Sample records for genes immune surveillance

  1. Tumor-Associated Glycans and Immune Surveillance

    PubMed Central

    Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas


    Changes in cell surface glycosylation are a hallmark of the transition from normal to inflamed and neoplastic tissue. Tumor-associated carbohydrate antigens (TACAs) challenge our understanding of immune tolerance, while functioning as immune targets that bridge innate immune surveillance and adaptive antitumor immunity in clinical applications. T-cells, being a part of the adaptive immune response, are the most popular component of the immune system considered for targeting tumor cells. However, for TACAs, T-cells take a back seat to antibodies and natural killer cells as first-line innate defense mechanisms. Here, we briefly highlight the rationale associated with the relative importance of the immune surveillance machinery that might be applicable for developing therapeutics. PMID:26343966

  2. Mathematical model of tumor-immune surveillance.


    Mahasa, Khaphetsi Joseph; Ouifki, Rachid; Eladdadi, Amina; Pillis, Lisette de


    We present a novel mathematical model involving various immune cell populations and tumor cell populations. The model describes how tumor cells evolve and survive the brief encounter with the immune system mediated by natural killer (NK) cells and the activated CD8(+) cytotoxic T lymphocytes (CTLs). The model is composed of ordinary differential equations describing the interactions between these important immune lymphocytes and various tumor cell populations. Based on up-to-date knowledge of immune evasion and rational considerations, the model is designed to illustrate how tumors evade both arms of host immunity (i.e. innate and adaptive immunity). The model predicts that (a) an influx of an external source of NK cells might play a crucial role in enhancing NK-cell immune surveillance; (b) the host immune system alone is not fully effective against progression of tumor cells; (c) the development of immunoresistance by tumor cells is inevitable in tumor immune surveillance. Our model also supports the importance of infiltrating NK cells in tumor immune surveillance, which can be enhanced by NK cell-based immunotherapeutic approaches.

  3. The concept of immune surveillance against tumors: The first theories

    PubMed Central

    Ribatti, Domenico


    The immune system plays a major role in the surveillance against tumors. To avoid attack from the immune system, tumor cells develop different strategies to escape immune surveillance. Evidence of immune surveillance comes from both animal models and clinical observations. Mice with a wide variety of immunodeficiencies have a high rate of tumor incidence and are more susceptible to transplanted or chemical carcinogen-induced tumors. Immunosuppressed patients have a high incidence of tumors. However, many patients develop cancer even in the presence of an apparently normal immune system. This indicates that tumor cells are able to escape immune surveillance. The aim of this review article is to summarize the literature concerning the development of the theory of immune surveillance against tumors; to discuss the evidence for and against this theory, and to discuss the concept of immunoediting. Finally, the current approaches in anti-tumor immunotherapy will be analyzed. PMID:27764780

  4. The concept of immune surveillance against tumors. The first theories.


    Ribatti, Domenico


    The immune system plays a major role in the surveillance against tumors. To avoid attack from the immune system, tumor cells develop different strategies to escape immune surveillance. Evidence of immune surveillance comes from both animal models and clinical observations. Mice with a wide variety of immunodeficiencies have a high rate of tumor incidence and are more susceptible to transplanted or chemical carcinogen-induced tumors. Immunosuppressed patients have a high incidence of tumors. However, many patients develop cancer even in the presence of an apparently normal immune system. This indicates that tumor cells are able to escape immune surveillance. The aim of this review article is to summarize the literature concerning the development of the theory of immune surveillance against tumors; to discuss the evidence for and against this theory, and to discuss the concept of immunoediting. Finally, the current approaches in anti-tumor immunotherapy will be analyzed.

  5. Cytokines and immune surveillance in humans

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald


    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. Among the parameters shown, by us and others, to be affected is the production of interferons. Interferons are a family of cytokines that are antiviral and play a major role in regulating immune responses that control resistance to infection. Alterations in interferon and other cytokine production and activity could result in changes in immunity and a possible compromise of host defenses against both opportunistic and external infections. The purpose of the present study is to further explore the effects of space flight on cytokines and cytokine-directed immunological function.

  6. Deubiquitinases: Novel Therapeutic Targets in Immune Surveillance?

    PubMed Central


    Inflammation is a protective response of the organism to tissue injury or infection. It occurs when the immune system recognizes Pathogen-Associated Molecular Patterns (PAMPs) or Damage-Associated Molecular Pattern (DAMPs) through the activation of Pattern Recognition Receptors. This initiates a variety of signalling events that conclude in the upregulation of proinflammatory molecules, which initiate an appropriate immune response. This response is tightly regulated since any aberrant activation of immune responses would have severe pathological consequences such as sepsis or chronic inflammatory and autoimmune diseases. Accumulative evidence shows that the ubiquitin system, and in particular ubiquitin-specific isopeptidases also known as deubiquitinases (DUBs), plays crucial roles in the control of these immune pathways. In this review we will give an up-to-date overview on the role of DUBs in the NF-κB pathway and inflammasome activation, two intrinsically related events triggered by activation of the membrane TLRs as well as the cytosolic NOD and NLR receptors. Modulation of DUB activity by small molecules has been proposed as a way to control dysregulation or overactivation of these key players of the inflammatory response. We will also discuss the advances and challenges of a potential use of DUBs as therapeutic targets in inflammatory pathologies. PMID:27597804

  7. Deubiquitinases: Novel Therapeutic Targets in Immune Surveillance?


    Lopez-Castejon, Gloria; Edelmann, Mariola J


    Inflammation is a protective response of the organism to tissue injury or infection. It occurs when the immune system recognizes Pathogen-Associated Molecular Patterns (PAMPs) or Damage-Associated Molecular Pattern (DAMPs) through the activation of Pattern Recognition Receptors. This initiates a variety of signalling events that conclude in the upregulation of proinflammatory molecules, which initiate an appropriate immune response. This response is tightly regulated since any aberrant activation of immune responses would have severe pathological consequences such as sepsis or chronic inflammatory and autoimmune diseases. Accumulative evidence shows that the ubiquitin system, and in particular ubiquitin-specific isopeptidases also known as deubiquitinases (DUBs), plays crucial roles in the control of these immune pathways. In this review we will give an up-to-date overview on the role of DUBs in the NF-κB pathway and inflammasome activation, two intrinsically related events triggered by activation of the membrane TLRs as well as the cytosolic NOD and NLR receptors. Modulation of DUB activity by small molecules has been proposed as a way to control dysregulation or overactivation of these key players of the inflammatory response. We will also discuss the advances and challenges of a potential use of DUBs as therapeutic targets in inflammatory pathologies.

  8. Cytokines and immune surveillance in humans

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald


    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. Among the parameters shown, by us and others, to be affected is the production of interferons. Interferons are a family of cytokines that are antiviral and play a major role in regulating immune responses that control resistance to infection. Alterations in interferon and other cytokine production and activity could result in changes in immunity and a possible compromise of host defenses against both opportunistic and external infections. The purpose of the present study is to explore further the effects of space flight on cyotokines and cytokine-directed immunological function. Among the tests carried out are interferon-alpha production, interferon-gamma production, interleukin-1 and -2 production, signal transduction in neutrophils, signal transduction in monocytes, and monocyte phagocytic activity. The experiments will be performed using peripheral blood obtained from human subjects. It is our intent to eventually carry out these experiments using astronauts as subjects to determine the effects of space flight on cytokine production and activity. However, these subjects are not currently available. Until they become available, we will carry out these experiments using subjects maintained in the bed-rest model for microgravity.

  9. Immune surveillance of the CNS following infection and injury

    PubMed Central

    Russo, Matthew; McGavern, Dorian B.


    The central nervous system (CNS) contains a sophisticated neural network that must be constantly surveyed in order to detect and mitigate a diverse array of challenges. The innate and adaptive immune systems actively participate in this surveillance, which is critical for the maintenance of CNS homeostasis and can facilitate the resolution of infections, degeneration, and tissue damage. Infections and sterile injuries represent two common challenges imposed on the CNS that require a prompt immune response. While the inducers of these two challenges differ in origin, the resultant responses orchestrated by the CNS share some overlapping features. Here, we review how the CNS immunologically discriminates between pathogens and sterile injuries, mobilizes an immune reaction, and, ultimately, regulates local and peripherally-derived immune cells to provide a supportive milieu for tissue repair. PMID:26431941

  10. Complement: a key system for immune surveillance and homeostasis.


    Ricklin, Daniel; Hajishengallis, George; Yang, Kun; Lambris, John D


    Nearly a century after the significance of the human complement system was recognized, we have come to realize that its functions extend far beyond the elimination of microbes. Complement acts as a rapid and efficient immune surveillance system that has distinct effects on healthy and altered host cells and foreign intruders. By eliminating cellular debris and infectious microbes, orchestrating immune responses and sending 'danger' signals, complement contributes substantially to homeostasis, but it can also take action against healthy cells if not properly controlled. This review describes our updated view of the function, structure and dynamics of the complement network, highlights its interconnection with immunity at large and with other endogenous pathways, and illustrates its multiple roles in homeostasis and disease.

  11. Cancer-Associated Immune Resistance and Evasion of Immune Surveillance in Colorectal Cancer

    PubMed Central

    Laudanna, Carmelo; Febbraro, Antonio


    Data from molecular profiles of tumors and tumor associated cells provide a model in which cancer cells can acquire the capability of avoiding immune surveillance by expressing an immune-like phenotype. Recent works reveal that expression of immune antigens (PDL1, CD47, CD73, CD14, CD68, MAC387, CD163, DAP12, and CD15) by tumor cells “immune resistance,” combined with prometastatic function of nonmalignant infiltrating cells, may represent a strategy to overcome the rate-limiting steps of metastatic cascade through (a) enhanced interactions with protumorigenic myeloid cells and escape from T-dependent immune response mediated by CD8+ and natural killer (NK) cells; (b) production of immune mediators that establish a local and systemic tumor-supportive environment (premetastatic niche); (c) ability to survive either in the peripheral blood as circulating tumor cells (CTCs) or at the metastatic site forming a cooperative prometastatic loop with foreign “myeloid” cells, macrophages, and neutrophils, respectively. The development of cancer-specific “immune resistance” can be orchestrated either by cooperation with tumor microenvironment or by successive rounds of genetic/epigenetic changes. Recognition of the applicability of this model may provide effective therapeutic avenues for complete elimination of immune-resistant metastatic cells and for enhanced antitumor immunity as part of a combinatorial strategy. PMID:27006653

  12. Cancer-Associated Immune Resistance and Evasion of Immune Surveillance in Colorectal Cancer.


    Parcesepe, Pietro; Giordano, Guido; Laudanna, Carmelo; Febbraro, Antonio; Pancione, Massimo


    Data from molecular profiles of tumors and tumor associated cells provide a model in which cancer cells can acquire the capability of avoiding immune surveillance by expressing an immune-like phenotype. Recent works reveal that expression of immune antigens (PDL1, CD47, CD73, CD14, CD68, MAC387, CD163, DAP12, and CD15) by tumor cells "immune resistance," combined with prometastatic function of nonmalignant infiltrating cells, may represent a strategy to overcome the rate-limiting steps of metastatic cascade through (a) enhanced interactions with protumorigenic myeloid cells and escape from T-dependent immune response mediated by CD8+ and natural killer (NK) cells; (b) production of immune mediators that establish a local and systemic tumor-supportive environment (premetastatic niche); (c) ability to survive either in the peripheral blood as circulating tumor cells (CTCs) or at the metastatic site forming a cooperative prometastatic loop with foreign "myeloid" cells, macrophages, and neutrophils, respectively. The development of cancer-specific "immune resistance" can be orchestrated either by cooperation with tumor microenvironment or by successive rounds of genetic/epigenetic changes. Recognition of the applicability of this model may provide effective therapeutic avenues for complete elimination of immune-resistant metastatic cells and for enhanced antitumor immunity as part of a combinatorial strategy.

  13. Immune surveillance of the lung by migrating tissue monocytes

    PubMed Central

    Rodero, Mathieu P; Poupel, Lucie; Loyher, Pierre-Louis; Hamon, Pauline; Licata, Fabrice; Pessel, Charlotte; Hume, David A; Combadière, Christophe; Boissonnas, Alexandre


    Monocytes are phagocytic effector cells in the blood and precursors of resident and inflammatory tissue macrophages. The aim of the current study was to analyse and compare their contribution to innate immune surveillance of the lung in the steady state with macrophage and dendritic cells (DC). ECFP and EGFP transgenic reporters based upon Csf1r and Cx3cr1 distinguish monocytes from resident mononuclear phagocytes. We used these transgenes to study the migratory properties of monocytes and macrophages by functional imaging on explanted lungs. Migratory monocytes were found to be either patrolling within large vessels of the lung or locating at the interface between lung capillaries and alveoli. This spatial organisation gives to monocytes the property to capture fluorescent particles derived from both vascular and airway routes. We conclude that monocytes participate in steady-state surveillance of the lung, in a way that is complementary to resident macrophages and DC, without differentiating into macrophages. DOI: PMID:26167653

  14. Myeloid PTEN deficiency impairs tumor-immune surveillance via immune-checkpoint inhibition

    PubMed Central

    Kuttke, M.; Sahin, E.; Pisoni, J.; Percig, S.; Vogel, A.; Kraemmer, D.; Hanzl, L.; Brunner, J. S.; Paar, H.; Soukup, K.; Halfmann, A.; Dohnal, A. M.; Steiner, C. W.; Blüml, S.; Basilio, J.; Hochreiter, B.; Salzmann, M.; Hoesel, B.; Lametschwandtner, G.; Eferl, R.; Schmid, J. A.; Schabbauer, G.


    ABSTRACT Tumor–host interaction is determined by constant immune surveillance, characterized by tumor infiltration of myeloid and lymphoid cells. A malfunctioning or diverted immune response promotes tumor growth and metastasis. Recent advances had been made, by treating of certain tumor types, such as melanoma, with T-cell checkpoint inhibitors. This highlights the importance of understanding the molecular mechanisms underlying the crosstalk between tumors and their environment, in particular myeloid and lymphoid cells. Our aim was to study the contribution of the myeloid PI3K/PTEN-signaling pathway in the regulation of tumor-immune surveillance in murine models of cancer. We made use of conditional PTEN-deficient mice, which exhibit sustained activation of the PI3K-signaling axis in a variety of myeloid cell subsets such as macrophages and dendritic cells (DCs). In colitis-associated colon cancer (CAC), mice deficient in myeloid PTEN showed a markedly higher tumor burden and decreased survival. We attributed this observation to the increased presence of immune-modulatory conventional CD8α+ DCs in the spleen, whereas other relevant myeloid cell subsets were largely unaffected. Notably, we detected enhanced surface expression of PD-L1 and PD-L2 on these DCs. As a consequence, tumoricidal T-cell responses were hampered or redirected. Taken together, our findings indicated an unanticipated role for the PI3K/PTEN-signaling axis in the functional regulation of splenic antigen-presenting cells (APCs). Our data pointed at potential, indirect, tumoricidal effects of subclass-specific PI3K inhibitors, which are currently under clinical investigation for treatment of tumors, via myeloid cell activation. PMID:27622019

  15. A global survey of adverse event following immunization surveillance systems for pregnant women and their infants

    PubMed Central

    Cassidy, Christine; MacDonald, Noni E.; Steenbeek, Audrey; Ortiz, Justin R.; Zuber, Patrick L. F.; Top, Karina A.


    ABSTRACT Strengthening antenatal care as a platform for maternal immunization is a priority of the World Health Organization (WHO). Systematic surveillance for adverse events following immunization (AEFI) in pregnancy is needed to identify vaccine safety events. We sought to identify active and passive AEFI surveillance systems for pregnant women and infants. Representatives from all National Pharmacovigilance Centers and a convenience sample of vaccine safety experts were invited to complete a 14-item online survey in English, French or Spanish. The survey captured maternal immunization policies, and active and passive AEFI surveillance systems for pregnant women and infants in respondents' countries. The analysis was descriptive. We received responses from 51/185 (28%) invited persons from 47/148 (32%) countries representing all WHO regions, and low, middle and high-income countries. Thirty countries had national immunization policies targeting pregnant women. Eleven countries had active surveillance systems to detect serious AEFI in pregnant women and/or their infants, including six low and middle-income countries (LMIC). Thirty-nine countries had passive surveillance systems, including 23 LMIC. These active and passive surveillance programs cover approximately 8% and 56% of the worldwide annual birth cohort, respectively. Data from one active and four passive systems have been published. We identified 50 active and passive AEFI surveillance systems for pregnant women and infants, but few have published their findings. AEFI surveillance appears to be feasible in low and high resource settings. Further expansion of AEFI surveillance for pregnant women and sharing of vaccine safety information will provide additional evidence in support of maternal immunization policies. PMID:27159639

  16. The role of liver sinusoidal cells in local hepatic immune surveillance

    PubMed Central

    Wohlleber, Dirk; Knolle, Percy A


    Although the liver's function as unique immune organ regulating immunity has received a lot of attention over the last years, the mechanisms determining hepatic immune surveillance against infected hepatocytes remain less well defined. Liver sinusoidal cells, in particular, liver sinusoidal endothelial cells (LSECs) and Kupffer cells (KCs), serve as physical platform for recruitment and anchoring of blood-borne immune cells in the liver. Liver sinusoidal cells also function as portal of entry for infectious microorganisms targeting the liver such as hepatotropic viruses, bacteria or parasites. At the same time, liver sinusoidal cells actively contribute to achieve immune surveillance against bacterial and viral infections. KCs function as adhesion hubs for CD8 T cells from the circulation, which initiates the interaction of virus-specific CD8 T cells with infected hepatocytes. Through their phagocytic function, KCs contribute to removal of bacteria from the circulation and engage in cross talk with sinusoidal lymphocyte populations to achieve elimination of phagocytosed bacteria. LSECs contribute to local immune surveillance through cross-presentation of viral antigens that causes antigen-specific retention of CD8 T cells from the circulation. Such cross-presentation of viral antigens activates CD8 T cells to release TNF that in turn triggers selective killing of virus-infected hepatocytes. Beyond major histocompatibility complex (MHC)-restricted T-cell immunity, CD1- and MR1-restricted innate-like lymphocytes are found in liver sinusoids whose roles in local immune surveillance against infection need to be defined. Thus, liver sinusoidal cell populations bear key functions for hepatic recruitment and for local activation of immune cells, which are both required for efficient immune surveillance against infection in the liver. PMID:28090319

  17. HLA Immune Function Genes in Autism

    PubMed Central

    Torres, Anthony R.; Westover, Jonna B.; Rosenspire, Allen J.


    The human leukocyte antigen (HLA) genes on chromosome 6 are instrumental in many innate and adaptive immune responses. The HLA genes/haplotypes can also be involved in immune dysfunction and autoimmune diseases. It is now becoming apparent that many of the non-antigen-presenting HLA genes make significant contributions to autoimmune diseases. Interestingly, it has been reported that autism subjects often have associations with HLA genes/haplotypes, suggesting an underlying dysregulation of the immune system mediated by HLA genes. Genetic studies have only succeeded in identifying autism-causing genes in a small number of subjects suggesting that the genome has not been adequately interrogated. Close examination of the HLA region in autism has been relatively ignored, largely due to extraordinary genetic complexity. It is our proposition that genetic polymorphisms in the HLA region, especially in the non-antigen-presenting regions, may be important in the etiology of autism in certain subjects. PMID:22928105

  18. Surveillance for Adverse Events following Immunization from 2008 to 2011 in Zhejiang Province, China

    PubMed Central

    Li, Qian; Lin, Luoya; Chen, Enfu; Chen, Yaping; Qi, Xiaohua


    This study summarizes passive surveillance data for adverse events following immunization (AEFI) reported to the National AEFI Surveillance System (NASS) in Zhejiang province and describes reporting trends from 2008 to 2011. AEFI reporting rates were calculated using denominator data from the Individual Immunization Information System and the Zhejiang provincial Bureau of Statistics. A total of 6,265 AEFI records were reported; the overall reporting rate was 9.2 per 100,000 doses. There were two peaks of reporting rates, which were associated mainly with the introduction of the pandemic H1N1 influenza virus vaccine (pH1N1) in 2009 and the measles-mumps vaccine (MM) campaign in 2010. The majority of the AEFI described nonserious events. Fifteen deaths were recorded, but only one was possibly related to immunization. The most frequently reported reactions were fever and injection site reaction. Vaccines distributed in Zhejiang province have proven to be generally safe. The data on AEFI surveillance provide a reference point for ongoing reporting of trends and illustrate the value of the NASS database as a surveillance tool for monitoring of AEFI. PMID:23239804

  19. Immune Surveillance of Unhealthy Cells by Natural Killer cells

    PubMed Central

    Iannello, Alexandre; Raulet, David H.


    Pathogenic and oncogenic insults result in the induction of intrinsic defense mechanisms such as cell death pathways and senescence, and extrinsic pathways that mobilize immune responses to destroy unhealthy cells. Both protective mechanisms presumably evolved to limit the damage these insults could inflict on the host. After viral infection or malignant transformation, unhealthy cells can be directly sensed by natural killer (NK) and some T cells via the activating receptor NKG2D. All NK cells and subsets of T cells express NKG2D. The NKG2D/ligand system represents a major recognition mechanism for detection and elimination of unhealthy cells. Here we discuss different pathways, including stress pathways, that are responsible for cell surface display of ligands for NKG2D, which are self-proteins that are minimally expressed by normal cells. We also discuss new results indicating that efficient elimination of tumor cells that display NKG2D ligands depends on the recruitment of NK cells and other immune cells to the tumor, which can be regulated by distinct mechanisms, including the p53-dependent production of chemokines by senescent tumors. The cooperative effect of pathways that induce the display NKG2D ligands and distinct pathways that mobilize immune cells provides a higher degree of specificity to the NK cell response. PMID:24135717

  20. Immune Surveillance Against a Solid Tumor Fails because of Immunological Ignorance

    NASA Astrophysics Data System (ADS)

    Ochsenbein, Adrian F.; Klenerman, Paul; Karrer, Urs; Ludewig, Burkhard; Pericin, Marcus; Hengartner, Hans; Zinkernagel, Rolf M.


    Many peripheral solid tumors such as sarcomas and carcinomas express tumor-specific antigens that can serve as targets for immune effector T cells. Nevertheless, overall immune surveillance against such tumors seems relatively inefficient. We studied immune surveillance against a s.c. sarcoma expressing a characterized viral tumor antigen. Surprisingly, the tumor cells were capable of inducing a protective cytotoxic T cell response if transferred as a single-cell suspension. However, if they were transplanted as small tumor pieces, tumors readily grew. Tumor growth correlated strictly with (i) failure of tumor cells to reach the draining lymph nodes and (ii) absence of primed cytotoxic T cells. Cytotoxic T cells were not tolerant or deleted because a tumor antigen-specific cytotoxic T cell response was readily induced in lymphoid tissue by immunization with virus or with tumor cells even in the presence of large tumors. Established tumors were rejected by vaccine-induced effector T cells if effector T cells were maintained by prolonged or repetitive vaccination, but not by single-dose vaccination. Thus, in addition to several other tumor-promoting parameters, some antigenic peripheral sarcomas--and probably carcinomas--may grow not because they anergize or tolerize tumor-specific T cells, but because such tumors are immunologically dealt with as if they were in a so-called immunologically privileged site and are ignored for too long.

  1. [Immune response genes products in human physiology].


    Khaitov, R M; Alekseev, L P


    Current data on physiological role of human immune response genes' proteomic products (antigens) are discussed. The antigens are specified by a very high level of diversity that mediates a wide specter ofphysiological functions. They actually provide integrity and biological stability of human as species. These data reveal new ideas on many pathological processes as well as drafts new approaches for prophylaxis and treatment.

  2. Acquired immunity and asymptomatic reservoir impact on frontline and airport ebola outbreak syndromic surveillance and response.


    Tambo, Ernest; Xiao-Nong, Zhou


    The number of surveillance networks for infectious disease diagnosis and response has been growing. In 2000, the World Health Organization (WHO) established the Global Outbreak Alert and Response Network, which has been endorsed by each of the 46 WHO African members since then. Yet, taming the dynamics and plague of the vicious Ebola virus disease (EVD) in African countries has been patchy and erratic due to inadequate surveillance and contact tracing, community defiance and resistance, a lack of detection and response systems, meager/weak knowledge and information on the disease, inadequacies in protective materials protocols, contact tracing nightmare and differing priorities at various levels of the public health system. Despite the widespread acceptance of syndromic surveillance (SS) systems, their ability to provide early warning alerts and notifications of outbreaks is still unverified. Information is often too limited for any outbreak, or emerging or otherwise unexpected disease, to be recognized at either the community or the national level. Indeed, little is known about the role and the interactions between the Ebola infection and exposure to other syndemics and the development of acquired immunity, asymptomatic reservoir, and Ebola seroconversion. Can lessons be learnt from smallpox, polio, and influenza immunity, and can immunization against these serve as a guide? In most endemic countries, community health centers and disease control and prevention at airports solely relies on passive routine immunization control and reactive syndromic response. The frontline and airport Ebola SS systems in West Africa have shown deficiencies in terms of responding with an alarming number of case fatalities, and suggest that more detailed insights into Ebola, and proactive actions, are needed. The quest for effective early indicators (EEE) in shifting the public and global health paradigm requires the development and implementation of a comprehensive and effective

  3. Community BMI Surveillance Using an Existing Immunization Registry in San Diego, California.


    Ratigan, Amanda R; Lindsay, Suzanne; Lemus, Hector; Chambers, Christina D; Anderson, Cheryl A M; Cronan, Terry A; Browner, Deirdre K; Wooten, Wilma J


    This study examines the demographic representativeness of the County of San Diego Body Mass Index (BMI) Surveillance System to determine if the BMI estimates being obtained from this convenience sample of individuals who visited their healthcare provider for outpatient services can be generalized to the general population of San Diego. Height and weight were transmitted from electronic health records systems to the San Diego Immunization Registry (SDIR). Age, gender, and race/ethnicity of this sample are compared to general population estimates by sub-regional area (SRA) (n = 41) to account for regional demographic differences. A < 10% difference (calculated as the ratio of the differences between the frequencies of a sub-group in this sample and general population estimates obtained from the U.S. Census Bureau) was used to determine representativeness. In 2011, the sample consisted of 352,924 residents aged 2-100 years. The younger age groups (2-11, 12-17 years) and the oldest age group (≥65 years) were representative in 90, 75, and 85% of SRAs, respectively. Furthermore, at least one of the five racial/ethnic groups was represented in 71% of SRAs. This BMI Surveillance System was found to demographically represent some SRAs well, suggesting that this registry-based surveillance system may be useful in estimating and monitoring neighborhood-level BMI data.

  4. Knowledge, Perceptions, and Practice of Nurses on Surveillance of Adverse Events following Childhood Immunization in Nairobi, Kenya

    PubMed Central

    Atieli, Harrysone; Were, Tom


    Background. Although vaccines currently approved for routine childhood immunization are safe and effective, frequent adverse events following immunization often cause illnesses and sometimes loss of public trust in immunization programs. Nurses are essential in this surveillance system. Objective. To determine nurses' knowledge, perception, and practice towards surveillance of postimmunization adverse events within Nairobi County health centers, Kenya. Methods. This is a cross-sectional survey involving nurses (n = 274). Data were collected using self-administered questionnaires. Data analysis was performed using SPSS version 20. Differences in proportions of categorical variables were compared between groups using chi-square tests. Binary logistic regression model was used to compute independent predictors of outcome. Results. 29.2%, 32.1%, and 45.3% of the respondents had good knowledge, good practices, and good perceptions on AEFI surveillance, respectively. Respondents with diploma or degree nursing training level were 1.8 times and 2.5 times more likely to have good knowledge and good perception in AEFI surveillance, respectively. Nurses with previous AEFI training were 9.7 times and 1.8 times more likely to have good AEFI knowledge and practices, respectively. Conclusion. There is a need to train and mentor nurses on AEFI surveillance. Findings of this study will be valuable in informing policy review on childhood immunization programs. PMID:28078288

  5. The X chromosome and immune associated genes.


    Bianchi, Ilaria; Lleo, Ana; Gershwin, M Eric; Invernizzi, Pietro


    The X chromosome is known to contain the largest number of immune-related genes of the whole human genome. For this reason, X chromosome has recently become subject of great interest and attention and numerous studies have been aimed at understanding the role of genes on the X chromosome in triggering and maintaining the autoimmune aggression. Autoimmune diseases are indeed a growing heath burden affecting cumulatively up to 10% of the general population. It is intriguing that most X-linked primary immune deficiencies carry significant autoimmune manifestations, thus illustrating the critical role played by products of single gene located on the X chromosome in the onset, function and homeostasis of the immune system. Again, the plethora of autoimmune stigmata observed in patients with Turner syndrome, a disease due to the lack of one X chromosome or the presence of major X chromosome deletions, indicate that X-linked genes play a unique and major role in autoimmunity. There have been several reports on a role of X chromosome gene dosage through inactivation or duplication in women with autoimmune diseases, for example through a higher rate of circulating cells with a single X chromosome (i.e. with X monosomy). Finally, a challenge for researchers in the coming years will be to dissect the role for the large number of X-linked microRNAs from the perspective of autoimmune disease development. Taken together, X chromosome might well constitute the common trait of the susceptibility to autoimmune diseases, other than to explain the female preponderance of these conditions. This review will focus on the available evidence on X chromosome changes and discuss their potential implications and limitations.

  6. Myeloid-derived suppressor cells (MDSC) facilitate distant metastasis of malignancies by shielding circulating tumor cells (CTC) from immune surveillance.


    Liu, Qiaofei; Liao, Quan; Zhao, Yupei


    The mechanisms of distant metastasis of malignancies largely remain unknown. Circulating tumor cells (CTC) derived from the primary cancer initiate distant metastasis by entering and traversing the bloodstream. Current methods to detect CTC are based on the notion that CTC do not express the common leukocyte antigen CD45. However, these methods neglect the fact that CTC can directly adhere to platelets and immune cells and therefore appear to be CD45-positive. The potential effects of interactions between CTC and adhesive immune cells have been largely overlooked, despite the fact that most CTC are killed by immune effector cells and only those that evade immune surveillance result in clonal expansion and metastatic lesions. It is crucial to define the characteristics that allow a select CTC population to escape immune surveillance; particularly, it must be determined whether interactions between CTC and adhesive immune cells provide a protective effect on CTC survival. If interactions between CTC and adhesive immune cells offer a selective advantage to those CTC cells, the next consideration is which characteristics of a CTC-immune cell population allow sufficient protection to facilitate immune evasion. Myeloid-derived suppressor cells (MDSC) are a large heterogeneous population of immature myeloid cells that accumulate during cancer progression to induce extensively systemic and local immunosuppression, a phenomenon that has been demonstrated to facilitate cancer distant metastasis. We hypothesize, therefore, that CTC populations interacting with adhesive immune cells will have different biological behavior than CTC populations alone. Further, we hypothesize that CTC can create a defensive shield consisting of adhesive MDSC, which allows evasion of immune surveillance and therefore facilitates distant metastatic lesions. This possibility highlights the importance of direct interactions between CTC and adhesive immune cells and suggests the potential target that

  7. Gene gun immunization to combat malaria.


    Bergmann-Leitner, Elke S; Leitner, Wolfgang W


    DNA immunization by gene gun against a variety of infectious diseases has yielded promising results in animal models. Skin-based DNA vaccination against these diseases is not only an attractive option for the clinic but can aid in the discovery and optimization of vaccine candidates. Vaccination against the protozoan parasite Plasmodium presents unique challenges: (a) most parasite-associated antigens are stage-specific; (b) antibodies capable of neutralizing the parasite during the probing of the mosquitoes have to be available at high titers in order to prevent infection of the liver; (c) immunity to liver-stage infection needs to be absolute in order to prevent subsequent blood-stage parasitemia. Gene gun vaccination has successfully been used to prevent the infection of mice with the rodent malaria strain P. berghei and has been employed in a macaque model of human P. falciparum. DNA plasmid delivery by gene gun offers the opportunity to economically and efficiently test novel malaria vaccine candidates and vaccination strategies, which include the evaluation of novel molecular adjuvant strategies. Here we describe the procedures involved in making and delivering a pre-clinical malaria DNA vaccine by gene gun as well as the correct approach for the in vivo evaluation of the vaccine. Furthermore, we discuss various approaches that either have already been tested or could be employed to improve DNA vaccines against malaria.

  8. A comparative assessment of immunization records in the Defense Medical Surveillance System and the Vaccine Adverse Event Reporting System.


    McNeil, Michael M; Ma, Guihua; Aranas, Aaron; Payne, Daniel C; Rose, Charles E


    We compared immunization data in the Defense Medical Surveillance System (DMSS) and immunization data for service members with an anthrax vaccine-associated adverse event reported to the Vaccine Adverse Event Reporting System (VAERS) during January 1998 through December 2004. Our main measure of agreement was sensitivity of the DMSS conditional on an immunization record(s) occurring in VAERS. The sensitivity of DMSS was 73% for all vaccines and 74% for the anthrax vaccine on the VAERS index immunization date. Our study is the first to quantify the agreement between immunization records in VAERS and DMSS. Our data suggest the immunization information in military VAERS reports and the DMSS is similar for anthrax and non-anthrax immunizations.

  9. Expression of immune genes in skin of channel catfish immunized with live theronts of Ichthyophthirius multifiliis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There is limited information on innate and adaptive immune gene expression in the skin of channel catfish, Ictalurus punctatus immunized with Ichthyophthirius multifiliis (Ich). The objective of this study was to evaluate differential expression of innate and adaptive immune genes, including immunog...

  10. Molecular structure of the immunity gene and immunity protein of the bacteriocinogenic plasmid Clo DF13.

    PubMed Central

    van den Elzen, P J; Gaastra, W; Spelt, C E; de Graaf, F K; Veltkamp, E; Nijkamp, H J


    The nucleotide sequence of the Clo DF13 DNA region comprising the immunity gene has been determined. We also elucidated the aminoacid sequence of the 40 N-terminal and 7 C-terminal aminoacids of the purified immunity protein. From analysis of the data obtained we were able to locate the immunity gene between 11.7 and 14.5% on the Clo DF13 map, and to determine the complete aminoacid sequence of the immunity protein. It was observed that the Clo DF13 immunity gene encodes an 85 aminoacid protein and is transcribed in the same direction as the cloacin gene. These experimental data support our model, presented elsewhere, which implicates that the cloacin and immunity genes of Clo DF13 are coordinately transcribed from the cloacin promoter. We also present DNA sequence data indicating that an extra ribosome binding site precedes the immunity gene on the polycistronic mRNA. This ribosome binding site might explain the fact that in cloacinogenic cells more immunity protein than cloacin is synthesized. The comparison of the complete aminoacid sequence of the Clo DF13 immunity protein, with the aminoacid sequence data of the purified, comparable Col E3 immunity protein revealed that both proteins have extensive homologies in primary and secondary structure, although they are exchangeable only to a low extent in vivo and in vitro. It was also observed that a lysine residue was modified in immunity protein isolated from excreted bacteriocin complexes. Images PMID:6253914

  11. Age-related changes in natural killer cell repertoires: impact on NK cell function and immune surveillance.


    Manser, Angela R; Uhrberg, Markus


    A key feature of human natural killer (NK) cells, which enables efficient recognition of infected and malignant target cells, is the expression of HLA class I-specific receptors of the KIR and NKG2 gene families. Cell-to-cell variability in receptor expression leads to the formation of complex NK cell repertoires. As outlined here, NK cells go through major changes from newborns to adults characterized by downregulation of the inhibitory NKG2A receptor and concomitant upregulation of KIR family members. This process is completed in young adults, and in the majority of individuals, KIR/NKG2A repertoires remain remarkably stable until old age. Nonetheless, age-related factors have the potential to majorly influence the complexity of NK cell repertoires: Firstly infection with HCMV is associated with major clonal expansions of terminally differentiated NKG2C- and KIR-expressing NK cells in certain individuals. Secondly, ineffective hematopoiesis can lead to immature and less diversified NK cell repertoires as observed in myelodysplastic syndrome (MDS), a malignant disease of the elderly. Thus, whereas in the majority of elderly the NK cell compartment appears to be highly stable in terms of function and phenotype, in a minority of subjects a breakdown of NK cell repertoire diversity is observed that might influence immune surveillance and healthy aging.

  12. Immune function genes, genetics, and the neurobiology of addiction.


    Crews, Fulton T


    The neuroimmune system (i.e., the immune system and those components of the nervous system that help regulate immune responses), and in particular the innate immune system, play a role in the development of addictions, including alcoholism, particularly in the context of stressful situations. Certain cells of the neuroimmune system are activated both by stress and by environmental factors such as alcohol, resulting in the induction of genes involved in innate immunity. One of the molecules mediating this gene induction is a regulatory protein called nuclear factor-κB, which activates many innate immune genes. Innate immune gene induction in certain brain regions (e.g., the frontal cortex), in turn, can disrupt decision making, which is a characteristic of addiction to alcohol and other drugs. Likewise, altered neuroimmune signaling processes are linked to alcohol-induced negative affect and depression-like behaviors and also regulate alcohol-drinking behavior. Moreover, the expression of several genes and proteins involved in innate immunity is enhanced in addicted people. Finally, specific variants of multiple innate immune genes are associated with the genetic risk for alcoholism in humans, further strengthening the connection between increased brain innate immune gene expression and alcohol addiction.

  13. CD147 stimulates hepatoma cells escaping from immune surveillance of T cells by interaction with Cyclophilin A.


    Ren, Yi-Xin; Wang, Shu-Jing; Fan, Jian-Hui; Sun, Shi-Jie; Li, Xia; Padhiar, Arshad Ahmed; Zhang, Jia-Ning


    T cells play an important role in tumor immune surveillance. CD147 is a member of immunoglobulin superfamily present on the surface of many tumor cells and mediates malignant cell behaviors. Cyclophilin A (CypA) is an intracellular protein promoting inflammation when released from cells. CypA is a natural ligand for CD147. In this study, CD147 specific short hairpin RNAs (shRNA) were transfected into murine hepatocellular carcinoma Hepa1-6 cells to assess the effects of CD147 on hepatoma cells escaping from immune surveillance of T cells. We found extracellular CypA stimulated cell proliferation through CD147 by activating ERK1/2 signaling pathway. Downregulation of CD147 expression on Hepa1-6 cells significantly suppressed tumor progression in vivo, and decreased cell viability when co-cultured with T cells in vitro. Importantly, knockdown of CD147 on Hepa1-6 cells resulted in significantly increased T cells chemotaxis induced by CypA both in vivo and in vitro. These findings provide novel mechanisms how tumor cells escaping from immune surveillance of T cells. We provide a potential therapy for hepatocellular carcinoma by targeting CD147 or CD147-CypA interactions.

  14. [Surveillance system for adverse events following immunization against yellow fever in Burkina Faso in 2008. Good practice recommendations].


    Yaméogo, T M; Breugelmans, J G; Kambou, J L; Badolo, O; Tiendrebéogo, S; Traoré, E; Avokey, F; Yactayo, S


    Yellow fever (YF) remains a public health problem in Africa. In 2007 and 2008, Togo, Senegal, Mali and Burkina Faso became the first countries to implement mass YF immunization campaigns within the framework of the Yellow Fever Initiative. The goal of this initiative led by the World Health Organization (WHO) and the United Nations Children's Fund (UNICEF) with the support of The Global Alliance for Vaccines and Immunization (GAVI) is to organize mass YF immunization campaigns in 12 African countries at high risk forYF transmission between 2006 and 2013. A total of 290 million USD have been allocated for vaccination of 180 million people with the highly effective attenuated 17DYF vaccine. Working in partnership with the WHO, the 12 member states are to identify and target high risk areas with the dual aim of preventing epidemics and increasing immunization coverage. Surveillance of adverse events following immunization (AEFI) is a mandatory component for organization of these campaigns. Purpose. The purpose of this article is to describe the AEFI surveillance system implemented in Burkina Faso in 2008. Methods. The strategy used in Burkina Faso was based on a combination of regular passive surveillance and active surveillance. General guidelines and related operational processes were established including reporting forms, investigation forms, and procedures for collection, storage and transport of biological specimens. Classification of cases was based on clearly defined criteria. Any patient meeting the defined criteria and requiring hospitalization was considered as a serious case. In addition to case definition criteria, serious cases were tracked according to presented signs and symptoms using a line-listing form at two university hospital centers in Ouagadougou and one regional hospital center. Emergency room admission records and patient charts were examined during the surveillance period (30 days after the end of the immunization campaign) and on

  15. Forewarning of Poliovirus Outbreaks in the Horn of Africa: An Assessment of Acute Flaccid Paralysis Surveillance and Routine Immunization Systems in Kenya

    PubMed Central

    Walker, Allison Taylor; Sodha, Samir; Warren, Wick C.; Sergon, Kibet; Kiptoon, Shem; Ogange, John; Ahmeda, Abdi Hassan; Eshetu, Messeret; Corkum, Melissa; Pillai, Satish; Scobie, Heather; Mdodo, Rennatus; Tack, Danielle M.; Halldin, Cara; Appelgren, Kristie; Kretsinger, Katrina; Bensyl, Diana M.; Njeru, Ian; Kolongei, Titus; Muigai, Juliet; Ismail, Amina; Okiror, Samuel O.


    Background Although the Horn of Africa region has successfully eliminated endemic poliovirus circulation, it remains at risk for reintroduction. International partners assisted Kenya in identifying gaps in the polio surveillance and routine immunization programs, and provided recommendations for improved surveillance and routine immunization during the health system decentralization process. Methods Structured questionnaires collected information about acute flaccid paralysis (AFP) surveillance resources, training, data monitoring, and supervision at provincial, district, and health facility levels. The routine immunization program information collected included questions about vaccine and resource availability, cold chain, logistics, health-care services and access, outreach coverage data, microplanning, and management and monitoring of AFP surveillance. Results Although AFP surveillance met national performance standards, widespread deficiencies and limited resources were observed and reported at all levels. Deficiencies were related to provider knowledge, funding, training, and supervision, and were particularly evident at the health facility level. Conclusions Gap analysis assists in maximizing resources and capacity building in countries where surveillance and routine immunization lag behind other health priorities. Limited resources for surveillance and routine immunization systems in the region indicate a risk for additional outbreaks of wild poliovirus and other vaccine-preventable illnesses. Monitoring and evaluation of program strengthening activities are needed. PMID:25316880

  16. Cervical Carcinogenesis and Immune Response Gene Polymorphisms: A Review

    PubMed Central

    Mooij, Merel


    The local immune response is considered a key determinant in cervical carcinogenesis after persistent infection with oncogenic, high-risk human papillomavirus (HPV) infections. Genetic variation in various immune response genes has been shown to influence risk of developing cervical cancer, as well as progression and survival among cervical cancer patients. We reviewed the literature on associations of immunogenetic single nucleotide polymorphism, allele, genotype, and haplotype distributions with risk and progression of cervical cancer. Studies on HLA and KIR gene polymorphisms were excluded due to the abundance on literature on that subject. We show that multiple genes and loci are associated with variation in risk of cervical cancer. Rather than one single gene being responsible for cervical carcinogenesis, we postulate that variations in the different immune response genes lead to subtle differences in the effectiveness of the antiviral and antitumour immune responses, ultimately leading to differences in risk of developing cervical cancer and progressive disease after HPV infection. PMID:28280748

  17. Advances in Overcoming Immune Responses following Hemophilia Gene Therapy

    PubMed Central

    Miao, Carol H.


    Both Clinical trials and pre-clinical experiments for hemophilia gene therapy showed that it is important to overcome potential immune responses against gene transfer vectors and/or transgene products to ensure the success of gene therapy. Recently various approaches have been investigated to prevent or modulate such responses. Gene transfer vectors have been specifically engineered and immunosuppressive regimens have been administered to avoid or manipulate the immune responses against the vectors. In order to prevent cytotoxic lymphocyte or antibody formation induced by transgene expression, novel approaches have been developed, including methods to manipulate antigen presentation, development of variant genes encoding less immunogenic proteins or gene transfer protocols to evade immune responses, as well as immunosuppressive strategies to target either T and/or B cell responses. Most of these successful protocols involve the induction of activated regulatory T cells to create a regulatory immune environment during tolerance induction. Recent development of these strategies to evade vector-specific immune responses and induce long-term immune tolerance specific to the transgene product will be discussed. PMID:22737594

  18. Tolerability of modified tick-borne encephalitis vaccine FSME-IMMUN "NEW" in children: results of post-marketing surveillance.


    Pavlova, Borislava G; Loew-Baselli, Alexandra; Fritsch, Sandor; Poellabauer, Eva Maria; Vartian, Nina; Rinke, Ingeborg; Ehrlich, Hartmut J


    A new, highly purified, inactivated tick-borne encephalitis (TBE) vaccine FSME-IMMUN "NEW" has been developed by Baxter using a production virus seed derived from chick embryo cells instead of mouse brain. In clinical trials, the vaccine was shown to be highly immunogenic and well tolerated in adults and children. Following licensure in 2001, the tolerability of half the adult dose of FSME-IMMUN "NEW" (1.2 microg antigen/0.25 ml) was investigated in a post-marketing surveillance in 1899 children aged 6 months to 12 years. Rectal body temperature was measured daily for 3 days after the first vaccination. An overall fever rate of 20.3% (95% CI=18.5; 22%) was observed, which was mostly mild in nature (>38.0 to surveillance population). These results demonstrated that, in routine medical practice, FSME-IMMUN "NEW" vaccine at a dose of 1.2 microg antigen/0.25 ml is safe for the first vaccination in children.

  19. Crystal structure of the RNA-guided immune surveillance Cascade complex in Escherichia coli.


    Zhao, Hongtu; Sheng, Gang; Wang, Jiuyu; Wang, Min; Bunkoczi, Gabor; Gong, Weimin; Wei, Zhiyi; Wang, Yanli


    Clustered regularly interspaced short palindromic repeats (CRISPR) together with CRISPR-associated (Cas) proteins form the CRISPR/Cas system to defend against foreign nucleic acids of bacterial and archaeal origin. In the I-E subtype CRISPR/Cas system, eleven subunits from five Cas proteins (CasA1B2C6D1E1) assemble along a CRISPR RNA (crRNA) to form the Cascade complex. Here we report on the 3.05 Å crystal structure of the 405-kilodalton Escherichia coli Cascade complex that provides molecular details beyond those available from earlier lower-resolution cryo-electron microscopy structures. The bound 61-nucleotide crRNA spans the entire 11-protein subunit-containing complex, where it interacts with all six CasC subunits (named CasC1-6), with its 5' and 3' terminal repeats anchored by CasD and CasE, respectively. The crRNA spacer region is positioned along a continuous groove on the concave surface generated by the aligned CasC1-6 subunits. The five long β-hairpins that project from individual CasC2-6 subunits extend across the crRNA, with each β-hairpin inserting into the gap between the last stacked base and its adjacent splayed counterpart, and positioned within the groove of the preceding CasC subunit. Therefore, instead of continuously stacking, the crRNA spacer region is divided into five equal fragments, with each fragment containing five stacked bases flanked by one flipped-out base. Each of those crRNA spacer fragments interacts with CasC in a similar fashion. Furthermore, our structure explains why the seed sequence, with its outward-directed bases, has a critical role in target DNA recognition. In conclusion, our structure of the Cascade complex provides novel molecular details of protein-protein and protein-RNA alignments and interactions required for generation of a complex mediating RNA-guided immune surveillance.

  20. Autochthonous primary and metastatic melanomas in Hgf-Cdk4 R24C mice evade T-cell-mediated immune surveillance.


    Landsberg, Jennifer; Gaffal, Evelyn; Cron, Mira; Kohlmeyer, Judith; Renn, Marcel; Tüting, Thomas


    Genetically engineered mouse models offer new opportunities to investigate the role of cell-mediated immunity in the natural progression of melanoma in an immunocompetent host. Here we report that Hgf-Cdk4(R24C) mice spontaneously develop a spectrum of primary melanomas with high penetrance during their first year of life. Malignant transformation proceeds in a stepwise manner from multiple melanocytic nevi to single nodular melanomas and disseminated metastases in most mice. Migrating melanoma cells invade the draining lymph nodes without activating the immune system. Autochthonous primary tumors are destroyed following experimental introduction of immune surveillance using an adoptive lymphocyte transfer approach. However, some tumor cells are able to survive, evade immune cell control, and recur both locally and systemically. Immune tolerance in recurring tumors may be supported by immunosuppressive Gr1(+) myeloid cells. Taken together, our results demonstrate that primary and metastatic melanomas developing spontaneously in Hgf-Cdk4(R24C) mice effectively evade cellular immune surveillance.

  1. The Innate Immune-Related Genes in Catfish

    PubMed Central

    Gao, Lei; He, Chongbo; Liu, Xueguang; Su, Hao; Gao, Xianggang; Li, Yunfeng; Liu, Weidong


    Catfish is one of the most important aquaculture species in America (as well as in Asia and Africa). In recent years, the production of catfish has suffered massive financial losses due to pathogen spread and breakouts. Innate immunity plays a crucial role in increasing resistance to pathogenic organisms and has generated increasing interest in the past few years. This review summarizes the current understanding of innate immune-related genes in catfish, including pattern recognition receptors, antimicrobial peptides, complements, lectins, cytokines, transferrin and gene expression profiling using microarrays and next generation sequencing technologies. This review will benefit the understanding of innate immune system in catfish and further efforts in studying the innate immune-related genes in fish. PMID:23203058

  2. Spatiotemporally restricted arenavirus replication induces immune surveillance and type I interferon-dependent tumour regression

    PubMed Central

    Kalkavan, Halime; Sharma, Piyush; Kasper, Stefan; Helfrich, Iris; Pandyra, Aleksandra A.; Gassa, Asmae; Virchow, Isabel; Flatz, Lukas; Brandenburg, Tim; Namineni, Sukumar; Heikenwalder, Mathias; Höchst, Bastian; Knolle, Percy A.; Wollmann, Guido; von Laer, Dorothee; Drexler, Ingo; Rathbun, Jessica; Cannon, Paula M.; Scheu, Stefanie; Bauer, Jens; Chauhan, Jagat; Häussinger, Dieter; Willimsky, Gerald; Löhning, Max; Schadendorf, Dirk; Brandau, Sven; Schuler, Martin; Lang, Philipp A.; Lang, Karl S.


    Immune-mediated effector molecules can limit cancer growth, but lack of sustained immune activation in the tumour microenvironment restricts antitumour immunity. New therapeutic approaches that induce a strong and prolonged immune activation would represent a major immunotherapeutic advance. Here we show that the arenaviruses lymphocytic choriomeningitis virus (LCMV) and the clinically used Junin virus vaccine (Candid#1) preferentially replicate in tumour cells in a variety of murine and human cancer models. Viral replication leads to prolonged local immune activation, rapid regression of localized and metastatic cancers, and long-term disease control. Mechanistically, LCMV induces antitumour immunity, which depends on the recruitment of interferon-producing Ly6C+ monocytes and additionally enhances tumour-specific CD8+ T cells. In comparison with other clinically evaluated oncolytic viruses and to PD-1 blockade, LCMV treatment shows promising antitumoural benefits. In conclusion, therapeutically administered arenavirus replicates in cancer cells and induces tumour regression by enhancing local immune responses. PMID:28248314

  3. The heterogeneous immune microenvironment in breast cancer is affected by hypoxia-related genes.


    Duechler, Markus; Peczek, Lukasz; Zuk, Karolina; Zalesna, Izabela; Jeziorski, Arkadiusz; Czyz, Malgorzata


    The immune system constitutes an important first-line defence against malignant transformation. However, cancer mediated immunosuppression inactivates the mechanisms of host immune surveillance. Cancer cells shut down anti-cancer immunity through direct cell-cell interactions with leukocytes and through soluble factors, establishing an immunosuppressive environment for unimpeded cancer growth. The composition of the immunosuppressive microenvironment in breast tumours is not well documented. To address this question, selected immunosuppressive factors were analyzed in tumour specimens from 33 breast cancer patients after surgery. The mRNA expression of selected genes was quantified in fresh tumour samples. Tumour infiltrating leukocytes were characterized by flow cytometry to identify regulatory T cells, myeloid derived suppressor cells, and type 2 macrophages. Statistical analysis revealed several interesting correlations between the studied parameters and clinical features. Overall, a surprisingly high degree of heterogeneity in the composition of the immunosuppressive environment was found across all breast cancer samples which adds to the complexity of this disease. The influence of the hypoxia inducible factors (HIFs) on the immune microenvironment was also addressed. The level of HIFs correlated with hormone receptor status and the expression of several immunosuppressive molecules. Targeting HIFs might not only sensitize breast tumours for radiation and chemotherapies but also interfere with cancer immunosuppression.

  4. Population Genetics of Anopheles coluzzii Immune Pathways and Genes

    PubMed Central

    Rottschaefer, Susan M.; Crawford, Jacob E.; Riehle, Michelle M.; Guelbeogo, Wamdaogo M.; Gneme, Awa; Sagnon, N’Fale; Vernick, Kenneth D.; Lazzaro, Brian P.


    Natural selection is expected to drive adaptive evolution in genes involved in host–pathogen interactions. In this study, we use molecular population genetic analyses to understand how natural selection operates on the immune system of Anopheles coluzzii (formerly A. gambiae “M form”). We analyzed patterns of intraspecific and interspecific genetic variation in 20 immune-related genes and 17 nonimmune genes from a wild population of A. coluzzii and asked if patterns of genetic variation in the immune genes are consistent with pathogen-driven selection shaping the evolution of defense. We found evidence of a balanced polymorphism in CTLMA2, which encodes a C-type lectin involved in regulation of the melanization response. The two CTLMA2 haplotypes, which are distinguished by fixed amino acid differences near the predicted peptide cleavage site, are also segregating in the sister species A. gambiae (“S form”) and A. arabiensis. Comparison of the two haplotypes between species indicates that they were not shared among the species through introgression, but rather that they arose before the species divergence and have been adaptively maintained as a balanced polymorphism in all three species. We additionally found that STAT-B, a retroduplicate of STAT-A, shows strong evidence of adaptive evolution that is consistent with neofunctionalization after duplication. In contrast to the striking patterns of adaptive evolution observed in these Anopheles-specific immune genes, we found no evidence of adaptive evolution in the Toll and Imd innate immune pathways that are orthologously conserved throughout insects. Genes encoding the Imd pathway exhibit high rates of amino acid divergence between Anopheles species but also display elevated amino acid diversity that is consistent with relaxed purifying selection. These results indicate that adaptive coevolution between A. coluzzii and its pathogens is more likely to involve novel or lineage-specific molecular mechanisms

  5. big bang gene modulates gut immune tolerance in Drosophila.


    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc


    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  6. Regulation of cytokine gene transcription in the immune system.


    Holloway, A F; Rao, S; Shannon, M F


    The controlled expression of cytokine genes is an essential component of an immune response. The specific types of cytokines as well as the time and place of their production is important in generating an appropriate immune response to an infectious agent. Aberrant expression is associated with pathological conditions of the immune system such as autoimmunity, atopy and chronic inflammation. Cytokine gene transcription is generally induced in a cell-specific manner. Over the last 15 years, a large amount of information has been generated describing the transcriptional controls that are exerted on cytokine genes. Recently, efforts have been directed at understanding how these genes are transcribed in a chromatin context. This review will discuss the mechanisms by which cytokine genes become available for transcription in a cell-restricted manner as well as the mechanisms by which these genes sense their environment and activate high level transcription in a transient manner. Particular attention will be paid to the role of chromatin in allowing transcription factor access to appropriate genes.

  7. Gene therapy for primary adaptive immune deficiencies.


    Fischer, Alain; Hacein-Bey-Abina, Salima; Cavazzana-Calvo, Marina


    Gene therapy has become an option for the treatment of 2 forms of severe combined immunodeficiency (SCID): X-linked SCID and adenosine deaminase deficiency. The results of clinical trials initiated more than 10 years ago testify to sustained and reproducible correction of the underlying T-cell immunodeficiency. Successful treatment is based on the selective advantage conferred on T-cell precursors through their expression of the therapeutic transgene. However, "first-generation" retroviral vectors also caused leukemia in some patients with X-linked SCID because of the constructs' tendency to insert into active genes (eg, proto-oncogenes) in progenitor cells and transactivate an oncogene through a viral element in the long terminal repeat. These elements have been deleted from the vectors now in use. Together with the use of lentiviral vectors (which are more potent for transducing stem cells), these advances should provide a basis for the safe and effective extension of gene therapy's indications in the field of primary immunodeficiencies. Nevertheless, this extension will have to be proved by examining the results of the ongoing clinical trials.

  8. Squamous cell carcinomas escape immune surveillance via inducing chronic activation and exhaustion of CD8+ T Cells co-expressing PD-1 and LAG-3 inhibitory receptors

    PubMed Central

    Mishra, Ameet K.; Kadoishi, Tanya; Wang, Xiaoguang; Driver, Emily; Chen, Zhangguo; Wang, Xiao-Jing; Wang, Jing H.


    Squamous cell carcinoma (SCC) is the second commonest type of skin cancer. Moreover, about 90% of head and neck cancers are SCCs. SCCs develop at a significantly higher rate under chronic immunosuppressive conditions, implicating a role of immune surveillance in controlling SCCs. It remains largely unknown how SCCs evade immune recognition. Here, we established a mouse model by injecting tumor cells derived from primary SCCs harboring KrasG12D mutation and Smad4 deletion into wild-type (wt) or CD8−/− recipients. We found comparable tumor growth between wt and CD8−/− recipients, indicating a complete escape of CD8+ T cell-mediated anti-tumor responses by these SCCs. Mechanistically, CD8+ T cells apparently were not defective in infiltrating tumors given their relatively increased percentage among tumor infiltrating lymphocytes (TILs). CD8+ TILs exhibited phenotypes of chronic activation and exhaustion, including overexpression of activation markers, co-expression of programmed cell death 1 (PD-1) and lymphocyte activation gene-3 (LAG-3), as well as TCRβ downregulation. Among CD4+ TILs, T regulatory cells (Tregs) were preferentially expanded. Contradictory to prior findings in melanoma, Treg expansion was independent of CD8+ T cells in our SCC model. Unexpectedly, CD8+ T cells were required for promoting NK cell infiltration within SCCs. Furthermore, we uncovered AKT-dependent lymphocyte-induced PD-L1 upregulation on SCCs, which was contributed greatly by combinatorial effects of CD8+ T and NK cells. Lastly, dual blockade of PD-1 and LAG-3 inhibited the tumor growth of SCCs. Thus, our findings identify novel immune evasion mechanisms of SCCs and suggest that immunosuppressive mechanisms operate in a cancer-type specific and context-dependent manner. PMID:27835902

  9. Squamous cell carcinomas escape immune surveillance via inducing chronic activation and exhaustion of CD8+ T Cells co-expressing PD-1 and LAG-3 inhibitory receptors.


    Mishra, Ameet K; Kadoishi, Tanya; Wang, Xiaoguang; Driver, Emily; Chen, Zhangguo; Wang, Xiao-Jing; Wang, Jing H


    Squamous cell carcinoma (SCC) is the second commonest type of skin cancer. Moreover, about 90% of head and neck cancers are SCCs. SCCs develop at a significantly higher rate under chronic immunosuppressive conditions, implicating a role of immune surveillance in controlling SCCs. It remains largely unknown how SCCs evade immune recognition. Here, we established a mouse model by injecting tumor cells derived from primary SCCs harboring KrasG12D mutation and Smad4 deletion into wild-type (wt) or CD8-/- recipients. We found comparable tumor growth between wt and CD8-/- recipients, indicating a complete escape of CD8+ T cell-mediated anti-tumor responses by these SCCs. Mechanistically, CD8+ T cells apparently were not defective in infiltrating tumors given their relatively increased percentage among tumor infiltrating lymphocytes (TILs). CD8+ TILs exhibited phenotypes of chronic activation and exhaustion, including overexpression of activation markers, co-expression of programmed cell death 1 (PD-1) and lymphocyte activation gene-3 (LAG-3), as well as TCRβ downregulation. Among CD4+ TILs, T regulatory cells (Tregs) were preferentially expanded. Contradictory to prior findings in melanoma, Treg expansion was independent of CD8+ T cells in our SCC model. Unexpectedly, CD8+ T cells were required for promoting NK cell infiltration within SCCs. Furthermore, we uncovered AKT-dependent lymphocyte-induced PD-L1 upregulation on SCCs, which was contributed greatly by combinatorial effects of CD8+ T and NK cells. Lastly, dual blockade of PD-1 and LAG-3 inhibited the tumor growth of SCCs. Thus, our findings identify novel immune evasion mechanisms of SCCs and suggest that immunosuppressive mechanisms operate in a cancer-type specific and context-dependent manner.

  10. Genetic determinants of HIV-1 infection and progression to AIDS: immune response genes.


    Kaur, G; Mehra, N


    Genomic studies involving well-defined multicenter cohorts of HIV-1/AIDS covering multiple populations have led to a greater understanding of the role of host determinants in viral acquisition, disease progression, transmission, and response to anti-retroviral therapy. Similarly, recent knowledge on the virus genetic diversity has helped in elucidating mechanisms leading to the evolution of viral escape mutants and the role played by host immune determinants, in particular the major histocompatibility complex (MHC) associated genes. At least two alleles, HLA-B*27 and B*57, have been identified as 'protective' against HIV-1 while B*35 and B*53 act as susceptibility favoring factors. How human leukocyte antigen (HLA)-mediated selection drives the evolution of HIV-1 and which circulating variants are more likely to evade immune surveillance of the population are now beginning to become clear. Importantly, the rare HLA alleles in a population bear a selective advantage to the host because these can induce immune responses against pre-adapted viruses. It is conceivable that previously established protective HLA associations are shifting with the evolving cytotoxic T lymphocyte (CTL) epitopes and may not remain protective in future. At the same time, this process is unraveling novel sub-dominant epitopes of the virus which could now be incorporated as the dominant target CTL epitopes. An insight into the population-specific correlates of protection is hence necessary for designing future anti-HIV therapeutic and/or prophylactic vaccine formulation(s).

  11. Environmental cues orchestrate regional immune surveillance and protection by pulmonary CTLs.


    Cauley, Linda S


    Tissue-resident memory CD8 T cells (TRM) provide preemptive immunity against infections that begin in peripheral tissues by guarding the site of initial pathogen exposure. Their role in immunity to respiratory virus infection is particularly important because severe damage to the alveoli can be avoided when local populations of TRM cells reduce viral burdens and dampen the responses of effector CD8 T cells in the lungs. Although a connection between rapid immune activation and early viral control is well established, the signals that keep TRM cells poised for action in the local tissues remain poorly defined. Recent studies have shown that environmental cues influence the fate decisions of activated CTLs during memory formation. Manipulation of these signaling pathways could provide new ways to capitalize on protection from TRM cells in mucosal tissues, while reducing collateral damage and pathology during vaccination.

  12. Role of Trypanosoma cruzi Trans-sialidase on the Escape from Host Immune Surveillance

    PubMed Central

    Nardy, Ana F. F. R.; Freire-de-Lima, Celio G.; Pérez, Ana R.; Morrot, Alexandre


    Chagas disease is caused by the flagellate protozoan Trypanosoma cruzi, affecting millions of people throughout Latin America. The parasite dampens host immune response causing modifications in diverse lymphoid compartments, including the thymus. T. cruzi trans-sialidase (TS) seems to play a fundamental role in such immunopathological events. This unusual enzyme catalyses the transference of sialic acid molecules from host glycoconjugates to acceptor molecules placed on the parasite surface. TS activity mediates several biological effects leading to the subversion of host immune system, hence favoring both parasite survival and the establishment of chronic infection. This review summarizes current findings on the roles of TS in the immune response during T. cruzi infection. PMID:27047464

  13. Effect of Recombination in the Evolutionary Dynamics of HIV under the Surveillance of Immune System

    NASA Astrophysics Data System (ADS)

    Peng, Weiqun; Yang, Wenjing; Wang, Guanyu


    Human immunodeficiency virus (HIV) is a retrovirus that causes acquired immunodeficiency syndrome (AIDS), which has become one of the most destructive pandemics in history. The fact that HIV virus evolves very fast plays a central role in AIDS immunopathogenesis and the difficulty we face in finding a cure or a vaccine for AIDS. A distinguishing feature of HIV is its high frequency of recombination. The effect of recombination in the HIV evolution is not clear. We establish a mathematical model of the evolutionary dynamics. This model incorporates both point mutation and recombination for genetic diversity, and employs a fitness function developed by Wang and Deem (PRL 97, 188106, 2006) that accounts for the effect of immune system. Using this model, we explore the role of recombination in the battle between the virus population and the immune system, with a special focus on the condition under which recombination helps the virus population to escape from the immune system.

  14. The evolution of secondary organization in immune system gene libraries

    SciTech Connect

    Hightower, R.; Forrest, S.; Perelson, A.S.


    A binary model of the immune system is used to study the effects of evolution on the genetic encoding for antibody molecules. We report experiments which show that the evolution of immune system genes, simulated by the genetic algorithm, can induce a high degree of genetic organization even though that organization is not explicitly required by the fitness function. This secondary organization is related to the true fitness of an individual, in contrast to the sampled fitness which is the explicit fitness measure used to drive the process of evolution.

  15. Importance of immune response genes in hemophilia A

    PubMed Central

    de Alencar, Josiane Bazzo; Macedo, Luciana Conci; de Barros, Morgana Ferreira; Rodrigues, Camila; Cadide, Renata Campos; Sell, Ana Maria; Visentainer, Jeane Eliete Laguila


    Hemophilia A is a disease caused by a deficiency of coagulation factor VIII resulting from genetic inheritance linked to chromosome X. One treatment option is the administration of plasma or recombinant FVIII. However, some patients develop inhibitors or antibodies against this factor. Inhibitors are alloantibodies that bind to the epitope of factor VIII causing it to be recognized by the immune system as a foreign peptide. This is the most serious complication in hemophilia patients in respect to replacement therapy. Some studies have suggested that genetic factors influence the development of factor VIII inhibitors such as ethnicity, family history, mutations in the factor VIII gene and in genes of the immune system. The aim of this study was to conduct a literature review to assess the influence of genetic factors of immune response genes, especially genes of the major histocompatibility complex and cytokines, which may be related to the development of factor VIII inhibitors in hemophilia A patients. Understanding these risk factors will help to determine future differential treatment in the control and prevention of the development of inhibitors. PMID:24106448

  16. Cadm1 is a metastasis susceptibility gene that suppresses metastasis by modifying tumor interaction with the cell-mediated immunity.


    Faraji, Farhoud; Pang, Yanli; Walker, Renard C; Nieves Borges, Rosan; Yang, Li; Hunter, Kent W


    Metastasis is a complex process utilizing both tumor-cell-autonomous properties and host-derived factors, including cellular immunity. We have previously shown that germline polymorphisms can modify tumor cell metastatic capabilities through cell-autonomous mechanisms. However, how metastasis susceptibility genes interact with the tumor stroma is incompletely understood. Here, we employ a complex genetic screen to identify Cadm1 as a novel modifier of metastasis. We demonstrate that Cadm1 can specifically suppress metastasis without affecting primary tumor growth. Unexpectedly, Cadm1 did not alter tumor-cell-autonomous properties such as proliferation or invasion, but required the host's adaptive immune system to affect metastasis. The metastasis-suppressing effect of Cadm1 was lost in mice lacking T cell-mediated immunity, which was partially phenocopied by depleting CD8(+) T cells in immune-competent mice. Our data show a novel function for Cadm1 in suppressing metastasis by sensitizing tumor cells to immune surveillance mechanisms, and this is the first report of a heritable metastasis susceptibility gene engaging tumor non-autonomous factors.

  17. B lymphocyte immune response gene phenotype is genetically determined

    SciTech Connect

    Tse, H.Y.; Mond, J.J.; Longo, D.L.


    We examined the effects of the developmental milieu on the capacity of B cells to undergo immune response gene-controlled, T cell-dependent polyclonal proliferation. Although I-Aq poly(Glu60 Ala30 Tyr10)n (GAT)-nonresponder T cells developing in a responder environment become phenotypic GAT-responders, I-Aq B cells remain unresponsive to GAT, even after maturation in a GAT-responder animal. Conversely, (B10.A x B10.Q)F1 ((GAT responder x GAT nonresponder)F1) T cells developing in a B10.Q GAT nonresponder host fail to respond to GAT, but F1 B cells from the same F1 leads to parent chimeras make excellent proliferative responses in the presence of GAT and responder T cells. Thus, by this assay, B cell immune response gene function is genetically determined and is not affected by the developmental milieu.

  18. Passive immunization against HIV/AIDS by antibody gene transfer.


    Yang, Lili; Wang, Pin


    Despite tremendous efforts over the course of many years, the quest for an effective HIV vaccine by the classical method of active immunization remains largely elusive. However, two recent studies in mice and macaques have now demonstrated a new strategy designated as Vectored ImmunoProphylaxis (VIP), which involves passive immunization by viral vector-mediated delivery of genes encoding broadly neutralizing antibodies (bnAbs) for in vivo expression. Robust protection against virus infection was observed in preclinical settings when animals were given VIP to express monoclonal neutralizing antibodies. This unorthodox approach raises new promise for combating the ongoing global HIV pandemic. In this article, we survey the status of antibody gene transfer, review the revolutionary progress on isolation of extremely bnAbs, detail VIP experiments against HIV and its related virus conduced in humanized mice and macaque monkeys, and discuss the pros and cons of VIP and its opportunities and challenges towards clinical applications to control HIV/AIDS endemics.

  19. Survival and Intra-Nuclear Trafficking of Burkholderia pseudomallei: Strategies of Evasion from Immune Surveillance?

    PubMed Central

    Vadivelu, Jamuna; Vellasamy, Kumutha Malar; Thimma, Jaikumar; Mariappan, Vanitha; Kang, Wen-Tyng; Choh, Leang-Chung; Wong, Kum Thong


    Background During infection, successful bacterial clearance is achieved via the host immune system acting in conjunction with appropriate antibiotic therapy. However, it still remains a tip of the iceberg as to where persistent pathogens namely, Burkholderia pseudomallei (B. pseudomallei) reside/hide to escape from host immune sensors and antimicrobial pressure. Methods We used transmission electron microscopy (TEM) to investigate post-mortem tissue sections of patients with clinical melioidosis to identify the localisation of a recently identified gut microbiome, B. pseudomallei within host cells. The intranuclear presence of B. pseudomallei was confirmed using transmission electron microscopy (TEM) of experimentally infected guinea pig spleen tissues and Live Z-stack, and ImageJ analysis of fluorescence microscopy analysis of in vitro infection of A549 human lung epithelial cells. Results TEM investigations revealed intranuclear localization of B. pseudomallei in cells of infected human lung and guinea pig spleen tissues. We also found that B. pseudomallei induced actin polymerization following infection of A549 human lung epithelial cells. Infected A549 lung epithelial cells using 3D-Laser scanning confocal microscopy (LSCM) and immunofluorescence microscopy confirmed the intranuclear localization of B. pseudomallei. Conclusion B. pseudomallei was found within the nuclear compartment of host cells. The nucleus may play a role as an occult or transient niche for persistence of intracellular pathogens, potentially leading to recurrrent episodes or recrudescence of infection. PMID:28045926

  20. How is the effectiveness of immune surveillance impacted by the spatial distribution of spreading infections?

    PubMed Central

    Kadolsky, Ulrich D.; Yates, Andrew J.


    What effect does the spatial distribution of infected cells have on the efficiency of their removal by immune cells, such as cytotoxic T lymphocytes (CTL)? If infected cells spread in clusters, CTL may initially be slow to locate them but subsequently kill more rapidly than in diffuse infections. We address this question using stochastic, spatially explicit models of CTL interacting with different patterns of infection. Rather than the effector : target ratio, we show that the relevant quantity is the ratio of a CTL's expected time to locate its next target (search time) to the average time it spends conjugated with a target that it is killing (handling time). For inefficient (slow) CTL, when the search time is always limiting, the critical density of CTL (that required to control 50% of infections, C*) is independent of the spatial distribution and derives from simple mass-action kinetics. For more efficient CTL such that handling time becomes limiting, mass-action underestimates C*, and the more clustered an infection the greater is C*. If CTL migrate chemotactically towards targets the converse holds—C* falls, and clustered infections are controlled most efficiently. Real infections are likely to spread patchily; this combined with even weak chemotaxis means that sterilizing immunity may be achieved with substantially lower numbers of CTL than standard models predict. PMID:26150655

  1. The Nuclear Orphan Receptor NR2F6 Is a Central Checkpoint for Cancer Immune Surveillance

    PubMed Central

    Hermann-Kleiter, Natascha; Klepsch, Victoria; Wallner, Stephanie; Siegmund, Kerstin; Klepsch, Sebastian; Tuzlak, Selma; Villunger, Andreas; Kaminski, Sandra; Pfeifhofer-Obermair, Christa; Gruber, Thomas; Wolf, Dominik; Baier, Gottfried


    Summary Nuclear receptor subfamily 2, group F, member 6 (NR2F6) is an orphan member of the nuclear receptor superfamily. Here, we show that genetic ablation of Nr2f6 significantly improves survival in the murine transgenic TRAMP prostate cancer model. Furthermore, Nr2f6−/− mice spontaneously reject implanted tumors and develop host-protective immunological memory against tumor rechallenge. This is paralleled by increased frequencies of both CD4+ and CD8+ T cells and higher expression levels of interleukin 2 and interferon γ at the tumor site. Mechanistically, CD4+ and CD8+ T cell-intrinsic NR2F6 acts as a direct repressor of the NFAT/AP-1 complex on both the interleukin 2 and the interferon γ cytokine promoters, attenuating their transcriptional thresholds. Adoptive transfer of Nr2f6-deficient T cells into tumor-bearing immunocompetent mice is sufficient to delay tumor outgrowth. Altogether, this defines NR2F6 as an intracellular immune checkpoint in effector T cells, governing the amplitude of anti-cancer immunity. PMID:26387951

  2. The Escape of Cancer from T Cell-Mediated Immune Surveillance: HLA Class I Loss and Tumor Tissue Architecture.


    Garrido, Federico; Perea, Francisco; Bernal, Mónica; Sánchez-Palencia, Abel; Aptsiauri, Natalia; Ruiz-Cabello, Francisco


    Tumor immune escape is associated with the loss of tumor HLA class I (HLA-I) expression commonly found in malignant cells. Accumulating evidence suggests that the efficacy of immunotherapy depends on the expression levels of HLA class I molecules on tumors cells. It also depends on the molecular mechanism underlying the loss of HLA expression, which could be reversible/"soft" or irreversible/"hard" due to genetic alterations in HLA, β2-microglobulin or IFN genes. Immune selection of HLA-I negative tumor cells harboring structural/irreversible alterations has been demonstrated after immunotherapy in cancer patients and in experimental cancer models. Here, we summarize recent findings indicating that tumor HLA-I loss also correlates with a reduced intra-tumor T cell infiltration and with a specific reorganization of tumor tissue. T cell immune selection of HLA-I negative tumors results in a clear separation between the stroma and the tumor parenchyma with leucocytes, macrophages and other mononuclear cells restrained outside the tumor mass. Better understanding of the structural and functional changes taking place in the tumor microenvironment may help to overcome cancer immune escape and improve the efficacy of different immunotherapeutic strategies. We also underline the urgent need for designing strategies to enhance tumor HLA class I expression that could improve tumor rejection by cytotoxic T-lymphocytes (CTL).

  3. The Escape of Cancer from T Cell-Mediated Immune Surveillance: HLA Class I Loss and Tumor Tissue Architecture

    PubMed Central

    Garrido, Federico; Perea, Francisco; Bernal, Mónica; Sánchez-Palencia, Abel; Aptsiauri, Natalia; Ruiz-Cabello, Francisco


    Tumor immune escape is associated with the loss of tumor HLA class I (HLA-I) expression commonly found in malignant cells. Accumulating evidence suggests that the efficacy of immunotherapy depends on the expression levels of HLA class I molecules on tumors cells. It also depends on the molecular mechanism underlying the loss of HLA expression, which could be reversible/“soft” or irreversible/“hard” due to genetic alterations in HLA, β2-microglobulin or IFN genes. Immune selection of HLA-I negative tumor cells harboring structural/irreversible alterations has been demonstrated after immunotherapy in cancer patients and in experimental cancer models. Here, we summarize recent findings indicating that tumor HLA-I loss also correlates with a reduced intra-tumor T cell infiltration and with a specific reorganization of tumor tissue. T cell immune selection of HLA-I negative tumors results in a clear separation between the stroma and the tumor parenchyma with leucocytes, macrophages and other mononuclear cells restrained outside the tumor mass. Better understanding of the structural and functional changes taking place in the tumor microenvironment may help to overcome cancer immune escape and improve the efficacy of different immunotherapeutic strategies. We also underline the urgent need for designing strategies to enhance tumor HLA class I expression that could improve tumor rejection by cytotoxic T-lymphocytes (CTL). PMID:28264447

  4. Origins of immunity: transcription factors and homologues of effector genes of the vertebrate immune system expressed in sea urchin coelomocytes.


    Pancer, Z; Rast, J P; Davidson, E H


    Echinoderms share common ancestry with the chordates within the deuterostome clade. Molecular features that are shared between their immune systems and that of mammals thus illuminate the basal genetic framework on which these immune systems have been constructed during evolution. The immune effector cells of sea urchins are the coelomocytes, whose primary function is protection against invasive marine pathogens; here we identify six genes expressed in coelomocytes, homologues of which are also expressed in cells of the mammalian immune system. Three coelomocyte genes reported here encode transcription factors. These are an NFKB homologue (SpNFKB); a GATA-2/3 homologue (SpGATAc); and a runt domain factor (SpRunt-1). All three of these coelomocyte genes respond sharply to bacterial challenge: SpNFKB and SpRunt-1 genes are rapidly up-regulated, while transcripts of SpGATAc factor disappear within hours of injection of bacteria. Sham injection also activates SpNFKB and SpRunt, though with slower kinetics, but does not affect SpGATAc levels. Another gene, SpHS, encodes a protein related to the signal transduction intermediate HS1 of lymphoid cells. Two other newly discovered genes, SpSRCR1 and SpSRCR5, encode proteins featuring SRCR repeats. These genes are members of a complex family of SRCR genes all expressed specifically in coelomocytes. The SRCR repeats most closely resemble those of mammalian macrophage scavenger receptors. Remarkably, each individual sea urchin expresses a specific pattern of SRCR genes. Our results imply some shared immune functions and more generally, a shared regulatory architecture which underlies immune system gene expression in all deuterostomes. We conclude that the vertebrate immune system has evolved by inserting new genes into old gene regulatory networks dedicated to immunity.

  5. Epigenetic regulation of inducible gene expression in the immune system.


    Lim, Pek Siew; Li, Jasmine; Holloway, Adele F; Rao, Sudha


    T cells are exquisitely poised to respond rapidly to pathogens and have proved an instructive model for exploring the regulation of inducible genes. Individual genes respond to antigenic stimulation in different ways, and it has become clear that the interplay between transcription factors and the chromatin platform of individual genes governs these responses. Our understanding of the complexity of the chromatin platform and the epigenetic mechanisms that contribute to transcriptional control has expanded dramatically in recent years. These mechanisms include the presence/absence of histone modification marks, which form an epigenetic signature to mark active or inactive genes. These signatures are dynamically added or removed by epigenetic enzymes, comprising an array of histone-modifying enzymes, including the more recently recognized chromatin-associated signalling kinases. In addition, chromatin-remodelling complexes physically alter the chromatin structure to regulate chromatin accessibility to transcriptional regulatory factors. The advent of genome-wide technologies has enabled characterization of the chromatin landscape of T cells in terms of histone occupancy, histone modification patterns and transcription factor association with specific genomic regulatory regions, generating a picture of the T-cell epigenome. Here, we discuss the multi-layered regulation of inducible gene expression in the immune system, focusing on the interplay between transcription factors, and the T-cell epigenome, including the role played by chromatin remodellers and epigenetic enzymes. We will also use IL2, a key inducible cytokine gene in T cells, as an example of how the different layers of epigenetic mechanisms regulate immune responsive genes during T-cell activation.

  6. Ten years of gene therapy for primary immune deficiencies.


    Aiuti, Alessandro; Roncarolo, Maria Grazia


    Gene therapy with hematopoietic stem cells (HSC) is an attractive therapeutic strategy for several forms of primary immunodeficiencies. Current approaches are based on ex vivo gene transfer of the therapeutic gene into autologous HSC by vector-mediated gene transfer. In the past decade, substantial progress has been achieved in the treatment of severe combined immundeficiencies (SCID)-X1, adenosine deaminase (ADA)-deficient SCID, and chronic granulomatous disease (CGD). Results of the SCID gene therapy trials have shown long-term restoration of immune competence and clinical benefit in over 30 patients. The inclusion of reduced-dose conditioning in the ADA-SCID has allowed the engraftment of multipotent gene-corrected HSC at substantial level. In the CGD trial significant engraftment and transgene expression were observed, but the therapeutic effect was transient. The occurrence of adverse events related to insertional mutagenesis in the SCID-X1 and CGD trial has highlighted the limitations of current retroviral vector technology. For future applications the risk-benefit evaluation should include the type of vector employed, the disease background and the nature of the transgene. The use of self-inactivating lentiviral vectors will provide significant advantages in terms of natural gene regulation and reduction in the potential for adverse mutagenic events. Following recent advances in preclinical studies, lentiviral vectors are now being translated into new clinical approaches, such as Wiskott-Aldrich Syndrome.

  7. Immunoglobulin D enhances immune surveillance by activating antimicrobial, proinflammatory and B cell-stimulating programs in basophils.


    Chen, Kang; Xu, Weifeng; Wilson, Melanie; He, Bing; Miller, Norman W; Bengtén, Eva; Edholm, Eva-Stina; Santini, Paul A; Rath, Poonam; Chiu, April; Cattalini, Marco; Litzman, Jiri; B Bussel, James; Huang, Bihui; Meini, Antonella; Riesbeck, Kristian; Cunningham-Rundles, Charlotte; Plebani, Alessandro; Cerutti, Andrea


    Immunoglobulin D (IgD) is an enigmatic antibody isotype that mature B cells express together with IgM through alternative RNA splicing. Here we report active T cell-dependent and T cell-independent IgM-to-IgD class switching in B cells of the human upper respiratory mucosa. This process required activation-induced cytidine deaminase (AID) and generated local and circulating IgD-producing plasmablasts reactive to respiratory bacteria. Circulating IgD bound to basophils through a calcium-mobilizing receptor that induced antimicrobial, opsonizing, inflammatory and B cell-stimulating factors, including cathelicidin, interleukin 1 (IL-1), IL-4 and B cell-activating factor (BAFF), after IgD crosslinking. By showing dysregulation of IgD class-switched B cells and 'IgD-armed' basophils in autoinflammatory syndromes with periodic fever, our data indicate that IgD orchestrates an ancestral surveillance system at the interface between immunity and inflammation.

  8. Clonal selection in the human Vδ1 T cell repertoire indicates γδ TCR-dependent adaptive immune surveillance

    PubMed Central

    Davey, Martin S.; Willcox, Carrie R.; Joyce, Stephen P.; Ladell, Kristin; Kasatskaya, Sofya A.; McLaren, James E.; Hunter, Stuart; Salim, Mahboob; Mohammed, Fiyaz; Price, David A.; Chudakov, Dmitriy M.; Willcox, Benjamin E.


    γδ T cells are considered to be innate-like lymphocytes that respond rapidly to stress without clonal selection and differentiation. Here we use next-generation sequencing to probe how this paradigm relates to human Vδ2neg T cells, implicated in responses to viral infection and cancer. The prevalent Vδ1 T cell receptor (TCR) repertoire is private and initially unfocused in cord blood, typically becoming strongly focused on a few high-frequency clonotypes by adulthood. Clonal expansions have differentiated from a naive to effector phenotype associated with CD27 downregulation, retaining proliferative capacity and TCR sensitivity, displaying increased cytotoxic markers and altered homing capabilities, and remaining relatively stable over time. Contrastingly, Vδ2+ T cells express semi-invariant TCRs, which are present at birth and shared between individuals. Human Vδ1+ T cells have therefore evolved a distinct biology from the Vδ2+ subset, involving a central, personalized role for the γδ TCR in directing a highly adaptive yet unconventional form of immune surveillance. PMID:28248310

  9. Calcitonin Gene-Related Peptide: Key Regulator of Cutaneous Immunity

    PubMed Central

    Granstein, Richard D.; Wagner, John A.; Stohl, Lori L.; Ding, Wanhong


    Calcitonin gene-related peptide (CGRP) has been viewed as a neuropeptide and vasodilator. However, CGRP is more appropriately thought of as a pleiotropic signaling molecule. Indeed, CGRP has key regulatory functions on immune and inflammatory processes within the skin. CGRP-containing nerves are intimately associated with epidermal LCs and CGRP has profound regulatory effects on Langerhans cell antigen-presenting capability. When LCs are exposed to CGRP in vitro, their ability to present antigen for in vivo priming of naïve mice or elicitation of delayed-type hypersensitivity is inhibited in at least some situations. Administration of CGRP intradermally inhibits acquisition of immunity to Th1-dominant haptens applied to the injected site while augmenting immunity to Th2-dominant haptens, although the cellular targets of activity in these experiments remains unclear. Although CGRP can be a pro-inflammatory agent, several studies have demonstrated that administration of CGRP can inhibit the elicitation of inflammation by inflammatory stimuli in vivo. In this regard, CGRP inhibits the release of certain chemokines by stimulated endothelial cells. This is likely to be physiologically relevant since cutaneous blood vessels are innervated by sensory nerves. Exciting new studies suggest a significant role for CGRP in the pathogenesis of psoriasis and, most strikingly, that CGRP inhibit the ability of LCs to transmit the human immunodeficiency virus 1 to T lymphocytes. A more complete understanding of the role of CGRP in the skin immune system may lead to new and novel approaches for the therapy of immune mediated skin disorders. PMID:25534428

  10. Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.


    Michelucci, Alessandro; Cordes, Thekla; Ghelfi, Jenny; Pailot, Arnaud; Reiling, Norbert; Goldmann, Oliver; Binz, Tina; Wegner, André; Tallam, Aravind; Rausell, Antonio; Buttini, Manuel; Linster, Carole L; Medina, Eva; Balling, Rudi; Hiller, Karsten


    Immunoresponsive gene 1 (Irg1) is highly expressed in mammalian macrophages during inflammation, but its biological function has not yet been elucidated. Here, we identify Irg1 as the gene coding for an enzyme producing itaconic acid (also known as methylenesuccinic acid) through the decarboxylation of cis-aconitate, a tricarboxylic acid cycle intermediate. Using a gain-and-loss-of-function approach in both mouse and human immune cells, we found Irg1 expression levels correlating with the amounts of itaconic acid, a metabolite previously proposed to have an antimicrobial effect. We purified IRG1 protein and identified its cis-aconitate decarboxylating activity in an enzymatic assay. Itaconic acid is an organic compound that inhibits isocitrate lyase, the key enzyme of the glyoxylate shunt, a pathway essential for bacterial growth under specific conditions. Here we show that itaconic acid inhibits the growth of bacteria expressing isocitrate lyase, such as Salmonella enterica and Mycobacterium tuberculosis. Furthermore, Irg1 gene silencing in macrophages resulted in significantly decreased intracellular itaconic acid levels as well as significantly reduced antimicrobial activity during bacterial infections. Taken together, our results demonstrate that IRG1 links cellular metabolism with immune defense by catalyzing itaconic acid production.

  11. Measles surveillance in Taiwan, 2012-2014: Changing epidemiology, immune response, and circulating genotypes.


    Cheng, Wen-Yueh; Wang, Hsiao-Chi; Wu, Ho-Sheng; Liu, Ming-Tsan


    In Taiwan, although the coverage rate of two doses of measles-containing vaccine has been maintained at over 95% since 2001, measles outbreaks occurred in 2002, 2009, and 2011. The present study reports that 43 cases were confirmed by laboratory testing in Taiwan in 2012-2014 and that adults have emerged as one of groups susceptible to measles virus (MV) infection, who may have discrepant humoral immune reactions--indicated by the level of IgM and IgG antibodies compared to a naïve, susceptible measles case. Thirty-seven of 43 cases confirmed by RT-PCR were further characterized by genotyping. In Taiwan, genotype H1 was the major strain in circulation prior to 2010, while D9 was the most frequently detected MV genotype between 2010 and 2011. The genotyping data collected between 2012 and 2014 revealed that H1 rebounded in 2012 after an absence in 2011 and was imported from China and Vietnam. In 2014, genotype B3 first appeared in Taiwan following import from the Philippines and became the most frequently detected strain. Genotype D8, linked to importation from various countries, including India, Indonesia, Thailand, and Vietnam, showed sequence divergence. D9 was imported from Malaysia in 2014. The MV genotypes detected in Taiwan reflected the genotypes of circulating endemic measles strains in neighboring countries. A significant rise in the number of measles cases and in measles with genotypes imported from surrounding countries indicated that measles resurged in Asia in 2014.

  12. Ipr1 gene mediates innate immunity to tuberculosis

    PubMed Central

    Pan, Hui; Yan, Bo-Shiun; Rojas, Mauricio; Shebzukhov, Yuriy V.; Zhou, Hongwei; Kobzik, Lester; Higgins, Darren; Daly, Mark; Bloom, Barry R.; Kramnik, Igor


    An estimated 8 million people are infected each year with the pathogen, Mycobacterium tuberculosis, and over 2 million die annually1. Yet only about 10% of those infected develop tuberculosis. Genetic variation within host populations is known to play a significant role in humans and animals 2,3, but the nature of genetic control of host resistance to tuberculosis remains poorly understood. Previously we mapped a new genetic locus on mouse chromosome 1, designated sst1 (for supersusceptibility to tuberculosis1)4. Here we demonstrate in sst1 congenic mouse strains that this locus mediates innate immunity, and identify a candidate gene, Intracellular Pathogen Resistance 1 (Ipr1), within the sst1 locus. The Ipr1 gene is upregulated in the sst1 resistant macrophages upon activation and infection, but is not expressed in the sst1 susceptible macrophages. Expression of the Ipr1 transgene in the sst1 susceptible macrophages limits multiplication not only of MTB but also Listeria monocytogenes and switches a cell death pathway of the infected macrophages from necrosis to apoptosis. Our data suggest that the Ipr1 gene product may play a novel role in integrating signals generated by intracellular pathogens with mechanisms controlling innate immunity, cell death and pathogenesis. PMID:15815631

  13. Y-linked variation for autosomal immune gene regulation has the potential to shape sexually dimorphic immunity.


    Kutch, Ian C; Fedorka, Kenneth M


    Sexually dimorphic phenotypes arise from the differential expression of male and female shared genes throughout the genome. Unfortunately, the underlying molecular mechanisms by which dimorphic regulation manifests and evolves are unclear. Recent work suggests that Y-chromosomes may play an important role, given that Drosophila melanogaster Ys were shown to influence the regulation of hundreds of X and autosomal genes. For Y-linked regulatory variation (YRV) to facilitate sexually dimorphic evolution, however, it must exist within populations (where selection operates) and influence male fitness. These criteria have seldom been investigated, leaving the potential for dimorphic evolution via YRV unclear. Interestingly, male and female D. melanogaster differ in immune gene regulation. Furthermore, immune gene regulation appears to be influenced by the Y-chromosome, suggesting it may contribute to dimorphic immune evolution. We address this possibility by introgressing Y-chromosomes from a single wild population into an isogenic background (to create Y-lines) and assessing immune gene regulation and bacterial defence. We found that Y-line males differed in their immune gene regulation and their ability to defend against Serratia marcescens. Moreover, gene expression and bacterial defence were positively genetically correlated. These data indicate that the Y-chromosome has the potential to shape the evolution of sexually dimorphic immunity in this system.

  14. Y-linked variation for autosomal immune gene regulation has the potential to shape sexually dimorphic immunity

    PubMed Central

    Kutch, Ian C.; Fedorka, Kenneth M.


    Sexually dimorphic phenotypes arise from the differential expression of male and female shared genes throughout the genome. Unfortunately, the underlying molecular mechanisms by which dimorphic regulation manifests and evolves are unclear. Recent work suggests that Y-chromosomes may play an important role, given that Drosophila melanogaster Ys were shown to influence the regulation of hundreds of X and autosomal genes. For Y-linked regulatory variation (YRV) to facilitate sexually dimorphic evolution, however, it must exist within populations (where selection operates) and influence male fitness. These criteria have seldom been investigated, leaving the potential for dimorphic evolution via YRV unclear. Interestingly, male and female D. melanogaster differ in immune gene regulation. Furthermore, immune gene regulation appears to be influenced by the Y-chromosome, suggesting it may contribute to dimorphic immune evolution. We address this possibility by introgressing Y-chromosomes from a single wild population into an isogenic background (to create Y-lines) and assessing immune gene regulation and bacterial defence. We found that Y-line males differed in their immune gene regulation and their ability to defend against Serratia marcescens. Moreover, gene expression and bacterial defence were positively genetically correlated. These data indicate that the Y-chromosome has the potential to shape the evolution of sexually dimorphic immunity in this system. PMID:26631557

  15. Immune- and wound-dependent differential gene expression in an ancient insect.


    Johnston, Paul R; Rolff, Jens


    Two of the main functions of the immune system are to control infections and to contribute to wound closure. Here we present the results of an RNAseq study of immune- and wound-response gene expression in the damselfly Coenagrion puella, a representative of the odonates, the oldest taxon of winged insects. De novo assembly of RNAseq data revealed a rich repertoire of canonical immune pathways, as known from model insects, including recognition, transduction and effector gene expression. A shared set of immune and wound repair genes were differentially expressed in both wounded and immune-challenged larvae. Moreover 3-fold more immune genes were induced only in the immune-challenged treatment. This is consistent with the notion that the immune-system reads a balance of signals related to wounding and infection and that the response is tailored accordingly.

  16. Royal Decree: Gene Expression in Trans-Generationally Immune Primed Bumblebee Workers Mimics a Primary Immune Response.


    Barribeau, Seth M; Schmid-Hempel, Paul; Sadd, Ben M


    Invertebrates lack the cellular and physiological machinery of the adaptive immune system, but show specificity in their immune response and immune priming. Functionally, immune priming is comparable to immune memory in vertebrates. Individuals that have survived exposure to a given parasite are better protected against subsequent exposures. Protection may be cross-reactive, but demonstrations of persistent and specific protection in invertebrates are increasing. This immune priming can cross generations ("trans-generational" immune priming), preparing offspring for the prevailing parasite environment. While these phenomena gain increasing support, the mechanistic foundations underlying such immune priming, both within and across generations, remain largely unknown. Using a transcriptomic approach, we show that exposing bumblebee queens with an injection of heat-killed bacteria, known to induce trans-generational immune priming, alters daughter (worker) gene expression. Daughters, even when unexposed themselves, constitutively express a core set of the genes induced upon direct bacterial exposure, including high expression of antimicrobial peptides, a beta-glucan receptor protein implicated in bacterial recognition and the induction of the toll signaling pathway, and slit-3 which is important in honeybee immunity. Maternal exposure results in a distinct upregulation of their daughters' immune system, with a signature overlapping with the induced individual response to a direct exposure. This will mediate mother-offspring protection, but also associated costs related to reconfiguration of constitutive immune expression. Moreover, identification of conserved immune pathways in memory-like responses has important implications for our understanding of the innate immune system, including the innate components in vertebrates, which share many of these pathways.

  17. Successive Losses of Central Immune Genes Characterize the Gadiformes' Alternate Immunity.


    Solbakken, Monica H; Rise, Matthew L; Jakobsen, Kjetill S; Jentoft, Sissel


    Great genetic variability among teleost immunomes, with gene losses and expansions of central adaptive and innate components, has been discovered through genome sequencing over the last few years. Here, we demonstrate that the innate Myxovirus resistance gene (Mx) is lost from the ancestor of Gadiformes and the closely related Stylephorus chordatus, thus predating the loss of Major Histocompatibility Complex class II (MHCII) in Gadiformes. Although the functional implication of Mx loss is still unknown, we demonstrate that this loss is one of several ancient events appearing in successive order throughout the evolution of teleost immunity. In particular, we find that the loss of Toll-like receptor 5 predates the loss of Mx involving the entire Paracanthopterygii lineage. Using a time-calibrated phylogeny, we show that loss of MHCII and Mx overlap with major paleoclimatic and geological events indicating that these genetic changes were adaptive responses to the changing environment at the time.

  18. Successive Losses of Central Immune Genes Characterize the Gadiformes’ Alternate Immunity

    PubMed Central

    Solbakken, Monica H.; Rise, Matthew L.; Jakobsen, Kjetill S.; Jentoft, Sissel


    Great genetic variability among teleost immunomes, with gene losses and expansions of central adaptive and innate components, has been discovered through genome sequencing over the last few years. Here, we demonstrate that the innate Myxovirus resistance gene (Mx) is lost from the ancestor of Gadiformes and the closely related Stylephorus chordatus, thus predating the loss of Major Histocompatibility Complex class II (MHCII) in Gadiformes. Although the functional implication of Mx loss is still unknown, we demonstrate that this loss is one of several ancient events appearing in successive order throughout the evolution of teleost immunity. In particular, we find that the loss of Toll-like receptor 5 predates the loss of Mx involving the entire Paracanthopterygii lineage. Using a time-calibrated phylogeny, we show that loss of MHCII and Mx overlap with major paleoclimatic and geological events indicating that these genetic changes were adaptive responses to the changing environment at the time. PMID:27797950

  19. Characterization of rainbow trout (Oncorhynchus mykiss) spleen transcriptome and identification of immune-related genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance against specific diseases is affecting profitability in fish production systems including rainbow trout. Limited information is known about functions and mechanisms of the immune gene pathways in teleosts. Immunogenomics are powerful tools to determine immune-related genes/gene pathways a...

  20. Population Immunity against Serotype-2 Poliomyelitis Leading up to the Global Withdrawal of the Oral Poliovirus Vaccine: Spatio-temporal Modelling of Surveillance Data

    PubMed Central

    O’Reilly, Kathleen M.; Etsano, Andrew; Vaz, Rui Gama; Jafari, Hamid; Grassly, Nicholas C.; Blake, Isobel M.


    Background Global withdrawal of serotype-2 oral poliovirus vaccine (OPV2) took place in April 2016. This marked a milestone in global polio eradication and was a public health intervention of unprecedented scale, affecting 155 countries. Achieving high levels of serotype-2 population immunity before OPV2 withdrawal was critical to avoid subsequent outbreaks of serotype-2 vaccine-derived polioviruses (VDPV2s). Methods and Findings In August 2015, we estimated vaccine-induced population immunity against serotype-2 poliomyelitis for 1 January 2004–30 June 2015 and produced forecasts for April 2016 by district in Nigeria and Pakistan. Population immunity was estimated from the vaccination histories of children <36 mo old identified with non-polio acute flaccid paralysis (AFP) reported through polio surveillance, information on immunisation activities with different oral poliovirus vaccine (OPV) formulations, and serotype-specific estimates of the efficacy of these OPVs against poliomyelitis. District immunity estimates were spatio-temporally smoothed using a Bayesian hierarchical framework. Coverage estimates for immunisation activities were also obtained, allowing for heterogeneity within and among districts. Forward projections of immunity, based on these estimates and planned immunisation activities, were produced through to April 2016 using a cohort model. Estimated population immunity was negatively correlated with the probability of VDPV2 poliomyelitis being reported in a district. In Nigeria and Pakistan, declines in immunity during 2008–2009 and 2012–2013, respectively, were associated with outbreaks of VDPV2. Immunity has since improved in both countries as a result of increased use of trivalent OPV, and projections generally indicated sustained or improved immunity in April 2016, such that the majority of districts (99% [95% uncertainty interval 97%–100%] in Nigeria and 84% [95% uncertainty interval 77%–91%] in Pakistan) had >70% population immunity

  1. Gene Therapy for the Treatment of Primary Immune Deficiencies.


    Kuo, Caroline Y; Kohn, Donald B


    The use of gene therapy in the treatment of primary immune deficiencies (PID) has advanced significantly in the last decade. Clinical trials for X-linked severe combined immunodeficiency, adenosine deaminase deficiency (ADA), chronic granulomatous disease, and Wiskott-Aldrich syndrome have demonstrated that gene transfer into hematopoietic stem cells and autologous transplant can result in clinical improvement and is curative for many patients. Unfortunately, early clinical trials were complicated by vector-related insertional mutagenic events for several diseases with the exception of ADA-deficiency SCID. These results prompted the current wave of clinical trials for primary immunodeficiency using alternative retro- or lenti-viral vector constructs that are self-inactivating, and they have shown clinical efficacy without leukemic events thus far. The field of gene therapy continues to progress, with improvements in viral vector profiles, stem cell culturing techniques, and site-specific genome editing platforms. The future of gene therapy is promising, and we are quickly moving towards a time when it will be a standard cellular therapy for many forms of PID.

  2. Squamous-cell carcinoma, Kaposi's sarcoma and Burkitt's lymphoma are consequences of impaired immune surveillance of ubiquitous viruses in acquired immune deficiency syndrome, allograft recipients and tropical African patients.


    Purtilo, D T; Manolov, G; Manolova, Y; Harada, S; Lipscomb, H


    The immune system has evolved under Darwinian pressures as a defence against ubiquitous viruses. Immune surveillance against viral antigens protects the normal host. Individuals with inherited or acquired immune-deficiency disorders can become vulnerable to ubiquitous viruses and neoplasms can ensue, such as B-cell lymphoma, hepatocellular carcinoma, squamous-cell carcinoma, Kaposi's sarcoma, and carcinoma of the penis and uterine cervix. Immunodeficiency permits Epstein-Barr virus, hepatitis B virus, papillomavirus, herpes simplex virus, and cytomegalovirus to induce sustained target-cell proliferation. Each virus selects specific cellular targets bearing viral receptors and the infection leads to proliferation of the target cells rather than lysis. Various co-factors, including nutrition, exposure to tumour-promoting agents, parasitic infection, and ultraviolet light, may promote carcinogenesis. Depending on the type and severity of the immune deficiency, gradual proliferation may lead to evolution of a malignant clone. Conversion of polyclonal virally infected proliferating cells to give monoclonal malignancy is probably due to specific cytogenetic rearrangements which allow oncogene activation and endow an altered tumour cell with selective growth advantages over normal diploid cells. Prevention of viral oncogenesis may be possible by treatment of immune-deficient individuals with premalignant disorders. Immunotherapy and antiviral therapy may prevent progression of viral-induced proliferation to malignancy. The purpose of this paper is to discuss and evaluate the role of immune deficiency and viruses in the induction of malignancies commonly occurring in Africans residing in sub-Saharan Africa (Purtilo, 1976). The types of malignancies commonly occurring in this region are believed to be due to ubiquitous viruses. A failure of immune surveillance mechanisms to recognize viral antigens and abrogate proliferation of infected target cells predisposes to

  3. The identification of immune genes in the milk transcriptome of the Tasmanian devil (Sarcophilus harrisii)

    PubMed Central

    Hewavisenti, Rehana V.; Morris, Katrina M.; O’Meally, Denis; Cheng, Yuanyuan; Papenfuss, Anthony T.


    Tasmanian devil (Sarcophilus harrisii) pouch young, like other marsupials, are born underdeveloped and immunologically naïve, and are unable to mount an adaptive immune response. The mother’s milk provides nutrients for growth and development as well as providing passive immunity. To better understand immune response in this endangered species, we set out to characterise the genes involved in passive immunity by sequencing and annotating the transcriptome of a devil milk sample collected during mid-lactation. At mid-lactation we expect the young to have heightened immune responses, as they have emerged from the pouch, encountering new pathogens. A total of 233,660 transcripts were identified, including approximately 17,827 unique protein-coding genes and 846 immune genes. The most highly expressed transcripts were dominated by milk protein genes such as those encoding early lactation protein, late lactation proteins, α-lactalbumin, α-casein and β-casein. There were numerous highly expressed immune genes including lysozyme, whey acidic protein, ferritin and major histocompatibility complex I and II. Genes encoding immunoglobulins, antimicrobial peptides, chemokines and immune cell receptors were also identified. The array of immune genes identified in this study reflects the importance of the milk in providing immune protection to Tasmanian devil young and provides the first insight into Tasmanian devil milk. PMID:26793426

  4. The identification of immune genes in the milk transcriptome of the Tasmanian devil (Sarcophilus harrisii).


    Hewavisenti, Rehana V; Morris, Katrina M; O'Meally, Denis; Cheng, Yuanyuan; Papenfuss, Anthony T; Belov, Katherine


    Tasmanian devil (Sarcophilus harrisii) pouch young, like other marsupials, are born underdeveloped and immunologically naïve, and are unable to mount an adaptive immune response. The mother's milk provides nutrients for growth and development as well as providing passive immunity. To better understand immune response in this endangered species, we set out to characterise the genes involved in passive immunity by sequencing and annotating the transcriptome of a devil milk sample collected during mid-lactation. At mid-lactation we expect the young to have heightened immune responses, as they have emerged from the pouch, encountering new pathogens. A total of 233,660 transcripts were identified, including approximately 17,827 unique protein-coding genes and 846 immune genes. The most highly expressed transcripts were dominated by milk protein genes such as those encoding early lactation protein, late lactation proteins, α-lactalbumin, α-casein and β-casein. There were numerous highly expressed immune genes including lysozyme, whey acidic protein, ferritin and major histocompatibility complex I and II. Genes encoding immunoglobulins, antimicrobial peptides, chemokines and immune cell receptors were also identified. The array of immune genes identified in this study reflects the importance of the milk in providing immune protection to Tasmanian devil young and provides the first insight into Tasmanian devil milk.

  5. Sequential displacement of Type VI Secretion System effector genes leads to evolution of diverse immunity gene arrays in Vibrio cholerae

    PubMed Central

    Kirchberger, Paul C.; Unterweger, Daniel; Provenzano, Daniele; Pukatzki, Stefan; Boucher, Yan


    Type VI secretion systems (T6SS) enable bacteria to engage neighboring cells in contact-dependent competition. In Vibrio cholerae, three chromosomal clusters each encode a pair of effector and immunity genes downstream of those encoding the T6SS structural machinery for effector delivery. Different combinations of effector-immunity proteins lead to competition between strains of V. cholerae, which are thought to be protected only from the toxicity of their own effectors. Screening of all publically available V. cholerae genomes showed that numerous strains possess long arrays of orphan immunity genes encoded in the 3′ region of their T6SS clusters. Phylogenetic analysis reveals that these genes are highly similar to those found in the effector-immunity pairs of other strains, indicating acquisition by horizontal gene transfer. Extensive genomic comparisons also suggest that successive addition of effector-immunity gene pairs replaces ancestral effectors, yet retains the cognate immunity genes. The retention of old immunity genes perhaps provides protection against nearby kin bacteria in which the old effector was not replaced. This mechanism, combined with frequent homologous recombination, is likely responsible for the high diversity of T6SS effector-immunity gene profiles observed for V. cholerae and closely related species. PMID:28327641

  6. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes

    PubMed Central

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.


    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring. PMID:27731423

  7. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes

    NASA Astrophysics Data System (ADS)

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.


    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring.

  8. Characterization of the rainbow trout spleen transcriptome and identification of immune-related genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Disease susceptibility affects production efficiency and profitability in rainbow trout aquaculture. There is limited information available regarding the functions and mechanisms of teleost immune pathways. Immunogenomics provides powerful approaches to identify disease resistance genes/gene pathway...

  9. [Expression and immunity of multi-HIV B'/C subype genes in replicating DNA vaccines].


    Gao, Ying-ying; Deng, Yao; Qi, Xiang-rong; Zhang, Xiang-min; Meng, Xin; Wang, Hui-juan; Tan, Wen-jie; Ruan, Li


    To understand the effect of various gene structures of HIV B'/C subtype on the gene expression and immunity in DNA vaccine, replicating DNA vector pSCK2 was used to construct seven DNA vaccines carrying one or more of HIV B'/C subtype genes: gagpol, gp160 and rtn (rev, tat and nef fusion gene). Immunofluorescence staining indicated that Gag, Gp160, Rev, Tat and Nef could be expressed from the seven DNA vaccines. Stronger expression was observed with the gene in single-gene expression plasmid or with the gene located at upper-IRES in double- or multi-gene expression plasmid. ELISA test showed that Gag induced higher antibody response, but the antibody titers stimulated by Gp160, Pol, or RTN were very low. Both Gag single-gene expression plasmid and Gag-RTN double-gene expression plasmid separately inoculating induced stronger antibody response against Gag than Gag-Gp160 double-gene expression plasmid and Gagpol-Gp160-RTN multi-gene expression plasmid or combined inoculation of Gag and Gp160 single-gene expression plasmids did. ELISPOT detection showed that all the seven DNA vaccines could stimulate cellular immune response against Gag, Pol, Gp160, Tat, and Nef, respectively. Gagpol or Gp160 single-gene expression plasmid separately inoculating stimulated the strongest cellular immune response. Tat and Nef expressed in all the plasmids induced similar immune response. These results indicated that HIV B'/C subtype genes gagpol, gp160 and rtn could be efficiently expressed in the replicating DNA vaccine vector, single-gene expression plasmid had the higher gene expression level and induced stronger immune response; combined immunization of Gagpol and Gp160 had dramatically lower immunity than Gagpol or Gp160 separated immunization did. Immunity of RTN had no difference between combined and separated immunizations. Therefore, in case of immunization with DNA vaccines containing different HIV genes, it is necessary to optimize the combined immunization procedure

  10. Fight or flight? - Flight increases immune gene expression but does not help to fight an infection.


    Woestmann, L; Kvist, J; Saastamoinen, M


    Flight represents a key trait in most insects, being energetically extremely demanding, yet often necessary for foraging and reproduction. Additionally, dispersal via flight is especially important for species living in fragmented landscapes. Even though, based on life-history theory, a negative relationship may be expected between flight and immunity, a number of previous studies have indicated flight to induce an increased immune response. In this study, we assessed whether induced immunity (i.e. immune gene expression) in response to 15-min forced flight treatment impacts individual survival of bacterial infection in the Glanville fritillary butterfly (Melitaea cinxia). We were able to confirm previous findings of flight-induced immune gene expression, but still observed substantially stronger effects on both gene expression levels and life span due to bacterial infection compared to flight treatment. Even though gene expression levels of some immunity-related genes were elevated due to flight, these individuals did not show increased survival of bacterial infection, indicating that flight-induced immune activation does not completely protect them from the negative effects of bacterial infection. Finally, an interaction between flight and immune treatment indicated a potential trade-off: flight treatment increased immune gene expression in naïve individuals only, whereas in infected individuals no increase in immune gene expression was induced by flight. Our results suggest that the up-regulation of immune genes upon flight is based on a general stress response rather than reflecting an adaptive response to cope with potential infections during flight or in new habitats.

  11. Identification of immune response-related genes in the Chinese oak silkworm, Antheraea pernyi by suppression subtractive hybridization.


    Liu, Qiu-Ning; Zhu, Bao-Jian; Wang, Lei; Wei, Guo-Qing; Dai, Li-Shang; Lin, Kun-Zhang; Sun, Yu; Qiu, Jian-Feng; Fu, Wei-Wei; Liu, Chao-Liang


    Insects possess an innate immune system that responds to invading microorganisms. In this study, a subtractive cDNA library was constructed to screen for immune response-related genes in the fat bodies of Antheraea pernyi (Lepidoptera: Saturniidae) pupa challenged with Escherichia coli. Four hundred putative EST clones were identified by suppression subtractive hybridization (SSH), including 50 immune response-related genes, three cytoskeleton genes, eight cell cycle and apoptosis genes, five respiration and energy metabolism genes, five transport genes, 40 metabolism genes, ten stress response genes, four transcription and translation regulation genes and 77 unknown genes. To verify the reliability of the SSH data, the transcription of a set of randomly selected immune response-related genes were confirmed by semi-quantitative reverse transcription-PCR (RT-PCR) and real-time quantitative reverse transcription-PCR (qRT-PCR). These identified immune response-related genes provide insight into understanding the innate immunity in A. pernyi.

  12. Genome-Wide RNAi Screens in C. elegans to Identify Genes Influencing Lifespan and Innate Immunity.


    Sinha, Amit; Rae, Robbie


    RNA interference is a rapid, inexpensive, and highly effective tool used to inhibit gene function. In C. elegans, whole genome screens have been used to identify genes involved with numerous traits including aging and innate immunity. RNAi in C. elegans can be carried out via feeding, soaking, or injection. Here we outline protocols used to maintain, grow, and carry out RNAi via feeding in C. elegans and determine whether the inhibited genes are essential for lifespan or innate immunity.

  13. Identification and evolution of an NFAT gene involving Branchiostoma belcheri innate immunity.


    Song, Xiaojun; Hu, Jing; Jin, Ping; Chen, Liming; Ma, Fei


    The Nuclear Factor of Activated T cells (NFAT) plays an important role in innate and adaptive immunity, but no NFAT genes have yet been identified in amphioxus species. Here we identified and characterized an NFAT-like gene from Branchiostoma belcheri, and also studied extensively the evolutionary history of NFAT family genes. We found that the amphioxus genome contains an AmphiNFAT gene encoding an NFAT homolog. The AmphiNFAT gene was found to be involved in the innate immune response to LPS stimulation in B. belcheri and was ubiquitously and differentially expressed in all investigated tissues. The NFAT family genes were present in a common ancestor with cnidaria, and NFAT1-4 paralogs were lost early in Branchiostoma and Strongylocentrotus genomes. We discovered that NFAT family genes underwent strong purifying selection. Taken together, our findings provide an insight into the innate immune response of amphioxus and the evolution of the NFAT gene family.

  14. Massive expansion and functional divergence of innate immune genes in a protostome

    PubMed Central

    Zhang, Linlin; Li, Li; Guo, Ximing; Litman, Gary W.; Dishaw, Larry J.; Zhang, Guofan


    The molecules that mediate innate immunity are encoded by relatively few genes and exhibit broad specificity. Detailed annotation of the Pacific oyster (Crassostrea gigas) genome, a protostome invertebrate, reveals large-scale duplication and divergence of multigene families encoding molecules that effect innate immunity. Transcriptome analyses indicate dynamic and orchestrated specific expression of numerous innate immune genes in response to experimental challenge with pathogens, including bacteria, and a pathogenic virus. Variable expression of individual members of the multigene families encoding these genes also occurs during different types of abiotic stress (environmentally-equivalent conditions of temperature, salinity and desiccation). Multiple families of immune genes are responsive in concert to certain biotic and abiotic challenges. Individual members of expanded families of immune genes are differentially expressed under both biotic challenge and abiotic stress conditions. Members of the same families of innate immune molecules also are transcribed in developmental stage- and tissue-specific manners. An integrated, highly complex innate immune system that exhibits remarkable discriminatory properties and responses to different pathogens as well as environmental stress has arisen through the adaptive recruitment of tandem duplicated genes. The co-adaptive evolution of stress and innate immune responses appears to have an ancient origin in phylogeny. PMID:25732911

  15. Do the genes of the innate immune response contribute to neuroprotection in Drosophila?


    Cantera, Rafael; Barrio, Rosa


    A profound debate exists on the relationship between neurodegeneration and the innate immune response in humans. Although it is clear that such a relation exists, the causes and consequences of this complex association remain to be determined in detail. Drosophila is being used to investigate the mechanisms involved in neurodegeneration, and all genomic studies on this issue have generated gene catalogues enriched in genes of the innate immune response. We review the data reported in these publications and propose that the abundance of immune genes in studies of neurodegeneration reflects at least two phenomena: (i) some proteins have functions in both immune and nervous systems, and (ii) immune genes might also be of neuroprotective value in Drosophila. This review opens this debate in Drosophila, which could thus be used as an instrumental model to elucidate this question.

  16. In vitro VLA-4 blockade results in an impaired NK cell-mediated immune surveillance against melanoma.


    Gandoglia, Ilaria; Ivaldi, Federico; Carrega, Paolo; Armentani, Eric; Ferlazzo, Guido; Mancardi, Gianluigi; Kerlero de Rosbo, Nicole; Uccelli, Antonio; Laroni, Alice


    cells in the lower chamber, and that it was significantly reduced in presence of NTZ. Our results show that upon exposure to NTZ both cytolytic activity and migration toward melanoma cells were affected, suggesting that binding of NTZ to NK cells affects pathways involved in these NK-cell functions. We analyzed the expression of CD49d on NK cells from MS patients treated with NTZ and observed that it decreases with time of treatment. These data suggest that blockade of VLA-4 on NK-cell surface alters some key functions involved in the immune surveillance toward melanoma by NK cells and may provide a mechanistic explanation for the reported occurrence of melanoma in MS patients treated with NTZ.

  17. Comparative tissue expression of American lobster (Homarus americanus) immune genes during bacterial and scuticociliate challenge.


    Clark, K Fraser; Acorn, Adam R; Wang, Haili; Greenwood, Spencer J


    The American lobster (Homarus americanus) fishery is the most economically significant fishery in Canada; although comparatively little is known about the lobsters' response to pathogenic challenge. This is the first study to investigate the expression of immune genes in tissues outside of the lobster hepatopancreas in response to challenges by the Gram-positive bacteria, Aerococcus viridans var. homari or the scuticociliate parasite, Anophryoides haemophila. The hepatopancreas has been regarded as the major humoral immune organ in crustaceans, but the contribution of other organs and tissues to the molecular immune response has largely been overlooked. This study used RT-qPCR to monitor the gene expression of several immune genes including three anti-lipopolysaccharide isoforms (ALF) Homame ALF-B1, Homame ALF-C1 and ALFHa-1, acute phase serum amyloid protein A (SAA), as well as thioredoxin and hexokinase, in antennal gland and gill tissues. Our findings indicate that the gene expression of the SAA and all ALF isoforms in the antennal gland and gill tissues increased in response to pathogenic challenge. However, there was differential expression of individual ALF isoforms that were dependent on both the tissue, and the pathogen used in the challenge. The gene expression changes of several immune genes were found to be higher in the antennal gland than have been previously reported for the hepatopancreas. This study demonstrates that increased immune gene expression from the gill and antennal gland over the course of pathogen induced disease contributes to the immune response of H. americanus.

  18. Identification and Functional Analysis of Antifungal Immune Response Genes in Drosophila

    PubMed Central

    Jin, Li Hua; Shim, Jaewon; Yoon, Joon Sun; Kim, Byungil; Kim, Jihyun; Kim-Ha, Jeongsil; Kim, Young-Joon


    Essential aspects of the innate immune response to microbial infection appear to be conserved between insects and mammals. Although signaling pathways that activate NF-κB during innate immune responses to various microorganisms have been studied in detail, regulatory mechanisms that control other immune responses to fungal infection require further investigation. To identify new Drosophila genes involved in antifungal immune responses, we selected genes known to be differentially regulated in SL2 cells by microbial cell wall components and tested their roles in antifungal defense using mutant flies. From 130 mutant lines, sixteen mutants exhibited increased sensitivity to fungal infection. Examination of their effects on defense against various types of bacteria and fungi revealed nine genes that are involved specifically in defense against fungal infection. All of these mutants displayed defects in phagocytosis or activation of antimicrobial peptide genes following infection. In some mutants, these immune deficiencies were attributed to defects in hemocyte development and differentiation, while other mutants showed specific defects in immune signaling required for humoral or cellular immune responses. Our results identify a new class of genes involved in antifungal immune responses in Drosophila. PMID:18833296

  19. Repeated observation of immune gene sets enrichment in women with non-small cell lung cancer.


    Araujo, Jhajaira M; Prado, Alexandra; Cardenas, Nadezhda K; Zaharia, Mayer; Dyer, Richard; Doimi, Franco; Bravo, Leny; Pinillos, Luis; Morante, Zaida; Aguilar, Alfredo; Mas, Luis A; Gomez, Henry L; Vallejos, Carlos S; Rolfo, Christian; Pinto, Joseph A


    There are different biological and clinical patterns of lung cancer between genders indicating intrinsic differences leading to increased sensitivity to cigarette smoke-induced DNA damage, mutational patterns of KRAS and better clinical outcomes in women while differences between genders at gene-expression levels was not previously reported. Here we show an enrichment of immune genes in NSCLC in women compared to men. We found in a GSEA analysis (by biological processes annotated from Gene Ontology) of six public datasets a repeated observation of immune gene sets enrichment in women. "Immune system process", "immune response", "defense response", "cellular defense response" and "regulation of immune system process" were the gene sets most over-represented while APOBEC3G, APOBEC3F, LAT, CD1D and CCL5 represented the top-five core genes. Characterization of immune cell composition with the platform CIBERSORT showed no differences between genders; however, there were differences when tumor tissues were compared to normal tissues. Our results suggest different immune responses in NSCLC between genders that could be related with the different clinical outcome.

  20. Repeated observation of immune gene sets enrichment in women with non-small cell lung cancer

    PubMed Central

    Araujo, Jhajaira M.; Prado, Alexandra; Cardenas, Nadezhda K.; Zaharia, Mayer; Dyer, Richard; Doimi, Franco; Bravo, Leny; Pinillos, Luis; Morante, Zaida; Aguilar, Alfredo; Mas, Luis A.; Gomez, Henry L.; Vallejos, Carlos S.; Rolfo, Christian; Pinto, Joseph A.


    There are different biological and clinical patterns of lung cancer between genders indicating intrinsic differences leading to increased sensitivity to cigarette smoke-induced DNA damage, mutational patterns of KRAS and better clinical outcomes in women while differences between genders at gene-expression levels was not previously reported. Here we show an enrichment of immune genes in NSCLC in women compared to men. We found in a GSEA analysis (by biological processes annotated from Gene Ontology) of six public datasets a repeated observation of immune gene sets enrichment in women. “Immune system process”, “immune response”, “defense response”, “cellular defense response” and “regulation of immune system process” were the gene sets most over-represented while APOBEC3G, APOBEC3F, LAT, CD1D and CCL5 represented the top-five core genes. Characterization of immune cell composition with the platform CIBERSORT showed no differences between genders; however, there were differences when tumor tissues were compared to normal tissues. Our results suggest different immune responses in NSCLC between genders that could be related with the different clinical outcome. PMID:26958810

  1. Optimizing High Dimensional Gene Expression Studies for Immune Response Following Smallpox Vaccination Using Taqman® Low Density Immune Arrays

    PubMed Central

    Oberg, Ann L.; Dhiman, Neelam; Grill, Diane E.; Ryan, Jenna E.; Kennedy, Richard B.; Poland, Gregory A.


    Introduction We sought to determine the time and vaccinia virus dose combination that would maximize the number of acute immune response changes in response to vaccinia stimulation in preparation for a large gene expression microarray experiment. Methods PBMCs from ten subjects were exposed to five vaccinia virus doses for three lengths of time. Gene expression was measured for 90 immune response genes via Taqman® Low Density Immune Arrays. Expression data were normalized via model-based non-linear normalization. Linear mixed effects model results were used to standardize changes across genes and determine the time/multiplicity of infection (MOI) combination with the largest number of changes. Results The greatest number of changes occurred with a MOI of 5.0 and exposure time of 48 hours. Further inspection revealed that most changes had occurred earlier and faded at this combination. The second highest number of changes was found at a MOI of 0.5 PFU/cell and time of 18 hours. Conclusions We conclude a time of 18 hours with a MOI of 0.5 PFU/cell is the optimal time/MOI combination for the full scale gene expression study. The strategy described herein is a general and resource efficient way to make critical decisions regarding experimental parameters for studies utilizing expensive assays that interrogate a large number of variables. PMID:21277306

  2. Immunizations


    ... Get Weight Loss Surgery? A Week of Healthy Breakfasts Shyness Immunizations KidsHealth > For Teens > Immunizations Print A A A What's in this article? Why Are Vaccinations Important? Why Do I Need Shots? Which Vaccinations Do ...

  3. Selective Landscapes in newt Immune Genes Inferred from Patterns of Nucleotide Variation

    PubMed Central

    Fijarczyk, Anna; Dudek, Katarzyna; Babik, Wieslaw


    Host–pathogen interactions may result in either directional selection or in pressure for the maintenance of polymorphism at the molecular level. Hence signatures of both positive and balancing selection are expected in immune genes. Because both overall selective pressure and specific targets may differ between species, large-scale population genomic studies are useful in detecting functionally important immune genes and comparing selective landscapes between taxa. Such studies are of particular interest in amphibians, a group threatened worldwide by emerging infectious diseases. Here, we present an analysis of polymorphism and divergence of 634 immune genes in two lineages of Lissotriton newts: L. montandoni and L. vulgaris graecus. Variation in newt immune genes has been shaped predominantly by widespread purifying selection and strong evolutionary constraint, implying long-term importance of these genes for functioning of the immune system. The two evolutionary lineages differ in the overall strength of purifying selection which can partially be explained by demographic history but may also signal differences in long-term pathogen pressure. The prevalent constraint notwithstanding, 23 putative targets of positive selection and 11 putative targets of balancing selection were identified. The latter were detected by composite tests involving the demographic model and further validated in independent population samples. Putative targets of balancing selection encode proteins which may interact closely with pathogens but include also regulators of immune response. The identified candidates will be useful for testing whether genes affected by balancing selection are more prone to interspecific introgression than other genes in the genome. PMID:27702815

  4. Characterization of innate immunity genes in the parasitic nematode Brugia malayi.


    Libro, Silvia; Slatko, Barton E; Foster, Jeremy M

    The filarial nematode Brugia malayi is one of the causative agents of lymphatic filariasis, a neglected tropical disease that affects 120 million people worldwide. The limited effectiveness of available anthelmintics and the absence of a vaccine have prompted extensive research on the interaction between Brugia and its obligate bacterial endosymbiont, Wolbachia. Recent studies suggest that Wolbachia is able to manipulate its nematode host immunity but relatively little is known about the immune system of filarial nematodes. Therefore, elucidation of the mechanisms underlying the immune system of B. malayi may be useful for understanding how the symbiotic relationship is maintained and help in the identification of new drug targets. In order to characterize the main genetic pathways involved in B. malayi immunity, we exposed adult female worms to two bacterial lysates (Escherichia coli and Bacillus amyloliquefaciens), dsRNA and dsDNA. We performed transcriptome sequencing of worms exposed to each immune elicitor at two different timepoints. Gene expression analysis of untreated and immune-challenged worms was performed to characterize gene expression patterns associated with each type of immune stimulation. Our results indicate that different immune elicitors produced distinct expression patterns in B. malayi, with changes in the expression of orthologs of well-characterized C. elegans immune pathways such as insulin, TGF-β, and p38 MAPK pathways, as well as C-type lectins and several stress-response genes.

  5. Resolving misassembled cattle immune gene clusters with hierarchical, long read sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Animal health is a critical component of productivity; however, current genomic selection genotyping tools have a paucity of genetic markers within key immune gene clusters (IGC) involved in the cattle innate and adaptive immune systems. With diseases such as Bovine Tuberculosis and Johne’s disease ...

  6. Emerging roles of p53 and other tumour-suppressor genes in immune regulation

    PubMed Central

    Muñoz-Fontela, César; Mandinova, Anna; Aaronson, Stuart A.; Lee, Sam W.


    Tumour-suppressor genes are indispensable for the maintenance of genomic integrity. Recently, several of these genes, including p53, PTEN, RB1 and ARF, have been implicated in immune responses and inflammatory diseases. In particular, the p53 tumour-suppressor pathway is involved in crucial aspects of tumour immunology and in homeostatic regulation of immune responses. Other studies have identified roles for p53 in various cellular processes, including metabolism and stem cell maintenance. Here, we discuss the emerging roles of p53 and other tumour-suppressor genes in tumour immunology as well as in additional immunological settings, such as virus infection. This relatively unexplored area could yield important insights into the homeostatic control of immune cells in health and disease, and facilitate the development of more effective immunotherapies. Consequently, tumour-suppressor genes are emerging as potential guardians of immune integrity. PMID:27667712

  7. Identification of candidate genes and mutations in QTL regions for immune responses in chicken.


    Siwek, M; Slawinska, A; Rydzanicz, M; Wesoly, J; Fraszczak, M; Suchocki, T; Skiba, J; Skiba, K; Szyda, J


    There are two categories of immune responses - innate and adaptive immunity - both having polygenic backgrounds and a significant environmental component. In our study, adaptive immunity was represented by the specific antibody response toward keyhole limpet hemocyanin (KLH); innate immunity was represented by natural antibodies toward lipopolysaccharide (LPS) and lipoteichoic acid (LTA). Defining genetic bases of immune responses leads from defining quantitative trait loci (QTL) toward a single mutation responsible for variation in the phenotypic trait. The goal of the reported study was to define candidate genes and mutations for the immune traits of interest in chicken by performing an association study of SNPs located in candidate genes defined in QTL regions. Candidate genes and SNPs in QTL regions were selected in silico. SNP association was based on a custom SNP panel, GoldenGate genotyping assay (Illumina) and two statistical models: random mixed model and CAR score. The most significant SNP for immune response toward KLH was located in the JMJD6 gene located on GGA18. Four SNPs in candidate genes FOXJ1 (GGA18), EPHB1 (GGA9), PTGER4 (GGAZ) and PRKCB (GGA14) showed association with natural antibodies for LPS. A single SNP in ITGB4 (GGA18) was associated with natural antibodies for LTA. All associated SNPs mentioned above showed additive effects.

  8. Immunomodulatory Effects of Saccharomyces cerevisiae Fermentation Product Supplementation on Immune Gene Expression and Lymphocyte Distribution in Immune Organs in Broilers

    PubMed Central

    Chou, Wen K.; Park, Jungwoo; Carey, John B.; McIntyre, Don R.; Berghman, Luc R.


    A study was conducted to evaluate the molecular and cellular immunomodulatory effects of a Saccharomyces cerevisiae fermentation product (Original XPC, Diamond V) in broilers. Our lab has previously demonstrated that broilers fed XPC generate faster and stronger antigen-specific humoral immune responses to Newcastle disease virus (NDV) vaccination. This study aims at investigating the mechanism behind this increased immunocompetence. One-day-old broilers were randomly assigned to one of two treatments: 1.25 kg/ton S. cerevisiae fermentation product (XPC treatment group) or control diet. Birds were vaccinated against NDV on day 1 (B1 strain) and day 21 (LaSota strain) post-hatch. Innate and adaptive immune-related gene expression profiles in central (thymus and bursa of Fabricius) and peripheral (spleen) immune organs were investigated at 14 and 28 days of age by qPCR array. Fold changes larger than 1.2 (P < 0.05) between treated and control were considered significant. Lymphocyte subpopulations in central and peripheral immune organs and blood leukocytes were analyzed by flow cytometry at 14, 21, 28, and 42 days of age. In the spleen, Th1 immune responses and antiviral genes, such as IFN-γ, and its downstream genes signal transducer and activator of transcription (STAT4) and NFκB, were significantly upregulated in the treated group by 14 days of age. In the thymus, genes belonging to different functional groups were influenced at different time points. Cytokine genes associated with lymphocyte maturation, differentiation, and proliferation, such as IL-1R, IL-2, and IL-15 were significantly upregulated in the treated group by 28 days of age. Genes preferentially expressed in the medulla of the thymus and mature thymocytes, such as Myxovirus resistance gene 1, interferon regulatory factor-1, interferon regulatory factor-7, and STAT1, were upregulated in the birds supplemented with XPC. Birds supplemented with XPC had significantly higher percentages

  9. Manipulating the in vivo immune response by targeted gene knockdown.


    Lieberman, Judy


    Aptamers, nucleic acids selected for high affinity binding to proteins, can be used to activate or antagonize immune mediators or receptors in a location and cell-type specific manner and to enhance antigen presentation. They can also be linked to other molecules (other aptamers, siRNAs or miRNAs, proteins, toxins) to produce multifunctional compounds for targeted immune modulation in vivo. Aptamer-siRNA chimeras (AsiCs) that induce efficient cell-specific knockdown in immune cells in vitro and in vivo can be used as an immunological research tool or potentially as an immunomodulating therapeutic.

  10. Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

    PubMed Central

    Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo


    The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

  11. Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.


    Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo


    The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

  12. Molecular surveillance of low pathogenic avian influenza viruses in wild birds across the United States: inferences from the hemagglutinin gene.


    Piaggio, Antoinette J; Shriner, Susan A; VanDalen, Kaci K; Franklin, Alan B; Anderson, Theodore D; Kolokotronis, Sergios-Orestis


    A United States interagency avian influenza surveillance plan was initiated in 2006 for early detection of highly pathogenic avian influenza viruses (HPAIV) in wild birds. The plan included a variety of wild bird sampling strategies including the testing of fecal samples from aquatic areas throughout the United States from April 2006 through December 2007. Although HPAIV was not detected through this surveillance effort we were able to obtain 759 fecal samples that were positive for low pathogenic avian influenza virus (LPAIV). We used 136 DNA sequences obtained from these samples along with samples from a public influenza sequence database for a phylogenetic assessment of hemagglutinin (HA) diversity in the United States. We analyzed sequences from all HA subtypes except H5, H7, H14 and H15 to examine genetic variation, exchange between Eurasia and North America, and geographic distribution of LPAIV in wild birds in the United States. This study confirms intercontinental exchange of some HA subtypes (including a newly documented H9 exchange event), as well as identifies subtypes that do not regularly experience intercontinental gene flow but have been circulating and evolving in North America for at least the past 20 years. These HA subtypes have high levels of genetic diversity with many lineages co-circulating within the wild birds of North America. The surveillance effort that provided these samples demonstrates that such efforts, albeit labor-intensive, provide important information about the ecology of LPAIV circulating in North America.

  13. Maternal transfer and transcriptional onset of immune genes during ontogenesis in Atlantic cod.


    Seppola, Marit; Johnsen, Hanne; Mennen, Saskia; Myrnes, Bjørnar; Tveiten, Helge


    The immune system in teleosts is not completely developed during embryonic and larval stages and immune competence is assumed to be restricted. This study is the first to address whether immune transcripts are maternally transferred to offspring and when immune genes are transcriptionally active in Atlantic cod (Gadus morhua). In unfertilised eggs, transcripts encoding lysozyme and cathelicidin were found indicating maternal transfer of antibacterial transcripts. Lysozyme activity was also present at this stage suggesting the presence of a functional protein. Transcripts of two other putative antibacterial genes (hepcidin and pentraxin) and antiviral genes (ISG15 and LGP2) were absent in unfertilised eggs. The transcriptional onset of these genes occurred during the gastrula period. Transcripts of the heavy chain constant regions of the immunoglobulin (Ig) D, membrane-associated and secreted form of IgM were absent in unfertilised eggs. Transcription of the heavy chain locus commenced at low levels during the segmentation period indicating the onset of B-cell development. Most innate immune genes showed an increase in transcription around hatch and first feeding, indicating a preparation for increased pathogen exposure at this time. Prior to and during metamorphosis all genes showed a pronounced elevation in transcript levels indicating a further maturation of the immune system during this period.

  14. Gene Expression Profile of the Hypothalamus in DNP-KLH Immunized Mice Following Electroacupuncture Stimulation

    PubMed Central

    Kim, Sun Kwang; Kim, Jeungshin; Ko, Eunjung; Kim, Hyunseong; Hwang, Deok-Sang; Lee, Sanghoon; Baek, Yonghyeon; Min, Byung-Il; Nam, Sangsoo; Bae, Hyunsu


    Clinical evidence indicates that electroacupuncture (EA) is effective for allergic disorder. Recent animal studies have shown that EA treatment reduces levels of IgE and Th2 cytokines in BALB/c mice immunized with 2,4-dinitrophenylated keyhole limpet protein (DNP-KLH). The hypothalamus, a brain center of the neural-immune system, is known to be activated by EA stimulation. This study was performed to identify and characterize the differentially expressed genes in the hypothalamus of DNP-KLH immunized mice that were stimulated with EA or only restrained. To this aim, we conducted a microarray analysis to evaluate the global gene expression profiles, using the hypothalamic RNA samples taken from three groups of mice: (i) normal control group (no treatments); (ii) IMH group (DNP-KLH immunization + restraint); and (iii) IMEA group (immunization + EA stimulation). The microarray analysis revealed that total 39 genes were altered in their expression levels by EA treatment. Ten genes, including T-cell receptor alpha variable region family 13 subfamily 1 (Tcra-V13.1), heat shock protein 1B (Hspa1b) and 2′–5′ oligoadenylate synthetase 1F (Oas1f), were up-regulated in the IMEA group when compared with the IMH group. In contrast, 29 genes, including decay accelerating factor 2 (Daf2), NAD(P)H dehydrogenase, quinone 1 (Nqo1) and programmed cell death 1 ligand 2 (Pdcd1lg2) were down-regulated in the IMEA group as compared with the IMH group. These results suggest that EA treatment can modulate immune response in DNP-KLH immunized mice by regulating expression levels of genes that are associated with innate immune, cellular defense and/or other kinds of immune system in the hypothalamus. PMID:21799680

  15. Effects of polyamines on cellular innate immune response and the expression of immune-relevant genes in gilthead seabream leucocytes.


    Reyes-Becerril, Martha; Ascencio-Valle, Felipe; Tovar-Ramírez, Dariel; Meseguer, José; Esteban, María Ángeles


    It is well known that the polyamines spermidine and spermine, along with the diamine putrescine, are involved in many cellular processes and they are known to play an important role in the control of the innate immune response in higher vertebrates. However, to the best of our knowledge, no studies have focused on their immunological implications in other vertebrates, such as fish. For this reason, the effects of polyamines on the cellular innate immune response and immune-related gene expression were evaluated in vitro, using seabream head-kidney leucocytes (HKL). For this study, head-kidney leucocytes were incubated with the polyamines putrescine, spermine or spermidine (0.005 and 0.0025%) for 0.50, 1, 2 or 4 h. No significant effect was observed on either leucocyte viability or the innate cellular immune responses (peroxidase content and phagocytic and respiratory burst activities). The polyamines produced an increase in respiratory burst and phagocytic ability when leucocytes were incubated principally with putrescine (0.005 and 0.0025%) after 2 and 4 h of the experiment. Finally, the expression levels of immune-associated genes (IgM, MHCIα, MHCIIα, C3, IL-1β, CD8, Hep, NCCRP-1, CSF-1 and TLR) were quantified by real-time PCR and some of them (C3, MHCI, CD8, IgM and Hep) were up-regulated by the higher polyamine concentration. Further studies are needed to ascertain how polyamines control the immune system of seabream as well as which mechanisms are involved.

  16. Immunity-related genes in Ixodes scapularis--perspectives from genome information.


    Smith, Alexis A; Pal, Utpal


    Ixodes scapularis, commonly known as the deer tick, transmits a wide array of human and animal pathogens including Borrelia burgdorferi. Despite substantial advances in our understanding of immunity in model arthropods, including other disease vectors, precisely how I. scapularis immunity functions and influences persistence of invading pathogens remains largely unknown. This review provides a comprehensive analysis of the recently sequenced I. scapularis genome for the occurrence of immune-related genes and related pathways. We will also discuss the potential influence of immunity-related genes on the persistence of tick-borne pathogens with an emphasis on the Lyme disease pathogen B. burgdorferi. Further enhancement of our knowledge of tick immune responses is critical to understanding the molecular basis of the persistence of tick-borne pathogens and development of novel interventions against the relevant infections.

  17. Gene expression analysis reveals the dysregulation of immune and metabolic pathways in Alzheimer's disease

    PubMed Central

    Li, Zhiyan; Xu, Panpan; Yao, Lifen


    In recent years, several pathway analyses of genome-wide association studies reported the involvement of metabolic and immune pathways in Alzheimer's disease (AD). Until now, the exact mechanisms of these pathways in AD are still unclear. Here, we conducted a pathway analysis of a whole genome AD case-control expression dataset (n=41, 25 AD cases and 16 controls) from the human temporal cortex tissue. Using the differently expressed AD genes, we identified significant KEGG pathways related to metabolism and immune processes. Using the up- and down- regulated AD gene list, we further found up-regulated AD gene were significantly enriched in immune and metabolic pathways. We further compare the immune and metabolic KEGG pathways from the expression dataset with those from previous GWAS datasets, and found that most of these pathways are shared in both GWAS and expression datasets. PMID:27732949

  18. Surveillance of congenital rubella syndrome in Japan, 1978-2002: effect of revision of the immunization law.


    Katow, Shigetaka


    Infection of rubella virus at the early stages of pregnancy in women who are not immune to rubella often induces congenital anomalies in infants, namely congenital rubella syndrome (CRS). This paper is the first comprehensive report of CRS cases in Japan, compiled from a questionnaire to major hospitals, reports to journals and academic meetings, and cases for virus/virus genome verification submitted to the National Institute of Infectious Diseases. CRS incidence in Japan was determined to be 0.2-8.1 cases/100,000 live births per year in epidemic years and 0.1-0.7 in non-epidemic years, respectively. In the last 4 years, the number of CRS cases remarkably decreased to one-three cases per year. This decrease is thought to be because the immunization law was revised in 1994 for changing the focus of rubella immunization from junior high school girls to infants of both sexes.

  19. Inducible Defenses Stay Up Late: Temporal Patterns of Immune Gene Expression in Tenebrio molitor

    PubMed Central

    Johnston, Paul R; Makarova, Olga; Rolff, Jens


    The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. PMID:24318927

  20. Marek's disease virus-induced immunosuppression: array analysis of chicken immune response gene expression profiling.


    Heidari, Mohammad; Sarson, Aimie J; Huebner, Marianne; Sharif, Shayan; Kireev, Dmitry; Zhou, Huaijun


    Marek's disease (MD) is a lymphoproliferative disease of chickens induced by a highly cell-associated oncogenic alpha-herpesvirus, Marek's disease virus (MDV). MDV replicates in chicken lymphocytes and establishes a latency infection within CD4(+) T cells. Host-virus interaction, immune responses to infection, and transcriptional profiling of chicken gene expression in MD are poorly understood. In this study we conducted a global host gene expression analysis in the splenocytes of MDV-infected chickens using oligonucleotide-based Affymetrix GeneChip Chicken Genome Arrays. These arrays contain probes for more than 32,000 chicken transcripts and most of the known MDV genes and open reading frames. Two-week-old MD-susceptible chickens were inoculated with an oncogenic strain of MDV, and spleen samples were collected 5 and 15 days post-infection (dpi) for RNA isolation and microarray analysis. Array results displayed a significant differential pattern of immune response transcriptome between the two phases of MDV infection. The expression levels of more than 22 immune-response and related genes were downregulated, while the expression levels of at least 58 genes were increased at 5 dpi (cytolytic infection), compared to age-matched control birds. In comparison, out of 73 immune-response and related genes, 67 genes were downregulated, with only 6 genes having higher expression levels at 15 dpi (latency infection). Cytokines, chemokines, MHC molecules and related receptors, and adhesion molecules were among the many MDV-induced downregulated genes that are critical for an effective antiviral immune response. In addition, several apoptosis-associated genes were decreased in expression during latent infection, suggesting an MDV-induced blocking of initiation or progression of programmed cell death processes. These chicken arrays are valuable tools in understanding the molecular mechanisms behind viral pathogenesis and chicken gene expression patterns, and associated

  1. Specific Gene Expression Responses to Parasite Genotypes Reveal Redundancy of Innate Immunity in Vertebrates

    PubMed Central

    Haase, David; Rieger, Jennifer K.; Witten, Anika; Stoll, Monika; Bornberg-Bauer, Erich; Kalbe, Martin; Reusch, Thorsten B. H.


    Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus). By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes. PMID:25254967

  2. Genomic Signatures of Selective Pressures and Introgression from Archaic Hominins at Human Innate Immunity Genes

    PubMed Central

    Deschamps, Matthieu; Laval, Guillaume; Fagny, Maud; Itan, Yuval; Abel, Laurent; Casanova, Jean-Laurent; Patin, Etienne; Quintana-Murci, Lluis


    Human genes governing innate immunity provide a valuable tool for the study of the selective pressure imposed by microorganisms on host genomes. A comprehensive, genome-wide study of how selective constraints and adaptations have driven the evolution of innate immunity genes is missing. Using full-genome sequence variation from the 1000 Genomes Project, we first show that innate immunity genes have globally evolved under stronger purifying selection than the remainder of protein-coding genes. We identify a gene set under the strongest selective constraints, mutations in which are likely to predispose individuals to life-threatening disease, as illustrated by STAT1 and TRAF3. We then evaluate the occurrence of local adaptation and detect 57 high-scoring signals of positive selection at innate immunity genes, variation in which has been associated with susceptibility to common infectious or autoimmune diseases. Furthermore, we show that most adaptations targeting coding variation have occurred in the last 6,000–13,000 years, the period at which populations shifted from hunting and gathering to farming. Finally, we show that innate immunity genes present higher Neandertal introgression than the remainder of the coding genome. Notably, among the genes presenting the highest Neandertal ancestry, we find the TLR6-TLR1-TLR10 cluster, which also contains functional adaptive variation in Europeans. This study identifies highly constrained genes that fulfill essential, non-redundant functions in host survival and reveals others that are more permissive to change—containing variation acquired from archaic hominins or adaptive variants in specific populations—improving our understanding of the relative biological importance of innate immunity pathways in natural conditions. PMID:26748513

  3. Hepatitis A immunity in the District of Aveiro (Portugal): an eleven-year surveillance study (2002-2012).


    Pereira, Sara; Linhares, Inês; Neves, António Ferreira; Almeida, Adelaide


    Hepatitis A is a common viral liver disease and brings serious health and economic problems as its epidemiologic pattern changes over time. National serosurveys from developed countries have indicated a decline in HAV (hepatitis A virus) seroprevalence over time due to the improvement of economic and sanitation levels. The hepatitis A virus (HAV) immunity rate was surveyed throughout an eleven-year period by sex and age group in Aveiro District. In this retrospective study, blood samples from patients of Aveiro District, in ambulatory regime, collected at the Clinical Analysis Laboratory Avelab between 2002 and 2012 were screened for the presence of antibodies against HAV antigen using a chemiluminescence immunoassay. The global immunity (positive total anti-HAV) was 60% and only 0.3% of the patients presented recent infection by HAV (positive IgM anti-HAV). The HAV immunity was age-dependent (p < 0.05), but no significant differences (p > 0.05) between sexes were observed. The immunity was similar throughout the study period (p > 0.05). The results of this study indicate that young people (especially under 25 years old) from District of Aveiro are susceptible to HAV infection, constituting a high risk group. The elderly should be also a concern in the future of Hepatitis A infection.

  4. Hepatitis A Immunity in the District of Aveiro (Portugal): An Eleven-Year Surveillance Study (2002–2012)

    PubMed Central

    Pereira, Sara; Linhares, Inês; Neves, António Ferreira; Almeida, Adelaide


    Hepatitis A is a common viral liver disease and brings serious health and economic problems as its epidemiologic pattern changes over time. National serosurveys from developed countries have indicated a decline in HAV (hepatitis A virus) seroprevalence over time due to the improvement of economic and sanitation levels. The hepatitis A virus (HAV) immunity rate was surveyed throughout an eleven-year period by sex and age group in Aveiro District. In this retrospective study, blood samples from patients of Aveiro District, in ambulatory regime, collected at the Clinical Analysis Laboratory Avelab between 2002 and 2012 were screened for the presence of antibodies against HAV antigen using a chemiluminescence immunoassay. The global immunity (positive total anti-HAV) was 60% and only 0.3% of the patients presented recent infection by HAV (positive IgM anti-HAV). The HAV immunity was age-dependent (p < 0.05), but no significant differences (p > 0.05) between sexes were observed. The immunity was similar throughout the study period (p > 0.05). The results of this study indicate that young people (especially under 25 years old) from District of Aveiro are susceptible to HAV infection, constituting a high risk group. The elderly should be also a concern in the future of Hepatitis A infection. PMID:24638206

  5. Surveillance for adverse events following receipt of pandemic 2009 H1N1 vaccine in the Post-Licensure Rapid Immunization Safety Monitoring (PRISM) System, 2009-2010.


    Yih, W Katherine; Lee, Grace M; Lieu, Tracy A; Ball, Robert; Kulldorff, Martin; Rett, Melisa; Wahl, Peter M; McMahill-Walraven, Cheryl N; Platt, Richard; Salmon, Daniel A


    The Post-Licensure Rapid Immunization Safety Monitoring (PRISM) system is a cohort-based active surveillance network initiated by the US Department of Health and Human Services to supplement preexisting and other vaccine safety monitoring systems in tracking the safety of monovalent pandemic 2009 H1N1 influenza vaccine in the United States during 2009-2010. PRISM investigators conducted retrospective analysis to determine whether 2009 H1N1 vaccination was associated with increased risk of any of 14 prespecified outcomes. Five health insurance and associated companies with 38 million members and 9 state/city immunization registries contributed records on more than 2.6 million doses of 2009 H1N1 vaccine. Data on outcomes came from insurance claims. Complementary designs (self-controlled risk interval, case-centered, and current-vs.-historical comparison) were used to optimize control for confounding and statistical power. The self-controlled risk interval analysis of chart-confirmed Guillain-Barré syndrome found an elevated but not statistically significant incidence rate ratio following receipt of inactivated 2009 H1N1 vaccine (incidence rate ratio = 2.50, 95% confidence interval: 0.42, 15.0) and no cases following live attenuated 2009 H1N1 vaccine. The study did not control for infection prior to Guillain-Barré syndrome, which may have been a confounder. The risks of other health outcomes of interest were generally not significantly elevated after 2009 H1N1 vaccination.

  6. Expression of immune-related genes of common carp during cyprinid herpesvirus 3 infection.


    Sunarto, Agus; McColl, Kenneth A


    Fish herpesviruses and their hosts may have coevolved for 400 to 450 million yr. During this coexistence, the hosts have equipped themselves with an elaborate immune system to defend themselves from invading viruses, whereas the viruses have developed strategies to evade host immunity, including the expression of cytokine genes that have been captured from the host. Taking advantage of our experimental model for cyprinid herpesvirus 3 (CyHV-3) persistence in carp, we studied the gene expression of host and virus immune-related genes in each stage of infection: acute, persistent and reactivation phases. IFNγ-1, IFNγ-2, IL-12 and IL-10 host genes, and the CyHV-3 vIL-10 gene (khvIL-10) were highly significantly up-regulated in different phases of CyHV-3 infection. Similarly, host IL-1β was up-regulated in the acute phase of CyHV-3 infection. There was no significant difference in the expression of host TNFα-1 and MHC-II genes during all phases of CyHV-3 infection. Based on the expression profile of carp immune-related genes in each stage of CyHV-3 infection, we propose a possible interaction between carp IL-12, carp IL-10 and khvIL-10 during the course of viral infection. To our knowledge, this is the first report on the expression of cytokine genes during all phases (acute, persistent and reactivation) of CyHV-3 infection.

  7. Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis

    PubMed Central

    Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-hua; Xue, Dongbo


    Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including “immune response” as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma. PMID:28355233

  8. Adeno-associated virus (AAV) vectors in gene therapy: immune challenges and strategies to circumvent them.


    Hareendran, Sangeetha; Balakrishnan, Balaji; Sen, Dwaipayan; Kumar, Sanjay; Srivastava, Alok; Jayandharan, Giridhara R


    AAV-based gene transfer protocols have shown remarkable success when directed to immune-privileged sites such as for retinal disorders like Lebers congenital amaurosis. In contrast, AAV-mediated gene transfer into liver or muscle tissue for diseases such as hemophilia B, α1 anti-trypsin deficiency and muscular dystrophy has demonstrated a decline in gene transfer efficacy over time. It is now known that in humans, AAV triggers specific pathways that recruit immune sensors. These factors initiate an immediate reaction against either the viral capsid or the vector encoded protein as part of innate immune response or to produce a more specific adaptive response that generates immunological memory. The vector-transduced cells are then rapidly destroyed due to this immune activation. However, unlike other viral vectors, AAV is not immunogenic in murine models. Its immunogenicity becomes apparent only in large animal models and human subjects. Moreover, humans are natural hosts to AAV and exhibit a high seroprevalence against AAV vectors. This limits the widespread application of AAV vectors into patients with pre-existing neutralising antibodies or memory T cells. To address these issues, various strategies are being tested. Alternate serotype vectors (AAV1-10), efficient expression cassettes, specific tissue targeting, immune-suppression and engineered capsid variants are some approaches proposed to minimise this immune stimulation. In this review, we have summarised the nature of the immune response documented against AAV in various pre-clinical and clinical settings and have further discussed the strategies to evade them.

  9. Intradermal gene immunization: the possible role of DNA uptake in the induction of cellular immunity to viruses.

    PubMed Central

    Raz, E; Carson, D A; Parker, S E; Parr, T B; Abai, A M; Aichinger, G; Gromkowski, S H; Singh, M; Lew, D; Yankauckas, M A


    The skin and mucous membranes are the anatomical sites were most viruses are first encountered by the immune system. Previous experiments have suggested that striated muscle cells are unique among mammalian cell types in their capacity to take up and express free DNA in the absence of a viral vector or physical carrier. However, we have found that mice injected into the superficial skin with free (naked) plasmid DNA encoding the influenza nucleoprotein gene had discrete foci of epidermal and dermal cells, including cells with dendritic morphology, that contained immunoreactive nucleoprotein antigen. A single intradermal administration of 0.3-15 micrograms of free plasmid DNA induced anti-nucleoprotein-specific antibody and cytotoxic T lymphocytes that persisted for at least 68-70 weeks after vaccination. Intradermal gene administration induced higher antibody titers than did direct gene injection into skeletal muscle and did not cause local inflammation or necrosis. Compared with control animals, the gene-injected mice were resistant to challenge with a heterologous strain of influenza virus. These results indicate that the cells of the skin can take up and express free foreign DNA and induce cellular and humoral immune responses against the encoded protein. We suggest that DNA uptake by the skin-associated lymphoid tissues may play a role in the induction of cytotoxic T cells against viruses and other intracellular pathogens. Images PMID:7937799

  10. Feminizing Wolbachia: a transcriptomics approach with insights on the immune response genes in Armadillidium vulgare

    PubMed Central


    Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals) and uninfected ones (i.e., “asymbiotic” animals) as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen). Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host immunity when females are

  11. Revealing Shared and Distinct Gene Network Organization in Arabidopsis Immune Responses by Integrative Analysis1

    PubMed Central

    Dong, Xiaobao; Jiang, Zhenhong; Peng, You-Liang; Zhang, Ziding


    Pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) are two main plant immune responses to counter pathogen invasion. Genome-wide gene network organizing principles leading to quantitative differences between PTI and ETI have remained elusive. We combined an advanced machine learning method and modular network analysis to systematically characterize the organizing principles of Arabidopsis (Arabidopsis thaliana) PTI and ETI at three network resolutions. At the single network node/edge level, we ranked genes and gene interactions based on their ability to distinguish immune response from normal growth and successfully identified many immune-related genes associated with PTI and ETI. Topological analysis revealed that the top-ranked gene interactions tend to link network modules. At the subnetwork level, we identified a subnetwork shared by PTI and ETI encompassing 1,159 genes and 1,289 interactions. This subnetwork is enriched in interactions linking network modules and is also a hotspot of attack by pathogen effectors. The subnetwork likely represents a core component in the coordination of multiple biological processes to favor defense over development. Finally, we constructed modular network models for PTI and ETI to explain the quantitative differences in the global network architecture. Our results indicate that the defense modules in ETI are organized into relatively independent structures, explaining the robustness of ETI to genetic mutations and effector attacks. Taken together, the multiscale comparisons of PTI and ETI provide a systems biology perspective on plant immunity and emphasize coordination among network modules to establish a robust immune response. PMID:25614062

  12. Innate immune gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.


    Shaughnessy, Ronan G; Meade, Kieran G; Cahalane, Sarah; Allan, Brenda; Reiman, Carla; Callanan, John J; O'Farrelly, Cliona


    Salmonella enterica serovar Typhimurium and Campylobacter jejuni are major human pathogens, yet colonise chickens without causing pathology. The aim of this study was to compare intestinal innate immune responses to both bacterial species, in a 4-week-old broiler chicken model. Challenged and control birds were sacrificed and tissue samples taken for histopathology and RNA extraction. No significant clinical or pathological changes were observed in response to infection with either bacterial species. Expression of selected genes involved in pathogen detection and the innate immune response were profiled in caecal tissues by quantitative real-time PCR. TLR4 and TLR21 gene expression was transiently increased in response to both bacterial species (P<0.05). Significant increases in TLR5 and TLR15 gene expression were detected in response to S. Typhimurium but not to C. jejuni. Transient increases of proinflammatory cytokine (IL6 and IFNG) and chemokine (IL8 and K60) genes increased as early as 6h in response to S. Typhimurium. Minimal cytokine gene expression was detected in response to C. jejuni after 20h. IL8 gene expression however, was significantly increased by 24-fold (P<0.01). The differential expression profiles of innate immune genes in both infection models shed light on the tailored responses of the host immune system to specific microbes. It is further evidence that innate regulation of these responses is an important prerequisite to preventing development of disease.

  13. Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.


    Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M


    We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp.

  14. Cancer-targeted BikDD gene therapy elicits protective antitumor immunity against lung cancer.


    Sher, Yuh-Pyng; Liu, Shih-Jen; Chang, Chun-Mien; Lien, Shu-Pei; Chen, Chien-Hua; Han, Zhenbo; Li, Long-Yuan; Chen, Jin-Shing; Wu, Cheng-Wen; Hung, Mien-Chie


    Targeted cancer-specific gene therapy is a promising strategy for treating metastatic lung cancer, which is a leading cause of lung cancer-related deaths. Previously, we developed a cancer-targeted gene therapy expression system with high tumor specificity and strong activity that selectively induced lung cancer cell killing without affecting normal cells in immunocompromised mice. Here, we found this cancer-targeted gene therapy, SV-BikDD, composed of the survivin promoter in the VP16-GAL4-WPRE integrated systemic amplifier system to drive the apoptotic gene BikDD, not only caused cytotoxic effects in cancer cells but also elicited a cancer-specific cytotoxic T lymphocyte response to synergistically increase the therapeutic effect and further develop an effective systemic antitumoral immunity against rechallenges of tumorigenic dose of parental tumor cells inoculated at distant sites in immunocompetent mice. In addition, this cancer-targeted gene therapy does not elicit an immune response against normal tissues, but CMV-BikDD treatment does. The therapeutic vector could also induce proinflammatory cytokines to activate innate immunity and provide some benefits in antitumor gene therapy. Thus, this study provides a promising strategy with benefit of antitumoral immune response worthy of further development in clinical trials for treating lung cancer via cancer-targeted gene therapy.

  15. In vivo monitoring of transfected DNA, gene expression kinetics, and cellular immune responses in mice immunized with a human NIS gene-expressing plasmid.


    Son, Hye-Youn; Jeon, Yong-Hyun; Chung, June-Key; Kim, Chul-Woo


    In assessing the effectiveness of DNA vaccines, it is important to monitor: (1) the kinetics of target gene expression in vivo; and (2) the movement of cells that become transfected with the plasmid DNA used in the immunization of a subject. In this study, we used, as a visual imaging marker, expression of the transfected human sodium/iodide symporter (hNIS) gene, which enhances intracellular radio-pertechnetate (TcO4-) accumulation. After intradermal (i.d.) and systemic injection of mice with pcDNA-hNIS and radioactive Technetium-99m (Tc-99m), respectively, whole-body images were obtained by nuclear scintigraphy. The migration of mice cells transfected with the hNIS gene was monitored over a 2-week period by gamma-radioactivity counting of isolated cell populations and was demonstrated in peripheral lymphoid tissues, especially in the draining lymph nodes (dLNs). Beginning at 24 h after DNA inoculation and continuing for the 2-week monitoring period, hNIS-expressing cells were observed specifically in the T-cell-rich zones of the paracortical area of the dLNs. Over the same time period, high levels of INF-γ-secreting CD8 T-cells were found in the dLNs of the pcDNA-hNIS immunized mice. Tumor growth was also significantly retarded in the mice that received hNIS DNA immunization followed by inoculation with CT26 colorectal adenocarcinoma cells that had been transfected with the rat NIS gene (rNIS), which is 93% homologous to the hNIS gene. In conclusion, mouse cells transfected with hNIS DNA after i.d. immunization were found to traffic to the dLNs, and hNIS gene expression in these cells continued for at least 2 weeks post immunization. Furthermore, sequential presentation of NIS DNA to T-cells by migratory antigen presenting cells could induce NIS DNA-specific Th1 immune responses and thus retard the growth of NIS-expressing tumors.

  16. AAV gene transfer to the retina does not protect retrovirally transduced hepatocytes from the immune response.


    Bellodi-Privato, Marta; Le Meur, Guylène; Aubert, Dominique; Mendes-Madera, Alexandra; Pichard, Virginie; Rolling, Fabienne; Ferry, Nicolas


    Gene therapy of inherited hepatic disease relies on sustained expression of the therapeutic transgene. In many instances, such expression will require immune tolerization to the non-self therapeutic transgene product. We previously demonstrated that a cytotoxic immune response eliminated hepatocytes after in vivo transduction using recombinant retroviral vectors. In the present study we investigated whether prior gene transfer to the retina, which is suspected to induce immune tolerance, could alleviate the immune response occurring after retrovirus mediated gene transfer to the liver. Retinal cells were transduced using adeno-associated viral vectors harbouring a beta-galactosidase transgene. Sixty days later, regenerating hepatocytes were transduced after partial hepatectomy using a recombinant retrovirus carrying the transgene. Three weeks later, anti beta-galactosidase antibodies were present in all animals. Elimination of the transduced hepatocytes eventually occurred in all animals by 2 months after liver gene transfer, although sustained beta-galactosidase expression was still present in the retina in 66% of the animals. We conclude that although the retina behaves as an immunoprivileged site, gene expression in the subretinal space is not sufficient to induce immune tolerance to a transgene product expressed in the liver.

  17. Evolutionary History of the Cancer Immunity Antigen MAGE Gene Family

    PubMed Central

    Katsura, Yukako; Satta, Yoko


    The evolutionary mode of a multi-gene family can change over time, depending on the functional differentiation and local genomic environment of family members. In this study, we demonstrate such a change in the melanoma antigen (MAGE) gene family on the mammalian X chromosome. The MAGE gene family is composed of ten subfamilies that can be categorized into two types. Type I genes are of relatively recent origin, and they encode epitopes for human leukocyte antigen (HLA) in cancer cells. Type II genes are relatively ancient and some of their products are known to be involved in apoptosis or cell proliferation. The evolutionary history of the MAGE gene family can be divided into four phases. In phase I, a single-copy state of an ancestral gene and the evolutionarily conserved mode had lasted until the emergence of eutherian mammals. In phase II, eight subfamily ancestors, with the exception for MAGE-C and MAGE-D subfamilies, were formed via retrotransposition independently. This would coincide with a transposition burst of LINE elements at the eutherian radiation. However, MAGE-C was generated by gene duplication of MAGE-A. Phase III is characterized by extensive gene duplication within each subfamily and in particular the formation of palindromes in the MAGE-A subfamily, which occurred in an ancestor of the Catarrhini. Phase IV is characterized by the decay of a palindrome in most Catarrhini, with the exception of humans. Although the palindrome is truncated by frequent deletions in apes and Old World monkeys, it is retained in humans. Here, we argue that this human-specific retention stems from negative selection acting on MAGE-A genes encoding epitopes of cancer cells, which preserves their ability to bind to highly divergent HLA molecules. These findings are interpreted with consideration of the biological factors shaping recent human MAGE-A genes. PMID:21695252

  18. Strategies to Modulate Immune Responses: A New Frontier for Gene Therapy

    PubMed Central

    Arruda, Valder R; Favaro, Patricia; Finn, Jonathan D


    The success of gene therapy strategies to cure disease relies on the control of unwanted immune responses to transgene products, genetically modified cells and/or to the vector. Effective treatment of an established immune response is much harder to achieve than prevention of a response before it has had a chance to develop. However, preventive strategies are not always effective in avoiding immune responses, thus the use of drugs to induce immunosuppression (IS) is required. The growing discovery of novel drugs provides a conceptual shift from using generalized, moderately intensive immunosuppressive regimens towards a refined approach to attain the optimal balance of naive cells, effector cells, memory cells, and regulatory cells, harnessing the natural tolerance mechanisms of the body. We review several strategies based on transient IS coupled with gene therapy for sustained immune tolerance induction to the therapeutic transgene. PMID:19584819

  19. ImmuSort, a database on gene plasticity and electronic sorting for immune cells

    PubMed Central

    Wang, Pingzhang; Yang, Yehong; Han, Wenling; Ma, Dalong


    Gene expression is highly dynamic and plastic. We present a new immunological database, ImmuSort. Unlike other gene expression databases, ImmuSort provides a convenient way to view global differential gene expression data across thousands of experimental conditions in immune cells. It enables electronic sorting, which is a bioinformatics process to retrieve cell states associated with specific experimental conditions that are mainly based on gene expression intensity. A comparison of gene expression profiles reveals other applications, such as the evaluation of immune cell biomarkers and cell subsets, identification of cell specific and/or disease-associated genes or transcripts, comparison of gene expression in different transcript variants and probe set quality evaluation. A plasticity score is introduced to measure gene plasticity. Average rank and marker evaluation scores are used to evaluate biomarkers. The current version includes 31 human and 17 mouse immune cell groups, comprising 10,422 and 3,929 microarrays derived from public databases, respectively. A total of 20,283 human and 20,963 mouse genes are available to query in the database. Examples show the distinct advantages of the database. The database URL is PMID:25988315

  20. Characterization of the rainbow trout spleen transcriptome and identification of immune-related genes

    PubMed Central

    Ali, Ali; Rexroad, Caird E.; Thorgaard, Gary H.; Yao, Jianbo; Salem, Mohamed


    Resistance against diseases affects profitability of rainbow trout. Limited information is available about functions and mechanisms of teleost immune pathways. Immunogenomics provides powerful tools to determine disease resistance genes/gene pathways and develop genetic markers for genomic selection. RNA-Seq sequencing of the rainbow trout spleen yielded 93,532,200 reads (100 bp). High quality reads were assembled into 43,047 contigs. 26,333 (61.17%) of the contigs had hits to the NR protein database and 7024 (16.32%) had hits to the KEGG database. Gene ontology showed significant percentages of transcripts assigned to binding (51%), signaling (7%), response to stimuli (9%) and receptor activity (4%) suggesting existence of many immune-related genes. KEGG annotation revealed 2825 sequences belonging to “organismal systems” with the highest number of sequences, 842 (29.81%), assigned to immune system. A number of sequences were identified for the first time in rainbow trout belonging to Toll-like receptor signaling (35), B cell receptor signaling pathway (44), T cell receptor signaling pathway (56), chemokine signaling pathway (73), Fc gamma R-mediated phagocytosis (52), leukocyte transendothelial migration (60) and NK cell mediated cytotoxicity (42). In addition, 51 transcripts were identified as spleen-specific genes. The list includes 277 full-length cDNAs. The presence of a large number of immune-related genes and pathways similar to other vertebrates suggests that innate and adaptive immunity in fish are conserved. This study provides deep-sequence data of rainbow trout spleen transcriptome and identifies many new immune-related genes and full-length cDNAs. This data will help identify allelic variations suitable for genomic selection and genetic manipulation in aquaculture. PMID:25352861

  1. Immunization


    ... remembers" the germ and can fight it again. Vaccines contain germs that have been killed or weakened. When given to a healthy person, the vaccine triggers the immune system to respond and thus ...

  2. Therapeutic antibody gene transfer: an active approach to passive immunity.


    Bakker, Joost M; Bleeker, Wim K; Parren, Paul W H I


    Advances in gene transfer approaches are enabling the possibility of applying therapeutic antibodies using DNA. In particular gene transfer in combination with electroporation is promising and can result in generating in vivo antibody concentrations in the low therapeutic range. However, several important problems need to be dealt with before antibody gene transfer can become a valuable supplement to the current therapies. As antibody production following gene transfer is difficult to control, the danger of inducing autoimmune conditions or uncontrollable side effects occurs in cases in which autologous antigens are targeted. It is suggested that the most promising area of application therefore appears to be infectious disease in which heterologous antigens are targeted and concerns for long-term antibody exposure are minimal. Finally, genes encoding fully human antibodies will enhance long-term expression and decrease problems linked to immunogenicity.

  3. De novo annotation of the immune-enriched transcriptome provides insights into immune system genes of Chinese sturgeon (Acipenser sinensis).


    Zhu, Rong; Du, He-Jun; Li, Shun-Yi; Li, Ya-Dong; Ni, Hong; Yu, Xue-Jing; Yang, Yan-Yan; Fan, Yu-Ding; Jiang, Nan; Zeng, Ling-Bing; Wang, Xing-Guo


    Chinese sturgeon (Acipenser sinensis), one of the oldest extant actinopterygian fishes with very high evolutionary, economical and conservation interest, is considered to be one of the critically endangered aquatic animals in China. Up to date, the immune system of this species remains largely undetermined with little sequence information publicly available. Herein, the first comprehensive transcriptome of immune tissues for Chinese sturgeon was characterized using Illumina deep sequencing. Over 67 million high-quality reads were generated and de novo assembled into the final set of 91,739 unique sequences. The annotation pipeline revealed that 25,871 unigenes were successfully annotated in the public databases, of which only 2002 had significant match to the existing sequences for the genus Acipenser. Overall 22,827 unigenes were categorized into 52 GO terms, 12,742 were classified into 26 KOG categories, and 4968 were assigned to 339 KEGG pathways. A more detailed annotation search showed the presence of a notable representation of immune-related genes, which suggests that this non-teleost actinopterygian fish harbors the same intermediates as in the well known immune pathways from mammals and teleosts, such as pattern recognition receptor (PRR) signaling pathway, JAK-STAT signaling pathway, complement and coagulation pathway, T-cell receptor (TCR) and B-cell receptor (BCR) signaling pathways. Additional genetic marker discovery led to the retrieval of 20,056 simple sequence repeats (SSRs) and 327,140 single nucleotide polymorphisms (SNPs). This immune-enriched transcriptome of Chinese sturgeon represents a rich resource that adds to the currently nascent field of chondrostean fish immunogenetics and furthers the conservation and management of this valuable fish.

  4. [The relationship between the polymorphism of immunity genes and both aging and age-related diseases].


    Ruan, Qing-Wei; Yu, Zhuo-Wei; Bao, Zhi-Jun; Ma, Yong-Xing


    Aging is acommon, progressive and irreversible state of multi-cell dysfunction. Immune aging mainly includes the declines of regenerative capacity and lymphoid lineage differentiation potential, the hyporesponsive to infection and vaccination, the hyperresponsive in the context of inflammatory pathology, and the increased risk of autoimmunity. The dysfunction of aged immune system accelerates the occurrence of aging and age-related diseases. The mutation of immunity genes that affect immune responses accelerates or slows aging process and age-related diseases. The frequencies of acquired immunity genes, such as immune protective HLA II DRB1*11 and DRB*16-associated haplotype, are increased in the longevity populations. The increased susceptibility of immune inflammatory response, morbidity and mortality in the elderly is often associated with decreased frequencies of anti-inflammatory factor IL-10 -1082G allele, TNF-β1 haplotype cnd10T/C, cnd25G/G, -988C/C, -800G/A, low proinflammatory fator TNFa level related extended TNF-A genotype -1031C/C, -863C/A, -857C/C, IL-6-174 CC and IFN-γ+874 T allele as well. The innate immunity genes, such as highly expressed anti-inflammatory +896 G KIR4 allele, CCR5Δ32 variant, -765 C Cox-2 allele, -1708 G and 21 C 5-Lox alleles are detected in centenarians. In age-related diseases, a higher CMV-specific IgG antibody level in elderly individuals is associated with a decreased frequency of KIR haplotypes KIR2DS5 and A1B10 and an increased frequency of MBL2 haplotypes LYPB, LYQC and HYPD that result in the absence of MBL2 protein. The increased frequencies of CRP ATG haplotypes and CFH 402 His allele indicate high mortality in the elderly. In the present study, we review the advances in the polymorphism and haplotype of innate and adoptive immunity genes, and their association with both aging and age-related diseases. To strengthen the analysis of extended haplotypes, epigenetic studies of immunity genes and genetic study of

  5. Exploiting Gene-Expression Deconvolution to Probe the Genetics of the Immune System.


    Steuerman, Yael; Gat-Viks, Irit


    Sequence variation can affect the physiological state of the immune system. Major experimental efforts targeted at understanding the genetic control of the abundance of immune cell subpopulations. However, these studies are typically focused on a limited number of immune cell types, mainly due to the use of relatively low throughput cell-sorting technologies. Here we present an algorithm that can reveal the genetic basis of inter-individual variation in the abundance of immune cell types using only gene expression and genotyping measurements as input. Our algorithm predicts the abundance of immune cell subpopulations based on the RNA levels of informative marker genes within a complex tissue, and then provides the genetic control on these predicted immune traits as output. A key feature of the approach is the integration of predictions from various sets of marker genes and refinement of these sets to avoid spurious signals. Our evaluation of both synthetic and real biological data shows the significant benefits of the new approach. Our method, VoCAL, is implemented in the freely available R package ComICS.

  6. Exploiting Gene-Expression Deconvolution to Probe the Genetics of the Immune System

    PubMed Central

    Steuerman, Yael; Gat-Viks, Irit


    Sequence variation can affect the physiological state of the immune system. Major experimental efforts targeted at understanding the genetic control of the abundance of immune cell subpopulations. However, these studies are typically focused on a limited number of immune cell types, mainly due to the use of relatively low throughput cell-sorting technologies. Here we present an algorithm that can reveal the genetic basis of inter-individual variation in the abundance of immune cell types using only gene expression and genotyping measurements as input. Our algorithm predicts the abundance of immune cell subpopulations based on the RNA levels of informative marker genes within a complex tissue, and then provides the genetic control on these predicted immune traits as output. A key feature of the approach is the integration of predictions from various sets of marker genes and refinement of these sets to avoid spurious signals. Our evaluation of both synthetic and real biological data shows the significant benefits of the new approach. Our method, VoCAL, is implemented in the freely available R package ComICS. PMID:27035464

  7. Systemic protein delivery by muscle-gene transfer is limited by a local immune response

    PubMed Central

    Wang, Lixin; Dobrzynski, Eric; Schlachterman, Alexander; Cao, Ou; Herzog, Roland W.


    Adeno-associated viral (AAV) vectors have been successfully used for therapeutic expression of systemic transgene products (such as factor IX or erythropoietin) following in vivo administration to skeletal muscle of animal models of inherited hematologic disorders. However, an immune response may be initiated if the transgene product represents a neoantigen. Here, we use ovalbumin (OVA) as a model antigen and demonstrate immune-mediated elimination of expression on muscle-directed AAV-2 gene transfer. Administration to immune competent mice resulted in transient systemic OVA expression. Within 10 days, OVA-specific T-helper cells had been activated in draining lymph nodes, an inflammatory immune response ensued, and OVA-expressing muscle fibers were destroyed by a cytotoxic CD8+ T-cell response. Use of a muscle-specific promoter did not prevent this immune response. Adoptively transferred CD4+ cells transgenic for a T-cell receptor specific to OVA peptide-major histocompatibility complex class II showed antigen-specific, vector dose-dependent proliferation confined to the draining lymph nodes of AAV-OVA–transduced muscle within 5 days after gene transfer and subsequently participated in lymphocytic infiltration of transduced muscle. This study documents that a local immune response limits sustained expression of a secreted protein in muscle gene transfer, a finding that may have consequences for design of clinical protocols. PMID:15713796

  8. Microgravity and immunity: Changes in lymphocyte gene expression.

    NASA Astrophysics Data System (ADS)

    Risin, D.; Ward, N. E.; Risin, S. A.; Pellis, N. R.

    Earlier studies had shown that modeled and true microgravity MG cause multiple direct effects on human lymphocytes MG inhibits lymphocyte locomotion suppresses polyclonal and antigen-specific activation affects signal transduction mechanisms as well as activation-induced apoptosis In this study we assessed changes in gene expression associated with lymphocyte exposure to microgravity in an attempt to identify microgravity-sensitive genes MGSG in general and specifically those genes that might be responsible for the functional and structural changes observed earlier Two sets of experiments targeting different goals were conducted In the first set T-lymphocytes from normal donors were activated with anti-CD3 and IL2 and then cultured in 1g static and modeled MG MMG conditions Rotating Wall Vessel bioreactor for 24 hours This setting allowed searching for MGSG by comparison of gene expression patterns in zero and 1 g gravity In the second set - activated T-cells after culturing for 24 hours in 1g and MMG were exposed three hours before harvesting to a secondary activation stimulus PHA thus triggering the apoptotic pathway Total RNA was extracted using the RNeasy isolation kit Qiagen Valencia CA Affymetrix Gene Chips U133A allowing testing for 18 400 human genes were used for microarray analysis The experiments were performed in triplicates with T-cells obtained from different blood donors to minimize the possible input of biological variation in gene expression and discriminate changes that are associated with the

  9. Complement C3 gene: Expression characterization and innate immune response in razor clam Sinonovacula constricta.


    Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale


    Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta.

  10. Identification of immunity-related genes in the burying beetle Nicrophorus vespilloides by suppression subtractive hybridization.


    Vogel, H; Badapanda, C; Vilcinskas, A


    Burying beetles reproduce on small vertebrate cadavers which they bury in the soil after localization through volatiles emitted from the carcass. They then chemically preserve the carcass and prepare it as a diet for the adults and their offspring. It is predicted that exposure to high loads of soil and/or carrion-associated microbes necessitates an effective immune system. In the present paper, we report experimental screening for immunity-related genes in the burying beetle Nicrophorus vespilloides using the suppression subtractive hybridization approach. A total of 1179 putative gene objects were identified in the Nicrophorus cDNA library, which was enriched for transcripts differentially expressed upon challenge with heat-inactivated bacteria. In addition to genes known to be involved in immunity-related recognition and signalling, we found transcripts encoding for antimicrobial peptides and for an array of enzymes that can be linked to immunity or to stress-induced pathways. We also determined proteins that may contribute to detoxification of toxins produced by microbial competitors. In addition, factors involved in mRNA stability determination and central components of the RNA interference machinery were identified, implying transcriptional reprogramming and potential stress-induced retrotransposon elimination. The identified candidate immune effector and stress-related genes may provide important information about the unusual ecology and evolution of the burying beetles.

  11. Natural genetic variation profoundly regulates gene expression in immune cells and dictates susceptibility to CNS autoimmunity.


    Bearoff, F; Del Rio, R; Case, L K; Dragon, J A; Nguyen-Vu, T; Lin, C-Y; Blankenhorn, E P; Teuscher, C; Krementsov, D N


    Regulation of gene expression in immune cells is known to be under genetic control, and likely contributes to susceptibility to autoimmune diseases such as multiple sclerosis (MS). How this occurs in concert across multiple immune cell types is poorly understood. Using a mouse model that harnesses the genetic diversity of wild-derived mice, more accurately reflecting genetically diverse human populations, we provide an extensive characterization of the genetic regulation of gene expression in five different naive immune cell types relevant to MS. The immune cell transcriptome is shown to be under profound genetic control, exhibiting diverse patterns: global, cell-specific and sex-specific. Bioinformatic analysis of the genetically controlled transcript networks reveals reduced cell type specificity and inflammatory activity in wild-derived PWD/PhJ mice, compared with the conventional laboratory strain C57BL/6J. Additionally, candidate MS-GWAS (genome-wide association study candidate genes for MS susceptibility) genes were significantly enriched among transcripts overrepresented in C57BL/6J cells compared with PWD. These expression level differences correlate with robust differences in susceptibility to experimental autoimmune encephalomyelitis, the principal model of MS, and skewing of the encephalitogenic T-cell responses. Taken together, our results provide functional insights into the genetic regulation of the immune transcriptome, and shed light on how this in turn contributes to susceptibility to autoimmune disease.

  12. Microgravity and Immunity: Changes in Lymphocyte Gene Expression

    NASA Technical Reports Server (NTRS)

    Risin, D.; Pellis, N. R.; Ward, N. E.; Risin, S. A.


    Earlier studies had shown that modeled and true microgravity (MG) cause multiple direct effects on human lymphocytes. MG inhibits lymphocyte locomotion, suppresses polyclonal and antigen-specific activation, affects signal transduction mechanisms, as well as activation-induced apoptosis. In this study we assessed changes in gene expression associated with lymphocyte exposure to microgravity in an attempt to identify microgravity-sensitive genes (MGSG) in general and specifically those genes that might be responsible for the functional and structural changes observed earlier. Two sets of experiments targeting different goals were conducted. In the first set, T-lymphocytes from normal donors were activated with antiCD3 and IL2 and then cultured in 1g (static) and modeled MG (MMG) conditions (Rotating Wall Vessel bioreactor) for 24 hours. This setting allowed searching for MGSG by comparison of gene expression patterns in zero and 1 g gravity. In the second set - activated T-cells after culturing for 24 hours in 1g and MMG were exposed three hours before harvesting to a secondary activation stimulus (PHA) thus triggering the apoptotic pathway. Total RNA was extracted using the RNeasy isolation kit (Qiagen, Valencia, CA). Affymetrix Gene Chips (U133A), allowing testing for 18,400 human genes, were used for microarray analysis. In the first set of experiments MMG exposure resulted in altered expression of 89 genes, 10 of them were up-regulated and 79 down-regulated. In the second set, changes in expression were revealed in 85 genes, 20 were up-regulated and 65 were down-regulated. The analysis revealed that significant numbers of MGS genes are associated with signal transduction and apoptotic pathways. Interestingly, the majority of genes that responded by up- or down-regulation in the alternative sets of experiments were not the same, possibly reflecting different functional states of the examined T-lymphocyte populations. The responder genes (MGSG) might play an

  13. Altered expression of immune-related genes in children with Down syndrome.


    Zampieri, Bruna Lancia; Biselli-Périco, Joice Matos; de Souza, Jorge Estefano Santana; Bürger, Matheus Carvalho; Silva Júnior, Wilson Araújo; Goloni-Bertollo, Eny Maria; Pavarino, Erika Cristina


    Individuals with Down syndrome (DS) have a high incidence of immunological alterations with increased susceptibility to bacterial and viral infections and high frequency of different types of hematologic malignancies and autoimmune disorders. In the current study, we profiled the expression pattern of 92 immune-related genes in peripheral blood mononuclear cells (PBMCs) of two different groups, children with DS and control children, to identify differentially expressed genes that might be of pathogenetic importance for the development and phenotype of the immunological alterations observed in individuals with DS. PBMCs samples were obtained from six DS individuals with karyotypically confirmed full trisomy 21 and six healthy control individuals (ages 2-6 years). Gene expression was profiled in duplicate according to the manufacturer's instructions provided by commercially available TaqMan Human Immune Array representing 92 immune function genes and four reference genes on a 96-plex gene card. A set of 17 differentially expressed genes, not located on chromosome 21 (HSA21), involved in immune and inflammatory pathways was identified including 13 genes (BCL2, CCL3, CCR7, CD19, CD28, CD40, CD40LG, CD80, EDN1, IKBKB, IL6, NOS2 and SKI) significantly down-regulated and four genes (BCL2L1, CCR2, CCR5 and IL10) significantly up-regulated in children with DS. These findings highlight a list of candidate genes for further investigation into the molecular mechanism underlying DS pathology and reinforce the secondary effects of the presence of a third copy of HSA21.

  14. Multiplex immune-related genes expression analysis response to bacterial challenge in mud crab, Scylla paramamosain.


    Zhang, Fengying; Jiang, Keji; Sun, Manman; Zhang, Dan; Ma, Lingbo


    Crabs lack an acquired adaptive immune system and host defense is believed to depend entirely on innate, non-adaptive mechanisms to resist invasion by pathogens. Discovery of immune-related factors are helpful for understanding the molecular response of crabs to pathogens. The mud crab Scylla paramamosain is an important marine species for aquaculture in China because of its high nutritional value for humans. In recent years, the crab is prone to being infected by microbes with the enlargement of breeding scale. In this study, eight immune-related genes were analyzed by multiplex genes expression analysis using the GenomeLab GeXP analysis system (Beckman Coulter). The expression levels of all the detected genes rose after challenged by the live bacteria, but the levels of only four genes (C-type lectin, alpha 2-macroglobulin, HSP70 and thioredoxin 1) increased after challenge in heat-killed bacteria group. So the live bacteria were more effective in motivating expressions of immune factors than heat-killed bacteria. However, the transcript of C-type lectin firstly increased at 1 h after challenge in both heat-killed and live bacteria group. This indicated that C-type lectin was a quite susceptive immune factor responding to external pathogen. In group challenged by live bacteria, the genes of alpha 2-macroglobulin, HSP40, thioredoxin 1 and prophenoloxidase activating factor (PPAF) showed response earlier than the other genes. The rise of PPAF expression preceded prophenoloxidase (proPO), which suggested that PPAF might trigger production of proPO transcripts in the early stage of phenoloxidase reaction system. C-type lectin, proPO, thioredoxin 1, HSP40, and alpha 2-macroglobulin are very important immunity factors in response to bacterial infection. According to the result of heat-killed group, HSP70 is a sensitively inductive factor to foreign stimulus compared with the other genes. The multi-gene analysis presented an alternative approach for screening of immune

  15. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.


    Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R


    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

  16. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing

    PubMed Central

    Vannette, Rachel L.; Mohamed, Abbas; Johnson, Brian R.


    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging. PMID:26549293

  17. Nucleic acid vaccination of Brucella abortus ribosomal L7/L12 gene elicits immune response.


    Kurar, E; Splitter, G A


    Nucleic acid vaccines provide an exciting approach for antigen presentation to the immune system. As a test of this new methodology, the immune response to the in vivo-expressed Brucella abortus ribosomal L7/12 gene in the muscle cells of mice was examined. To accomplish this goal the eukaryotic expression systems pcDNA3 and p6 were used. Single intramuscular injection of the L7/L12 gene driven by the human cytomegalovirus (CMV) promoter (pcDNA3) or bovine MHC 1 promoter (p6) resulted in intracellular expression of the B. abortus L7/L12 immunodominant protein encoded by this gene. This application facilitated directed antigen presentation to the immune system and established specific antibody and T-cell responses compared with vector only (pcDNA3) negative controls and B. abortus S19 injected positive controls. Although pcDNA3-encoded L7/L12 gene-inoculated mice possessed significant protection, p6-L7/L12 did not engender significant protection against B. abortus S2308 infection compared to positive control mice. These data suggest a promising antigen-specific response, and L7/L12 nucleic acid vaccination may be an initial step in the development of genetically engineered candidate vaccines against brucellosis. This study for the first time focuses on DNA immunization of a gene from B. abortus.

  18. Eda haplotypes in three-spined stickleback are associated with variation in immune gene expression

    PubMed Central

    Robertson, Shaun; Bradley, Janette E.; MacColl, Andrew D. C.


    Haplotypes underlying local adaptation and speciation are predicted to have numerous phenotypic effects, but few genes involved have been identified, with much work to date concentrating on visible, morphological, phenotypes. The link between genes controlling these adaptive morphological phenotypes and the immune system has seldom been investigated, even though changes in the immune system could have profound adaptive consequences. The Eda gene in three-spined stickleback is one of the best studied major adaptation genes; it directly controls bony plate architecture and has been associated with additional aspects of adaptation to freshwater. Here, we exposed F2 hybrids, used to separate Eda genotype from genetic background, to contrasting conditions in semi-natural enclosures. We demonstrate an association between the Eda haplotype block and the expression pattern of key immune system genes. Furthermore, low plated fish grew less and experienced higher burdens of a common ectoparasite with fitness consequences. Little is currently known about the role of the immune system in facilitating adaptation to novel environments, but this study provides an indication of its potential importance. PMID:28195171

  19. Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).


    Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine


    The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species.

  20. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others


    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  1. An MHC class I immune evasion gene of Marek׳s disease virus.


    Hearn, Cari; Preeyanon, Likit; Hunt, Henry D; York, Ian A


    Marek׳s disease virus (MDV) is a widespread α-herpesvirus of chickens that causes T cell tumors. Acute, but not latent, MDV infection has previously been shown to lead to downregulation of cell-surface MHC class I (Virology 282:198-205 (2001)), but the gene(s) involved have not been identified. Here we demonstrate that an MDV gene, MDV012, is capable of reducing surface expression of MHC class I on chicken cells. Co-expression of an MHC class I-binding peptide targeted to the endoplasmic reticulum (bypassing the requirement for the TAP peptide transporter) partially rescued MHC class I expression in the presence of MDV012, suggesting that MDV012 is a TAP-blocking MHC class I immune evasion protein. This is the first unique non-mammalian MHC class I immune evasion gene identified, and suggests that α-herpesviruses have conserved this function for at least 100 million years.

  2. Identification of immune inducible genes from the velvet worm Epiperipatus biolleyi (Onychophora).


    Altincicek, Boran; Vilcinskas, Andreas


    Onychophora are the next relatives of Arthropoda and, hence, represent an important taxon to unravel relationships among Insecta, Crustacea, Arachnida, and Myriapoda. Here, we screened for immune inducible genes from the onychophoran Epiperipatus biolleyi (Peripatidae) by injecting crude bacterial LPS and applying the suppression subtractive hybridization technique. Our analysis of 288 cDNAs resulted in identification of 36 novel genes in E. biolleyi whose potential homologues from other animals are known to mediate immune-related signaling (e.g. mitogen-activated protein kinase kinase 1 and immunoglobulin enhancer binding protein), to be involved in cellular processes (e.g. perilipin and myosin light chain), or to act as immune effector molecules (e.g. lysosomal beta-galactosidase, a putative antimicrobial peptide and a potential thiolester containing protein). Comparisons with homologous genes from other animals including the two most favored ecdysozoan model organisms of innate immunity research, the nematode Caenorhabditis elegans and the fruit fly Drosophila melanogaster, provide further insights into the origin and evolution of Arthropoda immunity.

  3. Temperature stress affects the expression of immune response genes in the alfalfa leafcutting bee, Megachile rotundata.


    Xu, J; James, Rosalind R


    Environmental stresses are thought to be associated with increases in disease suceptibility, attributable to evolutionary trade-offs between the energy demands required to deal with stress vs pathogens. We compared the effects of temperature stress and pathogen exposure on the immune response of a solitary bee, Megachile rotundata. Using an oligonucleotide microarray with 125 genes (375 probes), we determined that both high and low temperatures increased the expression of immune response genes in M. rotundata and reduced levels of a disease called chalkbrood. In the absence of the pathogen, trypsin-like serine and pathogen recognition proteases were most highly expressed at the lowest rearing temperature (20°C), while immune response signalling pathways and melanization were highly expressed at the warmest temperature tested (35°C). In pathogen-exposed bees, immune response genes tended to be most highly expressed at moderate temperatures, where we also saw the greatest infection levels. Temperature stress appears to have activated immunity before the pathogen elicited a response from the host, and this early activity prevented infection under stressful conditions. In this insect, the trade-off in energetic costs associated with stress and infection may be partially avoided by the use of conserved responses that reduce the effects of both.

  4. Trans-Species Polymorphism in Immune Genes: General Pattern or MHC-Restricted Phenomenon?

    PubMed Central

    Vinkler, Michal


    Immunity exhibits extraordinarily high levels of variation. Evolution of the immune system in response to host-pathogen interactions in particular ecological contexts appears to be frequently associated with diversifying selection increasing the genetic variability. Many studies have documented that immunologically relevant polymorphism observed today may be tens of millions years old and may predate the emergence of present species. This pattern can be explained by the concept of trans-species polymorphism (TSP) predicting the maintenance and sharing of favourable functionally important alleles of immune-related genes between species due to ongoing balancing selection. Despite the generality of this concept explaining the long-lasting adaptive variation inherited from ancestors, current research in TSP has vastly focused only on major histocompatibility complex (MHC). In this review we summarise the evidence available on TSP in human and animal immune genes to reveal that TSP is not a MHC-specific evolutionary pattern. Further research should clearly pay more attention to the investigation of TSP in innate immune genes and especially pattern recognition receptors which are promising candidates for this type of evolution. More effort should also be made to distinguish TSP from convergent evolution and adaptive introgression. Identification of balanced TSP variants may represent an accurate approach in evolutionary medicine to recognise disease-resistance alleles. PMID:26090501

  5. Natural genetic variation profoundly regulates gene expression in immune cells and dictates susceptibility to CNS autoimmunity

    PubMed Central

    Bearoff, Frank; del Rio, Roxana; Case, Laure K.; Dragon, Julie A.; Nguyen-Vu, Trang; Lin, Chin-Yo; Blankenhorn, Elizabeth P.; Teuscher, Cory; Krementsov, Dimitry N.


    Regulation of gene expression in immune cells is known to be under genetic control, and likely contributes to susceptibility to autoimmune diseases, such as multiple sclerosis (MS). How this occurs in concert across multiple immune cell types is poorly understood. Using a mouse model that harnesses the genetic diversity of wild-derived mice, more accurately reflecting genetically diverse human populations, we provide an extensive characterization of the genetic regulation of gene expression in five different naïve immune cell types relevant to MS. The immune cell transcriptome is shown to be under profound genetic control, exhibiting diverse patterns: global, cell-specific, and sex-specific. Bioinformatic analysis of the genetically-controlled transcript networks reveals reduced cell type-specificity and inflammatory activity in wild-derived PWD/PhJ mice, compared with the conventional laboratory strain C57BL/6J. Additionally, candidate MS-GWAS genes were significantly enriched among transcripts overrepresented in C57BL/6J cells compared to PWD. These expression level differences correlate with robust differences in susceptibility to experimental autoimmune encephalomyelitis, the principal model of MS, and skewing of the encephalitogenic T cell responses. Taken together, our results provide functional insights into the genetic regulation of the immune transcriptome, and shed light on how this in turn contributes to susceptibility to autoimmune disease. PMID:27653816

  6. Inborn Errors in Immunity

    PubMed Central

    Lionakis, M.S.; Hajishengallis, G.


    In recent years, the study of genetic defects arising from inborn errors in immunity has resulted in the discovery of new genes involved in the function of the immune system and in the elucidation of the roles of known genes whose importance was previously unappreciated. With the recent explosion in the field of genomics and the increasing number of genetic defects identified, the study of naturally occurring mutations has become a powerful tool for gaining mechanistic insight into the functions of the human immune system. In this concise perspective, we discuss emerging evidence that inborn errors in immunity constitute real-life models that are indispensable both for the in-depth understanding of human biology and for obtaining critical insights into common diseases, such as those affecting oral health. In the field of oral mucosal immunity, through the study of patients with select gene disruptions, the interleukin-17 (IL-17) pathway has emerged as a critical element in oral immune surveillance and susceptibility to inflammatory disease, with disruptions in the IL-17 axis now strongly linked to mucosal fungal susceptibility, whereas overactivation of the same pathways is linked to inflammatory periodontitis. PMID:25900229

  7. TGFβ receptor 1: an immune susceptibility gene in HPV-associated cancer.


    Levovitz, Chaya; Chen, Dan; Ivansson, Emma; Gyllensten, Ulf; Finnigan, John P; Alshawish, Sara; Zhang, Weijia; Schadt, Eric E; Posner, Marshal R; Genden, Eric M; Boffetta, Paolo; Sikora, Andrew G


    Only a minority of those exposed to human papillomavirus (HPV) develop HPV-related cervical and oropharyngeal cancer. Because host immunity affects infection and progression to cancer, we tested the hypothesis that genetic variation in immune-related genes is a determinant of susceptibility to oropharyngeal cancer and other HPV-associated cancers by performing a multitier integrative computational analysis with oropharyngeal cancer data from a head and neck cancer genome-wide association study (GWAS). Independent analyses, including single-gene, gene-interconnectivity, protein-protein interaction, gene expression, and pathway analysis, identified immune genes and pathways significantly associated with oropharyngeal cancer. TGFβR1, which intersected all tiers of analysis and thus selected for validation, replicated significantly in the head and neck cancer GWAS limited to HPV-seropositive cases and an independent cervical cancer GWAS. The TGFβR1 containing p38-MAPK pathway was significantly associated with oropharyngeal cancer and cervical cancer, and TGFβR1 was overexpressed in oropharyngeal cancer, cervical cancer, and HPV(+) head and neck cancer tumors. These concordant analyses implicate TGFβR1 signaling as a process dysregulated across HPV-related cancers. This study demonstrates that genetic variation in immune-related genes is associated with susceptibility to oropharyngeal cancer and implicates TGFβR1/TGFβ signaling in the development of both oropharyngeal cancer and cervical cancer. Better understanding of the immunogenetic basis of susceptibility to HPV-associated cancers may provide insight into host/virus interactions and immune processes dysregulated in the minority of HPV-exposed individuals who progress to cancer.

  8. TGFβ Receptor 1: An Immune Susceptibility Gene in HPV-Associated Cancer

    PubMed Central

    Levovitz, Chaya; Chen, Dan; Ivansson, Emma; Gyllensten, Ulf; Finnigan, John P.; Alshawish, Sara; Zhang, Weijia; Schadt, Eric E.; Posner, Marshal R.; Genden, Eric M.; Boffetta, Paolo; Sikora, Andrew G.


    Only a minority of those exposed to human papillomavirus (HPV) develop HPV-related cervical and oropharyngeal cancer. Because host immunity affects infection and progression to cancer, we tested the hypothesis that genetic variation in immune-related genes is a determinant of susceptibility to oropharyngeal cancer and other HPV-associated cancers by performing a multitier integrative computational analysis with oropharyngeal cancer data from a head and neck cancer genome-wide association study (GWAS). Independent analyses, including single-gene, gene-interconnectivity, protein–protein interaction, gene expression, and pathway analysis, identified immune genes and pathways significantly associated with oropharyngeal cancer. TGFβR1, which intersected all tiers of analysis and thus selected for validation, replicated significantly in the head and neck cancer GWAS limited to HPV-seropositive cases and an independent cervical cancer GWAS. The TGFβR1 containing p38–MAPK pathway was significantly associated with oropharyngeal cancer and cervical cancer, and TGFβR1 was overexpressed in oropharyngeal cancer, cervical cancer, and HPV+ head and neck cancer tumors. These concordant analyses implicate TGFβR1 signaling as a process dysregulated across HPV-related cancers. This study demonstrates that genetic variation in immune-related genes is associated with susceptibility to oropharyngeal cancer and implicates TGFβR1/TGFβ signaling in the development of both oropharyngeal cancer and cervical cancer. Better understanding of the immunogenetic basis of susceptibility to HPV-associated cancers may provide insight into host/virus interactions and immune processes dysregulated in the minority of HPV-exposed individuals who progress to cancer. PMID:25273091

  9. Protein-poor diet reduces host-specific immune gene expression in Bombus terrestris

    PubMed Central

    Brunner, Franziska S.; Schmid-Hempel, Paul; Barribeau, Seth M.


    Parasites infect hosts non-randomly as genotypes of hosts vary in susceptibility to the same genotypes of parasites, but this specificity may be modulated by environmental factors such as nutrition. Nutrition plays an important role for any physiological investment. As immune responses are costly, resource limitation should negatively affect immunity through trade-offs with other physiological requirements. Consequently, nutritional limitation should diminish immune capacity in general, but does it also dampen differences among hosts? We investigated the effect of short-term pollen deprivation on the immune responses of our model host Bombus terrestris when infected with the highly prevalent natural parasite Crithidia bombi. Bumblebees deprived of pollen, their protein source, show reduced immune responses to infection. They failed to upregulate a number of genes, including antimicrobial peptides, in response to infection. In particular, they also showed less specific immune expression patterns across individuals and colonies. These findings provide evidence for how immune responses on the individual-level vary with important elements of the environment and illustrate how nutrition can functionally alter not only general resistance, but also alter the pattern of specific host–parasite interactions. PMID:24850921

  10. Candidate Gene Approach for Parasite Resistance in Sheep – Variation in Immune Pathway Genes and Association with Fecal Egg Count

    PubMed Central

    Periasamy, Kathiravan; Pichler, Rudolf; Poli, Mario; Cristel, Silvina; Cetrá, Bibiana; Medus, Daniel; Basar, Muladno; A. K., Thiruvenkadan; Ramasamy, Saravanan; Ellahi, Masroor Babbar; Mohammed, Faruque; Teneva, Atanaska; Shamsuddin, Mohammed; Podesta, Mario Garcia; Diallo, Adama


    Sheep chromosome 3 (Oar3) has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs) within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF) did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05) in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have potential for

  11. Innate immune response gene expression profiles of N9 microglia are pathogen-type specific.


    McKimmie, Clive S; Roy, Douglas; Forster, Thorsten; Fazakerley, John K


    Glial cells, particularly microglia, are thought to play a pivotal role in initiating and guiding innate immune responses to CNS infections and in perpetuating inflammation and pathology in CNS diseases such as multiple sclerosis and Alzheimer's disease. We describe here the development and use of a new microarray designed to specifically profile transcript expression of innate immunity genes. Microarray analysis validated by quantitative PCR demonstrated an extensive range of pattern recognition receptor gene expression in resting N9 microglia, including Toll-like receptors, scavenger receptors and lectins. Stimulation with LPS or infection with virus modulated pattern recognition receptor, cytokine, chemokine and other innate immune transcripts in a distinct and stimulus-specific manner. This study demonstrates that a single glial cell phenotype has an innate capability to detect infection, determine its form and generate specific responses.

  12. Combining cytotoxic and immune-mediated gene therapy to treat brain tumors.


    Curtin, James F; King, Gwendalyn D; Candolfi, Marianela; Greeno, Remy B; Kroeger, Kurt M; Lowenstein, Pedro R; Castro, Maria G


    Glioblastoma (GBM) is a type of intracranial brain tumor, for which there is no cure. In spite of advances in surgery, chemotherapy and radiotherapy, patients die within a year of diagnosis. Therefore, there is a critical need to develop novel therapeutic approaches for this disease. Gene therapy, which is the use of genes or other nucleic acids as drugs, is a powerful new treatment strategy which can be developed to treat GBM. Several treatment modalities are amenable for gene therapy implementation, e.g. conditional cytotoxic approaches, targeted delivery of toxins into the tumor mass, immune stimulatory strategies, and these will all be the focus of this review. Both conditional cytotoxicity and targeted toxin mediated tumor death, are aimed at eliminating an established tumor mass and preventing further growth. Tumors employ several defensive strategies that suppress and inhibit anti-tumor immune responses. A better understanding of the mechanisms involved in eliciting anti-tumor immune responses has identified promising targets for immunotherapy. Immunotherapy is designed to aid the immune system to recognize and destroy tumor cells in order to eliminate the tumor burden. Also, immune-therapeutic strategies have the added advantage that an activated immune system has the capability of recognizing tumor cells at distant sites from the primary tumor, therefore targeting metastasis distant from the primary tumor locale. Pre-clinical models and clinical trials have demonstrated that in spite of their location within the central nervous system (CNS), a tissue described as 'immune privileged', brain tumors can be effectively targeted by the activated immune system following various immunotherapeutic strategies. This review will highlight recent advances in brain tumor immunotherapy, with particular emphasis on advances made using gene therapy strategies, as well as reviewing other novel therapies that can be used in combination with immunotherapy. Another important

  13. Combining Cytotoxic and Immune-Mediated Gene Therapy to Treat Brain Tumors

    PubMed Central

    Curtin, James F.; King, Gwendalyn D.; Candolfi, Marianela; Greeno, Remy B.; Kroeger, Kurt M.; Lowenstein, Pedro R.; Castro, Maria G.


    Glioblastoma (GBM) is a type of intracranial brain tumor, for which there is no cure. In spite of advances in surgery, chemotherapy and radiotherapy, patients die within a year of diagnosis. Therefore, there is a critical need to develop novel therapeutic approaches for this disease. Gene therapy, which is the use of genes or other nucleic acids as drugs, is a powerful new treatment strategy which can be developed to treat GBM. Several treatment modalities are amenable for gene therapy implementation, e.g. conditional cytotoxic approaches, targeted delivery of toxins into the tumor mass, immune stimulatory strategies, and these will all be the focus of this review. Both conditional cytotoxicity and targeted toxin mediated tumor death, are aimed at eliminating an established tumor mass and preventing further growth. Tumors employ several defensive strategies that suppress and inhibit anti-tumor immune responses. A better understanding of the mechanisms involved in eliciting anti-tumor immune responses has identified promising targets for immunotherapy. Immunotherapy is designed to aid the immune system to recognize and destroy tumor cells in order to eliminate the tumor burden. Also, immune-therapeutic strategies have the added advantage that an activated immune system has the capability of recognizing tumor cells at distant sites from the primary tumor, therefore targeting metastasis distant from the primary tumor locale. Pre-clinical models and clinical trials have demonstrated that in spite of their location within the central nervous system (CNS), a tissue described as ‘immune privileged’, brain tumors can be effectively targeted by the activated immune system following various immunotherapeutic strategies. This review will highlight recent advances in brain tumor immunotherapy, with particular emphasis on advances made using gene therapy strategies, as well as reviewing other novel therapies that can be used in combination with immunotherapy. Another

  14. SAFB1 Mediates Repression of Immune Regulators and Apoptotic Genes in Breast Cancer Cells*

    PubMed Central

    Hammerich-Hille, Stephanie; Kaipparettu, Benny A.; Tsimelzon, Anna; Creighton, Chad J.; Jiang, Shiming; Polo, Jose M.; Melnick, Ari; Meyer, Rene; Oesterreich, Steffi


    The scaffold attachment factors SAFB1 and SAFB2 are paralogs, which are involved in cell cycle regulation, apoptosis, differentiation, and stress response. They have been shown to function as estrogen receptor corepressors, and there is evidence for a role in breast tumorigenesis. To identify their endogenous target genes in MCF-7 breast cancer cells, we utilized a combined approach of chromatin immunoprecipitation (ChIP)-on-chip and gene expression array studies. By performing ChIP-on-chip on microarrays containing 24,000 promoters, we identified 541 SAFB1/SAFB2-binding sites in promoters of known genes, with significant enrichment on chromosomes 1 and 6. Gene expression analysis revealed that the majority of target genes were induced in the absence of SAFB1 or SAFB2 and less were repressed. Interestingly, there was no significant overlap between the genes identified by ChIP-on-chip and gene expression array analysis, suggesting regulation through regions outside the proximal promoters. In contrast to SAFB2, which shared most of its target genes with SAFB1, SAFB1 had many unique target genes, most of them involved in the regulation of the immune system. A subsequent analysis of the estrogen treatment group revealed that 12% of estrogen-regulated genes were dependent on SAFB1, with the majority being estrogen-repressed genes. These were primarily genes involved in apoptosis, such as BBC3, NEDD9, and OPG. Thus, this study confirms the primary role of SAFB1/SAFB2 as corepressors and also uncovers a previously unknown role for SAFB1 in the regulation of immune genes and in estrogen-mediated repression of genes. PMID:19901029

  15. Repurposed transcriptomic data facilitate discovery of innate immunity toll-like receptor (TLR) Genes across Lophotrochozoa.


    Halanych, Kenneth M; Kocot, Kevin M


    The growing volume of genomic data from across life represents opportunities for deriving valuable biological information from data that were initially collected for another purpose. Here, we use transcriptomes collected for phylogenomic studies to search for toll-like receptor (TLR) genes in poorly sampled lophotrochozoan clades (Annelida, Mollusca, Brachiopoda, Phoronida, and Entoprocta) and one ecdysozoan clade (Priapulida). TLR genes are involved in innate immunity across animals by recognizing potential microbial infection. They have an extracellular leucine-rich repeat (LRR) domain connected to a transmembrane domain and an intracellular toll/interleukin-1 receptor (TIR) domain. Consequently, these genes are important in initiating a signaling pathway to trigger defense. We found at least one TLR ortholog in all but two taxa examined, suggesting that a broad array of lophotrochozoans may have innate immune systems similar to those observed in vertebrates and arthropods. Comparison to the SMART database confirmed the presence of both the LRR and the TIR protein motifs characteristic of TLR genes. Because we looked at only one transcriptome per species, discovery of TLR genes was limited for most taxa. However, several TRL-like genes that vary in the number and placement of LRR domains were found in phoronids. Additionally, several contigs contained LRR domains but lacked TIR domains, suggesting they were not TLRs. Many of these LRR-containing contigs had other domains (e.g., immunoglobin) and are likely involved in innate immunity.

  16. Disruption of Rpp1-mediated soybean rust immunity by virus-induced gene silencing.


    Cooper, Bret; Campbell, Kimberly B; McMahon, Michael B; Luster, Douglas G


    Phakopsora pachyrhizi, a fungus that causes rust disease on soybean, has potential to impart significant yield loss and disrupt food security and animal feed production. Rpp1 is a soybean gene that confers immunity to soybean rust, and it is important to understand how it regulates the soybean defense system and to use this knowledge to protect commercial crops. It was previously discovered that some soybean proteins resembling transcription factors accumulate in the nucleus of Rpp1 soybeans. To determine if they contribute to immunity, Bean pod mottle virus was used to attenuate or silence the expression of their genes. Rpp1 plants subjected to virus-induced gene silencing exhibited reduced amounts of RNA for 5 of the tested genes, and the plants developed rust-like symptoms after subsequent inoculation with fungal spores. Symptoms were associated with the accumulation of rust fungal RNA and protein. Silenced plants also had reduced amounts of RNA for the soybean Myb84 transcription factor and soybean isoflavone O-methyltransferase, both of which are important to phenylpropanoid biosynthesis and lignin formation, crucial components of rust resistance. These results help resolve some of the genes that contribute to Rpp1-mediated immunity and improve upon the knowledge of the soybean defense system. It is possible that these genes could be manipulated to enhance rust resistance in otherwise susceptible soybean cultivars.

  17. Structural but not functional conservation of an immune molecule: a tachylectin-like gene in Hydractinia.


    Mali, Brahim; Soza-Ried, Jorge; Frohme, Marcus; Frank, Uri


    Tachylectin-related proteins are a recently characterized group of pattern recognition molecules, functioning in the innate immunity of various animals, from the ancient sponges to vertebrates. Tachylectins are characterized by six internal tandem repeats forming beta-propeller domains. We have identified and characterized a tachylectin-related gene in the colonial marine hydroid, Hydractinia echinata. The predicted gene product, termed CTRN, contained an N-terminal signal peptide and had a well-conserved tachylectin-like structure. RT-PCR analyses revealed only post-metamorphic expression while no mRNA was detected during embryonic development or in planula larvae. Exposure of colonies to LPS under conditions known to activate an immune response in Hydractinia did not result in upregulation of the gene. In situ hybridization analysis of metamorphosed animals detected CTRN transcripts only in a small subpopulation of neurons and their precursor cells, localized in a ring-like structure around the mouth of polyps. The same ring-like structure of CTRN expressing neurons was also observed in young polyp buds, predicting the position of the future mouth. This type of expression pattern can hardly be attributed to an immune-relevant gene. Thus, despite high structural similarity to tachylectins, this cnidarian member of this group seems to be an exception to all other tachylectins identified so far as it seems to have no function in cnidarian innate immunity.

  18. High amino acid diversity and positive selection at a putative coral immunity gene (tachylectin-2)

    PubMed Central


    Background Genes involved in immune functions, including pathogen recognition and the activation of innate defense pathways, are among the most genetically variable known, and the proteins that they encode are often characterized by high rates of amino acid substitutions, a hallmark of positive selection. The high levels of variation characteristic of immunity genes make them useful tools for conservation genetics. To date, highly variable immunity genes have yet to be found in corals, keystone organisms of the world's most diverse marine ecosystem, the coral reef. Here, we examine variation in and selection on a putative innate immunity gene from Oculina, a coral genus previously used as a model for studies of coral disease and bleaching. Results In a survey of 244 Oculina alleles, we find high nonsynonymous variation and a signature of positive selection, consistent with a putative role in immunity. Using computational protein structure prediction, we generate a structural model of the Oculina protein that closely matches the known structure of tachylectin-2 from the Japanese horseshoe crab (Tachypleus tridentatus), a protein with demonstrated function in microbial recognition and agglutination. We also demonstrate that at least three other genera of anthozoan cnidarians (Acropora, Montastrea and Nematostella) possess proteins structurally similar to tachylectin-2. Conclusions Taken together, the evidence of high amino acid diversity, positive selection and structural correspondence to the horseshoe crab tachylectin-2 suggests that this protein is 1) part of Oculina's innate immunity repertoire, and 2) evolving adaptively, possibly under selective pressure from coral-associated microorganisms. Tachylectin-2 may serve as a candidate locus to screen coral populations for their capacity to respond adaptively to future environmental change. PMID:20482872

  19. Innate immune-stimulating and immune genes up-regulating activities of three types of alginate from Sargassum siliquosum in Pacific white shrimp, Litopenaeus vannamei.


    Yudiati, Ervia; Isnansetyo, Alim; Murwantoko; Ayuningtyas; Triyanto; Handayani, Christina Retna


    The Total Haemocyte Count (THC), phenoloxidase (PO), Superoxide Dismutase (SOD) activity, Phagocytic Activity/Index and Total Protein Plasma (TPP) were examined after feeding the white shrimp Litopenaeus vannamei with diets supplemented with three different types of alginates (acid, calcium and sodium alginates). Immune-related genes expression was evaluated by quantitative Real Time PCR (qRT-PCR). Results indicated that the immune parameters directly increased according to the doses of alginates and time. The 2.0 g kg(-1) of acid and sodium alginate treatments were gave better results. Four immune-related genes expression i.e. LGBP, Toll, Lectin, proPO were up regulated. It is therefore concluded that the supplementation of alginate of Sargassum siliquosum on the diet of L. vannamei enhanced the innate immunity as well as the expression of immune-related genes. It is the first report on the simultaneous evaluation of three alginate types to enhance innate immune parameters and immune-related genes expression in L. vannamei.

  20. Mycobacterium tuberculosis Requires Phosphate-Responsive Gene Regulation To Resist Host Immunity

    PubMed Central

    Leistikow, Rachel L.; Kirksey, Meghan A.; Voskuil, Martin I.; McKinney, John D.


    Mycobacterium tuberculosis persists in the tissues of mammalian hosts despite inducing a robust immune response dominated by the macrophage-activating cytokine gamma interferon (IFN-γ). We identified the M. tuberculosis phosphate-specific transport (Pst) system component PstA1 as a factor required to resist IFN-γ-dependent immunity. A ΔpstA1 mutant was fully virulent in IFN-γ−/− mice but attenuated in wild-type (WT) mice and mice lacking specific IFN-γ-inducible immune mechanisms: nitric oxide synthase (NOS2), phagosome-associated p47 GTPase (Irgm1), or phagocyte oxidase (phox). These phenotypes suggest that ΔpstA1 bacteria are sensitized to an IFN-γ-dependent immune mechanism(s) other than NOS2, Irgm1, or phox. In other species, the Pst system has a secondary role as a negative regulator of phosphate starvation-responsive gene expression through an interaction with a two-component signal transduction system. In M. tuberculosis, we found that ΔpstA1 bacteria exhibited dysregulated gene expression during growth in phosphate-rich medium that was mediated by the two-component sensor kinase/response regulator system SenX3-RegX3. Remarkably, deletion of the regX3 gene suppressed the replication and virulence defects of ΔpstA1 bacteria in NOS2−/− mice, suggesting that M. tuberculosis requires the Pst system to negatively regulate activity of RegX3 in response to available phosphate in vivo. We therefore speculate that inorganic phosphate is readily available during replication in the lung and is an important signal controlling M. tuberculosis gene expression via the Pst-SenX3-RegX3 signal transduction system. Inability to sense this environmental signal, due to Pst deficiency, results in dysregulation of gene expression and sensitization of the bacteria to the host immune response. PMID:23132496

  1. Expression profile of human immune-responsive gene 1 and generation and characterization of polyclonal antiserum.


    Xiao, Wei; Wang, Lan; Xiao, Ruijing; Wu, Mengjun; Tan, Jinquan; He, Yuling


    Murine immune-responsive gene 1 (IRG1) plays significant roles in embryonic implantation and neurodegeneration. The expression pattern of the human IRG1 gene, however, has not yet been established, and the predicted gene sequence has been revised several times according to computed expressed sequence tags (ESTs). To determine the human IRG1 gene expression profile, human fetal tissue samples, peripheral blood mononuclear cells (PBMCs) from normal healthy subjects, and the human leukemia cell lines THP-1 and K-562 challenged with lipopolysaccharide (LPS) were subjected to RT-PCR using degenerate primers. The results indicated that the IRG1 gene is differentially expressed in human fetal PBMCs and LPS-stimulated adult PBMCs. The amplified gene fragment was cloned into the pET32a(+) vector and fusion-expressed with a His-tag in a prokaryotic system. After affinity chromatography, human IRG1h fusion proteins were isolated by SDS-PAGE and identified by mass spectrometric analysis for use as an immunogen to immunize rabbits. The titer and specificity of the purified rabbit antiserum were sufficient to measure human IRG1 gene expression in various tissues and cultures. This purified polyclonal antiserum will allow us to initiate studies to elucidate the biological roles of the human IRG1 gene.

  2. Molecular profiling of T-helper immune genes during dengue virus infection

    PubMed Central

    Chen, Jincheng; Ng, Mary Mah Lee; Chu, Justin Jang Hann


    In this study, we provide a comprehensive molecular profiling of the involvement of T- helper (Th) genes during dengue virus infection of different cell types. The Th gene profiles of three human cell types (monocytes, T-cells and hepatocytes) were analyzed simultaneously via array-based RT-PCR upon infection with dengue virus. Differential regulation of 41 Th genes was identified and of which 20 of those genes may contribute to immuno-pathogenesis of dengue virus infection by regulating inflammation, thrombocytopenia and vascular permeability. Among the strongly up-regulated genes were the RANTES, CC-CKR3, IRF4, CLEC2C, IL-6 and TLR6, which are potent inducer of inflammation and vascular permeability. Profiling genes obtained from this study may serve as potential biomarkers and the modulation of Th immune responses during dengue virus infection has important implications in disease outcome. PMID:19117515

  3. Immune deficiency enhances expression of recombinant human antibody in mice after nonviral in vivo gene transfer.


    Kitaguchi, Kohji; Toda, Mikako; Takekoshi, Masataka; Maeda, Fumiko; Muramatsu, Tatsuo; Murai, Atsushi


    A cDNA encoding human antibody against hepatitis B virus was expressed in normal and severe combined immune deficiency (SCID) mice to clarify whether or not host immune status affects circulating levels of the recombinant human antibody (RhAb) after nonviral in vivo gene transfer. For transferring genes, either electroporation (EP) or hydrodynamics-based transfection (HD) was employed. The former was applied to the leg muscle to express the gene, while the latter primarily targeted foreign gene expression in the liver. The expressed RhAb was secreted into the blood circulation, and its existence was assayed by ELISA. Prior to the investigation of host immune status, suitable forms of plasmid expression vectors and types of electrodes were determined in normal mice. Results showed that the vector encoding both the light and heavy chains driven by the CMV promoter had the highest plasma RhAb concentrations, and a pair of pincette-type electrodes conferred the best performance. In both EP and HD, the SCID state showed an increased and prolonged RhAb production in the blood circulation due probably to suppressed recognition of RhAb as a foreign protein to the host animal. The difference in gene transfer methods demonstrated a characteristic pattern: an early and sharp rise followed by a relatively rapid decrease in HD, in contrast to a gradual rise followed by a plateau level maintained in EP. As a result, with the same amount of gene transferred, the plasma RhAb concentrations for the first 7 or 8 weeks were higher in HD than EP, while the reverse was true for the latter period. Multiple gene transfer contributed to maintaining and prolonging high RhAb concentrations in plasma by both methods with similar characteristic patterns accompanying the respective gene transfer method. These results suggest the importance of host immunological potency for maintaining plasma RhAb concentrations if these gene transfer technologies are used for clinical and therapeutic purposes.

  4. DNA Vaccines: Protective Immunizations by Parenteral, Mucosal, and Gene-Gun Inoculations

    NASA Astrophysics Data System (ADS)

    Fynan, Ellen F.; Webster, Robert G.; Fuller, Deborah H.; Haynes, Joel R.; Santoro, Joseph C.; Robinson, Harriet L.


    Plasmid DNAs expressing influenza virus hemagglutinin glycoproteins have been tested for their ability to raise protective immunity against lethal influenza challenges of the same subtype. In trials using two inoculations of from 50 to 300 μg of purified DNA in saline, 67-95% of test mice and 25-63% of test chickens have been protected against a lethal influenza challenge. Parenteral routes of inoculation that achieved good protection included intramuscular and intravenous injections. Successful mucosal routes of vaccination included DNA drops administered to the nares or trachea. By far the most efficient DNA immunizations were achieved by using a gene gun to deliver DNA-coated gold beads to the epidermis. In mice, 95% protection was achieved by two immunizations with beads loaded with as little as 0.4 μg of DNA. The breadth of routes supporting successful DNA immunizations, coupled with the very small amounts of DNA required for gene-gun immunizations, highlight the potential of this remarkably simple technique for the development of subunit vaccines.

  5. Zinc–gene interaction related to inflammatory/immune response in ageing

    PubMed Central

    Malavolta, Marco


    The pivotal role played by zinc–gene interaction in affecting some relevant cytokines (IL-6 and TNF-α) and heat shock proteins (HSP70-2) in ageing, successful ageing (nonagenarians) and the most common age-related diseases, such as atherosclerosis and infections, is now recognized. The polymorphisms of genes codifying proteins related to the inflammation are predictive on one hand in longevity, on the other hand they are associated with atherosclerosis or severe infections. Since the health life-span has a strong genetic component, which in turn also affected by nutritional factors like zinc, the association of these polymorphisms with innate immune response, zinc ion bioavailability and Metallothioneins (MT) homeostasis is an useful tool to unravel the role played by zinc–gene interactions in longevity, especially due to the inability of MT in zinc release in ageing and chronic inflammation. In ageing, this last fact leads to depressed innate immune response for host defence. In contrast, in very old age the inflammation is lower with subsequent more zinc ion bioavailability, less MT gene expression and satisfactory innate immunity. Therefore, the zinc–gene (IL-6, TNF-α, Hsp70-2) interactions, via MT homeostasis, are crucial to achieve successful ageing. PMID:18850188

  6. Widespread Decreased Expression of Immune Function Genes in Human Peripheral Blood Following Radiation Exposure

    PubMed Central

    Paul, Sunirmal; Smilenov, Lubomir B.; Amundson, Sally A.


    We report a large-scale reduced expression of genes in pathways related to cell-type specific immunity functions that emerges from microarray analysis 48 h after ex vivo γ-ray irradiation (0, 0.5, 2, 5, 8 Gy) of human peripheral blood from five donors. This response is similar to that seen in patients at 24 h after the start of total-body irradiation and strengthens the rationale for the ex vivo model as an adjunct to human in vivo studies. The most marked response was in genes associated with natural killer (NK) cell immune functions, reflecting a relative loss of NK cells from the population. T- and B-cell mediated immunity genes were also significantly represented in the radiation response. Combined with our previous studies, a single gene expression signature was able to predict radiation dose range with 97% accuracy at times from 6–48 h after exposure. Gene expression signatures that may report on the loss or functional deactivation of blood cell subpopulations after radiation exposure may be particularly useful both for triage biodosimetry and for monitoring the effect of radiation mitigating treatments. PMID:24168352

  7. Immune disease-associated variants in gene enhancers point to BET epigenetic mechanisms for therapeutic intervention.


    Tough, David F; Prinjha, Rab K


    Genome-wide association studies have identified thousands of single nucleotide polymorphisms in the human genome that are statistically associated with particular disease traits. In this Perspective, we review emerging data suggesting that most single nucleotide polymorphisms associated with immune-mediated diseases are found in regulatory regions of the DNA - parts of the genome that control expression of the protein encoding genes - rather than causing mutations in proteins. We discuss how the emerging understanding of particular gene regulatory regions, gene enhancers and the epigenetic mechanisms by which they are regulated is opening up new opportunities for the treatment of immune-mediated diseases, focusing particularly on the BET family of epigenetic reader proteins as potential therapeutic targets.

  8. Gene, environment, microbiome and mucosal immune tolerance in rheumatoid arthritis

    PubMed Central

    Deane, Kevin D.; Scher, Jose U.


    RA is a complex multifactorial chronic disease that transitions through several stages. Multiple studies now support that there is a prolonged phase in early RA development during which there is serum elevation of RA-related autoantibodies including RF and ACPAs in the absence of clinically evident synovitis. This suggests that RA pathogenesis might originate in an extra-articular location, which we hypothesize is a mucosal site. In discussing this hypothesis, we will present herein the current understanding of mucosal immunology, including a discussion about the generation of autoimmune responses at these surfaces. We will also examine how other factors such as genes, microbes and other environmental toxins (including tobacco smoke) could influence the triggering of autoimmunity at mucosal sites and eventually systemic organ disease. We will also propose a research agenda to improve our understanding of the role of mucosal inflammation in the development of RA. PMID:25539828

  9. Immune-Related Gene Expression Patterns in GPV- or H9N2-Infected Goose Spleens

    PubMed Central

    Chen, Shun; Wang, Anqi; Sun, Lipei; Liu, Fei; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Yang, Qiao; Wu, Ying; Sun, Kunfeng; Chen, Xiaoyue; Cheng, Anchun


    Goose parvovirus (GPV) and avian influenza virus subtype H9N2 are single-stranded DNA (ssDNA) and single-stranded RNA (ssRNA) viruses, respectively, both of which can spread in goslings and cause a significant economic loss. To explore the comprehensive transcriptome of GPV- or H9N2-infected goose spleens and to understand the immune responses induced by a DNA virus (GPV) or a RNA virus (H9N2), RNA-seq was performed on the spleens of goslings at the fifth day post infection. In the present study, 2604 and 2409 differentially expressed unigenes were identified in the GPV- and H9N2-infected groups, respectively. Through KEGG pathway enrichment analyses, the up-regulated transcripts in the two virus-infected groups were mainly involved in immune-related pathways. In addition, the two virus-infected groups displayed similar expression patterns in the immune response pathways, including pattern-recognition receptor signaling pathways, the antigen processing and presentation pathway, the NF-κB signaling pathway and the JAK-STAT signaling pathway, as well as cytokines. Furthermore, most of the immune-related genes, particularly TLR7, TRAF3, Mx, TRIM25, CD4, and CD8α, increased in response to GPV and H9N2 infection. However, the depression of NF-κB signaling may be a mechanism by which the viruses evade the host immune system or a strategy to achieve immune homeostasis. PMID:27916934

  10. Molecular Evolution of Immune Genes in the Malaria Mosquito Anopheles gambiae

    PubMed Central

    Lehmann, Tovi; Hume, Jen C. C.; Licht, Monica; Burns, Christopher S.; Wollenberg, Kurt; Simard, Fred; Ribeiro, Jose' M. C.


    Background As pathogens that circumvent the host immune response are favoured by selection, so are host alleles that reduce parasite load. Such evolutionary processes leave their signature on the genes involved. Deciphering modes of selection operating on immune genes might reveal the nature of host-pathogen interactions and factors that govern susceptibility in host populations. Such understanding would have important public health implications. Methodology/Findings We analyzed polymorphisms in four mosquito immune genes (SP14D1, GNBP, defensin, and gambicin) to decipher selection effects, presumably mediated by pathogens. Using samples of Anopheles arabiensis, An. quadriannulatus and four An. gambiae populations, as well as published sequences from other Culicidae, we contrasted patterns of polymorphisms between different functional units of the same gene within and between populations. Our results revealed selection signatures operating on different time scales. At the most recent time scale, within-population diversity revealed purifying selection. Between populations and between species variation revealed reduced differentiation (GNBP and gambicin) at coding vs. noncoding- regions, consistent with balancing selection. McDonald-Kreitman tests between An. quadriannulatus and both sibling species revealed higher fixation rate of synonymous than nonsynonymous substitutions (GNBP) in accordance with frequency dependent balancing selection. At the longest time scale (>100 my), PAML analysis using distant Culicid taxa revealed positive selection at one codon in gambicin. Patterns of genetic variation were independent of exposure to human pathogens. Significance and Conclusions Purifying selection is the most common form of selection operating on immune genes as it was detected on a contemporary time scale on all genes. Selection for “hypervariability” was not detected, but negative balancing selection, detected at a recent evolutionary time scale between sibling

  11. Protein Poly(ADP-ribosyl)ation Regulates Arabidopsis Immune Gene Expression and Defense Responses

    PubMed Central

    Feng, Baomin; Liu, Chenglong; de Oliveira, Marcos V. V.; Intorne, Aline C.; Li, Bo; Babilonia, Kevin; de Souza Filho, Gonçalo A.; Shan, Libo; He, Ping


    Perception of microbe-associated molecular patterns (MAMPs) elicits transcriptional reprogramming in hosts and activates defense to pathogen attacks. The molecular mechanisms underlying plant pattern-triggered immunity remain elusive. A genetic screen identified Arabidopsis poly(ADP-ribose) glycohydrolase 1 (atparg1) mutant with elevated immune gene expression upon multiple MAMP and pathogen treatments. Poly(ADP-ribose) glycohydrolase (PARG) is predicted to remove poly(ADP-ribose) polymers on acceptor proteins modified by poly(ADP-ribose) polymerases (PARPs) with three PARPs and two PARGs in Arabidopsis genome. AtPARP1 and AtPARP2 possess poly(ADP-ribose) polymerase activity, and the activity of AtPARP2 was enhanced by MAMP treatment. AtPARG1, but not AtPARG2, carries glycohydrolase activity in vivo and in vitro. Importantly, mutation (G450R) in atparg1 blocks its activity and the corresponding residue is highly conserved and essential for human HsPARG activity. Consistently, mutant atparp1atparp2 plants exhibited compromised immune gene activation and enhanced susceptibility to pathogen infections. Our study indicates that protein poly(ADP-ribosyl)ation plays critical roles in plant immune gene expression and defense to pathogen attacks. PMID:25569773

  12. Protein poly(ADP-ribosyl)ation regulates arabidopsis immune gene expression and defense responses.


    Feng, Baomin; Liu, Chenglong; de Oliveira, Marcos V V; Intorne, Aline C; Li, Bo; Babilonia, Kevin; de Souza Filho, Gonçalo A; Shan, Libo; He, Ping


    Perception of microbe-associated molecular patterns (MAMPs) elicits transcriptional reprogramming in hosts and activates defense to pathogen attacks. The molecular mechanisms underlying plant pattern-triggered immunity remain elusive. A genetic screen identified Arabidopsis poly(ADP-ribose) glycohydrolase 1 (atparg1) mutant with elevated immune gene expression upon multiple MAMP and pathogen treatments. Poly(ADP-ribose) glycohydrolase (PARG) is predicted to remove poly(ADP-ribose) polymers on acceptor proteins modified by poly(ADP-ribose) polymerases (PARPs) with three PARPs and two PARGs in Arabidopsis genome. AtPARP1 and AtPARP2 possess poly(ADP-ribose) polymerase activity, and the activity of AtPARP2 was enhanced by MAMP treatment. AtPARG1, but not AtPARG2, carries glycohydrolase activity in vivo and in vitro. Importantly, mutation (G450R) in atparg1 blocks its activity and the corresponding residue is highly conserved and essential for human HsPARG activity. Consistently, mutant atparp1atparp2 plants exhibited compromised immune gene activation and enhanced susceptibility to pathogen infections. Our study indicates that protein poly(ADP-ribosyl)ation plays critical roles in plant immune gene expression and defense to pathogen attacks.

  13. Identification of a vir-orthologous immune evasion gene family from primate malaria parasites.


    Prajapati, Surendra Kumar; Singh, Om Prakash


    The immune evasion gene family of malaria parasites encodes variant surface proteins that are expressed at the surface of infected erythrocytes and help the parasite in evading the host immune response by means of antigenic variation. The identification of Plasmodium vivax vir orthologous immune evasion gene family from primate malaria parasites would provide new insight into the evolution of virulence and pathogenesis. Three vir subfamilies viz. vir-B, vir-D and vir-G were successfully PCR amplified from primate malaria parasites, cloned and sequenced. DNA sequence analysis confirmed orthologues of vir-D subfamily in Plasmodium cynomolgi, Plasmodium simium, Plasmodium simiovale and Plasmodium fieldi. The identified vir-D orthologues are 1-9 distinct members of the immune evasion gene family which have 68-83% sequence identity with vir-D and 71.2-98.5% sequence identity within the members identified from primate malaria parasites. The absence of other vir subfamilies among primate malaria parasites reflects the limitations in the experimental approach. This study clearly identified the presence of vir-D like sequences in four species of Plasmodium infecting primates that would be useful in understanding the evolution of virulence in malaria parasites.

  14. Identification of host immune regulation candidate genes of Toxascaris leonina by expression sequenced tags (ESTs) analysis.


    Cho, Min Kyoung; Lee, Keun Hee; Lee, Sun Joo; Kang, Se Won; Ock, Mee Sun; Hong, Yeon Chul; Lee, Yong Seok; Yu, Hak Sun


    Toxascaris leonina adult worms live in the gastrointestinal tract of dog, cat, and fox, releasing eggs which enter the environment by the fecal route. Previously, we reported that T. leonina adult worm derived protein was able to inhibit OVA-specific Th2 responses, and in particular, immunization with parasite proteins exerts a more profound protective effect than allergen treatment. In order to gain greater insight into the relevant immune evasion mechanisms as well as basic scientific information, we have generated ESTs of T. leonina adult female worm and investigated their functions using euKaryotic Orthologous Groups (KOG) database analysis. From the randomly selected plasmids containing DNA inserts, a total of 487 reads were collected from the T. leonina adult worm cDNA library. The annotated ESTs were classified into 25 KOG categories; the most of ESTs (7.90%) were annotated with energy production and conversion, and the second highly annotated category is translation, ribosomal structure and biogenesis related ESTs (7.69%). We also identified many host-parasite immune related genes including C-type lectin, galectin, SXP, and cathepsin L-like cysteine protease coding genes. It is necessary to get more information regarding these genes for understanding about the mechanisms of immune evasion of Toxascaris.

  15. Major role of local immune responses in antibody formation to factor IX in AAV gene transfer.


    Wang, L; Cao, O; Swalm, B; Dobrzynski, E; Mingozzi, F; Herzog, R W


    The risk of an immune response to the coagulation factor IX (F.IX) transgene product is a concern in gene therapy for the X-linked bleeding disorder hemophilia B. In order to investigate the mechanism of F.IX-specific lymphocyte activation in the context of adeno-associated viral (AAV) gene transfer to skeletal muscle, we injected AAV-2 vector expressing human F.IX (hF.IX) into outbred immune-competent mice. Systemic hF.IX levels were transiently detected in the circulation, but diminished concomitant with activation of CD4+ T and B cells. ELISPOT assays documented robust responses to hF.IX in the draining lymph nodes of injected muscle by day 14. Formation of inhibitory antibodies to hF.IX was observed over a wide range of vector doses, with increased doses causing stronger immune responses. A prolonged inflammatory reaction in muscle started at 1.5-2 months, but ultimately failed to eliminate transgene expression. By 1.5 months, hF.IX antigen re-emerged in circulation in approximately 70% of animals injected with high vector dose. Hepatic gene transfer elicited only infrequent and weaker immune responses, with higher vector doses causing a reduction in T-cell responses to hF.IX. In summary, the data document substantial influence of target tissue, local antigen presentation, and antigen levels on lymphocyte responses to F.IX.

  16. The surprisingly complex immune gene repertoire of a simple sponge, exemplified by the NLR genes: a capacity for specificity?


    Degnan, Sandie M


    Most bacteria are not pathogenic to animals, and may instead serve beneficial functions. The requisite need for animals to differentiate between microbial friend and foe is likely borne from a deep evolutionary imperative to recognise self from non-self, a service ably provided by the innate immune system. Recent findings from an ancient lineage of simple animals - marine sponges - have revealed an unexpectedly large and diverse suite of genes belonging to one family of pattern recognition receptors, namely the NLR genes. Because NLRs can recognise a broad spectrum of microbial ligands, they may play a critical role in mediating the animal-bacterial crosstalk needed for sophisticated discrimination between microbes of various relationships. The building blocks for an advanced NLR-based immune specificity encoded in the genome of the coral reef sponge Amphimedon queenslandica may provide a specialisation and diversity of responses that equals, or even exceeds, that of vertebrate NLRs.

  17. Altered endometrial immune gene expression in beef heifers with retarded embryos.


    Beltman, M E; Forde, N; Lonergan, P; Crowe, M A


    The aim of the present study was to compare endometrial gene expression profiles in a group of beef heifers yielding viable or retarded embryos on Day 7 after oestrus as a means of potentially explaining differences in embryo survival rates. Heifers were classified as either: (1) viable, when the embryo collected on Day 7 after oestrus was at the correct developmental stage (i.e. morula/early blastocyst); or (2) retarded, when the embryo was arrested at the 2-16-cell stage. The focus of the present study was on genes that were associated with either the pro- or anti-inflammatory immune response. Endometrial gene expression was determined using quantitative real-time polymerase chain reaction analysis. Expression of the β-defensin (DEFB1), interferon (IFN)-α (IFNA), IFN-γ (IFNG), interleukin (IL)-6 (IL6), IL-10 (IL10), forkhead box P3 (FOXP3) and natural cytotoxicity triggering receptor 1 (NCR1) genes was lower in endometria from viable than retarded heifers. Expression of the nuclear factor of kappa light polypeptide gene enhancer in B cells 1 (NKFB1), transforming growth factor (TGF)-β (TGFB), IFN-γ-inducible protein 16 (IFI16) and IL-21 (IL21) genes was higher in viable than retarded heifers. We propose that small disturbances in the expression of immune genes in the endometrium on Day 7 after oestrus can have detrimental effects on embryo survival.

  18. Effector CD4+ T cell expression signatures and immune-mediated disease associated genes.


    Zhang, Wei; Ferguson, John; Ng, Sok Meng; Hui, Ken; Goh, Gerald; Lin, Aiping; Esplugues, Enric; Flavell, Richard A; Abraham, Clara; Zhao, Hongyu; Cho, Judy H


    Genome-wide association studies (GWAS) in immune-mediated diseases have identified over 150 associated genomic loci. Many of these loci play a role in T cell responses, and regulation of T cell differentiation plays a critical role in immune-mediated diseases; however, the relationship between implicated disease loci and T cell differentiation is incompletely understood. To further address this relationship, we examined differential gene expression in naïve human CD4+ T cells, as well as in in vitro differentiated Th1, memory Th17-negative and Th17-enriched CD4+ T cells subsets using microarray and RNASeq. We observed a marked enrichment for increased expression in memory CD4+ compared to naïve CD4+ T cells of genes contained among immune-mediated disease loci. Within memory T cells, expression of disease-associated genes was typically increased in Th17-enriched compared to Th17-negative cells. Utilizing RNASeq and promoter methylation studies, we identified a differential regulation pattern for genes solely expressed in Th17 cells (IL17A and CCL20) compared to genes expressed in both Th17 and Th1 cells (IL23R and IL12RB2), where high levels of promoter methylation are correlated to near zero RNASeq levels for IL17A and CCL20. These findings have implications for human Th17 celI plasticity and for the regulation of Th17-Th1 expression signatures. Importantly, utilizing RNASeq we found an abundant isoform of IL23R terminating before the transmembrane domain that was enriched in Th17 cells. In addition to molecular resolution, we find that RNASeq provides significantly improved power to define differential gene expression and identify alternative gene variants relative to microarray analysis. The comprehensive integration of differential gene expression between cell subsets with disease-association signals, and functional pathways provides insight into disease pathogenesis.

  19. Blood gene expression profiles suggest altered immune function associated with symptoms of generalized anxiety disorder

    PubMed Central

    Wingo, Aliza P.; Gibson, Greg


    Prospective epidemiological studies found that generalized anxiety disorder (GAD) can impair immune function and increase risk for cardiovascular disease or events. Mechanisms underlying the physiological reverberations of anxiety, however, are still elusive. Hence, we aimed to investigate molecular processes mediating effects of anxiety on physical health using blood gene expression profiles of 336 community participants (157 anxious and 179 control). We examined genome-wide differential gene expression in anxiety, as well as associations between nine major modules of co-regulated transcripts in blood gene expression and anxiety. No significant differential expression was observed in women, but 631 genes were differentially expressed between anxious and control men at the false discovery rate of 0.1 after controlling for age, body mass index, race, and batch effect. Gene set enrichment analysis (GSEA) revealed that genes with altered expression levels in anxious men were involved in response of various immune cells to vaccination and to acute viral and bacterial infection, and in a metabolic network affecting traits of metabolic syndrome. Further, we found one set of 260 co-regulated genes to be significantly associated with anxiety in men after controlling for the relevant covariates, and demonstrate its equivalence to a component of the stress-related conserved transcriptional response to adversity profile. Taken together, our results suggest potential molecular pathways that can explain negative effects of GAD observed in epidemiological studies. Remarkably, even mild anxiety, which most of our participants had, was associated with observable changes in immune-related gene expression levels. Our findings generate hypotheses and provide incremental insights into molecular mechanisms mediating negative physiological effects of GAD. PMID:25300922

  20. Blood gene expression profiles suggest altered immune function associated with symptoms of generalized anxiety disorder.


    Wingo, Aliza P; Gibson, Greg


    Prospective epidemiological studies found that generalized anxiety disorder (GAD) can impair immune function and increase risk for cardiovascular disease or events. Mechanisms underlying the physiological reverberations of anxiety, however, are still elusive. Hence, we aimed to investigate molecular processes mediating effects of anxiety on physical health using blood gene expression profiles of 336 community participants (157 anxious and 179 control). We examined genome-wide differential gene expression in anxiety, as well as associations between nine major modules of co-regulated transcripts in blood gene expression and anxiety. No significant differential expression was observed in women, but 631 genes were differentially expressed between anxious and control men at the false discovery rate of 0.1 after controlling for age, body mass index, race, and batch effect. Gene set enrichment analysis (GSEA) revealed that genes with altered expression levels in anxious men were involved in response of various immune cells to vaccination and to acute viral and bacterial infection, and in a metabolic network affecting traits of metabolic syndrome. Further, we found one set of 260 co-regulated genes to be significantly associated with anxiety in men after controlling for the relevant covariates, and demonstrate its equivalence to a component of the stress-related conserved transcriptional response to adversity profile. Taken together, our results suggest potential molecular pathways that can explain negative effects of GAD observed in epidemiological studies. Remarkably, even mild anxiety, which most of our participants had, was associated with observable changes in immune-related gene expression levels. Our findings generate hypotheses and provide incremental insights into molecular mechanisms mediating negative physiological effects of GAD.

  1. Immune gene discovery by expressed sequence tag (EST) analysis of hemocytes in the ridgetail white prawn Exopalaemon carinicauda

    PubMed Central

    Duan, Yafei; Liu, Ping; Li, Jitao; Li, Jian; Chen, Ping


    The ridgetail white prawn Exopalaemon carinicauda is one of the most important commercial species in eastern China. However, little information of immune genes in E. carinicauda has been reported. To identify distinctive genes associated with immunity, an expressed sequence tag (EST) library was constructed from hemocytes of E. carinicauda. A total of 3411 clones were sequenced, yielding 2853 ESTs and the average sequence length is 436 bp. The cluster and assembly analysis yielded 1053 unique sequences including 329 contigs and 724 singletons. Blast analysis identified 593 (56.3%) of the unique sequences as orthologs of genes from other organisms (E-value < 1e-5). Based on the COG and Gene Ontology (GO), 593 unique sequences were classified. Through comparison with previous studies, 153 genes assembled from 367 ESTs have been identified as possibly involved in defense or immune functions. These genes are categorized into seven categories according to their putative functions in shrimp immune system: antimicrobial peptides, prophenoloxidase activating system, antioxidant defense systems, chaperone proteins, clottable proteins, pattern recognition receptors and other immune-related genes. According to EST abundance, the major immune-related genes were thioredoxin (141, 4.94% of all ESTs) and calmodulin (14, 0.49% of all ESTs). The EST sequences of E. carinicauda hemocytes provide important information of the immune system and lay the groundwork for development of molecular markers related to disease resistance in prawn species. PMID:23092732

  2. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis.


    Ding, Xicheng; Lillehoj, Hyun S; Dalloul, Rami A; Min, Wongi; Sato, Takanori; Yasuda, Atsushi; Lillehoj, Erik P


    An Eimeria tenella microneme recombinant gene (EtMIC2) and encoded protein were evaluated as potential vaccines against avian coccidiosis. In ovo inoculation with the EtMIC2 gene increased anti-EtMIC2 antibody titers at days 10 and 17 following E. tenella infection. In addition, vaccinated birds developed protective immunity against infection by E. tenella as assessed by significantly increased body weight gain and decreased fecal oocyst shedding compared with non-vaccinated controls. Vaccination with the EtMIC2 gene also led to protective immunity against infection by E. acervulina, but not E. maxima. Combined in ovo DNA vaccination plus post-hatch boosting with EtMIC2 DNA or protein did not improve antibody titers or protective immunity beyond that achieved with in ovo vaccination alone. These results provide evidence that in ovo immunization with a recombinant Eimeria microneme gene stimulates protective intestinal immunity against coccidiosis.

  3. Gene therapy for immune disorders: good news tempered by bad news.


    Puck, Jennifer M; Malech, Harry L


    After a dozen years of human gene therapy trials characterized by minimal gene correction and disappointing clinical impact, the field of gene therapy received some good news in 2000. Infants with X-linked severe combined immunodeficiency who received retroviral gene addition to cells from their bone marrow developed impressive immune reconstitution. During the following 2 years, additional patients were treated and the news was even better-babies receiving gene therapy had sustained T-cell production and in several cases developed better cell function than most patients treated with standard bone marrow transplants. Unfortunately, bad news followed. Three of the patients experienced leukemic T-cell expansions, found to be associated with retroviral insertions into genomic DNA. Where does the field stand today?

  4. SNP/haplotype associations in cytokine and cytokine receptor genes and immunity to rubella vaccine.


    Dhiman, Neelam; Haralambieva, Iana H; Kennedy, Richard B; Vierkant, Robert A; O'Byrne, Megan M; Ovsyannikova, Inna G; Jacobson, Robert M; Poland, Gregory A


    An effective immune response to vaccination is, in part, a complex interaction of alleles of multiple genes regulating cytokine networks. We conducted a genotyping study of Th1/Th2/inflammatory cytokines/cytokine receptors in healthy children (n = 738, 11-19 years) to determine associations between individual single-nucleotide polymorphisms (SNPs)/haplotypes and immune outcomes after two doses of rubella vaccine. SNPs (n = 501) were selected using the ldSelect-approach and genotyped using Illumina GoldenGate and TaqMan assays. Rubella-IgG levels were measured by immunoassay and secreted cytokines by ELISA. Linear regression and post hoc haplotype analyses were used to determine associations between single SNPs/haplotypes and immune outcomes. Increased carriage of minor alleles for the promoter SNPs (rs2844482 and rs2857708) of the TNFA gene were associated with dose-related increases in rubella antibodies. IL-6 secretion was co-directionally associated (p < or = 0.01) with five intronic SNPs in the TNFRSF1B gene in an allele dose-related manner, while five promoter/intronic SNPs in the IL12B gene were associated with variations in IL-6 secretion. TNFA haplotype AAACGGGGC (t-statistic = 3.32) and IL12B promoter haplotype TAG (t-statistic = 2.66) were associated with higher levels of (p < or = 0.01) rubella-IgG and IL-6 secretion, respectively. We identified individual SNPs/haplotypes in TNFA/TNFRSF1B and IL12B genes that appear to modulate immunity to rubella vaccination. Identification of such "genetic fingerprints" may predict the outcome of vaccine response and inform new vaccine strategies.

  5. ImmuCo: a database of gene co-expression in immune cells

    PubMed Central

    Wang, Pingzhang; Qi, Huiying; Song, Shibin; Li, Shuang; Huang, Ningyu; Han, Wenling; Ma, Dalong


    Current gene co-expression databases and correlation networks do not support cell-specific analysis. Gene co-expression and expression correlation are subtly different phenomena, although both are likely to be functionally significant. Here, we report a new database, ImmuCo (, which is a cell-specific database that contains information about gene co-expression in immune cells, identifying co-expression and correlation between any two genes. The strength of co-expression of queried genes is indicated by signal values and detection calls, whereas expression correlation and strength are reflected by Pearson correlation coefficients. A scatter plot of the signal values is provided to directly illustrate the extent of co-expression and correlation. In addition, the database allows the analysis of cell-specific gene expression profile across multiple experimental conditions and can generate a list of genes that are highly correlated with the queried genes. Currently, the database covers 18 human cell groups and 10 mouse cell groups, including 20 283 human genes and 20 963 mouse genes. More than 8.6 × 108 and 7.4 × 108 probe set combinations are provided for querying each human and mouse cell group, respectively. Sample applications support the distinctive advantages of the database. PMID:25326331

  6. Polymorphisms in Anopheles gambiae Immune Genes Associated with Natural Resistance to Plasmodium falciparum

    PubMed Central

    Harris, Caroline; Lambrechts, Louis; Rousset, François; Abate, Luc; Nsango, Sandrine E.; Fontenille, Didier; Morlais, Isabelle; Cohuet, Anna


    Many genes involved in the immune response of Anopheles gambiae, the main malaria vector in Africa, have been identified, but whether naturally occurring polymorphisms in these genes underlie variation in resistance to the human malaria parasite, Plasmodium falciparum, is currently unknown. Here we carried out a candidate gene association study to identify single nucleotide polymorphisms (SNPs) associated with natural resistance to P. falciparum. A. gambiae M form mosquitoes from Cameroon were experimentally challenged with three local wild P. falciparum isolates. Statistical associations were assessed between 157 SNPs selected from a set of 67 A. gambiae immune-related genes and the level of infection. Isolate-specific associations were accounted for by including the effect of the isolate in the analysis. Five SNPs were significantly associated to the infection phenotype, located within or upstream of AgMDL1, CEC1, Sp PPO activate, Sp SNAKElike, and TOLL6. Low overall and local linkage disequilibrium indicated high specificity in the loci found. Association between infection phenotype and two SNPs was isolate-specific, providing the first evidence of vector genotype by parasite isolate interactions at the molecular level. Four SNPs were associated to either oocyst presence or load, indicating that the genetic basis of infection prevalence and intensity may differ. The validity of the approach was verified by confirming the functional role of Sp SNAKElike in gene silencing assays. These results strongly support the role of genetic variation within or near these five A. gambiae immune genes, in concert with other genes, in natural resistance to P. falciparum. They emphasize the need to distinguish between infection prevalence and intensity and to account for the genetic specificity of vector-parasite interactions in dissecting the genetic basis of Anopheles resistance to human malaria. PMID:20862317

  7. Spatial and temporal coordination of expression of immune response genes during Pseudomonas infection of horseshoe crab, Carcinoscorpius rotundicauda.


    Ding, J L; Tan, K C; Thangamani, S; Kusuma, N; Seow, W K; Bui, T H H; Wang, J; Ho, B


    Knowledge on how genes are turned on/off during infection and immunity is lacking. Here, we report the co-regulation of diverse clusters of functionally related immune response genes in a horseshoe crab, Carcinoscorpius rotundicauda. Expressed sequence tag (EST) clusters for frontline immune defense, cell signalling, apoptosis and stress response genes were expressed or repressed spatio-temporally during the acute phase of Pseudomonas infection. An infection time course monitored by virtual Northern evaluation indicates upregulation of genes in blood cells (amebocytes) at 3-h postinfection, whereas most of the hepatopancreas genes remained down regulated over 72 h of infection. Thus, the two tissues orchestrate a coordinated and timely response to infection. The hepatopancreas probably immuno-modulates the expression of other genes and serves as a reservoir for later response, if/when chronic infection ensues. On the other hand, being the first to encounter pathogens, we reasoned that amebocytes would respond acutely to infection. Besides acute transactivation of the immune genes, the amebocytes maintained morphological integrity, indicating their ability to synthesise and store/secrete the immune proteins and effectors to sustain the frontline innate immune defense, while simultaneously elicit complement-mediated phagocytosis of the invading pathogen. Our results show that the immune response against Pseudomonas infection is spatially and temporally coordinated.

  8. Transcriptome sequencing of black grouse (Tetrao tetrix) for immune gene discovery and microsatellite development

    PubMed Central

    Wang, Biao; Ekblom, Robert; Castoe, Todd A.; Jones, Eleanor P.; Kozma, Radoslav; Bongcam-Rudloff, Erik; Pollock, David D.; Höglund, Jacob


    The black grouse (Tetrao tetrix) is a galliform bird species that is important for both ecological studies and conservation genetics. Here, we report the sequencing of the spleen transcriptome of black grouse using 454 GS FLX Titanium sequencing. We performed a large-scale gene discovery analysis with a focus on genes that might be related to fitness in this species and also identified a large set of microsatellites. In total, we obtained 182 179 quality-filtered sequencing reads that we assembled into 9035 contigs. Using these contigs and 15 794 length-filtered (greater than 200 bp) singletons, we identified 7762 transcripts that appear to be homologues of chicken genes. A specific BLAST search with an emphasis on immune genes found 308 homologous chicken genes that have immune function, including ten major histocompatibility complex-related genes located on chicken chromosome 16. We also identified 1300 expressed sequence tag microsatellites and were able to design suitable flanking primers for 526 of these. A preliminary test of the polymorphism of the microsatellites found 10 polymorphic microsatellites of the 102 tested. Genomic resources generated in this study should greatly benefit future ecological, evolutionary and conservation genetic studies on this species. PMID:22724064

  9. Transcriptome sequencing of black grouse (Tetrao tetrix) for immune gene discovery and microsatellite development.


    Wang, Biao; Ekblom, Robert; Castoe, Todd A; Jones, Eleanor P; Kozma, Radoslav; Bongcam-Rudloff, Erik; Pollock, David D; Höglund, Jacob


    The black grouse (Tetrao tetrix) is a galliform bird species that is important for both ecological studies and conservation genetics. Here, we report the sequencing of the spleen transcriptome of black grouse using 454 GS FLX Titanium sequencing. We performed a large-scale gene discovery analysis with a focus on genes that might be related to fitness in this species and also identified a large set of microsatellites. In total, we obtained 182 179 quality-filtered sequencing reads that we assembled into 9035 contigs. Using these contigs and 15 794 length-filtered (greater than 200 bp) singletons, we identified 7762 transcripts that appear to be homologues of chicken genes. A specific BLAST search with an emphasis on immune genes found 308 homologous chicken genes that have immune function, including ten major histocompatibility complex-related genes located on chicken chromosome 16. We also identified 1300 expressed sequence tag microsatellites and were able to design suitable flanking primers for 526 of these. A preliminary test of the polymorphism of the microsatellites found 10 polymorphic microsatellites of the 102 tested. Genomic resources generated in this study should greatly benefit future ecological, evolutionary and conservation genetic studies on this species.

  10. SARS-CoV regulates immune function-related gene expression in human monocytic cells.


    Hu, Wanchung; Yen, Yu-Ting; Singh, Sher; Kao, Chuan-Liang; Wu-Hsieh, Betty A


    Severe acute respiratory syndrome (SARS) is characterized by acute respiratory distress syndrome (ARDS) and pulmonary fibrosis, and monocytes/macrophages are the key players in the pathogenesis of SARS. In this study, we compared the transcriptional profiles of SARS coronavirus (SARS-CoV)-infected monocytic cells against that infected by coronavirus 229E (CoV-229E). Total RNA was extracted from infected DC-SIGN-transfected monocytes (THP-1-DC-SIGN) at 6 and 24 h after infection, and the gene expression was profiled in oligonucleotide-based microarrays. Analysis of immune-related gene expression profiles showed that at 24 h after SARS-CoV infection: (1) IFN-α/β-inducible and cathepsin/proteasome genes were downregulated; (2) hypoxia/hyperoxia-related genes were upregulated; and (3) TLR/TLR-signaling, cytokine/cytokine receptor-related, chemokine/chemokine receptor-related, lysosome-related, MHC/chaperon-related, and fibrosis-related genes were differentially regulated. These results elucidate that SARS-CoV infection regulates immune-related genes in monocytes/macrophages, which may be important to the pathogenesis of SARS.

  11. AAV2-mediated in vivo immune gene therapy of solid tumours

    PubMed Central


    Background Many strategies have been adopted to unleash the potential of gene therapy for cancer, involving a wide range of therapeutic genes delivered by various methods. Immune therapy has become one of the major strategies adopted for cancer gene therapy and seeks to stimulate the immune system to target tumour antigens. In this study, the feasibility of AAV2 mediated immunotherapy of growing tumours was examined, in isolation and combined with anti-angiogenic therapy. Methods Immune-competent Balb/C or C57 mice bearing subcutaneous JBS fibrosarcoma or Lewis Lung Carcinoma (LLC) tumour xenografts respectively were treated by intra-tumoural administration of AAV2 vector encoding the immune up-regulating cytokine granulocyte macrophage-colony stimulating factor (GM-CSF) and the co-stimulatory molecule B7-1 to subcutaneous tumours, either alone or in combination with intra-muscular (IM) delivery of AAV2 vector encoding Nk4 14 days prior to tumour induction. Tumour growth and survival was monitored for all animals. Cured animals were re-challenged with tumourigenic doses of the original tumour type. In vivo cytotoxicity assays were used to investigate establishment of cell-mediated responses in treated animals. Results AAV2-mediated GM-CSF, B7-1 treatment resulted in a significant reduction in tumour growth and an increase in survival in both tumour models. Cured animals were resistant to re-challenge, and induction of T cell mediated anti-tumour responses were demonstrated. Adoptive transfer of splenocytes to naïve animals prevented tumour establishment. Systemic production of Nk4 induced by intra-muscular (IM) delivery of Nk4 significantly reduced subcutaneous tumour growth. However, combination of Nk4 treatment with GM-CSF, B7-1 therapy reduced the efficacy of the immune therapy. Conclusions Overall, this study demonstrates the potential for in vivo AAV2 mediated immune gene therapy, and provides data on the inter-relationship between tumour vasculature and

  12. Immune-related gene expression in nurse honey bees (Apis mellifera) exposed to synthetic acaricides.


    Garrido, Paula Melisa; Antúnez, Karina; Martín, Mariana; Porrini, Martín Pablo; Zunino, Pablo; Eguaras, Martín Javier


    The mite Varroa destructor is an ectoparasite affecting honey bees worldwide. Synthetic acaricides have been among the principal tools available to beekeepers for its control, although several studies have shown its negative effects on honey bee physiology. Recent research suggests that those molecules strongly impact on immune signaling cascades and cellular immunity. In the present work, LC(50) in six-day-old bees were determined for the following acaricides: tau-fluvalinate, flumethrin, amitraz and coumaphos. According to this obtained value, a group of individuals was treated with each acaricide and then processed for qPCR analysis. Transcript levels for genes encoding antimicrobial peptides and immune-related proteins were assessed. Flumethrin increased the expression of hymenoptaecin when comparing treated and control bees. Significant differences were recorded between coumaphos and flumethrin treatments, while the first one reduced the expression of hymenoptaecin and abaecin, the last one up-regulated their expressions. No significant statistically changes were recorded in the expression levels of vitellogenin, lysozyme or glucose dehydrogenase among bees treated with acaricides and control bees. This work constitutes the first report, under laboratory conditions, about induction of immune related genes in response to synthetic miticides.

  13. Cellular Immune Response Against Firefly Luciferase After Sleeping Beauty–Mediated Gene Transfer In Vivo

    PubMed Central

    Podetz-Pedersen, Kelly M.; Vezys, Vaiva; Somia, Nikunj V.; Russell, Stephen J.


    Abstract The Sleeping Beauty (SB) transposon system has been shown to mediate new gene sequence integration resulting in long-term expression. Here the effectiveness of hyperactive SB100X transposase was tested, and we found that hydrodynamic co-delivery of a firefly luciferase transposon (pT2/CaL) along with SB100X transposase (pCMV-SB100X) resulted in remarkably sustained, high levels of luciferase expression. However, after 4 weeks there was a rapid, animal-by-animal loss of luciferase expression that was not observed in immunodeficient mice. We hypothesized that this sustained, high-level luciferase expression achieved using the SB100X transposase elicits an immune response in pT2/CaL co-administered mice, which was supported by the rapid loss of luciferase expression upon challenge of previously treated animals and in naive animals adoptively transferred with splenocytes from previously treated animals. Specificity of the immune response to luciferase was demonstrated by increased cytokine expression in splenocytes after exposure to luciferase peptide in parallel with MHC I–luciferase peptide tetramer binding. This anti-luciferase immune response observed following continuous, high-level luciferase expression in vivo clearly impacts its use as an in vivo reporter. As both an immunogen and an extremely sensitive reporter, luciferase is also a useful model system for the study of immune responses following in vivo gene transfer and expression. PMID:25093708

  14. Evolution of a polydnavirus gene in relation to parasitoid-host species immune resistance.


    Dupas, Stéphane; Gitau, Catherine Wanjiru; Branca, Antoine; Le Rü, Bruno Pierre; Silvain, Jean-François


    CrV1, a polydisperse DNA virus (polydnavirus or PDV) gene contributes to the suppression of host immunity in Cotesia genus parasitoids. Its molecular evolution was analyzed in relation to levels of resistance in the sympatric host species. Natural selection for nonsynonymous substitutions (positive Darwinian selection) was observed at specific amino acid sites among CrV1 variants; particularly, between parasitoid strains immune suppressive and nonimmune suppressive to the main resistant stem borer host, Busseola fusca. In Cotesia sesamiae, geographic distribution of CrV1 alleles in Kenya was correlated to the relative abundance of B. fusca. These results suggest that PDV genes evolve through natural selection and are genetically linked to factors of suppression of local host resistance. We discuss the forces driving the evolution of CrV1 and its use as a marker to understand parasitoid adaptation to host resistance in biological control.

  15. Discovery of immune-related genes expressed in hemocytes of the tarantula spider Acanthoscurria gomesiana.


    Lorenzini, Daniel M; da Silva, Pedro I; Soares, Marcelo B; Arruda, Paulo; Setubal, João; Daffre, Sirlei


    The present study reports the identification of immune related transcripts from hemocytes of the spider Acanthoscurria gomesiana by high throughput sequencing of expressed sequence tags (ESTs). To generate ESTs from hemocytes, two cDNA libraries were prepared: one by directional cloning (primary) and the other by the normalization of the first (normalized). A total of 7584 clones were sequenced and the identical ESTs were clustered, resulting in 3723 assembled sequences (AS). At least 20% of these sequences are putative novel genes. The automatic functional annotation of AS based on Gene Ontology revealed several abundant transcripts related to the following functional classes: hemocyanin, lectin, and structural constituents of ribosome and cytoskeleton. From this annotation, 73 transcripts possibly involved in immune response were also identified, suggesting the existence of several molecular processes not previously described for spiders, such as: pathogen recognition, coagulation, complement activation, cell adhesion and intracellular signaling pathway for the activation of cellular defenses.

  16. Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.


    Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z


    The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.

  17. Enhanced immune response with foot and mouth disease virus VP1 and interleukin-1 fusion genes.


    Park, Jong Hyeon; Kim, Sun Jin; Oem, Jae Ku; Lee, Kwang Nyeong; Kim, Yong Joo; Kye, Soo Jeong; Park, Jee Yong; Joo, Yi Seok


    The capsid of the foot and mouth disease (FMD) virus carries the epitopes that are critical for inducing the immune response. In an attempt to enhance the specific immune response, plasmid DNA was constructed to express VP1/interleukin-1alpha (IL-1alpha) and precursor capsid (P1) in combination with 2A (P1-2A)/IL-1alpha under the control of the human cytomegalovirus (HCMV) immediateearly promoter and intron. After DNA transfection into MA104 (monkey kidney) cells, Western blotting and an immunofluorescence assay were used to confirm the expression of VP1 or P1-2A and IL-1alpha. Mice were inoculated with the encoding plasmids via the intradermal route, and the IgG1 and IgG2a levels were used to determine the immune responses. These results show that although the immunized groups did not carry a high level of neutralizing antibodies, the plasmids encoding the VP1/ IL-1alpha, and P1-2A /IL-1alpha fused genes were effective in inducing an enhanced immune response.

  18. Genome-Wide Association Studies Suggest Limited Immune Gene Enrichment in Schizophrenia Compared to 5 Autoimmune Diseases.


    Pouget, Jennie G; Gonçalves, Vanessa F; Spain, Sarah L; Finucane, Hilary K; Raychaudhuri, Soumya; Kennedy, James L; Knight, Jo


    There has been intense debate over the immunological basis of schizophrenia, and the potential utility of adjunct immunotherapies. The major histocompatibility complex is consistently the most powerful region of association in genome-wide association studies (GWASs) of schizophrenia and has been interpreted as strong genetic evidence supporting the immune hypothesis. However, global pathway analyses provide inconsistent evidence of immune involvement in schizophrenia, and it remains unclear whether genetic data support an immune etiology per se. Here we empirically test the hypothesis that variation in immune genes contributes to schizophrenia. We show that there is no enrichment of immune loci outside of the MHC region in the largest genetic study of schizophrenia conducted to date, in contrast to 5 diseases of known immune origin. Among 108 regions of the genome previously associated with schizophrenia, we identify 6 immune candidates (DPP4, HSPD1, EGR1, CLU, ESAM, NFATC3) encoding proteins with alternative, nonimmune roles in the brain. While our findings do not refute evidence that has accumulated in support of the immune hypothesis, they suggest that genetically mediated alterations in immune function may not play a major role in schizophrenia susceptibility. Instead, there may be a role for pleiotropic effects of a small number of immune genes that also regulate brain development and plasticity. Whether immune alterations drive schizophrenia progression is an important question to be addressed by future research, especially in light of the growing interest in applying immunotherapies in schizophrenia.

  19. Genome-wide characterization and expression profiling of immune genes in the diamondback moth, Plutella xylostella (L.)

    PubMed Central

    Xia, Xiaofeng; Yu, Liying; Xue, Minqian; Yu, Xiaoqiang; Vasseur, Liette; Gurr, Geoff M.; Baxter, Simon W.; Lin, Hailan; Lin, Junhan; You, Minsheng


    The diamondback moth, Plutella xylostella (L.), is a destructive pest that attacks cruciferous crops worldwide. Immune responses are important for interactions between insects and pathogens and information on these underpins the development of strategies for biocontrol-based pest management. Little, however, is known about immune genes and their regulation patterns in P. xylostella. A total of 149 immune-related genes in 20 gene families were identified through comparison of P. xylostella genome with the genomes of other insects. Complete and conserved Toll, IMD and JAK-STAT signaling pathways were found in P. xylostella. Genes involved in pathogen recognition were expanded and more diversified than genes associated with intracellular signal transduction. Gene expression profiles showed that the IMD pathway may regulate expression of antimicrobial peptide (AMP) genes in the midgut, and be related to an observed down-regulation of AMPs in experimental lines of insecticide-resistant P. xylostella. A bacterial feeding study demonstrated that P. xylostella could activate different AMPs in response to bacterial infection. This study has established a framework of comprehensive expression profiles that highlight cues for immune regulation in a major pest. Our work provides a foundation for further studies on the functions of P. xylostella immune genes and mechanisms of innate immunity. PMID:25943446

  20. Genome-wide characterization and expression profiling of immune genes in the diamondback moth, Plutella xylostella (L.).


    Xia, Xiaofeng; Yu, Liying; Xue, Minqian; Yu, Xiaoqiang; Vasseur, Liette; Gurr, Geoff M; Baxter, Simon W; Lin, Hailan; Lin, Junhan; You, Minsheng


    The diamondback moth, Plutella xylostella (L.), is a destructive pest that attacks cruciferous crops worldwide. Immune responses are important for interactions between insects and pathogens and information on these underpins the development of strategies for biocontrol-based pest management. Little, however, is known about immune genes and their regulation patterns in P. xylostella. A total of 149 immune-related genes in 20 gene families were identified through comparison of P. xylostella genome with the genomes of other insects. Complete and conserved Toll, IMD and JAK-STAT signaling pathways were found in P. xylostella. Genes involved in pathogen recognition were expanded and more diversified than genes associated with intracellular signal transduction. Gene expression profiles showed that the IMD pathway may regulate expression of antimicrobial peptide (AMP) genes in the midgut, and be related to an observed down-regulation of AMPs in experimental lines of insecticide-resistant P. xylostella. A bacterial feeding study demonstrated that P. xylostella could activate different AMPs in response to bacterial infection. This study has established a framework of comprehensive expression profiles that highlight cues for immune regulation in a major pest. Our work provides a foundation for further studies on the functions of P. xylostella immune genes and mechanisms of innate immunity.

  1. Identification and characterization of a TAB1 gene involved in innate immunity of amphioxus (Branchiostoma belcheri).


    Yin, Denghua; Li, Wenjuan; Fu, Meili; Chen, Liming; Ma, Fei; Jin, Ping


    Transforming growth factor-β activated kinase-1 (TAK1) is an essential regulator in toll-like receptor (TLR), tumor necrosis factor (TNF) and interleukin-1 (IL-1) signaling pathways, and plays very important roles in animal innate immunity. TAK1-binding protein, TAB1, can specifically regulate the activation of TAK1. However, the TAB1 gene in amphioxus has not yet been identified to date. In this study, we identified and characterized a TAB1 gene from Branchiostoma belcheri (designed as AmphiTAB1). Our results showed that the full-length cDNA of AmphiTAB1 is 2281bp long with an open reading frame (ORF) of 1659bp that encodes a predicted protein of 553 amino acids containing a typical PP2Cc domain. Phylogenetic analysis indicated that the AmphiTAB1 gene was located between invertebrates and vertebrates, suggesting that the AmphiTAB1 gene is a member of the TAB1 gene family. Real-time PCR analysis indicated that the AmphiTAB1 was ubiquitously and differentially expressed in six investigated tissues (gills, hepatic cecum, intestine, muscles, notochord and gonad). After lipopolysaccharide stimulation, the expression of AmphiTAB1 was significantly up-regulated at 6h, which shows that AmphiTAB1 may be involved in the host immune response. In addition, the recombinant TAB1 expressed in vitro shows a molecular mass of 62kDa and Western blot confirmed it, which proved it is an encoding isoform. Taken together, our findings provide an insight into innate immune response of amphioxus and evolution of the TAB1 gene family.

  2. Adult Drosophila melanogaster evolved for antibacterial defense invest in infection-induced expression of both humoral and cellular immunity genes

    PubMed Central


    Background While the transcription of innate immunity genes in response to bacterial infection has been well-characterised in the Drosophila model, we recently demonstrated the capacity for such transcription to evolve in flies selected for improved antibacterial defense. Here we use this experimental system to examine how insects invest in constitutive versus infection-induced transcription of immunity genes. These two strategies carry with them different consequences with respect to energetic and pleiotropic costs and may be more or less effective in improving defense depending on whether the genes contribute to humoral or cellular aspects of immunity. Findings Contrary to expectation we show that selection preferentially increased the infection-induced expression of both cellular and humoral immunity genes. Given their functional roles, infection induced increases in expression were expected for the humoral genes, while increases in constitutive expression were expected for the cellular genes. We also report a restricted ability to improve transcription of immunity genes that is on the order of 2-3 fold regardless of total transcription level of the gene. Conclusions The evolved increases in infection-induced expression of the cellular genes may result from specific cross talk with humoral pathways or from generalised strategies for enhancing immunity gene transcription. A failure to see improvements in constitutive expression of the cellular genes suggests either that increases might come at too great a cost or that patterns of expression in adults are decoupled from the larval phase where increases would be most effective. The similarity in fold change increase across all immunity genes may suggest a shared mechanism for the evolution of increased transcription in small, discrete units such as duplication of cis-regulatory elements. PMID:21859495

  3. Trans-species polymorphism at antimicrobial innate immunity cathelicidin genes of Atlantic cod and related species.


    Halldórsdóttir, Katrín; Árnason, Einar


    Natural selection, the most important force in evolution, comes in three forms. Negative purifying selection removes deleterious variation and maintains adaptations. Positive directional selection fixes beneficial variants, producing new adaptations. Balancing selection maintains variation in a population. Important mechanisms of balancing selection include heterozygote advantage, frequency-dependent advantage of rarity, and local and fluctuating episodic selection. A rare pathogen gains an advantage because host defenses are predominantly effective against prevalent types. Similarly, a rare immune variant gives its host an advantage because the prevalent pathogens cannot escape the host's apostatic defense. Due to the stochastic nature of evolution, neutral variation may accumulate on genealogical branches, but trans-species polymorphisms are rare under neutrality and are strong evidence for balancing selection. Balanced polymorphism maintains diversity at the major histocompatibility complex (MHC) in vertebrates. The Atlantic cod is missing genes for both MHC-II and CD4, vital parts of the adaptive immune system. Nevertheless, cod are healthy in their ecological niche, maintaining large populations that support major commercial fisheries. Innate immunity is of interest from an evolutionary perspective, particularly in taxa lacking adaptive immunity. Here, we analyze extensive amino acid and nucleotide polymorphisms of the cathelicidin gene family in Atlantic cod and closely related taxa. There are three major clusters, Cath1, Cath2, and Cath3, that we consider to be paralogous genes. There is extensive nucleotide and amino acid allelic variation between and within clusters. The major feature of the results is that the variation clusters by alleles and not by species in phylogenetic trees and discriminant analysis of principal components. Variation within the three groups shows trans-species polymorphism that is older than speciation and that is suggestive of

  4. Molecular clock of HIV-1 envelope genes under early immune selection


    Park, Sung Yong; Love, Tanzy M. T.; Perelson, Alan S.; ...


    Here, the molecular clock hypothesis that genes or proteins evolve at a constant rate is a key tool to reveal phylogenetic relationships among species. Using the molecular clock, we can trace an infection back to transmission using HIV-1 sequences from a single time point. Whether or not a strict molecular clock applies to HIV-1’s early evolution in the presence of immune selection has not yet been fully examined.

  5. Human T cell leukemia virus type I and neurologic disease: events in bone marrow, peripheral blood, and central nervous system during normal immune surveillance and neuroinflammation.


    Grant, Christian; Barmak, Kate; Alefantis, Timothy; Yao, Jing; Jacobson, Steven; Wigdahl, Brian


    Human T cell lymphotropic/leukemia virus type I (HTLV-I) has been identified as the causative agent of both adult T cell leukemia (ATL) and HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Although the exact sequence of events that occur during the early stages of infection are not known in detail, the initial route of infection may predetermine, along with host, environmental, and viral factors, the subset of target cells and/or the primary immune response encountered by HTLV-I, and whether an HTLV-I-infected individual will remain asymptomatic, develop ATL, or progress to the neuroinflammatory disease, HAM/TSP. Although a large number of studies have indicated that CD4(+) T cells represent an important target for HTLV-I infection in the peripheral blood (PB), additional evidence has accumulated over the past several years demonstrating that HTLV-I can infect several additional cellular compartments in vivo, including CD8(+) T lymphocytes, PB monocytes, dendritic cells, B lymphocytes, and resident central nervous system (CNS) astrocytes. More importantly, extensive latent viral infection of the bone marrow, including cells likely to be hematopoietic progenitor cells, has been observed in individuals with HAM/TSP as well as some asymptomatic carriers, but to a much lesser extent in individuals with ATL. Furthermore, HTLV-I(+) CD34(+) hematopoietic progenitor cells can maintain the intact proviral genome and initiate viral gene expression during the differentiation process. Introduction of HTLV-I-infected bone marrow progenitor cells into the PB, followed by genomic activation and low level viral gene expression may lead to an increase in proviral DNA load in the PB, resulting in a progressive state of immune dysregulation including the generation of a detrimental cytotoxic Tax-specific CD8(+) T cell population, anti-HTLV-I antibodies, and neurotoxic cytokines involved in disruption of myelin-producing cells and neuronal degradation

  6. Th1/Th2 Cytokines: An Easy Model to Study Gene Expression in Immune Cells

    PubMed Central

    González-Polo, Rosa A.; Soler, Germán; Fuentes, José M.


    This report describes a laboratory exercise that was incorporated into a Cell Biology and Molecular Biology advanced course. The exercise was made for a class size with eight students and was designed to reinforce the understanding of basic molecular biology techniques. Students used the techniques of reverse transcription and arginase activity measurement as well as nitric oxide determination to discover whether two specific genes were expressed by cytokine-stimulated dendritic cells. The experiment served as the basis for discussing the importance of differential gene expression inside the eukaryotic cell and the importance of cytokines in the immune system. PMID:17012221

  7. Dietary fermentable fiber upregulated immune related genes expression, increased innate immune response and resistance of rainbow trout (Oncorhynchus mykiss) against Aeromonas hydrophila.


    Yarahmadi, Peyman; Kolangi Miandare, Hamed; Farahmand, Hamid; Mirvaghefi, Alireza; Hoseinifar, Seyed Hossein


    This trial was carried out to investigate the effects of dietary administration of Vitacel(®), a commercial fermentable fiber, on immune related genes (Lysozyme, TNFα and HSP70) expression, innate immune response and resistance of rainbow trout against Aeromonas hydrophila. 120 healthy rainbow trout (81.65 ± 1.49 g) were distributed in six fiberglass tanks assigned to two treatments. The treatments were feeding rainbow trout with diets supplemented with 0 (control) or 10 g kg(-1) Vitacel(®) for 45 days. The results revealed that administration of fermentable fiber significantly (P < 0.05) upregulated lysozyme and TNFα gene expression. HSP70 gene expression was significantly lower in Vitacel(®) fed fish at the end of trial (P < 0.05). Furthermore dietary administrations of Vitacel(®) remarkably elevated rainbow trout innate immune parameters include serum lysozyme, ACH50, bactericidal activity and agglutination antibody titer (P < 0.05). Administration of 10 g kg(-1) Vitacel(®) significantly increased rainbow trout resistance against A. hydrophila (P < 0.05). The results of present study revealed that dietary Vitacel(®) can upregulates immune related genes expression and elevates innate immune response and disease resistance of rainbow trout.

  8. The extent to which immunity, apoptosis and detoxification gene expression interact with 17 alpha-methyltestosterone.


    Abo-Al-Ela, Haitham G; El-Nahas, Abeer F; Mahmoud, Shawky; Ibrahim, Essam M


    Innate immunity is the first line of defence against invasion by foreign pathogens. One widely used synthetic androgen for the production of all-male fish, particularly commercially valuable Nile tilapia, Oreochromis niloticus, is 17 alpha-methyltestosterone (MT). The present study investigates the effect of MT on innate immunity, cellular apoptosis and detoxification and the mortality rate, during and after the feeding of fry with 0-, 40-and 60-mg MT/kg. Expression analysis was completed on interleukin 1 beta (il1β), interleukin 8 (il8), tumour necrosis factor alpha (tnfα), CXC2- and CC-chemokines, interferon (ifn), myxovirus resistance (mx), toll-like receptor 7 (tlr7), immunoglobulin M heavy chain (IgM heavy chain), vitellogenin (vtg), cellular apoptosis susceptibility (cas) and glutathione S-transferase α1 (gstα1). Expression analysis revealed that MT had a significant impact on these genes, and this impact varied from induction to repression during and after the treatment. Linear regression analysis showed a significant association between the majority of the tested gene transcript levels and mortality rates on the 7(th) and 21(st) days of hormonal treatment and 2 weeks following hormonal cessation. The results are thoroughly discussed in this article. This is the first report concerning the hazardous effect of MT on a series of genes involved in immunity, apoptosis and detoxification in the Nile tilapia fry.

  9. Differentiated regulation of immune-response related genes between LUAD and LUSC subtypes of lung cancers

    PubMed Central

    Chen, Mengzhu; Liu, Xiuying; Du, Jie; Wang, Xiu-Jie; Xia, Lixin


    Lung squamous cell carcinoma (LUSC) and lung adenocarcinoma (LUAD) are the two major subtypes of lung cancer, with LUSC exhibits faster progression rate than LUAD. To investigate the roles of immune-response related genes (IRGs) in lung cancer progression, we used LUAD and LUSC samples at different cancer progression stages, and identified that the expression profiles of IRGs could serve as a better classification marker for cancerous tissues of both LUAD and LUSC. We found that the expression changes of IRGs were different between LUAD and LUSC. Cell cycle promoting genes, including KIFs and proteasomes, showed faster up-regulation in LUSC, whereas immune response promoting genes, including MHC molecules and chemokines, were more rapidly repressed in LUSC. Comparative pathway analysis revealed that members of the Toll-like receptor and T cell receptor signaling pathways exhibited diverged expression changes between LUAD and LUSC, especially at the early cancer stages. Our results revealed the difference of LUAD and LUSC from the immune response point of view, and provided new clues for the differential treatment of LUAD and LUSC. PMID:27863400

  10. Linking Transcriptional Changes over Time in Stimulated Dendritic Cells to Identify Gene Networks Activated during the Innate Immune Response

    PubMed Central

    Patil, Ashwini; Kumagai, Yutaro; Liang, Kuo-ching; Suzuki, Yutaka; Nakai, Kenta


    The innate immune response is primarily mediated by the Toll-like receptors functioning through the MyD88-dependent and TRIF-dependent pathways. Despite being widely studied, it is not yet completely understood and systems-level analyses have been lacking. In this study, we identified a high-probability network of genes activated during the innate immune response using a novel approach to analyze time-course gene expression profiles of activated immune cells in combination with a large gene regulatory and protein-protein interaction network. We classified the immune response into three consecutive time-dependent stages and identified the most probable paths between genes showing a significant change in expression at each stage. The resultant network contained several novel and known regulators of the innate immune response, many of which did not show any observable change in expression at the sampled time points. The response network shows the dominance of genes from specific functional classes during different stages of the immune response. It also suggests a role for the protein phosphatase 2a catalytic subunit α in the regulation of the immunoproteasome during the late phase of the response. In order to clarify the differences between the MyD88-dependent and TRIF-dependent pathways in the innate immune response, time-course gene expression profiles from MyD88-knockout and TRIF-knockout dendritic cells were analyzed. Their response networks suggest the dominance of the MyD88-dependent pathway in the innate immune response, and an association of the circadian regulators and immunoproteasomal degradation with the TRIF-dependent pathway. The response network presented here provides the most probable associations between genes expressed in the early and the late phases of the innate immune response, while taking into account the intermediate regulators. We propose that the method described here can also be used in the identification of time-dependent gene sub

  11. Linking transcriptional changes over time in stimulated dendritic cells to identify gene networks activated during the innate immune response.


    Patil, Ashwini; Kumagai, Yutaro; Liang, Kuo-Ching; Suzuki, Yutaka; Nakai, Kenta


    The innate immune response is primarily mediated by the Toll-like receptors functioning through the MyD88-dependent and TRIF-dependent pathways. Despite being widely studied, it is not yet completely understood and systems-level analyses have been lacking. In this study, we identified a high-probability network of genes activated during the innate immune response using a novel approach to analyze time-course gene expression profiles of activated immune cells in combination with a large gene regulatory and protein-protein interaction network. We classified the immune response into three consecutive time-dependent stages and identified the most probable paths between genes showing a significant change in expression at each stage. The resultant network contained several novel and known regulators of the innate immune response, many of which did not show any observable change in expression at the sampled time points. The response network shows the dominance of genes from specific functional classes during different stages of the immune response. It also suggests a role for the protein phosphatase 2a catalytic subunit α in the regulation of the immunoproteasome during the late phase of the response. In order to clarify the differences between the MyD88-dependent and TRIF-dependent pathways in the innate immune response, time-course gene expression profiles from MyD88-knockout and TRIF-knockout dendritic cells were analyzed. Their response networks suggest the dominance of the MyD88-dependent pathway in the innate immune response, and an association of the circadian regulators and immunoproteasomal degradation with the TRIF-dependent pathway. The response network presented here provides the most probable associations between genes expressed in the early and the late phases of the innate immune response, while taking into account the intermediate regulators. We propose that the method described here can also be used in the identification of time-dependent gene sub

  12. Gene Models, Expression Repertoire, and Immune Response of Plasmodium vivax Reticulocyte Binding Proteins

    PubMed Central

    Hietanen, Jenni; Chim-ong, Anongruk; Chiramanewong, Thanprakorn; Gruszczyk, Jakub; Roobsoong, Wanlapa; Sattabongkot, Jetsumon


    Members of the Plasmodium vivax reticulocyte binding protein (PvRBP) family are believed to mediate specific invasion of reticulocytes by P. vivax. In this study, we performed molecular characterization of genes encoding members of this protein family. Through cDNA sequencing, we constructed full-length gene models and verified genes that are protein coding and those that are pseudogenes. We also used quantitative PCR to measure their in vivo transcript abundances in clinical P. vivax isolates. Like genes encoding related invasion ligands of P. falciparum, Pvrbp expression levels vary broadly across different parasite isolates. Through antibody measurements, we found that host immune pressure may be the driving force behind the distinctly high diversity of one of the family members, PvRBP2c. Mild yet significant negative correlation was found between parasitemia and the PvRBP2b antibody level, suggesting that antibodies to the protein may interfere with invasion. PMID:26712206

  13. NF-Y and the immune response: Dissecting the complex regulation of MHC genes.


    Sachini, Nikoleta; Papamatheakis, Joseph


    Nuclear Factor Y (NF-Y) was first described as one of the CCAAT binding factors. Although CCAAT motifs were found to be present in various genes, NF-Y attracted a lot of interest early on, due to its role in Major Histocompatibility Complex (MHC) gene regulation. MHC genes are crucial in immune response and show peculiar expression patterns. Among other conserved elements on MHC promoters, an NF-Y binding CCAAT box was found to contribute to MHC transcriptional regulation. NF-Y along with other DNA binding factors assembles in a stereospecific manner to form a multiprotein scaffold, the MHC enhanceosome, which is necessary but not sufficient to drive transcription. Transcriptional activation is achieved by the recruitment of yet another factor, the class II transcriptional activator (CIITA). In this review, we briefly discuss basic findings on MHCII transcription regulation and we highlight NF-Y different modes of function in MHCII gene activation.

  14. Gene Networks Specific for Innate Immunity Define Post-Traumatic Stress Disorder

    PubMed Central

    Breen, Michael S.; Maihofer, Adam X.; Glatt, Stephen J.; Tylee, Daniel S.; Chandler, Sharon D.; Tsuang, Ming T.; Risbrough, Victoria B.; Baker, Dewleen G.; O’Connor, Daniel T.; Nievergelt, Caroline M.; Woelk, Christopher H.


    The molecular factors involved in the development of Post-Traumatic Stress Disorder (PTSD) remain poorly understood. Previous transcriptomic studies investigating the mechanisms of PTSD apply targeted approaches to identify individual genes under a cross-sectional framework lack a holistic view of the behaviours and properties of these genes at the system-level. Here we sought to apply an unsupervised gene-network based approach to a prospective experimental design using whole-transcriptome RNA-Seq gene expression from peripheral blood leukocytes of U.S. Marines (N=188), obtained both pre- and post-deployment to conflict zones. We identified discrete groups of co-regulated genes (i.e., co-expression modules) and tested them for association to PTSD. We identified one module at both pre- and post-deployment containing putative causal signatures for PTSD development displaying an over-expression of genes enriched for functions of innate-immune response and interferon signalling (Type-I and Type-II). Importantly, these results were replicated in a second non-overlapping independent dataset of U.S. Marines (N=96), further outlining the role of innate immune and interferon signalling genes within co-expression modules to explain at least part of the causal pathophysiology for PTSD development. A second module, consequential of trauma exposure, contained PTSD resiliency signatures and an over-expression of genes involved in hemostasis and wound responsiveness suggesting that chronic levels of stress impair proper wound healing during/after exposure to the battlefield while highlighting the role of the hemostatic system as a clinical indicator of chronic-based stress. These findings provide novel insights for early preventative measures and advanced PTSD detection, which may lead to interventions that delay or perhaps abrogate the development of PTSD. PMID:25754082

  15. Humoral immunity to AAV vectors in gene therapy: challenges and potential solutions.


    Masat, Elisa; Pavani, Giulia; Mingozzi, Federico


    Gene transfer trials with adeno-associated virus (AAV) vectors have initiated to unveil the therapeutic potential of this approach, with some of the most exciting results coming from clinical studies of gene transfer for hemophilia B, congenital blindness, and the recent market approval of the first AAV-based gene therapy in Europe. With clinical development, however, some of the limitations of in vivo gene transfer have emerged; in particular the host immune system represents an important obstacle to be overcome in terms of both safety and efficacy of gene transfer in vivo with AAV vectors. Results in humans undergoing gene transfer indicate that capsid-specific T cell responses directed against transduced cells may limit the duration of transgene expression following AAV gene transfer, and similarly anti-AAV neutralizing antibodies can completely prevent transduction of a target tissue, resulting in lack of efficacy. Anti-AAV neutralizing antibodies are highly prevalent in humans, and the frequency of subjects with detectable titers can reach up to two thirds of the population. The approach to the problem of preexisting humoral immunity to AAV so far has been the exclusion of seropositive subjects, but this solution is far from being optimal. Several additional strategies have been proposed and tested in a variety of preclinical animal models. Future studies will help defining the optimal strategy, or combination of strategies, to successfully treat subjects with preexisting antibodies to AAV due to natural infection or to prior administration of AAV vectors. These advancements will likely have a significant impact on the field of gene transfer with AAV vectors.

  16. Immune response to lentiviral bilirubin UDP-glucuronosyltransferase gene transfer in fetal and neonatal rats.


    Seppen, J; van Til, N P; van der Rijt, R; Hiralall, J K; Kunne, C; Elferink, R P J Oude


    Gene therapy for inherited disorders might cause an immune response to the therapeutic protein. A solution would be to introduce the gene in the fetal or neonatal period, which should lead to tolerization. Lentiviral vectors mediate long-term gene expression, and are well suited for gene therapy early in development. A model for fetal or neonatal gene therapy is the inherited disorder of bilirubin metabolism, Crigler-Najjar disease (CN). The absence of bilirubin UDP-glucoronyltransferase (UGT1A1) activity in CN patients causes high serum levels of unconjugated bilirubin and brain damage in infancy. CN is attractive for the development of gene therapy because the mutant Gunn rat closely mimics the human disease. Injection of UGT1A1 lentiviral vectors corrected the hyperbilirubinemia for more than a year in rats injected as fetuses and for up to 18 weeks in rats injected the day of birth. UGT1A1 gene transfer was confirmed by the presence of bilirubin glucuronides in bile. All animals injected with UGT1A1 lentiviral vectors developed antibodies to UGT1A1. Animals injected with green fluorescent protein (GFP) lentiviral vectors did not develop antibodies to GFP. Our results indicate that fetal and neonatal gene therapy with immunogenic proteins such as UGT1A1 does not necessarily lead to tolerization.

  17. The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.


    Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon


    The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

  18. Innate immunity gene expression changes in critically ill patients with sepsis and disease-related malnutrition

    PubMed Central

    Sarnecka, Agnieszka; Dąbrowska, Aleksandra; Kosałka, Katarzyna; Wachowska, Ewelina; Bałan, Barbara J.; Jankowska, Marta; Korta, Teresa; Niewiński, Grzegorz; Kański, Andrzej; Mikaszewska-Sokolewicz, Małgorzata; Omidi, Mohammad; Majewska, Krystyna; Słotwińska, Sylwia M.


    The aim of this study was an attempt to determine whether the expression of genes involved in innate antibacterial response (TL R2, NOD 1, TRAF6, HMGB 1 and Hsp70) in peripheral blood leukocytes in critically ill patients, may undergo significant changes depending on the severity of the infection and the degree of malnutrition. The study was performed in a group of 128 patients with infections treated in the intensive care and surgical ward. In 103/80.5% of patients, infections had a severe course (sepsis, severe sepsis, septic shock, mechanical ventilation of the lungs). Clinical monitoring included diagnosis of severe infection (according to the criteria of the ACC P/SCC M), assessment of severity of the patient condition and risk of death (APACHE II and SAPS II), nutritional assessment (NRS 2002 and SGA scales) and the observation of the early results of treatment. Gene expression at the mRNA level was analyzed by real-time PCR. The results of the present study indicate that in critically ill patients treated in the IC U there are significant disturbances in the expression of genes associated with innate antimicrobial immunity, which may have a significant impact on the clinical outcome. The expression of these genes varies depending on the severity of the patient condition, severity of infection and nutritional status. Expression disorders of genes belonging to innate antimicrobial immunity should be diagnosed as early as possible, monitored during the treatment and taken into account during early therapeutic treatment (including early nutrition to support the functions of immune cells). PMID:26648775

  19. Temozolomide does not impair gene therapy-mediated antitumor immunity in syngeneic brain tumor models

    PubMed Central

    Wibowo, Mia; Ahlzadeh, Gabrielle E; Puntel, Mariana; Ghiasi, Homayon; Kamran, Neha; Paran, Christopher; Lowenstein, Pedro R; Castro, Maria G


    Purpose Glioblastoma multiforme (GBM) is the most common primary brain cancer in adults. Chemotherapy with temozolomide (TMZ) significantly prolongs the survival of GBM patients. However, the 3-year survival is still ~5%. Herein we combined intratumoral administration of an adenoviral vector expressing Flt3L (Ad-Flt3L) with systemic TMZ in order to assess its impact on therapeutic efficacy. Experimental Design Wild type or immunodeficient mice bearing intracranial GBM or metastatic melanoma were treated with an intratumoral injection of Ad-Flt3L alone or in combination with the conditionally cytotoxic enzyme thymidine kinase (Ad-TK), followed by systemic administration of ganciclovir and TMZ. We monitored survival and measured the tumor-infiltrating immune cells. Results While treatment with TMZ alone led to a small improvement in median survival, when used in combination with gene therapy-mediated immunotherapy it significantly increased the survival of tumor-bearing mice. The anti-tumor effect was further enhanced by concomitant intratumoral administration of Ad-TK, leading to 50–70% long-term survival in all tumor models. Although TMZ reduced the content of T cells in the tumor, this did not affect the therapeutic efficacy. The anti-tumor effect of Ad-Flt3L+Ad-TK+TMZ required an intact immune system, since the treatment failed when administered to KO mice that lacked lymphocytes or dendritic cells. Conclusions Our results challenge the notion that chemotherapy leads to a state of immune-suppression which impairs the ability of the immune system to mount an effective anti-tumor response. Our work indicates that TMZ does not inhibit antitumor immunity and supports its clinical implementation in combination with immune-mediated therapies. PMID:24501391

  20. Detection of the KPC Gene in Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii during a PCR-Based Nosocomial Surveillance Study in Puerto Rico▿

    PubMed Central

    Robledo, Iraida E.; Aquino, Edna E.; Vázquez, Guillermo J.


    A 6-month, PCR-based, island-wide hospital surveillance study of beta-lactam resistance in Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii was conducted in Puerto Rico. Of 10,507 isolates, 1,239 (12%) unique, multi-beta-lactam-resistant isolates from all geographical regions were identified. The KPC gene was detected in 61 E. coli, 333 K. pneumoniae, 99 P. aeruginosa, and 41 A. baumannii isolates, indicating the widespread dissemination of the KPC gene in clinically significant nosocomial isolates. PMID:21444702

  1. Dynamics of immune system gene expression upon bacterial challenge and wounding in a social insect (Bombus terrestris).


    Erler, Silvio; Popp, Mario; Lattorff, H Michael G


    The innate immune system which helps individuals to combat pathogens comprises a set of genes representing four immune system pathways (Toll, Imd, JNK and JAK/STAT). There is a lack of immune genes in social insects (e.g. honeybees) when compared to Diptera. Potentially, this might be compensated by an advanced system of social immunity (synergistic action of several individuals). The bumble bee, Bombus terrestris, is a primitively eusocial species with an annual life cycle and colonies headed by a single queen. We used this key pollinator to study the temporal dynamics of immune system gene expression in response to wounding and bacterial challenge.Antimicrobial peptides (AMP) (abaecin, defensin 1, hymenoptaecin) were strongly up-regulated by wounding and bacterial challenge, the latter showing a higher impact on the gene expression level. Sterile wounding down-regulated TEP A, an effector gene of the JAK/STAT pathway, and bacterial infection influenced genes of the Imd (relish) and JNK pathway (basket). Relish was up-regulated within the first hour after bacterial challenge, but decreased strongly afterwards. AMP expression following wounding and bacterial challenge correlates with the expression pattern of relish whereas correlated expression with dorsal was absent. Although expression of AMPs was high, continuous bacterial growth was observed throughout the experiment.Here we demonstrate for the first time the temporal dynamics of immune system gene expression in a social insect. Wounding and bacterial challenge affected the innate immune system significantly. Induction of AMP expression due to wounding might comprise a pre-adaptation to accompanying bacterial infections. Compared with solitary species this social insect exhibits reduced immune system efficiency, as bacterial growth could not be inhibited. A negative feedback loop regulating the Imd-pathway is suggested. AMPs, the end product of the Imd-pathway, inhibited the up-regulation of the transcription

  2. Turning (Ir gene) low responders into high responders by antibody manipulation of the developing immune system.

    PubMed Central

    Martinz, C; Marcos, M A; Pereira, P; Marquez, C; Toribio, M; de la Hera, A; Cazenave, P A; Coutinho, A


    The ability of helper T cells directed against trinitrophenyl-modified syngeneic spleen cells to recognize low-hapten densities on target cells is under major histocompatibility complex-linked Ir gene control. Thus, BALB/c (H-2d) mice are low responders while H-2 congenic BALB.C3H (H-2k) mice are high responders. Immunization of adult BALB/c mice with the monoclonal antibody F6(51), directed to shared idiotopes by anti-trinitrophenyl antibodies and clonal receptors on anti-trinitrophenyl-self helper T cells, leads to the production of high titers of circulating idiotype, has no influence on helper T cell idiotypic profiles, but shifts to a high-responder phenotype the ability of helper T cells to recognize low-hapten densities. These effects on Ir gene phenotype are even more striking in untreated progenies from F6(51)-immunized BALB/c females, which are better responders than genetically high-responder BALB.C3H mice, although completely different in the expression of the F6(51)-defined clonotype. The general significance of these findings on Ir gene-directed T-cell repertoire selection is discussed, for they constitute formal evidence against antigen-presentation as a mechanism of Ir gene effects and strong support for the importance of maternal influences on the development of T-cell repertoires. PMID:2954161

  3. Genome-wide association study implicates immune activation of multiple integrin genes in inflammatory bowel disease.


    de Lange, Katrina M; Moutsianas, Loukas; Lee, James C; Lamb, Christopher A; Luo, Yang; Kennedy, Nicholas A; Jostins, Luke; Rice, Daniel L; Gutierrez-Achury, Javier; Ji, Sun-Gou; Heap, Graham; Nimmo, Elaine R; Edwards, Cathryn; Henderson, Paul; Mowat, Craig; Sanderson, Jeremy; Satsangi, Jack; Simmons, Alison; Wilson, David C; Tremelling, Mark; Hart, Ailsa; Mathew, Christopher G; Newman, William G; Parkes, Miles; Lees, Charlie W; Uhlig, Holm; Hawkey, Chris; Prescott, Natalie J; Ahmad, Tariq; Mansfield, John C; Anderson, Carl A; Barrett, Jeffrey C


    Genetic association studies have identified 215 risk loci for inflammatory bowel disease, thereby uncovering fundamental aspects of its molecular biology. We performed a genome-wide association study of 25,305 individuals and conducted a meta-analysis with published summary statistics, yielding a total sample size of 59,957 subjects. We identified 25 new susceptibility loci, 3 of which contain integrin genes that encode proteins in pathways that have been identified as important therapeutic targets in inflammatory bowel disease. The associated variants are correlated with expression changes in response to immune stimulus at two of these genes (ITGA4 and ITGB8) and at previously implicated loci (ITGAL and ICAM1). In all four cases, the expression-increasing allele also increases disease risk. We also identified likely causal missense variants in a gene implicated in primary immune deficiency, PLCG2, and a negative regulator of inflammation, SLAMF8. Our results demonstrate that new associations at common variants continue to identify genes relevant to therapeutic target identification and prioritization.

  4. Perforin gene transfer into hematopoietic stem cells improves immune dysregulation in murine models of perforin deficiency.


    Carmo, Marlene; Risma, Kimberly A; Arumugam, Paritha; Tiwari, Swati; Hontz, Adrianne E; Montiel-Equihua, Claudia A; Alonso-Ferrero, Maria E; Blundell, Michael P; Schambach, Axel; Baum, Christopher; Malik, Punam; Thrasher, Adrian J; Jordan, Michael B; Gaspar, H Bobby


    Defects in perforin lead to the failure of T and NK cell cytotoxicity, hypercytokinemia, and the immune dysregulatory condition known as familial hemophagocytic lymphohistiocytosis (FHL). The only curative treatment is allogeneic hematopoietic stem cell transplantation which carries substantial risks. We used lentiviral vectors (LV) expressing the human perforin gene, under the transcriptional control of the ubiquitous phosphoglycerate kinase promoter or a lineage-specific perforin promoter, to correct the defect in different murine models. Following LV-mediated gene transfer into progenitor cells from perforin-deficient mice, we observed perforin expression in mature T and NK cells, and there was no evidence of progenitor cell toxicity when transplanted into irradiated recipients. The resulting perforin-reconstituted NK cells showed partial recovery of cytotoxicity, and we observed full recovery of cytotoxicity in polyclonal CD8(+) T cells. Furthermore, reconstituted T cells with defined antigen specificity displayed normal cytotoxic function against peptide-loaded targets. Reconstituted CD8(+) lymphoblasts had reduced interferon-γ secretion following stimulation in vitro, suggesting restoration of normal immune regulation. Finally, upon viral challenge, mice with >30% engraftment of gene-modified cells exhibited reduction of cytokine hypersecretion and cytopenias. This study demonstrates the potential of hematopoietic stem cell gene therapy as a curative treatment for perforin-deficient FHL.

  5. Common Genetic Variants Found in HLA and KIR Immune Genes in Autism Spectrum Disorder.


    Torres, Anthony R; Sweeten, Thayne L; Johnson, Randall C; Odell, Dennis; Westover, Jonna B; Bray-Ward, Patricia; Ward, David C; Davies, Christopher J; Thomas, Aaron J; Croen, Lisa A; Benson, Michael


    The "common variant-common disease" hypothesis was proposed to explain diseases with strong inheritance. This model suggests that a genetic disease is the result of the combination of several common genetic variants. Common genetic variants are described as a 5% frequency differential between diseased vs. matched control populations. This theory was recently supported by an epidemiology paper stating that about 50% of genetic risk for autism resides in common variants. However, rare variants, rather than common variants, have been found in numerous genome wide genetic studies and many have concluded that the "common variant-common disease" hypothesis is incorrect. One interpretation is that rare variants are major contributors to genetic diseases and autism involves the interaction of many rare variants, especially in the brain. It is obvious there is much yet to be learned about autism genetics. Evidence has been mounting over the years indicating immune involvement in autism, particularly the HLA genes on chromosome 6 and KIR genes on chromosome 19. These two large multigene complexes have important immune functions and have been shown to interact to eliminate unwanted virally infected and malignant cells. HLA proteins have important functions in antigen presentation in adaptive immunity and specific epitopes on HLA class I proteins act as cognate ligands for KIR receptors in innate immunity. Data suggests that HLA alleles and KIR activating genes/haplotypes are common variants in different autism populations. For example, class I allele (HLA-A2 and HLA-G 14 bp-indel) frequencies are significantly increased by more than 5% over control populations (Table 2). The HLA-DR4 Class II and shared epitope frequencies are significantly above the control populations (Table 2). Three activating KIR genes: 3DS1, 2DS1, and 2DS2 have increased frequencies of 15, 22, and 14% in autism populations, respectively. There is a 6% increase in total activating KIR genes in autism over

  6. Common Genetic Variants Found in HLA and KIR Immune Genes in Autism Spectrum Disorder

    PubMed Central

    Torres, Anthony R.; Sweeten, Thayne L.; Johnson, Randall C.; Odell, Dennis; Westover, Jonna B.; Bray-Ward, Patricia; Ward, David C.; Davies, Christopher J.; Thomas, Aaron J.; Croen, Lisa A.; Benson, Michael


    The “common variant—common disease” hypothesis was proposed to explain diseases with strong inheritance. This model suggests that a genetic disease is the result of the combination of several common genetic variants. Common genetic variants are described as a 5% frequency differential between diseased vs. matched control populations. This theory was recently supported by an epidemiology paper stating that about 50% of genetic risk for autism resides in common variants. However, rare variants, rather than common variants, have been found in numerous genome wide genetic studies and many have concluded that the “common variant—common disease” hypothesis is incorrect. One interpretation is that rare variants are major contributors to genetic diseases and autism involves the interaction of many rare variants, especially in the brain. It is obvious there is much yet to be learned about autism genetics. Evidence has been mounting over the years indicating immune involvement in autism, particularly the HLA genes on chromosome 6 and KIR genes on chromosome 19. These two large multigene complexes have important immune functions and have been shown to interact to eliminate unwanted virally infected and malignant cells. HLA proteins have important functions in antigen presentation in adaptive immunity and specific epitopes on HLA class I proteins act as cognate ligands for KIR receptors in innate immunity. Data suggests that HLA alleles and KIR activating genes/haplotypes are common variants in different autism populations. For example, class I allele (HLA-A2 and HLA-G 14 bp-indel) frequencies are significantly increased by more than 5% over control populations (Table 2). The HLA-DR4 Class II and shared epitope frequencies are significantly above the control populations (Table 2). Three activating KIR genes: 3DS1, 2DS1, and 2DS2 have increased frequencies of 15, 22, and 14% in autism populations, respectively. There is a 6% increase in total activating KIR genes in

  7. Gene therapy for hemophilia "A" and "B": efficacy, safety and immune consequences.


    Chuah, M; Vandendriessche, T


    The first successful gene therapy trials for the treatment of hereditary disorders underscore the potential of gene therapy to combat disease and alleviate human suffering. The development of gene therapy for hemophilia is not only a research priority in its own right but also serves as an ideal trailblazer for many different diseases. Significant progress has recently been made in the development of gene therapy for the treatment of hemophilia A and B. Long-term therapeutic levels of factor VIII and IX could be expressed following gene therapy in hemophilic mice, stably correcting the bleeding diathesis. These advances parallel the development of improved gene delivery systems. The induction of neutralizing antibodies (inhibitors) to the clotting factors could potentially preclude stable phenotypic correction. The risk of inhibitor formation varied, depending at least in part on the type of vector used and its in vivo tropism. We also demonstrated that the risk of immune responses to the vector particles, the clotting factors and/or transduced cells can be reduced by using vectors that only minimally interact with antigen presenting cells. In hemophilic mice, robust and stable clotting factor expression levels were achieved using adeno-associated viral vectors based on the newly disovered serotypes AAV8 and AAV9 which can efficient deliver the clotting factor genes into hepatocytes without triggering any inflammatory responses or adverse events. Pre-clinical studies in large animal models will be initiated to further validate these improved AAV vectors to ultimately justify a clinical trial in patients with severe hemophilia.

  8. The acute phase response of cod (Gadus morhua L.): expression of immune response genes.


    Audunsdottir, Sigridur S; Magnadottir, Bergljot; Gisladottir, Berglind; Jonsson, Zophonias O; Bragason, Birkir Th


    An acute phase response (APR) was experimentally induced in Atlantic cod (Gadus morhua L.) by intramuscular injection of turpentine oil. The change in the expression of immune related genes was monitored in the anterior kidney and the spleen over a period of 7 days. The genes examined were two types of pentraxins, apolipoprotein A1 (ApoA-I), the complement component C3, interleukin-1β (IL-1β), transferrin, cathelicidin, and hepcidin. All genes were constitutively expressed in both organs and their expression amplified by the turpentine injection. A pattern of response was observed both with respect to the organ preference and to the timing of a maximum response. The increased gene expression of the pentraxins, ApoA-I and C3 was restricted to the anterior kidney, the gene expression of IL-1β, cathelicidin, and transferrin increased in both organs, while hepcidin gene expression was only significantly increased in the spleen. The pentraxins and ApoA-I appear to be early mediators of APR in cod, possibly stimulating C3 and IL-1β response, while the antimicrobial peptides may play a minor role. The increase in transferrin gene expression in both organs, and apparent indifference to cortisol release associated with the turpentine injection, suggests that this could be a typical acute phase protein in cod.

  9. Expression of Immune-Related Genes of Ducks Infected with Avian Pathogenic Escherichia coli (APEC)

    PubMed Central

    Li, Rong; Li, Ning; Zhang, Jinzhou; Wang, Yao; Liu, Jiyuan; Cai, Yumei; Chai, Tongjie; Wei, Liangmeng


    Avian pathogenic Escherichia coli (APEC) can cause severe disease in ducks, characterized by perihepatitis, pericarditis, and airsacculitis. Although the studies of bacteria isolation and methods of detection have been reported, host immune responses to APEC infection remain unclear. In response, we systemically examined the expression of immune-related genes and bacteria distribution in APEC-infected ducks. Results demonstrated that APEC can quickly replicate in the liver, spleen, and brain, with the highest bacteria content at 2 days post infection. The expression of toll-like receptors (TLRs), avian β-defensins (AvBDs) and major histocompatibility complex (MHC) were tested in the liver, spleen, and brain of infected ducks. TLR2, TLR4, TLR5, and TLR15 showed different expression patterns, which indicated that they all responded to APEC infection. The expression of AvBD2 was upregulated in all tested tissues during the 3 days of testing, whereas the expression of AvBD4, AvBD5, AvBD7, and AvBD9 were downregulated, and though MHC-I was upregulated on all test days, MHC-II was dramatically downregulated. Overall, our results suggest that APEC can replicate in various tissues in a short time, and the activation of host immune responses begins at onset of infection. These findings thus clarify duck immune responses to APEC infection and offer insights into its pathogenesis. PMID:27199963

  10. Quantitative dynamic imaging of immune cell signalling using lentiviral gene transfer.


    Bagnall, J; Boddington, C; Boyd, J; Brignall, R; Rowe, W; Jones, N A; Schmidt, L; Spiller, D G; White, M R H; Paszek, P


    Live-cell imaging of fluorescent fusion proteins has transformed our understanding of mammalian cell signalling and function. However, some cellular systems such as immune cells are unsuitable or refractory to many existing transgene delivery methods thus limiting systematic analyses. Here, a flexible lentiviral gene transfer platform for dynamic time-lapse imaging has been developed and validated with single-molecule spectroscopy, mathematical modelling and transcriptomics and used for analysis of a set of inflammation-related signalling networks. Time-lapse imaging of nuclear factor kappa B (NF-κB), signal transducer and activator of transcription (STATs) and nuclear factor of activated T-cells (NFAT) in mammalian immune cell lines provided evidence for heterogeneous temporal encoding of inflammatory signals. In particular, the absolute quantification of single-cell responses over time via fluorescent correlation spectroscopy (FCS) showed that NF-κB p65 activation in response to tumour necrosis factor α (TNFα) was differentially encoded in variable amplitude of nuclear translocation between immune and non-immune cells. The absolute number of activated molecules was dictated in part by the cell size, suggesting a morphology-dependent regulatory mechanism. The developed platform will enable further absolute quantitative analyses of the dynamic interactions between signalling networks, in and between individual cells, allowing better integration with mathematical models of signalling networks.

  11. Genetic polymorphisms in host antiviral genes: associations with humoral and cellular immunity to measles vaccine.


    Haralambieva, Iana H; Ovsyannikova, Inna G; Umlauf, Benjamin J; Vierkant, Robert A; Shane Pankratz, V; Jacobson, Robert M; Poland, Gregory A


    Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella (MMR) vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction for FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and

  12. A long noncoding RNA induced by TLRs mediates both activation and repression of immune response genes

    PubMed Central

    Carpenter, Susan; Atianand, Maninjay; Aiello, Daniel; Ricci, Emiliano; Gandhi, Pallavi; Hall, Lisa L.; Byron, Meg; Monks, Brian; Henry-Bezy, Meabh; O’Neill, Luke A.J; Lawrence, Jeanne B.; Moore, Melissa J.; Caffrey, Daniel R.; Fitzgerald, Katherine A.


    An inducible program of inflammatory gene expression is central to anti-microbial defenses. Signal-dependent activation of transcription factors, transcriptional co-regulators and chromatin modifying factors collaborate to control this response. Here we identify a long noncoding RNA that acts as a key regulator of this inflammatory response. Germline-encoded receptors such as the Toll-like receptors induce the expression of numerous lncRNAs. One of these, lincRNA-Cox2 mediates both the activation and repression of distinct classes of immune genes. Transcriptional repression of target genes is dependent on interactions of lincRNA-Cox2 with heterogeneous nuclear ribonucleoprotein A/B and A2/B1. Collectively, these studies unveil a central role of lincRNA-Cox2 as a broad acting regulatory component of the circuit that controls the inflammatory response. PMID:23907535

  13. The effects of dietary Immunogen on innate immune response, immune related genes expression and disease resistance of rainbow trout (Oncorhynchus mykiss).


    Yar Ahmadi, Peyman; Farahmand, Hamid; Kolangi Miandare, Hamed; Mirvaghefi, Alireza; Hoseinifar, Seyed Hossein


    This study investigates the effects of prebiotic Immunogen on lysozyme, TNFα and HSP70 gene expression in head kidney, humoral innate immune parameters and resistant to Aeromonas hydrophila of rainbow trout. 120 healthy rainbow trout (81.65 ± 1.49 g) were distributed in six fiberglass tanks assigned to two groups fed control or diet supplemented with 2 g kg(-1) Immunogen for 45 days. The results revealed that administration of Immunogen significantly (P < 0.05) up regulated lysozyme and TNFα gene expression. HSP70 gene expression was significantly (P < 0.05) lower in Immunogen fed fish at the end of trial. Humoral innate immune parameters (lysozyme activity, ACH50 and bactericidal activity) were significantly (P < 0.05) increased whether 15 or 45 days after feeding on Immunogen supplemented diet. However, significant (P < 0.05) increase in agglutination antibody titer observed just after 45 days feeding on Immunogen. Rainbow trout fed with 2 g kg(-1) Immunogen showed remarkably higher resistance against A. hydrophila (64.44% survival) compared to the control group (24.44% survival). These results confirm that Immunogen can up regulates immune related genes expression, stimulates immune response that per se enhances disease resistance in rainbow trout.

  14. Estrogen regulation of gene expression in the teleost fish immune system.


    Burgos-Aceves, Mario Alberto; Cohen, Amit; Smith, Yoav; Faggio, Caterina


    Elucidating the mechanisms of estrogens-induced immunomodulation in teleost fish is of great importance due to the observed worldwide continuing decrease in pristine environments. However, little is know about the immunotoxicological consequences of exposure to these chemicals in fish, or of the mechanisms through which these effects are mediated. In this review, we summarize the results showing estrogens (natural or synthetic) acting through estrogen receptors and regulating specific target genes, also through microRNAs (miRNAs), leading to modulation of the immune functioning. The identification and characterization of miRNAs will provide new opportunities for functional genome research on teleost immune system and can also be useful when screening for novel molecule biomarkers for environmental pollution.

  15. Differentially expressed immune-related genes in hemocytes of the pearl oyster Pinctada fucata against allograft identified by transcriptome analysis.


    Wei, Jinfen; Liu, Baosuo; Fan, Sigang; Li, Haimei; Chen, Mingqiang; Zhang, Bo; Su, Jiaqi; Meng, Zihao; Yu, Dahui


    The pearl oyster Pinctada fucata is commonly cultured for marine pearls in China. To culture pearls, a mantle piece from a donor pearl oyster is grafted with a nucleus into a receptor. This transplanted mantle piece may be rejected by the immune system of the recipient oyster, thus reducing the success of transplantation. However, there have been limited studies about the oyster's immune defense against allograft. In this study, hemocyte transcriptome analysis was performed to detect the immune responses to allograft in P. fucata at 0 h and 48 h after a transplant. The sequencing reaction produced 92.5 million reads that were mapped against the reference genome sequences of P. fucata. The Gene Ontology (GO) annotation and the Kyoto Encyclopedia of Genes and Genomes (KEGG) were used to identify all immune-related differentially expressed genes (DEGs). Compared with patterns at 0 h, a total of 798 DEGs were identified, including 410 up-regulated and 388 down-regulated genes at 48 h. The expression levels of interleukin receptor and toll-like receptor in hemocytes were increased significantly 48 h post-transplant, indicating that the oyster immune response was induced. Finally, altered levels of 18 randomly selected immune-related DEGs were confirmed by quantitative real-time PCR (qRT-PCR). Our results provide the basis for further analysis of the immune rejection of allotransplantation.

  16. The Associations between Immunity-Related Genes and Breast Cancer Prognosis in Korean Women

    PubMed Central

    Choi, Jaesung; Song, Nan; Han, Sohee; Chung, Seokang; Sung, Hyuna; Lee, Ji-young; Jung, Sunjae; Park, Sue K.; Yoo, Keun-Young; Han, Wonshik; Lee, Jong Won; Noh, Dong-Young; Kang, Daehee; Choi, Ji-Yeob


    We investigated the role of common genetic variation in immune-related genes on breast cancer disease-free survival (DFS) in Korean women. 107 breast cancer patients of the Seoul Breast Cancer Study (SEBCS) were selected for this study. A total of 2,432 tag single nucleotide polymorphisms (SNPs) in 283 immune-related genes were genotyped with the GoldenGate Oligonucleotide pool assay (OPA). A multivariate Cox-proportional hazard model and polygenic risk score model were used to estimate the effects of SNPs on breast cancer prognosis. Harrell’s C index was calculated to estimate the predictive accuracy of polygenic risk score model. Subsequently, an extended gene set enrichment analysis (GSEA-SNP) was conducted to approximate the biological pathway. In addition, to confirm our results with current evidence, previous studies were systematically reviewed. Sixty-two SNPs were statistically significant at p-value less than 0.05. The most significant SNPs were rs1952438 in SOCS4 gene (hazard ratio (HR) = 11.99, 95% CI = 3.62–39.72, P = 4.84E-05), rs2289278 in TSLP gene (HR = 4.25, 95% CI = 2.10–8.62, P = 5.99E-05) and rs2074724 in HGF gene (HR = 4.63, 95% CI = 2.18–9.87, P = 7.04E-05). In the polygenic risk score model, the HR of women in the 3rd tertile was 6.78 (95% CI = 1.48–31.06) compared to patients in the 1st tertile of polygenic risk score. Harrell’s C index was 0.813 with total patients and 0.924 in 4-fold cross validation. In the pathway analysis, 18 pathways were significantly associated with breast cancer prognosis (P<0.1). The IL-6R, IL-8, IL-10RB, IL-12A, and IL-12B was associated with the prognosis of cancer in data of both our study and a previous study. Therefore, our results suggest that genetic polymorphisms in immune-related genes have relevance to breast cancer prognosis among Korean women. PMID:25075970

  17. Calmodulin is a stress and immune response gene in Chinese mitten crab Eriocheir sinensis.


    Li, Shuo; Jia, Zirui; Li, Xuejing; Geng, Xuyun; Sun, Jinsheng


    Calmodulin (CaM) is a multifunctional calcium sensor protein that participates in various cellular processes under normal, stress and pathological conditions. In crabs, however, the involvement of CaM in response to environmental stress and immune challenges has not been revealed yet. In the present study, a CaM cDNA (EsCaM) was identified from Chinese mitten crab Eriocheir sinensis and its mRNA expression patterns in response to ambient (salinity and pH) stress and immune challenges was examined. EsCaM encodes a 149-amino-acid protein with a calculated molecular mass of 16.8 kDa and an isoelectric point of 4.09. In unstimulated healthy E. sinensis, EsCaM mRNA transcript was detected in all tested tissues with predominant expression in hepatopancreas and the lowest expression in haemocytes. Ambient salinity (15‰ and 30‰ salinities) and pH (pH 6 and 8.5) stress significantly altered EsCaM mRNA expression in gill, hepatopancreas, haemocytes, intestine and muscle in Chinese mitten crab. In addition, EsCaM gene expression was significantly and rapidly induced as early as 2 h after LPS and Poly(I:C) immune stimulations in haemocytes in vitro. Furthermore, EsCaM expression was significantly up-regulated in E. sinensis haemocytes, gill, hepatopancreas, intestine and muscle in response to Edwardsiella tarda and Vibrio anguillarum challenges. Collectively, our findings suggest that EsCaM is an important stress and immune response gene in Chinese mitten crab.

  18. Immune and inflammatory gene signature in rat cerebrum in subarachnoid hemorrhage with microarray analysis.


    Lee, Chu-I; Chou, An-Kuo; Lin, Ching-Chih; Chou, Chia-Hua; Loh, Joon-Khim; Lieu, Ann-Shung; Wang, Chih-Jen; Huang, Chi-Ying F; Howng, Shen-Long; Hong, Yi-Ren


    Cerebral vasospasm following subarachnoid hemorrhage (SAH) has been studied in terms of a contraction of the major cerebral arteries, but the effect of cerebrum tissue in SAH is not yet well understood. To gain insight into the biology of SAH-expressing cerebrum, we employed oligonucleotide microarrays to characterize the gene expression profiles of cerebrum tissue at the early stage of SAH. Functional gene expression in the cerebrum was analyzed 2 h following stage 1-hemorrhage in Sprague-Dawley rats. mRNA was investigated by performing microarray and quantitative real-time PCR analyses, and protein expression was determined by Western blot analysis. In this study, 18 upregulated and 18 downregulated genes displayed at least a 1.5-fold change. Five genes were verified by real-time PCR, including three upregulated genes [prostaglandin E synthase (PGES), CD14 antigen, and tissue inhibitor of metalloproteinase 1 (TIMP1)] as well as two downregulated genes [KRAB-zinc finger protein-2 (KZF-2) and γ-aminobutyric acid B receptor 1 (GABA B receptor)]. Notably, there were functional implications for the three upregulated genes involved in the inflammatory SAH process. However, the mechanisms leading to decreased KZF-2 and GABA B receptor expression in SAH have never been characterized. We conclude that oligonucleotide microarrays have the potential for use as a method to identify candidate genes associated with SAH and to provide novel investigational targets, including genes involved in the immune and inflammatory response. Furthermore, understanding the regulation of MMP9/TIMP1 during the early stages of SAH may elucidate the pathophysiological mechanisms in SAH rats.

  19. Local gene expression and immune responses of vaginal DNA vaccination using a needle-free injector.


    Kanazawa, Takanori; Takashima, Yuuki; Tamura, Toshiaki; Tsuchiya, Miki; Shibata, Yasunori; Udagawa, Haruhide; Okada, Hiroaki


    The vaginal mucosa is the most common site of initiation of virus infections that are transmitted through heterosexual intercourse, including HIV and papillomavirus. Thus, in order to prevent or treat these infections, strong vaginal immunity is required as the first line of defense. In this study, to establish a less invasive, safe, convenient and effective immunization method, we examined the local (skin and vagina) gene transfection efficiency of a non-needle jet injector for daily insulin injection. In the skin experiment, the needle-free injector resulted in a marked increase in marker gene expression, compared to the conventional needle-syringe injection. In addition, intradermal DNA vaccination using the needle-free injector dramatically induced IFN-gamma and antibody systemic responses in mice. Furthermore, we investigated the applicability of the needle-free injector as a vaginal vaccination tool in rabbits. Vaginal gene expression using the needle-free injector was significantly greater than that using needle-syringe injection. Moreover, intravaginal vaccination by the needle-free injector promoted vaginal IgA secretion and IFN-gamma mRNA expression in the blood lymphocytes, to a degree significantly higher than that by needle-syringe injection. In conclusion, local vaginal DNA vaccination using a needle-free jet injector is a promising approach for the prevention and treatment of mucosal infectious diseases.

  20. Developmental alterations in CNS stress-related gene expression following postnatal immune activation.


    Amath, A; Foster, J A; Sidor, M M


    Early-life adversity is associated with dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis and increased susceptibility to later-life psychopathology. Specifically, there is mounting evidence suggesting that the immune system plays an important role in central nervous system (CNS) development and in the programing of behavior. The current study investigated how early-life immune challenge affects the development of CNS stress neurocircuitry by examining the gene expression profile of corticotropin-releasing hormone (CRH), CRH receptors, and the major corticosteroid receptors within the limbic-hypothalamic circuit of the developing rodent brain. Mice were administered a 0.05 mg/kg lipopolysaccharide (LPS) injection on postnatal day (P) 3 and 5 and gene expression was assessed using in situ hybridization from P14 to P28. Target genes investigated were CRH, CRH receptor-1 (CRHR1), CRH receptor-2, the mineralocorticoid receptor, and the glucocorticoid receptor (GR). Early LPS challenge resulted in a transient decrease in CRHR1 mRNA expression in the cornuammonis 1 (CA1) and CA3 regions of the hippocampus that were accompanied by increased hippocampal GR mRNA expression in the CA1 region between P14 and P21. This was followed by increased hypothalamic CRH expression in LPS-mice on P28. Our current findings suggest that early-life LPS challenge impacts the developmental trajectory of CNS stress neurocircuitry. These results lend insight into the molecular basis for the later development of stress-related behaviors as previously described in early immune challenge rodents.

  1. Wolbachia Stimulates Immune Gene Expression and Inhibits Plasmodium Development in Anopheles gambiae

    PubMed Central

    Kambris, Zakaria; Blagborough, Andrew M.; Pinto, Sofia B.; Blagrove, Marcus S. C.; Godfray, H. Charles J.; Sinden, Robert E.; Sinkins, Steven P.


    The over-replicating wMelPop strain of the endosymbiont Wolbachia pipientis has recently been shown to be capable of inducing immune upregulation and inhibition of pathogen transmission in Aedes aegypti mosquitoes. In order to examine whether comparable effects would be seen in the malaria vector Anopheles gambiae, transient somatic infections of wMelPop were created by intrathoracic inoculation. Upregulation of six selected immune genes was observed compared to controls, at least two of which (LRIM1 and TEP1) influence the development of malaria parasites. A stably infected An. gambiae cell line also showed increased expression of malaria-related immune genes. Highly significant reductions in Plasmodium infection intensity were observed in the wMelPop-infected cohort, and using gene knockdown, evidence for the role of TEP1 in this phenotype was obtained. Comparing the levels of upregulation in somatic and stably inherited wMelPop infections in Ae. aegypti revealed that levels of upregulation were lower in the somatic infections than in the stably transinfected line; inhibition of development of Brugia filarial nematodes was nevertheless observed in the somatic wMelPop infected females. Thus we consider that the effects observed in An. gambiae are also likely to be more pronounced if stably inherited wMelPop transinfections can be created, and that somatic infections of Wolbachia provide a useful model for examining effects on pathogen development or dissemination. The data are discussed with respect to the comparative effects on malaria vectorial capacity of life shortening and direct inhibition of Plasmodium development that can be produced by Wolbachia. PMID:20949079

  2. Immune response in mice and cattle after immunization with a Boophilus microplus DNA vaccine containing bm86 gene.


    Ruiz, Lina María; Orduz, Sergio; López, Elkin D; Guzmán, Fanny; Patarroyo, Manuel E; Armengol, Gemma


    Plasmid pBMC2 encoding antigen Bm86 from a Colombian strain of cattle tick Boophilus microplus, was used for DNA-mediated immunization of BALB/c mice, employing doses of 10 and 50microg, delivered by intradermic and intramuscular routes. Anti-Bm86 antibody levels were significantly higher compared to control mice treated with PBS. In the evaluation of immunoglobulin isotypes, significant levels of IgG2a and IgG2b were observed in mice immunized with 50microg of pBMC2. Measurement of interleukine (IL) levels (IL-4, IL-5, IL-12(p40)) and interferon-gamma (IFN-gamma) in the sera of mice immunized with pBMC2 indicated high levels of IL-4 and IL-5, although there were also significant levels of IFN-gamma. Mice immunized with pBMC2 showed antigen-specific stimulation of splenocytes according to the incorporation of bromodeoxyuridine and IFN-gamma secretion. In all trials, mice injected intramuscularly with 50microg of pBMC2 presented the highest immune response. Moreover, cattle immunized with this DNA vaccine showed antibody production significantly different to the negative control. In conclusion, these results suggest the potential of DNA immunization with pBMC2 to induce humoral and cellular immune responses against B. microplus.

  3. Trans-species polymorphism at antimicrobial innate immunity cathelicidin genes of Atlantic cod and related species

    PubMed Central

    Árnason, Einar


    Natural selection, the most important force in evolution, comes in three forms. Negative purifying selection removes deleterious variation and maintains adaptations. Positive directional selection fixes beneficial variants, producing new adaptations. Balancing selection maintains variation in a population. Important mechanisms of balancing selection include heterozygote advantage, frequency-dependent advantage of rarity, and local and fluctuating episodic selection. A rare pathogen gains an advantage because host defenses are predominantly effective against prevalent types. Similarly, a rare immune variant gives its host an advantage because the prevalent pathogens cannot escape the host’s apostatic defense. Due to the stochastic nature of evolution, neutral variation may accumulate on genealogical branches, but trans-species polymorphisms are rare under neutrality and are strong evidence for balancing selection. Balanced polymorphism maintains diversity at the major histocompatibility complex (MHC) in vertebrates. The Atlantic cod is missing genes for both MHC-II and CD4, vital parts of the adaptive immune system. Nevertheless, cod are healthy in their ecological niche, maintaining large populations that support major commercial fisheries. Innate immunity is of interest from an evolutionary perspective, particularly in taxa lacking adaptive immunity. Here, we analyze extensive amino acid and nucleotide polymorphisms of the cathelicidin gene family in Atlantic cod and closely related taxa. There are three major clusters, Cath1, Cath2, and Cath3, that we consider to be paralogous genes. There is extensive nucleotide and amino acid allelic variation between and within clusters. The major feature of the results is that the variation clusters by alleles and not by species in phylogenetic trees and discriminant analysis of principal components. Variation within the three groups shows trans-species polymorphism that is older than speciation and that is suggestive of

  4. Zebra Fish Lacking Adaptive Immunity Acquire an Antiviral Alert State Characterized by Upregulated Gene Expression of Apoptosis, Multigene Families, and Interferon-Related Genes.


    García-Valtanen, Pablo; Martínez-López, Alicia; López-Muñoz, Azucena; Bello-Perez, Melissa; Medina-Gali, Regla M; Ortega-Villaizán, María Del Mar; Varela, Monica; Figueras, Antonio; Mulero, Víctoriano; Novoa, Beatriz; Estepa, Amparo; Coll, Julio


    To investigate fish innate immunity, we have conducted organ and cell immune-related transcriptomic as well as immunohistologic analysis in mutant zebra fish (Danio rerio) lacking adaptive immunity (rag1(-/-)) at different developmental stages (egg, larvae, and adult), before and after infection with spring viremia carp virus (SVCV). The results revealed that, compared to immunocompetent zebra fish (rag1(+/+) ), rag1(-/-) acquired increased resistance to SVCV with age, correlating with elevated transcript levels of immune genes in skin/fins and lymphoid organs (head kidney and spleen). Gene sets corresponding to apoptotic functions, immune-related multigene families, and interferon-related genes were constitutively upregulated in uninfected adult rag1(-/-) zebra fish. Overexpression of activated CASPASE-3 in different tissues before and after infection with SVCV further confirmed increased apoptotic function in rag1(-/-) zebra fish. Concurrently, staining of different tissue samples with a pan-leukocyte antibody marker showed abundant leukocyte infiltrations in SVCV-infected rag1(-/-) fish, coinciding with increased transcript expression of genes related to NK-cells and macrophages, suggesting that these genes played a key role in the enhanced immune response of rag1(-/-) zebra fish to SVCV lethal infection. Overall, we present evidence that indicates that rag1(-/-) zebra fish acquire an antiviral alert state while they reach adulthood in the absence of adaptive immunity. This antiviral state was characterized by (i) a more rapid response to viral infection, which resulted in increased survival, (ii) the involvement of NK-cell- and macrophage-mediated transcript responses rather than B- and/or T-cell dependent cells, and (iii) enhanced apoptosis, described here for the first time, as well as the similar modulation of multigene family/interferon-related genes previously associated to fish that survived lethal viral infections. From this and other studies, it might

  5. HER2/neu DNA vaccination by intradermal gene delivery in a mouse tumor model: Gene gun is superior to jet injector in inducing CTL responses and protective immunity.


    Nguyen-Hoai, Tam; Kobelt, Dennis; Hohn, Oliver; Vu, Minh D; Schlag, Peter M; Dörken, Bernd; Norley, Steven; Lipp, Martin; Walther, Wolfgang; Pezzutto, Antonio; Westermann, Jörg


    DNA vaccines are potential tools for the induction of immune responses against both infectious disease and cancer. The dermal application of DNA vaccines is of particular interest since the epidermal and dermal layers of the skin are characterized by an abundance of antigen-presenting cells (APCs). The aim of our study was to compare tumor protection as obtained by two different methods of intradermal DNA delivery (gene gun and jet injector) in a well-established HER2/neu mouse tumor model. BALB/c mice were immunized twice with a HER2/neu-coding plasmid by gene gun or jet injector. Mice were then subcutaneously challenged with HER2/neu(+) syngeneic D2F2/E2 tumor cells. Protection against subsequent challenges with tumor cells as well as humoral and T-cell immune responses induced by the vaccine were monitored. Gene gun immunization was far superior to jet injector both in terms of tumor protection and induction of HER2/neu-specific immune responses. After gene gun immunization, 60% of the mice remained tumor-free until day 140 as compared with 25% after jet injector immunization. Furthermore, gene gun vaccination was able to induce both a strong T(H)1-polarized T-cell response with detectable cytotoxic T-lymphocyte (CTL) activity and a humoral immune response against HER2/neu, whereas the jet injector was not. Although the disadvantages that were associated with the use of the jet injector in our model may be overcome with methodological modifications and/or in larger animals, which exhibit a thicker skin and/or subcutaneous muscle tissue, we conclude that gene gun delivery constitutes the method of choice for intradermal DNA delivery in preclinical mouse models and possibly also for the clinical development of DNA-based vaccines.

  6. De Novo Transcriptomic Analysis of Peripheral Blood Lymphocytes from the Chinese Goose: Gene Discovery and Immune System Pathway Description

    PubMed Central

    Tariq, Mansoor; Chen, Rong; Yuan, Hongyu; Liu, Yanjie; Wu, Yanan; Wang, Junya; Xia, Chun


    Background The Chinese goose is one of the most economically important poultry birds and is a natural reservoir for many avian viruses. However, the nature and regulation of the innate and adaptive immune systems of this waterfowl species are not completely understood due to limited information on the goose genome. Recently, transcriptome sequencing technology was applied in the genomic studies focused on novel gene discovery. Thus, this study described the transcriptome of the goose peripheral blood lymphocytes to identify immunity relevant genes. Principal Findings De novo transcriptome assembly of the goose peripheral blood lymphocytes was sequenced by Illumina-Solexa technology. In total, 211,198 unigenes were assembled from the 69.36 million cleaned reads. The average length, N50 size and the maximum length of the assembled unigenes were 687 bp, 1,298 bp and 18,992 bp, respectively. A total of 36,854 unigenes showed similarity by BLAST search against the NCBI non-redundant (Nr) protein database. For functional classification, 163,161 unigenes were comprised of three Gene Ontology (Go) categories and 67 subcategories. A total of 15,334 unigenes were annotated into 25 eukaryotic orthologous groups (KOGs) categories. Kyoto Encyclopedia of Genes and Genomes (KEGG) database annotated 39,585 unigenes into six biological functional groups and 308 pathways. Among the 2,757 unigenes that participated in the 15 immune system KEGG pathways, 125 of the most important immune relevant genes were summarized and analyzed by STRING analysis to identify gene interactions and relationships. Moreover, 10 genes were confirmed by PCR and analyzed. Of these 125 unigenes, 109 unigenes, approximately 87%, were not previously identified in the goose. Conclusion This de novo transcriptome analysis could provide important Chinese goose sequence information and highlights the value of new gene discovery, pathways investigation and immune system gene identification, and comparison with

  7. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell-directed gene therapy of murine hemophilia A.


    Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B


    Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV.

  8. Identification of immune system and response genes, and novel mutations causing melanotic tumor formation in Drosophila melanogaster

    SciTech Connect

    Rodriguez, A.; Zhou, Zhijian; Tang, My Lien


    We are using Drosophila as a model system for analysis of immunity and tumor formation and have conducted two types of screens using enhancer detector strains to find genes related to these processes: genes expressed in the immune system (type A; hemocytes, lymph glands and fat body) and genes increased in expression by bacterial infection (type B). For type A, tissue-specific reporter gene activity was determined. For type B, a variation of enhancer detection was devised in which {beta}-galactosidase is assayed spectrophotometrically with and without bacterial infection. Because of immune system involvement in melanotic tumor formation, a third type was hypothesized to be found among types A and B: genes that, when mutated, have a melanotic tumor phenotype. Enhancer detector strains (2800) were screened for type A, 900 for B, and 11 retained for further analysis. Complementation tests, cytological mapping, P-element mobilization, and determination of lethal phase and mutant phenotype have identified six novel genes, Dorothy, wizard, toto, viking, Thor and dappled, and one previously identified gene, Collagen IV. All are associated with reporter gene expression in at least one immune system tissue. Thor has increased expression upon infection. Mutations of wizard and dappled have a melanotic tumor phenotype. 72 refs., 6 figs., 3 tabs.

  9. RNA sequencing analysis of human podocytes reveals glucocorticoid regulated gene networks targeting non-immune pathways

    PubMed Central

    Jiang, Lulu; Hindmarch, Charles C. T.; Rogers, Mark; Campbell, Colin; Waterfall, Christy; Coghill, Jane; Mathieson, Peter W.; Welsh, Gavin I.


    Glucocorticoids are steroids that reduce inflammation and are used as immunosuppressive drugs for many diseases. They are also the mainstay for the treatment of minimal change nephropathy (MCN), which is characterised by an absence of inflammation. Their mechanisms of action remain elusive. Evidence suggests that immunomodulatory drugs can directly act on glomerular epithelial cells or ‘podocytes’, the cell type which is the main target of injury in MCN. To understand the nature of glucocorticoid effects on non-immune cell functions, we generated RNA sequencing data from human podocyte cell lines and identified the genes that are significantly regulated in dexamethasone-treated podocytes compared to vehicle-treated cells. The upregulated genes are of functional relevance to cytoskeleton-related processes, whereas the downregulated genes mostly encode pro-inflammatory cytokines and growth factors. We observed a tendency for dexamethasone-upregulated genes to be downregulated in MCN patients. Integrative analysis revealed gene networks composed of critical signaling pathways that are likely targeted by dexamethasone in podocytes. PMID:27774996

  10. Immune signatures and disorder-specific patterns in a cross-disorder gene expression analysis

    PubMed Central

    de Jong, Simone; Newhouse, Stephen J.; Patel, Hamel; Lee, Sanghyuck; Dempster, David; Curtis, Charles; Paya-Cano, Jose; Murphy, Declan; Wilson, C. Ellie; Horder, Jamie; Mendez, M. Andreina; Asherson, Philip; Rivera, Margarita; Costello, Helen; Maltezos, Stefanos; Whitwell, Susannah; Pitts, Mark; Tye, Charlotte; Ashwood, Karen L.; Bolton, Patrick; Curran, Sarah; McGuffin, Peter; Dobson, Richard; Breen, Gerome


    Background Recent studies point to overlap between neuropsychiatric disorders in symptomatology and genetic aetiology. Aims To systematically investigate genomics overlap between childhood and adult attention-deficit hyperactivity disorder (ADHD), autism spectrum disorder (ASD) and major depressive disorder (MDD). Method Analysis of whole-genome blood gene expression and genetic risk scores of 318 individuals. Participants included individuals affected with adult ADHD (n = 93), childhood ADHD (n = 17), MDD (n = 63), ASD (n = 51), childhood dual diagnosis of ADHD–ASD (n = 16) and healthy controls (n = 78). Results Weighted gene co-expression analysis results reveal disorder-specific signatures for childhood ADHD and MDD, and also highlight two immune-related gene co-expression modules correlating inversely with MDD and adult ADHD disease status. We find no significant relationship between polygenic risk scores and gene expression signatures. Conclusions Our results reveal disorder overlap and specificity at the genetic and gene expression level. They suggest new pathways contributing to distinct pathophysiology in psychiatric disorders and shed light on potential shared genomic risk factors. PMID:27151072

  11. RNA sequencing analysis of human podocytes reveals glucocorticoid regulated gene networks targeting non-immune pathways.


    Jiang, Lulu; Hindmarch, Charles C T; Rogers, Mark; Campbell, Colin; Waterfall, Christy; Coghill, Jane; Mathieson, Peter W; Welsh, Gavin I


    Glucocorticoids are steroids that reduce inflammation and are used as immunosuppressive drugs for many diseases. They are also the mainstay for the treatment of minimal change nephropathy (MCN), which is characterised by an absence of inflammation. Their mechanisms of action remain elusive. Evidence suggests that immunomodulatory drugs can directly act on glomerular epithelial cells or 'podocytes', the cell type which is the main target of injury in MCN. To understand the nature of glucocorticoid effects on non-immune cell functions, we generated RNA sequencing data from human podocyte cell lines and identified the genes that are significantly regulated in dexamethasone-treated podocytes compared to vehicle-treated cells. The upregulated genes are of functional relevance to cytoskeleton-related processes, whereas the downregulated genes mostly encode pro-inflammatory cytokines and growth factors. We observed a tendency for dexamethasone-upregulated genes to be downregulated in MCN patients. Integrative analysis revealed gene networks composed of critical signaling pathways that are likely targeted by dexamethasone in podocytes.

  12. KIR Genes and Patterns Given by the A Priori Algorithm: Immunity for Haematological Malignancies

    PubMed Central

    Rodríguez-Escobedo, J. Gilberto; García-Sepúlveda, Christian A.; Cuevas-Tello, Juan C.


    Killer-cell immunoglobulin-like receptors (KIRs) are membrane proteins expressed by cells of innate and adaptive immunity. The KIR system consists of 17 genes and 614 alleles arranged into different haplotypes. KIR genes modulate susceptibility to haematological malignancies, viral infections, and autoimmune diseases. Molecular epidemiology studies rely on traditional statistical methods to identify associations between KIR genes and disease. We have previously described our results by applying support vector machines to identify associations between KIR genes and disease. However, rules specifying which haplotypes are associated with greater susceptibility to malignancies are lacking. Here we present the results of our investigation into the rules governing haematological malignancy susceptibility. We have studied the different haplotypic combinations of 17 KIR genes in 300 healthy individuals and 43 patients with haematological malignancies (25 with leukaemia and 18 with lymphomas). We compare two machine learning algorithms against traditional statistical analysis and show that the “a priori” algorithm is capable of discovering patterns unrevealed by previous algorithms and statistical approaches. PMID:26495028

  13. Transcriptome profiling analysis of naked carp (Gymnocypris przewalskii) provides insights into the immune-related genes in highland fish.


    Tong, Chao; Zhang, Cunfang; Zhang, Renyi; Zhao, Kai


    The naked carp, Gymnocypris przewalskii, is one of the dominant aquaculture fish species in Qinghai Province, China. Its wild stocks have severely suffered from overfishing, and the farming species are vulnerable to various pathogens infections. Here we report the first immune-related tissues transcriptome of a wild naked carp using a deep sequencing approach. A total of 158,087 unigenes are generated, 2687 gill-specific gene and 3215 kidney-specific genes are identified, respectively. Gene ontology analysis shows that 51,671 unigenes are involved in three major functional categories: biological process, cellular component, and molecular function. Further analysis shows that numerous consensus sequences are homologous to known immune-related genes. Pathways mapping annotate 56,270 unigenes and identify a large number of immune-related pathways. In addition, we focus on the immune-related genes and gene family in Toll-like receptor signaling pathway involved in innate immunity, including toll-like receptors (TLRs), interferon regulatory factors (IRFs), interleukins (ILs) and tumor necrosis factors (TNFs). Eventually, we identify 5 TLRs, 4 IRFs, 3 ILs and 2 TNFs with a completed coding sequence though mining the transcriptome data. Phylogeny analysis shows these genes of naked carp are mostly close to zebrafish. Protein domain and selection pressure analyses together show that all these genes are highly conserved in gene sequence and protein domain structure with other species, and purifying selection underwent in these genes, implied functionally important features are conserved in the genes above. Intriguingly, we detect positive selection signals in naked carp TLR4, and significant divergence occurred among tested species TLR4, suggested that naked carp TLR4 function may be affected. Finally, we identify 23,867 simple sequence repeat (SSR) marks in this transcriptome. Taken together, this study not only contributes a large number of candidate genes in naked carp

  14. The effect of PDIA3 gene knockout on the mucosal immune function in IBS rats

    PubMed Central

    Zhuang, Zhao-Meng; Wang, Xiao-Teng; Zhang, Lu; Tao, Li-Yuan; Lv, Bin


    Objective: To observe the changes of intestinal inflammation on PDIA3 gene knockout IBS rats and its effect on immune function. Methods: 36 SD rats were randomly divided into four groups: the control group (n = 8); IBS- empty virus group (IBS-GFP, which); IBS-PDIA3 knockout group (n = 12); IBS- the control group (n = 12). After modeling, colon and ileocecal tissue pathology in each group were observed separately. Changes of immune and inflammatory markers were measured. At the same time, ultrastructural changes in each group were observed by electron microscopy. Results: Compared with the IBS control group, inflammation was reduced significantly in IBS-PDIA3 knockout group. IgE, IL-4 and IL-9 and the level of intestinal trypsin type were decreased significantly. Furthermore, mast cell degranulation and PAR 2 receptor reduced significantly. Conclusion: PDIA3 may play an important role in the development of IBS by mediating through immune responses of mucosal abnormalities. However, the mechanism needs to be confirmed in further study. PMID:26221224

  15. Exposure to West Nile Virus Increases Bacterial Diversity and Immune Gene Expression in Culex pipiens

    PubMed Central

    Zink, Steven D.; Van Slyke, Greta A.; Palumbo, Michael J.; Kramer, Laura D.; Ciota, Alexander T.


    Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance in WNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia. PMID:26516902

  16. Covariation in stress and immune gene expression in a range expanding bird.


    Martin, Lynn B; Liebl, Andrea L; Kilvitis, Holly J


    The enemy release hypothesis (ERH) posits that hosts encounter fewer infectious parasites when they arrive in new areas, so individuals that adjust their immune defenses most effectively should thrive and even expand the range of that species. An important aspect of vertebrate immune defense is inflammation, as it provides rapid defense against diverse parasites. Glucocorticoids (GCs) are integral to the regulation of inflammation, so here we investigated whether and how covariation in the expression of genes affecting the regulation of inflammation and GCs might have impacted the house sparrow (Passer domesticus) invasion of Kenya. Toll-like receptors 2 and 4 (TLRs) detect microbial threats and instigate inflammatory responses, whereas the glucocorticoid receptor (GR) is integral to resolving inflammation via both local and systemic pathways. As with a previous study on circulating leukocytes, we found that splenic TLR-4 and TLR-2 (the latter marginally non-significant) expression was higher in younger than older populations but only when differences in spleen size were considered; birds at the range edge had larger spleens. In regards to covariation, we found that TLR-2, TLR-4 and GR expression were closely inter-related within individuals, but covariation did not differ among populations. Subsequently, our data suggest that house sparrows are using variants of a common stress-immune regulatory mechanism to expand their Kenyan range.

  17. Heme Signaling Impacts Global Gene Expression, Immunity and Dengue Virus Infectivity in Aedes aegypti

    PubMed Central

    Bottino-Rojas, Vanessa; Talyuli, Octávio A. C.; Jupatanakul, Natapong; Sim, Shuzhen; Dimopoulos, George; Venancio, Thiago M.; Bahia, Ana C.; Sorgine, Marcos H.; Oliveira, Pedro L.; Paiva-Silva, Gabriela O.


    Blood-feeding mosquitoes are exposed to high levels of heme, the product of hemoglobin degradation. Heme is a pro-oxidant that influences a variety of cellular processes. We performed a global analysis of heme-regulated Aedes aegypti (yellow fever mosquito) transcriptional changes to better understand influence on mosquito physiology at the molecular level. We observed an iron- and reactive oxygen species (ROS)-independent signaling induced by heme that comprised genes related to redox metabolism. By modulating the abundance of these transcripts, heme possibly acts as a danger signaling molecule. Furthermore, heme triggered critical changes in the expression of energy metabolism and immune response genes, altering the susceptibility towards bacteria and dengue virus. These findings seem to have implications on the adaptation of mosquitoes to hematophagy and consequently on their ability to transmit diseases. Altogether, these results may also contribute to the understanding of heme cell biology in eukaryotic cells. PMID:26275150

  18. Overwintering Is Associated with Reduced Expression of Immune Genes and Higher Susceptibility to Virus Infection in Honey Bees.


    Steinmann, Nadja; Corona, Miguel; Neumann, Peter; Dainat, Benjamin


    The eusocial honey bee, Apis mellifera, has evolved remarkable abilities to survive extreme seasonal differences in temperature and availability of resources by dividing the worker caste into two groups that differ in physiology and lifespan: summer and winter bees. Most of the recent major losses of managed honey bee colonies occur during the winter, suggesting that winter bees may have compromised immune function and higher susceptibility to diseases. We tested this hypothesis by comparing the expression of eight immune genes and naturally occurring infection levels of deformed wing virus (DWV), one of the most widespread viruses in A. mellifera populations, between summer and winter bees. Possible interactions between immune response and physiological activity were tested by measuring the expression of vitellogenin and methyl farnesoate epoxidase, a gene coding for the last enzyme involved in juvenile hormone biosynthesis. Our data show that high DWV loads in winter bees correlate with reduced expression of genes involved in the cellular immune response and physiological activity and high expression of humoral immune genes involved in antibacterial defense compared with summer bees. This expression pattern could reflect evolutionary adaptations to resist bacterial pathogens and economize energy during the winter under a pathogen landscape with reduced risk of pathogenic viral infections. The outbreak of Varroa destructor infestation could have overcome these adaptations by promoting the transmission of viruses. Our results suggest that reduced cellular immune function during the winter may have increased honey bee's susceptibility to DWV. These results contribute to our understanding of honey bee colony losses in temperate regions.

  19. Transcriptome Analysis of the White Body of the Squid Euprymna tasmanica with Emphasis on Immune and Hematopoietic Gene Discovery

    PubMed Central

    Salazar, Karla A.; Joffe, Nina R.; Dinguirard, Nathalie; Houde, Peter; Castillo, Maria G.


    In the mutualistic relationship between the squid Euprymna tasmanica and the bioluminescent bacterium Vibrio fischeri, several host factors, including immune-related proteins, are known to interact and respond specifically and exclusively to the presence of the symbiont. In squid and octopus, the white body is considered to be an immune organ mainly due to the fact that blood cells, or hemocytes, are known to be present in high numbers and in different developmental stages. Hence, the white body has been described as the site of hematopoiesis in cephalopods. However, to our knowledge, there are no studies showing any molecular evidence of such functions. In this study, we performed a transcriptomic analysis of white body tissue of the Southern dumpling squid, E. tasmanica. Our primary goal was to gain insights into the functions of this tissue and to test for the presence of gene transcripts associated with hematopoietic and immune processes. Several hematopoiesis genes including CPSF1, GATA 2, TFIID, and FGFR2 were found to be expressed in the white body. In addition, transcripts associated with immune-related signal transduction pathways, such as the toll-like receptor/NF-κβ, and MAPK pathways were also found, as well as other immune genes previously identified in E. tasmanica’s sister species, E. scolopes. This study is the first to analyze an immune organ within cephalopods, and to provide gene expression data supporting the white body as a hematopoietic tissue. PMID:25775132

  20. Transcriptome analysis of the white body of the squid Euprymna tasmanica with emphasis on immune and hematopoietic gene discovery.


    Salazar, Karla A; Joffe, Nina R; Dinguirard, Nathalie; Houde, Peter; Castillo, Maria G


    In the mutualistic relationship between the squid Euprymna tasmanica and the bioluminescent bacterium Vibrio fischeri, several host factors, including immune-related proteins, are known to interact and respond specifically and exclusively to the presence of the symbiont. In squid and octopus, the white body is considered to be an immune organ mainly due to the fact that blood cells, or hemocytes, are known to be present in high numbers and in different developmental stages. Hence, the white body has been described as the site of hematopoiesis in cephalopods. However, to our knowledge, there are no studies showing any molecular evidence of such functions. In this study, we performed a transcriptomic analysis of white body tissue of the Southern dumpling squid, E. tasmanica. Our primary goal was to gain insights into the functions of this tissue and to test for the presence of gene transcripts associated with hematopoietic and immune processes. Several hematopoiesis genes including CPSF1, GATA 2, TFIID, and FGFR2 were found to be expressed in the white body. In addition, transcripts associated with immune-related signal transduction pathways, such as the toll-like receptor/NF-κβ, and MAPK pathways were also found, as well as other immune genes previously identified in E. tasmanica's sister species, E. scolopes. This study is the first to analyze an immune organ within cephalopods, and to provide gene expression data supporting the white body as a hematopoietic tissue.

  1. Immunosuppressive Myeloid Cells' Blockade in the Glioma Microenvironment Enhances the Efficacy of Immune-Stimulatory Gene Therapy.


    Kamran, Neha; Kadiyala, Padma; Saxena, Meghna; Candolfi, Marianela; Li, Youping; Moreno-Ayala, Mariela A; Raja, Nicholas; Shah, Diana; Lowenstein, Pedro R; Castro, Maria G


    Survival of glioma (GBM) patients treated with the current standard of care remains dismal. Immunotherapeutic approaches that harness the cytotoxic and memory potential of the host immune system have shown great benefit in other cancers. GBMs have developed multiple strategies, including the accumulation of myeloid-derived suppressor cells (MDSCs) to induce immunosuppression. It is therefore imperative to develop multipronged approaches when aiming to generate a robust anti-tumor immune response. Herein, we tested whether combining MDSC depletion or checkpoint blockade would augment the efficacy of immune-stimulatory herpes simplex type-I thymidine kinase (TK) plus Fms-like tyrosine kinase ligand (Flt3L)-mediated immune stimulatory gene therapy. Our results show that MDSCs constitute >40% of the tumor-infiltrating immune cells. These cells express IL-4Rα, inducible nitric oxide synthase (iNOS), arginase, programmed death ligand 1 (PDL1), and CD80, molecules that are critically involved in antigen-specific T cell suppression. Depletion of MDSCs strongly enhanced the TK/Flt3L gene therapy-induced tumor-specific CD8 T cell response, which lead to increased median survival and percentage of long-term survivors. Also, combining PDL1 or CTLA-4 immune checkpoint blockade greatly improved the efficacy of TK/Flt3L gene therapy. Our results, therefore, indicate that blocking MDSC-mediated immunosuppression holds great promise for increasing the efficacy of gene therapy-mediated immunotherapies for GBM.

  2. Comparative transcriptomics of stickleback immune gene responses upon infection by two helminth parasites, Diplostomum pseudospathaceum and Schistocephalus solidus.


    Haase, David; Rieger, Jenny K; Witten, Anika; Stoll, Monika; Bornberg-Bauer, Erich; Kalbe, Martin; Schmidt-Drewello, Alexander; Scharsack, Jörn P; Reusch, Thorsten B H


    Immune systems of vertebrates are much more diverse than previously thought, in particular at the base of the vertebrate clade. RNA-seq was used to describe in detail the transcriptomic response of stickleback hosts to infection by two helminth parasites, the trematode Diplostomum pseudospathaceum (2 genotypes plus a genotype mix) and the cestode Schistocephalus solidus. Based on a global transcription profiling, we present immune genes that are active during chronic or multiple repeated infection. We found that the transcription profiles of D. pseudospathaceum genotypes were as divergent as those of the two parasite species. When comparing the host immune response, only 5 immune genes were consistently upregulated upon infection by both species. These genes indicated a role for enhanced toll like receptor (TLR) activity (CTSK, CYP27B1) and an associated positive regulation of macrophages (CYP27B1, THBS1) for general helminth defense. We interpret the largely differentiated gene expression response among parasite species as general redundancy of the vertebrate immune system, which was also visible in genotype-specific responses among the different D. pseudospathaceum infections. The present study provides the first evidence that IL4-mediated activation of T-helper lymphocyte cells is also important in anti-helminthic immune responses of teleost fish.

  3. System-Wide Associations between DNA-Methylation, Gene Expression, and Humoral Immune Response to Influenza Vaccination

    PubMed Central

    Zimmermann, Michael T.; Oberg, Ann L.; Grill, Diane E.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Kennedy, Richard B.; Poland, Gregory A.


    Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50–74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant’s propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens. PMID:27031986

  4. Gene expression profiling of coelomic cells and discovery of immune-related genes in the earthworm, Eisenia andrei, using expressed sequence tags.


    Tak, Eun Sik; Cho, Sung-Jin; Park, Soon Cheol


    The coelomic cells of the earthworm consist of leukocytes, chlorogocytes, and coelomocytes, which play an important role in innate immunity reactions. To gain insight into the expression profiles of coelomic cells of the earthworm, Eisenia andrei, we analyzed 1151 expressed sequence tags (ESTs) derived from the cDNA library of the coelomic cells. Among the 1151 ESTs analyzed, 493 ESTs (42.8%) showed a significant similarity to known genes and represented 164 unique genes, of which 93 ESTs were singletons and 71 ESTs manifested as two or more ESTs. From the 164 unique genes sequenced, we found 24 immune-related and cell defense genes. Furthermore, real-time PCR analysis showed that levels of lysenin-related proteins mRNA in coelomic cells of E. andrei were upregulated after the injection of Bacillus subtilis bacteria. This EST data-set would provide a valuable resource for future researches of earthworm immune system.

  5. Structure and immune expression analysis of hemoglobin genes from the blood clam Tegillarca granosa.


    Bao, Y B; Wang, Q; Guo, X M; Lin, Z H


    Hemoglobin (Hb) is the major protein component of erythrocytes in animals with red blood, although it can serve additional functions beyond the transport of oxygen. The blood clam (Tegillarca granosa) is one of the few mollusks that has Hb, although the structure and function of molluskan Hbs remain unclear. We characterized two unique and highly compartmentalized blood clam hemoglobin genes, Tg-HbIIA and Tg-HbIIB, at the molecular level. The full-length cDNA of Tg-HbIIA was 731 bp with a 450-bp open reading frame encoding 150 amino acids; that of Tg-HbIIB was 698 bp, with a 456-bp open reading frame encoding 152 amino acids. Their intronic regions were amplified by PCR. The two genes showed the typical 2 intron/3 exon organization found in T. granosa. The 3-D structures of the three blood clam Tg-Hbs were predicted using the SWISS-MODEL Protein Modeling Server, and a phylogenetic analysis was conducted to investigate its evolution. As quantified by qRT-PCR, the expression levels of Tg-HbIIA and Tg-HbIIB were significantly upregulated upon challenge by Vibrio parahaemolyticus, lipopolysaccharides, and peptidoglycans. Three Hb isoforms, Tg-HbI, Tg-HbIIA, and Tg-HbIIB, were found. Specific structures and evolutionary features were found in these molluskan Hb genes. Challenge experiments indicated that Tg-Hbs are involved in immune defense responses against bacterial infection and bacterial pathogenic factors. As this is the first functional research on Hb genes in the blood clam, our findings provide new insight into the innate immune defense mechanisms of T. granosa.

  6. Genetic Organization of Plasmid ColJs, Encoding Colicin Js Activity, Immunity, and Release Genes

    PubMed Central

    Šmajs, David; Weinstock, George M.


    The 5.2-kb ColJs plasmid of a colicinogenic strain of Shigella sonnei (colicin type 7) was isolated and sequenced. pColJs was partly homologous to pColE1 and to pesticin-encoding plasmid pPCP1, mainly in the rep, mob, and cer regions. A 1.2-kb unique region of pColJs showed significantly different G+C content (34%) compared to the rest of pColJs (53%). Within the unique region, seven open reading frames (ORFs) were identified. ORF94 was shown to code for colicin Js activity (cja), a 94-amino-acid polypeptide (molecular mass, 10.4 kDa); ORF129 (cji) was shown to code for the 129-amino-acid colicin Js immunity protein (molecular mass, 14.3 kDa); and ORF65 was shown to be involved in colicin Js release by producer bacteria (cjl) coding for a 65-amino-acid polypeptide (molecular mass, 7.5 kDa). In contrast to the gene order in other colicin operons, the cjl gene was found upstream from cja. Moreover, the promoter upstream from cjl was similar to promoters described upstream from several colicin activity genes. The cji gene was found to be located downstream from cja with a transcription polarity opposite to that of the cjl and cja genes. The cja, cji, and cjl genes were not similar to other known colicin genes. Colicin Js was purified as an inactive fusion protein with an N-terminal histidine tag. Activity of the purified fusion form of colicin Js was restored after cleavage of the amino acids fused to the colicin Js N terminus. PMID:11395458

  7. Identification of immune-relevant genes in histoincompatible rejecting colonies of the tunicate Botryllus schlosseri.


    Oren, Matan; Douek, Jacob; Fishelson, Zvi; Rinkevich, Baruch


    The colonial ascidian Botryllus schlosseri manifests a unique allorecognition system that is controlled by a single histocompatibility haplotype, the Fu/HC locus. When two allogeneic incompatible colonies come into direct contact, they develop inflammatory-like rejection lesions, called points of rejection (POR). While screening for differentially expressed genes during POR formation, we developed and analyzed a cDNA library of expressed sequence tags (ESTs) with 1693 unique ESTs that were clustered and assembled into 217 contigs and 1476 singlets. About 51% of these ESTs showed high similarity (E-value 0.005) to known database sequences, of which 123 matches were identified as immune-relevant genes encoding for stress proteins, pattern recognition receptors and complement proteins, proteases and protease inhibitors, cell adhesion and coagulation proteins, cytokine-related proteins, programmed cell death and proteasome-associated proteins. This first EST wide-screening analysis of the Botryllus allorecognition effector arm reveals a complex innate immune system, hallmarked by a whole genome response to allorecognition challenge.

  8. Combined Tbet and IL12 gene therapy elicits and recruits superior antitumor immunity in vivo.


    Qu, Yanyan; Chen, Lu; Lowe, Devin B; Storkus, Walter J; Taylor, Jennifer L


    We have recently shown that intratumor (i.t.) injection of syngenic dendritic cells (DC) engineered to express the transcription factor Tbet (TBX21) promotes protective type-1 T cell-mediated immunity via a mechanism that is largely interleukin (IL)-12p70-independent. Since IL-12 is a classical promoter of type-1 immunity, the current study was undertaken to determine whether gene therapy using combined Tbet and IL-12 complementary DNA (cDNA) would yield improved antitumor efficacy based on the complementary/synergistic action of these biologic modifiers. Mice bearing established subcutaneous (s.c.) tumors injected with DC concomitantly expressing ectopic Tbet and IL12 (i.e., DC.Tbet/IL12) displayed superior (i) rates of tumor rejection and extended overall survival, (ii) cross-priming of Tc1 reactive against antigens expressed within the tumor microenvironment, and (iii) infiltration of CD8(+) T cells into treated tumors in association with elevated locoregional production of CXCR3 ligand chemokines. In established bilateral tumor models, i.t. delivery of DC.Tbet/IL12 into a single lesion led to slowed growth or regression at both tumor sites. Furthermore, DC.Tbet/IL12 pulsed with tumor antigen-derived peptides and injected as a therapy distal to the tumor site prevented tumor growth and activated robust antigen-specific Tc1 responses. These data support the translation use of combined Tbet and IL-12p70 gene therapy in the cancer setting.

  9. Expression of Immune-Related Genes during Loach (Misgurnus anguillicaudatus) Embryonic and Early Larval Development

    PubMed Central

    Lee, Jang Wook; Kim, Jung Eun; Goo, In Bon; Hwang, Ju-Ae; Im, Jea Hyun; Choi, Hye-Sung; Lee, Jeong-Ho


    Early life stage mortality in fish is one of the problems faced by loach aquaculture. However, our understanding of immune system in early life stage fish is still incomplete, and the information available is restricted to a few fish species. In the present work, we investigated the expression of immune-related transcripts in loach during early development. In fishes, recombination-activating gene 1 (RAG-1) and sacsin (SACS) have been considered as immunological function. In this study, the expression of the both genes was assessed throughout the early developmental stages of loach using real-time PCR method. maRAG-1 mRNA was first detected in 0 dph, observed the increased mostly until 40 dph. Significant expression of maRAG-1 was detected in 0 to 40 dph. These patterns of expression may suggest that the loach start to develop its function after hatching. On the other hand, maSACS was detected in unfertilized oocyte to molura stages and 0 to 40 dph. maSACS mRNA transcripts were detected in unfertilized oocytes, suggesting that they are maternally transferred. PMID:26973969

  10. Molecular characterization of Ran gene up-regulated in large yellow croaker (Pseudosciaena crocea) immunity.


    Han, Fang; Wang, Xiao-Qing; Yao, Cui-luan; Wang, Zhi-yong


    RanGTPase, one family of small G protein superfamily, has been widely demonstrated to be involved in transport system between cytoplasm and nucleus. However the knowledge about the function of RanGTPase in immunity remains limited. In this report, Ran gene (named LycRan) cDNA was cloned from the large yellow croaker, Pseudosciaena crocea, a marine fish. The full-length cDNA of LycRan was of 1033 bp, including a 5'-terminal untranslated region (UTR) of 43 bp, 3'-terminal UTR of 338 bp and an open reading frame (ORF) of 648 bp encoding a polypeptide of 216 amino acids. The deduced protein is highly homologous, it shares 90.74%, 88.89%, 89.35% and 85.20% identities with those of salmon, frog, human and fruit fly respectively. RT-PCR analysis indicated that LycRan gene was constitutively expressed in 9 tissues examined, including kidney, liver, gill, muscle, spleen, skin, heart, intestine and blood. The result of quantitative Real-Time RT-PCR analysis revealed the highest expression in kidney and the weakest expression in skin. Time course analysis showed that LycRan expression was obviously up-regulated in kidney, blood and spleen after immunization with either poly I:C or formalin-inactive Gram-negative bacterium Vibrio parahaemolyticus. It indicated that the highest expression was 2.8 times (at 48 h) as much as that in the control in the kidney (p < 0.05) challenged by poly I:C and 3.2 times (at 24 h) in the blood (p < 0.05) challenged by bacteria. These results suggested that LycRan might play an important role in large yellow croaker defense against the pathogen infection. Our study, therefore, might provide a clue to elucidate the large yellow croaker innate immunity.

  11. Identification of Immune Related LRR-Containing Genes in Maize (Zea mays L.) by Genome-Wide Sequence Analysis

    PubMed Central

    Song, Wei; Wang, Baoqiang; Li, Xinghua; Wei, Jianfen; Chen, Ling; Zhang, Dongmin; Zhang, Wenying; Li, Ronggai


    A large number of immune receptors consist of nucleotide binding site-leucine rich repeat (NBS-LRR) proteins and leucine rich repeat-receptor-like kinases (LRR-RLK) that play a crucial role in plant disease resistance. Although many NBS-LRR genes have been previously identified in Zea mays, there are no reports on identifying NBS-LRR genes encoded in the N-terminal Toll/interleukin-1 receptor (TIR) motif and identifying genome-wide LRR-RLK genes. In the present study, 151 NBS-LRR genes and 226 LRR-RLK genes were identified after performing bioinformatics analysis of the entire maize genome. Of these identified genes, 64 NBS-LRR genes and four TIR-NBS-LRR genes were identified for the first time. The NBS-LRR genes are unevenly distributed on each chromosome with gene clusters located at the distal end of each chromosome, while LRR-RLK genes have a random chromosomal distribution with more paired genes. Additionally, six LRR-RLK/RLPs including FLS2, PSY1R, PSKR1, BIR1, SERK3, and Cf5 were characterized in Zea mays for the first time. Their predicted amino acid sequences have similar protein structures with their respective homologues in other plants, indicating that these maize LRR-RLK/RLPs have the same functions as their homologues act as immune receptors. The identified gene sequences would assist in the study of their functions in maize. PMID:26609518

  12. Creation of immune 'stealth' genes for gene therapy through fusion with the Gly-Ala repeat of EBNA-1.


    Ossevoort, M; Visser, B M J; van den Wollenberg, D J M; van der Voort, E I H; Offringa, R; Melief, C J M; Toes, R E M; Hoeben, R C


    A major obstacle in gene-therapy protocols is T-cell-mediated destruction of transgene-expressing cells. Therefore new approaches are needed to prevent rapid clearance of transduced cells. We exploited the Gly-Ala repeat (GAr) domain of the Epstein-Barr virus nuclear antigen-1, since the GAr prevents cytotoxic T-lymphocyte-epitope generation. Here we show that three different enzymes (viz. the E. coli LacZ gene encoded beta-galactosidase, firefly luciferase, and HSV1 thymidine kinase) fused with the GAr retained their function. Moreover, linking GAr with beta-galactosidase successfully prevented recognition of GAr-LacZ-expressing cells by beta-galactosidase-specific CTL. Nonetheless, vaccination with a GAr-LacZ adenovirus or with an allogeneic cell line expressing GAr-LacZ resulted in the induction of beta-gal-specific CTL. This demonstrates that the GAr domain does not inhibit cross presentation of antigens, but only affects breakdown of endogenously synthesized proteins. These data demonstrate how the GAr domain can be exploited to create immuno'stealth' genes by hiding transgene products from CTL-mediated immune attack.

  13. Associations between polymorphisms in the antiviral TRIM genes and measles vaccine immunity.


    Ovsyannikova, Inna G; Haralambieva, Iana H; Vierkant, Robert A; O'Byrne, Megan M; Poland, Gregory A


    The role of polymorphisms within the antiviral tripartite motif (TRIM) genes in measles vaccine adaptive immune responses was examined. A limited association was found between TRIM5 (rs7122620) and TRIM25 (rs205499) gene polymorphisms and measles-specific antibody levels. However, many associations were found between TRIM gene SNPs and variations in cellular responses (IFN-γ Elispot and secreted cytokines IL-2, IL-6, IL-10, IFN-γ, and TNF-α). TRIM22 rs2291841 was significantly associated with an increased IFN-γ Elispot response (35 vs. 102 SFC per 2×10(5)PBMC, p=0.009, q=0.71) in Caucasians. A non-synonymous TRIM25 rs205498 (in LD with other SNPs, r(2)≥0.56), as well as the TRIM25 AAAGGAAAGGAGT haplotype, was associated with a decreased IFN-γ Elispot response (t-statistic -2.32, p=0.02) in African-Americans. We also identified polymorphisms in the TRIM5, TRIM22, and TRIM25 genes that were associated with significant differences in cytokine responses. Additional studies are necessary to replicate our findings and to examine the functional consequences of these associations.

  14. Cortisol-treated zebrafish embryos develop into pro-inflammatory adults with aberrant immune gene regulation

    PubMed Central

    Hartig, Ellen I.; Zhu, Shusen; King, Benjamin L.


    ABSTRACT Chronic early-life stress increases adult susceptibility to numerous health problems linked to chronic inflammation. One way that this may occur is via glucocorticoid-induced developmental programming. To gain insight into such programming we treated zebrafish embryos with cortisol and examined the effects on both larvae and adults. Treated larvae had elevated whole-body cortisol and glucocorticoid signaling, and upregulated genes associated with defense response and immune system processes. In adulthood the treated fish maintained elevated basal cortisol levels in the absence of exogenous cortisol, and constitutively mis-expressed genes involved in defense response and its regulation. Adults derived from cortisol-treated embryos displayed defective tailfin regeneration, heightened basal expression of pro-inflammatory genes, and failure to appropriately regulate those genes following injury or immunological challenge. These results support the hypothesis that chronically elevated glucocorticoid signaling early in life directs development of a pro-inflammatory adult phenotype, at the expense of immunoregulation and somatic regenerative capacity. PMID:27444789

  15. Expression of immune genes on chromosome 6p21.3-22.1 in schizophrenia.


    Sinkus, Melissa L; Adams, Catherine E; Logel, Judith; Freedman, Robert; Leonard, Sherry


    Schizophrenia is a common mental illness with a large genetic component. Three genome-wide association studies have implicated the major histocompatibility complex gene region on chromosome 6p21.3-22.1 in schizophrenia. In addition, nicotine, which is commonly abused in schizophrenia, affects the expression of central nervous system immune genes. Messenger RNA levels for genes in the 6p21.3-22.1 region were measured in human postmortem hippocampus of 89 subjects. The effects of schizophrenia diagnosis, smoking and systemic inflammatory illness were compared. Cell-specific expression patterns for the class I major histocompatibility complex gene HLA-A were explored utilizing in situ hybridization. Expression of five genes was altered in schizophrenic subjects. Messenger RNA levels for the class I major histocompatibility complex antigen HLA-B were increased in schizophrenic nonsmokers, while levels for smokers were indistinguishable from those of controls. β2 microglobulin, HLA-A and Notch4 were all expressed in a pattern where inflammatory illness was associated with increased expression in controls but not in subjects with schizophrenia. Schizophrenia was also associated with increased expression of Butyrophilin 2A2. HLA-A was expressed in glutamatergic and GABAergic neurons in the dentate gyrus, hilus, and the stratum pyramidale of the CA1-CA4 regions of the hippocampus, but not in astrocytes. In conclusion, the expression of genes from the major histocompatibility complex region of chromosome 6 with likely roles in synaptic development is altered in schizophrenia. There were also significant interactions between schizophrenia diagnosis and both inflammatory illness and smoking.

  16. The nociception genes painless and Piezo are required for the cellular immune response of Drosophila larvae to wasp parasitization.


    Tokusumi, Yumiko; Tokusumi, Tsuyoshi; Schulz, Robert A


    In vertebrates, interaction between the nervous system and immune system is important to protect a challenged host from stress inputs from external sources. In this study, we demonstrate that sensory neurons are involved in the cellular immune response elicited by wasp infestation of Drosophila larvae. Multidendritic class IV neurons sense contacts from external stimuli and induce avoidance behaviors for host defense. Our findings show that inactivation of these sensory neurons impairs the cellular response against wasp parasitization. We also demonstrate that the nociception genes encoding the mechanosensory receptors Painless and Piezo, both expressed in class IV neurons, are essential for the normal cellular immune response to parasite challenge.

  17. CD14, a Key Candidate Gene Associated with Specific Immune Response to Cockroach

    PubMed Central

    Gao, Peisong; Grigoryev, Dmitry N.; Rafaels, Nicholas M.; Mu, Deguang; Wright, Jerry M.; Cheadle, Christopher; Togias, Alkis; Beaty, Terri H.; Mathias, Rasika A.; Schroeder, John T.; Barnes, Kathleen C.


    Summary Background Sensitization to cockroach allergen is one of the strongest predictors of asthma morbidity, especially among African Americans. Objective Our aims were to determine the genomic basis of cockroach sensitization and the specific response to cockroach antigen. Methods We investigated the Th1/Th2 cytokine profile of co-cultured plasmacytoid DCs (pDCs) and CD4+ T cells and the “transcript signature” of the immune response to cockroach antigen using high-throughput expression profiling of co-cultured cells. Results We observed significantly elevated levels of IL-13, IL-10 and TNF-α, but undetectable levels of IL-12p70 and IFN-α, when cultures were exposed to crude cockroach antigen. A significant difference was observed for IL-13 between cockroach allergic and non-allergic individuals (p = 0.039). Microarray analyses demonstrated a greater response at 48 hours compared to 4 hours, with 50 genes being uniquely expressed in cockroach antigen-treated cells, including CD14, S100A8, CCL8, and IFI44L. The increased CD14 expression was further observed in purified pDCs, human monocytic THP-1 cells, and supernatant of co-cultured pDCs and CD4+ T cells in exposure to cockroach extract. Furthermore, the most differential expression of CD14 between cockroach allergy and non-cockroach allergy was only observed among individuals with the CC “high-risk” genotype of the CD14 -260C/T. Ingenuity Pathways Analysis (IPA) analyses suggested the interferon-signaling as the most significant canonical pathway. Conclusion Our results suggest these differentially expressed genes, particularly CD14, and genes in the interferon-signaling pathway may be important candidates for further investigation of their role in the immune response to cockroach allergen. PMID:20618347

  18. Polymorphisms in inflammatory and immune response genes associated with cerebral cavernous malformation type 1 severity

    PubMed Central

    Choquet, Hélène; Pawlikowska, Ludmila; Nelson, Jeffrey; McCulloch, Charles E.; Akers, Amy; Baca, Beth; Khan, Yasir; Hart, Blaine; Morrison, Leslie; Kim, Helen


    Background Familial cerebral cavernous malformation type 1 (CCM1) is an autosomal dominant disease caused by mutations in the Krev Interaction Trapped 1 (KRIT1/CCM1) gene, and characterized by multiple brain lesions that often result in intracerebral hemorrhage (ICH), seizures, and neurological deficits. Carriers of the same genetic mutation can present with variable symptoms and severity of disease, suggesting the influence of modifier factors. Evidence is emerging that inflammation and immune response play a role in the pathogenesis of CCM. The purpose of this study was to investigate whether common variants in inflammatory and immune response genes influence the severity of familial CCM1 disease, as manifested by ICH and greater brain lesion count. Methods Hispanic CCM1 patients (n=188) harboring the founder Q455X ‘common Hispanic mutation’ (CHM) in the KRIT1 gene were analyzed at baseline. Participants were enrolled between June 2010 and March 2014 either through the Brain Vascular Malformation Consortium (BVMC) study or through the Angioma Alliance organization. Clinical assessment and cerebral susceptibility-weighted magnetic resonance imaging were performed to determine ICH as well as total and large (≥5 mm in diameter) lesion counts. Samples were genotyped on the Affymetrix Axiom Genome-Wide LAT1 Human Array. We analyzed 830 variants in 56 inflammatory and immune response genes for association with ICH and residuals of log-transformed total or large lesion count adjusted for age at enrollment and gender. Variants were analyzed individually, grouped by sub-pathways or whole pathway. Results At baseline, 30.3% of CCM1-CHM subjects had ICH, with a mean ± standard deviation (SD) of 60.1 ± 115.0 (range 0 to 713) for total lesions and 4.9 ± 8.7 (range 0 to 104) for large lesions. The heritability estimates explained by all autosomal variants were 0.20 (SE=0.31), 0.81 (SE=0.17) and 0.48 (SE=0.19), for ICH, total lesion count and large lesion count

  19. Threonine modulates immune response, antioxidant status and gene expressions of antioxidant enzymes and antioxidant-immune-cytokine-related signaling molecules in juvenile blunt snout bream (Megalobrama amblycephala).


    Habte-Tsion, Habte-Michael; Ren, Mingchun; Liu, Bo; Ge, Xianping; Xie, Jun; Chen, Ruli


    A 9-week feeding trial was conducted to investigate the effects of graded dietary threonine (Thr) levels (0.58-2.58%) on the hematological parameters, immune response, antioxidant status and hepatopancreatic gene expression of antioxidant enzymes and antioxidant-immune-cytokine-related signaling molecules in juvenile blunt snout bream. For this purpose, 3 tanks were randomly arranged and assigned to each experimental diet. Fish were fed with their respective diet to apparent satiation 4 times daily. The results indicated that white blood cell, red blood cell and haemoglobin significantly responded to graded dietary Thr levels, while hematocrit didn't. Complement components (C3 and C4), total iron-binding capacity (TIBC), immunoglobulin M (IgM), superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) increased with increasing dietary Thr levels up to 1.58-2.08% and thereafter tended to decrease. Dietary Thr regulated the gene expressions of Cu/Zn-SOD, Mn-SOD and CAT, GPx1, glutathione S-transferase mu (GST), nuclear factor erythroid 2-related factor 2 (Nrf2), heat shock protein-70 (Hsp70), tumor necrosis factor-alpha (TNF-α), apolipoprotein A-I (ApoA1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and fructose-bisphosphate aldolase B (ALDOB); while the gene expression of peroxiredoxin II (PrxII) was not significantly modified by graded Thr levels. These genes are involved in different functions including antioxidant, immune, and defense responses, energy metabolism and protein synthesis. Therefore, this study could provide a new molecular tool for studies in fish immunonutrition and shed light on the regulatory mechanisms that dietary Thr improved the antioxidant and immune capacities of fish.

  20. Cord blood gene expression supports that prenatal exposure to perfluoroalkyl substances causes depressed immune functionality in early childhood.


    Pennings, Jeroen L A; Jennen, Danyel G J; Nygaard, Unni C; Namork, Ellen; Haug, Line S; van Loveren, Henk; Granum, Berit


    Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are a class of synthetic compounds that have widespread use in consumer and industrial applications. PFAS are considered environmental pollutants that have various toxic properties, including effects on the immune system. Recent human studies indicate that prenatal exposure to PFAS leads to suppressed immune responses in early childhood. In this study, data from the Norwegian BraMat cohort was used to investigate transcriptomics profiles in neonatal cord blood and their association with maternal PFAS exposure, anti-rubella antibody levels at 3 years of age and the number of common cold episodes until 3 years. Genes associated with PFAS exposure showed enrichment for immunological and developmental functions. The analyses identified a toxicogenomics profile of 52 PFAS exposure-associated genes that were in common with genes associated with rubella titers and/or common cold episodes. This gene set contains several immunomodulatory genes (CYTL1, IL27) as well as other immune-associated genes (e.g. EMR4P, SHC4, ADORA2A). In addition, this study identified PPARD as a PFAS toxicogenomics marker. These markers can serve as the basis for further mechanistic or epidemiological studies. This study provides a transcriptomics connection between prenatal PFAS exposure and impaired immune function in early childhood and supports current views on PPAR- and NF-κB-mediated modes of action. The findings add to the available evidence that PFAS exposure is immunotoxic in humans and support regulatory policies to phase out these substances.

  1. Possible influence of B chromosomes on genes included in immune response and parasite burden in Apodemus flavicollis.


    Adnađević, Tanja; Jovanović, Vladimir M; Blagojević, Jelena; Budinski, Ivana; Cabrilo, Borislav; Bjelić-Čabrilo, Olivera; Bijelić-Čabrilo, Olivera; Vujošević, Mladen


    Genetic background underlying wild populations immune response to different parasites is still not well understood. We studied immune response to multiple infections and to competition between different parasite species at different developmental stages in population of yellow-necked mouse, Apodemus flavicollis. Quantitative real-time PCR was used to investigate associations of MHC II-DRB, IL-10 and Tgf-β genes expressions with presence of intestinal parasites at different developmental stages. Furthermore, we were interested whether the host related characteristics (sex, age, body condition, presence of B chromosomes or expression of other genes) or characteristics of present parasites (number of adult parasites of each identified species, egg count of each parasite genus, total number of nematode individuals) affect differential expression of the studied genes. A significant invert association between the expression of MHC II-DRB and Tgf-β gene was found, which together with absence of IL-10 association confirmed modified Th2 as the main type of immune response to nematode infections. Effect of recorded parasites and parasite life-cycle stage on expression levels of MHC II-DRB gene was detected only through interactions with host-related characteristics such as sex, age, and the presence of B chromosomes. The presence of B chromosomes is associated with lower expression level of Tgf-β gene. Although the influence of host genetic background on parasite infection has already been well documented, this is the first study in mammals that gave presence of B chromosomes on immune response full consideration.

  2. Inherited Susceptibility to Breast Cancer in Healthy Women: Mutation in Breast Cancer Genes, Immune Surveillance, and Psychological Distress

    DTIC Science & Technology


    risk for breast cancer: the buffering role of emotional expressivity. Psychoneuroimmunology Research Society May 2001. Kim Y, Valdimarsdottir H...Biobehavioral consequences of stress in individuals. Danish Cancer Society, Copenhagen, Denmark, 1998. Psychoneuroimmunology and cancer. University...Psychiatry. SUNY Stony Brook, Stony Brook, NY 2001. Psychoneuroimmunology in cancer Prevention and control. The American Society of Preventive

  3. A member of the immunoglobulin superfamily, orange-spotted grouper novel immune gene EcVig, is induced by immune stimulants and type I interferon.


    Yeh, Ying-Chun; Wang, Ting-Yu; Chou, Hsin-Yiu; Lin, Han-You; Chen, Tzong-Yueh; Aoki, Takashi; Wang, Han-Ching


    A novel grouper immune gene, EcVig was identified in orange-spotted grouper (Epinephelus coioides). We recently determined that EcVig expression can be induced by infection with nervous necrosis virus (NNV, an RNA virus), whereas NNV replication may be suppressed when EcVig was overexpressed. Although EcVig appeared to be involved in grouper antiviral activity, its immune effects have not been well characterized. In the present study, two PAMPs (pathogen-associated molecular patterns; lipopolysaccharides [LPS] and synthetic double-stranded RNA polyriboinosinic-polyribocytidylic acid [poly(I:C)]), as well as fish DNA virus (red sea bream iridovirus, RSIV; grouper iridovirus, GIV), were used to study EcVig responses in orange-spotted grouper. In addition, groupers were given recombinant type I interferon to determine whether EcVig expression was induced. Poly(I:C) rapidly induced substantial expression of EcVig, whereas LPS stimulation did not appear to have any effect in grouper intestine. Expression levels of total EcVig and other IFN-stimulated genes (ISGs) were all significantly increased after RSIV and GIV infection. Furthermore, stimulation of recombinant type I IFN also increased EcVig expression. We conclude that EcVig may be a novel IFN-stimulated gene that demonstrates an antiviral immune response.

  4. Conjugal immunity of Streptomyces strains carrying the integrative element pSAM2 is due to the pif gene (pSAM2 immunity factor).


    Possoz, Christophe; Gagnat, Josette; Sezonov, Guennadi; Guérineau, Michel; Pernodet, Jean-Luc


    Mechanisms of conjugal immunity preventing redundant exchange between two cells harbouring the same conjugative element have been reported in diverse bacteria. Such a system does exist for pSAM2, a conjugative and integrative element of Streptomyces. The apparition of the conjugative free form of pSAM2 in the donor strain during mating can be considered as the initial step of transfer. We analysed the genes involved in transfer inhibition by mating donors harbouring pSAM2 with recipient strains containing different regions of pSAM2. The conjugal immunity was previously thought to be mediated by the transcriptional repressor KorSA. Although the transfer efficiency is reduced by its presence in the recipient, the initiation of the transfer process is not affected. In contrast, the presence in the recipient strain of a single pSAM2 gene, pif (pSAM2 immunity factor), was sufficient to abolish both transfer and initiation of transfer. Thus, the clustered genes korSA and pif act complementarily to maintain pSAM2 in a 'prophage' state under non-conjugal conditions. KorSA is involved in intracellular signalling, whereas Pif participates in intercellular signalling. The Pif nudix motif is essential for its activity. This is the first protein of the nudix family shown to be involved in bacterial conjugation.

  5. Parallel declines in cognition, motivation, and locomotion in aging mice: association with immune gene upregulation in the medial prefrontal cortex

    PubMed Central

    Bordner, Kelly A.; Kitchen, Robert R.; Carlyle, Becky; George, Elizabeth D.; Mahajan, Milind C.; Mane, Shrikant M.; Taylor, Jane R.; Simen, Arthur A.


    Aging in humans is associated with parallel changes in cognition, motivation, and motoric performance. Based on the human aging literature, we hypothesized that this constellation of age-related changes is mediated by the medial prefrontal cortex and that it would be observed in aging mice. Toward this end, we performed detailed assessments of cognition, motivation, and motoric behavior in aging mice. We assessed behavioral and cognitive performance in C57Bl/6 mice aged 6, 18, and 24 months, and followed this with microarray analysis of tissue from the medial prefrontal cortex and analysis of serum cytokine levels. Multivariate modeling of these data suggested that the age-related changes in cognition, motivation, motor performance, and prefrontal immune gene expression were highly correlated. Peripheral cytokine levels were also correlated with these variables, but less strongly than measures of prefrontal immune gene upregulation. To determine whether the observed immune gene expression changes were due to prefrontal microglial cells, we isolated CD11b-positive cells from the prefrontal cortex and subject them to next-generation RNA sequencing. Many of the immune changes present in whole medial prefrontal cortex were enriched in this cell population. These data suggest that, as in humans, cognition, motivation, and motoric performance in the mouse change together with age and are strongly associated with CNS immune gene upregulation. PMID:21453768

  6. Immune gene expression in the spleen of chickens experimentally infected with Ascaridia galli.


    Dalgaard, Tina S; Skovgaard, Kerstin; Norup, Liselotte R; Pleidrup, Janne; Permin, Anders; Schou, Torben W; Vadekær, Dorte F; Jungersen, Gregers; Juul-Madsen, Helle R


    Ascaridia galli is a gastrointestinal nematode infecting chickens. Chickens kept in alternative rearing systems or at free-range experience increased risk for infection with resulting high prevalences. A. galli infection causes reduced weight gain, decreased egg production and in severe cases increased mortality. More importantly, the parasitised chickens are more susceptible to secondary infections and their ability to develop vaccine-induced protective immunity against other diseases may be compromised. Detailed information about the immune response to the natural infection may be exploited to enable future vaccine development. In the present study, expression of immune genes in the chicken spleen during an experimental infection with A. galli was investigated using the Fluidigm(®) BioMark™ microfluidic qPCR platform which combines automatic high-throughput with attractive low sample and reagent consumption. Spleenic transcription of immunological genes was compared between infected chickens and non-infected controls at week 2, 6, and 9 p.i. corresponding to different stages of parasite development/maturation. At week 2 p.i. increased expression of IL-13 was observed in infected chickens. Increased expression of MBL, CRP, IFN-α, IL-1β, IL-8, IL-12β and IL-18 followed at week 6 p.i. and at both week 6 and 9 p.i. expression of DEFβ1 was highly increased in infected chickens. In summary, apart from also earlier reported increased expression of the Th2 signature cytokine IL-13 we observed only few differentially expressed genes at week 2 p.i. which corresponds to the larvae histotrophic phase. In contrast, we observed increased expression of pro-inflammatory cytokines and acute phase proteins in infected chickens, by week 6 p.i. where the larvae re-enter the intestinal lumen. Increased expression of DEFβ1 was observed in infected chickens at week 6 p.i. but also at week 9 p.i. which corresponds to a matured stage where adult worms are present in the

  7. Molecular characterization and immune response expression of the QM gene from the scallop Chlamys farreri.


    Chen, Guofu; Zhang, Chunyun; Wang, Yue; Wang, Yuanyuan; Guo, Changlu; Wang, Chongming


    The scallop Chlamys farreri is an important aquaculture species in northern China. However, the sustainable development of the scallop industry is currently threatened by several pathogens that cause mass mortality of this mollusk. Therefore, a complete understanding of the immune response mechanisms involved in host-virus interactions is necessary. This study reports a novel QM gene from C. farreri. This gene was first identified as a putative tumor suppressor gene from human and then confirmed to participate in several functions, including immune response. The QM gene from C. farreri (CfQM) was identified by suppression subtractive hybridization, and its full-length (763 bp) cDNA was obtained through rapid amplification of cDNA ends. The cDNA of CfQM contained a short 5'-UTR of 22 bp and a 3'-UTR of 84 bp. Its ORF comprised 657 nucleotides that encode 218 amino acids with a molecular weight of approximately 28.3 kDa and an isoelectric point of 10.06. The deduced amino acid sequence of CfQM contained a series of conserved functional motifs that belong to the QM family. Phylogenetic analysis revealed that CfQM was closely related to other mollusk QM proteins, and altogether they form a mollusk QM protein subfamily that displays evolutionary conservation from yeast to human. The tissue-specific expression and transcriptional regulation of CfQM were investigated by quantitative real-time PCR in response to bacterial (Vibrio anguillarum) and viral (acute viral necrobiotic virus) challenges. The transcript level of CfQM was high in all of the examined tissues in a constitutive manner. The highest and lowest expression levels of CfQM were measured in the hepatopancreas and hemocyte, respectively. Upon bacterial and viral challenges, the relative mRNA expression of CfQM sharply increased at 6 h post-infection (hpi) and then normalized at 48 hpi. These findings suggest that CfQM can respond to and protect against pathogen challenge. To the best of our knowledge, this

  8. Association between Age at Diagnosis of Graves' Disease and Variants in Genes Involved in Immune Response

    PubMed Central

    Jurecka-Lubieniecka, Beata; Ploski, Rafal; Kula, Dorota; Krol, Aleksandra; Bednarczuk, Tomasz; Kolosza, Zofia; Tukiendorf, Andrzej; Szpak-Ulczok, Sylwia; Stanjek-Cichoracka, Anita; Polanska, Joanna; Jarzab, Barbara


    Background Graves' disease (GD) is a complex disease in which genetic predisposition is modified by environmental factors. The aim of the study was to examine the association between genetic variants in genes encoding proteins involved in immune response and the age at diagnosis of GD. Methods 735 GD patients and 1216 healthy controls from Poland were included into the study. Eight genetic variants in the HLA-DRB1, TNF, CTLA4, CD40, NFKb, PTPN22, IL4 and IL10 genes were genotyped. Patients were stratified by the age at diagnosis of GD and the association with genotype was analysed. Results Polymorphism in the HLA-DRB1, TNF and CTLA4 genes were associated with GD. The carriers of the HLA DRB1*03 allele were more frequent in patients with age at GD diagnosis ≤30 years than in patients with older age at GD diagnosis. Conclusions HLADRB1*03 allele is associated with young age at diagnosis of Graves' disease in polish population. PMID:23544060

  9. Gene/cell therapy approaches for Immune Dysregulation Polyendocrinopathy Enteropathy X-linked syndrome.


    Passerini, Laura; Santoni de Sio, Francesca R; Porteus, Matthew H; Bacchetta, Rosa


    Immune dysregulation, Polyendocrinopathy, Enteropathy, X-linked (IPEX) syndrome is a rare autoimmune disease due to mutations in the gene encoding for Forkhead box P3 (FOXP3), a transcription factor fundamental for the function of thymus-derived (t) regulatory T (Treg) cells. The dysfunction of Treg cells results in the development of devastating autoimmune manifestations affecting multiple organs, eventually leading to premature death in infants, if not promptly treated by hematopoietic stem cell transplantation (HSCT). Novel gene therapy strategies can be developed for IPEX syndrome as more definitive cure than allogeneic HSCT. Here we describe the therapeutic approaches, alternative to HSCT, currently under development. We described that effector T cells can be converted in regulatory T cells by LV-mediated FOXP3-gene transfer in differentiated T lymphocytes. Despite FOXP3 mutations mainly affect a highly specific T cell subset, manipulation of stem cells could be required for long-term remission of the disease. Therefore, we believe that a more comprehensive strategy should aim at correcting FOXP3-mutated stem cells. Potentials and hurdles of both strategies will be highlighted here.

  10. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera.


    Mao, Wenfu; Schuler, Mary A; Berenbaum, May R


    As a managed pollinator, the honey bee Apis mellifera is critical to the American agricultural enterprise. Recent colony losses have thus raised concerns; possible explanations for bee decline include nutritional deficiencies and exposures to pesticides and pathogens. We determined that constituents found in honey, including p-coumaric acid, pinocembrin, and pinobanksin 5-methyl ether, specifically induce detoxification genes. These inducers are primarily found not in nectar but in pollen in the case of p-coumaric acid (a monomer of sporopollenin, the principal constituent of pollen cell walls) and propolis, a resinous material gathered and processed by bees to line wax cells. RNA-seq analysis (massively parallel RNA sequencing) revealed that p-coumaric acid specifically up-regulates all classes of detoxification genes as well as select antimicrobial peptide genes. This up-regulation has functional significance in that that adding p-coumaric acid to a diet of sucrose increases midgut metabolism of coumaphos, a widely used in-hive acaricide, by ∼60%. As a major component of pollen grains, p-coumaric acid is ubiquitous in the natural diet of honey bees and may function as a nutraceutical regulating immune and detoxification processes. The widespread apicultural use of honey substitutes, including high-fructose corn syrup, may thus compromise the ability of honey bees to cope with pesticides and pathogens and contribute to colony losses.

  11. Identification and isolation of stimulator of interferon genes (STING): an innate immune sensory and adaptor gene from camelids.


    Premraj, A; Aleyas, A G; Nautiyal, B; Rasool, T J


    The mechanism by which type I interferon-mediated antiviral response is mounted by hosts against invading pathogen is an intriguing one. Of late, an endoplasmic reticulum transmembrane protein encoded by a gene called stimulator of interferon genes (STING) is implicated in the innate signalling pathways and has been identified and cloned in few mammalian species including human, mouse and pig. In this article, we report the identification of STING from three different species of a highly conserved family of mammals - the camelids. cDNAs encoding the STING of Old World camels - dromedary camel (Camelus dromedarius) and bactrian camel (Camelus bactrianus) and a New World camel - llama (Llama glama) were amplified using conserved primers and RACE. The complete STING cDNA of dromedary camel is 2171 bp long with a 706-bp 5' untranslated regions (UTR), an 1137-bp open reading frame (ORF) and a 328-bp 3' UTR. Sequence and phylogenetic analysis of the ORF of STING from these three camelids indicate high level of similarity among camelids and conservation of critical amino acid residues across different species. Quantitative real-time PCR analysis revealed high levels of STING mRNA expression in blood, spleen, lymph node and lung. The identification of camelid STING will help in better understanding of the role of this molecule in the innate immunity of the camelids and other mammals.

  12. Venom of Parasitoid, Pteromalus puparum, Suppresses Host, Pieris rapae, Immune Promotion by Decreasing Host C-Type Lectin Gene Expression

    PubMed Central

    Fang, Qi; Wang, Fei; Gatehouse, John A.; Gatehouse, Angharad M. R.; Chen, Xue-xin; Hu, Cui; Ye, Gong-yin


    Background Insect hosts have evolved immunity against invasion by parasitoids, and in co-evolutionary response parasitoids have also developed strategies to overcome host immune systems. The mechanisms through which parasitoid venoms disrupt the promotion of host immunity are still unclear. We report here a new mechanism evolved by parasitoid Pteromalus puparum, whose venom inhibited the promotion of immunity in its host Pieris rapae (cabbage white butterfly). Methodology/Principal Findings A full-length cDNA encoding a C-type lectin (Pr-CTL) was isolated from P. rapae. Quantitative PCR and immunoblotting showed that injection of bacterial and inert beads induced expression of Pr-CTL, with peaks of mRNA and Pr-CTL protein levels at 4 and 8 h post beads challenge, respectively. In contrast, parasitoid venom suppressed Pr-CTL expression when co-injected with beads, in a time and dose-dependent manner. Immunolocalization and immunoblotting results showed that Pr-CTL was first detectable in vesicles present in cytoplasm of granulocytes in host hemolymph, and was then secreted from cells into circulatory fluid. Finally, the secreted Pr-CTL bound to cellular membranes of both granulocytes and plasmatocytes. Injection of double-stranded RNA specific for target gene decreased expression of Pr-CTL, and a few other host immune-related genes. Suppression of Pr-CTL expression also down-regulated antimicrobial and phenoloxidase activities, and reducing phagocytotic and encapsulation rates in host. The inhibitory effect of parasitoid venom on host encapsulation is consistent with its effect in suppressing Pr-CTL expression. Binding assay results showed that recombinant Pr-CTL directly attached to the surface of P. puparum egges. We infer that Pr-CTL may serve as an immune signalling co-effector, first binding to parasitoid eggs, regulating expression of a set of immune-related genes and promoting host immunity. Conclusions/Significance P. puparum venom inhibits promotion of host

  13. Immunization with the cysteine proteinase Ldccys1 gene from Leishmania (Leishmania) chagasi and the recombinant Ldccys1 protein elicits protective immune responses in a murine model of visceral leishmaniasis.


    Ferreira, Josie Haydée L; Gentil, Luciana Girotto; Dias, Suzana Souza; Fedeli, Carlos Eduardo C; Katz, Simone; Barbiéri, Clara Lúcia


    The gene Ldccys1 encoding a cysteine proteinase of 30 kDa from Leishmania (Leishmania) chagasi, as well as the recombinant cysteine proteinase rLdccys1, obtained by cloning and expression of the Ldccys1 gene in the pHIS vector, were used to evaluate their ability to induce immune protective responses in BALB/c mice against L. (L.) chagasi infection. Mice were immunized subcutaneously with rLdccys1 plus Bacille Calmette Guerin (BCG) or Propionibacterium acnes as adjuvants or intramuscularly with a plasmid carrying the Ldccys1 gene (Ldccys1/pcDNA3) and CpG ODN as the adjuvant, followed by a booster with rLdccys1 plus CpG ODN. Two weeks after immunization the animals were challenged with 1 x 10(7) amastigotes of L. (L.) chagasi. Both immunization protocols induced significant protection against L. (L.) chagasi infection as shown by a very low parasite load in the spleen of immunized mice compared to the non-immunized controls. However, DNA immunization was 10-fold more protective than immunization with the recombinant protein. Whereas rLdccys1 induced a significant secretion of IFN-gamma and nitric oxide (NO), animals immunized with the Ldccys1 gene increased the production of IgG2a antibodies, IFN-gamma and NO. These results indicated that protection triggered by the two immunization protocols was correlated to a predominant Th1 response.

  14. Burkholderia pseudomallei Differentially Regulates Host Innate Immune Response Genes for Intracellular Survival in Lung Epithelial Cells

    PubMed Central

    Vellasamy, Kumutha Malar; Mariappan, Vanitha; Shankar, Esaki M.; Vadivelu, Jamuna


    Background Burkholderia pseudomallei, the causative agent of melioidosis poses a serious threat to humankind. B. pseudomallei secretes numerous virulence proteins that alter host cell functions to escape from intracellular immune sensors. However, the events underlying disease pathogenesis are poorly understood. Methods We determined the ability of B. pseudomallei to invade and survive intracellularly in A549 human lung epithelial cells, and also investigated the early transcriptional responses using an Illumina HumanHT-12 v4 microarray platform, after three hours of exposure to live B. pseudomallei (BCMS) and its secreted proteins (CCMS). Results We found that the ability of B. pseudomallei to invade and survive intracellularly correlated with increase of multiplicity of infection and duration of contact. Activation of host carbohydrate metabolism and apoptosis as well as suppression of amino acid metabolism and innate immune responses both by live bacteria and its secreted proteins were evident. These early events might be linked to initial activation of host genes directed towards bacterial dissemination from lungs to target organs (via proposed in vivo mechanisms) or to escape potential sensing by macrophages. Conclusion Understanding the early responses of A549 cells toward B. pseudomallei infection provide preliminary insights into the likely pathogenesis mechanisms underlying melioidosis, and could contribute to development of novel intervention strategies to combat B. pseudomallei infections. PMID:27367858

  15. Therapeutic Response in Feline Sandhoff Disease Despite Immunity to Intracranial Gene Therapy

    PubMed Central

    Bradbury, Allison M; Cochran, J Nicholas; McCurdy, Victoria J; Johnson, Aime K; Brunson, Brandon L; Gray-Edwards, Heather; Leroy, Stanley G; Hwang, Misako; Randle, Ashley N; Jackson, Laura S; Morrison, Nancy E; Baek, Rena C; Seyfried, Thomas N; Cheng, Seng H; Cox, Nancy R; Baker, Henry J; Cachón-González, M Begona; Cox, Timothy M; Sena-Esteves, Miguel; Martin, Douglas R


    Salutary responses to adeno-associated viral (AAV) gene therapy have been reported in the mouse model of Sandhoff disease (SD), a neurodegenerative lysosomal storage disease caused by deficiency of β-N-acetylhexosaminidase (Hex). While untreated mice reach the humane endpoint by 4.1 months of age, mice treated by a single intracranial injection of vectors expressing human hexosaminidase may live a normal life span of 2 years. When treated with the same therapeutic vectors used in mice, two cats with SD lived to 7.0 and 8.2 months of age, compared with an untreated life span of 4.5 ± 0.5 months (n = 11). Because a pronounced humoral immune response to both the AAV1 vectors and human hexosaminidase was documented, feline cDNAs for the hexosaminidase α- and β-subunits were cloned into AAVrh8 vectors. Cats treated with vectors expressing feline hexosaminidase produced enzymatic activity >75-fold normal at the brain injection site with little evidence of an immune infiltrate. Affected cats treated with feline-specific vectors by bilateral injection of the thalamus lived to 10.4 ± 3.7 months of age (n = 3), or 2.3 times as long as untreated cats. These studies support the therapeutic potential of AAV vectors for SD and underscore the importance of species-specific cDNAs for translational research. PMID:23689599

  16. High-Throughput Sequence Analysis of Turbot (Scophthalmus maximus) Transcriptome Using 454-Pyrosequencing for the Discovery of Antiviral Immune Genes

    PubMed Central

    Pereiro, Patricia; Balseiro, Pablo; Romero, Alejandro; Dios, Sonia; Forn-Cuni, Gabriel; Fuste, Berta; Planas, Josep V.; Beltran, Sergi; Novoa, Beatriz; Figueras, Antonio


    Background Turbot (Scophthalmus maximus L.) is an important aquacultural resource both in Europe and Asia. However, there is little information on gene sequences available in public databases. Currently, one of the main problems affecting the culture of this flatfish is mortality due to several pathogens, especially viral diseases which are not treatable. In order to identify new genes involved in immune defense, we conducted 454-pyrosequencing of the turbot transcriptome after different immune stimulations. Methodology/Principal Findings Turbot were injected with viral stimuli to increase the expression level of immune-related genes. High-throughput deep sequencing using 454-pyrosequencing technology yielded 915,256 high-quality reads. These sequences were assembled into 55,404 contigs that were subjected to annotation steps. Intriguingly, 55.16% of the deduced protein was not significantly similar to any sequences in the databases used for the annotation and only 0.85% of the BLASTx top-hits matched S. maximus protein sequences. This relatively low level of annotation is possibly due to the limited information for this specie and other flatfish in the database. These results suggest the identification of a large number of new genes in turbot and in fish in general. A more detailed analysis showed the presence of putative members of several innate and specific immune pathways. Conclusions/Significance To our knowledge, this study is the first transcriptome analysis using 454-pyrosequencing for turbot. Previously, there were only 12,471 EST and less of 1,500 nucleotide sequences for S. maximus in NCBI database. Our results provide a rich source of data (55,404 contigs and 181,845 singletons) for discovering and identifying new genes, which will serve as a basis for microarray construction, gene expression characterization and for identification of genetic markers to be used in several applications. Immune stimulation in turbot was very effective, obtaining an

  17. Dietary sodium propionate affects mucosal immune parameters, growth and appetite related genes expression: Insights from zebrafish model.


    Hoseinifar, Seyed Hossein; Safari, Roghieh; Dadar, Maryam


    Propionate is a short-chain fatty acid (SCFA) that improves physiological and pathophysiological properties. However, there is limited information available about the effects of SCFAs on mucosal immune parameters as well as growth and appetite related genes expression. The aim of the present study was to evaluate the effect of sodium propionate (SP) intake on the mucosal immune parameters, growth and appetite related genes expression using zebrafish (Danio rerio) as model organism. Zebrafish fed control or diet supplemented with different levels (0.5, 1 and 2%) of SP for 8weeks. At the end of feeding trial, the expression of the key genes related to growth and appetite (GH, IGF1, MYSTN and Ghrl) was evaluated. Also, mucosal immune parameters (Total Ig, lysozyme and protease activity) were studied in skin mucus of zebrafish. The results showed that dietary administration of SP significantly (P<0.05) up-regulated the expression of GH, IGF1 and down-regulated MYSTN gene. Also, feeding zebrafish with SP supplemented diet significantly increased appetite related gene expression (P<0.05) with a more pronounced effect in higher inclusion levels. Compared with control group, the expression of appetite related gene (Ghrl) was remarkably (P<0.05) higher in SP fed zebrafish. Also, elevated mucosal immune parameters was observed in zebrafish fed SP supplemented diet. The present results revealed beneficial effects of dietary SP on mucosal immune response and growth and appetite related genes expression. These results also highlighted the potential use of SP as additive in human diets.

  18. Effect of Ipr1 on expression levels of immune genes related to macrophage anti-infection of mycobacterium tuberculosis

    PubMed Central

    Li, Na; Liu, Pengfei; Wang, Lianwen; Liu, Jingbo; Yuan, Xiao; Meng, Wei; Dong, Yan; Li, Boqing


    Background: Intracellular pathogen resistance 1 (Ipr1) has been found in macrophages and plays a pivotal role in fighting against Mycobacterium tuberculosis (Mtb) infection. This study is designed to evaluate the effect of Iprl on the expression of macrophage genes related to the anti-infection of Mtb. Design or methods: In the experimental and control groups, the macrophages were infected with Mycobacterium H37Ra, and then the related immune genes between two groups were detected using microarray assay. Real-time quantitative PCR was applied to detect the differences in the expression of three up-regulated genes detected by microarray assay and to verify the reliability of microarray assay. Results: The expression of Iprl up-regulated 11 genes related to macrophage anti-immunity involved TLRs signaling pathway including TLR2 and TLR4, Irak1, Traf7, Ifngr1 and Tnfrsfla. No significant difference was found in terms of the molecular expression involved in regulation of the adaptive immune response, such as IL-1 and IL-12. The results of real-time PCR were consistent with the findings of microarray assay. Conclusions: The expression of Iprl gene probably promotes macrophage activity and enhances the ability of macrophages to fight against Mtb infection. The underlying mechanism may be achieved by up-regulating the expression levels of innate immunity genes, especially TLR2/TLR4 and signal transduction molecules, which is determined using microarray assay. All these findings offer the basis for subsequent study of the mechanisms of Ipr1 gene in host innate immunity against Mtb infection. PMID:26064231

  19. Expression profiling analysis of immune-related genes in channel catfish (Ictalurus punctatus) skin mucus following Flavobacterium columnare challenge.


    Ren, Yichao; Zhao, Honggang; Su, Baofeng; Peatman, Eric; Li, Chao


    Fish are covered by a watery gel-mucus, mainly secreted by the goblet cells, serving as the physical and biochemical barrier between the external environment and the interior milieu, playing more important roles in fish that without scale. Despite the important roles of mucus in fish immunity, the knowledge of detailed molecular events happened during infection process is still limited. While most studies were focused on characterizing the protein and enzyme activities in the mucus following challenge, no studies have examined the gene expression profiles in fish mucus. In this regard, herein we carried out the first gene profiling analysis in catfish mucus using real-time PCR. Ten important immune-related genes were selected according to our previous studies. Their expression levels were examined in the early timepoints (namely, 1 h, 2 h, 4 h, 8 h, and 24 h) following Flavobacterium columnare challenge. Notably, expression levels of most of the selected genes were rapidly altered by the challenge. Seven genes were down-regulated, while only three genes were up-regulated. In addition, the gene expression patterns in mucus were very different from the mucosal surfaces (skin, gill and intestine) and the classical immune organs (liver, spleen and kidney). The unique expression patterns obtained here may be resulted from the great advantage of the large amount of attached bacteria in the mucus than the internal tissues, and resulted from the bacteria virulent actors to suppress the host immune response. Taken together, our results can expand our knowledge of fish mucosal immunity, and the un-lethal mucus sampling can provide early insight for developing the strategies for selection of disease resistant families and strains in catfish as well as other fish species.

  20. Control of immune ligands by members of a cytomegalovirus gene expansion suppresses natural killer cell activation

    PubMed Central

    Fielding, Ceri A; Weekes, Michael P; Nobre, Luis V; Ruckova, Eva; Wilkie, Gavin S; Paulo, Joao A; Chang, Chiwen; Suárez, Nicolás M; Davies, James A; Antrobus, Robin; Stanton, Richard J; Aicheler, Rebecca J; Nichols, Hester; Vojtesek, Borek; Trowsdale, John; Davison, Andrew J; Gygi, Steven P


    The human cytomegalovirus (HCMV) US12 family consists of ten sequentially arranged genes (US12-21) with poorly characterized function. We now identify novel natural killer (NK) cell evasion functions for four members: US12, US14, US18 and US20. Using a systematic multiplexed proteomics approach to quantify ~1300 cell surface and ~7200 whole cell proteins, we demonstrate that the US12 family selectively targets plasma membrane proteins and plays key roles in regulating NK ligands, adhesion molecules and cytokine receptors. US18 and US20 work in concert to suppress cell surface expression of the critical NKp30 ligand B7-H6 thus inhibiting NK cell activation. The US12 family is therefore identified as a major new hub of immune regulation. DOI: PMID:28186488

  1. How do plants achieve immunity? Defence without specialized immune cells.


    Spoel, Steven H; Dong, Xinnian


    Vertebrates have evolved a sophisticated adaptive immune system that relies on an almost infinite diversity of antigen receptors that are clonally expressed by specialized immune cells that roam the circulatory system. These immune cells provide vertebrates with extraordinary antigen-specific immune capacity and memory, while minimizing self-reactivity. Plants, however, lack specialized mobile immune cells. Instead, every plant cell is thought to be capable of launching an effective immune response. So how do plants achieve specific, self-tolerant immunity and establish immune memory? Recent developments point towards a multilayered plant innate immune system comprised of self-surveillance, systemic signalling and chromosomal changes that together establish effective immunity.

  2. Finding immune gene expression differences induced by marine bacterial pathogens in the deep-sea hydrothermal vent mussel Bathymodiolus azoricus

    NASA Astrophysics Data System (ADS)

    Martins, E.; Queiroz, A.; Serrão Santos, R.; Bettencourt, R.


    The deep-sea hydrothermal vent mussel Bathymodiolus azoricus lives in a natural environment characterized by extreme conditions of hydrostatic pressure, temperature, pH, high concentrations of heavy metals, methane and hydrogen sulphide. The deep-sea vent biological systems represent thus the opportunity to study and provide new insights into the basic physiological principles that govern the defense mechanisms in vent animals and to understand how they cope with microbial infections. Hence, the importance of understanding this animal's innate defense mechanisms, by examining its differential immune gene expressions toward different pathogenic agents. In the present study, B. azoricus mussels were infected with single suspensions of marine bacterial pathogens, consisting of Vibrio splendidus, Vibrio alginolyticus, or Vibrio anguillarum, and a pool of these Vibrio strains. Flavobacterium suspensions were also used as an irrelevant bacterium. Gene expression analyses were carried out using gill samples from animals dissected at 12 h and 24 h post-infection times by means of quantitative-Polymerase Chain Reaction aimed at targeting several immune genes. We also performed SDS-PAGE protein analyses from the same gill tissues. We concluded that there are different levels of immune gene expression between the 12 h and 24 h exposure times to various bacterial suspensions. Our results from qPCR demonstrated a general pattern of gene expression, decreasing from 12 h over 24 h post-infection. Among the bacteria tested, Flavobacterium is the microorganism species inducing the highest gene expression level in 12 h post-infections animals. The 24 h infected animals revealed, however, greater gene expression levels, using V. splendidus as the infectious agent. The SDS-PAGE analysis also pointed at protein profile differences between 12 h and 24 h, particularly around a protein area, of 18 KDa molecular mass, where most dissimilarities were found. Multivariate analyses

  3. Finding immune gene expression differences induced by marine bacterial pathogens in the Deep-sea hydrothermal vent mussel Bathymodiolus azoricus

    NASA Astrophysics Data System (ADS)

    Martins, E.; Queiroz, A.; Serrão Santos, R.; Bettencourt, R.


    The deep-sea hydrothermal vent mussel Bathymodiolus azoricus lives in a natural environment characterised by extreme conditions of hydrostatic pressure, temperature, pH, high concentrations of heavy metals, methane and hydrogen sulphide. The deep-sea vent biological systems represent thus the opportunity to study and provide new insights into the basic physiological principles that govern the defense mechanisms in vent animals and to understand how they cope with microbial infections. Hence, the importance of understanding this animal's innate defense mechanisms, by examining its differential immune gene expressions toward different pathogenic agents. In the present study, B. azoricus mussels were infected with single suspensions of marine bacterial pathogens, consisting of Vibrio splendidus, Vibrio alginolyticus, or Vibrio anguillarum, and a pool of these Vibrio bacteria. Flavobacterium suspensions were also used as a non-pathogenic bacterium. Gene expression analyses were carried out using gill samples from infected animals by means of quantitative-Polymerase Chain Reaction aimed at targeting several immune genes. We also performed SDS-PAGE protein analyses from the same gill tissues. We concluded that there are different levels of immune gene expression between the 12 h to 24 h exposure times to various bacterial suspensions. Our results from qPCR demonstrated a general pattern of gene expression, decreasing from 12 h over 24 h post-infection. Among the bacteria tested, Flavobacterium is the bacterium inducing the highest gene expression level in 12 h post-infections animals. The 24 h infected animals revealed, however, greater gene expression levels, using V. splendidus as the infectious agent. The SDS-PAGE analysis also pointed at protein profile differences between 12 h and 24 h, particularly evident for proteins of 18-20 KDa molecular mass, where most dissimilarity was found. Multivariate analyses demonstrated that immune genes, as well as experimental

  4. Expression Analysis of Immune Related Genes Identified from the Coelomocytes of Sea Cucumber (Apostichopus japonicus) in Response to LPS Challenge

    PubMed Central

    Dong, Ying; Sun, Hongjuan; Zhou, Zunchun; Yang, Aifu; Chen, Zhong; Guan, Xiaoyan; Gao, Shan; Wang, Bai; Jiang, Bei; Jiang, Jingwei


    The sea cucumber (Apostichopus japonicus) occupies a basal position during the evolution of deuterostomes and is also an important aquaculture species. In order to identify more immune effectors, transcriptome sequencing of A. japonicus coelomocytes in response to lipopolysaccharide (LPS) challenge was performed using the Illumina HiSeq™ 2000 platform. One hundred and seven differentially expressed genes were selected and divided into four functional categories including pathogen recognition (25 genes), reorganization of cytoskeleton (27 genes), inflammation (41 genes) and apoptosis (14 genes). They were analyzed to elucidate the mechanisms of host-pathogen interactions and downstream signaling transduction. Quantitative real-time polymerase chain reactions (qRT-PCRs) of 10 representative genes validated the accuracy and reliability of RNA sequencing results with the correlation coefficients from 0.88 to 0.98 and p-value <0.05. Expression analysis of immune-related genes after LPS challenge will be useful in understanding the immune response mechanisms of A. japonicus against pathogen invasion and developing strategies for resistant markers selection. PMID:25421239

  5. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.


    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  6. Gene Therapy for Mucopolysaccharidosis Type VI Is Effective in Cats Without Pre-Existing Immunity to AAV8

    PubMed Central

    Ferla, Rita; O'Malley, Thomas; Calcedo, Roberto; O'Donnell, Patricia; Wang, Ping; Cotugno, Gabriella; Claudiani, Pamela; Wilson, James M.; Haskins, Mark


    Abstract Liver gene transfer with adeno-associated viral (AAV) 2/8 vectors is being considered for therapy of systemic diseases like mucopolysaccharidosis type VI (MPS VI), a lysosomal storage disease due to deficiency of arylsulfatase B (ARSB). We have previously reported that liver gene transfer with AAV2/8 results in sustained yet variable expression of ARSB. We hypothesized that the variability we observed could be due to pre-existing immunity to wild-type AAV8. To test this, we compared the levels of AAV2/8-mediated transduction in MPS VI cats with and without pre-existing immunity to AAV8. In addition, since levels of lysosomal enzymes as low as 5% of normal are expected to be therapeutic, we evaluated the impact of pre-existing immunity on MPS VI phenotypic rescue. AAV2/8 administration to MPS VI cats without pre-existing neutralizing antibodies to AAV8 resulted in consistent and dose-dependent expression of ARSB, urinary glycosaminoglycan (GAG) reduction, and femur length amelioration. Conversely, animals with pre-existing immunity to AAV8 showed low levels of ARSB expression and limited phenotypic improvement. Our data support the use of AAV2/8-mediated gene transfer for MPS VI and other systemic diseases, and highlight that pre-existing immunity to AAV8 should be considered in determining subject eligibility for therapy. PMID:23194248

  7. A mimotope gene encoding the major IgE epitope of allergen Phl p 5 for epitope-specific immunization.


    Wallmann, J; Proell, M; Stepanoska, T; Hantusch, B; Pali-Schöll, I; Thalhamer, T; Thalhamer, J; Jensen-Jarolim, E; Hartl, A


    A gene vaccine based on a mammalian expression vector containing the sequence of a peptide mimotope of Phl p 5 was constructed. To test whether mimotope gene vaccines can induce allergen-specific antibody responses via molecular mimicry, BALB/c mice were immunized using the mimotope construct with or without a tetanus toxin T-helper epitope. Moreover, intradermal injection was compared to epidermal application via gene gun immunization. Immunization with both mimotope gene constructs elicited allergen-specific antibody responses. As expected, gene gun bombardment induced a Th2-biased immune response, typically associated with IgG1 and IgE antibody production. In contrast, intradermal injection of the vaccine triggered IgG2a antibody expression without any detectable IgE levels, thus biasing the immune response towards Th1. In an RBL assay, mimotope-specific IgG antibodies were able to prevent cross-linking of allergen-specific IgE by Phl p 5. A construct coding for the complete Phl p 5 induced T-cell activation, IFN-gamma and IL-4 production. In contrast, the mimotope-DNA construct being devoid of allergen-specific T-cell epitopes had no capacity to activate allergen-specific T cells. Taken together, our data show that it is feasible to induce blocking IgG antibodies with a mimotope-DNA construct when applied intradermally. Thus the mimotope-DNA strategy has two advantages: (1) the avoidance of IgE induction and (2) the avoidance of triggering allergen-specific T-lymphocytes. We therefore suggest that mimotope gene vaccines are potential candidates for epitope-specific immunotherapy of type I allergy.

  8. Surveillance of Autism.

    ERIC Educational Resources Information Center

    Boyle, Coleen A.; Bertrand, Jacquelyn; Yeargin-Allsopp, Marshalyn


    This article describes the autism surveillance activities of the Center for Disease Control and Prevention. It considers why surveillance to track prevalence of autistic disorders is needed, how such surveillance is conducted, and the special challenges of autism surveillance. (DB)

  9. National Department of Defense Surveillance for Clinical Group A Streptococcal Isolates, Antibiotic Resistance, and emm Gene Types from 8 Basic Training Military Sites

    DTIC Science & Technology


    is one of these important virulence factors, offering GAS several mechanisms of defense against the human immune system, most notably the ability to...statistically significant association with erythromycin resistance. This study was not able to assess the mechanism of resistance for these isolates, but other...studies have suggested the presence of efflux mechanisms and resistance genes [34, 35]. Though there was high prevalence of erythromycin resistance

  10. Immune response and survival of Circulifer haematoceps to Spiroplasma citri infection requires expression of the gene hexamerin.


    Eliautout, Rémi; Dubrana, Marie-Pierre; Vincent-Monégat, Carole; Vallier, Agnès; Braquart-Varnier, Christine; Poirié, Marylène; Saillard, Colette; Heddi, Abdelaziz; Arricau-Bouvery, Nathalie


    Spiroplasma citri is a cell wall-less bacterium that infects plants. It is transmitted by the leafhopper Circulifer haematoceps, which hosts this bacterium in the haemocel and insect tissues. Bacterial factors involved in spiroplasma colonization of the insect host have been identified, but the immune response of the leafhopper to S. citri infection remains unknown. In this study, we showed that C. haematoceps activates both humoral and cellular immune responses when challenged with bacteria. When infected by S. citri, C. haematoceps displayed a specific immune response, evidenced by activation of phagocytosis and upregulation of a gene encoding the protein hexamerin. S. citri infection also resulted in decreased phenoloxidase-like activity. Inhibition of hexamerin by RNA interference resulted in a significant reduction in phenoloxidase-like activity and increased mortality of infected leafhoppers. Therefore, the gene hexamerin is involved in S. citri control by interfering with insect phenoloxidase activity.

  11. Interferon-related and other immune genes are downregulated in peripheral blood leukocytes in the luteal phase of the menstrual cycle.


    Dosiou, Chrysoula; Lathi, Ruth B; Tulac, Suzana; Huang, S-T Joseph; Giudice, Linda C


    Interaction between the endocrine and the immune systems has been suggested by observations of sexual dimorphism of the immune response, differential susceptibility to autoimmunity between the sexes, changes in autoimmune disease activity during the menstrual cycle and in pregnancy and in vitro studies of hormonal influence on cytokine production.We hypothesized that if there is hormonal regulation of the immune response, this would be manifest in peripheral blood leukocytes (PBLs) at different phases of the menstrual cycle. In this study, we describe gene profiling of PBLs from the follicular and luteal phases of the menstrual cycle. We observe important differences in immune gene expression, with significant down-regulation of the Th1 immune response in the luteal phase. A significant number of interferon (IFN)-related genes are amongst the downregulated genes. These results support significant hormonal regulation of the immune system and may have therapeutic implications in diseases of autoimmunity in women.

  12. Alpha1-antitrypsin gene therapy modulates cellular immunity and efficiently prevents type 1 diabetes in nonobese diabetic mice.


    Lu, Yuanqing; Tang, Mei; Wasserfall, Clive; Kou, Zhongchen; Campbell-Thompson, Martha; Gardemann, Thomas; Crawford, James; Atkinson, Mark; Song, Sihong


    An imbalance of the immune-regulatory pathways plays an important role in the development of type 1 diabetes. Therefore, immunoregulatory and antiinflammatory strategies hold great potential for the prevention of this autoimmune disease. Studies have demonstrated that two serine proteinase inhibitors, alpha1-antitrypsin (AAT) and elafin, act as potent antiinflammatory agents. In the present study, we sought to develop an efficient gene therapy approach to prevent type 1 diabetes. Cohorts of 4-week-old female nonobese diabetic (NOD) mice were injected intramuscularly with rAAV1-CB-hAAT, rAAV1-CB-hElafin, or saline. AAV1 vector mediated sustained high levels of transgene expression, sufficient to overcome a humoral immune response against hAAT. AAT gene therapy, contrary to elafin and saline, was remarkably effective in preventing type 1 diabetes. T cell receptor spectratyping indicated that AAT gene therapy altered T cell repertoire diversity in splenocytes from NOD mice. Adoptive transfer experiments demonstrated that AAT gene therapy attenuated cellular immunity associated with beta cell destruction. This study demonstrates that AAT gene therapy attenuates cell-mediated autoimmunity, alters the T cell receptor repertoire, and efficiently prevents type 1 diabetes in the NOD mouse model. These results strongly suggest that rAAV1-mediated AAT gene therapy may be useful as a novel approach to prevent type 1 diabetes.

  13. Identification of Immunity-Related Genes in Dialeurodes citri against Entomopathogenic Fungus Lecanicillium attenuatum by RNA-Seq Analysis

    PubMed Central

    Yu, Shijiang; Ding, Lili; Luo, Ren; Li, Xiaojiao; Yang, Juan; Liu, Haoqiang; Cong, Lin; Ran, Chun


    Dialeurodes citri is a major pest in citrus producing areas, and large-scale outbreaks have occurred increasingly often in recent years. Lecanicillium attenuatum is an important entomopathogenic fungus that can parasitize and kill D. citri. We separated the fungus from corpses of D. citri larvae. However, the sound immune defense system of pests makes infection by an entomopathogenic fungus difficult. Here we used RNA sequencing technology (RNA-Seq) to build a transcriptome database for D. citri and performed digital gene expression profiling to screen genes that act in the immune defense of D. citri larvae infected with a pathogenic fungus. De novo assembly generated 84,733 unigenes with mean length of 772 nt. All unigenes were searched against GO, Nr, Swiss-Prot, COG, and KEGG databases and a total of 28,190 (33.3%) unigenes were annotated. We identified 129 immunity-related unigenes in transcriptome database that were related to pattern recognition receptors, information transduction factors and response factors. From the digital gene expression profile, we identified 441 unigenes that were differentially expressed in D. citri infected with L. attenuatum. Through calculated Log2Ratio values, we identified genes for which fold changes in expression were obvious, including cuticle protein, vitellogenin, cathepsin, prophenoloxidase, clip-domain serine protease, lysozyme, and others. Subsequent quantitative real-time polymerase chain reaction analysis verified the results. The identified genes may serve as target genes for microbial control of D. citri. PMID:27644092

  14. Mutational Analysis of the sbo-alb Locus of Bacillus subtilis: Identification of Genes Required for Subtilosin Production and Immunity

    PubMed Central

    Zheng, Guolu; Hehn, Robin; Zuber, Peter


    The Bacillus subtilis 168 derivative JH642 produces a bacteriocin, subtilosin, which possesses activity against Listeria monocytogenes. Inspection of the amino acid sequence of the presubtilosin polypeptide encoded by the gene sboA and sequence data from analysis of mature subtilosin indicate that the precursor subtilosin peptide undergoes several unique and unusual chemical modifications during its maturation process. The genes of the sbo-alb operon are believed to function in the synthesis and maturation of subtilosin. Nonpolar mutations introduced into each of the alb genes resulted in loss or reduction of subtilosin production. sboA, albA, and albF mutants showed no antilisterial activity, indicating that the products of these genes are critical for the production of active subtilosin. Mutations in albB, -C, and -D resulted in reduction of antilisterial activity and decreased immunity to subtilosin, particularly under anaerobic conditions. A new gene, sboX, encoding another bacteriocin-like product was discovered residing in a sequence overlapping the coding region of sboA. Construction of an sboX-lacZ translational fusion and analysis of its expression indicate that sboX is induced in stationary phase of anaerobic cultures of JH642. An in-frame deletion of the sboX coding sequence did not affect the antilisterial activity or production of or immunity to subtilosin. The results of this investigation show that the sbo-alb genes are required for the mechanisms of subtilosin synthesis and immunity. PMID:10809709

  15. The expression of an immune-related phenoloxidase gene is modulated in Ciona intestinalis ovary, test cells, embryos and larva.


    Parrinello, Daniela; Sanfratello, Maria A; Vizzini, Aiti; Cammarata, Matteo


    Two distinct Ciona intestinalis phenoloxidases (CinPO1, 2) had previously been cloned and sequenced. The CinPO2 is involved in innate immunity and is expressed by inflammatory hemocytes that populate the tunic and pharynx vessels as a response to LPS inoculation. In situ hybridization and immunohistochemistry assays on histological section, showed that the expression of this gene and the produced protein are shared with oogenesis, embryogenesis and larval morphogenesis. Intriguingly, upregulation of gene transcription was found in the test cell layer that envelopes the ovary follicle, ovulated egg, and gastrula, as well as it was modulated in the zygotic nucleus of outer balstomers of 32-cell embryo, neurula presumptive epidermis tissue and larval mesenchyme. The anti-CinPO2 antibodies, specific for adult inflammatory cells, recognize epitopes in the cytoplasm of ovarian oocytes, ovulated eggs, development stages and larval mesenchyme. The overall findings disclose the precocious activation of the CinPO2 immunity-related gene, and show a developmentally programmed expression of this phenoloxidase. Furthermore, these findings support the multifunctional roles of immunity-related genes and allows us to explore new perspectives on ascidian development and immunity.

  16. A dystrophic muscle broadens the contribution and activation of immune cells reacting to rAAV gene transfer.


    Ferrand, M; Galy, A; Boisgerault, F


    Recombinant adeno-associated viral vectors (rAAVs) are used for therapeutic gene transfer in skeletal muscle, but it is unclear if immune reactivity to gene transfer and persistence of transgene are affected by pathologic conditions such as muscular dystrophy. Thus, we compared dystrophic mice devoid of α-sarcoglycan with healthy mice to characterize immune cell activation and cellular populations contributing to the loss of gene-modified myofibers. Following rAAV2/1 delivery of an immunogenic α-sarcoglycan reporter transgene in the muscle, both strains developed strong CD4 and CD8 T-cell-mediated immune responses in lymphoid organs associated with muscle CD3+ T and CD11b+ mononuclear cell infiltrates. Selective cell subset depletion models revealed that CD4+ T cells were essential for transgene rejection in both healthy and pathologic mice, but macrophages and CD8+ T cells additionally contributed as effector cells of transgene rejection only in dystrophic mice. Vectors restricting transgene expression in antigen-presenting cells showed that endogenous presentation of transgene products was the sole mechanism responsible for T-cell priming in normal mice, whereas additional and protracted antigenic presentation occurred in dystrophic animals, leading to secondary CD4+ T-cell activation and failure to maintain transgene expression. Therefore, the dystrophic environment diversifies cellular immune response mechanisms induced by gene transfer, with a negative outcome.

  17. Zebra Fish Lacking Adaptive Immunity Acquire an Antiviral Alert State Characterized by Upregulated Gene Expression of Apoptosis, Multigene Families, and Interferon-Related Genes

    PubMed Central

    García-Valtanen, Pablo; Martínez-López, Alicia; López-Muñoz, Azucena; Bello-Perez, Melissa; Medina-Gali, Regla M.; Ortega-Villaizán, María del Mar; Varela, Monica; Figueras, Antonio; Mulero, Víctoriano; Novoa, Beatriz; Estepa, Amparo; Coll, Julio


    To investigate fish innate immunity, we have conducted organ and cell immune-related transcriptomic as well as immunohistologic analysis in mutant zebra fish (Danio rerio) lacking adaptive immunity (rag1−/−) at different developmental stages (egg, larvae, and adult), before and after infection with spring viremia carp virus (SVCV). The results revealed that, compared to immunocompetent zebra fish (rag1+/+), rag1−/− acquired increased resistance to SVCV with age, correlating with elevated transcript levels of immune genes in skin/fins and lymphoid organs (head kidney and spleen). Gene sets corresponding to apoptotic functions, immune-related multigene families, and interferon-related genes were constitutively upregulated in uninfected adult rag1−/− zebra fish. Overexpression of activated CASPASE-3 in different tissues before and after infection with SVCV further confirmed increased apoptotic function in rag1−/− zebra fish. Concurrently, staining of different tissue samples with a pan-leukocyte antibody marker showed abundant leukocyte infiltrations in SVCV-infected rag1−/− fish, coinciding with increased transcript expression of genes related to NK-cells and macrophages, suggesting that these genes played a key role in the enhanced immune response of rag1−/− zebra fish to SVCV lethal infection. Overall, we present evidence that indicates that rag1−/− zebra fish acquire an antiviral alert state while they reach adulthood in the absence of adaptive immunity. This antiviral state was characterized by (i) a more rapid response to viral infection, which resulted in increased survival, (ii) the involvement of NK-cell- and macrophage-mediated transcript responses rather than B- and/or T-cell dependent cells, and (iii) enhanced apoptosis, described here for the first time, as well as the similar modulation of multigene family/interferon-related genes previously associated to fish that survived lethal viral infections. From this and other studies

  18. Overwintering Is Associated with Reduced Expression of Immune Genes and Higher Susceptibility to Virus Infection in Honey Bees

    PubMed Central

    Steinmann, Nadja; Corona, Miguel; Neumann, Peter; Dainat, Benjamin


    The eusocial honey bee, Apis mellifera, has evolved remarkable abilities to survive extreme seasonal differences in temperature and availability of resources by dividing the worker caste into two groups that differ in physiology and lifespan: summer and winter bees. Most of the recent major losses of managed honey bee colonies occur during the winter, suggesting that winter bees may have compromised immune function and higher susceptibility to diseases. We tested this hypothesis by comparing the expression of eight immune genes and naturally occurring infection levels of deformed wing virus (DWV), one of the most widespread viruses in A. mellifera populations, between summer and winter bees. Possible interactions between immune response and physiological activity were tested by measuring the expression of vitellogenin and methyl farnesoate epoxidase, a gene coding for the last enzyme involved in juvenile hormone biosynthesis. Our data show that high DWV loads in winter bees correlate with reduced expression of genes involved in the cellular immune response and physiological activity and high expression of humoral immune genes involved in antibacterial defense compared with summer bees. This expression pattern could reflect evolutionary adaptations to resist bacterial pathogens and economize energy during the winter under a pathogen landscape with reduced risk of pathogenic viral infections. The outbreak of Varroa destructor infestation could have overcome these adaptations by promoting the transmission of viruses. Our results suggest that reduced cellular immune function during the winter may have increased honey bee’s susceptibility to DWV. These results contribute to our understanding of honey bee colony losses in temperate regions. PMID:26121358

  19. Immune responsive gene 1, a novel oncogene, increases the growth and tumorigenicity of glioma.


    Pan, Jun; Zhao, Xiaoyong; Lin, Chunnan; Xu, Hongchao; Yin, Zhilin; Liu, Tianzhu; Zhang, Shizhong


    Immune responsive gene 1 (IRG1) is highly expressed in mammalian macrophages during inflammation. However, the role of IRG1 in tumorigenesis remains unclear. In the present study, we aimed to clarify the epigenetic regulation and biological functions of IRG1 in glioma. We found that the expression level of IRG1 influenced the WHO stage in 140 glioma patients. Overexpression of IRG1 increased the growth, invasion, and tumorigenesis in U251 and SHG-44 glioma cells both in vitro and in vivo. Suppression of IRG1 expression by si-IRG1 decreased the levels of cell cycle regulatory proteins, namely, E2F1, p21, CDK4, CDK6 and cyclin D1. Knockdown of IRG1 expression by RNA interference increased E-cadherin expression and decreased the amounts of snail and vimentin. Furthermore, the suppression of IRG1 expression inhibited the expression of NF-κB and STAT3, suggesting a role of IRG1 in regulating the genes associated with these factors and thereby contributing to a decrease in glioma cell proliferation, migration and invasion. Collectively, our findings revealed that IRG1 is a candidate oncogene that is amplified in glioma and is involved in novel mechanisms that influence glioma pathogenesis.

  20. Diversity and evolutionary patterns of immune genes in free-ranging Namibian leopards (Panthera pardus pardus).


    Castro-Prieto, Aines; Wachter, Bettina; Melzheimer, Joerg; Thalwitzer, Susanne; Sommer, Simone


    The genes of the major histocompatibility complex (MHC) are a key component of the mammalian immune system and have become important molecular markers for fitness-related genetic variation in wildlife populations. Currently, no information about the MHC sequence variation and constitution in African leopards exists. In this study, we isolated and characterized genetic variation at the adaptively most important region of MHC class I and MHC class II-DRB genes in 25 free-ranging African leopards from Namibia and investigated the mechanisms that generate and maintain MHC polymorphism in the species. Using single-stranded conformation polymorphism analysis and direct sequencing, we detected 6 MHC class I and 6 MHC class II-DRB sequences, which likely correspond to at least 3 MHC class I and 3 MHC class II-DRB loci. Amino acid sequence variation in both MHC classes was higher or similar in comparison to other reported felids. We found signatures of positive selection shaping the diversity of MHC class I and MHC class II-DRB loci during the evolutionary history of the species. A comparison of MHC class I and MHC class II-DRB sequences of the leopard to those of other felids revealed a trans-species mode of evolution. In addition, the evolutionary relationships of MHC class II-DRB sequences between African and Asian leopard subspecies are discussed.

  1. Caste-Specific Expression Patterns of Immune Response and Chemosensory Related Genes in the Leaf-Cutting Ant, Atta vollenweideri

    PubMed Central

    Koch, Sarah I.; Groh, Katrin; Vogel, Heiko; Hannson, Bill S.; Kleineidam, Christoph J.; Grosse-Wilde, Ewald


    Leaf-cutting ants are evolutionary derived social insects with elaborated division of labor and tremendous colony sizes with millions of workers. Their social organization is mainly based on olfactory communication using different pheromones and is promoted by a pronounced size-polymorphism of workers that perform different tasks within the colony. The size polymorphism and associated behaviors are correlated to distinct antennal lobe (AL) phenotypes. Two worker phenotypes differ in number of olfactory glomeruli in the AL and the presence or absence of an extremely large glomerulus (macroglomerulus), involved in trail-pheromone reception. The males' AL contains three macroglomeruli which are presumably involved in detection of sex-pheromone components. We investigated the antennal transcriptome data of all major castes (males, queens and workers) and two worker subcastes (large and tiny workers). In order to identify putative odorant receptor genes involved in pheromone detection, we identified differentially expressed odorant receptor genes (OR-genes) using custom microarrays. In total, we found 185 OR-gene fragments that are clearly related to ORs and we identified orthologs for 70 OR-genes. Among them one OR-gene differs in relative expression between the two worker subcastes by a factor of >3 and thus is a very promising candidate gene for the trail-pheromone receptor. Using the relative expression of OR-genes in males versus queens, we identified 2 candidates for sex-pheromone receptor genes in males. In addition, we identified genes from all other chemosensory related gene families (13 chemosensory protein genes, 8 odorant binding protein genes, 2 sensory-neuron membrane protein genes, 7 ionotropic receptor genes, 2 gustatory receptor genes), and we found ant-specific expansions in the chemosensory protein gene family. In addition, a large number of genes involved in immune defense exhibited differential expression across the three different castes, and some

  2. Gene expression profiling by mRNA sequencing reveals increased expression of immune/inflammation-related genes in the hippocampus of individuals with schizophrenia.


    Hwang, Y; Kim, J; Shin, J Y; Kim, J Ii; Seo, J S; Webster, M J; Lee, D; Kim, S


    Whole-genome expression profiling in postmortem brain tissue has recently provided insight into the pathophysiology of schizophrenia. Previous microarray and RNA-Seq studies identified several biological processes including synaptic function, mitochondrial function and immune/inflammation response as altered in the cortex of subjects with schizophrenia. Now using RNA-Seq data from the hippocampus, we have identified 144 differentially expressed genes in schizophrenia cases as compared with unaffected controls. Immune/inflammation response was the main biological process over-represented in these genes. The upregulation of several of these genes, IFITM1, IFITM2, IFITM3, APOL1 (Apolipoprotein L1), ADORA2A (adenosine receptor 2A), IGFBP4 and CD163 were validated in the schizophrenia subjects using data from the SNCID database and with quantitative RT-PCR. We identified a co-expression module associated with schizophrenia that includes the majority of differentially expressed genes related to immune/inflammation response as well as with the density of parvalbumin-containing neurons in the hippocampus. The results indicate that abnormal immune/inflammation response in the hippocampus may underlie the pathophysiology of schizophrenia and may be associated with abnormalities in the parvalbumin-containing neurons that lead to the cognitive deficits of the disease.

  3. Transcription profiling of immune genes during parasite infection in susceptible and resistant strains of the flour beetles (Tribolium castaneum).


    Zhong, Daibin; Wang, Mei-Hui; Pai, Aditi; Yan, Guiyun


    The flour beetle, Tribolium castaneum, is an intermediate host for the tapeworm Hymenolepis diminuta and has become an important genetic model to explore immune responses to parasite infection in insect hosts. The present study examined the immune responses to tapeworm infection in resistant (TIW1) and susceptible (cSM) strains of the red flour beetle, T. castaneum, using real-time quantitative reverse transcription PCR on 29 immunity-related genes that exhibit antimicrobial properties. Thirteen of the 29 genes showed constitutive differences in expression between the two strains. Fourteen to fifteen of the 29 genes exhibited significant differences in transcription levels when beetles were challenged with tapeworm parasite in the resistant and susceptible strains. Nine genes (GNBP3, cSPH2, lysozyme4, defensin1, PGRP-SA, defensin2, coleoptericin1, attacin2 and serpin29) in cSM and 13 genes (lysozyme2, proPO1, GNBP3, cSPH2, lysozyme4, defensin1, PGRP-SA, defensin2, coleoptericin1, attacin2, proPO2/3, PGRP-LE and PGRP-SB) in TIW1 were up-regulated by infections or showed parasite infection-induced expression. Seven genes (attacin2, coleoptericin1, defensin1, defensin2, lysozyme2, PGRP-SA and PGRP-SB) were more than 10 folds higher in the resistant TIW1 strain than in the susceptible cSM strain after exposure to tapeworm parasites. This study demonstrated the effects of genetic background, the transcription profile to parasite infection, and identified the immunity-related genes that were significantly regulated by the infection of tapeworms in Tribolium beetles.

  4. Increased stocking density causes changes in expression of selected stress- and immune-related genes, humoral innate immune parameters and stress responses of rainbow trout (Oncorhynchus mykiss).


    Yarahmadi, Peyman; Miandare, Hamed Kolangi; Fayaz, Sahel; Caipang, Christopher Marlowe A


    The present study investigated the effects of various stocking densities on the health status (stress and immune responses) of rainbow trout (Onchorhynchus mykiss). Juvenile rainbow trout were acclimated, placed in circular tanks under stocking densities of 10, 40 and 80 kg m(-3) and reared for 30 days. The relative expression of genes involved in stress and immunity such as HSP70, LyzII, TNF-1α, IL-1β, IL-8 and IFN-γ1 in the head kidney was determined. Serum cortisol, ACTH, total antioxidant capacity, osmolality and lactate were measured after 30 days of culture at different stocking densities (D1:10 kg m(-3), D2: 40 kg m(-3) and D3: 80 kg m(-3)) as indices of stress responses. In addition, the effects of stocking densities on serum complement, bactericidal activity, agglutinating antibody titers, serum IgM, anti-protease activity, serum total protein and alkaline phosphatase of the fish were measured. HSP70 gene expression was significantly density-dependent upregulated in D2 and D3 densities compared to D1 (P < 0.05). Also, there was significant downregulation in expression of LyzII, TNF-1α, IL-1β, IL-8 and IFN-γ1 in fish reared at density of either D2 or D3 (P < 0.05). In terms of stress responses, serum ACTH, cortisol and lactate level showed significant density-dependent increase (P < 0.05) while serum osmolality and total antioxidant capacity showed significant decline (P < 0.05) in fish reared at higher densities (D2 and D3) compared to fish reared at lower density (D1) (P < 0.05). Concordant with the expression of the immune-related genes, the serum complement and bactericidal activity as well as specific antibody titer against Aeromonas hydrophila, IgM and anti-protease activity decreased along with elevation of stocking density from D1 to D3 (P < 0.05). However, different stocking densities had no significant effect on serum total protein level and alkaline phosphatase activity. These results suggested that elevation of stocking

  5. The importance of immune gene variability (MHC) in evolutionary ecology and conservation

    PubMed Central

    Sommer, Simone


    Genetic studies have typically inferred the effects of human impact by documenting patterns of genetic differentiation and levels of genetic diversity among potentially isolated populations using selective neutral markers such as mitochondrial control region sequences, microsatellites or single nucleotide polymorphism (SNPs). However, evolutionary relevant and adaptive processes within and between populations can only be reflected by coding genes. In vertebrates, growing evidence suggests that genetic diversity is particularly important at the level of the major histocompatibility complex (MHC). MHC variants influence many important biological traits, including immune recognition, susceptibility to infectious and autoimmune diseases, individual odours, mating preferences, kin recognition, cooperation and pregnancy outcome. These diverse functions and characteristics place genes of the MHC among the best candidates for studies of mechanisms and significance of molecular adaptation in vertebrates. MHC variability is believed to be maintained by pathogen-driven selection, mediated either through heterozygote advantage or frequency-dependent selection. Up to now, most of our knowledge has derived from studies in humans or from model organisms under experimental, laboratory conditions. Empirical support for selective mechanisms in free-ranging animal populations in their natural environment is rare. In this review, I first introduce general information about the structure and function of MHC genes, as well as current hypotheses and concepts concerning the role of selection in the maintenance of MHC polymorphism. The evolutionary forces acting on the genetic diversity in coding and non-coding markers are compared. Then, I summarise empirical support for the functional importance of MHC variability in parasite resistance with emphasis on the evidence derived from free-ranging animal populations investigated in their natural habitat. Finally, I discuss the importance of

  6. Genes involved in innate immunity associated with asbestos-related fibrotic changes

    PubMed Central

    Kukkonen, Mari K; Vehmas, Tapio; Piirilä, Päivi; Hirvonen, Ari


    Objectives To determine whether genetic polymorphisms in several candidate genes related to innate immunity and protease–antiprotease balance modify individual susceptibility to develop asbestos-related fibrotic pleuropulmonary changes. Methods Sixteen polymorphisms from nine genes (NLRP3, CARD8, TNF, TGFB1, GC, MMP1, MMP9, MMP12 and TIMP2) were genotyped from 951 Finnish asbestos-exposed workers. The genotype/haplotype data were compared to signs of fibrosis and pleural thickenings using linear and logistic regression analysis adjusted for potential confounders. Results A functional polymorphism (Q705K; rs35829419) in the NLRP3 gene was associated with interstitial lung fibrosis (p=0.013), and the TGFB1 rs2241718 SNP with visceral pleural fibrosis (VPF) (p=0.044). In stratified analysis, the carriage of at least one NLRP3 variant allele conferred a 2.5-fold increased risk for pathological interstitial lung fibrosis (OR 2.44, 95% CI 0.97 to 6.14). Conversely, the carriage of at least one TGFB1 rs2241718 variant allele protected against VPF (OR 0.62, 95% CI 0.39 to 0.98). The TIMP2 rs2277698 SNP and a haplotype consisting of the TGFB1 rs1800469 and rs1800470 SNPs were associated with the degree of pleural thickening calcification (p=0.037 and p=0.035), and the CARD8 rs2043211 SNP with the greatest thickness of pleural plaques (p=0.015). Conclusions Our results support the hypothesis that the NLRP3 inflammasome is important in the development of fibrotic lung disease by associating the NLRP3 rs35829419 variant allele with increased risk of asbestos-related interstitial lung fibrosis, and the TGFB1 rs2241718 variant allele with decreased risk of asbestos-related VPF. Polymorphisms in CARD8 and TIMP2 are proposed to modify the development and/or calcification of pleural thickenings. PMID:24142982

  7. Elimination of contaminating cap genes in AAV vector virions reduces immune responses and improves transgene expression in a canine gene therapy model.


    Wang, Z; Halbert, C L; Lee, D; Butts, T; Tapscott, S J; Storb, R; Miller, A D


    Animal and human gene therapy studies utilizing AAV vectors have shown that immune responses to AAV capsid proteins can severely limit transgene expression. The main source of capsid antigen is that associated with the AAV vectors, which can be reduced by stringent vector purification. A second source of AAV capsid proteins is that expressed from cap genes aberrantly packaged into AAV virions during vector production. This antigen source can be eliminated by the use of a cap gene that is too large to be incorporated into an AAV capsid, such as a cap gene containing a large intron (captron gene). Here, we investigated the effects of elimination of cap gene transfer and of vector purification by CsCl gradient centrifugation on AAV vector immunogenicity and expression following intramuscular injection in dogs. We found that both approaches reduced vector immunogenicity and that combining the two produced the lowest immune responses and highest transgene expression. This combined approach enabled the use of a relatively mild immunosuppressive regimen to promote robust micro-dystrophin gene expression in Duchenne muscular dystrophy-affected dogs. Our study shows the importance of minimizing AAV cap gene impurities and indicates that this improvement in AAV vector production may benefit human applications.

  8. The immune microenvironment of the colorectal tumor: Involvement of immunity genes and microRNAs belonging to the TH17 pathway.


    Omrane, Inés; Benammar-Elgaaied, Amel


    Colorectal cancer is a complex and multifactorial disease. Various factors such as genetic, immunological, epigenetic and environmental constitute minor risk factors with their additive effects contributing to the advent of colorectal cancer. In order to evaluate the role of innate and adaptive immunity in the susceptibility, the presentation and the development of colorectal cancer, we considered an immunogenetic approach on polymorphisms in the TLR4 gene and NOD2/CARD15 gene (receptors of innate immunity) as well as in cytokine genes of the TH17 pathway IL17A, IL17F and cytokine receptor IL23R. Then, we evaluated the expression of microRNAs regulated by TLR4 and NOD2/CARD15 or targeting TLR4, IL17 and proinflammatory cytokines (IL-6, TNF) induced by IL17. Through a case-control study, we showed that the polymorphism of IL17A is associated with its susceptibility to colorectal cancer. Considering the tumor location, we found that the mutated alleles of IL17A, IL17F and IL23R are rather associated with colon cancer and not with rectum cancer. This result confirms that the colon and rectum are two different physiological entities. This study shows that TLR4, IL17A/F and IL23R polymorphisms are involved in the presentation of the disease with regard to tumor architecture, histology, and differentiation, advanced stage of the disease and lymph node and metastasis. Overall, these polymorphisms are associated with a poor prognosis of the disease. Furthermore, in order to evaluate the involvement of epigenetic mechanisms in the occurrence of colorectal cancer, we aimed at analyzing the tumor compared to a normal adjacent tissue and the expression of miRNAs (miR21, miR146a, miR135a, miR147b and miR155) that regulate immunity genes especially the cytokines of the TH17 pathway. This research has shown that microRNAs 21, 135a and 146a are associated with colorectal cancer. Indeed, these three miRs are overexpressed in cancer tissue compared to healthy tissue. These results

  9. Physical mapping of immune-related genes in Yesso scallop (Patinopecten yessoensis) using fluorescent in situ hybridization

    PubMed Central

    Yang, Zujing; Li, Xuan; Liao, Huan; Hu, Liping; Zhang, Zhengrui; Zhao, Bosong; Huang, Xiaoting; Bao, Zhenmin


    Abstract The innate immune system plays a pivotal role in defending invasion of microorganisms for scallops. Previous studies on immune-related genes in the Yesso scallop, Patinopecten yessoensis (Jay, 1857) have mainly focused on characterization and expression pattern in response to bacterial challenge, no research has been carried out on the cytogenetic level yet. In the present study, eight fosmid clones containing the sequences of key immune-related genes (PyNFkB, PyTRAF2, PyTRAF4, PyTRAF7, PyMyd88-1, PyMyd88-3, PyMKK-7 and PyTNFR) were isolated and seven of them were successfully mapped on chromosomes of Patinopecten yessoensis utilizing fluorescence in situ hybridization. Wherein, PyMyd88-1, PyMyd88-3 and PyMKK-7 located on the same chromosome pair with adjacent positions and the other genes were mapped on four non-homologous chromosome pairs, showing a similar distribution to another five model species. The isolation and mapping of such genes of the Yesso scallop will lay a foundation for studies such as assignment of interested genes to chromosomes, construction cytogenetic maps and so on. PMID:28123676

  10. The effects of feeding β-glucan to Pangasianodon hypophthalmus on immune gene expression and resistance to Edwardsiella ictaluri.


    Sirimanapong, Wanna; Thompson, Kim D; Ooi, Ei Lin; Bekaert, Michaël; Collet, Bertrand; Taggart, John B; Bron, James E; Green, Darren M; Shinn, Andrew P; Adams, Alexandra; Leaver, Michael J


    Pangasianodon hypophthalmus (striped catfish) is an important aquaculture species and intensification of farming has increased disease problems, particularly Edwardsiella ictaluri. The effects of feeding β-glucans on immune gene expression and resistance to E. ictaluri in P. hypophthalmus were explored. Fish were fed 0.1% fungal-derived β-glucan or 0.1% commercial yeast-derived β-glucan or a basal control diet without glucan. After 14 days of feeding, the mRNA expression of immune genes (transferrin, C-reactive protein, precerebellin-like protein, Complement C3 and factor B, 2a MHC class II and interleukin-1 beta) in liver, kidney and spleen were determined. Following this fish from each of the three diet treatment groups were infected with E. ictaluri and further gene expression measured 24 h post-infection (h.p.i.), while the remaining fish were monitored over 2 weeks for mortalities. Cumulative percentage mortality at 14 days post-infection (d.p.i.) was less in β-glucan fed fish compared to controls. There was no difference in gene expression between dietary groups after feeding for 14 days, but there was a clear difference between infected and uninfected fish at 24 h.p.i., and based on principal component analysis β-glucans stimulated the overall expression of immune genes in the liver, kidney and spleen at 24 h.p.i.

  11. Enhanced expression of trim14 gene suppressed Sindbis virus reproduction and modulated the transcription of a large number of genes of innate immunity.


    Nenasheva, V V; Kovaleva, G V; Uryvaev, L V; Ionova, K S; Dedova, A V; Vorkunova, G K; Chernyshenko, S V; Khaidarova, N V; Tarantul, V Z


    In the present research, we have studied an influence of enhanced expression TRIM14 on alphavirus Sindbis (SINV, Togaviridae family) infection. In the HEK293 cells transfected with human trim14 gene (HEK-trim14), SINV yield after infection was decreased 1000-10,000 times (3-4 lg of TCD50/ml) at 24 h p.i. and considerably less (1-2 lg of TCD50/ml) at 48 h p.i. Analysis of the expression of 43 genes directly or indirectly involved in innate immune machine in HEK-trim14 non-infected cells comparing with the control (non-transfected) HEK293 cells revealed that stable trim14 transfection in HEK293 cells caused increased transcription of 18 genes (ifna, il6 (ifnβ2), isg15, raf-1, NF-kB (nf-kb1, rela, nf-kb2, relb), grb2, grb3-3, traf3ip2, junB, c-myb, pu.1, akt1, tyk2, erk2, mek2) and lowered transcription of 3 genes (ifnγ, gata1, il-17a). The similar patterns of genes expression observe in SINV-infected non-transfected HEK293 cells. However, SINV infection of HEK-trim14 cells caused inhibition of the most interferon cascade genes as well as subunits of transcription factor NF-κB. Thus, stable enhanced expression of trim14 gene in cells activates the transcription of many immunity genes and suppresses the SINV reproduction, but SINV infection of HEK-trim14 cells promotes inhibition of some genes involved in innate immune system.

  12. Sulfated galactans from Gracilaria fisheri bind to shrimp haemocyte membrane proteins and stimulate the expression of immune genes.


    Rudtanatip, Tawut; Withyachumnarnkul, Boonsirm; Wongprasert, Kanokpan


    Previous studies demonstrated that sulfated galactans (SG) from Gracilaria fisheri (G. fisheri) exhibit immunostimulant activity in shrimp. The present study was conducted to test the hypothesis that SG stimulates signaling molecules of the immune response of shrimp by binding to receptors on the host cell membrane. Accordingly, we evaluated the ability of SG to bind to shrimp haemocytes and showed that SG bound to the shrimp haemocyte membrane (SHM), potentially to specific receptors. Furthermore, this binding was associated with an activation of immune response genes of shrimp. Data from confocal laser scanning micrographs revealed that FITC-labeled SG bound to haemocytes. Far western blot analysis demonstrated that SHM peptides, with molecular sizes of 13, 14, 15, 17, and 25 kDa, were associated with SG. Peptide sequence analysis of the isolated bands using LC-MS/MS and NCBI blast search revealed the identity of the 13, 14, and 17 kDa peptides as lipopolysaccharide and β-1,3-glucan binding protein (LGBP). SG induced the expression of immune related genes and downstream signaling mediators of LGBP including IMD, IKKs, NF-κB, antimicrobial peptides (crustin and PEN-4), the antiviral immunity (dicer), and proPO system (proPO-I and proPO-II). A LGBP neutralizing assay with anti-LGBP antibody indicated a decrease in SG-induced expression of LGBP downstream signaling mediators and the immune related genes. In conclusion, this study demonstrated that the SG-stimulated immune activity in haemocytes is mediated, in part, through the LGBP, and IMD-NF-κB pathway.

  13. Functional similarities between pigeon 'milk' and mammalian milk: induction of immune gene expression and modification of the microbiota.


    Gillespie, Meagan J; Stanley, Dragana; Chen, Honglei; Donald, John A; Nicholas, Kevin R; Moore, Robert J; Crowley, Tamsyn M


    Pigeon 'milk' and mammalian milk have functional similarities in terms of nutritional benefit and delivery of immunoglobulins to the young. Mammalian milk has been clearly shown to aid in the development of the immune system and microbiota of the young, but similar effects have not yet been attributed to pigeon 'milk'. Therefore, using a chicken model, we investigated the effect of pigeon 'milk' on immune gene expression in the Gut Associated Lymphoid Tissue (GALT) and on the composition of the caecal microbiota. Chickens fed pigeon 'milk' had a faster rate of growth and a better feed conversion ratio than control chickens. There was significantly enhanced expression of immune-related gene pathways and interferon-stimulated genes in the GALT of pigeon 'milk'-fed chickens. These pathways include the innate immune response, regulation of cytokine production and regulation of B cell activation and proliferation. The caecal microbiota of pigeon 'milk'-fed chickens was significantly more diverse than control chickens, and appears to be affected by prebiotics in pigeon 'milk', as well as being directly seeded by bacteria present in pigeon 'milk'. Our results demonstrate that pigeon 'milk' has further modes of action which make it functionally similar to mammalian milk. We hypothesise that pigeon 'lactation' and mammalian lactation evolved independently but resulted in similarly functional products.

  14. Transcriptome Analysis and Identification of Differentially Expressed Transcripts of Immune-Related Genes in Spleen of Gosling and Adult Goose.


    Wang, Anqi; Liu, Fei; Chen, Shun; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Wu, Ying; Chen, Xiaoyue; Cheng, Anchun


    The goose (Anser cygnoides), having high nutritional value, high-quality feathers and high economic benefit, is an economically important poultry species. However, the molecular mechanisms underlying the higher susceptibility to pathogens in goslings than in adult geese remains poorly understood. In this study, the histological sections of spleen tissue from a two-week-old gosling and an adult goose, respectively, were subjected to comparative analysis. The spleen of gosling was mainly composed of mesenchyma, accompanied by scattered lymphocytes, whereas the spleen parenchyma was well developed in the adult goose. To investigate goose immune-related genes, we performed deep transcriptome and gene expression analyses of the spleen samples using paired-end sequencing technology (Illumina). In total, 50,390 unigenes were assembled using Trinity software and TGICL software. Moreover, these assembled unigenes were annotated with gene descriptions and gene ontology (GO) analysis was performed. Through Kyoto encyclopedia of genes and genomes (KEGG) analysis, we investigated 558 important immune-relevant unigenes and 23 predicted cytokines. In addition, 22 immune-related genes with differential expression between gosling and adult goose were identified, among which the three genes showing largest differences in expression were immunoglobulin alpha heavy chain (IgH), mannan-binding lectin serine protease 1 isoform X1 (MASP1) and C-X-C chemokine receptor type 4 (CXCR4). Finally, of these 22 differentially expressed immune-related genes, seven genes, including tumor necrosis factor receptor superfamily member 13B (TNFRSF13B), C-C motif chemokine 4-like (CCL4), CXCR4, interleukin 2 receptor alpha (IL2RA), MHC class I heavy chain (MHCIα), transporter of antigen processing 2 (TAP2) IgH, were confirmed by quantitative real-time PCR (qRT-PCR). The expression levels of all the candidate unigenes were up-regulated in adult geese other than that of TNFRSF13B. The comparative

  15. Air surveillance

    SciTech Connect

    Patton, G.W.


    This section of the 1994 Hanford Site Environmental Report summarizes the air surveillance and monitoring programs currently in operation at that Hanford Site. Atmospheric releases of pollutants from Hanford to the surrounding region are a potential source of human exposure. For that reason, both radioactive and nonradioactive materials in air are monitored at a number of locations. The influence of Hanford emissions on local radionuclide concentrations was evaluated by comparing concentrations measured at distant locations within the region to concentrations measured at the Site perimeter. This section discusses sample collection, analytical methods, and the results of the Hanford air surveillance program. A complete listing of all analytical results summarized in this section is reported separately by Bisping (1995).

  16. Maternal immune activation by LPS selectively alters specific gene expression profiles of interneuron migration and oxidative stress in the fetus without triggering a fetal immune response

    PubMed Central

    Oskvig, Devon B.; Elkahloun, Abdel G.; Johnson, Kory R.; Phillips, Terry M.; Herkenham, Miles


    Maternal immune activation (MIA) is a risk factor for the development of schizophrenia and autism. Infections during pregnancy activate the mother’s immune system and alter the fetal environment, with consequential effects on CNS function and behavior in the offspring, but the cellular and molecular links between infection-induced altered fetal development and risk for neuropsychiatric disorders are unknown. We investigated the immunological, molecular, and behavioral effects of MIA in the offspring of pregnant Sprague-Dawley rats given an intraperitoneal (0.25 mg/kg) injection of lipopolysaccharide (LPS) on gestational day 15. LPS significantly elevated pro-inflammatory cytokine levels in maternal serum, amniotic fluid, and fetal brain at 4 h, and levels decreased but remained elevated at 24 h. Offspring born to LPS-treated dams exhibited reduced social preference and exploration behaviors as juveniles and young adults. Whole genome microarray analysis of the fetal brain at 4 h post maternal LPS was performed to elucidate the possible molecular mechanisms by which MIA affects the fetal brain. We observed dysregulation of 3,285 genes in restricted functional categories, with increased mRNA expression of cellular stress and cell death genes and reduced expression of developmentally-regulated and brain-specific genes, specifically those that regulate neuronal migration of GABAergic interneurons, including the Distal-less (Dlx) family of transcription factors required for tangential migration from progenitor pools within the ganglionic eminences into the cerebral cortex. Our results provide a novel mechanism by which MIA induces the widespread down-regulation of critical neurodevelopmental genes, including those previously associated with autism. PMID:22310921

  17. Maternal immune activation by LPS selectively alters specific gene expression profiles of interneuron migration and oxidative stress in the fetus without triggering a fetal immune response.


    Oskvig, Devon B; Elkahloun, Abdel G; Johnson, Kory R; Phillips, Terry M; Herkenham, Miles


    Maternal immune activation (MIA) is a risk factor for the development of schizophrenia and autism. Infections during pregnancy activate the mother's immune system and alter the fetal environment, with consequential effects on CNS function and behavior in the offspring, but the cellular and molecular links between infection-induced altered fetal development and risk for neuropsychiatric disorders are unknown. We investigated the immunological, molecular, and behavioral effects of MIA in the offspring of pregnant Sprague-Dawley rats given an intraperitoneal (0.25 mg/kg) injection of lipopolysaccharide (LPS) on gestational day 15. LPS significantly elevated pro-inflammatory cytokine levels in maternal serum, amniotic fluid, and fetal brain at 4 h, and levels decreased but remained elevated at 24 h. Offspring born to LPS-treated dams exhibited reduced social preference and exploration behaviors as juveniles and young adults. Whole genome microarray analysis of the fetal brain at 4 h post maternal LPS was performed to elucidate the possible molecular mechanisms by which MIA affects the fetal brain. We observed dysregulation of 3285 genes in restricted functional categories, with increased mRNA expression of cellular stress and cell death genes and reduced expression of developmentally-regulated and brain-specific genes, specifically those that regulate neuronal migration of GABAergic interneurons, including the Distal-less (Dlx) family of transcription factors required for tangential migration from progenitor pools within the ganglionic eminences into the cerebral cortex. Our results provide a novel mechanism by which MIA induces the widespread down-regulation of critical neurodevelopmental genes, including those previously associated with autism.

  18. Immune protective effect of human alpha-1-antitrypsin gene during β cell transplantation in diabetic mice.


    Yang, Lu; Liao, Yu-Ting; Yang, Xiao-Fei; Reng, Li-Wei; Qi, Hui; Li, Fu-Rong


    Type 1 diabetes (T1D) is a chronic autoimmune disease in which β cells are destroyed. Islet transplantation is the most promising therapeutic treatment for T1D patients. However, allograft rejection and autoimmune reaction have been recognized as primary causes of graft loss after transplantation. Alpha-1-antitrypsin (AAT) is an important serine protease inhibitor in serum. AAT is characterized by anti-inflammation, anti-apoptosis, and induction-specific immunological tolerance. In this study, we successfully established NIT-hAAT cell lines, which are murine islet β cell lines with stable expression of human AAT (hAAT) gene. These NIT-hAAT cells were transplanted under the left kidney capsule of BALB/c diabetic mice. Interestingly, the sustained expression of hAAT in vivo can block the inflammatory cell infiltration and reduce the production of proinflammatory cytokines to effectively prevent nonspecific inflammation. Results showed that hAAT can inhibit the proliferation of lymphocytes, shift the balance between Th17 and Treg, and suppress the maturation of dendritic cells. Therefore, hAAT can serve as a beneficial immunomodulator that limits immune rejection to prolong islet allograft survival and achieve long-term successful transplant outcomes.

  19. Gene therapy using IL 12 family members in infection, auto immunity, and cancer.


    Waldner, Maximilian J; Neurath, Markus F


    Interleukin-12 (IL-12) is known for several years to have an essential role in inflammatory responses and innate resistance to infection and cancer. This has been largely attributed to its ability to initiate the differentiation of T-helper-1 (Th1) cells producing interferon-gamma. Recently, two new cytokines, IL-23 and IL-27, with homology to IL-12 were discovered and assigned to the IL-12 family of cytokines. Growing evidence supports a role for IL-23 as key mediator of autoimmune disease regulating the new Th17 subset of CD4+ T cells. IL-27 can have pro- and anti-inflammatory effects, which increase Th1 differentiation, suppress Th2 proliferation, or stimulate cytotoxic T cell activity. Several strategies have been pursued to apply the immunological effects of IL-12 family members to the treatment of human disease. Whereas the inhibition of IL-12 and IL-23 signal transduction has shown promising results for the treatment of autoimmune disease, the administration of IL-12 during infection and cancer can increase the host immune reaction. The increasing knowledge about the new IL-12 family members, IL-23 and IL-27, has revealed new therapeutic options for the use of these cytokines. In this review, we discuss therapeutic strategies using IL-12 family members in infection, autoimmunity, and cancer with special focus on gene administration.

  20. Disentangling the roles of natural selection and genetic drift in shaping variation at MHC immunity genes.


    Sutton, Jolene T; Nakagawa, Shinichi; Robertson, Bruce C; Jamieson, Ian G


    The major histocompatibility complex (MHC) forms an integral component of the vertebrate immune response and, due to strong selection pressures, is one of the most polymorphic regions of the entire genome. Despite over 15 years of research, empirical studies offer highly contradictory explanations of the relative roles of different evolutionary forces, selection and genetic drift, acting on MHC genes during population bottlenecks. Here, we take a meta-analytical approach to quantify the results of studies into the effects of bottlenecks on MHC polymorphism. We show that the consequences of selection acting on MHC loci prior to a bottleneck event, combined with drift during the bottleneck, will result in overall loss of MHC polymorphism that is ∼15% greater than loss of neutral genetic diversity. These results are counter to general expectations that selection should maintain MHC polymorphism, but do agree with the results of recent simulation models and at least two empirical studies. Notably, our results suggest that negative frequency-dependent selection could be more important than overdominance for maintaining high MHC polymorphism in pre-bottlenecked populations.

  1. Landscape-scale variation in an anthropogenic factor shapes immune gene variation within a wild population.


    Gonzalez-Quevedo, Catalina; Davies, Richard G; Phillips, Karl P; Spurgin, Lewis G; Richardson, David S


    Understanding the spatial scale at which selection acts upon adaptive genetic variation in natural populations is fundamental to our understanding of evolutionary ecology, and has important ramifications for conservation. The environmental factors to which individuals of a population are exposed can vary at fine spatial scales, potentially generating localized patterns of adaptation. Here, we compared patterns of neutral and major histocompatibility complex (MHC) variation within an island population of Berthelot's pipit (Anthus berthelotii) to assess whether landscape-level differences in pathogen-mediated selection generate fine-scale spatial structuring in these immune genes. Specifically, we tested for spatial associations between the distribution of avian malaria, and the factors previously shown to influence that distribution, and MHC variation within resident individuals. Although we found no overall genetic structure across the population for either neutral or MHC loci, we did find localized associations between environmental factors and MHC variation. One MHC class I allele (ANBE48) was directly associated with malaria infection risk, while the presence of the ANBE48 and ANBE38 alleles within individuals correlated (positively and negatively, respectively) with distance to the nearest poultry farm, an anthropogenic factor previously shown to be an important determinant of disease distribution in the study population. Our findings highlight the importance of considering small spatial scales when studying the patterns and processes involved in evolution at adaptive loci.

  2. An immune-inflammation gene expression signature in prostate tumors of smokers

    PubMed Central

    Yi, Ming; Tang, Wei; Luo, Jun; Dorsey, Tiffany H.; Stagliano, Katherine E.; Gillespie, John W.; Hudson, Robert S.; Terunuma, Atsushi; Shoe, Jennifer L.; Haines, Diana C.; Yfantis, Harris G.; Han, Misop; Martin, Damali N.; Jordan, Symone V.; Borin, James F.; Naslund, Michael J.; Alexander, Richard B.; Stephens, Robert M.; Loffredo, Christopher A.; Lee, Dong H.; Putluri, Nagireddy; Sreekumar, Arun; Hurwitz, Arthur A.; Ambs, Stefan


    Smokers develop metastatic prostate cancer more frequently than nonsmokers, suggesting that a tobacco-derived factor is driving metastatic progression. To identify smoking-induced alterations in human prostate cancer, we analyzed gene and protein expression patterns in tumors collected from current, past, and never smokers. By this route, we elucidated a distinct pattern of molecular alterations characterized by an immune and inflammation signature in tumors from current smokers that were either attenuated or absent in past and never smokers. Specifically, this signature included elevated immunoglobulin expression by tumor-infiltrating B cells, NF-κB activation, and increased chemokine expression. In an alternate approach to characterize smoking-induced oncogenic alterations, we also explored the effects of nicotine in human prostate cancer cells and prostate cancer-prone TRAMP mice. These investigations showed that nicotine increased glutamine consumption and invasiveness of cancer cells in vitro and accelerated metastatic progression in tumor-bearing TRAMP mice. Overall, our findings suggested that nicotine was sufficient to induce a phenotype resembling the epidemiology of smoking-associated prostate cancer progression, illuminating a novel candidate driver underlying metastatic prostate cancer in current smokers. PMID:26719530

  3. Sublethal effects of acaricides and Nosema ceranae infection on immune related gene expression in honeybees.


    Garrido, Paula Melisa; Porrini, Martín Pablo; Antúnez, Karina; Branchiccela, Belén; Martínez-Noël, Giselle María Astrid; Zunino, Pablo; Salerno, Graciela; Eguaras, Martín Javier; Ieno, Elena


    Nosema ceranae is an obligate intracellular parasite and the etiologic agent of Nosemosis that affects honeybees. Beside the stress caused by this pathogen, honeybee colonies are exposed to pesticides under beekeeper intervention, such as acaricides to control Varroa mites. These compounds can accumulate at high concentrations in apicultural matrices. In this work, the effects of parasitosis/acaricide on genes involved in honeybee immunity and survival were evaluated. Nurse bees were infected with N. ceranae and/or were chronically treated with sublethal doses of coumaphos or tau-fluvalinate, the two most abundant pesticides recorded in productive hives. Our results demonstrate the following: (1) honeybee survival was not affected by any of the treatments; (2) parasite development was not altered by acaricide treatments; (3) coumaphos exposure decreased lysozyme expression; (4) N. ceranae reduced levels of vitellogenin transcripts independently of the presence of acaricides. However, combined effects among stressors on imagoes were not recorded. Sublethal doses of acaricides and their interaction with other ubiquitous parasites in colonies, extending the experimental time, are of particular interest in further research work.

  4. Rapid surveillance for health events following a mass meningococcal B vaccine program in a university setting: A Canadian Immunization Research Network study.


    Langley, J M; MacDougall, D M; Halperin, B A; Swain, A; Halperin, S A; Top, K A; McNeil, S A; MacKinnon-Cameron, D; Marty, K; De Serres, G; Dubé, E; Bettinger, J A


    An outbreak of Neisseria meningitidis serotype B infection occurred at a small residential university; public health announced an organizational vaccination program with the 4-component Meningococcal B (4CMenB) vaccine (Bexsero(TM), Novartis/GlaxoSmithKline Inc.) several days later. Since there were limited published data on reactogenicity of 4CMenB in persons over 17years of age, this study sought to conduct rapid surveillance of health events in vaccinees and controls using an online survey. Vaccine uptake was 84.7% for dose 1 (2967/3500) and 70% (2456/3500) for dose 2; the survey response rates were 33.0% (987/2967) and 18.7% (459/2456) in dose 1 and dose 1 recipients respectively, and 12% in unvaccinated individuals (63/533). Most students were 20-29years of age (vaccinees, 64.0%; controls, 74.0). A new health problem or worsening of an existing health problem was reported by 30.0% and 30.3% of vaccine recipients after doses 1 and 2 respectively; and by 15.9% of controls. These health problems interfered with the ability to perform normal activities in most vaccinees reporting these events (74.7% post dose 1; 62.6% post dose 2), and in 60% of controls. The health problems led to a health care provider visit (including emergency room) in 12.8% and 14.4% of vaccinees post doses 1 and 2, respectively and in 40% of controls. The most common reactions in vaccinees were injection site reactions (20.6% post dose 1, 16.1% post dose 20 and non-specific systemic complaints (22.6% post dose 1, 17.6% post dose 2). No hospitalizations were reported. An online surveillance program during an emergency meningococcal B vaccine program was successfully implemented, and detected higher rates of health events in vaccinees compared to controls, and high rates of both vaccinees and controls seeking medical attention. The types of adverse events reported by young adult vaccinees were consistent with those previously.

  5. Identification and Isolation of Brucella suis Virulence Genes Involved in Resistance to the Human Innate Immune System▿

    PubMed Central

    Liautard, Janny; Ouahrani-Bettache, Safia; Jubier-Maurin, Véronique; Lafont, Virginie; Köhler, Stephan; Liautard, Jean-Pierre


    Brucella strains are facultative intracellular pathogens that induce chronic diseases in humans and animals. This observation implies that Brucella subverts innate and specific immune responses of the host to develop its full virulence. Deciphering the genes involved in the subversion of the immune system is of primary importance for understanding the virulence of the bacteria, for understanding the pathogenic consequences of infection, and for designing an efficient vaccine. We have developed an in vitro system involving human macrophages infected by Brucella suis and activated syngeneic γ9δ2 T lymphocytes. Under these conditions, multiplication of B. suis inside macrophages is only slightly reduced. To identify the genes responsible for this reduced sensitivity, we screened a library of 2,000 clones of transposon-mutated B. suis. For rapid and quantitative analysis of the multiplication of the bacteria, we describe a simple method based on Alamar blue reduction, which is compatible with screening a large library. By comparing multiplication inside macrophages alone and multiplication inside macrophages with activated γ9δ2 T cells, we identified four genes of B. suis that were necessary to resist to the action of the γ9δ2 T cells. The putative functions of these genes are discussed in order to propose possible explanations for understanding their exact role in the subversion of innate immunity. PMID:17709411

  6. De novo characterization of Larimichthys crocea transcriptome for growth-/immune-related gene identification and massive microsatellite (SSR) marker development

    NASA Astrophysics Data System (ADS)

    Han, Zhaofang; Xiao, Shijun; Liu, Xiande; Liu, Yang; Li, Jiakai; Xie, Yangjie; Wang, Zhi Yong


    The large yellow croaker, Larimichthys crocea is an important marine fish in China with a high economic value. In the last decade, the stock conservation and aquaculture industry of this species have been facing severe challenges because of wild population collapse and degeneration of important economic traits. However, genes contributing to growth and immunity in L. crocea have not been thoroughly analyzed, and available molecular markers are still not sufficient for genetic resource management and molecular selection. In this work, we sequenced the transcriptome in L. crocea liver tissue with a Roche 454 sequencing platform and assembled the transcriptome into 93 801 transcripts. Of them, 38 856 transcripts were successfully annotated in nt, nr, Swiss-Prot, InterPro, COG, GO and KEGG databases. Based on the annotation information, 3 165 unigenes related to growth and immunity were identified. Additionally, a total of 6 391 simple sequence repeats (SSRs) were identified from the transcriptome, among which 4 498 SSRs had enough flanking regions to design primers for polymerase chain reactions (PCR). To access the polymorphism of these markers, 30 primer pairs were randomly selected for PCR amplification and validation in 30 individuals, and 12 primer pairs (40.0%) exhibited obvious length polymorphisms. This work applied RNA-Seq to assemble and analyze a live transcriptome in L. crocea. With gene annotation and sequence information, genes related to growth and immunity were identified and massive SSR markers were developed, providing valuable genetic resources for future gene functional analysis and selective breeding of L. crocea.

  7. Genetic association analyses implicate aberrant regulation of innate and adaptive immunity genes in the pathogenesis of systemic lupus erythematosus

    PubMed Central

    Graham, Deborah S Cunninghame; Pinder, Christopher L; Tombleson, Philip; Behrens, Timothy W; Martín, Javier; Fairfax, Benjamin P; Knight, Julian C; Chen, Lingyan; Replogle, Joseph; Syvänen, Ann-Christine; Rönnblom, Lars; Graham, Robert R; Wither, Joan E; Rioux, John D; Alarcón-Riquelme, Marta E; Vyse, Timothy J


    Systemic lupus erythematosus (SLE; OMIM 152700) is a genetically complex autoimmune disease characterized by loss of immune tolerance to nuclear and cell surface antigens. Previous genome-wide association studies (GWAS) had modest sample sizes, reducing their scope and reliability. Our study comprised 7,219 cases and 15,991 controls of European ancestry: a new GWAS, meta-analysis with a published GWAS and a replication study. We have mapped 43 susceptibility loci, including 10 novel associations. Assisted by dense genome coverage, imputation provided evidence for missense variants underpinning associations in eight genes. Other likely causal genes were established by examining associated alleles for cis-acting eQTL effects in a range of ex vivo immune cells. We found an over-representation (n=16) of transcription factors among SLE susceptibility genes. This supports the view that aberrantly regulated gene expression networks in multiple cell types in both the innate and adaptive immune response contribute to the risk of developing SLE. PMID:26502338

  8. De novo characterization of Larimichthys crocea transcriptome for growth-/immune-related gene identification and massive microsatellite (SSR) marker development

    NASA Astrophysics Data System (ADS)

    Han, Zhaofang; Xiao, Shijun; Liu, Xiande; Liu, Yang; Li, Jiakai; Xie, Yangjie; Wang, Zhiyong


    The large yellow croaker, Larimichthys crocea is an important marine fish in China with a high economic value. In the last decade, the stock conservation and aquaculture industry of this species have been facing severe challenges because of wild population collapse and degeneration of important economic traits. However, genes contributing to growth and immunity in L. crocea have not been thoroughly analyzed, and available molecular markers are still not sufficient for genetic resource management and molecular selection. In this work, we sequenced the transcriptome in L. crocea liver tissue with a Roche 454 sequencing platform and assembled the transcriptome into 93 801 transcripts. Of them, 38 856 transcripts were successfully annotated in nt, nr, Swiss-Prot, InterPro, COG, GO and KEGG databases. Based on the annotation information, 3 165 unigenes related to growth and immunity were identified. Additionally, a total of 6 391 simple sequence repeats (SSRs) were identified from the transcriptome, among which 4 498 SSRs had enough flanking regions to design primers for polymerase chain reactions (PCR). To access the polymorphism of these markers, 30 primer pairs were randomly selected for PCR amplification and validation in 30 individuals, and 12 primer pairs (40.0%) exhibited obvious length polymorphisms. This work applied RNA-Seq to assemble and analyze a live transcriptome in L. crocea. With gene annotation and sequence information, genes related to growth and immunity were identified and massive SSR markers were developed, providing valuable genetic resources for future gene functional analysis and selective breeding of L. crocea.

  9. Peptidoglycan recognition protein genes and their roles in the innate immune pathways of the red flour beetle, Tribolium castaneum.


    Koyama, Hiroaki; Kato, Daiki; Minakuchi, Chieka; Tanaka, Toshiharu; Yokoi, Kakeru; Miura, Ken


    We have previously demonstrated that the functional Toll and IMD innate immune pathways indeed exist in the model beetle, Tribolium castaneum while the beetle's pathways have broader specificity in terms of microbial activation than that of Drosophila. To elucidate the molecular basis of this broad microbial activation, we here focused on potential upstream sensors of the T. castaneum innate immune pathways, peptidoglycan recognition proteins (PGRPs). Our phenotype analyses utilizing RNA interference-based comprehensive gene knockdown followed by bacterial challenge suggested: PGRP-LA functions as a pivotal sensor of the IMD pathway for both Gram-negative and Gram-positive bacteria; PGRP-LC acts as an IMD pathway-associated sensor mainly for Gram-negative bacteria; PGRP-LE also has some roles in Gram-negative bacterial recognition of the IMD pathway. On the other hand, we did not obtain clear phenotype changes by gene knockdown of short-type PGRP genes, probably because of highly inducible nature of these genes. Our results may collectively account for the promiscuous bacterial activation of the T. castaneum innate immune pathways at least in part.

  10. Micronutrient-gene interactions related to inflammatory/immune response and antioxidant activity in ageing and inflammation. A systematic review.


    Mocchegiani, Eugenio; Costarelli, Laura; Giacconi, Robertina; Malavolta, Marco; Basso, Andrea; Piacenza, Francesco; Ostan, Rita; Cevenini, Elisa; Gonos, Efstathios S; Monti, Daniela


    Recent longitudinal studies in dietary daily intake in human centenarians have shown that a satisfactory content of some micronutrients within the cells maintain several immune functions, a low grade of inflammation and preserve antioxidant activity. Micronutrients (zinc, copper, selenium) play a pivotal role in maintaining and reinforcing the performances of the immune and antioxidant systems as well as in affecting the complex network of the genes (nutrigenomic) with anti- and pro-inflammatory tasks. Genes of pro- and anti-inflammatory cytokines and some key regulators of trace elements homeostasis, such as Metallothioneins (MT), are involved in the susceptibility to major geriatric disease/disorders. Moreover, the genetic inter-individual variability may affect the nutrients' absorption (nutrigenetic) with altered effects on inflammatory/immune response and antioxidant activity. The interaction between genetic factors and micronutrients (nutrigenomic and nutrigenetic approaches) may influence ageing and longevity because the micronutrients may become also toxic. This review reports the micronutrient-gene interactions in ageing and their impact on the healthy state with a focus on the method of protein-metal speciation analysis. The association between micronutrient-gene interactions and the protein-metal speciation analysis can give a complete picture for a personalized nutrient supplementation or chelation in order to reach healthy ageing and longevity.

  11. Vaccination with lentiviral vector expressing the nfa1 gene confers a protective immune response to mice infected with Naegleria fowleri.


    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon


    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.

  12. Identification of Immune-Related Genes and Development of SSR/SNP Markers from the Spleen Transcriptome of Schizothorax prenanti

    PubMed Central

    Zhang, Zhengshi; Lv, Changhuan; Zheng, Shuming; Wang, Zhiyong; Wang, Xiaoqing


    Schizothorax prenanti (S. prenanti) is mainly distributed in the upstream regions of the Yangtze River and its tributaries in China. This species is indigenous and commercially important. However, in recent years, wild populations and aquacultures have faced the serious challenges of germplasm variation loss and an increased susceptibility to a range of pathogens. Currently, the genetics and immune mechanisms of S. prenanti are unknown, partly due to a lack of genome and transcriptome information. Here, we sought to identify genes related to immune functions and to identify molecular markers to study the function of these genes and for trait mapping. To this end, the transcriptome from spleen tissues of S. prenanti was analyzed and sequenced. Using paired-end reads from the Illumina Hiseq2500 platform, 48,517 transcripts were isolated from the spleen transcriptome. These transcripts could be clustered into 37,785 unigenes with an N50 length of 2,539 bp. The majority of the unigenes (35,653, 94.4%) were successfully annotated using non-redundant nucleotide sequence analysis (nt), and the non-redundant protein (nr), Swiss-Prot, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. KEGG pathway assignment identified more than 500 immune-related genes. Furthermore, 7,545 putative simple sequence repeats (SSRs), 857,535 single nucleotide polymorphisms (SNPs), and 53,481 insertion/deletion (InDels) were detected from the transcriptome. This is the first reported high-throughput transcriptome analysis of S. prenanti, and it provides valuable genetic resources for the investigation of immune mechanisms, conservation of germplasm, and molecular marker-assisted breeding of S. prenanti. PMID:27019203

  13. Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Hepatopancreas of Microbial Challenged Mitten Crab Eriocheir sinensis

    PubMed Central

    Li, Xihong; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen; Shi, Guohui


    Background The Chinese mitten crab Eriocheir sinensis is an important economic crustacean and has been seriously attacked by various diseases, which requires more and more information for immune relevant genes on genome background. Recently, high-throughput RNA sequencing (RNA-seq) technology provides a powerful and efficient method for transcript analysis and immune gene discovery. Methods/Principal Findings A cDNA library from hepatopancreas of E. sinensis challenged by a mixture of three pathogen strains (Gram-positive bacteria Micrococcus luteus, Gram-negative bacteria Vibrio alginolyticus and fungi Pichia pastoris; 108 cfu·mL−1) was constructed and randomly sequenced using Illumina technique. Totally 39.76 million clean reads were assembled to 70,300 unigenes. After ruling out short-length and low-quality sequences, 52,074 non-redundant unigenes were compared to public databases for homology searching and 17,617 of them showed high similarity to sequences in NCBI non-redundant protein (Nr) database. For function classification and pathway assignment, 18,734 (36.00%) unigenes were categorized to three Gene Ontology (GO) categories, 12,243 (23.51%) were classified to 25 Clusters of Orthologous Groups (COG), and 8,983 (17.25%) were assigned to six Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. Potentially, 24, 14, 47 and 132 unigenes were characterized to be involved in Toll, IMD, JAK-STAT and MAPK pathways, respectively. Conclusions/Significance This is the first systematical transcriptome analysis of components relating to innate immune pathways in E. sinensis. Functional genes and putative pathways identified here will contribute to better understand immune system and prevent various diseases in crab. PMID:23874555

  14. Patients with genetically heterogeneous synchronous colorectal cancer carry rare damaging germline mutations in immune-related genes

    PubMed Central

    Cereda, Matteo; Gambardella, Gennaro; Benedetti, Lorena; Iannelli, Fabio; Patel, Dominic; Basso, Gianluca; Guerra, Rosalinda F.; Mourikis, Thanos P.; Puccio, Ignazio; Sinha, Shruti; Laghi, Luigi; Spencer, Jo; Rodriguez-Justo, Manuel; Ciccarelli, Francesca D.


    Synchronous colorectal cancers (syCRCs) are physically separated tumours that develop simultaneously. To understand how the genetic and environmental background influences the development of multiple tumours, here we conduct a comparative analysis of 20 syCRCs from 10 patients. We show that syCRCs have independent genetic origins, acquire dissimilar somatic alterations, and have different clone composition. This inter- and intratumour heterogeneity must be considered in the selection of therapy and in the monitoring of resistance. SyCRC patients show a higher occurrence of inherited damaging mutations in immune-related genes compared to patients with solitary colorectal cancer and to healthy individuals from the 1,000 Genomes Project. Moreover, they have a different composition of immune cell populations in tumour and normal mucosa, and transcriptional differences in immune-related biological processes. This suggests an environmental field effect that promotes multiple tumours likely in the background of inflammation. PMID:27377421

  15. Associations between Single Nucleotide Polymorphisms in Cellular Viral Receptors and Attachment Factor-Related Genes and Humoral Immunity to Rubella Vaccination

    PubMed Central

    Haralambieva, Iana H.; Lambert, Nathaniel D.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Larrabee, Beth R.; Pankratz, V. Shane; Poland, Gregory A.


    Background Viral attachment and cell entry host factors are important for viral replication, pathogenesis, and the generation and sustenance of immune responses after infection and/or vaccination, and are plausible genetic regulators of vaccine-induced immunity. Methods Using a tag-SNP approach in candidate gene study, we assessed the role of selected cell surface receptor genes, attachment factor-related genes, along with other immune genes in the genetic control of immune response variations after live rubella vaccination in two independent study cohorts. Results Our analysis revealed evidence for multiple associations between genetic variants in the PVR, PVRL2, CD209/DC-SIGN, RARB, MOG, IL6 and other immune function-related genes and rubella-specific neutralizing antibodies after vaccination (meta p-value <0.05). Conclusion Our results indicate that multiple SNPs from genes involved in cell adhesion, viral attachment, and viral entry, as well as others in genes involved in signaling and/or immune response regulation, play a role in modulating humoral immune responses following live rubella vaccination. PMID:24945853

  16. Two peptides derived from trout IL-1beta have different stimulatory effects on immune gene expression after intraperitoneal administration.


    Hong, Suhee; Secombes, Chris J


    The aim of this study was to examine the biological activities of two IL-1beta derivatives on immune gene expression (i.e. IL-1beta, TNF-alpha, IL-8, MX, lysozyme) in fish using RT-PCR analysis, as a means to establish whether such peptides have value as immunostimulants in vivo. Two functional domains (P1 and P3) of the trout IL-1beta molecule were produced as synthetic peptides and tested for biological effects following intraperitoneal administration into rainbow trout (Oncorhynchus mykiss). P1 and P3 showed different regulatory effects on the examined genes. P1 did not stimulate proinflammatory gene expression but induced rapid expression of the antiviral gene MX. In contrast, P3 showed more widespread stimulatory effects, and increased expression of the proinflammatory genes IL-1beta and IL-8, as well as the antibacterial lysozyme gene. Such data confirm that it is possible to produce bioactive peptide derivatives of cytokine molecules, and in addition that it is possible to engineer the peptides for different stimulatory repertoires, that may have value in enhancing particular types of immune response to enhance disease resistance in fish.

  17. Human melanomas and ovarian cancers overexpressing mechanical barrier molecule genes lack immune signatures and have increased patient mortality risk

    PubMed Central

    Salerno, Elise P.; Bedognetti, Davide; Mauldin, Ileana S.; Deacon, Donna H.; Shea, Sofia M.; Obeid, Joseph M.; Coukos, George; Gajewski, Thomas F.; Marincola, Francesco M.; Slingluff, Craig L.


    ABSTRACT We have identified eight genes whose expression in human melanoma metastases and ovarian cancers is associated with a lack of Th1 immune signatures. They encode molecules with mechanical barrier function in the skin and other normal tissues and include filaggrin (FLG), tumor-associated calcium signal transducer 2 (TACSTD2), and six desmosomal proteins (DST, DSC3, DSP, PPL, PKP3, and JUP). This association has been validated in an independent series of 114 melanoma metastases. In these, DST expression alone is sufficient to identify melanomas without immune signatures, while FLG and the other six putative barrier molecules are overexpressed in a different subset of melanomas lacking immune signatures. Similar associations have been identified in a set of 186 ovarian cancers. RNA-seq data from 471 melanomas and 307 ovarian cancers in the TCGA database further support these findings and also reveal that overexpression of barrier molecules is strongly associated with early patient mortality for melanoma (p = 0.0002) and for ovarian cancer (p < 0.01). Interestingly, this association persists for FLG for melanoma (p = 0.012) and ovarian cancer (p = 0.006), whereas DST overexpression is negatively associated with CD8+ gene expression, but not with patient survival. Thus, overexpression of FLG or DST identifies two distinct patient populations with low immune cell infiltration in these cancers, but with different prognostic implications for each. These data raise the possibility that molecules with mechanical barrier function in skin and other tissues may be used by cancer cells to protect them from immune cell infiltration and immune-mediated destruction. PMID:28123876

  18. Human melanomas and ovarian cancers overexpressing mechanical barrier molecule genes lack immune signatures and have increased patient mortality risk.


    Salerno, Elise P; Bedognetti, Davide; Mauldin, Ileana S; Deacon, Donna H; Shea, Sofia M; Pinczewski, Joel; Obeid, Joseph M; Coukos, George; Wang, Ena; Gajewski, Thomas F; Marincola, Francesco M; Slingluff, Craig L


    We have identified eight genes whose expression in human melanoma metastases and ovarian cancers is associated with a lack of Th1 immune signatures. They encode molecules with mechanical barrier function in the skin and other normal tissues and include filaggrin (FLG), tumor-associated calcium signal transducer 2 (TACSTD2), and six desmosomal proteins (DST, DSC3, DSP, PPL, PKP3, and JUP). This association has been validated in an independent series of 114 melanoma metastases. In these, DST expression alone is sufficient to identify melanomas without immune signatures, while FLG and the other six putative barrier molecules are overexpressed in a different subset of melanomas lacking immune signatures. Similar associations have been identified in a set of 186 ovarian cancers. RNA-seq data from 471 melanomas and 307 ovarian cancers in the TCGA database further support these findings and also reveal that overexpression of barrier molecules is strongly associated with early patient mortality for melanoma (p = 0.0002) and for ovarian cancer (p < 0.01). Interestingly, this association persists for FLG for melanoma (p = 0.012) and ovarian cancer (p = 0.006), whereas DST overexpression is negatively associated with CD8(+) gene expression, but not with patient survival. Thus, overexpression of FLG or DST identifies two distinct patient populations with low immune cell infiltration in these cancers, but with different prognostic implications for each. These data raise the possibility that molecules with mechanical barrier function in skin and other tissues may be used by cancer cells to protect them from immune cell infiltration and immune-mediated destruction.

  19. Multigenic control of measles vaccine immunity mediated by polymorphisms in measles receptor, innate pathway, and cytokine genes.


    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; O'Byrne, Megan M; Jacobson, Robert M; Pankratz, V Shane; Poland, Gregory A


    Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5, 7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses.

  20. Diversity and evolution of 11 innate immune genes in Bos taurus taurus and Bos taurus indicus cattle

    PubMed Central

    Seabury, Christopher M.; Seabury, Paul M.; Decker, Jared E.; Schnabel, Robert D.; Taylor, Jeremy F.; Womack, James E.


    The Toll-like receptor (TLR) and peptidoglycan recognition protein 1 (PGLYRP1) genes play key roles in the innate immune systems of mammals. While the TLRs recognize a variety of invading pathogens and induce innate immune responses, PGLYRP1 is directly microbicidal. We used custom allele-specific assays to genotype and validate 220 diallelic variants, including 54 nonsynonymous SNPs in 11 bovine innate immune genes (TLR1-TLR10, PGLYRP1) for 37 cattle breeds. Bayesian haplotype reconstructions and median joining networks revealed haplotype sharing between Bos taurus taurus and Bos taurus indicus breeds at every locus, and we were unable to differentiate between the specialized B. t. taurus beef and dairy breeds, despite an average polymorphism density of one locus per 219 bp. Ninety-nine tagSNPs and one tag insertion-deletion polymorphism were sufficient to predict 100% of the variation at all 11 innate immune loci in both subspecies and their hybrids, whereas 58 tagSNPs captured 100% of the variation at 172 loci in B. t. taurus. PolyPhen and SIFT analyses of nonsynonymous SNPs encoding amino acid replacements indicated that the majority of these substitutions were benign, but up to 31% were expected to potentially impact protein function. Several diversity-based tests provided support for strong purifying selection acting on TLR10 in B. t. taurus cattle. These results will broadly impact efforts related to bovine translational genomics. PMID:20018671

  1. Where genes meet environment-integrating the role of gut luminal contents, immunity and pancreas in type 1 diabetes.


    Scott, Fraser W; Pound, Lynley D; Patrick, Christopher; Eberhard, Chandra E; Crookshank, Jennifer A


    The rise in new cases of type 1 diabetes (T1D) in genetically susceptible individuals over the past half century has been attributed to numerous environmental "triggers" or promoters such as enteroviruses, diet, and most recently, gut bacteria. No single cause has been identified in humans, likely because there are several pathways by which one can develop T1D. There is renewed attention to the role of the gut and its immune system in T1D pathogenesis based largely on recent animal studies demonstrating that altering the gut microbiota affects diabetes incidence. Although T1D patients display dysbiosis in the gut microbiome, it is unclear whether this is cause or effect. The heart of this question involves several moving parts including numerous risk genes, diet, viruses, gut microbiota, timing, and loss of immune tolerance to β-cells. Most clinical trials have addressed only one aspect of this puzzle using some form of immune suppression, without much success. The key location where our genes meet and deal with the environment is the gastrointestinal tract. The influence of all of its major contents, including microbes, diet, and immune system, must be understood as part of the integrative biology of T1D before we can develop durable means of preventing, treating, or curing this disease. In the present review, we expand our previous gut-centric model based on recent developments in the field.

  2. The profile of cytokines and IgG subclasses in BALB/c mice after immunization with Brucella ribosomal gene.


    Abtahi, H; Salmanian, A H; Rafati, S; Nejad, G B; Saffari, M; Ghazavi, A; Mosayebi, G


    This study was evaluated the ability of DNA vaccine encoding L7/L12 protein of Brucella sp. to induce cellular and humoral immune responses in BALB/c mice and the profile of cytokines and IgG sub classes were determined. Intra muscular vaccination of mice using L7/L12 gene. Three vaccinations at 3 week intervals were performed. Cytokines and IgG subclasses were analyzed 3 week after the last DNA vaccination. Splenic lymphocytes from L7/L12pCDNA3-vaccinated mice produced high levels of IFNy (3100 pg mL(-1)) and low levels of IL-5 (300 pg mL(-1)), 3 weeks post-vaccination. The L7/L12pCDNA3 immunizations elicited high IgG2a isotype response in mice immunized. This antigen also induced IgG1 titers which were slightly lower than the IgG2a titers. Immunological analysis shows the appropriate immune response in BALB/c mice model after vaccination with L7/L12 gene. The high level of IFNgamma and low level of IL-5 in combination with high IgG2a/IgG1 ratio show the activation of Th1 cell response. The lower bacterial cfu from vaccinated mice in comparison with control groups show the efficiency of L7/L12 DNA vaccination in mice model.

  3. The autoimmunity-associated gene PTPN22 potentiates toll-like receptor-driven, type 1 interferon-dependent immunity.


    Wang, Yaya; Shaked, Iftach; Stanford, Stephanie M; Zhou, Wenbo; Curtsinger, Julie M; Mikulski, Zbigniew; Shaheen, Zachary R; Cheng, Genhong; Sawatzke, Kristy; Campbell, Amanda M; Auger, Jennifer L; Bilgic, Hatice; Shoyama, Fernanda M; Schmeling, David O; Balfour, Henry H; Hasegawa, Kiminori; Chan, Andrew C; Corbett, John A; Binstadt, Bryce A; Mescher, Matthew F; Ley, Klaus; Bottini, Nunzio; Peterson, Erik J


    Immune cells sense microbial products through Toll-like receptors (TLR), which trigger host defense responses including type 1 interferons (IFNs) secretion. A coding polymorphism in the protein tyrosine phosphatase nonreceptor type 22 (PTPN22) gene is a susceptibility allele for human autoimmune and infectious disease. We report that Ptpn22 selectively regulated type 1 IFN production after TLR engagement in myeloid cells. Ptpn22 promoted host antiviral responses and was critical for TLR agonist-induced, type 1 IFN-dependent suppression of inflammation in colitis and arthritis. PTPN22 directly associated with TNF receptor-associated factor 3 (TRAF3) and promotes TRAF3 lysine 63-linked ubiquitination. The disease-associated PTPN22W variant failed to promote TRAF3 ubiquitination, type 1 IFN upregulation, and type 1 IFN-dependent suppression of arthritis. The findings establish a candidate innate immune mechanism of action for a human autoimmunity "risk" gene in the regulation of host defense and inflammation.

  4. DNA Immunization

    PubMed Central

    Wang, Shixia; Lu, Shan


    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

  5. MIrExpress: A Database for Gene Coexpression Correlation in Immune Cells Based on Mutual Information and Pearson Correlation.


    Wang, Luman; Mo, Qiaochu; Wang, Jianxin


    Most current gene coexpression databases support the analysis for linear correlation of gene pairs, but not nonlinear correlation of them, which hinders precisely evaluating the gene-gene coexpression strengths. Here, we report a new database, MIrExpress, which takes advantage of the information theory, as well as the Pearson linear correlation method, to measure the linear correlation, nonlinear correlation, and their hybrid of cell-specific gene coexpressions in immune cells. For a given gene pair or probe set pair input by web users, both mutual information (MI) and Pearson correlation coefficient (r) are calculated, and several corresponding values are reported to reflect their coexpression correlation nature, including MI and r values, their respective rank orderings, their rank comparison, and their hybrid correlation value. Furthermore, for a given gene, the top 10 most relevant genes to it are displayed with the MI, r, or their hybrid perspective, respectively. Currently, the database totally includes 16 human cell groups, involving 20,283 human genes. The expression data and the calculated correlation results from the database are interactively accessible on the web page and can be implemented for other related applications and researches.

  6. Contrasting expression of immune genes in scaled and scaleless skin of Atlantic salmon infected with young stages of Lepeophtheirus salmonis.


    Holm, H Jodaa; Skugor, S; Bjelland, A K; Radunovic, S; Wadsworth, S; Koppang, E O; Evensen, Ø


    Atlantic salmon skin tissues with and without scales were taken from two preferred sites of salmon louse (Lepeophtheirus salmonis) attachment, behind the dorsal fin (scaled) and from the top of the head (scaleless), respectively. Tissues were profiled by qPCR of 32 genes to study responses to copepodids, 4 days post infection (dpi), and during the moult of copepodids to the chalimus stage, at 8 dpi. Basal/constitutive differences were found for many immune-related genes between the two skin sites; e.g., mannose binding protein C was over 100 fold higher expressed in the scaled skin from the back in comparison to the skin without scales from the head. With lice-infection, at 4 dpi most genes in both tissues showed lower values than in the non-infected control. By 8 dpi, the majority of responses increased towards the control levels, including cytokines of Th1, Th17 and Th2 pathways. Immunohistochemistry of three immune factors revealed an even distribution of MHC class II positive cells throughout epidermis, including the top layer of keratinocytes, marked compartmentalization of Mx(+) and CD8α(+) cells close to stratum basale, and an increase in numbers of CD8α(+) cells in response to infection. In conclusion, suppression of immune genes during the copepodid stage likely sets off a beneficial situation for the parasite. At the moult to chalimus stage 8 dpi, only few genes surpassed the non-infected control levels, including CD8α. The gene expression pattern was reflected in the increased number of CD8α expressing cells, thus revealing a relatively minor activation of skin T-cell defenses in Atlantic salmon in response to L. salmonis infection.

  7. Partial Sleep Restriction Activates Immune Response-Related Gene Expression Pathways: Experimental and Epidemiological Studies in Humans

    PubMed Central

    Rantanen, Ville; Kronholm, Erkki; Surakka, Ida; van Leeuwen, Wessel M. A.; Lehto, Maili; Matikainen, Sampsa; Ripatti, Samuli; Härmä, Mikko; Sallinen, Mikael; Salomaa, Veikko; Jauhiainen, Matti; Alenius, Harri; Paunio, Tiina; Porkka-Heiskanen, Tarja


    Epidemiological studies have shown that short or insufficient sleep is associated with increased risk for metabolic diseases and mortality. To elucidate mechanisms behind this connection, we aimed to identify genes and pathways affected by experimentally induced, partial sleep restriction and to verify their connection to insufficient sleep at population level. The experimental design simulated sleep restriction during a working week: sleep of healthy men (N = 9) was restricted to 4 h/night for five nights. The control subjects (N = 4) spent 8 h/night in bed. Leukocyte RNA expression was analyzed at baseline, after sleep restriction, and after recovery using whole genome microarrays complemented with pathway and transcription factor analysis. Expression levels of the ten most up-regulated and ten most down-regulated transcripts were correlated with subjective assessment of insufficient sleep in a population cohort (N = 472). Experimental sleep restriction altered the expression of 117 genes. Eight of the 25 most up-regulated transcripts were related to immune function. Accordingly, fifteen of the 25 most up-regulated Gene Ontology pathways were also related to immune function, including those for B cell activation, interleukin 8 production, and NF-κB signaling (P<0.005). Of the ten most up-regulated genes, expression of STX16 correlated negatively with self-reported insufficient sleep in a population sample, while three other genes showed tendency for positive correlation. Of the ten most down-regulated genes, TBX21 and LGR6 correlated negatively and TGFBR3 positively with insufficient sleep. Partial sleep restriction affects the regulation of signaling pathways related to the immune system. Some of these changes appear to be long-lasting and may at least partly explain how prolonged sleep restriction can contribute to inflammation-associated pathological states, such as cardiometabolic diseases. PMID:24194869

  8. (Lack of) genetic diversity in immune genes predates glacial isolation in the North American mountain goat (Oreamnos americanus).


    Shafer, Aaron B A; Fan, Chia Wei; Côté, Steeve D; Coltman, David W


    The major histocompatibility complex (MHC) plays an important role in an organism's ability to respond to pathogens. Immunogenetic diversity is advantageous as it permits the recognition of more external antigens. For this reason, MHC and immune gene variation are considered a barometer for the genetic health of wild populations. Mountain goats (Oreamnos americanus) were previously shown to have little variation at the MHC Class II Oram-DRB locus, which was attributed to population bottlenecks during the last glacial maximum (LGM). In this paper, we extended the analysis of immunogenetic variability in mountain goats to 5 genes representing the 3 classes of MHC gene (Class I OLA, Class II DRA and DRB, and Class III TNF-α) and the natural resistance-associated macrophage protein. We sequenced approximately 3000 bp from 31 individuals sampled across the range of mountain goats and found very low levels of diversity (1-3 polymorphic sites per gene) with the exception of the Class I Oram-OLA gene. Oram-OLA was nearly 30 times more diverse than the other immune genes and appears to represent a source of increased immunogenetic diversity. This diversity may be attributed to multiple loci, mediated by pathogen exposure, or potentially influenced by social factors. The distribution of SNPs was not associated with refugial history, suggesting that the current distribution of immunogenetic diversity was present prior to the LGM. These data suggest that although they have low levels of diversity at the 4 of 5 immune loci, mountain goats may be better equipped for future climate oscillations and pathogen exposure than previously thought.

  9. Transcriptome Profiling Analysis on Whole Bodies of Microbial Challenged Eriocheir sinensis Larvae for Immune Gene Identification and SNP Development

    PubMed Central

    Cui, Zhaoxia; Li, Xihong; Liu, Yuan; Song, Chengwen; Hui, Min; Shi, Guohui; Luo, Danli; Li, Yingdong


    To study crab immunogenetics of individuals, newly hatched Eriocheir sinensis larvae were stimulated with a mixture of three pathogen strains (Gram-positive bacteria Micrococcus luteus, Gram-negative bacteria Vibrio alginolyticus and fungi Pichia pastoris; 108 cfu·mL-1). A total of 44,767,566 Illumina clean reads corresponding to 4.52 Gb nucleotides were generated and assembled into 100,252 unigenes (average length: 1,042 bp; range: 201-19,357 bp). 17,097 (26.09%) of 65,535 non-redundant unigenes were annotated in NCBI non-redundant protein (Nr) database. Moreover, 23,188 (35.38%) unigenes were assigned to three Gene Ontology (GO) categories, 15,071 (23.00%) to twenty-six Clusters of orthologous Groups (COG) and 8,574 (13.08%) to six Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. Numerous genes were further identified to be associated with multiple immune pathways, including Toll, immune deficiency (IMD), janus kinase (JAK)-signal transducers and activators of transcription (STAT) and mitogen-activated protein kinase (MAPK) pathways. Some of them, such as tumor necrosis factor receptor associated factor 6 (TRAF6), fibroblast growth factor (FGF), protein-tyrosine phosphatase (PTP), JNK-interacting protein 1 (JIP1), were first identified in E. sinensis. TRAF6 was even first discovered in crabs. Additionally, 49,555 single nucleotide polymorphisms (SNPs) were developed from over 13,309 unigenes. This is the first transcriptome report of whole bodies of E. sinensis larvae after immune challenge. Data generated here not only provide detail information to identify novel genes in genome reference-free E. sinensis, but also facilitate our understanding on host immunity and defense mechanism of the crab at whole transcriptome level. PMID:24324760

  10. Identification of Functional Toxin/Immunity Genes Linked to Contact-Dependent Growth Inhibition (CDI) and Rearrangement Hotspot (Rhs) Systems

    PubMed Central

    Poole, Stephen J.; Diner, Elie J.; Aoki, Stephanie K.; Braaten, Bruce A.; t'Kint de Roodenbeke, Claire; Low, David A.; Hayes, Christopher S.


    Bacterial contact-dependent growth inhibition (CDI) is mediated by the CdiA/CdiB family of two-partner secretion proteins. Each CdiA protein exhibits a distinct growth inhibition activity, which resides in the polymorphic C-terminal region (CdiA-CT). CDI+ cells also express unique CdiI immunity proteins that specifically block the activity of cognate CdiA-CT, thereby protecting the cell from autoinhibition. Here we show that many CDI systems contain multiple cdiA gene fragments that encode CdiA-CT sequences. These “orphan” cdiA-CT genes are almost always associated with downstream cdiI genes to form cdiA-CT/cdiI modules. Comparative genome analyses suggest that cdiA-CT/cdiI modules are mobile and exchanged between the CDI systems of different bacteria. In many instances, orphan cdiA-CT/cdiI modules are fused to full-length cdiA genes in other bacterial species. Examination of cdiA-CT/cdiI modules from Escherichia coli EC93, E. coli EC869, and Dickeya dadantii 3937 confirmed that these genes encode functional toxin/immunity pairs. Moreover, the orphan module from EC93 was functional in cell-mediated CDI when fused to the N-terminal portion of the EC93 CdiA protein. Bioinformatic analyses revealed that the genetic organization of CDI systems shares features with rhs (rearrangement hotspot) loci. Rhs proteins also contain polymorphic C-terminal regions (Rhs-CTs), some of which share significant sequence identity with CdiA-CTs. All rhs genes are followed by small ORFs representing possible rhsI immunity genes, and several Rhs systems encode orphan rhs-CT/rhsI modules. Analysis of rhs-CT/rhsI modules from D. dadantii 3937 demonstrated that Rhs-CTs have growth inhibitory activity, which is specifically blocked by cognate RhsI immunity proteins. Together, these results suggest that Rhs plays a role in intercellular competition and that orphan gene modules expand the diversity of toxic activities deployed by both CDI and Rhs systems. PMID:21829394

  11. Transcriptome Analysis Revealed Changes of Multiple Genes Involved in Haliotis discus hannai Innate Immunity during Vibrio parahemolyticus Infection

    PubMed Central

    Nam, Bo-Hye; Jung, Myunghee; Subramaniyam, Sathiyamoorthy; Yoo, Seung-il; Markkandan, Kesavan; Moon, Ji-Young; Kim, Young-Ok; Kim, Dong-Gyun; An, Cheul Min; Shin, Younhee; Jung, Ho-jin; Park, Jun-hyung


    Abalone (Haliotis discus hannai) is one of the most valuable marine aquatic species in Korea, Japan and China. Tremendous exposure to bacterial infection is common in aquaculture environment, especially by Vibrio sp. infections. It’s therefore necessary and urgent to understand the mechanism of H. discus hannai host defense against Vibrio parahemolyticus infection. However studies on its immune system are hindered by the lack of genomic resources. In the present study, we sequenced the transcriptome of control and bacterial challenged H. discus hannai tissues. Totally, 138 MB of reference transcriptome were obtained from de novo assembly of 34 GB clean bases from ten different libraries and annotated with the biological terms (GO and KEGG). A total of 10,575 transcripts exhibiting the differentially expression at least one pair of comparison and the functional annotations highlight genes related to immune response, cell adhesion, immune regulators, redox molecules and mitochondrial coding genes. Mostly, these groups of genes were dominated in hemocytes compared to other tissues. This work is a prerequisite for the identification of those physiological traits controlling H. discus hannai ability to survive against Vibrio infection. PMID:27088873

  12. Reduced expression of selective immune-related genes in silver catfish (Rhamdia quelen) monocytes exposed to atrazine.


    Kirsten, Karina Schreiner; Canova, Raíssa; Soveral, Lucas de Figueiredo; Friedrich, Maria Tereza; Frandoloso, Rafael; Kreutz, Luiz Carlos


    The effect of atrazine (ATZ) and its metabolites on aquatic vertebrate species has been a matter of concern to researchers and environmentalist. In this study we exposed head kidney monocytes to sublethal concentrations of atrazine (1 and 10 μg/ml(-1)), corresponding to 1% and 10% of the LC50-96h, to evaluate the expression of immune-related genes central to immune stimulation. The mRNA levels of TNF-α, Mieloperoxidase and Mx genes were significantly reduced following 24 h exposure to both concentrations of ATZ. The mRNA levels of iRAK4 were reduced only at the higher ATZ concentration and the mRNA levels of IL-1β were not affected. The results reported here support our previous findings on the immunosuppressive effect of ATZ indicating its potential to interfere with the expression of immune-related genes, and strengthen the need to regulate ATZ usage aiming to preserve animal and human health.

  13. Germline variation in NCF4, an innate immunity gene, is associated with an increased risk of colorectal cancer.


    Ryan, Bríd M; Zanetti, Krista A; Robles, Ana I; Schetter, Aaron J; Goodman, Julie; Hayes, Richard B; Huang, Wen-Yi; Gunter, Mark J; Yeager, Meredith; Burdette, Laurie; Berndt, Sonja I; Harris, Curtis C


    Chronic inflammation has been implicated in the etiology of colorectal adenoma and cancer; however, few key inflammatory genes mediating this relationship have been identified. In this study, we investigated the association of germline variation in innate immunity genes in relation to the risk of colorectal neoplasia. Our study was based on the analysis of samples collected from the prostate, lung, colorectal and ovarian (PLCO) Cancer Screening Trial. We investigated the association between 196 tag single nucleotide polymorphisms (SNPs) in 20 key innate immunity genes with risk of advanced colorectal adenoma and cancer in 719 adenoma cases, 481 cancer cases and 719 controls. Logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (CIs). After Bonferroni correction, the AG/GG genotype of rs5995355, which is upstream of NCF4, was associated with an increased risk of colorectal cancer (OR = 2.43, 95% CI = 1.73-3.39; p < 0.0001). NCF4 is part of the NAPDH complex, a key factor in biochemical pathways and the innate immune response. While not definitive, our analyses suggest that the variant allele does not affect expression of NCF4, but rather modulates activity of the NADPH complex. Additional studies on the functional consequences of rs5995355 in NCF4 may help to clarify the mechanistic link between inflammation and colorectal cancer.

  14. De novo RNA-Seq analysis of the venus clam, Cyclina sinensis, and the identification of immune-related genes.


    Pan, Baoping; Ren, Yipeng; Gao, Jing; Gao, Hong


    The Venus clam, Cyclina sinensis, is one of the most important bivalves in China. In recent years, increasing expansive morbidity has occurred in breeding areas, imposing significant losses on the national economy. To understand the molecular mechanisms of immune-related genes, we analyzed and sequenced hemolymph samples that were injected with two pathogenic microorganisms using the Illumina Miseq system. After trimming, more than 12 M PE reads with an average length greater than 410 bp were assembled into 70,079 transcripts with a mean length of 980 bp. Using a homology analysis, 102 (135 transcripts) potentially immune-related genes were identified, and most of them exhibited a similar pattern in both samples. These data indicated that the response of the clam to both types of bacterial infection might follow a similar molecular mechanism. Using the TreeFam method, 9,904 gene families and 1,031 unique families of the clam were preliminarily classified in comparison to five related species. A significant number of SSRs were identified, which could facilitate the identification of polymorphisms in Venus clam populations. These datasets will improve our knowledge of the molecular mechanisms driving the immune response to bacterial infection in clam populations and will provide basic data about clam breeding and disease control.

  15. The AVR2-SIX5 gene pair is required to activate I-2-mediated immunity in tomato.


    Ma, Lisong; Houterman, Petra M; Gawehns, Fleur; Cao, Lingxue; Sillo, Fabiano; Richter, Hanna; Clavijo-Ortiz, Myriam J; Schmidt, Sarah M; Boeren, Sjef; Vervoort, Jacques; Cornelissen, Ben J C; Rep, Martijn; Takken, Frank L W


    Plant-invading microbes betray their presence to a plant by exposure of antigenic molecules such as small, secreted proteins called 'effectors'. In Fusarium oxysporum f. sp. lycopersici (Fol) we identified a pair of effector gene candidates, AVR2-SIX5, whose expression is controlled by a shared promoter. The pathogenicity of AVR2 and SIX5 Fol knockouts was assessed on susceptible and resistant tomato (Solanum lycopersicum) plants carrying I-2. The I-2 NB-LRR protein confers resistance to Fol races carrying AVR2. Like Avr2, Six5 was found to be required for full virulence on susceptible plants. Unexpectedly, each knockout could breach I-2-mediated disease resistance. So whereas Avr2 is sufficient to induce I-2-mediated cell death, Avr2 and Six5 are both required for resistance. Avr2 and Six5 interact in yeast two-hybrid assays as well as in planta. Six5 and Avr2 accumulate in xylem sap of plants infected with the reciprocal knockouts, showing that lack of I-2 activation is not due to a lack of Avr2 accumulation in the SIX5 mutant. The effector repertoire of a pathogen determines its host specificity and its ability to manipulate plant immunity. Our findings challenge an oversimplified interpretation of the gene-for-gene model by showing requirement of two fungal genes for immunity conferred by one resistance gene.

  16. Identification of Immunity-Related Genes in Ostrinia furnacalis against Entomopathogenic Fungi by RNA-Seq Analysis

    PubMed Central

    Zhou, Fan; Wang, Guirong; An, Chunju


    Background The Asian corn borer (Ostrinia furnacalis (Guenée)) is one of the most serious corn pests in Asia. Control of this pest with entomopathogenic fungus Beauveria bassiana has been proposed. However, the molecular mechanisms involved in the interactions between O. furnacalis and B. bassiana are unclear, especially under the conditions that the genomic information of O. furnacalis is currently unavailable. So we sequenced and characterized the transcriptome of O. furnacalis larvae infected by B. bassiana with special emphasis on immunity-related genes. Methodology/Principal Findings Illumina Hiseq2000 was used to sequence 4.64 and 4.72 Gb of the transcriptome from water-injected and B. bassiana-injected O. furnacalis larvae, respectively. De novo assembly generated 62,382 unigenes with mean length of 729 nt. All unigenes were searched against Nt, Nr, Swiss-Prot, COG, and KEGG databases for annotations using BLASTN or BLASTX algorithm with an E-value cut-off of 10−5. A total of 35,700 (57.2%) unigenes were annotated to at least one database. Pairwise comparisons resulted in 13,890 differentially expressed genes, with 5,843 up-regulated and 8,047 down-regulated. Based on sequence similarity to homologs known to participate in immune responses, we totally identified 190 potential immunity-related unigenes. They encode 45 pattern recognition proteins, 33 modulation proteins involved in the prophenoloxidase activation cascade, 46 signal transduction molecules, and 66 immune responsive effectors, respectively. The obtained transcriptome contains putative orthologs for nearly all components of the Toll, Imd, and JAK/STAT pathways. We randomly selected 24 immunity-related unigenes and investigated their expression profiles using quantitative RT-PCR assay. The results revealed variant expression patterns in response to the infection of B. bassiana. Conclusions/Significance This study provides the comprehensive sequence resource and expression profiles of the

  17. Transcription of immune genes upon challenge with viral hemorrhagic septicemia virus (VHSV) in DNA vaccinated rainbow trout (Oncorhynchus mykiss).


    Cuesta, A; Tafalla, C


    Even though DNA vaccination has proven as one of the most effective methods in controlling fish rhabdoviruses, the immune mechanisms responsible for protection are still unknown. Many studies have focused on studying which cytokines and immune genes are triggered in response to the vaccine at different times post-vaccination. However, to elucidate the mechanism(s) responsible for protection, to our understanding it is also of great relevance to study the immune response to the virus in fish that have been previously vaccinated and compare it to the effects that the virus might have on non-vaccinated fish. This type of study has never been performed to date in fish. Thus, in the current work, we vaccinated rainbow trout (Oncorhynchus mykiss) with a DNA vaccine against viral hemorrhagic septicemia virus (VHSV), and 30 days post-vaccination we challenged the fish with a virulent VHSV. It was then, that we studied the immune response to the virus at very early times post-infection in fish, in order to compare the effects of VHSV on vaccinated or non-vaccinated trout. We studied the levels of expression of interleukin 1beta (IL-1beta), major histocompatibility complex (MHC) class Ialpha and IIalpha genes, immunoglobulin M (IgM), CD8alpha, type I interferon (IFN), Mx, IFN-gamma and natural killer enhancing factor (NKEF) in head kidney, spleen and blood. When we compared the effect that VHSV had on vaccinated fish to the effect that the virus produced in fish vaccinated with the empty plasmid, the genes that were significantly up-regulated were IL-1beta and MHC IIalpha in the spleen at day 1 post-infection, MHC Ialpha in all organs at day 1 post-infection, and IFN and Mx in the spleen and blood at days 1 and 3 post-infection, respectively. Genes that correlate with an increased specific immune response were not significantly increased in response to VHSV in these vaccinated animals. The results suggest that DNA vaccination induces a memory state in fish that, on the

  18. Expression profile of immune-associated genes in the kidney of cultured large yellow croaker Larimichthys crocea in the East China Sea area

    NASA Astrophysics Data System (ADS)

    Zhao, Shujiang; Zhao, Qian; Chen, Yinghua; Lv, Baoqiang; Wu, Xiongfei; Liu, Huihui; Zhu, Aiyi; Wu, Changwen


    To explore the effect of environment conditions on immune activity of fish, eight immune-associated genes responsible for innate immunity were selected from the GenBank, i.e. Pgrn-a, Ifit2, P-hepcidin, Lect2, β2m, Irf1, Il25 and Hsp96, and the mRNA expressions of them in the kidney of cultured large yellow croaker Larimichthys crocea in different sea areas in the East China Sea were examined with qPCR techniques. In the contrasts of immune-associated gene expression between areas and populations, significant differences were found, expression levels of these immune-associated genes were lower in the clear water area than in the poor water quantity area, and lower in May than in October. MY was more sensitive to environmental factors than DQ, which was coincident with the water quality in the culturing areas. Differential analyses of the expression levels of these immune-associated genes showed that significant up-regulation could be triggered by poor environmental factors. The expression patterns indicated that the expression levels of these genes were sensitive to ecological changes, thereby the immune-associated genes, especially Pgrn-a, Ifit2, β2m, Il25 and Hsp96, might serve as immediate and sensitive indicators of population immunologic vigor and ecosystem health. But the expression of immunity-associated genes at the level of gene transcription is highly influenced by multiple factors, and the exact causes or influencing factors of the up-regulation or down-regulation of these genes still need further thorough investigation.

  19. Identification of immunity-related genes in prostate cancer and potential role of the ETS family of transcription factors in their regulation.


    Shaikhibrahim, Zaki; Lindstrot, Andreas; Ellinger, Jörg; Rogenhofer, Sebastian; Buettner, Reinhard; Wernert, Nicolas


    The role of the immune response in tumor progression, and disease outcome is still debated, and a lack of knowledge of the immune defenses in prostate cancer still exists. In addition, the ETS family of transcription factors which is involved in translocations frequently found in prostate cancer is reported to be essential for the regulation of immunity-related genes. In order to identify immunity-related genes in prostate cancer, we performed two microarrays using RNA extracted from laser microdissected glands of the normal prostate proper (or the peripheral zone) and moderately and poorly differentiated prostate carcinomas from patients who had undergone radical prostatectomy. Many differentially expressed genes were found, however, only immunity-related genes (B cell, innate, and T cell immunity) with an expression of more than 10-fold increase or decrease and a P<0.01 between the moderately differentiated tumors and the normal glands, and the poorly differentiated tumors and the normal glands were considered significant. Based on these two microarrays, we identified a set of 37 genes that were up- or down-regulated in tumors (moderately and poorly differentiated) compared to the normal glands. Analysis of these genes revealed, strikingly, that 31/37 of these genes have potential binding sites within their promoter regions for members of the ETS family of transcription factors, and some are reported to be targets of ETS members. These findings identified immunity-related genes in prostate cancer, and provided insights into their potential regulation, which may lead to a better early detection, immunotherapy, and therapeutic drug treatment of this disease. Unraveling the dynamics of the ETS-immunity-related genes will provide an invaluable insight into understanding prostate cancer immunology.

  20. RNA-seq Profiles of Immune Related Genes in the Staghorn Coral Acropora cervicornis Infected with White Band Disease

    PubMed Central

    Libro, Silvia; Kaluziak, Stefan T.; Vollmer, Steven V.


    Coral diseases are among the most serious threats to coral reefs worldwide, yet most coral diseases remain poorly understood. How the coral host responds to pathogen infection is an area where very little is known. Here we used next-generation RNA-sequencing (RNA-seq) to produce a transcriptome-wide profile of the immune response of the Staghorn coral Acropora cervicornis to White Band Disease (WBD) by comparing infected versus healthy (asymptomatic) coral tissues. The transcriptome of A. cervicornis was assembled de novo from A-tail selected Illumina mRNA-seq data from whole coral tissues, and parsed bioinformatically into coral and non-coral transcripts using existing Acropora genomes in order to identify putative coral transcripts. Differentially expressed transcripts were identified in the coral and non-coral datasets to identify genes that were up- and down-regulated due to disease infection. RNA-seq analyses indicate that infected corals exhibited significant changes in gene expression across 4% (1,805 out of 47,748 transcripts) of the coral transcriptome. The primary response to infection included transcripts involved in macrophage-mediated pathogen recognition and ROS production, two hallmarks of phagocytosis, as well as key mediators of apoptosis and calcium homeostasis. The strong up-regulation of the enzyme allene oxide synthase-lipoxygenase suggests a key role of the allene oxide pathway in coral immunity. Interestingly, none of the three primary innate immune pathways - Toll-like receptors (TLR), Complement, and prophenoloxydase pathways, were strongly associated with the response of A. cervicornis to infection. Five-hundred and fifty differentially expressed non-coral transcripts were classified as metazoan (n = 84), algal or plant (n = 52), fungi (n = 24) and protozoans (n = 13). None of the 52 putative Symbiodinium or algal transcript had any clear immune functions indicating that the immune response is driven by the coral host, and not its algal

  1. RNA-seq profiles of immune related genes in the staghorn coral Acropora cervicornis infected with white band disease.


    Libro, Silvia; Kaluziak, Stefan T; Vollmer, Steven V


    Coral diseases are among the most serious threats to coral reefs worldwide, yet most coral diseases remain poorly understood. How the coral host responds to pathogen infection is an area where very little is known. Here we used next-generation RNA-sequencing (RNA-seq) to produce a transcriptome-wide profile of the immune response of the Staghorn coral Acropora cervicornis to White Band Disease (WBD) by comparing infected versus healthy (asymptomatic) coral tissues. The transcriptome of A. cervicornis was assembled de novo from A-tail selected Illumina mRNA-seq data from whole coral tissues, and parsed bioinformatically into coral and non-coral transcripts using existing Acropora genomes in order to identify putative coral transcripts. Differentially expressed transcripts were identified in the coral and non-coral datasets to identify genes that were up- and down-regulated due to disease infection. RNA-seq analyses indicate that infected corals exhibited significant changes in gene expression across 4% (1,805 out of 47,748 transcripts) of the coral transcriptome. The primary response to infection included transcripts involved in macrophage-mediated pathogen recognition and ROS production, two hallmarks of phagocytosis, as well as key mediators of apoptosis and calcium homeostasis. The strong up-regulation of the enzyme allene oxide synthase-lipoxygenase suggests a key role of the allene oxide pathway in coral immunity. Interestingly, none of the three primary innate immune pathways--Toll-like receptors (TLR), Complement, and prophenoloxydase pathways, were strongly associated with the response of A. cervicornis to infection. Five-hundred and fifty differentially expressed non-coral transcripts were classified as metazoan (n = 84), algal or plant (n = 52), fungi (n = 24) and protozoans (n = 13). None of the 52 putative Symbiodinium or algal transcript had any clear immune functions indicating that the immune response is driven by the coral host, and not its algal

  2. Induction of Cellular Immune Response by DNA Vaccine Coexpressing E. acervulina 3-1E Gene and Mature CHIl-15 Gene

    PubMed Central

    Ma, Dexing; Ma, Chunli; Gao, Mingyang; Li, Guangxing; Niu, Ze; Huang, Xiaodan


    We previously reported that the chimeric DNA vaccine pcDNA-3-1E-linker-mChIL-15, fused through linking Eimeria acervulina 3-1E encoding gene and mature chicken IL-15 (mChIL-15) gene with four flexible amino acid SPGS, could significantly offer protection against homologous challenge. In the present study, the induction of cellular immune response induced by the chimeric DNA vaccine pcDNA-3-1E-linker-mChIL-15 was investigated. Spleen lymphocyte subpopulations were characterized by flow cytometric analysis. The spleen lymphocyte proliferation assays were measured by 3-[4,5-dimethylthiazol-2-y1]-2,5-diphenyltetrazolium bromide (MTT) method. The mRNA profiles of ChIL-2 and ChIFN-γ in spleen were characterized by means of real-time PCR. Chickens immunized with pcDNA-3-1E-linker-mChIL-15 exhibited significant upregulated level of ChIL-2 and ChIFN-γ transcripts in spleen following two immunizations compared with chickens in other groups (P < 0.01). In comparison with pcDNA3.1-immunized and control groups, lymphocyte proliferation, percentage of CD8α+ cell, and levels of ChIL-2 and ChIFN-γ transcripts in the group immunized with pcDNA-3-1E-linker-mChIL-15 were significantly increased on day 6 following challenge (P < 0.05, P < 0.01, and P < 0.01, resp.). Our data suggested that the fusion antigen 3-1E-linker-mChIL-15 could be a potential candidate for E. acervulina vaccine development. PMID:22754694

  3. Resection of Non-Small Cell Lung Cancers Reverses Tumor-Induced Gene Expression Changes in the Peripheral Immune System

    PubMed Central

    Kossenkov, Andrew V.; Vachani, Anil; Chang, Celia; Nichols, Calen; Billouin, Shere; Horng, Wenhwai; Rom, William N.; Albelda, Steven M.; Showe, Michael K.; Showe, Louise C.


    PURPOSE To characterize the interactions of Non-small Cell Lung Cancer (NSCLC) tumors with the immune system at the level of mRNA and microRNA (miRNA) expression and to define expression signatures that characterize the presence of a malignant tumor vs. a non-malignant nodule. EXPERIMENTAL DESIGN We have examined the changes of both mRNA and miRNA expression levels in peripheral blood mononuclear cells (PBMC) between paired samples collected from NSCLC patients before and after tumor removal using Illumina gene expression arrays. RESULTS We found that malignant tumor removal significantly changes expression of more than 3,000 protein-coding genes, especially genes in pathways associated with suppression of the innate immune response, including NK cell signaling and apoptosis-associated ceramide signaling. Binding sites for the ETS-domain transcription factors ELK1, ELK4 and SPI1 were enriched in promoter regions of genes upregulated in the presence of a tumor. Additional important regulators included five miRNAs expressed at significantly higher levels before tumor removal. Repressed protein-coding targets of those miRNAs included many transcription factors, several involved in immunologically important pathways. While there was a significant overlap in the effects of malignant tumors and benign lung nodules on PBMC gene expression, we identified one gene panel which indicates a tumor or nodule presence and a second panel that can distinguish malignant from non-malignant nodules. CONCLUSIONS A tumor presence in the lung influences mRNA and miRNA expression in PBMC and this influence is reversed by tumor removal. These results suggest that PBMC gene expression signatures could be used for lung cancer diagnosis. PMID:21807633

  4. Genomic Analysis Reveals That Immune Function Genes Are Strongly Linked to Clinical Outcome in the North Central Cancer Treatment Group N9831 Adjuvant Trastuzumab Trial

    PubMed Central

    Perez, Edith A.; Thompson, E. Aubrey; Ballman, Karla V.; Anderson, S. Keith; Asmann, Yan W.; Kalari, Krishna R.; Eckel-Passow, Jeanette E.; Dueck, Amylou C.; Tenner, Kathleen S.; Jen, Jin; Fan, Jian-Bing; Geiger, Xochiquetzal J.; McCullough, Ann E.; Chen, Beiyun; Jenkins, Robert B.; Sledge, George W.; Winer, Eric P.; Gralow, Julie R.; Reinholz, Monica M.


    Purpose To develop a genomic signature that predicts benefit from trastuzumab in human epidermal growth factor receptor 2–positive breast cancer. Patients and Methods DASL technology was used to quantify mRNA in samples from 1,282 patients enrolled onto the Combination Chemotherapy With or Without Trastuzumab in Treating Women With Breast Cancer (North Central Cancer Treatment Group N9831 [NCCTG-N9831]) adjuvant trastuzumab trial. Cox proportional hazard ratios (HRs), adjusted for significant clinicopathologic risk factors, were used to determine the association of each gene with relapse-free survival (RFS) for 433 patients who received chemotherapy alone (arm A) and 849 patients who received chemotherapy plus trastuzumab (arms B and C). Network and pathway analyses were used to identify key biologic processes linked to RFS. The signature was built by using a voting scheme. Results Network and functional ontology analyses suggested that increased RFS was linked to a subset of immune function genes. A voting scheme model was used to define immune gene enrichment based on the expression of any nine or more of 14 immune function genes at or above the 0.40 quantile for the population. This model was used to identify immune gene–enriched tumors in arm A and arms B and C. Immune gene enrichment was linked to increased RFS in arms B and C (HR, 0.35; 95% CI, 0.22 to 0.55; P < .001), whereas arm B and C patients who did not exhibit immune gene enrichment did not benefit from trastuzumab (HR, 0.89; 95% CI, 0.62 to 1.28; P = .53). Enriched immune function gene expression as defined by our predictive signature was not associated with increased RFS in arm A (HR, 0.90; 95% CI, 0.60 to 1.37; P = .64). Conclusion Increased expression of a subset of immune function genes may provide a means of predicting benefit from adjuvant trastuzumab. PMID:25605861

  5. Characterization of the Miiuy Croaker (Miichthys miiuy) Transcriptome and Development of Immune-Relevant Genes and Molecular Markers

    PubMed Central

    Che, Rongbo; Sun, Yueyan; Sun, Dianqiao; Xu, Tianjun


    Background The miiuy croaker (Miichthys miiuy) is an important species of marine fish that supports capture fisheries and aquaculture. At present commercial scale aquaculture of this species is limited due to diseases caused by pathogens and parasites which restrict production and limit commercial value. The lack of transcriptomic and genomic information for the miiuy croaker limits the ability of researchers to study the pathogenesis and immune system of this species. In this study we constructed a cDNA library from liver, spleen and kidney which was sequenced using Illumina paired-end sequencing to enable gene discovery and molecular marker development. Principal Findings In our study, a total of 69,071 unigenes with an average length of 572 bp were obtained. Of these, 45,676 (66.13%) were successfully annotated in public databases. The unigenes were also annotated with Gene Ontology, Clusters of Orthologous Groups and KEGG pathways. Additionally, 498 immune-relevant genes were identified and classified. Furthermore, 14,885 putative simple sequence repeats (cSSRs) and 8,510 putative single nucleotide polymorphisms (SNPs) were identified from the 69,071 unigenes. Conclusion The miiuy croaker (Miichthys miiuy) transcriptome data provides a large resource to identify new genes involved in many processes including those involved in the response to pathogens and diseases. Furthermore, the thousands of potential cSSR and SNP markers found in this study are important resources with respect to future development of molecular marker assisted breeding programs for the miiuy croaker. PMID:24714210

  6. AAV-based neonatal gene therapy for hemophilia A: long-term correction and avoidance of immune responses in mice.


    Hu, C; Lipshutz, G S


    Hemophilia A gene therapy has been hampered by immune responses to vector-associated antigens and by neutralizing antibodies or inhibitors against the factor VIII (FVIII) protein; these 'inhibitors' more commonly affect hemophilia A patients than those with hemophilia B. A gene replacement strategy beginning in the neonatal period may avoid the development of these immune responses and lead to prolonged expression with correction of phenotype, thereby avoiding long-term consequences. A serotype rh10 adeno-associated virus (AAV) was developed splitting the FVIII coding sequence into heavy and light chains with the chicken β-actin promoter/CMV enhancer for dual recombinant adeno-associated viral vector delivery. Virions of each FVIII chain were co-injected intravenously into mice on the second day of life. Mice express sustained levels of FVIII antigen ≥5% up to 22 months of life without development of antibodies against FVIII. Phenotypic correction was manifest in all AAV-FVIII-treated mice as demonstrated by functional assay and reduction in bleeding time. This study demonstrates the use of AAV in a gene replacement strategy in neonatal mice that establishes both long-term phenotypic correction of hemophilia A and lack of antibody development against FVIII in this disease model where AAV is administered shortly after birth. These studies support the consideration of gene replacement therapy for diseases that are diagnosed in utero or in the early neonatal period.

  7. APC, K-ras, and p53 gene mutations in colorectal cancer patients: correlation to clinicopathologic features and postoperative surveillance.


    Hsieh, Jan-Sing; Lin, Shiu-Ru; Chang, Mei-Yin; Chen, Fang-Ming; Lu, Chien-Yu; Huang, Tsung-Jen; Huang, Yu-Sheng; Huang, Che-Jen; Wang, Jaw-Yuan


    Current researches have proposed a genetic model for colorectal cancer (CRC), in which the sequential accumulation of mutations in specific cancer-related genes, including adenomatous polyposis coli (APC), K-ras, and p53, drives the transition from normal epithelium through increasing adenomatous dysplasia to colorectal cancer. To identify patients with an increased risk of tumor recurrence or metastasis and evaluate the prognostic values of APC, K-ras, and p53 gene mutations, we investigated the frequency of these three mutated genes in tumors and sera of CRC patients. APC, K-ras, and p53 gene mutations in primary tumor tissues and their paired preoperative serum samples of 118 CRC patients were detected by using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis, followed by direct DNA sequencing of the PCR-amplified genomic DNA. Subsequently, serum molecular markers were analyzed for their correlation with patients' clinicopathologic features and presence of postoperative recurrence/metastasis. We did not observe any significant difference in the association of APC or K-ras or p53 gene mutations in primary tumors with patients' demographic data (all were P > 0.05). In contrast, both serum APC and p53 molecular markers were closely correlated with lymph node metastasis and TNM stage (both P < 0.05). Moreover, the serum overall molecular markers (at least one of the three markers) were prominently associated with depth of tumor invasion (P = 0.033), lymph node metastasis (P < 0.001), and TNM stage (P < 0.001). In addition, a significantly higher postoperative metastasis/recurrence rate in patients positive for overall molecular markers compared to those negative for these molecular markers were also demonstrated (P < 0.001). APC and K-ras molecular markers were more frequently observed in patients with locoregional metastasis (both P < 0.05), while p53 molecular marker was usually detected in the cases of peritoneal metastasis (P

  8. Surveillance of Dihydropteroate Synthase Genes in Stenotrophomonas maltophilia by LAMP: Implications for Infection Control and Initial Therapy

    PubMed Central

    Zhao, Jin; Xing, Yubin; Liu, Wei; Ni, Wentao; Wei, Chuanqi; Wang, Rui; Liu, Yunxi; Liu, Youning


    Stenotrophomonas maltophilia is a common nosocomial pathogen that causes high morbidity and mortality. Because of its inherent extended antibiotic resistance, therapeutic options for S. maltophilia are limited, and sulfamethoxazole/trimethoprim (SXT) is the only first-line antimicrobial recommended. However, with the spread of dihydropteroate synthase (sul1 and sul2) genes, global emergence of SXT resistance has been reported. There is an urgent need to develop a rapid and sensitive but cost-efficient method to monitor the dissemination of sul genes. In this study, we developed loop-mediated isothermal amplification (LAMP) assays for sul1 and sul2 using real-time turbidity and hydroxy naphthol blue coloration methods. The assays could quickly detect sul genes with high sensitivity and specificity. The LAMP detection limit was 0.74 pg/reaction of extracted genomic DNA for sul1 and 2.6 pg/reaction for sul2, which were both 10-fold more sensitive than the corresponding traditional PCR assays. Additionally, the LAMP assays could positively amplify DNA from sul1-producing strains, but not from the negative controls. We then used the LAMP assays to investigate the dissemination of sul genes among S. maltophilia isolates from patients in three hospitals in Beijing, China. Among 450 non-duplicated samples collected during 2012–2014, 56 (12.4%) strains were SXT-resistant. All these SXT-resistant strains were positive for sul genes, with 35 (62.5%) carrying sul1, 17 (30.4%) carrying sul2, and 4 (7.1%) carrying both sul1 and sul2, which indicated that sul genes were the predominant resistance mechanism. Of 394 SXT-susceptible strains, 16 were also sul-positive. To provide epidemiological data for the appropriate choice of antimicrobials for treatment of sul-positive S. maltophilia, we further tested the susceptibility to 18 antimicrobials. Among these, sul-positive strains showed the highest susceptibility to tetracycline derivatives, especially minocycline (MIC50/MIC90, 0

  9. Avirulence (AVR) Gene-Based Diagnosis Complements Existing Pathogen Surveillance Tools for Effective Deployment of Resistance (R) Genes Against Rice Blast Disease.


    Selisana, S M; Yanoria, M J; Quime, B; Chaipanya, C; Lu, G; Opulencia, R; Wang, G-L; Mitchell, T; Correll, J; Talbot, N; Leung, H; Zhou, B


    Avirulence (AVR) genes in Magnaporthe oryzae, the fungal pathogen that causes the devastating rice blast disease, have been documented to be major targets subject to mutations to avoid recognition by resistance (R) genes. In this study, an AVR-gene-based diagnosis tool for determining the virulence spectrum of a rice blast pathogen population was developed and validated. A set of 77 single-spore field isolates was subjected to pathotype analysis using differential lines, each containing a single R gene, and classified into 20 virulent pathotypes, except for 4 isolates that lost pathogenicity. In all, 10 differential lines showed low frequency (<24%) of resistance whereas 8 lines showed a high frequency (>95%), inferring the effectiveness of R genes present in the respective differential lines. In addition, the haplotypes of seven AVR genes were determined by polymerase chain reaction amplification and sequencing, if applicable. The calculated frequency of different AVR genes displayed significant variations in the population. AVRPiz-t and AVR-Pii were detected in 100 and 84.9% of the isolates, respectively. Five AVR genes such as AVR-Pik-D (20.5%) and AVR-Pik-E (1.4%), AVRPiz-t (2.7%), AVR-Pita (0%), AVR-Pia (0%), and AVR1-CO39 (0%) displayed low or even zero frequency. The frequency of AVR genes correlated almost perfectly with the resistance frequency of the cognate R genes in differential lines, except for International Rice Research Institute-bred blast-resistant lines IRBLzt-T, IRBLta-K1, and IRBLkp-K60. Both genetic analysis and molecular marker validation revealed an additional R gene, most likely Pi19 or its allele, in these three differential lines. This can explain the spuriously higher resistance frequency of each target R gene based on conventional pathotyping. This study demonstrates that AVR-gene-based diagnosis provides a precise, R-gene-specific, and differential line-free assessment method that can be used for determining the virulence spectrum of

  10. Gene therapy for adenosine deaminase-deficient severe combined immune deficiency: clinical comparison of retroviral vectors and treatment plans.


    Candotti, Fabio; Shaw, Kit L; Muul, Linda; Carbonaro, Denise; Sokolic, Robert; Choi, Christopher; Schurman, Shepherd H; Garabedian, Elizabeth; Kesserwan, Chimene; Jagadeesh, G Jayashree; Fu, Pei-Yu; Gschweng, Eric; Cooper, Aaron; Tisdale, John F; Weinberg, Kenneth I; Crooks, Gay M; Kapoor, Neena; Shah, Ami; Abdel-Azim, Hisham; Yu, Xiao-Jin; Smogorzewska, Monika; Wayne, Alan S; Rosenblatt, Howard M; Davis, Carla M; Hanson, Celine; Rishi, Radha G; Wang, Xiaoyan; Gjertson, David; Yang, Otto O; Balamurugan, Arumugam; Bauer, Gerhard; Ireland, Joanna A; Engel, Barbara C; Podsakoff, Gregory M; Hershfield, Michael S; Blaese, R Michael; Parkman, Robertson; Kohn, Donald B


    We conducted a gene therapy trial in 10 patients with adenosine deaminase (ADA)-deficient severe combined immunodeficiency using 2 slightly different retroviral vectors for the transduction of patients' bone marrow CD34(+) cells. Four subjects were treated without pretransplantation cytoreduction and remained on ADA enzyme-replacement therapy (ERT) throughout the procedure. Only transient (months), low-level (< 0.01%) gene marking was observed in PBMCs of 2 older subjects (15 and 20 years of age), whereas some gene marking of PBMC has persisted for the past 9 years in 2 younger subjects (4 and 6 years). Six additional subjects were treated using the same gene transfer protocol, but after withdrawal of ERT and administration of low-dose busulfan (65-90 mg/m(2)). Three of these remain well, off ERT (5, 4, and 3 years postprocedure), with gene marking in PBMC of 1%-10%, and ADA enzyme expression in PBMC near or in the normal range. Two subjects were restarted on ERT because of poor gene marking and immune recovery, and one had a subsequent allogeneic hematopoietic stem cell transplantation. These studies directly demonstrate the importance of providing nonmyeloablative pretransplantation conditioning to achieve therapeutic benefits with gene therapy for ADA-deficient severe combined immunodeficiency.

  11. Gene therapy for adenosine deaminase–deficient severe combined immune deficiency: clinical comparison of retroviral vectors and treatment plans

    PubMed Central

    Candotti, Fabio; Shaw, Kit L.; Muul, Linda; Carbonaro, Denise; Sokolic, Robert; Choi, Christopher; Schurman, Shepherd H.; Garabedian, Elizabeth; Kesserwan, Chimene; Jagadeesh, G. Jayashree; Fu, Pei-Yu; Gschweng, Eric; Cooper, Aaron; Tisdale, John F.; Weinberg, Kenneth I.; Crooks, Gay M.; Kapoor, Neena; Shah, Ami; Abdel-Azim, Hisham; Yu, Xiao-Jin; Smogorzewska, Monika; Wayne, Alan S.; Rosenblatt, Howard M.; Davis, Carla M.; Hanson, Celine; Rishi, Radha G.; Wang, Xiaoyan; Gjertson, David; Yang, Otto O.; Balamurugan, Arumugam; Bauer, Gerhard; Ireland, Joanna A.; Engel, Barbara C.; Podsakoff, Gregory M.; Hershfield, Michael S.; Blaese, R. Michael; Parkman, Robertson


    We conducted a gene therapy trial in 10 patients with adenosine deaminase (ADA)–deficient severe combined immunodeficiency using 2 slightly different retroviral vectors for the transduction of patients' bone marrow CD34+ cells. Four subjects were treated without pretransplantation cytoreduction and remained on ADA enzyme-replacement therapy (ERT) throughout the procedure. Only transient (months), low-level (< 0.01%) gene marking was observed in PBMCs of 2 older subjects (15 and 20 years of age), whereas some gene marking of PBMC has persisted for the past 9 years in 2 younger subjects (4 and 6 years). Six additional subjects were treated using the same gene transfer protocol, but after withdrawal of ERT and administration of low-dose busulfan (65-90 mg/m2). Three of these remain well, off ERT (5, 4, and 3 years postprocedure), with gene marking in PBMC of 1%-10%, and ADA enzyme expression in PBMC near or in the normal range. Two subjects were restarted on ERT because of poor gene marking and immune recovery, and one had a subsequent allogeneic hematopoietic stem cell transplantation. These studies directly demonstrate the importance of providing nonmyeloablative pretransplantation conditioning to achieve therapeutic benefits with gene therapy for ADA-deficient severe combined immunodeficiency. PMID:22968453

  12. xopAC-triggered Immunity against Xanthomonas Depends on Arabidopsis Receptor-Like Cytoplasmic Kinase Genes PBL2 and RIPK

    PubMed Central

    Guy, Endrick; Lautier, Martine; Chabannes, Matthieu; Roux, Brice; Lauber, Emmanuelle; Arlat, Matthieu; Noël, Laurent D.


    Xanthomonas campestris pv. campestris (Xcc) colonizes the vascular system of Brassicaceae and ultimately causes black rot. In susceptible Arabidopsis plants, XopAC type III effector inhibits by uridylylation positive regulators of the PAMP-triggered immunity such as the receptor-like cytoplasmic kinases (RLCK) BIK1 and PBL1. In the resistant ecotype Col-0, xopAC is a major avirulence gene of Xcc. In this study, we show that both the RLCK interaction domain and the uridylyl transferase domain of XopAC are required for avirulence. Furthermore, xopAC can also confer avirulence to both the vascular pathogen Ralstonia solanacearum and the mesophyll-colonizing pathogen Pseudomonas syringae indicating that xopAC-specified effector-triggered immunity is not specific to the vascular system. In planta, XopAC-YFP fusions are localized at the plasma membrane suggesting that XopAC might interact with membrane-localized proteins. Eight RLCK of subfamily VII predicted to be localized at the plasma membrane and interacting with XopAC in yeast two-hybrid assays have been isolated. Within this subfamily, PBL2 and RIPK RLCK genes but not BIK1 are important for xopAC-specified effector-triggered immunity and Arabidopsis resistance to Xcc. PMID:23951354

  13. Plasmid DNA immunization with Trypanosoma cruzi genes induces cardiac and clinical protection against Chagas disease in the canine model

    PubMed Central


    The only existing preventive measure against American trypanosomosis, or Chagas disease, is the control of the transmitting insect, which has only been effective in a few South American regions. Currently, there is no vaccine available to prevent this disease. Here, we present the clinical and cardiac levels of protection induced by expression to Trypanosoma cruzi genes encoding the TcSP and TcSSP4 proteins in the canine model. Physical examination, diagnostic chagasic serology, and serial electrocardiograms were performed before and after immunization, as well as after experimental infection. We found that immunization with recombinant plasmids prevented hyperthermia in the acute phase of experimental infection and produced lymphadenomegaly as an immunological response against the parasite and additionally prevented heart rate elevation (tachycardia) in the acute and/or chronic stages of infection. Immunization with T. cruzi genes encoding the TcSP and TcSSP4 antigens diminished the quality and quantity of the electrocardiographic abnormalities, thereby avoiding progression to more severe developments such as right bundle branch block or ventricular premature complexes in a greater number of dogs. PMID:23148870

  14. Effect of heavy oil exposure on antibacterial activity and expression of immune-related genes in Japanese flounder Paralichthys olivaceus.


    Song, Jun-Young; Nakayama, Kei; Kokushi, Emiko; Ito, Kazuki; Uno, Seiichi; Koyama, Jiro; Rahman, M Habibur; Murakami, Yasunori; Kitamura, Shin-Ichi


    Heavy oil (HO) pollution is one of the most important environmental issues globally. However, little is known about the immunotoxicity of HO in fish. We therefore investigated the effects of HO exposure on immunocompetence and expression of immune-related genes in Japanese flounder, Paralichthys olivaceus. To test immunocompetency, serum collected from the fish was mixed with Edwardsiella tarda, plated, and the resultant numbers of bacterial colonies were counted. Plates with serum from HO-exposed fish (5 d postexposure [dpe]) had significantly higher numbers of colonies than those of the untreated control group, suggesting that HO exposure suppresses immunocompetency. Downregulation of the immunoglobulin light chain (IgM) gene in HO-exposed fish at 5 dpe was detected by real-time polymerase chain reaction. These results suggest that IgM-mediated immunity is suppressed by HO exposure. We measured polycyclic aromatic hydrocarbon (PAH) concentrations in the liver of the fish. Low molecular weight PAHs were found to be taken up at high concentrations in fish liver; therefore, they are likely the cause of immune suppression in the fish.

  15. Activation of innate immune-response genes in little brown bats (Myotis lucifugus) infected with the fungus Pseudogymnoascus destructans.


    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M; Bollinger, Trent K; Willis, Craig K R; Voyles, Jamie; Misra, Vikram


    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.

  16. Whole transcriptome profiling of successful immune response to Vibrio infections in the oyster Crassostrea gigas by digital gene expression analysis.


    de Lorgeril, Julien; Zenagui, Reda; Rosa, Rafael D; Piquemal, David; Bachère, Evelyne


    The cultivated Pacific oyster Crassostrea gigas has suffered for decades large scale summer mortality phenomenon resulting from the interaction between the environment parameters, the oyster physiological and/or genetic status and the presence of pathogenic microorganisms including Vibrio species. To obtain a general picture of the molecular mechanisms implicated in C. gigas immune responsiveness to circumvent Vibrio infections, we have developed the first deep sequencing study of the transcriptome of hemocytes, the immunocompetent cells. Using Digital Gene Expression (DGE), we generated a transcript catalog of up-regulated genes from oysters surviving infection with virulent Vibrio strains (Vibrio splendidus LGP32 and V. aestuarianus LPi 02/41) compared to an avirulent one, V. tasmaniensis LMG 20012(T). For that an original experimental infection protocol was developed in which only animals that were able to survive infections were considered for the DGE approach. We report the identification of cellular and immune functions that characterize the oyster capability to survive pathogenic Vibrio infections. Functional annotations highlight genes related to signal transduction of immune response, cell adhesion and communication as well as cellular processes and defence mechanisms of phagocytosis, actin cytosqueleton reorganization, cell trafficking and autophagy, but also antioxidant and anti-apoptotic reactions. In addition, quantitative PCR analysis reveals the first identification of pathogen-specific signatures in oyster gene regulation, which opens the way for in depth molecular studies of oyster-pathogen interaction and pathogenesis. This work is a prerequisite for the identification of those physiological traits controlling oyster capacity to survive a Vibrio infection and, subsequently, for a better understanding of the phenomenon of summer mortality.

  17. An Image-Based Genetic Assay Identifies Genes in T1D Susceptibility Loci Controlling Cellular Antiviral Immunity in Mouse

    PubMed Central

    Liao, Juan; Jijon, Humberto B.; Kim, Ira R.; Goel, Gautam; Doan, Aivi; Sokol, Harry; Bauer, Hermann; Herrmann, Bernhard G.; Lassen, Kara G.; Xavier, Ramnik J.


    The pathogenesis of complex diseases, such as type 1 diabetes (T1D), derives from interactions between host genetics and environmental factors. Previous studies have suggested that viral infection plays a significant role in initiation of T1D in genetically predisposed individuals. T1D susceptibility loci may therefore be enriched in previously uncharacterized genes functioning in antiviral defense pathways. To identify genes involved in antiviral immunity, we performed an image-based high-throughput genetic screen using short hairpin RNAs (shRNAs) against 161 genes within T1D susceptibility loci. RAW 264.7 cells transduced with shRNAs were infected with GFP-expressing herpes simplex virus type 1 (HSV-1) and fluorescent microscopy was performed to assess the viral infectivity by fluorescence reporter activity. Of the 14 candidates identified with high confidence, two candidates were selected for further investigation, Il27 and Tagap. Administration of recombinant IL-27 during viral infection was found to act synergistically with interferon gamma (IFN-γ) to activate expression of type I IFNs and proinflammatory cytokines, and to enhance the activities of interferon regulatory factor 3 (IRF3). Consistent with a role in antiviral immunity, Tagap-deficient macrophages demonstrated increased viral replication, reduced expression of proinflammatory chemokines and cytokines, and decreased production of IFN-β. Taken together, our unbiased loss-of-function genetic screen identifies genes that play a role in host antiviral immunity and delineates roles for IL-27 and Tagap in the production of antiviral cytokines. PMID:25268627

  18. Whole Transcriptome Profiling of Successful Immune Response to Vibrio Infections in the Oyster Crassostrea gigas by Digital Gene Expression Analysis

    PubMed Central

    de Lorgeril, Julien; Zenagui, Reda; Rosa, Rafael D.; Piquemal, David; Bachère, Evelyne


    The cultivated Pacific oyster Crassostrea gigas has suffered for decades large scale summer mortality phenomenon resulting from the interaction between the environment parameters, the oyster physiological and/or genetic status and the presence of pathogenic microorganisms including Vibrio species. To obtain a general picture of the molecular mechanisms implicated in C. gigas immune responsiveness to circumvent Vibrio infections, we have developed the first deep sequencing study of the transcriptome of hemocytes, the immunocompetent cells. Using Digital Gene Expression (DGE), we generated a transcript catalog of up-regulated genes from oysters surviving infection with virulent Vibrio strains (Vibrio splendidus LGP32 and V. aestuarianus LPi 02/41) compared to an avirulent one, V. tasmaniensis LMG 20012T. For that an original experimental infection protocol was developed in which only animals that were able to survive infections were considered for the DGE approach. We report the identification of cellular and immune functions that characterize the oyster capability to survive pathogenic Vibrio infections. Functional annotations highlight genes related to signal transduction of immune response, cell adhesion and communication as well as cellular processes and defence mechanisms of phagocytosis, actin cytosqueleton reorganization, cell trafficking and autophagy, but also antioxidant and anti-apoptotic reactions. In addition, quantitative PCR analysis reveals the first identification of pathogen-specific signatures in oyster gene regulation, which opens the way for in depth molecular studies of oyster-pathogen interaction and pathogenesis. This work is a prerequisite for the identification of those physiological traits controlling oyster capacity to survive a Vibrio infection and, subsequently, for a better understanding of the phenomenon of summer mortality. PMID:21829707

  19. Gene cluster responsible for secretion of and immunity to multiple bacteriocins, the NKR-5-3 enterocins.