan) and five organic acids (benzoic acid, citric acid, fumaric acid, SA, and succinic acid) increased in 'Ca. L. asiaticus'-infected plants. On the other hand, the abundance of trans-JA and its precursor α-linolenic increased in D. citri-infested plants. Surprisingly, the double attack of both D. citri infestation and 'Ca. L. asiaticus' infection moderated the metabolic changes in all chemical classes studied. In addition, the gene expression analysis supported these results. Based on these findings, we suggest that, although amino acids such as phenylalanine are involved in citrus defense against 'Ca. L. asiaticus' infection through the activation of an SA-mediated pathway, fatty acids, especially α-linolenic acid, are involved in defense against D. citri infestation via the induction of a JA-mediated pathway.

Screening for ATM Mutations in an African-American Population to Identify a Predictor of Breast Cancer Susceptibility

DTIC Science & Technology

2006-07-01

ATM genetic variant identified affects radiosensitivity and levels of the protein encoded by the ATM gene for each mutation examined. 15. SUBJECT...women without breast cancer. An additional objective is to determine the functional impact upon the protein encoded by the ATM gene for each mutation ...each ATM variant identified affects radiosensitivity and levels of the protein encoded by the ATM gene for mutations identified. Body STATEMENT

Isolation of a gene encoding a novel spectinomycin phosphotransferase from Legionella pneumophila.

PubMed

Suter, T M; Viswanathan, V K; Cianciotto, N P

1997-06-01

A gene capable of conferring spectinomycin resistance was isolated from Legionella pneumophila, the agent of Legionnaires' disease. The gene (aph) encoded a 36-kDa protein which has similarity to aminoglycoside phosphotransferases. Biochemical analysis confirmed that aph encodes a phosphotransferase which modifies spectinomycin but not hygromycin, kanamycin, or streptomycin. The strain that was the source of aph demonstrated resistance to spectinomycin, and Southern hybridizations determined that aph also exists in other legionellae.

Isolation of a gene encoding a novel spectinomycin phosphotransferase from Legionella pneumophila.

PubMed Central

Suter, T M; Viswanathan, V K; Cianciotto, N P

1997-01-01

A gene capable of conferring spectinomycin resistance was isolated from Legionella pneumophila, the agent of Legionnaires' disease. The gene (aph) encoded a 36-kDa protein which has similarity to aminoglycoside phosphotransferases. Biochemical analysis confirmed that aph encodes a phosphotransferase which modifies spectinomycin but not hygromycin, kanamycin, or streptomycin. The strain that was the source of aph demonstrated resistance to spectinomycin, and Southern hybridizations determined that aph also exists in other legionellae. PMID:9174205

DFR1-Mediated Inhibition of Proline Degradation Pathway Regulates Drought and Freezing Tolerance in Arabidopsis.

PubMed

Ren, Yongbing; Miao, Min; Meng, Yun; Cao, Jiasheng; Fan, Tingting; Yue, Junyang; Xiao, Fangming; Liu, Yongsheng; Cao, Shuqing

2018-06-26

Proline accumulation is one of the most important adaptation mechanisms for plants to cope with environmental stresses, such as drought and freezing. However, the molecular mechanism of proline homeostasis under these stresses is largely unknown. Here, we identified a mitochondrial protein, DFR1, involved in the inhibition of proline degradation in Arabidopsis. DFR1 was strongly induced by drought and cold stresses. The dfr1 knockdown mutants showed hypersensitivity to drought and freezing stresses, whereas the DFR1 overexpression plants exhibited enhanced tolerance, which was positively correlated with proline levels. DFR1 interacts with proline degradation enzymes PDH1/2 and P5CDH and compromises their activities. Genetic analysis showed that DFR1 acts upstream of PDH1/2 and P5CDH to positively regulate proline accumulation. Our results demonstrate a regulatory mechanism by which, under drought and freezing stresses, DFR1 interacts with PDH1/2 and P5CDH to abrogate their activities to maintain proline homeostasis, thereby conferring drought and freezing tolerance. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Exogenous proline enhances the sensitivity of Tobacco BY-2 cells to arsenate.

PubMed

Nahar, Mst Nur-E-Nazmun; Islam, Mohammad Muzahidul; Hoque, Md Anamul; Yonezawa, Anna; Prodhan, Md Yeasin; Nakamura, Toshiyuki; Nakamura, Yoshimasa; Munemasa, Shintaro; Murata, Yoshiyuki

2017-09-01

Arsenic causes physiological and structural disorders in plants. Proline is accumulated as a compatible solute in plants under various stress conditions and mitigates stresses. Here, we investigated the effects of exogenous proline on tobacco Bright Yellow-2 (BY-2) cultured cells under [Formula: see text] stress. Arsenate did not inhibit BY-2 cell growth at 40 and 50 μM but did it at 60 μM. Proline at 0.5 to 10 mM did not affect the cell growth but delayed it at 20 mM. At 40 μM [Formula: see text], neither 0.5 mM nor 1 mM proline affected the cell growth but 10 mM proline inhibited it. In the presence of [Formula: see text], 10 mM proline increased the number of Evans Blue-stained (dead) cells and decreased the number of total cells. Together, our results suggest that exogenous proline does not alleviate arsenate toxicity but enhances the sensitivity of BY-2 cells to arsenate.

Cytosolic Accumulation of L-Proline Disrupts GABA-Ergic Transmission through GAD Blockade.

PubMed

Crabtree, Gregg W; Park, Alan J; Gordon, Joshua A; Gogos, Joseph A

2016-10-04

Proline dehydrogenase (PRODH), which degrades L-proline, resides within the schizophrenia-linked 22q11.2 deletion suggesting a role in disease. Supporting this, elevated L-proline levels have been shown to increase risk for psychotic disorders. Despite the strength of data linking PRODH and L-proline to neuropsychiatric diseases, targets of disease-relevant concentrations of L-proline have not been convincingly described. Here, we show that Prodh-deficient mice with elevated CNS L-proline display specific deficits in high-frequency GABA-ergic transmission and gamma-band oscillations. We find that L-proline is a GABA-mimetic and can act at multiple GABA-ergic targets. However, at disease-relevant concentrations, GABA-mimesis is limited to competitive blockade of glutamate decarboxylase leading to reduced GABA production. Significantly, deficits in GABA-ergic transmission are reversed by enhancing net GABA production with the clinically relevant compound vigabatrin. These findings indicate that accumulation of a neuroactive metabolite can lead to molecular and synaptic dysfunction and help to understand mechanisms underlying neuropsychiatric disease. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

PubMed

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Conformational flexibility determines selectivity and antibacterial, antiplasmodial, and anticancer potency of cationic α-helical peptides.

PubMed

Vermeer, Louic S; Lan, Yun; Abbate, Vincenzo; Ruh, Emrah; Bui, Tam T; Wilkinson, Louise J; Kanno, Tokuwa; Jumagulova, Elmira; Kozlowska, Justyna; Patel, Jayneil; McIntyre, Caitlin A; Yam, W C; Siu, Gilman; Atkinson, R Andrew; Lam, Jenny K W; Bansal, Sukhvinder S; Drake, Alex F; Mitchell, Graham H; Mason, A James

2012-10-05

We used a combination of fluorescence, circular dichroism (CD), and NMR spectroscopies in conjunction with size exclusion chromatography to help rationalize the relative antibacterial, antiplasmodial, and cytotoxic activities of a series of proline-free and proline-containing model antimicrobial peptides (AMPs) in terms of their structural properties. When compared with proline-free analogs, proline-containing peptides had greater activity against Gram-negative bacteria, two mammalian cancer cell lines, and intraerythrocytic Plasmodium falciparum, which they were capable of killing without causing hemolysis. In contrast, incorporation of proline did not have a consistent effect on peptide activity against Mycobacterium tuberculosis. In membrane-mimicking environments, structures with high α-helix content were adopted by both proline-free and proline-containing peptides. In solution, AMPs generally adopted disordered structures unless their sequences comprised more hydrophobic amino acids or until coordinating phosphate ions were added. Proline-containing peptides resisted ordering induced by either method. The roles of the angle subtended by positively charged amino acids and the positioning of the proline residues were also investigated. Careful positioning of proline residues in AMP sequences is required to enable the peptide to resist ordering and maintain optimal antibacterial activity, whereas varying the angle subtended by positively charged amino acids can attenuate hemolytic potential albeit with a modest reduction in potency. Maintaining conformational flexibility improves AMP potency and selectivity toward bacterial, plasmodial, and cancerous cells while enabling the targeting of intracellular pathogens.

Synthesis, spectral characterization and biological studies of some organotin(IV) complexes of L-proline, trans-hydroxy- L-proline and L-glutamine

NASA Astrophysics Data System (ADS)

Nath, Mala; Jairath, Ruchi; Eng, George; Song, Xueqing; Kumar, Ashok

2005-12-01

New organotin(IV) complexes of the general formula R 3Sn(L) (where R = Me, n-Bu and HL = L-proline; R = Me, Ph and HL = trans-hydroxy- L-proline and L-glutamine) and R 2Sn(L) 2 (where R = n-Bu, Ph and HL = L-proline; R = Ph, HL = trans-hydroxy- L-proline) have been synthesized by the reaction of R nSnCl 4- n (where n = 2 or 3) with sodium salt of the amino acid (HL). n-Bu 2Sn(Pro) 2 was synthesized by the reaction of n-Bu 2SnO with L-proline under azeotropic removal of water. The bonding and coordination behavior in these complexes have been discussed on the basis of IR and 119Sn Mössbauer spectroscopic studies in the solid-state. Their coordination behavior in solution has been discussed with the help of multinuclear ( 1H, 13C and 119Sn) NMR spectral studies. The 119Sn Mössbauer and IR studies indicate that L-proline and trans-hydroxy- L-proline show similar coordination behavior towards organotin(IV) compounds. Pentacoordinate trigonal-bipyramidal and hexacoordinate octahedral structures, respectively, have been proposed for the tri- and diorganotin(IV) complexes of L-proline and trans-hydroxy- L-proline, in which the carboxylate group acts as bidentate group. L-Glutamine shows different coordination behavior towards organotin(IV) compounds, it acts as monoanionic bidentate ligand coordinating through carboxylate and amino group. The triorganotin(IV) complexes of L-glutamine have been proposed to have trigonal-bipyramidal environment around tin. The newly synthesized complexes have been tested for their antiinflammatory and cardiovascular activities. Their LD 50 values are >1000 mg kg -1.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

PubMed

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora.

PubMed

Pöggeler, S

2000-06-01

In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.

Functional Consequences of Intracellular Proline Levels Manipulation Affecting PRODH/POX-Dependent Pro-Apoptotic Pathways in a Novel in Vitro Cell Culture Model.

PubMed

Zareba, Ilona; Surazynski, Arkadiusz; Chrusciel, Marcin; Miltyk, Wojciech; Doroszko, Milena; Rahman, Nafis; Palka, Jerzy

2017-01-01

The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels. We have used inhibitor of proline utilization in collagen biosynthesis, 2-metoxyestradiol (MOE), inhibitor of prolidase that generate proline, rapamycin (Rap) and glycyl-proline (GlyPro), substrate for prolidase. Collagen and DNA biosynthesis were evaluated by radiometric assays. Cell viability was determined using Nucleo-Counter NC-3000. The activity of prolidase was determined by colorimetric assay. Expression of proteins was assessed by Western blot and immunofluorescence bioimaging. Concentration of proline was analyzed by liquid chromatography with mass spectrometry. PRODH/POX knockdown decreased DNA and collagen biosynthesis, whereas increased prolidase activity and intracellular proline level in MCF-7shPRODH/POX cells. All studied compounds decreased cell viability in MCF-7 and MCF-7shPRODH/POX cells. DNA biosynthesis was similarly inhibited by Rap and MOE in both cell lines, but GlyPro inhibited the process only in MCF-7shPRODH/POX and MOE+GlyPro only in MCF-7 cells. All the compounds inhibited collagen biosynthesis, increased prolidase activity and cytoplasmic proline level in MCF-7shPRODH/POX cells and contributed to the induction of pro-survival mode only in MCF-7shPRODH/POX cells. In contrast, all studied compounds upregulated expression of pro-apoptotic protein only in MCF-7 cells. PRODH/POX was confirmed as a driver of apoptosis and proved the eligibility of MCF-7shPRODH/POX cell line as a highly effective model to elucidate the different mechanisms underlying proline utilization or generation in PRODH/POX-dependent pro-apoptotic pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

Arxula adeninivorans (Blastobotrys adeninivorans) — A Dimorphic Yeast of Great Biotechnological Potential

NASA Astrophysics Data System (ADS)

Böer, Erik; Steinborn, Gerhard; Florschütz, Kristina; Körner, Martina; Gellissen, Gerd; Kunze, Gotthard

The dimorphic ascomycetous yeast Arxula adeninivorans exhibits some unusual properties. Being a thermo- and halotolerant species it is able to assimilate and ferment many compounds as sole carbon and/or nitrogen source. It utilises n-alkanes and is capable of degrading starch. Due to these unusual biochemical properties A. adeninivorans can be exploited as a gene donor for the production of enzymes with attractive biotechnological characteristics. Examples of A. adeninivorans-derived genes that are overexpressed include the ALIP1 gene encoding a secretory lipase, the AINV encoding invertase, the AXDH encoding xylitol dehydrogenase and the APHY encoding a secretory phosphatase with phytase activity.

An evaluation of the role of a pyroglutamyl peptidase, a post-proline cleaving enzyme and a post-proline dipeptidyl amino peptidase, each purified from the soluble fraction of guinea-pig brain, in the degradation of thyroliberin in vitro.

PubMed

Browne, P; O'Cuinn, G

1983-12-01

The degradation of thyroliberin (less than Glu-His-Pro-NH2) to its component amino acids by the soluble fraction of guinea pig brain is catalysed by four enzymes namely a pyroglutamate aminopeptidase, a post-proline cleaving enzyme, a post-proline dipeptidyl aminopeptidase and a proline dipeptidase. 1. The pyroglutamate aminopeptidase was purified to over 90% homogeneity with a purification factor of 2868-fold and a yield of 5.7%. In addition to catalysing the hydrolysis of thyroliberin, acid thyroliberin and pyroglutamate-7-amido-4-methylcoumarin the pyroglutamate aminopeptidase catalysed the hydrolysis of the peptide bond adjacent to the pyroglutamic acid residue in luliberin, neurotensin bombesin, bradykinin-potentiating peptide B, the anorexogenic peptide and the dipeptides pyroglutamyl alanine and pyroglutamyl valine. Pyroglutamyl proline and eledoisin were not hydrolysed. 2. The post-proline cleaving enzyme was purified to apparent electrophoretic homogeneity with a purification factor of 2298-fold and a yield of 10.6%. The post-proline cleaving enzyme catalysed the hydrolysis of thyroliberin and N-benzyloxycarbonyl-glycylproline-7-amido-4-methylcoumarin. It did not catalyse the hydrolysis of glycylproline-7-amido-4-methylcoumarin or His-Pro-NH2. 3. The post-proline dipeptidyl aminopeptidase was partially purified with a purification factor of 301-fold and a yield of 8.9%. The post-proline dipeptidyl aminopeptidase catalysed the hydrolysis of His-Pro-NH2 and glycylproline-7-amido-4-methylcoumarin but did not exhibit any post-proline cleaving endopeptidase activity against thyroliberin or N-benzyloxycarbonyl-glycylproline-7-amido-4-methylcoumarin. 4. Studies with various functional reagents indicated that the pyroglutamate aminopeptidase could be specifically inhibited by 2-iodoacetamide (100% inhibition at an inhibitor concentration of 5 microM), the post-proline cleaving enzyme by bacitracin (IC50 = 42 microM) and the post-proline dipeptidyl aminopeptidase by puromycin (IC50 = 46 microM). Because of their specific inhibitory effects these three reagents were key elements in the elucidation of the overall pathway for the metabolism of thyroliberin by guinea pig brain tissue enzymes.

Structure of the Elastin-Contractile Units in the Thoracic Aorta and How Genes That Cause Thoracic Aortic Aneurysms and Dissections Disrupt This Structure.

PubMed

Karimi, Ashkan; Milewicz, Dianna M

2016-01-01

The medial layer of the aorta confers elasticity and strength to the aortic wall and is composed of alternating layers of smooth muscle cells (SMCs) and elastic fibres. The SMC elastin-contractile unit is a structural unit that links the elastin fibres to the SMCs and is characterized by the following: (1) layers of elastin fibres that are surrounded by microfibrils; (2) microfibrils that bind to the integrin receptors in focal adhesions on the cell surface of the SMCs; and (3) SMC contractile filaments that are linked to the focal adhesions on the inner side of the membrane. The genes that are altered to cause thoracic aortic aneurysms and aortic dissections encode proteins involved in the structure or function of the SMC elastin-contractile unit. Included in this gene list are the genes encoding protein that are structural components of elastin fibres and microfibrils, FBN1, MFAP5, ELN, and FBLN4. Also included are genes that encode structural proteins in the SMC contractile unit, including ACTA2, which encodes SMC-specific α-actin and MYH11, which encodes SMC-specific myosin heavy chain, along with MYLK and PRKG1, which encode kinases that control SMC contraction. Finally, mutations in the gene encoding the protein linking integrin receptors to the contractile filaments, FLNA, also predispose to thoracic aortic disease. Thus, these data suggest that functional SMC elastin-contractile units are important for maintaining the structural integrity of the aorta. Copyright © 2016 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds.

PubMed

Seabra, Ana R; Vieira, Cristina P; Cullimore, Julie V; Carvalho, Helena G

2010-08-19

Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS), occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2) in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate that this gene duplication represents a functional innovation of plastid located GS related to storage protein accumulation exclusive to legume seed metabolism.

Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

PubMed

Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

2011-04-01

Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Gene Cluster Encoding Cholate Catabolism in Rhodococcus spp.

PubMed Central

Wilbrink, Maarten H.; Casabon, Israël; Stewart, Gordon R.; Liu, Jie; van der Geize, Robert; Eltis, Lindsay D.

2012-01-01

Bile acids are highly abundant steroids with important functions in vertebrate digestion. Their catabolism by bacteria is an important component of the carbon cycle, contributes to gut ecology, and has potential commercial applications. We found that Rhodococcus jostii RHA1 grows well on cholate, as well as on its conjugates, taurocholate and glycocholate. The transcriptome of RHA1 growing on cholate revealed 39 genes upregulated on cholate, occurring in a single gene cluster. Reverse transcriptase quantitative PCR confirmed that selected genes in the cluster were upregulated 10-fold on cholate versus on cholesterol. One of these genes, kshA3, encoding a putative 3-ketosteroid-9α-hydroxylase, was deleted and found essential for growth on cholate. Two coenzyme A (CoA) synthetases encoded in the cluster, CasG and CasI, were heterologously expressed. CasG was shown to transform cholate to cholyl-CoA, thus initiating side chain degradation. CasI was shown to form CoA derivatives of steroids with isopropanoyl side chains, likely occurring as degradation intermediates. Orthologous gene clusters were identified in all available Rhodococcus genomes, as well as that of Thermomonospora curvata. Moreover, Rhodococcus equi 103S, Rhodococcus ruber Chol-4 and Rhodococcus erythropolis SQ1 each grew on cholate. In contrast, several mycolic acid bacteria lacking the gene cluster were unable to grow on cholate. Our results demonstrate that the above-mentioned gene cluster encodes cholate catabolism and is distinct from a more widely occurring gene cluster encoding cholesterol catabolism. PMID:23024343

Mycobacterium tuberculosis Is a Natural Ornithine Aminotransferase (rocD) Mutant and Depends on Rv2323c for Growth on Arginine

PubMed Central

Hampel, Annegret; Huber, Claudia; Geffers, Robert; Spona-Friedl, Marina; Eisenreich, Wolfgang; Bange, Franz-Christoph

2015-01-01

Mycobacterium tuberculosis (Mtb) possesses a genetic repertoire for metabolic pathways, which are specific and fit to its intracellular life style. Under in vitro conditions, Mtb is known to use arginine as a nitrogen source, but the metabolic pathways for arginine utilization have not been identified. Here we show that, in the presence of arginine, Mtb upregulates a gene cluster which includes an ornithine aminotransferase (rocD) and Rv2323c, a gene of unknown function. Isotopologue analysis by using 13C- or 15N-arginine revealed that in Mtb arginine is not only used as nitrogen source but also as carbon source for the formation of amino acids, in particular of proline. Surprisingly, rocD, which is widespread in other bacteria and is part of the classical arginase pathway turned out to be naturally deleted in Mtb, but not in non-tuberculous mycobacteria. Mtb lacking Rv2323c showed a growth defect on arginine, did not produce proline from arginine, and incorporated less nitrogen derived from arginine in its core nitrogen metabolism. We conclude that the highly induced pathway for arginine utilization in Mtb differs from that of other bacteria including non-tuberculous mycobacteria, probably reflecting a specific metabolic feature of intracellular Mtb. PMID:26368558

The prrF-Encoded Small Regulatory RNAs Are Required for Iron Homeostasis and Virulence of Pseudomonas aeruginosa

PubMed Central

Reinhart, Alexandria A.; Powell, Daniel A.; Nguyen, Angela T.; O'Neill, Maura; Djapgne, Louise; Wilks, Angela; Ernst, Robert K.

2014-01-01

Pseudomonas aeruginosa is an opportunistic pathogen that requires iron to cause infection, but it also must regulate the uptake of iron to avoid iron toxicity. The iron-responsive PrrF1 and PrrF2 small regulatory RNAs (sRNAs) are part of P. aeruginosa's iron regulatory network and affect the expression of at least 50 genes encoding iron-containing proteins. The genes encoding the PrrF1 and PrrF2 sRNAs are encoded in tandem in P. aeruginosa, allowing for the expression of a distinct, heme-responsive sRNA named PrrH that appears to regulate genes involved in heme metabolism. Using a combination of growth, mass spectrometry, and gene expression analysis, we showed that the ΔprrF1,2 mutant, which lacks expression of the PrrF and PrrH sRNAs, is defective for both iron and heme homeostasis. We also identified phuS, encoding a heme binding protein involved in heme acquisition, and vreR, encoding a previously identified regulator of P. aeruginosa virulence genes, as novel targets of prrF-mediated heme regulation. Finally, we showed that the prrF locus encoding the PrrF and PrrH sRNAs is required for P. aeruginosa virulence in a murine model of acute lung infection. Moreover, we showed that inoculation with a ΔprrF1,2 deletion mutant protects against future challenge with wild-type P. aeruginosa. Combined, these data demonstrate that the prrF-encoded sRNAs are critical regulators of P. aeruginosa virulence. PMID:25510881

A single dose of a DNA vaccine encoding apa coencapsulated with 6,6'-trehalose dimycolate in microspheres confers long-term protection against tuberculosis in Mycobacterium bovis BCG-primed mice.

PubMed

Carlétti, Dyego; Morais da Fonseca, Denise; Gembre, Ana Flávia; Masson, Ana Paula; Weijenborg Campos, Lívia; Leite, Luciana C C; Rodrigues Pires, Andréa; Lannes-Vieira, Joseli; Lopes Silva, Célio; Bonato, Vânia Luiza Deperon; Horn, Cynthia

2013-08-01

Mycobacterium bovis BCG prime DNA (Mycobacterium tuberculosis genes)-booster vaccinations have been shown to induce greater protection against tuberculosis (TB) than BCG alone. This heterologous prime-boost strategy is perhaps the most realistic vaccination for the future of TB infection control, especially in countries where TB is endemic. Moreover, a prime-boost regimen using biodegradable microspheres seems to be a promising immunization to stimulate a long-lasting immune response. The alanine proline antigen (Apa) is a highly immunogenic glycoprotein secreted by M. tuberculosis. This study investigated the immune protection of Apa DNA vaccine against intratracheal M. tuberculosis challenge in mice on the basis of a heterologous prime-boost regimen. BALB/c mice were subcutaneously primed with BCG and intramuscularly boosted with a single dose of plasmid carrying apa and 6,6'-trehalose dimycolate (TDM) adjuvant, coencapsulated in microspheres (BCG-APA), and were evaluated 30 and 70 days after challenge. This prime-boost strategy (BCG-APA) resulted in a significant reduction in the bacterial load in the lungs, thus leading to better preservation of the lung parenchyma, 70 days postinfection compared to BCG vaccinated mice. The profound effect of this heterologous prime-boost regimen in the experimental model supports its development as a feasible strategy for prevention of TB.

Consequences of SPAK inactivation on Hyperkalemic Hypertension caused by WNK1 mutations: evidence for differential roles of WNK1 and WNK4.

PubMed

Rafael, Chloé; Soukaseum, Christelle; Baudrie, Véronique; Frère, Perrine; Hadchouel, Juliette

2018-02-19

Mutations of the gene encoding WNK1 [With No lysine (K) kinase 1] or WNK4 cause Familial Hyperkalemic Hypertension (FHHt). Previous studies have shown that the activation of SPAK (Ste20-related Proline/Alanine-rich Kinase) plays a dominant role in the development of FHHt caused by WNK4 mutations. The implication of SPAK in FHHt caused by WNK1 mutation has never been investigated. To clarify this issue, we crossed WNK1 +/FHHt mice with SPAK knock-in mice in which the T-loop Thr243 residue was mutated to alanine to prevent activation by WNK kinases. We show that WNK1 +/FHHT :SPAK 243A/243A mice display an intermediate phenotype, between that of control and SPAK 243A/243A mice, with normal blood pressure but hypochloremic metabolic alkalosis. NCC abundance and phosphorylation levels also decrease below the wild-type level in the double-mutant mice but remain higher than in SPAK 243A/243A mice. This is different from what was observed in WNK4-FHHt mice in which SPAK inactivation completely restored the phenotype and NCC expression to wild-type levels. Although these results confirm that FHHt caused by WNK1 mutations is dependent on the activation of SPAK, they suggest that WNK1 and WNK4 play different roles in the distal nephron.

An abundant nucleolar phosphoprotein is associated with ribosomal DNA in Tetrahymena macronuclei.

PubMed Central

McGrath, K E; Smothers, J F; Dadd, C A; Madireddi, M T; Gorovsky, M A; Allis, C D

1997-01-01

An abundant 52-kDa phosphoprotein was identified and characterized from macronuclei of the ciliated protozoan Tetrahymena thermophila. Immunoblot analyses combined with light and electron microscopic immunocytochemistry demonstrate that this polypeptide, termed Nopp52, is enriched in the nucleoli of transcriptionally active macronuclei and missing altogether from transcriptionally inert micronuclei. The cDNA sequence encoding Nopp52 predicts a polypeptide whose amino-terminal half consists of multiple acidic/serine-rich regions alternating with basic/proline-rich regions. Multiple serines located in these acidic stretches lie within casein kinase II consensus motifs, and Nopp52 is an excellent substrate for casein kinase II in vitro. The carboxyl-terminal half of Nopp52 contains two RNA recognition motifs and an extreme carboxyl-terminal domain rich in glycine, arginine, and phenylalanine, motifs common in many RNA processing proteins. A similar combination and order of motifs is found in vertebrate nucleolin and yeast NSR1, suggesting that Nopp52 is a member of a family of related nucleolar proteins. NSR1 and nucleolin have been implicated in transcriptional regulation of rDNA and rRNA processing. Consistent with a role in ribosomal gene metabolism, rDNA and Nopp52 colocalize in situ, as well as by cross-linking and immunoprecipitation experiments, demonstrating an association between Nopp52 and rDNA in vivo. Images PMID:9017598

The cloning and characterization of a localized maternal transcript in Xenopus laevis whose zygotic counterpart is detected in the CNS.

PubMed

Reddy, B A; Kloc, M; Etkin, L D

1992-12-01

We have cloned a cDNA (xlan4) from a Xenopus laevis oocyte cDNA library whose cognate mRNA is localized in the animal pole region of full grown oocytes. The cDNA can be translated in vitro to produce a predicted size protein of 35 kDa and, is also expressed in E. coli as a fusion protein. The conceptual protein encoded by the xlan4 cDNA is 17.5% proline rich and possesses several PEST sequences found in proteins with short half-lives. The xlan4 mRNA is 2.6 kb and during early development its titer decreases until the neurula stage after which it begins to reaccumulate. Northern blots on dissected embryos and in situ hybridization revealed that the zygotic expression is limited to the dorsal axial structures consisting primarily of the CNS. UV irradiation of the vegetal pole region immediately following fertilization that produces ventralized embryos results in a loss of zygotic xlan4 expression. In the adult, xlan4 mRNA is limited primarily to the brain. The presence of this mRNA in animal pole region which contributes to the future neural cell lineages suggests that this gene product may function either in the specification of neural cell types or in a neural specific function.

A Single Dose of a DNA Vaccine Encoding Apa Coencapsulated with 6,6′-Trehalose Dimycolate in Microspheres Confers Long-Term Protection against Tuberculosis in Mycobacterium bovis BCG-Primed Mice

PubMed Central

Carlétti, Dyego; Morais da Fonseca, Denise; Gembre, Ana Flávia; Masson, Ana Paula; Weijenborg Campos, Lívia; Leite, Luciana C. C.; Rodrigues Pires, Andréa; Lannes-Vieira, Joseli; Lopes Silva, Célio; Bonato, Vânia Luiza Deperon

2013-01-01

Mycobacterium bovis BCG prime DNA (Mycobacterium tuberculosis genes)-booster vaccinations have been shown to induce greater protection against tuberculosis (TB) than BCG alone. This heterologous prime-boost strategy is perhaps the most realistic vaccination for the future of TB infection control, especially in countries where TB is endemic. Moreover, a prime-boost regimen using biodegradable microspheres seems to be a promising immunization to stimulate a long-lasting immune response. The alanine proline antigen (Apa) is a highly immunogenic glycoprotein secreted by M. tuberculosis. This study investigated the immune protection of Apa DNA vaccine against intratracheal M. tuberculosis challenge in mice on the basis of a heterologous prime-boost regimen. BALB/c mice were subcutaneously primed with BCG and intramuscularly boosted with a single dose of plasmid carrying apa and 6,6′-trehalose dimycolate (TDM) adjuvant, coencapsulated in microspheres (BCG-APA), and were evaluated 30 and 70 days after challenge. This prime-boost strategy (BCG-APA) resulted in a significant reduction in the bacterial load in the lungs, thus leading to better preservation of the lung parenchyma, 70 days postinfection compared to BCG vaccinated mice. The profound effect of this heterologous prime-boost regimen in the experimental model supports its development as a feasible strategy for prevention of TB. PMID:23740922

A functional aquaporin co-localizes with the vacuolar proton pyrophosphatase to acidocalcisomes and the contractile vacuole complex of Trypanosoma cruzi.

PubMed

Montalvetti, Andrea; Rohloff, Peter; Docampo, Roberto

2004-09-10

We cloned an aquaporin gene from Trypanosoma cruzi (TcAQP) that encodes a protein of 231 amino acids, which is highly hydrophobic. The protein has six putative transmembrane domains and the two signature motifs asparagine-proline-alanine (NPA) which have been shown, in other aquaporins, to be involved in the formation of an aqueous channel spanning the bilayer. TcAQP was sensitive to endo H treatment, suggesting that the protein is N-glycosylated. Oocytes of Xenopus laevis expressing TcAQP swelled under hyposmotic conditions indicating water permeability, which was abolished after preincubating oocytes with very low concentrations of the AQP inhibitors HgCl(2) and AgNO(3). glycerol transport was detected. No Immunofluorescence microscopy of T. cruzi expressing GFP-TcAQP showed co-localization of TcAQP with the vacuolar proton pyrophosphatase (V-H(+)-PPase), a marker of acidocalcisomes. This localization was confirmed by Western blotting and immunofluorescence staining using polyclonal antibodies against a C-terminal peptide of TcAQP. In addition, there was a strong anterior labeling in a vacuole, close to the flagellar pocket, that was distinct from the acidocalcisomes and that was identified by immunogold electron microscopy as the contractile vacuole complex. Taking together, the presence of an aquaporin in acidocalcisomes and the contractile vacuole complex of T. cruzi, provides support for the role of these organelles in osmotic adaptations of these parasites.

Evolution of EF-hand calcium-modulated proteins. II. Domains of several subfamilies have diverse evolutionary histories

NASA Technical Reports Server (NTRS)

Nakayama, S.; Moncrief, N. D.; Kretsinger, R. H.

1992-01-01

In the first report in this series we described the relationships and evolution of 152 individual proteins of the EF-hand subfamilies. Here we add 66 additional proteins and define eight (CDC, TPNV, CLNB, LPS, DGK, 1F8, VIS, TCBP) new subfamilies and seven (CAL, SQUD, CDPK, EFH5, TPP, LAV, CRGP) new unique proteins, which we assume represent new subfamilies. The main focus of this study is the classification of individual EF-hand domains. Five subfamilies--calmodulin, troponin C, essential light chain, regulatory light chain, CDC31/caltractin--and three uniques--call, squidulin, and calcium-dependent protein kinase--are congruent in that all evolved from a common four-domain precursor. In contrast calpain and sarcoplasmic calcium-binding protein (SARC) each evolved from its own one-domain precursor. The remaining 19 subfamilies and uniques appear to have evolved by translocation and splicing of genes encoding the EF-hand domains that were precursors to the congruent eight and to calpain and to SARC. The rates of evolution of the EF-hand domains are slower following formation of the subfamilies and establishment of their functions. Subfamilies are not readily classified by patterns of calcium coordination, interdomain linker stability, and glycine and proline distribution. There are many homoplasies indicating that similar variants of the EF-hand evolved by independent pathways.

Identification of a novel PSEN1 mutation (Leu232Pro) in a Korean patient with early-onset Alzheimer's disease and a family history of dementia.

PubMed

Park, Jiyun; An, Seong Soo A; Giau, Vo Van; Shim, Kyuhwan; Youn, Young Chul; Bagyinszky, Eva; Kim, SangYun

2017-08-01

In the present study, a novel mutation in exon 7 of presenilin 1 (Leu232Pro) was discovered in a Korean patient with early-onset Alzheimer's disease, who represented memory decline at 37 years of age, followed by impairment in spatial activity and concentrations and personality changes. Imaging analyses with magnetic resonance scan showed diffuse atrophy in the frontoparietal regions. Targeted next generation sequencing and Sanger sequencing identified a heterozygous T to C transition at position 695 (c.695T>C) of in presenilin 1 gene (PSEN1), resulting in a novel missense mutation at codon 232 from leucine to proline (L232P). Several family members of the patient developed dementia, suggesting an autosomal dominant inheritance; however, we were unable to perform a segregation analysis to confirm this. Since the proline may play a role as a helix breaker, this mutation could significantly disturb the transmembrane helix domain-V of PSEN1 and perturb its protein functions. This hypothesis was supported by the results from the in silico analyses, predicted a major kink on this helix. Several leucine>proline substitutions in other PSEN1 transmembrane helices revealed aggressive AD phenotypes. Future functional studies would be needed to evaluate the pathogenicity of this mutation in AD. Copyright © 2017 Elsevier Inc. All rights reserved.

CIP1 polypeptides and their uses

DOEpatents

Foreman, Pamela [Los Altos, CA; Van Solingen, Pieter [Naaldwijk, NL; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA

2011-04-12

Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

Paralogous ALT1 and ALT2 Retention and Diversification Have Generated Catalytically Active and Inactive Aminotransferases in Saccharomyces cerevisiae

PubMed Central

Peñalosa-Ruiz, Georgina; Aranda, Cristina; Ongay-Larios, Laura; Colon, Maritrini; Quezada, Hector; Gonzalez, Alicia

2012-01-01

Background Gene duplication and the subsequent divergence of paralogous pairs play a central role in the evolution of novel gene functions. S. cerevisiae possesses two paralogous genes (ALT1/ALT2) which presumably encode alanine aminotransferases. It has been previously shown that Alt1 encodes an alanine aminotransferase, involved in alanine metabolism; however the physiological role of Alt2 is not known. Here we investigate whether ALT2 encodes an active alanine aminotransferase. Principal Findings Our results show that although ALT1 and ALT2 encode 65% identical proteins, only Alt1 displays alanine aminotransferase activity; in contrast ALT2 encodes a catalytically inert protein. ALT1 and ALT2 expression is modulated by Nrg1 and by the intracellular alanine pool. ALT1 is alanine-induced showing a regulatory profile of a gene encoding an enzyme involved in amino acid catabolism, in agreement with the fact that Alt1 is the sole pathway for alanine catabolism present in S. cerevisiae. Conversely, ALT2 expression is alanine-repressed, indicating a role in alanine biosynthesis, although the encoded-protein has no alanine aminotransferase enzymatic activity. In the ancestral-like yeast L. kluyveri, the alanine aminotransferase activity was higher in the presence of alanine than in the presence of ammonium, suggesting that as for ALT1, LkALT1 expression could be alanine-induced. ALT2 retention poses the questions of whether the encoded protein plays a particular function, and if this function was present in the ancestral gene. It could be hypotesized that ALT2 diverged after duplication, through neo-functionalization or that ALT2 function was present in the ancestral gene, with a yet undiscovered function. Conclusions ALT1 and ALT2 divergence has resulted in delegation of alanine aminotransferase activity to Alt1. These genes display opposed regulatory profiles: ALT1 is alanine-induced, while ALT2 is alanine repressed. Both genes are negatively regulated by the Nrg1 repressor. Presented results indicate that alanine could act as ALT2 Nrg1-co-repressor. PMID:23049841

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

PubMed

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Proline with or without hydroxyproline influences collagen concentration and regulates prolyl 4-hydroxylase α (I) gene expression in juvenile turbo ( Scophthalmus maximus L.)

NASA Astrophysics Data System (ADS)

Zhang, Kaikai; Mai, Kangsen; Xu, Wei; Zhou, Huihui; Liufu, Zhiguo; Zhang, Yanjiao; Peng, Mo; Ai, Qinghui

2015-06-01

This study was conducted to investigate the effect of dietary proline (Pro), and Pro and hydroxyproline (Hyp) in combination on the growth performance, total Hyp and collagen concentrations of tissues, and prolyl 4-hydroxylase α(I) (P4H α(I)) gene expression in juvenile turbot feeding high plant protein diets. A diet containing 50% crude protein and 12% crude lipid was formulated as the basal and control, on which other two protein and lipid contents identical experimental diets were formulated by supplementing the basal with either 0.75% Pro (Pro-0.75) or 0.75% Pro and 0.75% Hyp (Pro+Hyp). Four groups of fish in indoor seawater recirculating systems, 35 individuals each, were fed twice a day to apparent satiation for 10 weeks. The results showed that dietary Pro and Hyp supplementation had no significant effect on growth performance and feed utilization of juvenile turbot (P > 0.05). Total Hyp and collagen concentrations in muscle were significantly increased when dietary Pro and Hyp increased (P <0.05), and fish fed diet Pro+Hyp showed significantly higher free Hyp content in plasma than those fed other diets (P <0.05). The expression of P4H a(I) gene in liver and muscle was significantly up regulated in fish fed diet Pro-0.75 in comparison with control (P <0.05); however the gene was significantly down regulated in fish fed diet Pro+Hyp in muscle in comparison with fish fed diet Pro-0.75 (P <0.05). It can be concluded that supplement of crystal L-Pro and L-Hyp to high plant protein diets did not show positive effects on growth performance of juvenile turbot, but enhanced total collagen concentrations in muscle.

Proline-rich antimicrobial peptide, PR-39 gene transduction altered invasive activity and actin structure in human hepatocellular carcinoma cells

PubMed Central

Ohtake, T; Fujimoto, Y; Ikuta, K; Saito, H; Ohhira, M; Ono, M; Kohgo, Y

1999-01-01

PR-39 is an endogenous proline-rich antimicrobial peptide which induces the synthesis of syndecan-1, a transmembrane heparan sulphate proteoglycan involved in cell-to-matrix interactions and wound healing. Previously, we revealed that the expression of syndecan-1 was reduced in human hepatocellular carcinomas with high metastatic potential and speculated that syndecan-1 played an important role in inhibition of invasion and metastasis. It is assumed that a modification of this process with PR-39 and syndecan-1 may result in a new strategy by which it can inhibit the invasion and metastasis. Therefore, we transduced a gene of PR-39 into human hepatocellular carcinoma cell line HLF, which shows a low expression of syndecan-1 and a high in vitro invasive activity, and examined whether this procedure could reduce the invasive activity of tumour cells. In two transfectants with PR-39 gene, the syndecan-1 expression was induced and the invasive activity in type I collagen-coated chamber was inhibited. Moreover, these transfectants showed the suppression of motile activity assayed by phagokinetic tracks in addition to the disorganization of actin filaments observed by a confocal imaging system. In contrast, five transfectants with syndecan-1 gene in the HLF cells revealed suppression of invasive activity but did not alter the motile activity and actin structures of the cell. These results suggest that PR-39 has functions involved in the suppression of motile activity and alteration of actin structure on human hepatocellular carcinoma cells in addition to the suppression of invasive activity which might result from the induction of syndecan-1 expression. © 1999 Cancer Research Campaign PMID:10507762

Rudimentary expression of RYamide in Drosophila melanogaster relative to other Drosophila species points to a functional decline of this neuropeptide gene.

PubMed

Veenstra, Jan A; Khammassi, Hela

2017-04-01

RYamides are arthropod neuropeptides with unknown function. In 2011 two RYamides were isolated from D. melanogaster as the ligands for the G-protein coupled receptor CG5811. The D. melanogaster gene encoding these neuropeptides is highly unusual, as there are four RYamide encoding exons in the current genome assembly, but an exon encoding a signal peptide is absent. Comparing the D. melanogaster gene structure with those from other species, including D. virilis, suggests that the gene is degenerating. RNAseq data from 1634 short sequence read archives at NCBI containing more than 34 billion spots yielded numerous individual spots that correspond to the RYamide encoding exons, of which a large number include the intron-exon boundary at the start of this exon. Although 72 different sequences have been spliced onto this RYamide encoding exon, none codes for the signal peptide of this gene. Thus, the RNAseq data for this gene reveal only noise and no signal. The very small quantities of peptide recovered during isolation and the absence of credible RNAseq data, indicates that the gene is very little expressed, while the RYamide gene structure in D. melanogaster suggests that it might be evolving into a pseudogene. Yet, the identification of the peptides it encodes clearly shows it is still functional. Using region specific antisera, we could localize numerous neurons and enteroendocrine cells in D. willistoni, D. virilis and D. pseudoobscura, but only two adult abdominal neurons in D. melanogaster. Those two neurons project to and innervate the rectal papillae, suggesting that RYamides may be involved in the regulation of water homeostasis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Analysis and Manipulation of Aspartate Pathway Genes for l-Lysine Overproduction from Methanol by Bacillus methanolicus▿

PubMed Central

Nærdal, Ingemar; Netzer, Roman; Ellingsen, Trond E.; Brautaset, Trygve

2011-01-01

We investigated the regulation and roles of six aspartate pathway genes in l-lysine overproduction in Bacillus methanolicus: dapG, encoding aspartokinase I (AKI); lysC, encoding AKII; yclM, encoding AKIII; asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; and lysA, encoding meso-diaminopimelate decarboxylase. Analysis of the wild-type strain revealed that in vivo lysC transcription was repressed 5-fold by l-lysine and induced 2-fold by dl-methionine added to the growth medium. Surprisingly, yclM transcription was repressed 5-fold by dl-methionine, while the dapG, asd, dapA, and lysA genes were not significantly repressed by any of the aspartate pathway amino acids. We show that the l-lysine-overproducing classical B. methanolicus mutant NOA2#13A52-8A66 has—in addition to a hom-1 mutation—chromosomal mutations in the dapG coding region and in the lysA promoter region. No mutations were found in its dapA, lysC, asd, and yclM genes. The mutant dapG gene product had abolished feedback inhibition by meso-diaminopimelate in vitro, and the lysA mutation was accompanied by an elevated (6-fold) lysA transcription level in vivo. Moreover, yclM transcription was increased 16-fold in mutant strain NOA2#13A52-8A66 compared to the wild-type strain. Overexpression of wild-type and mutant aspartate pathway genes demonstrated that all six genes are important for l-lysine overproduction as tested in shake flasks, and the effects were dependent on the genetic background tested. Coupled overexpression of up to three genes resulted in additive (above 80-fold) increased l-lysine production levels. PMID:21724876

Analysis and manipulation of aspartate pathway genes for L-lysine overproduction from methanol by Bacillus methanolicus.

PubMed

Nærdal, Ingemar; Netzer, Roman; Ellingsen, Trond E; Brautaset, Trygve

2011-09-01

We investigated the regulation and roles of six aspartate pathway genes in L-lysine overproduction in Bacillus methanolicus: dapG, encoding aspartokinase I (AKI); lysC, encoding AKII; yclM, encoding AKIII; asd, encoding aspartate semialdehyde dehydrogenase; dapA, encoding dihydrodipicolinate synthase; and lysA, encoding meso-diaminopimelate decarboxylase. Analysis of the wild-type strain revealed that in vivo lysC transcription was repressed 5-fold by L-lysine and induced 2-fold by dl-methionine added to the growth medium. Surprisingly, yclM transcription was repressed 5-fold by dl-methionine, while the dapG, asd, dapA, and lysA genes were not significantly repressed by any of the aspartate pathway amino acids. We show that the L-lysine-overproducing classical B. methanolicus mutant NOA2#13A52-8A66 has-in addition to a hom-1 mutation-chromosomal mutations in the dapG coding region and in the lysA promoter region. No mutations were found in its dapA, lysC, asd, and yclM genes. The mutant dapG gene product had abolished feedback inhibition by meso-diaminopimelate in vitro, and the lysA mutation was accompanied by an elevated (6-fold) lysA transcription level in vivo. Moreover, yclM transcription was increased 16-fold in mutant strain NOA2#13A52-8A66 compared to the wild-type strain. Overexpression of wild-type and mutant aspartate pathway genes demonstrated that all six genes are important for L-lysine overproduction as tested in shake flasks, and the effects were dependent on the genetic background tested. Coupled overexpression of up to three genes resulted in additive (above 80-fold) increased L-lysine production levels.

“Guilt by Association” Is the Exception Rather Than the Rule in Gene Networks

PubMed Central

Gillis, Jesse; Pavlidis, Paul

2012-01-01

Gene networks are commonly interpreted as encoding functional information in their connections. An extensively validated principle called guilt by association states that genes which are associated or interacting are more likely to share function. Guilt by association provides the central top-down principle for analyzing gene networks in functional terms or assessing their quality in encoding functional information. In this work, we show that functional information within gene networks is typically concentrated in only a very few interactions whose properties cannot be reliably related to the rest of the network. In effect, the apparent encoding of function within networks has been largely driven by outliers whose behaviour cannot even be generalized to individual genes, let alone to the network at large. While experimentalist-driven analysis of interactions may use prior expert knowledge to focus on the small fraction of critically important data, large-scale computational analyses have typically assumed that high-performance cross-validation in a network is due to a generalizable encoding of function. Because we find that gene function is not systemically encoded in networks, but dependent on specific and critical interactions, we conclude it is necessary to focus on the details of how networks encode function and what information computational analyses use to extract functional meaning. We explore a number of consequences of this and find that network structure itself provides clues as to which connections are critical and that systemic properties, such as scale-free-like behaviour, do not map onto the functional connectivity within networks. PMID:22479173

Influence of proline position upon the ion channel activity of alamethicin.

PubMed Central

Kaduk, C; Duclohier, H; Dathe, M; Wenschuh, H; Beyermann, M; Molle, G; Bienert, M

1997-01-01

Alamethicin, a 20-residue peptaibol, induces voltage-dependent ion channels in lipid bilayers according to the barrel-stave model. To study relationships between the proline-14-induced kink region and the channel-forming behavior of the peptide, a set of alamethicin analogs with proline incorporated at positions 11, 12, 13, 14, 15, 16, and 17, respectively, as well as an analog with alanine instead of proline at position 14 were synthesized. Macroscopic conductance experiments show that the voltage dependence of the peptides is conserved although slightly influenced, but the apparent mean number of monomers forming the channels is significantly reduced when proline is not located at position 14. This is confirmed in single-channel experiments. The analogs with proline next to position 14 (i.e., 13, 15, 16) show stable conductance levels, but of reduced number, which follows the order Alam-P14 > Alam-P15 > Alam-P16 > Alam-P13. This reduction in the number of levels is connected with changes in the lifetime of the channels. Analogs with proline at position 11, 12, or 17 produce erratic, extremely short-lived current events that could not be resolved. The changes in functional properties are related to structural properties as probed by circular dichroism. The results indicate that proline at position 14 results in optimal channel activity, whereas channels formed by the analogs bearing proline at different positions are considerably less stable. PMID:9129817

Penultimate proline in neuropeptides.

PubMed

Glover, Matthew S; Bellinger, Earl P; Radivojac, Predrag; Clemmer, David E

2015-08-18

A recent ion mobility spectrometry-mass spectrometry (IMS-MS) study revealed that tryptic peptide ions containing a proline residue at the second position from the N-terminus (i.e., penultimate proline) frequently adopt multiple conformations, owing to the cis-trans isomerization of Xaa(1)-Pro(2) peptide bonds [J. Am. Soc. Mass Spectrom. 2015, 26, 444]. Here, we present a statistical analysis of a neuropeptide database that illustrates penultimate proline residues are frequently found in neuropeptides. In order to probe the effect of penultimate proline on neuropeptide conformations, IMS-MS experiments were performed on two model peptides in which penultimate proline residues were known to be important for biological activity: the N-terminal region of human neuropeptide Y (NPY1-9, Tyr(1)-Pro(2)-Ser(3)-Lys(4)-Pro(5)-Asp(6)-Asn(7)-Pro(8)-Gly(9)-NH2) and a tachykinin-related peptide (CabTRP Ia, Ala(1)-Pro(2)-Ser(3)-Gly(4)-Phe(5)-Leu(6)-Gly(7)-Met(8)-Arg(9)-NH2). From these studies, it appears that penultimate prolines allow neuropeptides to populate multiple conformations arising from the cis-trans isomerization of Xaa(1)-Pro(2) peptide bonds. Although it is commonly proposed that the role of penultimate proline residues is to protect peptides from enzymatic degradation, the present results indicate that penultimate proline residues also are an important means of increasing the conformational heterogeneity of neuropeptides.

Mobile genetic element-encoded cytolysin connects virulence to methicillin resistance in MRSA.

PubMed

Queck, Shu Y; Khan, Burhan A; Wang, Rong; Bach, Thanh-Huy L; Kretschmer, Dorothee; Chen, Liang; Kreiswirth, Barry N; Peschel, Andreas; Deleo, Frank R; Otto, Michael

2009-07-01

Bacterial virulence and antibiotic resistance have a significant influence on disease severity and treatment options during bacterial infections. Frequently, the underlying genetic determinants are encoded on mobile genetic elements (MGEs). In the leading human pathogen Staphylococcus aureus, MGEs that contain antibiotic resistance genes commonly do not contain genes for virulence determinants. The phenol-soluble modulins (PSMs) are staphylococcal cytolytic toxins with a crucial role in immune evasion. While all known PSMs are core genome-encoded, we here describe a previously unidentified psm gene, psm-mec, within the staphylococcal methicillin resistance-encoding MGE SCCmec. PSM-mec was strongly expressed in many strains and showed the physico-chemical, pro-inflammatory, and cytolytic characteristics typical of PSMs. Notably, in an S. aureus strain with low production of core genome-encoded PSMs, expression of PSM-mec had a significant impact on immune evasion and disease. In addition to providing high-level resistance to methicillin, acquisition of SCCmec elements encoding PSM-mec by horizontal gene transfer may therefore contribute to staphylococcal virulence by substituting for the lack of expression of core genome-encoded PSMs. Thus, our study reveals a previously unknown role of methicillin resistance clusters in staphylococcal pathogenesis and shows that important virulence and antibiotic resistance determinants may be combined in staphylococcal MGEs.

Characterization of Pax3 and Pax7 genes and their expression patterns during different development and growth stages of Japanese pufferfish Takifugu rubripes.

PubMed

Akolkar, Dadasaheb B; Asaduzzaman, Md; Kinoshita, Shigeharu; Asakawa, Shuichi; Watabe, Shugo

2016-01-01

Pax3 and Pax7 are the regulators and markers of muscle progenitors and satellite cells that contribute to the embryonic development and postembryonic growth of skeletal muscle in vertebrates, as well as to its repair and regeneration. However, information regarding them in vertebrate genome model, torafugu Takifugu rubripes, has remained unknown. Therefore, as an initial step, here we characterized Pax3 and Pax7 from torafugu and investigated their expression patterns during different developmental stages by RT-PCR. In silico analysis with the Fugu genome database (ver. 4.0) yielded two distinct genes each for Pax3 (Pax3a and Pax3b) and Pax7 (Pax7a and Pax7b). The 75th amino acid, glutamine (Gln75), from the N-terminus was replaced by proline in the paired box domain (PD) of Pax3a. One single cDNA clone encoding Pax3a had deletion of Gln75 in PD, suggesting the presence of alternatively spliced variants (Q+/Q-). This was further supported by identification of two adjacent alternative 3' splice acceptor sites which produce Pax3b Q+ (aagCAGGGA) and Q- (aagcagGGA) variants. Interestingly, torafugu Pax7a, but not Pax7b, had an insert encoding five amino acid residues (SGEAS) in a C-terminal region of PD in two out of three cDNA clones. Genomic analysis showed two alternate splice donor sites at exon 4 of Pax7a. In synteny analysis, torafugu Pax3a showed syntenic relationship with the corresponding regions in other teleosts only, whereas Pax3b and Pax7b showed high syntenic relationship with the corresponding regions of both mammals and other teleosts. RT-PCR revealed that expression of Pax3a and Pax3b transcripts was restricted to embryonic stages only, whereas those of Pax7a and Pax7b was continued to be expressed in larvae and importantly those of Pax7a were found in adult skeletal muscles. Therefore, Pax3 appears to be most important for primary myogenesis and Pax7 for secondary myogenesis and growth by hyperplasia in fish. In this regard, the transcripts of torafugu Pax3 and Pax7 genes might be used for further investigation as a marker for identification of muscle precursor cells during different phases of growth, and this ambiguity is the next target of our research. Copyright © 2015 Elsevier B.V. All rights reserved.

Hydroxyproline Ring Pucker Causes Frustration of Helix Parameters in the Collagen Triple Helix

NASA Astrophysics Data System (ADS)

Ying Chow, W.; Bihan, Dominique; Forman, Chris J.; Slatter, David A.; Reid, David G.; Wales, David J.; Farndale, Richard W.; Duer, Melinda J.

2015-07-01

Collagens, the most abundant proteins in mammals, are defined by their triple-helical structures and distinctive Gly-Xaa-Yaa repeating sequence, where Xaa is often proline and Yaa, hydroxyproline (Hyp/O). It is known that hydroxyproline in the Yaa position stabilises the triple helix, and that lack of proline hydroxylation in vivo leads to dysfunctional collagen extracellular matrix assembly, due to a range of factors such as a change in hydration properties. In addition, we note that in model peptides, when Yaa is unmodified proline, the Xaa proline has a strong propensity to adopt an endo ring conformation, whilst when Yaa is hydroxyproline, the Xaa proline adopts a range of endo and exo conformations. Here we use a combination of solid-state NMR spectroscopy and potential energy landscape modelling of synthetic triple-helical collagen peptides to understand this effect. We show that hydroxylation of the Yaa proline causes the Xaa proline ring conformation to become metastable, which in turn confers flexibility on the triple helix.

Hydroxyproline Ring Pucker Causes Frustration of Helix Parameters in the Collagen Triple Helix

PubMed Central

Ying Chow, W.; Bihan, Dominique; Forman, Chris J.; Slatter, David A.; Reid, David G.; Wales, David J.; Farndale, Richard W.; Duer, Melinda J.

2015-01-01

Collagens, the most abundant proteins in mammals, are defined by their triple-helical structures and distinctive Gly-Xaa-Yaa repeating sequence, where Xaa is often proline and Yaa, hydroxyproline (Hyp/O). It is known that hydroxyproline in the Yaa position stabilises the triple helix, and that lack of proline hydroxylation in vivo leads to dysfunctional collagen extracellular matrix assembly, due to a range of factors such as a change in hydration properties. In addition, we note that in model peptides, when Yaa is unmodified proline, the Xaa proline has a strong propensity to adopt an endo ring conformation, whilst when Yaa is hydroxyproline, the Xaa proline adopts a range of endo and exo conformations. Here we use a combination of solid-state NMR spectroscopy and potential energy landscape modelling of synthetic triple-helical collagen peptides to understand this effect. We show that hydroxylation of the Yaa proline causes the Xaa proline ring conformation to become metastable, which in turn confers flexibility on the triple helix. PMID:26220399

Enthalpy characteristics of L-proline dissolution in certain water-organic mixtures at 298.15 K

NASA Astrophysics Data System (ADS)

Badelin, V. G.; Smirnov, V. I.

2017-01-01

A thermochemical study of the processes of L-proline dissolution in aqueous solutions of acetonitrile, 1,4-dioxane, acetone, dimethyl sulfoxide, nitromethane and tetrahydrofuran at T = 298.15 K in the range of organic solvent concentrations x2 = 0-0.25 mole fractions is performed. Standard values of the enthalpies of solution and transfer of L-proline from water to mixed solvent, and the enthalpy coefficients of pairwise interactions between L-proline and molecules of organic solvents, are calculated. The effect the composition of a water-organic mixture and the structure of organic solvents have on the enthalpy characteristics of L-proline dissolution and transfer is examined. The effect the energy properties of intermolecular interactions between components of a mixed solvent has on the intermolecular interactions between L-proline and molecules of cosolvent is estimated. The correlation between the enthalpy characteristics of L-proline dissolution and electron-donor properties of organic cosolvent in aqueous solutions is determined.

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

PubMed

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P < 0.05). In Ukraine, S. aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene. We also observed a high prevalence of PVL- and ET- encoding genes among S. aureus nasal carriage strains. A systematic surveillance system can help prevent transmission and spread of drug resistant toxin producing S. aureus strains.

Carbohydrate metabolism genes and pathways in insects: insights from the honey bee genome

PubMed Central

Kunieda, T; Fujiyuki, T; Kucharski, R; Foret, S; Ament, S A; Toth, A L; Ohashi, K; Takeuchi, H; Kamikouchi, A; Kage, E; Morioka, M; Beye, M; Kubo, T; Robinson, G E; Maleszka, R

2006-01-01

Carbohydrate-metabolizing enzymes may have particularly interesting roles in the honey bee, Apis mellifera, because this social insect has an extremely carbohydrate-rich diet, and nutrition plays important roles in caste determination and socially mediated behavioural plasticity. We annotated a total of 174 genes encoding carbohydrate-metabolizing enzymes and 28 genes encoding lipid-metabolizing enzymes, based on orthology to their counterparts in the fly, Drosophila melanogaster, and the mosquito, Anopheles gambiae. We found that the number of genes for carbohydrate metabolism appears to be more evolutionarily labile than for lipid metabolism. In particular, we identified striking changes in gene number or genomic organization for genes encoding glycolytic enzymes, cellulase, glucose oxidase and glucose dehydrogenases, glucose-methanol-choline (GMC) oxidoreductases, fucosyltransferases, and lysozymes. PMID:17069632

Novel Type V Staphylococcal Cassette Chromosome mec Driven by a Novel Cassette Chromosome Recombinase, ccrC

PubMed Central

Ito, Teruyo; Ma, Xiao Xue; Takeuchi, Fumihiko; Okuma, Keiko; Yuzawa, Harumi; Hiramatsu, Keiichi

2004-01-01

Staphylococcal cassette chromosome mec (SCCmec) is a mobile genetic element composed of the mec gene complex, which encodes methicillin resistance, and the ccr gene complex, which encodes the recombinases responsible for its mobility. The mec gene complex has been classified into four classes, and the ccr gene complex has been classified into three allotypes. Different combinations of mec gene complex classes and ccr gene complex types have so far defined four types of SCCmec elements. Now we introduce the fifth allotype of SCCmec, which was found on the chromosome of a community-acquired methicillin-resistant Staphylococcus aureus strain (strain WIS [WBG8318]) isolated in Australia. The element shared the same chromosomal integration site with the four extant types of SCCmec and the characteristic nucleotide sequences at the chromosome-SCCmec junction regions. The novel SCCmec carried mecA bracketed by IS431 (IS431-mecA-ΔmecR1-IS431), which is designated the class C2 mec gene complex; and instead of ccrA and ccrB genes, it carried a single copy of a gene homologue that encoded cassette chromosome recombinase. Since the open reading frame (ORF) was found to encode an enzyme which catalyzes the precise excision as well as site- and orientation-specific integration of the element, we designated the ORF cassette chromosome recombinase C (ccrC), and we designated the element type V SCCmec. Type V SCCmec is a small SCCmec element (28 kb) and does not carry any antibiotic resistance genes besides mecA. Unlike the extant SCCmec types, it carries a set of foreign genes encoding a restriction-modification system that might play a role in the stabilization of the element on the chromosome. PMID:15215121

Large structural modification with conserved conformation: analysis of delta(3)-fused aryl prolines in model beta-turns.

PubMed

Jeannotte, Guillaume; Lubell, William D

2004-11-10

For the first time, the influence of a fused Delta3-arylproline on peptide conformation has been studied by the synthesis and comparison of the conformations of peptides containing proline and pyrrolo-proline, 3 (PyPro). Pyrrolo-proline was demonstrated to be a conservative replacement for Pro in model beta-turns, 4 and 5, as shown by their similar DMSO titration curves, cis/trans-isomer populations, and NOESY spectral data. Pyrrolo-proline may thus be used for studying the structure activity relationships of Pro-containing peptides with minimal modification of secondary structures.

Complete genome sequence of Nitrosospira multiformis, an ammonia-oxidizing bacterium from the soil environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norton, Jeanette M.; Klotz, Martin G; Stein, Lisa Y

2008-01-01

The complete genome of the ammonia-oxidizing bacterium, Nitrosospira multiformis (ATCC 25196T), consists of a circular chromosome and three small plasmids totaling 3,234,309 bp and encoding 2827 putative proteins. Of these, 2026 proteins have predicted functions and 801 are without conserved functional domains, yet 747 of these have similarity to other predicted proteins in databases. Gene homologs from Nitrosomonas europaea and N. eutropha were the best match for 42% of the predicted genes in N. multiformis. The genome contains three nearly identical copies of amo and hao gene clusters as large repeats. Distinguishing features compared to N. europaea include: the presencemore » of gene clusters encoding urease and hydrogenase, a RuBisCO-encoding operon of distinctive structure and phylogeny, and a relatively small complement of genes related to Fe acquisition. Systems for synthesis of a pyoverdine-like siderophore and for acyl-homoserine lactone were unique to N. multiformis among the sequenced AOB genomes. Gene clusters encoding proteins associated with outer membrane and cell envelope functions including transporters, porins, exopolysaccharide synthesis, capsule formation and protein sorting/export were abundant. Numerous sensory transduction and response regulator gene systems directed towards sensing of the extracellular environment are described. Gene clusters for glycogen, polyphosphate and cyanophycin storage and utilization were identified providing mechanisms for meeting energy requirements under substrate-limited conditions. The genome of N. multiformis encodes the core pathways for chemolithoautotrophy along with adaptations for surface growth and survival in soil environments.« less

Transcriptional Profiling of Caulobacter crescentus during Growth on Complex and Minimal Media

PubMed Central

Hottes, Alison K.; Meewan, Maliwan; Yang, Desiree; Arana, Naomi; Romero, Pedro; McAdams, Harley H.; Stephens, Craig

2004-01-01

Microarray analysis was used to examine gene expression in the freshwater oligotrophic bacterium Caulobacter crescentus during growth on three standard laboratory media, including peptone-yeast extract medium (PYE) and minimal salts medium with glucose or xylose as the carbon source. Nearly 400 genes (approximately 10% of the genome) varied significantly in expression between at least two of these media. The differentially expressed genes included many encoding transport systems, most notably diverse TonB-dependent outer membrane channels of unknown substrate specificity. Amino acid degradation pathways constituted the largest class of genes induced in PYE. In contrast, many of the genes upregulated in minimal media encoded enzymes for synthesis of amino acids, including incorporation of ammonia and sulfate into glutamate and cysteine. Glucose availability induced expression of genes encoding enzymes of the Entner-Doudoroff pathway, which was demonstrated here through mutational analysis to be essential in C. crescentus for growth on glucose. Xylose induced expression of genes encoding several hydrolytic exoenzymes as well as an operon that may encode a novel pathway for xylose catabolism. A conserved DNA motif upstream of many xylose-induced genes was identified and shown to confer xylose-specific expression. Xylose is an abundant component of xylan in plant cell walls, and the microarray data suggest that in addition to serving as a carbon source for growth of C. crescentus, this pentose may be interpreted as a signal to produce enzymes associated with plant polymer degradation. PMID:14973021

Molecular cloning and characterization of alpha - galactosidase gene from Glaciozyma antarctica

NASA Astrophysics Data System (ADS)

Moheer, Reyad Qaed Al; Bakar, Farah Diba Abu; Murad, Abdul Munir Abdul

2015-09-01

Psychrophilic enzymes are proteins produced by psychrophilic organisms which recently are the limelight for industrial applications. A gene encoding α-galactosidase from a psychrophilic yeast, Glaciozyma antarctica PI12 which belongs to glycoside hydrolase family 27, was isolated and analyzed using several bioinformatic tools. The cDNA of the gene with the size of 1,404-bp encodes a protein with 467 amino acid residues. Predicted molecular weight of protein was 48.59 kDa and hence we name the gene encoding α-galactosidase as GAL48. We found that the predicted protein sequences possessed signal peptide sequence and are highly conserved among other fungal α-galactosidase.

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

PubMed

Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

2005-01-01

We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

PubMed

Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

2005-12-01

Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

The genomic structure of the human Charcot-Leyden crystal protein gene is analogous to those of the galectin genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dyer, K.D.; Handen, J.S.; Rosenberg, H.F.

The Charcot-Leyden crystal (CLC) protein, or eosinophil lysophospholipase, is a characteristic protein of human eosinophils and basophils; recent work has demonstrated that the CLC protein is both structurally and functionally related to the galectin family of {beta}-galactoside binding proteins. The galectins as a group share a number of features in common, including a linear ligand binding site encoded on a single exon. In this work, we demonstrate that the intron-exon structure of the gene encoding CLC is analogous to those encoding the galectins. The coding sequence of the CLC gene is divided into four exons, with the entire {beta}-galactoside bindingmore » site encoded by exon III. We have isolated CLC {beta}-galactoside binding sites from both orangutan (Pongo pygmaeus) and murine (Mus musculus) genomic DNAs, both encoded on single exons, and noted conservation of the amino acids shown to interact directly with the {beta}-galactoside ligand. The most likely interpretation of these results suggests the occurrence of one or more exon duplication and insertion events, resulting in the distribution of this lectin domain to CLC as well as to the multiple galectin genes. 35 refs., 3 figs.« less

Recombination and mutation of class II histocompatibility genes in wild mice.

PubMed

Wakeland, E K; Darby, B R

1983-12-01

We have compared the tryptic peptide fingerprints of the A alpha, A beta, E alpha, and E beta subunits encoded by four wild-derived H-2 complexes expressing A molecules closely related to Ak. The A molecules encoded by these Ak-related mice have A alpha and A beta subunits that differ from A alpha k and A beta k by less than 10% of their tryptic peptides. Comparisons among the four wild-derived A molecules suggested that these contemporary A alpha and A beta alleles arose by sequential mutational events from common ancestor A alpha and A beta alleles. These results suggest that A alpha and A beta may co-evolve as an A beta A alpha gene duplex in wild mice. Tryptic peptide fingerprint comparisons of the E beta gene linked to these Ak-related A beta A alpha gene duplexes indicate that two encode E beta d-like subunits, whereas another encodes an E beta s-like subunit. These results strongly suggest that the A beta A alpha duplex and E beta recombine in wild mouse populations. The significantly different evolutionary patterns exhibited by the class II genes encoding A vs E molecules are discussed.

Multi-functional acetyl-CoA carboxylase from Brassica napus is encoded by a multi-gene family: indication for plastidic localization of at least one isoform.

PubMed

Schulte, W; Töpfer, R; Stracke, R; Schell, J; Martini, N

1997-04-01

Three genes coding for different multifunctional acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) isoenzymes from Brassica napus were isolated and divided into two major classes according to structural features in their 5' regions: class I comprises two genes with an additional coding exon of approximately 300 bp at the 5' end, and class II is represented by one gene carrying an intron of 586 bp in its 5' untranslated region. Fusion of the peptide sequence encoded by the additional first exon of a class I ACCase gene to the jellyfish Aequorea victoria green fluorescent protein (GFP) and transient expression in tobacco protoplasts targeted GFP to the chloroplasts. In contrast to the deduced primary structure of the biotin carboxylase domain encoded by the class I gene, the corresponding amino acid sequence of the class II ACCase shows higher identity with that of the Arabidopsis ACCase, both lacking a transit peptide. The Arabidopsis ACCase has been proposed to be a cytosolic isoenzyme. These observations indicate that the two classes of ACCase genes encode plastidic and cytosolic isoforms of multi-functional, eukaryotic type, respectively, and that B. napus contains at least one multi-functional ACCase besides the multi-subunit, prokaryotic type located in plastids. Southern blot analysis of genomic DNA from B. napus, Brassica rapa, and Brassica oleracea, the ancestors of amphidiploid rapeseed, using a fragment of a multi-functional ACCase gene as a probe revealed that ACCase is encoded by a multi-gene family of at least five members.

Characterization of GM-CSF-inhibitory factor and Uracil DNA glycosylase encoding genes from camel pseudocowpoxvirus.

PubMed

Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Narnaware, S D; Mehta, S C; Singh, P K; Singh, Raghvendar; Tuteja, F C; Patil, N V

2015-06-01

The present study describes the PCR amplification of GM-CSF-inhibitory factor (GIF) and Uracil DNA glycosylase (UDG) encoding genes of pseudocowpoxvirus (PCPV) from the Indian Dromedaries (Camelus dromedarius) infected with contagious ecthyma using the primers based on the corresponding gene sequences of human PCPV and reindeer PCPV, respectively. The length of GIF gene of PCPV obtained from camel is 795 bp and due to the addition of one cytosine residue at position 374 and one adenine residue at position 516, the open reading frame (ORF) got altered, resulting in the production of truncated polypeptide. The ORF of UDG encoding gene of camel PCPV is 696 bp encoding a polypeptide of 26.0 kDa. Comparison of amino acid sequence homologies of GIF and UDG of camel PCPV revealed that the camel PCPV is closer to ORFV and PCPV (reference stains of both human and reindeer), respectively. Copyright © 2015 Elsevier Ltd. All rights reserved.

A mutation in a new gene bglJ, activates the bgl operon in Escherichia coli K-12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giel, M.; Desnoyer, M.; Lopilato, J.

1996-06-01

A new mutation , bglJ4, has been characterized that results in the expression of the silent bgl operon. The bgl operon encodes proteins necessary for the transport and utilization of the aromatic {beta}-glucosides arbutin and salicin. A variety of mutations activate the operon and result in a Bgl{sup +} phenotype. Activating mutations are located upstream of the bgl promoter and in genes located elsewhere on the chromosome. Mutations outside of the bgl operon occur in the genes encoding DNA gyrase and in the gene encoding the nucleoid associated protein H-NS. The mutation described here, bglJ4, has been mapped to amore » new locus at min 99 on the Escherichia coli K-12 genetic map. The putative protein encoded by the bglJ gene has homology to a family of transcriptional activators. Evidence is presented that increased expression of the bglJ product is needed for activation of the bgl operon. 56 refs., 3 figs., 3 tabs.« less

Two Closely Related Genes of Arabidopsis Encode Plastidial Cytidinediphosphate Diacylglycerol Synthases Essential for Photoautotrophic Growth1[C

PubMed Central

Haselier, André; Akbari, Hana; Weth, Agnes; Baumgartner, Werner; Frentzen, Margrit

2010-01-01

Cytidinediphosphate diacylglycerol synthase (CDS) catalyzes the formation of cytidinediphosphate diacylglycerol, an essential precursor of anionic phosphoglycerolipids like phosphatidylglycerol or -inositol. In plant cells, CDS isozymes are located in plastids, mitochondria, and microsomes. Here, we show that these isozymes are encoded by five genes in Arabidopsis (Arabidopsis thaliana). Alternative translation initiation or alternative splicing of CDS2 and CDS4 transcripts can result in up to 10 isoforms. Most of the cDNAs encoding the various plant isoforms were functionally expressed in yeast and rescued the nonviable phenotype of the mutant strain lacking CDS activity. The closely related genes CDS4 and CDS5 were found to encode plastidial isozymes with similar catalytic properties. Inactivation of both genes was required to obtain Arabidopsis mutant lines with a visible phenotype, suggesting that the genes have redundant functions. Analysis of these Arabidopsis mutants provided further independent evidence for the importance of plastidial phosphatidylglycerol for structure and function of thylakoid membranes and, hence, for photoautotrophic growth. PMID:20442275

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

PubMed

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Identification of an opd (organophosphate degradation) gene in an Agrobacterium isolate.

PubMed

Horne, Irene; Sutherland, Tara D; Harcourt, Rebecca L; Russell, Robyn J; Oakeshott, John G

2002-07-01

We isolated a bacterial strain, Agrobacterium radiobacter P230, which can hydrolyze a wide range of organophosphate (OP) insecticides. A gene encoding a protein involved in OP hydrolysis was cloned from A. radiobacter P230 and sequenced. This gene (called opdA) had sequence similarity to opd, a gene previously shown to encode an OP-hydrolyzing enzyme in Flavobacterium sp. strain ATCC 27551 and Brevundimonas diminuta MG. Insertional mutation of the opdA gene produced a strain lacking the ability to hydrolyze OPs, suggesting that this is the only gene encoding an OP-hydrolyzing enzyme in A. radiobacter P230. The OPH and OpdA proteins, encoded by opd and opdA, respectively, were overexpressed and purified as maltose-binding proteins, and the maltose-binding protein moiety was cleaved and removed. Neither protein was able to hydrolyze the aliphatic OP malathion. The kinetics of the two proteins for diethyl OPs were comparable. For dimethyl OPs, OpdA had a higher k(cat) than OPH. It was also capable of hydrolyzing the dimethyl OPs phosmet and fenthion, which were not hydrolyzed at detectable levels by OPH.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

PubMed

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Non-Targeted Metabolomics Analysis of Golden Retriever Muscular Dystrophy-Affected Muscles Reveals Alterations in Arginine and Proline Metabolism, and Elevations in Glutamic and Oleic Acid In Vivo

PubMed Central

Abdullah, Muhammad; Kornegay, Joe N.; Honcoop, Aubree; Parry, Traci L.; Balog-Alvarez, Cynthia J.; Muehlbauer, Michael J.; Newgard, Christopher B.; Patterson, Cam

2017-01-01

Background: Like Duchenne muscular dystrophy (DMD), the Golden Retriever Muscular Dystrophy (GRMD) dog model of DMD is characterized by muscle necrosis, progressive paralysis, and pseudohypertrophy in specific skeletal muscles. This severe GRMD phenotype includes moderate atrophy of the biceps femoris (BF) as compared to unaffected normal dogs, while the long digital extensor (LDE), which functions to flex the tibiotarsal joint and serves as a digital extensor, undergoes the most pronounced atrophy. A recent microarray analysis of GRMD identified alterations in genes associated with lipid metabolism and energy production. Methods: We, therefore, undertook a non-targeted metabolomics analysis of the milder/earlier stage disease GRMD BF muscle versus the more severe/chronic LDE using GC-MS to identify underlying metabolic defects specific for affected GRMD skeletal muscle. Results: Untargeted metabolomics analysis of moderately-affected GRMD muscle (BF) identified eight significantly altered metabolites, including significantly decreased stearamide (0.23-fold of controls, p = 2.89 × 10−3), carnosine (0.40-fold of controls, p = 1.88 × 10−2), fumaric acid (0.40-fold of controls, p = 7.40 × 10−4), lactamide (0.33-fold of controls, p = 4.84 × 10−2), myoinositol-2-phosphate (0.45-fold of controls, p = 3.66 × 10−2), and significantly increased oleic acid (1.77-fold of controls, p = 9.27 × 10−2), glutamic acid (2.48-fold of controls, p = 2.63 × 10−2), and proline (1.73-fold of controls, p = 3.01 × 10−2). Pathway enrichment analysis identified significant enrichment for arginine/proline metabolism (p = 5.88 × 10−4, FDR 4.7 × 10−2), where alterations in L-glutamic acid, proline, and carnosine were found. Additionally, multiple Krebs cycle intermediates were significantly decreased (e.g., malic acid, fumaric acid, citric/isocitric acid, and succinic acid), suggesting that altered energy metabolism may be underlying the observed GRMD BF muscle dysfunction. In contrast, two pathways, inosine-5′-monophosphate (VIP Score 3.91) and 3-phosphoglyceric acid (VIP Score 3.08) mainly contributed to the LDE signature, with two metabolites (phosphoglyceric acid and inosine-5′-monophosphate) being significantly decreased. When the BF and LDE were compared, the most significant metabolite was phosphoric acid, which was significantly less in the GRMD BF compared to control and GRMD LDE groups. Conclusions: The identification of elevated BF oleic acid (a long-chain fatty acid) is consistent with recent microarray studies identifying altered lipid metabolism genes, while alterations in arginine and proline metabolism are consistent with recent studies identifying elevated L-arginine in DMD patient sera as a biomarker of disease. Together, these studies demonstrate muscle-specific alterations in GRMD-affected muscle, which illustrate previously unidentified metabolic changes. PMID:28758940

Solvent and conformation dependence of amide I vibrations in peptides and proteins containing proline

NASA Astrophysics Data System (ADS)

Roy, Santanu; Lessing, Joshua; Meisl, Georg; Ganim, Ziad; Tokmakoff, Andrei; Knoester, Jasper; Jansen, Thomas L. C.

2011-12-01

We present a mixed quantum-classical model for studying the amide I vibrational dynamics (predominantly CO stretching) in peptides and proteins containing proline. There are existing models developed for determining frequencies of and couplings between the secondary amide units. However, these are not applicable to proline because this amino acid has a tertiary amide unit. Therefore, a new parametrization is required for infrared-spectroscopic studies of proteins that contain proline, such as collagen, the most abundant protein in humans and animals. Here, we construct the electrostatic and dihedral maps accounting for solvent and conformation effects on frequency and coupling for the proline unit. We examine the quality and the applicability of these maps by carrying out spectral simulations of a number of peptides with proline in D2O and compare with experimental observations.

Solvent and conformation dependence of amide I vibrations in peptides and proteins containing proline.

PubMed

Roy, Santanu; Lessing, Joshua; Meisl, Georg; Ganim, Ziad; Tokmakoff, Andrei; Knoester, Jasper; Jansen, Thomas L C

2011-12-21

We present a mixed quantum-classical model for studying the amide I vibrational dynamics (predominantly CO stretching) in peptides and proteins containing proline. There are existing models developed for determining frequencies of and couplings between the secondary amide units. However, these are not applicable to proline because this amino acid has a tertiary amide unit. Therefore, a new parametrization is required for infrared-spectroscopic studies of proteins that contain proline, such as collagen, the most abundant protein in humans and animals. Here, we construct the electrostatic and dihedral maps accounting for solvent and conformation effects on frequency and coupling for the proline unit. We examine the quality and the applicability of these maps by carrying out spectral simulations of a number of peptides with proline in D(2)O and compare with experimental observations.

Proline accumulation and its implication in cold tolerance of regenerable maize callus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, D.R.; Widholm, J.M.

1987-03-01

Embryogenic callus of maize (Zea mays L.) inbreds B37wx, H99, H99/sup 3/H95, Mo17, and Pa91 accumulated proline to levels 2.1 to 2.5 times that of control callus when subjected to mannitol-induced water stress, cool temperatures (19/sup 0/C) and abscisic acid (ABA). A combination of 0.53 molar mannitol plus 0.1 millimolar ABA induced a proline accumulation to about 4.5 times that of control callus, equivalent to approximately 0.18 millimoles proline per gram fresh weight of callus. Proline accumulation was directly related to the level of mannitol in the medium. Levels of ABA greater than 1.0 micromolar were required in the mediummore » to induce proline accumulation comparable to that induced by mannitol. Mannitol and ABA levels that induced maximum accumulation of proline also inhibited callus growth and increased tolerance to cold. Proline (12 millimolar) added to culture media also increased the tolerance of callus to 4/sup 0/C. The increased cold tolerance induced by the combination of mannitol and ABA has permitted the storage of the maize inbreds A632, A634Ht, B37wx, C103DTrf, Fr27rhm, H99, Pa91, Va35, and W117Ht at 4/sup 0/C for 90 days which is more than double the typical survival time of callus. These studies show that proline accumulation increase the cold tolerance of regenerable maize callus.« less

The molecular genetics of Usher syndrome.

PubMed

Ahmed, Z M; Riazuddin, S; Riazuddin, S; Wilcox, E R

2003-06-01

Association of sensorineural deafness and progressive retinitis pigmentosa with and without a vestibular abnormality is the hallmark of Usher syndrome and involves at least 12 loci among three different clinical subtypes. Genes identified for the more commonly inherited loci are USH2A (encoding usherin), MYO7A (encoding myosin VIIa), CDH23 (encoding cadherin 23), PCDH15 (encoding protocadherin 15), USH1C (encoding harmonin), USH3A (encoding clarin 1), and USH1G (encoding SANS). Transcripts from all these genes are found in many tissues/cell types other than the inner ear and retina, but all are uniquely critical for retinal and cochlear cell function. Many of these protein products have been demonstrated to have direct interactions with each other and perform an essential role in stereocilia homeostasis.

Cloning of the Pichia anomala SEC61 gene and its expression in a Saccharomyces cerevisiae sec61 mutant.

PubMed

Ruíz, Teresa; De la Rosa, José M; Domínguez, Angel; Rodríguez, Luis

2003-05-01

In several organisms, including Saccharomyces cerevisiae and other yeast species, the product encoded by the SEC61 gene is considered to be the core element of the translocation apparatus within the endoplasmic reticulum membrane through which translocation of secretory and membrane proteins occurs. In this study, we have cloned and characterized the homolog of the SEC61 gene from the yeast Pichia anomala. The cloned gene includes an ORF, interrupted after the first ten nucleotides by an intron of 131 bp, encoding a 479-amino acid putative polypeptide exhibiting homology to the products encoded by different eukaryotic SEC61 genes, particularly to those from other yeast species. We show that the P. anomala SEC61 gene is correctly processed (intron splicing) when expressed in S. cerevisiae and that it is able to complement the thermosensitive phenotype associated with a mutation in the S. cerevisiae SEC61 gene.

Identification of the gene for fly non-muscle myosin heavy chain: Drosophila myosin heavy chains are encoded by a gene family.

PubMed Central

Kiehart, D P; Lutz, M S; Chan, D; Ketchum, A S; Laymon, R A; Nguyen, B; Goldstein, L S

1989-01-01

In contrast to vertebrate species Drosophila has a single myosin heavy chain gene that apparently encodes all sarcomeric heavy chain polypeptides. Flies also contain a cytoplasmic myosin heavy chain polypeptide that by immunological and peptide mapping criteria is clearly different from the major thoracic muscle isoform. Here, we identify the gene that encodes this cytoplasmic isoform and demonstrate that it is distinct from the muscle myosin heavy chain gene. Thus, fly myosin heavy chains are the products of a gene family. Our data suggest that the contractile function required to power myosin based movement in non-muscle cells requires myosin diversity beyond that available in a single heavy chain gene. In addition, we show, that accumulation of cytoplasmic myosin transcripts is regulated in a developmental stage specific fashion, consistent with a key role for this protein in the movements of early embryogenesis. Images PMID:2498088

A novel chlorophyll a/b binding (Cab) protein gene from petunia which encodes the lower molecular weight Cab precursor protein.

PubMed

Stayton, M M; Black, M; Bedbrook, J; Dunsmuir, P

1986-12-22

The 16 petunia Cab genes which have been characterized are all closely related at the nucleotide sequence level and they encode Cab precursor polypeptides which are similar in sequence and length. Here we describe a novel petunia Cab gene which encodes a unique Cab precursor protein. This protein is a member of the smallest class of Cab precursor proteins for which no gene has previously been assigned in petunia or any other species. The features of this Cab precursor protein are that it is shorter by 2-3 amino acids than the formerly characterized Cab precursors, its transit peptide sequence is unrelated, and the mature polypeptide is significantly diverged at the functionally important N terminus from other petunia Cab proteins. Gene structure also discriminates this gene which is the only intron containing Cab gene in petunia genomic DNA.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

NASA Astrophysics Data System (ADS)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Characterization of EhaJ, a New Autotransporter Protein from Enterohemorrhagic and Enteropathogenic Escherichia coli

PubMed Central

Easton, Donna M.; Totsika, Makrina; Allsopp, Luke P.; Phan, Minh-Duy; Idris, Adi; Wurpel, Daniël J.; Sherlock, Orla; Zhang, Bing; Venturini, Carola; Beatson, Scott A.; Mahony, Timothy J.; Cobbold, Rowland N.; Schembri, Mark A.

2011-01-01

Enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC) are diarrheagenic pathotypes of E. coli that cause gastrointestinal disease with the potential for life-threatening sequelae. While certain EHEC and EPEC virulence mechanisms have been extensively studied, the factors that mediate host colonization remain to be properly defined. Previously, we identified four genes (ehaA, ehaB, ehaC, and ehaD) from the prototypic EHEC strain EDL933 that encode for proteins that belong to the autotransporter (AT) family. Here we have examined the prevalence of these genes, as well as several other AT-encoding genes, in a collection of EHEC and EPEC strains. We show that the complement of AT-encoding genes in EHEC and EPEC strains is variable, with some AT-encoding genes being highly prevalent. One previously uncharacterized AT-encoding gene, which we have termed ehaJ, was identified in 12/44 (27%) of EHEC and 2/20 (10%) of EPEC strains. The ehaJ gene lies immediately adjacent to a gene encoding a putative glycosyltransferase (referred to as egtA). Western blot analysis using an EhaJ-specific antibody indicated that EhaJ is glycosylated by EgtA. Expression of EhaJ in a recombinant E. coli strain, revealed EhaJ is located at the cell surface and in the presence of the egtA glycosyltransferase gene mediates strong biofilm formation in microtiter plate and flow cell assays. EhaJ also mediated adherence to a range of extracellular matrix proteins, however this occurred independent of glycosylation. We also demonstrate that EhaJ is expressed in a wild-type EPEC strain following in vitro growth. However, deletion of ehaJ did not significantly alter its adherence or biofilm properties. In summary, EhaJ is a new glycosylated AT protein from EPEC and EHEC. Further studies are required to elucidate the function of EhaJ in colonization and virulence. PMID:21687429

Targeted next-generation sequencing helps to decipher the genetic and phenotypic heterogeneity of hypertrophic cardiomyopathy

PubMed Central

Cecconi, Massimiliano; Parodi, Maria I.; Formisano, Francesco; Spirito, Paolo; Autore, Camillo; Musumeci, Maria B.; Favale, Stefano; Forleo, Cinzia; Rapezzi, Claudio; Biagini, Elena; Davì, Sabrina; Canepa, Elisabetta; Pennese, Loredana; Castagnetta, Mauro; Degiorgio, Dario; Coviello, Domenico A.

2016-01-01

Hypertrophic cardiomyopathy (HCM) is mainly associated with myosin, heavy chain 7 (MYH7) and myosin binding protein C, cardiac (MYBPC3) mutations. In order to better explain the clinical and genetic heterogeneity in HCM patients, in this study, we implemented a target-next generation sequencing (NGS) assay. An Ion AmpliSeq™ Custom Panel for the enrichment of 19 genes, of which 9 of these did not encode thick/intermediate and thin myofilament (TTm) proteins and, among them, 3 responsible of HCM phenocopy, was created. Ninety-two DNA samples were analyzed by the Ion Personal Genome Machine: 73 DNA samples (training set), previously genotyped in some of the genes by Sanger sequencing, were used to optimize the NGS strategy, whereas 19 DNA samples (discovery set) allowed the evaluation of NGS performance. In the training set, we identified 72 out of 73 expected mutations and 15 additional mutations: the molecular diagnosis was achieved in one patient with a previously wild-type status and the pre-excitation syndrome was explained in another. In the discovery set, we identified 20 mutations, 5 of which were in genes encoding non-TTm proteins, increasing the diagnostic yield by approximately 20%: a single mutation in genes encoding non-TTm proteins was identified in 2 out of 3 borderline HCM patients, whereas co-occuring mutations in genes encoding TTm and galactosidase alpha (GLA) altered proteins were characterized in a male with HCM and multiorgan dysfunction. Our combined targeted NGS-Sanger sequencing-based strategy allowed the molecular diagnosis of HCM with greater efficiency than using the conventional (Sanger) sequencing alone. Mutant alleles encoding non-TTm proteins may aid in the complete understanding of the genetic and phenotypic heterogeneity of HCM: co-occuring mutations of genes encoding TTm and non-TTm proteins could explain the wide variability of the HCM phenotype, whereas mutations in genes encoding only the non-TTm proteins are identifiable in patients with a milder HCM status. PMID:27600940

Characterization of two genes encoding the Mycobacterium tuberculosis ribonucleotide reductase small subunit.

PubMed Central

Yang, F; Curran, S C; Li, L S; Avarbock, D; Graf, J D; Chua, M M; Lu, G; Salem, J; Rubin, H

1997-01-01

Two nrdF genes, nrdF1 and nrdF2, encoding the small subunit (R2) of ribonucleotide reductase (RR) from Mycobacterium tuberculosis have 71% identity at the amino acid level and are both highly homologous with Salmonella typhimurium R2F. The calculated molecular masses of R2-1 and R2-2 are 36,588 (322 amino acids [aa]) and 36,957 (324 aa) Da, respectively. Western blot analysis of crude M. tuberculosis extracts indicates that both R2s are expressed in vivo. Recombinant R2-2 is enzymatically active when assayed with pure recombinant M. tuberculosis R1 subunit. Both ATP and dATP are activators for CDP reduction up to 2 and 1 mM, respectively. The gene encoding M. tuberculosis R2-1, nrdF1, is not linked to nrdF2, nor is either gene linked to the gene encoding the large subunit, M. tuberculosis nrdE. The gene encoding MTP64 was found downstream from nrdF1, and the gene encoding alcohol dehydrogenase was found downstream from nrdF2. A nrdA(Ts) strain of E. coli (E101) could be complemented by simultaneous transformation with M. tuberculosis nrdE and nrdF2. An M. tuberculosis nrdF2 variant in which the codon for the catalytically necessary tyrosine was replaced by the phenylalanine codon did not complement E101 when cotransformed with M. tuberculosis nrdE. Similarly, M. tuberculosis nrdF1 and nrdE did not complement E101. Activity of recombinant M. tuberculosis RR was inhibited by incubating the enzyme with a peptide corresponding to the 7 C-terminal amino acid residues of the R2-2 subunit. M. tuberculosis is a species in which a nrdEF system appears to encode the biologically active species of RR and also the only bacterial species identified so far in which class I RR subunits are not arranged on an operon. PMID:9335290

Evidence for a role of proline and hypothalamic astrocytes in the regulation of glucose metabolism in rats.

PubMed

Arrieta-Cruz, Isabel; Su, Ya; Knight, Colette M; Lam, Tony K T; Gutiérrez-Juárez, Roger

2013-04-01

The metabolism of lactate to pyruvate in the mediobasal hypothalamus (MBH) regulates hepatic glucose production. Because astrocytes and neurons are functionally linked by metabolic coupling through lactate transfer via the astrocyte-neuron lactate shuttle (ANLS), we reasoned that astrocytes might be involved in the hypothalamic regulation of glucose metabolism. To examine this possibility, we used the gluconeogenic amino acid proline, which is metabolized to pyruvate in astrocytes. Our results showed that increasing the availability of proline in rats either centrally (MBH) or systemically acutely lowered blood glucose. Pancreatic clamp studies revealed that this hypoglycemic effect was due to a decrease of hepatic glucose production secondary to an inhibition of glycogenolysis, gluconeogenesis, and glucose-6-phosphatase flux. The effect of proline was mimicked by glutamate, an intermediary of proline metabolism. Interestingly, proline's action was markedly blunted by pharmacological inhibition of hypothalamic lactate dehydrogenase (LDH) suggesting that metabolic flux through LDH was required. Furthermore, short hairpin RNA-mediated knockdown of hypothalamic LDH-A, an astrocytic component of the ANLS, also blunted the glucoregulatory action of proline. Thus our studies suggest not only a new role for proline in the regulation of hepatic glucose production but also indicate that hypothalamic astrocytes are involved in the regulatory mechanism as well.

Cloning, sequencing, and expression of the apa gene coding for the Mycobacterium tuberculosis 45/47-kilodalton secreted antigen complex.

PubMed

Laqueyrerie, A; Militzer, P; Romain, F; Eiglmeier, K; Cole, S; Marchal, G

1995-10-01

Effective protection against a virulent challenge with Mycobacterium tuberculosis is induced mainly by previous immunization with living attenuated mycobacteria, and it has been hypothesized that secreted proteins serve as major targets in the specific immune response. To identify and purify molecules present in culture medium filtrate which are dominant antigens during effective vaccination, a two-step selection procedure was used to select antigens able to interact with T lymphocytes and/or antibodies induced by immunization with living bacteria and to counterselect antigens interacting with the immune effectors induced by immunization with dead bacteria. A Mycobacterium bovis BCG 45/47-kDa antigen complex, present in BCG culture filtrate, has been previously identified and isolated (F. Romain, A. Laqueyrerie, P. Militzer, P. Pescher, P. Chavarot, M. Lagranderie, G. Auregan, M. Gheorghiu, and G. Marchal, Infect. Immun. 61:742-750, 1993). Since the cognate antibodies recognize the very same antigens present in M. tuberculosis culture medium filtrates, a project was undertaken to clone, express, and sequence the corresponding gene of M. tuberculosis. An M. tuberculosis shuttle cosmid library was transferred in Mycobacterium smegmatis and screened with a competitive enzyme-linked immunosorbent assay to detect the clones expressing the proteins. A clone containing a 40-kb DNA insert was selected, and by means of subcloning in Escherichia coli, a 2-kb fragment that coded for the molecules was identified. An open reading frame in the 2,061-nucleotide sequence codes for a secreted protein with a consensus signal peptide of 39 amino acids and a predicted molecular mass of 28,779 Da. The gene was referred to as apa because of the high percentages of proline (21.7%) and alanine (19%) in the purified protein. Southern hybridization analysis of digested total genomic DNA from M. tuberculosis (reference strains H37Rv and H37Ra) indicated that the apa gene was present as a single copy on the genome. The N-terminal identity or homology of the M. tuberculosis and M. bovis BCG purified molecules and their similar global and deduced amino acid compositions demonstrated the perfect correspondence between the molecular and chemical analyses. The presence of a high percentage of proline (21.7%) was confirmed and explained the apparent higher molecular mass (45/47 kDa) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis resulting from the increased rigidity of molecules due to proline residues.(ABSTRACT TRUNCATED AT 400 WORDS)

A sex-inducing pheromone triggers cell cycle arrest and mate attraction in the diatom Seminavis robusta

PubMed Central

Moeys, Sara; Frenkel, Johannes; Lembke, Christine; Gillard, Jeroen T. F.; Devos, Valerie; Van den Berge, Koen; Bouillon, Barbara; Huysman, Marie J. J.; De Decker, Sam; Scharf, Julia; Bones, Atle; Brembu, Tore; Winge, Per; Sabbe, Koen; Vuylsteke, Marnik; Clement, Lieven; De Veylder, Lieven; Pohnert, Georg; Vyverman, Wim

2016-01-01

Although sexual reproduction is believed to play a major role in the high diversification rates and species richness of diatoms, a mechanistic understanding of diatom life cycle control is virtually lacking. Diatom sexual signalling is controlled by a complex, yet largely unknown, pheromone system. Here, a sex-inducing pheromone (SIP+) of the benthic pennate diatom Seminavis robusta was identified by comparative metabolomics, subsequently purified, and physicochemically characterized. Transcriptome analysis revealed that SIP+ triggers the switch from mitosis-to-meiosis in the opposing mating type, coupled with the transcriptional induction of proline biosynthesis genes, and the release of the proline-derived attraction pheromone. The induction of cell cycle arrest by a pheromone, chemically distinct from the one used to attract the opposite mating type, highlights the existence of a sophisticated mechanism to increase chances of mate finding, while keeping the metabolic losses associated with the release of an attraction pheromone to a minimum. PMID:26786712

Chemical modification of L-glutamine to alpha-amino glutarimide on autoclaving facilitates Agrobacterium infection of host and non-host plants: A new use of a known compound

PubMed Central

2011-01-01

Background Accidental autoclaving of L-glutamine was found to facilitate the Agrobacterium infection of a non host plant like tea in an earlier study. In the present communication, we elucidate the structural changes in L-glutamine due to autoclaving and also confirm the role of heat transformed L-glutamine in Agrobacterium mediated genetic transformation of host/non host plants. Results When autoclaved at 121°C and 15 psi for 20 or 40 min, L-glutamine was structurally modified into 5-oxo proline and 3-amino glutarimide (α-amino glutarimide), respectively. Of the two autoclaved products, only α-amino glutarimide facilitated Agrobacterium infection of a number of resistant to susceptible plants. However, the compound did not have any vir gene inducing property. Conclusions We report a one pot autoclave process for the synthesis of 5-oxo proline and α-amino glutarimide from L-glutamine. Xenobiotic detoxifying property of α-amino glutarimide is also proposed. PMID:21624145

Cloning and sequence analysis of the LEU2 homologue gene from Pichia anomala.

PubMed

De la Rosa, J M; Pérez, J A; Gutiérrez, F; González, J M; Ruiz, T; Rodríguez, L

2001-11-01

The Pichia anomala LEU2 gene (PaLEU2) was isolated by complementation of a leu2 Saccharomyces cerevisiae mutant. The cloned gene also allowed growth of a Escherichia coli leuB mutant in leucine-lacking medium, indicating that it encodes a product able to complement the beta-isopropylmalate dehydrogenase deficiency of the mutants. The sequenced DNA fragment contains a complete ORF of 1092 bp, and the deduced polypeptide shares significant homologies with the products of the LEU2 genes from S. cerevisiae (84% identity) and other yeast species. A sequence resembling the GC-rich palindrome motif identified in the 5' region of S. cerevisiae LEU2 gene as the binding site for the transcription activating factor encoded by the LEU3 gene was found at the promoter region. In addition, upstream of the PaLEU2 the 3'-terminal half of a gene of the same orientation, encoding a homologue of the S. cerevisiae NFS1/SPL1 gene that encodes a mitochondrial cysteine desulphurase involved in both tRNA processing and mitochondrial metabolism, was found. The genomic organization of the PaNFS1-PaLEU2 gene pair is similar to that found in several other yeast species, including S. cerevisiae and Candida albicans, except that in some of them the LEU2 gene appears in the reverse orientation. Copyright 2001 John Wiley & Sons, Ltd.

Chirally directed formation of nanometer-scale proline clusters.

PubMed

Myung, Sunnie; Fioroni, Marco; Julian, Ryan R; Koeniger, Stormy L; Baik, Mu-Hyun; Clemmer, David E

2006-08-23

Ion mobility measurements, combined with molecular mechanics simulations, are used to study enantiopure and racemic proline clusters formed by electrospray ionization. Broad distributions of cluster sizes and charge states are observed, ranging from clusters containing only a few proline units to clusters that contain more than 100 proline units (i.e., protonated clusters of the form [xPro + nH](n+) with x = 1 to >100 and n = 1-7). As the sizes of clusters increase, there is direct evidence for nanometer scale, chirally induced organization into specific structures. For n = 4 and 5, enantiopure clusters of approximately 50 to 100 prolines assemble into structures that are more elongated than the most compact structure that is observed from the racemic proline clusters. A molecular analogue, cis-4-hydroxy-proline, displays significantly different behavior, indicating that in addition to the rigidity of the side chain ring, intermolecular interactions are important in the formation of chirally directed clusters. This is the first case in which assemblies of chirally selective elongated structures are observed in this size range of amino acid clusters. Relationships between enantiopurity, cluster shape, and overall energetics are discussed.

TGIF1 is a potential candidate gene for high myopia in ethnic Kashmiri population.

PubMed

Ahmed, Ishfaq; Rasool, Shabhat; Jan, Tariq; Qureshi, Tariq; Naykoo, Niyaz A; Andrabi, Khurshid I

2014-03-01

High myopia is a complex disorder that imposes serious consequences on ocular health. Linkage analysis has identified several genetic loci with a series of potential candidate genes that reveal an ambiguous pattern of association with high myopia due to population heterogeneity. We have accordingly chosen to examine the prospect of association of one such gene [transforming growth β-induced factor 1 (TGIF1)] in population that is purely ethnic (Kashmiri) and represents a homogeneous cohort from Northern India. Cases with high myopia with a spherical equivalent of ≥-6 diopters (D) and emmetropic controls with spherical equivalent within ±0.5 D in one or both eyes represented by a sample size of 212 ethnic Kashmiri subjects and 239 matched controls. Genomic DNA was genotyped for sequence variations in TGIF1 gene and allele frequencies tested for Hardy-Weinberg disequilibrium. Potential association was evaluated using χ(2) or Fisher's exact test. Two previously reported missense variations C > T, rs4468717 (first base of codon 143) changing proline to serine and rs2229333 (second base of codon 143) changing proline to leucine were identified in exon 10 of TGIF1. Both variations exhibited possibly significant (p < 0.05) association with the disease phenotype. Since the variant allele frequency of both the single-nucleotide polymorphisms in cases is higher than controls with odds ratio greater than 1.Therefore, variant allele of both the single-nucleotide polymorphisms represents the possible risk factor for myopia in the Kashmiri population. In silico predictions show that substitutions are likely to have an impact on the structure and functional properties of the protein, making it imperative to understand their functional consequences in relation to high myopia. TGIF1 is a relevant candidate gene with potential to contribute in the genesis of high myopia.

Steady-state and dynamic gene expression programs in Saccharomyces cerevisiae in response to variation in environmental nitrogen

PubMed Central

Airoldi, Edoardo M.; Miller, Darach; Athanasiadou, Rodoniki; Brandt, Nathan; Abdul-Rahman, Farah; Neymotin, Benjamin; Hashimoto, Tatsu; Bahmani, Tayebeh; Gresham, David

2016-01-01

Cell growth rate is regulated in response to the abundance and molecular form of essential nutrients. In Saccharomyces cerevisiae (budding yeast), the molecular form of environmental nitrogen is a major determinant of cell growth rate, supporting growth rates that vary at least threefold. Transcriptional control of nitrogen use is mediated in large part by nitrogen catabolite repression (NCR), which results in the repression of specific transcripts in the presence of a preferred nitrogen source that supports a fast growth rate, such as glutamine, that are otherwise expressed in the presence of a nonpreferred nitrogen source, such as proline, which supports a slower growth rate. Differential expression of the NCR regulon and additional nitrogen-responsive genes results in >500 transcripts that are differentially expressed in cells growing in the presence of different nitrogen sources in batch cultures. Here we find that in growth rate–controlled cultures using nitrogen-limited chemostats, gene expression programs are strikingly similar regardless of nitrogen source. NCR expression is derepressed in all nitrogen-limiting chemostat conditions regardless of nitrogen source, and in these conditions, only 34 transcripts exhibit nitrogen source–specific differential gene expression. Addition of either the preferred nitrogen source, glutamine, or the nonpreferred nitrogen source, proline, to cells growing in nitrogen-limited chemostats results in rapid, dose-dependent repression of the NCR regulon. Using a novel means of computational normalization to compare global gene expression programs in steady-state and dynamic conditions, we find evidence that the addition of nitrogen to nitrogen-limited cells results in the transient overproduction of transcripts required for protein translation. Simultaneously, we find that that accelerated mRNA degradation underlies the rapid clearing of a subset of transcripts, which is most pronounced for the highly expressed NCR-regulated permease genes GAP1, MEP2, DAL5, PUT4, and DIP5. Our results reveal novel aspects of nitrogen-regulated gene expression and highlight the need for a quantitative approach to study how the cell coordinates protein translation and nitrogen assimilation to optimize cell growth in different environments. PMID:26941329

Different Type 1 Fimbrial Genes and Tropisms of Commensal and Potentially Pathogenic Actinomyces spp. with Different Salivary Acidic Proline-Rich Protein and Statherin Ligand Specificities

PubMed Central

Li, Tong; Khah, Massoud Kheir; Slavnic, Snjezana; Johansson, Ingegerd; Strömberg, Nicklas

2001-01-01

Actinomyces spp. exhibit type 1 fimbria-mediated adhesion to salivary acidic proline-rich proteins (PRPs) and statherin ligands. Actinomyces spp. with different animal and tissue origins belong to three major adhesion types as relates to ligand specificity and type 1 fimbria genes. (i) In preferential acidic-PRP binding, strains of Actinomyces naeslundii genospecies 1 and 2 from human and monkey mouths displayed at least three ligand specificities characterized by preferential acidic-PRP binding. Slot blot DNA hybridization showed seven highly conserved type 1 fimbria genes (orf1- to -6 and fimP) in genospecies 1 and 2 strains, except that orf5 and orf3 were divergent in genospecies 1. (ii) In preferential statherin binding, oral Actinomyces viscosus strains of rat and hamster origin (and strain 19246 from a human case of actinomycosis) bound statherin preferentially. DNA hybridization and characterization of the type 1 fimbria genes from strain 19246 revealed a homologous gene cluster of four open reading frames (orfA to -C and fimP). Bioinformatics suggested sortase (orfB, orf4, and part of orf5), prepilin peptidase (orfC and orf6), fimbria subunit (fimP), and usher- and autotransporter-like (orfA and orf1 to -3) functions. Those gene regions corresponding to orf3 and orf5 were divergent, those corresponding to orf2, orf1, and fimP were moderately conserved, and those corresponding to orf4 and orf6 were highly conserved. Restriction fragment length polymorphism analyses using a fimP probe separated human and monkey and rat and hamster strains into phylogenetically different groups. (iii) In statherin-specific binding, strains of A. naeslundii genospecies 1 from septic and other human infections displayed a low-avidity binding to statherin. Only the orf4 and orf6 gene regions were highly conserved. Finally, rat saliva devoid of statherin bound bacterial strains avidly irrespective of ligand specificity, and specific antisera detected either type 1, type 2, or both types of fimbria on the investigated Actinomyces strains. PMID:11705891

A mental retardation gene, motopsin/prss12, modulates cell morphology by interaction with seizure-related gene 6.

PubMed

Mitsui, Shinichi; Hidaka, Chiharu; Furihata, Mutsuo; Osako, Yoji; Yuri, Kazunari

2013-07-12

A serine protease, motopsin (prss12), plays a significant role in cognitive function and the development of the brain, since the loss of motopsin function causes severe mental retardation in humans and enhances social behavior in mice. Motopsin is activity-dependently secreted from neuronal cells, is captured around the synaptic cleft, and cleaves a proteoglycan, agrin. The multi-domain structure of motopsin, consisting of a signal peptide, a proline-rich domain, a kringle domain, three scavenger receptor cysteine-rich domains, and a protease domain at the C-terminal, suggests the interaction with other molecules through these domains. To identify a protein interacting with motopsin, we performed yeast two-hybrid screening and found that seizure-related gene 6 (sez-6), a transmembrane protein on the plasma membrane of neuronal cells, bound to the proline-rich/kringle domain of motopsin. Pull-down and immunoprecipitation analyses indicated the interaction between these proteins. Immunocytochemical and immunohistochemical analyses suggested the co-localization of motopsin and sez-6 at neuronal cells in the developmental mouse brain and at motor neurons in the anterior horn of human spinal cords. Transient expression of motopsin in neuro2a cells increased the number and length of neurites as well as the level of neurite branching. Interestingly, co-expression of sez-6 with motopsin restored the effect of motopsin at the basal level, while sez-6 expression alone showed no effects on cell morphology. Our results suggest that the interaction of motopsin and sez-6 modulates the neuronal cell morphology. Copyright © 2013 Elsevier Inc. All rights reserved.

A Different Microbiome Gene Repertoire in the Airways of Cystic Fibrosis Patients with Severe Lung Disease

PubMed Central

Bacci, Giovanni; Fiscarelli, Ersilia; Taccetti, Giovanni; Dolce, Daniela; Paganin, Patrizia; Morelli, Patrizia; Tuccio, Vanessa; De Alessandri, Alessandra; Lucidi, Vincenzina

2017-01-01

In recent years, next-generation sequencing (NGS) was employed to decipher the structure and composition of the microbiota of the airways in cystic fibrosis (CF) patients. However, little is still known about the overall gene functions harbored by the resident microbial populations and which specific genes are associated with various stages of CF lung disease. In the present study, we aimed to identify the microbial gene repertoire of CF microbiota in twelve patients with severe and normal/mild lung disease by performing sputum shotgun metagenome sequencing. The abundance of metabolic pathways encoded by microbes inhabiting CF airways was reconstructed from the metagenome. We identified a set of metabolic pathways differently distributed in patients with different pulmonary function; namely, pathways related to bacterial chemotaxis and flagellar assembly, as well as genes encoding efflux-mediated antibiotic resistance mechanisms and virulence-related genes. The results indicated that the microbiome of CF patients with low pulmonary function is enriched in virulence-related genes and in genes encoding efflux-mediated antibiotic resistance mechanisms. Overall, the microbiome of severely affected adults with CF seems to encode different mechanisms for the facilitation of microbial colonization and persistence in the lung, consistent with the characteristics of multidrug-resistant microbial communities that are commonly observed in patients with severe lung disease. PMID:28758937

Activation of Pathogenesis-related Genes by the Rhizobacterium, Bacillus sp. JS, Which Induces Systemic Resistance in Tobacco Plants.

PubMed

Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung

2015-06-01

Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.

Fusagene vectors: a novel strategy for the expression of multiple genes from a single cistron.

PubMed

Gäken, J; Jiang, J; Daniel, K; van Berkel, E; Hughes, C; Kuiper, M; Darling, D; Tavassoli, M; Galea-Lauri, J; Ford, K; Kemeny, M; Russell, S; Farzaneh, F

2000-12-01

Transduction of cells with multiple genes, allowing their stable and co-ordinated expression, is difficult with the available methodologies. A method has been developed for expression of multiple gene products, as fusion proteins, from a single cistron. The encoded proteins are post-synthetically cleaved and processed into each of their constituent proteins as individual, biologically active factors. Specifically, linkers encoding cleavage sites for the Golgi expressed endoprotease, furin, have been incorporated between in-frame cDNA sequences encoding different secreted or membrane bound proteins. With this strategy we have developed expression vectors encoding multiple proteins (IL-2 and B7.1, IL-4 and B7.1, IL-4 and IL-2, IL-12 p40 and p35, and IL-12 p40, p35 and IL-2 ). Transduction and analysis of over 100 individual clones, derived from murine and human tumour cell lines, demonstrate the efficient expression and biological activity of each of the encoded proteins. Fusagene vectors enable the co-ordinated expression of multiple gene products from a single, monocistronic, expression cassette.

Structure, Expression, Chromosomal Location and Product of the Gene Encoding Adh2 in Petunia

PubMed Central

Gregerson, R. G.; Cameron, L.; McLean, M.; Dennis, P.; Strommer, J.

1993-01-01

In most higher plants the genes encoding alcohol dehydrogenase comprise a small gene family, usually with two members. The Adh1 gene of Petunia has been cloned and analyzed, but a second identifiable gene was not recovered from any of three genomic libraries. We have therefore employed the polymerase chain reaction to obtain the major portion of a second Adh gene. From sequence, mapping and northern data we conclude this gene encodes ADH2, the major anaerobically inducible Adh gene of Petunia. The availability of both Adh1 and Adh2 from Petunia has permitted us to compare their structures and patterns of expression to those of the well-studied Adh genes of maize, of which one is highly expressed developmentally, while both are induced in response to hypoxia. Despite their evolutionary distance, evidenced by deduced amino acid sequence as well as taxonomic classification, the pairs of genes are regulated in strikingly similar ways in maize and Petunia. Our findings suggest a significant biological basis for the regulatory strategy employed by these distant species for differential expression of multiple Adh genes. PMID:8096485

Proline accumulation in baker's yeast enhances high-sucrose stress tolerance and fermentation ability in sweet dough.

PubMed

Sasano, Yu; Haitani, Yutaka; Ohtsu, Iwao; Shima, Jun; Takagi, Hiroshi

2012-01-03

During bread-making processes, yeast cells are exposed to various baking-associated stresses. High-sucrose concentrations exert severe osmotic stress that seriously damages cellular components by generation of reactive oxygen species (ROS). Previously, we found that the accumulation of proline conferred freeze-thaw stress tolerance and the baker's yeast strain that accumulated proline retained higher-level fermentation abilities in frozen doughs than the wild-type strain. In this study, we constructed self-cloning diploid baker's yeast strains that accumulate proline. These resultant strains showed higher cell viability and lower intracellular oxidation levels than that observed in the wild-type strain under high-sucrose stress condition. Proline accumulation also enhanced the fermentation ability in high-sucrose-containing dough. These results demonstrate the usefulness of proline-accumulating baker's yeast for sweet dough baking. Copyright © 2011 Elsevier B.V. All rights reserved.

Central l-proline attenuates stress-induced dopamine and serotonin metabolism in the chick forebrain.

PubMed

Hamasu, Kousuke; Shigemi, Kazutaka; Kabuki, Yusuke; Tomonaga, Shozo; Denbow, D Michael; Furuse, Mitsuhiro

2009-08-21

Using microdialysis, we investigated the effect of l-proline on monoamine release in the medio-rostral neostriatum/hyperstriatum ventrale (MNH) of freely moving and restricted chicks. A 30 min handling-stress resulted in a significant increase in extracellular homovallinic acid (HVA), a dopamine metabolite, and 5-hydroxyindoleacetic acid (5-HIAA), a serotonin metabolite, in the MNH. l-Proline, perfused through the microdialysis probe into the MNH during the stressed condition, significantly attenuated the average dialysate concentration of HVA produced by handling-stress. Handling-stress resulted in a significant increase in 5-HIAA levels in the control group, which were attenuated by profusion with l-proline. l-Proline did not significantly modify basal concentrations of HVA or 5-HIAA in the MNH during control conditions. These results show that perfusion of l-proline modified the turnover/metabolism of dopamine and serotonin in the MNH caused by handling-stress.

Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

PubMed Central

van der Ploeg, Jan R.

2005-01-01

In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

Functional characterization of an apple (Malus x domestica) LysM domain receptor encoding gene for its role in defense response

USDA-ARS?s Scientific Manuscript database

Apple gene MDP0000136494 was identified as the only LysM containing protein encoding gene which was specifically up-regulated in P. ultimum infected apple root by a previous transcriptome analysis. In current study, the functional identity of MDP0000136494 was investigated using combined genomic, tr...

Cloning and sequencing the genes encoding goldfish and carp ependymin.

PubMed

Adams, D S; Shashoua, V E

1994-04-20

Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

The complete mitochondrial genome sequence of Eimeria innocua (Eimeriidae, Coccidia, Apicomplexa).

PubMed

Hafeez, Mian Abdul; Vrba, Vladimir; Barta, John Robert

2016-07-01

The complete mitochondrial genome of Eimeria innocua KR strain (Eimeriidae, Coccidia, Apicomplexa) was sequenced. This coccidium infects turkeys (Meleagris gallopavo), Bobwhite quails (Colinus virginianus), and Grey partridges (Perdix perdix). Genome organization and gene contents were comparable with other Eimeria spp. infecting galliform birds. The circular-mapping mt genome of E. innocua is 6247 bp in length with three protein-coding genes (cox1, cox3, and cytb), 19 gene fragments encoding large subunit (LSU) rRNA and 14 gene fragments encoding small subunit (SSU) rRNA. Like other Apicomplexa, no tRNA was encoded. The mitochondrial genome of E. innocua confirms its close phylogenetic affinities to Eimeria dispersa.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

Isolation and characterization of polygalacturonase genes (pecA and pecB) from Aspergillus flavus.

PubMed Central

Whitehead, M P; Shieh, M T; Cleveland, T E; Cary, J W; Dean, R A

1995-01-01

Two genes, pecA and pecB, encoding endopolyglacturonases were cloned from a highly aggressive strain of Aspergillus flavus. The pecA gene consisted of 1,228 bp encoding a protein of 363 amino acids with a predicted molecular mass of 37.6 kDa, interrupted by two introns of 58 and 81 bp in length. Accumulation of pecA mRNA in both pectin- or glucose-grown mycelia in the highly aggressive strain matched the activity profile of a pectinase previously identified as P2c. Transformants of a weakly aggressive strain containing a functional copy of the pecA gene produced P2c in vitro, confirming that pecA encodes P2c. The coding region of pecB was determined to be 1,217 bp in length interrupted by two introns of 65 and 54 bp in length. The predicted protein of 366 amino acids had an estimated molecular mass of 38 kDa. Transcripts of this gene accumulated in mycelia grown in medium containing pectin alone, never in mycelia grown in glucose-containing medium, for both highly and weakly aggressive strains. Thus, pecB encodes the activity previously identified as P1 or P3. pecA and pecB share a high degree of sequence identity with polygalacturonase genes from Aspergillus parasiticus and Aspergillus oryzae, further establishing the close relationships between members of the A. flavus group. Conservation of intron positions in these genes also indicates that they share a common ancestor with genes encoding endopolyglacturonases of Aspergillus niger. PMID:7574642