Sample records for genes per1 per2

  1. Rigid Cooperation of Per1 and Per2 proteins

    PubMed Central

    Tamiya, Hiroyuki; Ogawa, Sumito; Ouchi, Yasuyoshi; Akishita, Masahiro


    Period circadian clock (Per) genes Per1 and Per2 have essential roles in circadian oscillation. In this study, we identified a new role of Per1-Per2 cooperation, and its mechanism, using our new experimental methods. Under constant light conditions, the period length of Per1 and Per2 knockout mice depended on the copy number ratio of Per1:Per2. We then established a light-emitting diode-based lighting system that can generate any pattern of light intensity. Under gradually changing light in the absence of phase shift with different periods, both Per1(−/−) and Per2(−/−) mice were entrained to a broader range of period length than wild-type mice. To analyse Per1-Per2 cooperative roles at the cell culture level, we established a Per2 knockout-rescue system, which can detect period shortening in a familial advanced sleep phase syndrome (FASPS) mutant. Upon introduction of the Per1 coding region in this system, we saw period shortening. In conclusion, short period-associated protein Per1 and long period-associated Per2 cooperated to rigidly confine the circadian period to “circa” 24-h. These results suggest that the rigid circadian rhythm maintained through the cooperation of Per1-Per2 could negatively impact modern society, in which the use of artificial lighting is ubiquitous, and result in circadian disorders, including delirium. PMID:27609640

  2. Histone mono-ubiquitination by a Clock–Bmal1 complex marks Per1 and Per2 genes for circadian feedback

    PubMed Central

    Tamayo, Alfred G.; Duong, Hao A.; Robles, Maria S.; Mann, Matthias; Weitz, Charles J.


    Circadian rhythms in mammals are driven by a feedback loop in which the transcription factor Clock–Bmal1 activates expression of Per and Cry proteins, which together form a large nuclear complex (Per complex) that represses Clock–Bmal1 activity. We found that mouse Clock–Bmal1 recruits the Ddb1–Cullin-4 ubiquitin ligase to Per, Cry, and other circadian target genes. Histone 2B mono-ubiquitination at Per genes was rhythmic and depended on Bmal1, Ddb1, and Cullin-4a. Depletion of Ddb1–Cullin-4a or independent reduction of Histone 2B mono-ubiquitination caused defective circadian feedback and reduced the association of the Per complex with DNA-bound Clock–Bmal1. Clock–Bmal1 thus covalently marks Per genes for subsequent recruitment of the Per complex. Our results reveal a chromatin-mediated signal from the positive to the negative limb of the clock that provides a licensing mechanism for circadian feedback. PMID:26323038

  3. Differential induction and localization of mPer1 and mPer2 during advancing and delaying phase shifts

    PubMed Central

    Yan, Lily; Silver, Rae


    The mechanism whereby brief light exposure resets the mammalian circadian clock in a phase dependent manner is not known, but is thought to involve Per gene expression. At the behavioural level, a light pulse produces phase delays in early subjective night, phase advances in late subjective night, and no phase shifts in mid-subjective night or subjective day. To understand the relationship between Per gene activity and behavioural phase shifts, we examined light-induced mPer1 and mPer2 expression in the suprachiasmatic nucleus (SCN) of the mouse, in the subjective night, with a view to understanding SCN heterogeneity. In the VIP-containing region of the SCN (termed `core'), light-induced mPer1 expression occurs at all times of the subjective night, while mPer2 induction is seen only in early subjective night. In the remaining regions of the SCN (termed `shell'), a phase delaying light pulse produces no mPer1 but significant mPer2 expression, while a phase advancing light pulse produces no mPer2 but substantial mPer1 induction. Moreover, following a light pulse during mid-subjective night, neither mPer1 nor mPer2 are induced in the shell. The results reveal that behavioural phase shifts occur only when light-induced Per gene expression spreads from the core to the shell SCN, with mPer1 expression in shell corresponding to phase advances, and mPer2 corresponding to phase delays. The results indicate that the time course and the localization of light-induced Per gene expression in SCN reveals important aspects of intra-SCN communication. PMID:12405967

  4. Tetrodotoxin administration in the suprachiasmatic nucleus prevents NMDA-induced reductions in pineal melatonin without influencing Per1 and Per2 mRNA levels.


    Paul, Ketema N; Gamble, Karen L; Fukuhara, Chiaki; Novak, Colleen M; Tosini, Gianluca; Albers, H Elliott


    The suprachiasmatic nucleus (SCN) of the anterior hypothalamus contains a light-entrainable circadian pacemaker. Neurons in the SCN are part of a circuit that conveys light information from retinal efferents to the pineal gland. Light presented during the night acutely increases mRNA levels of the circadian clock genes Per1 and Per2 in the SCN, and acutely suppresses melatonin levels in the pineal gland. The present study investigated whether the ability of light to increase Per1 and Per2 mRNA levels and suppress pineal melatonin levels requires sodium-dependent action potentials in the SCN. Per1 and Per2 mRNA levels in the SCN and pineal melatonin levels were measured in Syrian hamsters injected with tetrodotoxin (TTX) prior to light exposure or injection of N-methyl-D-aspartate (NMDA). TTX inhibited the ability of light to increase Per1 and Per2 mRNA levels and suppress pineal melatonin levels. TTX did not, however, influence the ability of NMDA to increase Per1 and Per2 mRNA levels, though it did inhibit the ability of NMDA to suppress pineal melatonin levels. These results demonstrate that action potentials in the SCN are not necessary for NMDA receptor activation to increase Per1 and Per2 mRNA levels, but are necessary for NMDA receptor activation to decrease pineal melatonin levels. Taken together, these data support the hypothesis that the mechanism through which light information is conveyed to the pacemaker in the SCN is separate from and independent of the mechanism through which light information is conveyed to the SCN cells whose efferents suppress pineal melatonin levels.

  5. Melatonin Signal Transduction Pathways Require E-Box-Mediated Transcription of Per1 and Per2 to Reset the SCN Clock at Dusk

    PubMed Central

    Kandalepas, Patty C.; Mitchell, Jennifer W.; Gillette, Martha U.


    Melatonin is released from the pineal gland into the circulatory system at night in the absence of light, acting as “hormone of darkness” to the brain and body. Melatonin also can regulate circadian phasing of the suprachiasmatic nucleus (SCN). During the day-to-night transition, melatonin exposure advances intrinsic SCN neural activity rhythms via the melatonin type-2 (MT2) receptor and downstream activation of protein kinase C (PKC). The effects of melatonin on SCN phasing have not been linked to daily changes in the expression of core genes that constitute the molecular framework of the circadian clock. Using real-time RT-PCR, we found that melatonin induces an increase in the expression of two clock genes, Period 1 (Per1) and Period 2 (Per2). This effect occurs at CT 10, when melatonin advances SCN phase, but not at CT 6, when it does not. Using anti-sense oligodeoxynucleotides (α ODNs) to Per 1 and Per 2, as well as to E-box enhancer sequences in the promoters of these genes, we show that their specific induction is necessary for the phase-altering effects of melatonin on SCN neural activity rhythms in the rat. These effects of melatonin on Per1 and Per2 were mediated by PKC. This is unlike day-active non-photic signals that reset the SCN clock by non-PCK signal transduction mechanisms and by decreasing Per1 expression. Rather, this finding extends roles for Per1 and Per2, which are critical to photic phase-resetting, to a nonphotic zeitgeber, melatonin, and suggest that the regulation of these clock gene transcripts is required for clock resetting by diverse regulatory cues. PMID:27362940

  6. Clock gene Per2 as a controller of liver carcinogenesis

    PubMed Central

    Mteyrek, Ali; Filipski, Elisabeth; Guettier, Catherine; Okyar, Alper; Lévi, Francis


    Environmental disruption of molecular clocks promoted liver carcinogenesis and accelerated cancer progression in rodents. We investigated the specific role of clock gene Period 2 (Per2) for liver carcinogenesis and clock-controlled cellular proliferation, genomic instability and inflammation. We assessed liver histopathology, and determined molecular and physiology circadian patterns in mice on chronic diethylnitrosamine (DEN) exposure according to constitutive Per2 mutation. First, we found that Per2m/m liver displayed profound alterations in proliferation gene expression, including c-Myc derepression, phase-advanced Wee1, and arrhythmic Ccnb1 and K-ras mRNA expressions, as well as deregulated inflammation, through arrhythmic liver IL-6 protein concentration, in the absence of any DEN exposure. These changes could then make Per2m/m mice more prone to subsequently develop liver cancers on DEN. Indeed, primary liver cancers were nearly fourfold as frequent in Per2m/m mice as compared to wild-type (WT), 4 months after DEN exposure. The liver molecular clock was severely disrupted throughout the whole carcinogenesis process, including the initiation stage, i.e. within the initial 17 days on DEN. Per2m/m further exhibited increased c-Myc and Ccnb1 mean 24h expressions, lack of P53 response, and arrhythmic ATM, Wee1 and Ccnb1 expressions. DEN-induced tumor related inflammation was further promoted through increased protein concentrations of liver IL-6 and TNF-α as compared to WT during carcinogenesis initiation. Per2 mutation severely deregulated liver gene or protein expressions related to three cancer hallmarks, including uncontrolled proliferation, genomic instability, and tumor promoting inflammation, and accelerated liver carcinogenesis several-fold. Clock gene Per2 acted here as a liver tumor suppressor from initiation to progression. PMID:27494874

  7. The core clock gene Per1 phases molecular and electrical circadian rhythms in SCN neurons

    PubMed Central

    Jones, Jeff R.


    The brain’s biological clock, the suprachiasmatic nucleus (SCN), exhibits endogenous 24-hour rhythms in gene expression and spontaneous firing rate; however, the functional relationship between these neuronal rhythms is not fully understood. Here, we used a Per1::GFP transgenic mouse line that allows for the simultaneous quantification of molecular clock state and firing rate in SCN neurons to examine the relationship between these key components of the circadian clock. We find that there is a stable, phased relationship between E-box-driven clock gene expression and spontaneous firing rate in SCN neurons and that these relationships are independent of light input onto the system or of GABAA receptor-mediated synaptic activity. Importantly, the concordant phasing of gene and neural rhythms is disrupted in the absence of the homologous clock gene Per1, but persists in the absence of the core clock gene Per2. These results suggest that Per1 plays a unique, non-redundant role in phasing gene expression and firing rate rhythms in SCN neurons to increase the robustness of cellular timekeeping. PMID:27602274

  8. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun


    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  9. Diurnal Expression of the Per2 Gene and Protein in the Lateral Habenular Nucleus

    PubMed Central

    Zhao, Zhigong; Xu, Haiyan; Liu, Yongmao; Mu, Li; Xiao, Jinyu; Zhao, Hua


    The suprachiasmatic nucleus plays an important role in generating circadian rhythms in mammals. The lateral habenular nucleus (LHb) is closely linked to this structure. Interestingly, the LHb shows a rhythmic firing rate in vivo and in vitro, and sustained oscillation of rhythmic genes in vitro. However, under the in vivo condition, whether rhythmic gene expression in the LHb has circadian rhythms remains unknown. In this study, we examined LHb tissue in rats to determine Period2 (Per2) gene and protein expression at six zeitgeber time points (ZT2, ZT6, ZT10, ZT14, ZT18, and ZT22) in a 12-h light and 12-h dark (LD) environment. We found that in the LD environment, Per2 gene expression and PER2 protein levels in the LHb were higher in the day and lower in the night, showing periodic oscillation, with a peak at ZT10 and a trough at ZT22 (Per2 mRNA) and ZT18 (PER2 protein). We conclude that Per2 expression and PER2 protein levels in the LHb have rhythmic oscillation in vivo. This study provides a basis for further study on the role of the LHb in the circadian rhythm system. PMID:26213916


    PubMed Central

    Brager, Allison J.; Stowie, Adam C.; Prosser, Rebecca A.; Glass, J. David


    Cocaine is a potent disruptor of photic and non-photic pathways for circadian entrainment of the master circadian clock of the suprachiasmatic nucleus (SCN). These actions of cocaine likely involve its modulation of molecular (clock gene) components for SCN clock timekeeping. At present, however, the physiological basis of such an interaction is unclear. To address this question, we compared photic and non-photic phase-resetting responses between wild-type (WT) and Per2 mutant mice expressing nonfunctional PER2 protein to systemic and intra-SCN cocaine administrations. In the systemic trials, cocaine was administered i.p. (20 mg/kg) either at midday or prior to a light pulse in the early night to assess its non-photic and photic behavioral phase-resetting actions, respectively. In the intra-SCN trial, cocaine was administered by reverse microdialysis at midday to determine if the SCN is a direct target for its non-photic phase-resetting action. Non-photic phase-advancing responses to i.p. cocaine at midday were significantly (~3.5-fold) greater in Per2 mutants than WTs. However, the phase-advancing action of intra-SCN cocaine perfusion at midday did not differ between genotypes. In the light pulse trial, Per2 mutants exhibited larger photic phase-delays than did WTs, and the attenuating action of cocaine on this response was proportionately larger than in WTs. These data indicate that the Per2 clock gene is a potent modulator of cocaine’s actions in the circadian system. With regard to non-photic phase-resetting, the SCN is confirmed as a direct target of cocaine action; however, Per2 modulation of this effect likely occurs outside of the SCN. PMID:23333842

  11. High prevalence of the PER-1 gene among carbapenem-resistant Acinetobacter baumannii in Riyadh, Saudi Arabia.


    Aly, M M; Abu Alsoud, N M; Elrobh, M S; Al Johani, S M; Balkhy, H H


    The prevalence of carbapenem-resistant Acinetobacter baumannii in Saudi Arabia and their resistance genetic mechanisms are yet to be identified. We studied the prevalence and genetic diversity of extended-spectrum beta-lactamase genes, particularly the PER-1 gene, among carbapenem-resistant A. baumannii strains from patients at a tertiary care hospital in Riyadh, Saudi Arabia between 2006 and 2014. Fresh subcultured samples were tested for antimicrobial susceptibility minimum inhibitory concentration (MIC). Total genomic DNA was extracted from each isolate and further used for polymerase chain reaction (PCR) genotyping, sequence-based typing (SBT) of PER-1 and OXA-51-like gene, and multilocus sequence typing (MLST) of positive isolates. Randomly selected clinical isolates (n = 100) were subjected to MLST. A total of 503 isolates were characterized as multidrug-resistant (MDR) using the MIC. Isolates were further PCR tested for bla -TEM and bla -PER-1 resistance genes (n = 503). The genotyping results showed that 68/503 (14 %) isolates were positive to bla TEM. The genotyping results of PER-1-like genes showed that 384/503 (76.3 %) were positive among MDR Acinetobacter isolates. Based on SBT, the majority of these isolates were clustered into three main groups including isolates harboring PER-1: AB11 (bla -PER-1), isolate AB16 (bla -PER-1), and, finally, the plasmid pAB154 (bla -PER-7). Remarkably, many isolates were concealing the PER-1 gene and harboring the TEM resistance genes as well. MLST results for selected isolates (n = 100) identified four main sequence types (STs: 2, 19, 20, and 25) and four novel isolates (ST 486-489). We report 76.3 % prevalence of the PER-1 resistance gene among Acinetobacter clinical isolates from Riyadh, Saudi Arabia. Further work is needed to explore the clinical risks and patient outcome with such resistance related to healthcare-associated infections and investigate the genetic and molecular mechanisms that confer the MDR

  12. Molecular cloning, tissue distribution, and daily rhythms of expression of per1 gene in European sea bass (Dicentrarchus labrax).


    Sánchez, Jose Antonio; Madrid, Juan Antonio; Sánchez-Vázquez, Francisco Javier


    Circadian rhythms are controlled by interlocked autoregulatory feedback loops consisting of interactions of a group of circadian clock genes and their proteins. The Period family is a group of genes that are essential components of the molecular clock. In the present study, we cloned a period gene (per1) of the European sea bass, a marine teleost of chronobiological interest. The cloned sequence encoded a protein consisting of 1436 amino acids that homology and phylogenic analyses showed to be related with fish PER1 proteins possessing very high identity with Oryzias latipes (Medaka) per1. Polymerase chain reaction screening of per1 expression showed that this gene is expressed in all the tissues analyzed (brain, heart, liver, gill, muscle, digestive tract, adipose tissue, spleen, and retina). In addition, a daily expression rhythm, with an acrophase (peak time) approximately ZT0 (lights-on), was found in the two tissue types investigated: neural (brain) and peripheral (liver and heart). In conclusion, identification and characterization of the gene encoding sea bass per1 provide valuable information for understanding the circadian mechanism at the molecular level in this species, although further research is needed to clarify the exact role that per1 plays in the circadian oscillator and the dual behavior of European sea bass.

  13. Association of Per1 and Npas2 with autistic disorder: support for the clock genes/social timing hypothesis.


    Nicholas, B; Rudrasingham, V; Nash, S; Kirov, G; Owen, M J; Wimpory, D C


    Clock gene anomalies have been suggested as causative factors in autism. We screened eleven clock/clock-related genes in a predominantly high-functioning Autism Genetic Resource Exchange sample of strictly diagnosed autistic disorder progeny and their parents (110 trios) for association of clock gene variants with autistic disorder. We found significant association (P<0.05) for two single-nucleotide polymorphisms in per1 and two in npas2. Analysis of all possible combinations of two-marker haplotypes for each gene showed that in npas2 40 out of the 136 possible two-marker combinations were significant at the P<0.05 level, with the best result between markers rs1811399 and rs2117714, P=0.001. Haplotype analysis within per1 gave a single significant result: a global P=0.027 for the markers rs2253820-rs885747. No two-marker haplotype was significant in any of the other genes, despite the large number of tests performed. Our findings support the hypothesis that these epistatic clock genes may be involved in the etiology of autistic disorder. Problems in sleep, memory and timing are all characteristics of autistic disorder and aspects of sleep, memory and timing are each clock-gene-regulated in other species. We identify how our findings may be relevant to theories of autism that focus on the amygdala, cerebellum, memory and temporal deficits. We outline possible implications of these findings for developmental models of autism involving temporal synchrony/social timing.

  14. Genetic and clinical factors predict lithium's effects on PER2 gene expression rhythms in cells from bipolar disorder patients.


    McCarthy, M J; Wei, H; Marnoy, Z; Darvish, R M; McPhie, D L; Cohen, B M; Welsh, D K


    Bipolar disorder (BD) is associated with abnormal circadian rhythms. In treatment responsive BD patients, lithium (Li) stabilizes mood and reduces suicide risk. Li also affects circadian rhythms and expression of 'clock genes' that control them. However, the extent to which BD, Li and the circadian clock share common biological mechanisms is unknown, and there have been few direct measurements of clock gene function in samples from BD patients. Hence, the role of clock genes in BD and Li treatment remains unclear. Skin fibroblasts from BD patients (N=19) or healthy controls (N=19) were transduced with Per2::luc, a rhythmically expressed, bioluminescent circadian clock reporter gene, and rhythms were measured for 5 consecutive days. Rhythm amplitude and period were compared between BD cases and controls with and without Li. Baseline period was longer in BD cases than in controls. Li 1 mM increased amplitude in controls by 36%, but failed to do so in BD cases. Li 10 mM lengthened period in both BD cases and controls. Analysis of clock gene variants revealed that PER3 and RORA genotype predicted period lengthening by Li, whereas GSK3β genotype predicted rhythm effects of Li, specifically among BD cases. Analysis of BD cases by clinical history revealed that cells from past suicide attempters were more likely to show period lengthening with Li 1 mM. Finally, Li enhanced the resynchronization of damped rhythms, suggesting a mechanism by which Li could act therapeutically in BD. Our work suggests that the circadian clock's response to Li may be relevant to molecular pathology of BD.

  15. Circadian Clock genes Per2 and clock regulate steroid production, cell proliferation, and luteinizing hormone receptor transcription in ovarian granulosa cells

    SciTech Connect

    Shimizu, Takashi; Hirai, Yuko; Murayama, Chiaki; Miyamoto, Akio; Miyazaki, Hitoshi; Miyazaki, Koyomi


    Highlights: {yields} Treatment with Per2 and Clock siRNAs decreased the number of granulosa cells and LHr expression. {yields}Per2 siRNA treatment did not stimulate the production of estradiol and expression of P450arom. {yields} Clock siRNA treatment inhibited the production of estradiol and expression of P450arom mRNA. {yields}Per2 and Clock siRNA treatment increased and unchanged, respectively, progesterone production in FSH-treated granulosa cells. {yields} The expression of StAR mRNA was increased by Per2 siRNA and unchanged by Clock siRNA. -- Abstract: Circadian Clock genes are associated with the estrous cycle in female animals. Treatment with Per2 and Clock siRNAs decreased the number of granulosa cells and LHr expression in follicle-stimulating hormone FSH-treated granulosa cells. Per2 siRNA treatment did not stimulate the production of estradiol and expression of P450arom, whereas Clock siRNA treatment inhibited the production of estradiol and expression of P450arom mRNA. Per2 and Clock siRNA treatment increased and unchanged, respectively, progesterone production in FSH-treated granulosa cells. Similarly, expression of StAR mRNA was increased by Per2 siRNA and unchanged by Clock siRNA. Our data provide a new insight that Per2 and Clock have different action on ovarian granulosa cell functions.

  16. Decreased Bone Volume and Bone Mineral Density in the Tibial Trabecular Bone Is Associated with Per2 Gene by 405 nm Laser Stimulation

    PubMed Central

    Yoo, Yeong-Min; Lee, Myung-Han; Park, Ji Hyung; Seo, Dong-Hyun; Lee, Sangyeob; Jung, Byungjo; Kim, Han Sung; Bae, Kiho


    Low-level laser therapy/treatment (LLLT) using a minimally invasive laser needle system (MILNS) might enhance bone formation and suppress bone resorption. In this study, the use of 405 nm LLLT led to decreases in bone volume and bone mineral density (BMD) of tibial trabecular bone in wild-type (WT) and Per2 knockout (KO) mice. Bone volume and bone mineral density of tibial trabecular bone was decreased by 405 nm LLLT in Per2 KO compared to WT mice at two and four weeks. To determine the reduction in tibial bone, mRNA expressions of alkaline phosphatase (ALP) and Per2 were investigated at four weeks after 405 nm laser stimulation using MILNS. ALP gene expression was significantly reduced in the LLLT-stimulated right tibial bone of WT and Per2 KO mice compared to the non-irradiated left tibia (p < 0.001). Per2 mRNA expression in WT mice was significantly reduced in the LLLT-stimulated right tibial bone compared to the non-irradiated left tibia (p < 0.001). To identify the decrease in tibial bone mediated by the Per2 gene, levels of runt-related transcription factor 2 (Runx2) and ALP mRNAs were determined in non-irradiated WT and Per2 KO mice. These results demonstrated significant downregulation of Runx2 and ALP mRNA levels in Per2 KO mice (p < 0.001). Therefore, the reduction in tibial trabecular bone resulting from 405 nm LLLT using MILNS might be associated with Per2 gene expression. PMID:26580614

  17. Repeat variation in the human PER2 gene as a new genetic marker associated with cocaine addiction and brain dopamine D2 receptor availability.


    Shumay, E; Fowler, J S; Wang, G-J; Logan, J; Alia-Klein, N; Goldstein, R Z; Maloney, T; Wong, C; Volkow, N D


    Low dopamine D2 receptor (D2R) levels in the striatum are consistently reported in cocaine abusers; inter-individual variations in the degree of the decrease suggest a modulating effect of genetic makeup on vulnerability to addiction. The PER2 (Period 2) gene belongs to the clock genes family of circadian regulators; circadian oscillations of PER2 expression in the striatum was modulated by dopamine through D2Rs. Aberrant periodicity of PER2 contributes to the incidence and severity of various brain disorders, including drug addiction. Here we report a newly identified variable number tandem repeat (VNTR) polymorphism in the human PER2 gene (VNTR in the third intron). We found significant differences in the VNTR alleles prevalence across ethnic groups so that the major allele (4 repeats (4R)) is over-represented in non-African population (4R homozygosity is 88%), but not in African Americans (homozygosity 51%). We also detected a biased PER2 genotype distribution among healthy controls and cocaine-addicted individuals. In African Americans, the proportion of 4R/three repeat (3R) carriers in healthy controls is much lower than that in cocaine abusers (23% vs 39%, P=0.004), whereas among non-Africans most 3R/4R heterozygotes are healthy controls (10.5% vs 2.5%, P=0.04). Analysis of striatal D2R availability measured with positron emission tomography and [(11)C]raclopride revealed higher levels of D2R in carriers of 4R/4R genotype (P<0.01). Taken together, these results provide preliminary evidence for the role of the PER2 gene in regulating striatal D2R availability in the human brain and in vulnerability for cocaine addiction.

  18. Susceptibility Pattern and Distribution of Oxacillinases and blaPER-1 Genes among Multidrug Resistant Acinetobacter baumannii in a Teaching Hospital in Iran

    PubMed Central

    Bagheri Josheghani, Sareh; Moniri, Rezvan; Firoozeh, Farzaneh; Sehat, Mojtaba; Dasteh Goli, Yasaman


    Acinetobacter baumannii (A. baumannii) is an important nosocomial pathogen in healthcare institutions. β-Lactamase-mediated resistance is the most common mechanism for carbapenem resistance in A. baumannii. The aim of this study was to determine the antibiotic resistance pattern, to detect OXA encoding genes, class A, blaPER-1, and to detect the presence of ISAba1. A total of 124 A. baumannii isolates were collected from hospitalized patients in a teaching hospital in Kashan, Iran. The susceptibility of isolates to different antibiotics was determined by disk-diffusion method. PCR was used to detect blaPER-1, blaOXA-23, blaOXA-24, blaOXA-51, blaOXA-58, and ISAba1 genes. All isolates were resistant to ceftazidime, ceftriaxone, and cefotaxime. All of the isolates revealed susceptibility to polymyxin B and colistin. Ninety-six percent of the isolates were extensive drug resistance (XDR), 5.6% extended spectrum beta-lactamase (ESBL), and 54.8% metallo-beta-lactamase (MBL). All isolates were positive for blaOXA-51 and ISAba1. blaOXA-23,  blaOXA-24, and blaOXA-58 were found in 79.8%, 25%, and 3.2%, respectively. The frequency rate of blaPER-1 gene was 52.4%. Multidrug resistant A. baumannii isolates are increasing in our setting and extensively limit therapeutic options. The high rate presence of class D carbapenemase-encoding genes, mainly blaOXA-23 carbapenemases, is worrying and alarming as an emerging threat in our hospital. PMID:26881082

  19. Integrated Genome-wide association and hypothalamus eQTL studies indicate a link between the circadian rhythm-related gene PER1 and coping behavior.


    Ponsuksili, Siriluck; Zebunke, Manuela; Murani, Eduard; Trakooljul, Nares; Krieter, Joachim; Puppe, Birger; Schwerin, Manfred; Wimmers, Klaus


    Animal personality and coping styles are basic concepts for evaluating animal welfare. Struggling response of piglets in so-called backtests early in life reflects their coping strategy. Behavioral reactions of piglets in backtests have a moderate heritability, but their genetic basis largely remains unknown. Here, latency, duration and frequency of struggling attempts during one-minute backtests were repeatedly recorded of piglets at days 5, 12, 19, and 26. A genome-wide association study for backtest traits revealed 465 significant SNPs (FDR ≤ 0.05) mostly located in QTL (quantitative trait locus) regions on chromosome 3, 5, 12 and 16. In order to capture genes in these regions, 37 transcripts with significant SNPs were selected for expressionQTL analysis in the hypothalamus. Eight genes (ASGR1, CPAMD8, CTC1, FBXO39, IL19, LOC100511790, RAD51B, UBOX5) had cis- and five (RANGRF, PER1, PDZRN3, SH2D4B, LONP2) had trans-expressionQTL. In particular, for PER1, with known physiological implications for maintenance of circadian rhythms, a role in coping behavior was evidenced by confirmed association in an independent population. For CTC1 a cis-expression QTL and the consistent relationship of gene polymorphism, mRNA expression level and backtest traits promoted its link to coping style. GWAS and eQTL analyses uncovered positional and functional gene candidates for coping behavior.

  20. Dual regulation of clock gene Per2 expression in discrete brain areas by the circadian pacemaker and methamphetamine-induced oscillator in rats.


    Natsubori, Akiyo; Honma, Ken-ichi; Honma, Sato


    Behavioral rhythms induced by methamphetamine (MAP) treatment in rats are independent of the circadian pacemaker in the suprachiasmatic nucleus (SCN). To know the site and mechanism of an underlying oscillation (MAP-induced oscillator; MAO), extra-SCN circadian rhythms in the discrete brain areas were examined in rats with and without the SCN. To fix the phase of MAO, MAP was supplied in drinking water at a restricted time of day for 14 days (R-MAP) and subsequently given ad libitum (ad-MAP). Plain water was given to the controls at the same restricted time (R-Water). Clock gene Per2 expression was measured by a bioluminescence reporter in cultured brain tissues. In SCN-intact rats, MAO was induced by R-MAP and behavioral rhythms were phase-delayed from the restricted time under ad-MAP with relative coordination. Circadian Per2 rhythms in R-MAP rats were not affected in the SCN but were slightly phase-advanced in the olfactory bulb (OB), caudate-putamen (CPU) and substantia nigra (SN) as compared with R-Water rats. Following SCN lesion, R-MAP-induced MAO phase-shifted more slowly and did not show a sign of relative coordination. In these rats, circadian Per2 rhythms were significantly phase-shifted in the OB and SN as compared with SCN-intact rats. These findings indicate that MAO was induced by MAP given at a restricted time of day in association with phase-shifts of the extra-SCN circadian oscillators in the brain dopaminergic areas. The findings also suggest that these extra-SCN oscillators are the components of MAO and receive dual regulation by MAO and the SCN circadian pacemaker.

  1. Glucose Alters Per2 Rhythmicity Independent of AMPK, Whereas AMPK Inhibitor Compound C Causes Profound Repression of Clock Genes and AgRP in mHypoE-37 Hypothalamic Neurons

    PubMed Central

    Oosterman, Johanneke E.; Belsham, Denise D.


    Specific neurons in the hypothalamus are regulated by peripheral hormones and nutrients to maintain proper metabolic control. It is unclear if nutrients can directly control clock gene expression. We have therefore utilized the immortalized, hypothalamic cell line mHypoE-37, which exhibits robust circadian rhythms of core clock genes. mHypoE-37 neurons were exposed to 0.5 or 5.5 mM glucose, comparable to physiological levels in the brain. Per2 and Bmal1 mRNAs were assessed every 3 hours over 36 hours. Incubation with 5.5 mM glucose significantly shortened the period and delayed the phase of Per2 mRNA levels, but had no effect on Bmal1. Glucose had no significant effect on phospho-GSK3β, whereas AMPK phosphorylation was altered. Thus, the AMPK inhibitor Compound C was utilized, and mRNA levels of Per2, Bmal1, Cryptochrome1 (Cry1), agouti-related peptide (AgRP), carnitine palmitoyltransferase 1C (Cpt1c), and O-linked N-acetylglucosamine transferase (Ogt) were measured. Remarkably, Compound C dramatically reduced transcript levels of Per2, Bmal1, Cry1, and AgRP, but not Cpt1c or Ogt. Because AMPK was not inhibited at the same time or concentrations as the clock genes, we suggest that the effect of Compound C on gene expression occurs through an AMPK-independent mechanism. The consequences of inhibition of the rhythmic expression of clock genes, and in turn downstream metabolic mediators, such as AgRP, could have detrimental effects on overall metabolic processes. Importantly, the effects of the most commonly used AMPK inhibitor Compound C should be interpreted with caution, considering its role in AMPK-independent repression of specific genes, and especially clock gene rhythm dysregulation. PMID:26784927

  2. Cardiac Per2 Functions as Novel Link between Fatty Acid Metabolism and Myocardial Inflammation during Ischemia and Reperfusion Injury of the Heart

    PubMed Central

    Bonney, Stephanie; Kominsky, Doug; Brodsky, Kelley; Eltzschig, Holger; Walker, Lori; Eckle, Tobias


    Disruption of peripheral circadian rhyme pathways dominantly leads to metabolic disorders. Studies on circadian rhythm proteins in the heart indicated a role for Clock or Per2 in cardiac metabolism. In contrast to Clock−/−, Per2−/− mice have larger infarct sizes with deficient lactate production during myocardial ischemia. To test the hypothesis that cardiac Per2 represents an important regulator of cardiac metabolism during myocardial ischemia, we measured lactate during reperfusion in Per1−/−, Per2−/− or wildtype mice. As lactate measurements in whole blood indicated an exclusive role of Per2 in controlling lactate production during myocardial ischemia, we next performed gene array studies using various ischemia-reperfusion protocols comparing wildtype and Per2−/− mice. Surprisingly, high-throughput gene array analysis revealed dominantly lipid metabolism as the differentially regulated pathway in wildtype mice when compared to Per2−/−. In all ischemia-reperfusion protocols used, the enzyme enoyl-CoA hydratase, which is essential in fatty acid beta-oxidation, was regulated in wildtype animals only. Studies using nuclear magnet resonance imaging (NMRI) confirmed altered fatty acid populations with higher mono-unsaturated fatty acid levels in hearts from Per2−/− mice. Unexpectedly, studies on gene regulation during reperfusion revealed solely pro inflammatory genes as differentially regulated ‘Per2-genes’. Subsequent studies on inflammatory markers showed increasing IL-6 or TNFα levels during reperfusion in Per2−/− mice. In summary, these studies reveal an important role of cardiac Per2 for fatty acid metabolism and inflammation during myocardial ischemia and reperfusion, respectively. PMID:23977055

  3. Control of mammalian circadian rhythm by CKIepsilon-regulated proteasome-mediated PER2 degradation.


    Eide, Erik J; Woolf, Margaret F; Kang, Heeseog; Woolf, Peter; Hurst, William; Camacho, Fernando; Vielhaber, Erica L; Giovanni, Andrew; Virshup, David M


    The mammalian circadian regulatory proteins PER1 and PER2 undergo a daily cycle of accumulation followed by phosphorylation and degradation. Although phosphorylation-regulated proteolysis of these inhibitors is postulated to be essential for the function of the clock, inhibition of this process has not yet been shown to alter mammalian circadian rhythm. We have developed a cell-based model of PER2 degradation. Murine PER2 (mPER2) hyperphosphorylation induced by the cell-permeable protein phosphatase inhibitor calyculin A is rapidly followed by ubiquitination and degradation by the 26S proteasome. Proteasome-mediated degradation is critically important in the circadian clock, as proteasome inhibitors cause a significant lengthening of the circadian period in Rat-1 cells. CKIepsilon (casein kinase Iepsilon) has been postulated to prime PER2 for degradation. Supporting this idea, CKIepsilon inhibition also causes a significant lengthening of circadian period in synchronized Rat-1 cells. CKIepsilon inhibition also slows the degradation of PER2 in cells. CKIepsilon-mediated phosphorylation of PER2 recruits the ubiquitin ligase adapter protein beta-TrCP to a specific site, and dominant negative beta-TrCP blocks phosphorylation-dependent degradation of mPER2. These results provide a biochemical mechanism and functional relevance for the observed phosphorylation-degradation cycle of mammalian PER2. Cell culture-based biochemical assays combined with measurement of cell-based rhythm complement genetic studies to elucidate basic mechanisms controlling the mammalian clock.

  4. Imported PER-1 producing Pseudomonas aeruginosa, PER-1 producing Acinetobacter baumanii and VIM-2-producing Pseudomonas aeruginosa strains in Hungary

    PubMed Central

    Szabó, Dora; Szentandrássy, Julia; Juhász, Zsuzsa; Katona, Katalin; Nagy, Károly; Rókusz, László


    Introduction Pseudomonas aeruginosa and Acinetobacter baumanii are important nosocomial pathogens with wide intrinsic resistance. However, due to the dissemination of the acquired resistance mechanisms, such as extended-spectrum beta-lactamase (ESBL) and metallo beta-lactamase (MBL) production, multidrug resistant strains have been isolated more often. Case presentation We report a case of a Hungarian tourist, who was initially hospitalized in Egypt and later transferred to Hungary. On the day of admission PER-1-producing P. aeruginosa, PER-1 producing A. baumannii, SHV-5-producing Klebsiella pneumoniae and VIM-2-producing P. aeruginosa isolates were subcultured from the patient's samples in Hungary. Comparing the pulsed-field gel electrophoresis (PFGE) patterns of the P. aeruginosa strains from the patient to the P. aeruginosa strains occurring in this hospital, we can state that the PER-1-producing P. aeruginosa and VIM-2-producing P. aeruginosa had external origin. Conclusion This is the first report of PER-1-producing P. aeruginosa,and PER-1-producing A. baumanii strains in Hungary. This case highlights the importance of spreading of the beta-lactamase-mediated resistance mechanisms between countries and continents, showing the importance of careful screening and the isolation of patients arriving from a different country. PMID:18513394

  5. Negative reciprocal regulation between Sirt1 and Per2 modulates the circadian clock and aging

    PubMed Central

    Wang, Rui-Hong; Zhao, Tingrui; Cui, Kairong; Hu, Gangqing; Chen, Qiang; Chen, Weiping; Wang, Xin-Wei; Soto-Gutierrez, Alejandro; Zhao, Keji; Deng, Chu-Xia


    Sirtuin 1 (SIRT1) is involved in both aging and circadian-clock regulation, yet the link between the two processes in relation to SIRT1 function is not clear. Using Sirt1-deficient mice, we found that Sirt1 and Period 2 (Per2) constitute a reciprocal negative regulation loop that plays important roles in modulating hepatic circadian rhythmicity and aging. Sirt1-deficient mice exhibited profound premature aging and enhanced acetylation of histone H4 on lysine16 (H4K16) in the promoter of Per2, the latter of which leads to its overexpression; in turn, Per2 suppresses Sirt1 transcription through binding to the Sirt1 promoter at the Clock/Bmal1 site. This negative reciprocal relationship between SIRT1 and PER2 was also observed in human hepatocytes. We further demonstrated that the absence of Sirt1 or the ectopic overexpression of Per2 in the liver resulted in a dysregulated pace of the circadian rhythm. The similar circadian rhythm was also observed in aged wild type mice. The interplay between Sirt1 and Per2 modulates aging gene expression and circadian-clock maintenance. PMID:27346580

  6. Phase Resetting Light Pulses Induce Per1 and Persistent Spike Activity in a Subpopulation of Biological Clock Neurons

    PubMed Central

    Kuhlman, Sandra J.; Silver, Rae; Le Sauter, Joseph; Bult-Ito, Abel; McMahon, Douglas G.


    The endogenous circadian clock of the mammalian suprachiasmatic nucleus (SCN) can be reset by light to synchronize the biological clock of the brain with the external environment. This process involves induction of immediate-early genes such as the circadian clock gene Period1 (Per1) and results in a stable shift in the timing of behavioral and physiological rhythms on subsequent days. The mechanisms by which gene activation permanently alters the phase of clock neuron activity are unknown. To study the relationship between acute gene activation and persistent changes in the neurophysiology of SCN neurons, we recorded from SCN neurons marked with a dynamic green fluorescent protein (GFP) reporter of Per1 gene activity. Phase-resetting light pulses resulted in Per1 induction in a distinct subset of SCN neurons that also exhibited a persistent increase in action potential frequency 3–5 hr after a light pulse. By simultaneously quantifying Per1 gene activation and spike frequency in individual neurons, we found that the degree of Per1 induction was highly correlated with neuronal spike frequency on a cell-by-cell basis. Increased neuronal activity was mediated by membrane potential depolarization as a result of a reduction in outward potassium current. Double-label immunocytochemistry revealed that vasoactive intestinal peptide (VIP)-expressing cells, but not arginine vasopressin (AVP)-expressing cells, exhibited significant Per1 induction by light pulses. Rhythmic GFP expression occurred in both VIP and AVP neurons. Our results indicate that the steps that link acute molecular events to permanent changes in clock phase involve persistent suppression of potassium current, downstream of Per1 gene induction, in a specific subset of Per1-expressing neurons enriched for VIP. PMID:12598633

  7. Food-anticipatory activity and liver per1-luc activity in diabetic transgenic rats

    NASA Technical Reports Server (NTRS)

    Davidson, Alec J.; Stokkan, Karl-Arne; Yamazaki, Shin; Menaker, Michael


    The mammalian Per1 gene is an important component of the core cellular clock mechanism responsible for circadian rhythms. The rodent liver and other tissues rhythmically express Per1 in vitro but typically damp out within a few cycles. In the liver, the peak of this rhythm occurs in the late subjective night in an ad lib-fed rat, but will show a large phase advance in response to restricted availability of food during the day. The relationship between this shift in the liver clock and food-anticipatory activity (FAA), the circadian behavior entrained by daily feeding, is currently unknown. Insulin is released during feeding in mammals and could serve as an entraining signal to the liver. To test the role of insulin in the shift in liver Per1 expression and the generation of FAA, per-luciferase transgenic rats were made diabetic with a single injection of streptozotocine. Following 1 week of restricted feeding and locomotor activity monitoring, liver was collected for per-luc recording. In two separate experiments, FAA emerged and liver Per1 phase-shifted in response to daytime 8-h food restriction. The results rule out insulin as a necessary component of this system.

  8. Regulation of behavioral circadian rhythms and clock protein PER1 by the deubiquitinating enzyme USP2

    PubMed Central

    Yang, Yaoming; Duguay, David; Bédard, Nathalie; Rachalski, Adeline; Baquiran, Gerardo; Na, Chan Hyun; Fahrenkrug, Jan; Storch, Kai-Florian; Peng, Junmin; Wing, Simon S.; Cermakian, Nicolas


    Summary Endogenous 24-hour rhythms are generated by circadian clocks located in most tissues. The molecular clock mechanism is based on feedback loops involving clock genes and their protein products. Post-translational modifications, including ubiquitination, are important for regulating the clock feedback mechanism. Previous work has focused on the role of ubiquitin ligases in the clock mechanism. Here we show a role for the rhythmically-expressed deubiquitinating enzyme ubiquitin specific peptidase 2 (USP2) in clock function. Mice with a deletion of the Usp2 gene (Usp2 KO) display a longer free-running period of locomotor activity rhythms and altered responses of the clock to light. This was associated with altered expression of clock genes in synchronized Usp2 KO mouse embryonic fibroblasts and increased levels of clock protein PERIOD1 (PER1). USP2 can be coimmunoprecipitated with several clock proteins but directly interacts specifically with PER1 and deubiquitinates it. Interestingly, this deubiquitination does not alter PER1 stability. Taken together, our results identify USP2 as a new core component of the clock machinery and demonstrate a role for deubiquitination in the regulation of the circadian clock, both at the level of the core pacemaker and its response to external cues. PMID:23213472

  9. Fibroblast PER2 Circadian Rhythmicity Depends on Cell Density

    PubMed Central

    Noguchi, Takako; Wang, Lexie L.; Welsh, David K.


    Like neurons in the suprachiasmatic nucleus (SCN), the master circadian pacemaker in the brain, single fibroblasts can function as independent oscillators. In the SCN, synaptic and paracrine signaling among cells creates a robust, synchronized circadian oscillation, whereas there is no evidence for such integration in fibroblast cultures. However, interactions among single-cell fibroblast oscillators cannot be completely excluded, because fibroblasts were not isolated in previous work. In this study, we tested the autonomy of fibroblasts as single-cell circadian oscillators in high and low density culture, by single-cell imaging of cells from PER2::LUC circadian reporter mice. We found greatly reduced PER2::LUC rhythmicity in low density cultures, which could result from lack of either constitutive or rhythmic paracrine signals from neighboring fibroblasts. To discriminate between these two possibilities, we mixed PER2::LUC wild type (WT) cells with non-luminescent, non-rhythmic Bmal1−/− cells, so that density of rhythmic cells was low but overall cell density remained high. In this condition, WT cells showed clear rhythmicity similar to high density cultures. We also mixed PER2::LUC WT cells with non-luminescent, long period Cry2−/− cells. In this condition, WT cells showed a period no different from cells cultured with rhythmic WT cells or non-rhythmic Bmal1−/− cells. In previous work, we found that low K+ suppresses fibroblast rhythmicity, and we and others have found that either low K+ or low Ca2+ suppresses SCN rhythmicity. Therefore, we attempted to rescue rhythmicity of low density fibroblasts with high K+ (21 mM), high Ca2+ (3.6 mM), or conditioned medium. Conditioned medium from high density fibroblast cultures rescued rhythmicity of low density cultures, whereas high K+ or Ca2+ medium did not consistently rescue rhythmicity. These data suggest that fibroblasts require paracrine signals from adjacent cells for normal expression of rhythmicity

  10. Construction of recombinant pEGFP-N1-hPer2 plasmid and its expression in osteosarcoma cells.


    Cheng, Anyuan; Zhang, Yan; Mei, Hongjun; Fang, Shuo; Ji, Peng; Yang, Jian; Yu, Ling; Guo, Weichun


    The aim of this study was to construct the eukaryotic expression vector pEGFP-N1-hPer2 and assess its expression in the human osteosarcoma cell line MG63. Total mRNA was extracted from human osteosarcoma MG63 cells, the human period 2 (hPer2) gene was obtained by reverse transcription-polymerase chain reaction (RT-PCR) and cloned into the pEGFP-N1 vector, then the recombinant pEGFP-N1-hPer2 plasmid was constructed and transfected into MG63 cells using Lipofectamine 2000. The expression of hPer2 in MG63 cells was measured by quantitative RT-PCR and western blot analysis. The accurate construction of pEGFP-N1-hPer2 was verified by double enzyme digestion and DNA sequencing. hPer2 gene expression in the transfected cells was assessed by RT-qPCR and western blot analysis. In conclusion, the recombinant pEGFP-N1-hPer2 plasmid was constructed successfully, and expressed effectively in MG63 cells.

  11. Early doors (Edo) mutant mouse reveals the importance of period 2 (PER2) PAS domain structure for circadian pacemaking

    PubMed Central

    Militi, Stefania; Maywood, Elizabeth S.; Sandate, Colby R.; Chesham, Johanna E.; Parsons, Michael J.; Vibert, Jennifer L.; Joynson, Greg M.; Partch, Carrie L.; Hastings, Michael H.; Nolan, Patrick M.


    The suprachiasmatic nucleus (SCN) defines 24 h of time via a transcriptional/posttranslational feedback loop in which transactivation of Per (period) and Cry (cryptochrome) genes by BMAL1–CLOCK complexes is suppressed by PER–CRY complexes. The molecular/structural basis of how circadian protein complexes function is poorly understood. We describe a novel N-ethyl-N-nitrosourea (ENU)-induced mutation, early doors (Edo), in the PER-ARNT-SIM (PAS) domain dimerization region of period 2 (PER2) (I324N) that accelerates the circadian clock of Per2Edo/Edo mice by 1.5 h. Structural and biophysical analyses revealed that Edo alters the packing of the highly conserved interdomain linker of the PER2 PAS core such that, although PER2Edo complexes with clock proteins, its vulnerability to degradation mediated by casein kinase 1ε (CSNK1E) is increased. The functional relevance of this mutation is revealed by the ultrashort (<19 h) but robust circadian rhythms in Per2Edo/Edo; Csnk1eTau/Tau mice and the SCN. These periods are unprecedented in mice. Thus, Per2Edo reveals a direct causal link between the molecular structure of the PER2 PAS core and the pace of SCN circadian timekeeping. PMID:26903623

  12. Compartmentalized expression of light-induced clock genes in the suprachiasmatic nucleus of the diurnal grass rat (Arvicanthis niloticus)

    PubMed Central

    Ramanathan, Chidambaram; Campbell, Amy; Tomczak, Ashley; Nunez, Antonio A.; Smale, Laura; Yan, Lily


    Photic responses of the circadian system are mediated through light-induced clock gene expression in the suprachiasmatic nucleus (SCN). In nocturnal rodents, depending on the timing of light exposure, Per1 and Per2 gene expression shows distinct compartmentalized patterns that correspond to the behavioral responses. Whether the gene-and region-specific induction patterns are unique to nocturnal animals, or are also present in diurnal species is unknown. We explored this question by examining the light-induced Per1 and Per2 gene expression in functionally distinct SCN sub regions, using diurnal grass rats Arvicanthis niloticus. Light exposure during nighttime induced Per1 and Per2 expression in the SCN, showing unique spatiotemporal profiles depending on the phase of the light exposure. After a phase delaying light pulse (LP) in the early night, strong Per1 induction was observed in the retinorecipient core region of the SCN, while strong Per2 induction was observed throughout the entire SCN. After a phase advancing LP in the late night, Per1 was first induced in the core and then extended into the whole SCN, accompanied by a weak Per2 induction. This compartmentalized expression pattern is very similar to that observed in nocturnal rodents, suggesting that the same molecular and intercellular pathways underlying acute photic responses are present in both diurnal and nocturnal species. However, after a LP in early subjective day, which induces phase advances in diurnal grass rats, but not in nocturnal rodents, we did not observe any Per1 or Per2 induction in the SCN. This result suggests that in spite of remarkable similarities in the SCN of diurnal and nocturnal rodents, unique mechanisms are involved in mediating the phase shifts of diurnal animals during the subjective day. PMID:19393297

  13. PER2 variants are associated with abdominal obesity, psycho-behavioral factors and attrition in the dietary treatment of obesity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The purpose was to test for association between polymorphisms in the circadian clock-related gene PER2 and attrition in patients prone to withdrawal from a behavioral weight-reduction-program based on the Mediterranean Diet. 454 overweight/obese subjects (women= 380, men= 74), aged 20-65 years, who ...

  14. Circadian Rhythms of PER2::LUC in Individual Primary Mouse Hepatocytes and Cultures

    PubMed Central

    Molyneux, Penny C.; Yu, Jimmy K.; Li, Alexander S.; Leise, Tanya L.; Harrington, Mary E.


    Background Hepatocytes, the parenchymal cells of the liver, express core clock genes, such as Period2 and Cryptochrome2, which are involved in the transcriptional/translational feedback loop of the circadian clock. Whether or not the liver is capable of sustaining rhythms independent of a central pacemaker is controversial. Whether and how circadian information may be shared among cells in the liver in order to sustain oscillations is currently unknown. Results In this study we isolated primary hepatocytes from transgenic Per2Luc mice and used bioluminescence as a read-out of the state of the circadian clock. Hepatocytes cultured in a collagen gel sandwich configuration exhibited persistent circadian rhythms for several weeks. The amplitude of the rhythms damped, but medium changes consistently reset the phase and amplitude of the cultures. Cry2−/− Per2Luc cells oscillated robustly and expressed a longer period. Co-culturing with wildtype cells did not significantly shorten the period, indicating that coupling among hepatocytes is insufficient to synchronize cells with significantly differing periods. However, spatial patterns revealed by cellular imaging of wildtype cultures provided evidence of weak local coupling among the hepatocytes. Conclusions Our results with primary hepatocyte cultures demonstrate that cultured hepatocytes are weakly coupled. While this coupling is not sufficient to sustain global synchrony, it does increase local synchrony, which may stabilize the circadian rhythms of peripheral oscillators, such as the liver, against noise in the entraining signals. PMID:24498336


    PubMed Central

    Metz, Richard P.; Qu, Xiaoyu; Laffin, Brian; Earnest, David; Porter, Weston W.


    Mouse mammary epithelial cells (HC-11) and mammary tissues were analyzed for developmental changes in circadian clock, cellular proliferation and differentiation marker genes. Expression of the clock genes, Per1 and Bmal1, were elevated in differentiated HC-11 cells whereas Per2 mRNA levels were higher in undifferentiated cells. This differentiation-dependent profile of clock gene expression was consistent with that observed in mouse mammary glands as Per1 and Bmal1 mRNA levels were elevated in late pregnant and lactating mammary tissues, while Per2 expression was higher in proliferating virgin and early pregnant glands. In both HC-11 cells and mammary glands, elevated Per2 expression was positively correlated with c-Myc and Cyclin D1 mRNA levels while Per1 and Bmal1 expression changed in conjunction with ß-casein mRNA levels. Interestingly, developmental stage had differential effects on rhythms of clock gene expression in the mammary gland. These data suggest that circadian clock genes may play a role in mouse mammary gland development and differentiation. PMID:16261617

  16. CLOCK, PER2 and BMAL1 DNA methylation: association with obesity and metabolic syndrome characteristics and monounsaturated fat intake.


    Milagro, Fermín I; Gómez-Abellán, Purificación; Campión, Javier; Martínez, J Alfredo; Ordovás, Jose M; Garaulet, Marta


    The circadian clock system instructs 24-h rhythmicity on gene expression in essentially all cells, including adipocytes, and epigenetic mechanisms may participate in this regulation. The aim of this research was to investigate the influence of obesity and metabolic syndrome (MetS) features in clock gene methylation and the involvement of these epigenetic modifications in the outcomes. Sixty normal-weight, overweight and obese women followed a 16-weeks weight reduction program. DNA methylation levels at different CpG sites of CLOCK, BMAL1 and PER2 genes were analyzed by Sequenom's MassARRAY in white blood cells obtained before the treatment. Statistical differences between normal-weight and overweight + obese subjects were found in the methylation status of different CpG sites of CLOCK (CpGs 1, 5-6, 8 and 11-14) and, with lower statistical significance, in BMAL1 (CpGs 6-7, 8, 15 and 16-17). The methylation pattern of different CpG sites of the three genes showed significant associations with anthropometric parameters such as body mass index and adiposity, and with a MetS score. Moreover, the baseline methylation levels of CLOCK CpG 1 and PER2 CpGs 2-3 and 25 correlated with the magnitude of weight loss. Interestingly, the percentage of methylation of CLOCK CpGs 1 and 8 showed associations with the intake of monounsaturated and polyunsaturated fatty acids. This study demonstrates for the first time an association between methylation status of CpG sites located in clock genes (CLOCK, BMAL1 and PER2) with obesity, MetS and weight loss. Moreover, the methylation status of different CpG sites in CLOCK and PER2 could be used as biomarkers of weight-loss success, particularly CLOCK CPGs 5-6.

  17. Fibroblast Circadian Rhythms of PER2 Expression Depend on Membrane Potential and Intracellular Calcium

    PubMed Central

    Noguchi, Takako; Wang, Connie W.; Pan, Haiyun


    The suprachiasmatic nucleus (SCN) of the hypothalamus synchronizes circadian rhythms of cells and tissues throughout the body. In SCN neurons, rhythms of clock gene expression are suppressed by manipulations that hyperpolarize the plasma membrane or lower intracellular Ca2+. However, whether clocks in other cells also depend on membrane potential and calcium is unknown. In this study, we investigate the effects of membrane potential and intracellular calcium on circadian rhythms in mouse primary fibroblasts. Rhythms of clock gene expression were monitored using a PER2::LUC knockin reporter. We found that rhythms were lost or delayed at lower (hyperpolarizing) K+ concentrations. Bioluminescence imaging revealed that this loss of rhythmicity in cultures was due to loss of rhythmicity of single cells rather than desynchrony among cells. In lower Ca2+ concentrations, rhythms were advanced or had shorter periods. Buffering intracellular Ca2+ by the calcium chelator 1,2-Bis(2-aminophenoxy) ethane-N,N,N′,N′-tetraacetic acid tetrakis acetoxymethyl ester (BAPTA-AM) or manipulation of IP3-sensitive intracellular calcium stores by thapsigargin delayed rhythms. These results suggest that the circadian clock in fibroblasts, as in SCN neurons, is regulated by membrane potential and Ca2+. Changes in intracellular Ca2+ may mediate the effects of membrane potential that we observed. PMID:22734566

  18. Fibroblast circadian rhythms of PER2 expression depend on membrane potential and intracellular calcium.


    Noguchi, Takako; Wang, Connie W; Pan, Haiyun; Welsh, David K


    The suprachiasmatic nucleus (SCN) of the hypothalamus synchronizes circadian rhythms of cells and tissues throughout the body. In SCN neurons, rhythms of clock gene expression are suppressed by manipulations that hyperpolarize the plasma membrane or lower intracellular Ca(2+). However, whether clocks in other cells also depend on membrane potential and calcium is unknown. In this study, the authors investigate the effects of membrane potential and intracellular calcium on circadian rhythms in mouse primary fibroblasts. Rhythms of clock gene expression were monitored using a PER2::LUC knockin reporter. Rhythms were lost or delayed at lower (hyperpolarizing) K(+) concentrations. Bioluminescence imaging revealed that this loss of rhythmicity in cultures was due to loss of rhythmicity of single cells rather than loss of synchrony among cells. In lower Ca(2+) concentrations, rhythms were advanced or had shorter periods. Buffering intracellular Ca(2+) by the calcium chelator 1,2-Bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid tetrakis acetoxymethyl ester (BAPTA-AM) or manipulation of inositol triphosphate (IP(3))-sensitive intracellular calcium stores by thapsigargin delayed rhythms. These results suggest that the circadian clock in fibroblasts, as in SCN neurons, is regulated by membrane potential and Ca(2+). Changes in intracellular Ca(2+) may mediate the effects of membrane potential observed in this study.

  19. Per2 participates in AKT-mediated drug resistance in A549/DDP lung adenocarcinoma cells.


    Chen, Bo; Tan, Yaoxi; Liang, Yan; Li, Yan; Chen, Lei; Wu, Shuangshuang; Xu, Wei; Wang, Yan; Zhao, Weihong; Wu, Jianqing


    Period2 (Per2) is a key mammalian circadian clock protein, and additionally has a tumor suppressive function. The present study aimed to investigate its role in drug resistance in A549/cisplatin (DDP) lung adenocarcinoma cells. Per2 knockdown and overexpression in A549/DDP cells were used to compare cell proliferation (by MTT assay), apoptosis (active-caspase 3 western blot) and clone forming assay. The activation of AKT/mechanistic target of rapamycin (mTOR) was investigated by a western blot assay. The Per2 expression level was decreased in A549/DDP cells compared with A549 cells. Per2 knockdown by short hairpin RNA protects A549/DDP cells from apoptosis, and promotes proliferation and migration. Per2 knockdown results in increased activation of the phosphoinositide 3-kinase (PI3K)/AKT/mTOR signaling pathway. Overexpression of Per2 in A549/DDP cells may reduce the activity of the PI3K/AKT/mTOR signaling pathway, and promote apoptosis of A549 cells. The results of the present study suggest that Per2 participates in AKT-mediated drug resistance in A549/DDP lung adenocarcinoma cells.

  20. Per2 participates in AKT-mediated drug resistance in A549/DDP lung adenocarcinoma cells

    PubMed Central

    Chen, Bo; Tan, Yaoxi; Liang, Yan; Li, Yan; Chen, Lei; Wu, Shuangshuang; Xu, Wei; Wang, Yan; Zhao, Weihong; Wu, Jianqing


    Period2 (Per2) is a key mammalian circadian clock protein, and additionally has a tumor suppressive function. The present study aimed to investigate its role in drug resistance in A549/cisplatin (DDP) lung adenocarcinoma cells. Per2 knockdown and overexpression in A549/DDP cells were used to compare cell proliferation (by MTT assay), apoptosis (active-caspase 3 western blot) and clone forming assay. The activation of AKT/mechanistic target of rapamycin (mTOR) was investigated by a western blot assay. The Per2 expression level was decreased in A549/DDP cells compared with A549 cells. Per2 knockdown by short hairpin RNA protects A549/DDP cells from apoptosis, and promotes proliferation and migration. Per2 knockdown results in increased activation of the phosphoinositide 3-kinase (PI3K)/AKT/mTOR signaling pathway. Overexpression of Per2 in A549/DDP cells may reduce the activity of the PI3K/AKT/mTOR signaling pathway, and promote apoptosis of A549 cells. The results of the present study suggest that Per2 participates in AKT-mediated drug resistance in A549/DDP lung adenocarcinoma cells. PMID:28123577

  1. Detection of blaPER-1 & blaOxa10 among imipenem resistant isolates of Pseudomonas aeruginosa isolated from burn patients hospitalized in Shiraz Burn Hospital

    PubMed Central

    Emami, Amir; Bazargani, Abdollah; Mohammadi, Ali Akbar; Zardosht, Mitra; Seyed Jafari, Seyed Morteza


    Background and Objectives: Pseudomonas aeruginosa is one of the most important Gram negative opportunistic bacteria which causes infection among burn patients. Resistance to the antibiotics in this group of bacteria is increased due to the activity of extended spectrum β-lactamase (ESBLs) genes. In the current study, we investigated the prevalence of two genes (blaPER-1 & blaOxa10) related β-lactamase genes among imipenem resistance clinical isolates of P. aeruginosa in hospitalized patients. Materials and Methods: From May 2010 to March 2011, 270 P. aeruginosa isolated from hospitalized burned patients’ wounds in Shiraz Burn Hospital, were tested for Imipenem resistance by disk diffusion method. Presence of ESBLs exo-enzyme, blaPER-1 and blaOxa10 genes were also evaluated in the resistant isolate. Results: 210 (77.7%) of 270 P. aeruginosa isolates were resistant to imipenem. blaPER-1 and blaOxa10 were detected among 168 (80.0%) of imipenem resistant isolates. Furthermore, 160 (76.2%) of them had blaOxa10 gene and 84 (40.0%) of them had blaPER-1 while 63 (30.0%) resistant isolates contained both genes simultaneously. Conclusion: This study showed a high prevalence of blaPER-1 and blaOxa10 genes in hospitalized burn patients in south west of Iran. Therefore, it’s highly recommended to perform such tests routinely to evaluate the resistance pattern in order to better antibiotic selection in the burned patients. PMID:26644867

  2. Exploring the Landscape of Diazabicyclooctane (DBO) Inhibition: Avibactam (AVI) Inactivation of PER-2 β-Lactamase.


    Ruggiero, Melina; Papp-Wallace, Krisztina M; Taracila, Magdalena A; Mojica, Maria F; Bethel, Christopher R; Rudin, Susan D; Zeiser, Elise T; Gutkind, Gabriel; Bonomo, Robert A; Power, Pablo


    PER β-lactamases are an emerging family of extended-spectrum β-lactamases (ESBL) found in Gram negative bacteria. PER β-lactamases are unique among class A enzymes as they possess an inverted Ω loop and extended B3 β-strand. These singular structural differences are hypothesized to contribute to their hydrolytic profile against oxyimino-cephalosporins (e.g., cefotaxime and ceftazidime). Here, we tested the ability of avibactam (AVI), a novel non-β-lactam β-lactamase inhibitor to inactivate PER-2. Interestingly, the PER-2 inhibition constants (i.e., k2/K = 2 ± 0.1 × 10(3) M(-1)s(-1)) that were obtained when testing AVI were reminiscent of values observed testing class C and D β-lactamases (i.e., k2/K range ≈10(3) M(-1)s(-1)) and not class A β-lactamases (i.e., k2/K range, 10(4)-10(5) M(-1)s(-1)). Once AVI was bound, AVI formed a stable complex with PER-2 as observed via mass spectrometry (e.g., 31,389 ± 3 amu → 31,604 ± 3 amu for 24 hr). Molecular modeling of PER-2 with AVI showed that the carbonyl of AVI was located in the oxyanion hole of the β-lactamase and that the sulfate of AVI formed interactions with the β-lactam carboxylate binding site of the PER-2 β-lactamase. However, hydrophobic patches near the PER-2 active site (by Ser70 and B3-B4 β-strands) may affect the binding of necessary catalytic water molecules thus slowing acylation (k2/K) of AVI onto PER-2. As a result, the magnitude of k2/K resembles class D enzymes. Similarities in electrostatics and hydrophobicity of the active site were also observed between OXA-48 and PER-2, while CTX-M-15 was more hydrophilic. To overcome the enhanced cephalosporinase activity of PER-2 β-lactamase, we tested β-lactam-AVI combinations. As a result of lowering MICs to ≤ 2 mg/L, the ceftaroline-AVI combination could represent a favorable therapeutic option against Enterobacteriaceae expressing blaPER-2 Our studies define the inactivation of the PER-2 ESBL by AVI and suggest that the biophysical

  3. Melatonin Entrains PER2::LUC Bioluminescence Circadian Rhythm in the Mouse Cornea

    PubMed Central

    Baba, Kenkichi; Davidson, Alec J.; Tosini, Gianluca


    Purpose Previous studies have reported the presence of a circadian rhythm in PERIOD2::LUCIFERASE (PER2::LUC) bioluminescence in mouse photoreceptors, retina, RPE, and cornea. Melatonin (MLT) modulates many physiological functions in the eye and it is believed to be one of the key circadian signals within the eye. The aim of the present study was to investigate the regulation of the PER2::LUC circadian rhythm in mouse cornea and to determine the role played by MLT. Methods Corneas were obtained from PER2::LUC mice and cultured to measure bioluminescence rhythmicity in isolated tissue using a Lumicycle or CCD camera. To determine the time-dependent resetting of the corneal circadian clocks in response to MLT or IIK7 (a melatonin type 2 receptor, MT2, agonist) was added to the cultured corneas at different times of the day. We also defined the location of the MT2 receptor within different corneal layers using immunohistochemistry. Results A long-lasting bioluminescence rhythm was recorded from cultured PER2::LUC cornea and PER2::LUC signal was localized to the corneal epithelium and endothelium. MLT administration in the early night delayed the cornea rhythm, whereas administration of MLT at late night to early morning advanced the cornea rhythm. Treatment with IIK7 mimicked the MLT phase-shifting effect. Consistent with these results, MT2 immunoreactivity was localized to the corneal epithelium and endothelium. Conclusions Our work demonstrates that MLT entrains the PER2::LUC bioluminescence rhythm in the cornea. Our data indicate that the cornea may represent a model to study the molecular mechanisms by which MLT affects the circadian clock. PMID:26207312

  4. Eugenol confers resistance to Tomato yellow leaf curl virus (TYLCV) by regulating the expression of SlPer1 in tomato plants.


    Sun, Wei-Jie; Lv, Wen-Jing; Li, Li-Na; Yin, Gan; Hang, Xiaofang; Xue, Yanfeng; Chen, Jian; Shi, Zhiqi


    Tomato yellow leaf curl virus (TYLCV) is one of the most devastating plant diseases, and poses a significant agricultural concern because of the lack of an efficient control method. Eugenol is a plant-derived natural compound that has been widely used as a food additive and in medicine. In the present study, we demonstrated the potential of eugenol to enhance the resistance of tomato plants to TYLCV. The anti-TYLCV efficiency of eugenol was significantly higher than that of moroxydine hydrochloride (MH), a widely used commercial antiviral agent. Eugenol application stimulated the production of endogenous nitric oxide (NO) and salicylic acid (SA) in tomato plants. The full-length cDNA of SlPer1, which has been suggested to be a host R gene specific to TYLCV, was isolated from tomato plants. A sequence analysis suggested that SlPer1 might be a nucleobase-ascorbate transporter (NAT) belonging to the permease family. The transcript levels of SlPer1 increased markedly in response to treatment with eugenol or TYLCV inoculation. The results of this study also showed that SlPer1 expression was strongly induced by SA, MeJA (jasmonic acid methyl ester), and NO. Thus, we propose that the increased transcription of SlPer1 contributed to the high anti-TYLCV efficiency of eugenol, which might involve in the generation of endogenous SA and NO. Such findings provide the basis for the development of eugenol as an environmental-friendly agricultural antiviral agent.

  5. NPY-Induced Phase Shifts of PER2::LUC Rhythms are Mediated by Long-Term Suppression of Neuronal Excitability in a Phase-Specific Manner

    PubMed Central

    Besing, Rachel C.; Hablitz, Lauren M.; Paul, Jodi R.; Johnson, Russell L.; Prosser, Rebecca A.; Gamble, Karen L.


    Endogenous circadian rhythms are entrained to the 24-h light/dark cycle by both light and nonphotic stimuli. During the day, nonphotic stimuli, such as novel-wheel induced exercise, produce large phase advances. Neuropeptide Y (NPY) release from the thalamus onto suprachiasmatic nucleus (SCN) neurons at least partially mediates this nonphotic signal. We examined the hypothesis that NPY-induced phase advances are accompanied by suppression of PER2 and are mediated by long-term depression of neuronal excitability in a phase-specific manner. First, we found that NPY-induced phase advances in PER2::LUC SCN cultures are largest when NPY (2.35 µM) is given in the early part of the day (circadian time [CT] 0–6). In addition, PER2::LUC levels in NPY-treated (compared to vehicle-treated) samples were suppressed beginning 6–7 h after treatment. Similar NPY application to organotypic Per1::GFP SCN cultures resulted in long-term suppression of spike rate of GFP+ cells when slices were treated with NPY during the early or middle of the day (zeitgeber time [ZT] 2 or 6), but not during the late day (ZT 10). Furthermore, 1-h bath application of NPY to acute SCN brain slices decreased general neuronal activity measured through extracellular recordings. Finally, NPY-induced phase advances of PER2::LUC rhythms were blocked by latent depolarization with 34.5 mM [K+] 3 h after NPY application. These results suggest that NPY-induced phase advances may be mediated by long-term depression of neuronal excitability. This model is consistent with findings in other brain regions that NPY-induced persistent hyperpolarization underlies mechanisms of energy homeostasis, anxiety-related behavior, and thalamocortical synchronous firing. PMID:22324550

  6. Warm water bath stimulates phase-shifts of the peripheral circadian clocks in PER2::LUCIFERASE mouse.


    Ohnishi, Nobuaki; Tahara, Yu; Kuriki, Daisuke; Haraguchi, Atsushi; Shibata, Shigenobu


    Circadian clocks in the peripheral tissues of mice are known to be entrained by pulse stimuli such as restricted feeding, novel wheel running, and several other agents. However, there are no reports on high temperature pulse-mediated entrainment on the phase-shift of peripheral clocks in vivo. Here we show that temperature treatment of mice for two days at 41°C, instead of 37°C, for 1-2 h during the inactive period, using a temperature controlled water bath stimulated phase-advance of peripheral clocks in the kidney, liver, and submandibular gland of PER2::LUCIFERASE mice. On the other hand, treatment for 2 days at 35°C ambient room temperature for 2 h did not cause a phase-advance. Maintenance of mice at 41°C in a water bath, sustained the core body temperature at 40-41°C. However, the use of 37°C water bath or the 35°C ambient room temperature elevated the core body temperature to 38.5°C, suggesting that at least a core body temperature of 40-41°C is necessary to cause phase-advance under light-dark cycle conditions. The temperature pulse stimulation at 41°C, instead of 37°C water bath for 2 h led to the elevated expression of Per1 and Hsp70 in the peripheral tissue of mice. In summary, the present study demonstrates that transient high temperature pulse using water bath during daytime causes phase-advance in mouse peripheral clocks in vivo. The present results suggest that hot water bath may affect the phase of peripheral clocks.

  7. Synchronization of PER1 protein in parabrachial nucleus in a natural model of food anticipatory activity.


    Juárez, Claudia; Morgado, Elvira; Waliszewski, Stefan M; Martínez, Armando J; Meza, Enrique; Caba, Mario


    Rabbit pups represent a natural model of food anticipatory activity (FAA). FAA is the behavioral output of a putative food entrainable oscillator (FEO). It had been suggested that the FEO is comprised of a distributed system of clocks that work in concert in response to gastrointestinal input by food. Scheduled food intake synchronizes several nuclei in the brain, and the hypothalamus has received particular attention. On the contrary, brainstem nuclei, despite being among the brain structures to first receive food cues, have been scarcely studied. Here we analysed by immunohistochemistry possible oscillation of FOS and PER1 proteins through a complete 24-h cycle in the dorsal vagal complex (DVC) and parabrachial nucleus (PBN) of 7-8-day-old rabbit pups scheduled to nurse during the night (02:00 h) or day (10:00 h), and also in fasted subjects to explore the possible persistence of oscillations. We found a clear induction of FOS that peaks 1.5 h after nursing in all nuclei studied. PER1 was only synchronized in the PBN, reaching highest values 12 h after nursing. Only PER1 oscillations persisted, with a shift, in fasted subjects. We conclude that the DVC nuclei are probably more related to the transmission of food cues to other brain regions, but that the PBN participates in the integration of information essential for FAA. Our results support previous findings suggesting that the DVC nuclei, but not PBN, are not essential for FAA. We suggest that PBN is a key component of the proposed distributed system of clocks involved in FAA.

  8. Synchronization of PER1 protein in Parabrachial nucleus in a natural model of food anticipatory activity

    PubMed Central

    Juárez, Claudia; Morgado, Elvira; Waliszewski, Stefan M.; Martínez, Armando J.; Meza, Enrique; Caba, Mario


    Rabbit pups represent a natural model of food anticipatory activity (FAA). FAA is the behavioral output of a putative food entrainable oscillator (FEO). It had been suggested that the FEO is comprised of a distributed system of clocks that work in concert in response to gastrointestinal input by food. Scheduled food intake synchronizes several nuclei in the brain, and the hypothalamus has received particular attention. On the contrary, brainstem nuclei, despite being among the brain structures to first receive food cues, have been scarcely studied. Here we analyzed by immunohistochemistry possible oscillation of FOS and PER1 proteins through a complete 24 h cycle in the dorsal vagal complex (DVC) and parabrachial nucleus (PBN) of seven to eight day old rabbit pups scheduled to nurse during the night (02:00) or day (10:00) and also in fasted subjects to explore the possible persistence of oscillations. We found a clear induction of FOS that peaks 1.5 h after nursing in all nuclei studied. PER1 was only synchronized in the PBN, reaching highest values 12 h after nursing. Only PER1 oscillations persisted in fasted subjects. We conclude that the DVC nuclei are probably more related to the transmission of food cues to other brain regions but that the PBN participates in the integration of information essential for FAA. Our results support previous findings suggesting that the DVC nuclei, but not PBN, are not essential for FAA. We suggest that PBN is a key component of the proposed distributed system of clocks involved in FAA. PMID:22471601

  9. Role of Per1-interacting protein of the suprachiasmatic nucleus in NGF mediated neuronal survival

    SciTech Connect

    Kiyama, Atsuko . E-mail:; Isojima, Yasushi; Nagai, Katsuya


    We previously identified Per1-interacting protein of the suprachiasmatic nucleus (PIPS) in rats. To reveal its role, its tissue distribution was examined by immunoblotting. PIPS-like immunoreactive substance (PIPSLS) was observed in Brain, adrenal gland, and PC12 cells. Since PIPS, which has no nuclear localization signal (NLS), is translocated into nuclei of COS-7 cells in the presence of mPer1, the effect of NGF on nuclear localization of PIPS was examined using PC12 cells. NGF caused nuclear translocation of either PIPSLS or GFP-PIPS. NGF mediated nuclear translocation of PIPSLS was blocked by K252a, a TrkA-inhibitor, or wortmannin, a PI3K-inhibitor. Gab1, which is implicated in TrkA signaling and has NLS, co-immunoprecipitated with PIPSLS from PC12 cells using an anti-PIPS antibody. Inhibition of PIPS expression by RNAi increased levels of apoptosis in PC12 cells. These findings suggest that nuclear translocation of PIPS is involved in NGF mediated neuronal survival via TrkA, PI3K, and Gab1 signaling pathway.

  10. Gastrin Releasing Peptide Modulates Fast Delayed Rectifier Potassium Current in Per1-Expressing SCN Neurons

    PubMed Central

    Gamble, Karen L.; Kudo, Takashi; Colwell, Christopher S.; McMahon, Douglas G.


    The mammalian circadian clock in the suprachiasmatic nucleus (SCN) drives and maintains 24-h physiological rhythms, the phases of which are set by the local environmental light-dark cycle. Gastrin releasing peptide (GRP) communicates photic phase setting signals in the SCN by increasing neurophysiological activity of SCN neurons. Here, the ionic basis for persistent GRP-induced changes in neuronal activity was investigated in SCN slice cultures from Per1::GFP reporter mice during the early night. Recordings from Per1-fluorescent neurons in SCN slices several hours after GRP treatment revealed a significantly greater action potential frequency, a significant increase in voltage-activated outward current at depolarized potentials, and a significant increase in 4-aminopyridine (4-AP) sensitive fast delayed rectifier (fDR) potassium currents when compared to vehicle-treated slices. In addition, the persistent increase in spike rate following early night GRP application was blocked in SCN neurons from mice deficient in Kv3 channel proteins. Because fDR currents are regulated by the clock and are elevated in amplitude during the day, the present results support the model that GRP delays the phase of the clock during the early night by prolonging day-like membrane properties of SCN cells. Furthermore, these findings implicate fDR currents in the ionic basis for GRP-mediated entrainment of the primary mammalian circadian pacemaker. PMID:21454290

  11. Existence of a photoinducible phase for ovarian development and photoperiod-related alteration of clock gene expression in a damselfish.


    Takeuchi, Yuki; Hada, Noriko; Imamura, Satoshi; Hur, Sung-Pyo; Bouchekioua, Selma; Takemura, Akihiro


    The sapphire devil, Chrysiptera cyanea, is a reef-associated damselfish and their ovarian development can be induced by a long photoperiod. In this study, we demonstrated the existence of a photoinducible phase for the photoperiodic ovarian development in the sapphire devil. Induction of ovarian development under night-interruption light schedules and Nanda-Hamner cycles revealed that the photoinducible phase appeared in a circadian manner between ZT12 and ZT13. To characterize the effect of photoperiod on clock gene expression in the brain of this species, we determined the expression levels of the sdPer1, sdPer2, sdCry1, and sdCry2 clock genes under constant light and dark conditions (LL and DD) and photoperiodic (short and long photoperiods). The expression of sdPer1 exhibited clear circadian oscillation under both LL and DD conditions, while sdPer2 and sdCry1 expression levels were lower under DD than under LL conditions and sdCry2 expression was lower under LL than under DD conditions. These results suggest a key role for sdPer1 in circadian clock cycling and that sdPer2, sdCry1, and sdCry2 are light-responsive clock genes in the sapphire devil. After 1 week under a long photoperiod, we observed photoperiod-related changes in sdPer1, sdPer2, and sdCry2 expression, but not in sdCry1 expression. These results suggest that the expression patterns of some clock genes exhibit seasonal variation according to seasonal changes in day length and that such seasonal alteration of clock gene expression may contribute to seasonal recognition by the sapphire devil.

  12. Sleep Deprivation Influences Circadian Gene Expression in the Lateral Habenula.


    Zhang, Beilin; Gao, Yanxia; Li, Yang; Yang, Jing; Zhao, Hua


    Sleep is governed by homeostasis and the circadian clock. Clock genes play an important role in the generation and maintenance of circadian rhythms but are also involved in regulating sleep homeostasis. The lateral habenular nucleus (LHb) has been implicated in sleep-wake regulation, since LHb gene expression demonstrates circadian oscillation characteristics. This study focuses on the participation of LHb clock genes in regulating sleep homeostasis, as the nature of their involvement is unclear. In this study, we observed changes in sleep pattern following sleep deprivation in LHb-lesioned rats using EEG recording techniques. And then the changes of clock gene expression (Per1, Per2, and Bmal1) in the LHb after 6 hours of sleep deprivation were detected by using real-time quantitative PCR (qPCR). We found that sleep deprivation increased the length of Non-Rapid Eye Movement Sleep (NREMS) and decreased wakefulness. LHb-lesioning decreased the amplitude of reduced wake time and increased NREMS following sleep deprivation in rats. qPCR results demonstrated that Per2 expression was elevated after sleep deprivation, while the other two genes were unaffected. Following sleep recovery, Per2 expression was comparable to the control group. This study provides the basis for further research on the role of LHb Per2 gene in the regulation of sleep homeostasis.

  13. Sleep Deprivation Influences Circadian Gene Expression in the Lateral Habenula

    PubMed Central

    Gao, Yanxia


    Sleep is governed by homeostasis and the circadian clock. Clock genes play an important role in the generation and maintenance of circadian rhythms but are also involved in regulating sleep homeostasis. The lateral habenular nucleus (LHb) has been implicated in sleep-wake regulation, since LHb gene expression demonstrates circadian oscillation characteristics. This study focuses on the participation of LHb clock genes in regulating sleep homeostasis, as the nature of their involvement is unclear. In this study, we observed changes in sleep pattern following sleep deprivation in LHb-lesioned rats using EEG recording techniques. And then the changes of clock gene expression (Per1, Per2, and Bmal1) in the LHb after 6 hours of sleep deprivation were detected by using real-time quantitative PCR (qPCR). We found that sleep deprivation increased the length of Non-Rapid Eye Movement Sleep (NREMS) and decreased wakefulness. LHb-lesioning decreased the amplitude of reduced wake time and increased NREMS following sleep deprivation in rats. qPCR results demonstrated that Per2 expression was elevated after sleep deprivation, while the other two genes were unaffected. Following sleep recovery, Per2 expression was comparable to the control group. This study provides the basis for further research on the role of LHb Per2 gene in the regulation of sleep homeostasis. PMID:27413249

  14. PER1 rs3027172 Genotype Interacts with Early Life Stress to Predict Problematic Alcohol Use, but Not Reward-Related Ventral Striatum Activity

    PubMed Central

    Baranger, David A. A.; Ifrah, Chloé; Prather, Aric A.; Carey, Caitlin E.; Corral-Frías, Nadia S.; Drabant Conley, Emily; Hariri, Ahmad R.; Bogdan, Ryan


    Increasing evidence suggests that the circadian and stress regulatory systems contribute to alcohol use disorder (AUD) risk, which may partially arise through effects on reward-related neural function. The C allele of the PER1 rs3027172 single nucleotide polymorphism (SNP) reduces PER1 expression in cells incubated with cortisol and has been associated with increased risk for adult AUD and problematic drinking among adolescents exposed to high levels of familial psychosocial adversity. Using data from undergraduate students who completed the ongoing Duke Neurogenetics Study (DNS) (n = 665), we tested whether exposure to early life stress (ELS; Childhood Trauma Questionnaire) moderates the association between rs3027172 genotype and later problematic alcohol use (Alcohol Use Disorders Identification Test) as well as ventral striatum (VS) reactivity to reward (card-guessing task while functional magnetic resonance imaging data were acquired). Initial analyses found that PER1 rs3027172 genotype interacted with ELS to predict both problematic drinking and VS reactivity; minor C allele carriers, who were also exposed to elevated ELS reported greater problematic drinking and exhibited greater ventral striatum reactivity to reward-related stimuli. When gene × covariate and environment × covariate interactions were controlled for, the interaction predicting problematic alcohol use remained significant (p < 0.05, corrected) while the interaction predicting VS reactivity was no longer significant. These results extend our understanding of relationships between PER1 genotype, ELS, and problematic alcohol use, and serve as a cautionary tale on the importance of controlling for potential confounders in studies of moderation including gene × environment interactions. PMID:27065929

  15. Circadian PER2::LUC rhythms in the olfactory bulb of freely moving mice depend on the suprachiasmatic nucleus but not on behaviour rhythms.


    Ono, Daisuke; Honma, Sato; Honma, Ken-Ichi


    The temporal order of physiology and behaviour in mammals is regulated by the coordination of the master circadian clock in the suprachiasmatic nucleus (SCN) and peripheral clocks in various tissues outside the SCN. Because the circadian oscillator(s) in the olfactory bulb (OB) is regarded as SCN independent, we examined the relationship between the SCN master clock and the circadian clock in the OB. We also examined the role of vasoactive intestinal peptide receptor 2 in the circadian organization of the OB. We continuously monitored the circadian rhythms of a clock gene product PER2 in the SCN and OB of freely moving mice by means of a bioluminescence reporter and an optical fibre implanted in the brain. Robust circadian rhythms were detected in the OB and SCN for up to 19 days. Bilateral SCN lesions abolished the circadian behaviour rhythms and disorganized the PER2 rhythms in the OB. The PER2 rhythms in the OB showed more than one oscillatory component of a similar circadian period, suggesting internal desynchronization of constituent oscillators. By contrast, significant circadian PER2 rhythms were detected in the vasoactive intestinal peptide receptor 2-deficient mice, despite the substantial deterioration or abolition of circadian behavioural rhythms. These findings indicate that the circadian clock in the OB of freely moving mice depends on the SCN master clock but not on the circadian behavioural rhythms. The circadian PER2::LUC rhythm in the cultured OB was as robust as that in the cultured SCN but reset by slice preparation, suggesting that culturing of the slice reinforces the circadian rhythm.

  16. Time-related dynamics of variation in core clock gene expression levels in tissues relevant to the immune system.


    Mazzoccoli, G; Sothern, R B; Greco, A; Pazienza, V; Vinciguerra, M; Liu, S; Cai, Y


    Immune parameters show rhythmic changes with a 24-h periodicity driven by an internal circadian timing system that relies on clock genes (CGs). CGs form interlocked transcription-translation feedback loops to generate and maintain 24-h mRNA and protein oscillations. In this study we evaluate and compare the profiles and the dynamics of variation of CG expression in peripheral blood, and two lymphoid tissues of mice. Expression levels of seven recognized key CGs (mBmal1, mClock, mPer1, mPer2, mCry1, mCry2, and Rev-erbalpha) were evaluated by quantitative RT- PCR in spleen, thymus and peripheral blood of C57BL/6 male mice housed on a 12-h light (L)-dark (D) cycle and sacrificed every 4 h for 24 h (3-4 mice/time point). We found a statistically significant time-effect in spleen (S), thymus (T) and blood (B) for the original values of expression level of mBmal1 (S), mClock (T, B), mPer1 (S, B), mPer2 (S), mCry1 (S), mCry2 (B) and mRev-Erbalpha (S, T, B) and for the fractional variation calculated between single time-point expression value of mBmal1 (B), mPer2 (T), mCry2 (B) and mRev-Erbalpha (S). A significant 24-h rhythm was validated for five CGs in blood (mClock, mPer1, mPer2, mCry2, mRev-Erbalpha), for four CGs in the spleen (mBmal1, mPer1, mPer2, mRev-Erbalpha), and for three CGs in the thymus (mClock, mPer2, mRev-Erbalpha). The original values of acrophases for mBmal1, mClock, mPer1, mPer2, mCry1 and mCry2 were very similar for spleen and thymus and advanced by several hours for peripheral blood compared to the lymphoid tissues, whereas the phases of mRev-Erbalpha were coincident for all three tissues. In conclusion, central and peripheral lymphoid tissues in the mouse show different sequences of activation of clock gene expression compared to peripheral blood. These differences may underlie the compartmental pattern of web functioning in the immune system.

  17. Transduction of light in the suprachiasmatic nucleus: evidence for two different neurochemical cascades regulating the levels of Per1 mRNA and pineal melatonin.


    Paul, K N; Fukuhara, C; Tosini, G; Albers, H E


    The suprachiasmatic nucleus (SCN) contains a circadian clock and regulates melatonin synthesis in the pineal gland. Light exposure during the subjective night acutely increases the mRNA levels of the Period (Per)1 gene in the SCN and acutely suppresses melatonin levels in the pineal gland. Activation of N-methyl-D-aspartate (NMDA) receptors in the SCN has been demonstrated to phase-shift the circadian clock in a manner similar to light. We tested the hypothesis that activation of excitatory amino acid (EAA) receptors in the SCN mediates the acute effects of light on Per1 mRNA levels and pineal melatonin. NMDA, injected into the SCN of Syrian hamsters during the night, acutely suppressed melatonin levels in the pineal gland. Both the NMDA receptor antagonist 2-amino-5-phosphonopentanoic acid (AP5) and the alpha-amino-3-hydroxy-5-methylisoxazoleproprionic acid (AMPA)/kainate receptor antagonist 6,7-dinitroquinoxaline-2,3-dione (DNQX) inhibited the light-induced increase of Per1 mRNA levels in the SCN. In the same animals, however, these antagonists had no effect on the ability of light to suppress pineal melatonin. These results support the hypothesis that EAA receptor activation in the SCN is necessary for the acute effects of light on Per1 mRNA levels. They also indicate that NMDA receptor activation in the SCN is sufficient but may not be necessary for the acute effects of light on pineal melatonin. These data suggest that there may be at least two different neurochemical cascades that transduce the effects of light in the SCN

  18. Disruption of period gene expression alters the inductive effects of dioxin on the AhR signaling pathway in the mouse liver

    SciTech Connect

    Qu Xiaoyu; Metz, Richard P.; Porter, Weston W.; Cassone, Vincent M.; Earnest, David J.


    The aryl hydrocarbon receptor (AhR) and AhR nuclear translocator (ARNT) are transcription factors that express Per-Arnt-Sim (PAS) DNA-binding motifs and mediate the metabolism of drugs and environmental toxins in the liver. Because these transcription factors interact with other PAS genes in molecular feedback loops forming the mammalian circadian clockworks, we determined whether targeted disruption or siRNA inhibition of Per1 and Per2 expression alters toxin-mediated regulation of the AhR signaling pathway in the mouse liver and Hepa1c1c7 hepatoma cells in vitro. Treatment with the prototypical Ahr ligand, 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), had inductive effects on the primary targets of AhR signaling, Cyp1A1 and Cyp1B1, in the liver of all animals, but genotype-based differences were evident such that the toxin-mediated induction of Cyp1A1 expression was significantly greater (2-fold) in mice with targeted disruption of Per1 (Per1{sup ldc} and Per1{sup ldc}/Per2{sup ldc}). In vitro experiments yielded similar results demonstrating that siRNA inhibition of Per1 significantly increases the TCDD-induced expression of Cyp1A1 and Cyp1B1 in Hepa1c1c7 cells. Per2 inhibition in siRNA-infected Hepa1c1c7 cells had the opposite effect and significantly decreased both the induction of these p450 genes as well as AhR and Arnt expression in response to TCDD treatment. These findings suggest that Per1 may play a distinctive role in modulating AhR-regulated responses to TCDD in the liver.

  19. Effects of Per2 overexpression on growth inhibition and metastasis, and on MTA1, nm23-H1 and the autophagy-associated PI3K/PKB signaling pathway in nude mice xenograft models of ovarian cancer.


    Wang, Zhaoxia; Li, Li; Wang, Yang


    The aim of the present study was to evaluate the association between Period2 (Per2) and the occurrence and development of ovarian cancer, in addition to evaluating the effect of this gene on the growth and metastasis of ovarian cancer in nude mice xenograft models. The detection of Per2 by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and western blotting methods at various stages of ovarian cancer in tumor tissue samples was conducted. Nude mice xenograft models of ovarian cancer were constructed using an ovarian cancer cell line and, using a gene transfection technique, exogenous infusion of the recombinant gene, Per2, was performed. To assess for the successful and stable expression of Per2 in the tumor tissue, levels of Per2 expression in the nude mice xenograft models were detected by RT‑qPCR. During the experimental period, the tumor volumes were measured every three days. Two weeks following treatment cessation, the nude mice were sacrificed and the tumor weight and volume were measured. Furthermore, detection of the changes in expression levels of metastasis‑associated gene 1 (MTA‑1) and tumor metastasis suppressor gene, non‑metastasis protein 23‑H1 (nm23‑H1), and the expression change of autophagy‑associated signal transduction pathway, phosphatidylinositol 3‑kinase (PI3K)/protein kinase B (PKB) kinase were analyzed. The findings demonstrated that with ovarian cancer stage development, the expression of Per2 gradually reduced or ceased. In addition, exogenous Per2 was successfully and stably expressed in nude mice tumor tissue samples. Furthermore, in the Per2 overexpression group, MTA‑1 protein expression was significantly reduced when compared with the phosphate‑buffered saline (PBS) control and empty plasmid groups, while nm23‑H1 protein expression was significantly higher when compared with those two groups. The expression levels of PI3K and PKB kinase, which are marker proteins of the autophagy

  20. Postnatal ontogeny of the circadian expression of the adrenal clock genes and corticosterone rhythm in male rats.


    Ruiz Roa, Silvia Liliana; Martinez, Edson Zangiacomi; Martins, Clarissa Silva; Antonini, Sonir Rauber; de Castro, Margaret; Moreira, Ayrton Custódio


    The postnatal synchronization of the circadian variation of the adrenal clock genes in mammals remains unknown. We evaluated the postnatal ontogeny of daily variation of clock genes (Clock/Bmal1/Per1/Per2/Per3/Cry1/Cry2/Rorα/Rev-Erbα) and steroidogenesis-related genes (Star and Mc2r) in rat adrenals and its relationship with the emergence of plasma corticosterone rhythm using Cosinor analysis. Plasma corticosterone circadian rhythm was detected from postnatal day (P) P1, with morning acrophase, between zeitgeber time (ZT) ZT0 and ZT2. From P14, there was a nocturnal acrophase of corticosterone at ZT20, which was associated with pups' eye opening. Since P3 there was a circadian variation of the mRNA expression of Bmal1, Per2, Per3, Cry1 genes with morning acrophase whereas Rev-Erbα had nocturnal acrophase. From P14, Bmal1, Per2, Per3, Cry1 acrophases advanced by approximately 10h, as compared to early neonatal days, becoming vespertine-nocturnal. In all postnatal ages, Per2 and Cry1 circadian profiles were synchronized in phase while Bmal1 was in antiphase with the circadian rhythm of plasma corticosterone. Adult-like Star circadian rhythm profile was observed only from P21. In conclusion, our original data demonstrated a progressive postnatal maturation of the circadian variation of the adrenal clock genes in synchrony with the development of the corticosterone circadian rhythm in rats.

  1. Effect of angiotensin II on rhythmic per2 expression in the suprachiasmatic nucleus and heart and daily rhythm of activity in Wistar rats.


    Herichová, Iveta; Šoltésová, Dorota; Szántóová, Kristína; Mravec, Boris; Neupauerová, Denisa; Veselá, Anna; Zeman, Michal


    Endogenous daily rhythms are generated by the hierarchically organized circadian system predominantly synchronized by the external light (L): dark (D) cycle. During recent years several humoral signals have been found to influence the generation and manifestation of daily rhythm. Since most studies have been performed under in vitro conditions, the mechanisms employed under in vivo conditions need to be investigated. Our study focused on angiotensin II (angII)-mediated regulation of Per2 expression in the suprachiasmatic nuclei (SCN) and heart and spontaneous locomotor activity in Wistar rats under synchronized conditions. Angiotensin II was infused (100ng/kg/min) via subcutaneously implanted osmotic minipumps for 7 or 28days. Samples were taken in 4-h intervals during a 24hcycle and after a light pulse applied in the first and second part of the dark phase. Gene expression was measured using real time PCR. Locomotor activity was monitored using an infrared camera with a remote control installed in the animal facility. Seven days of angII infusion caused an increase in blood pressure and heart/body weight index and 28days of angII infusion also increased water intake in comparison with controls. We observed a distinct daily rhythm in Per2 expression in the SCN and heart of control rats and infused rats. Seven days of angII infusion did not influence Per2 expression in the heart. 28days of angII treatment caused significant phase advance and a decrease in nighttime expression of Per2 and influenced expression of clock controlled genes Rev-erb alpha and Dbp in the heart compared to the control. Four weeks of angII infusion decreased the responsiveness of Per2 expression in the SCN to a light pulse at the end of the dark phase of the 24hcycle. Expression of mRNA coding angiotensin-converting enzyme (ACE) and angiotensin-converting enzyme 2 (ACE2) showed a daily rhythm in the heart of control rats. Four weeks of angII infusion caused a decrease in amplitude of rhythmic

  2. Crystal structure of the extended-spectrum β-lactamase PER-2 and insights into the role of specific residues in the interaction with β-lactams and β-lactamase inhibitors.


    Ruggiero, Melina; Kerff, Frédéric; Herman, Raphaël; Sapunaric, Frédéric; Galleni, Moreno; Gutkind, Gabriel; Charlier, Paulette; Sauvage, Eric; Power, Pablo


    PER-2 belongs to a small (7 members to date) group of extended-spectrum β-lactamases. It has 88% amino acid identity with PER-1 and both display high catalytic efficiencies toward most β-lactams. In this study, we determined the X-ray structure of PER-2 at 2.20 Å and evaluated the possible role of several residues in the structure and activity toward β-lactams and mechanism-based inhibitors. PER-2 is defined by the presence of a singular trans bond between residues 166 to 167, which generates an inverted Ω loop, an expanded fold of this domain that results in a wide active site cavity that allows for efficient hydrolysis of antibiotics like the oxyimino-cephalosporins, and a series of exclusive interactions between residues not frequently involved in the stabilization of the active site in other class A β-lactamases. PER β-lactamases might be included within a cluster of evolutionarily related enzymes harboring the conserved residues Asp136 and Asn179. Other signature residues that define these enzymes seem to be Gln69, Arg220, Thr237, and probably Arg/Lys240A ("A" indicates an insertion according to Ambler's scheme for residue numbering in PER β-lactamases), with structurally important roles in the stabilization of the active site and proper orientation of catalytic water molecules, among others. We propose, supported by simulated models of PER-2 in combination with different β-lactams, the presence of a hydrogen-bond network connecting Ser70-Gln69-water-Thr237-Arg220 that might be important for the proper activity and inhibition of the enzyme. Therefore, we expect that mutations occurring in these positions will have impacts on the overall hydrolytic behavior.

  3. Crystal Structure of the Extended-Spectrum β-Lactamase PER-2 and Insights into the Role of Specific Residues in the Interaction with β-Lactams and β-Lactamase Inhibitors

    PubMed Central

    Ruggiero, Melina; Kerff, Frédéric; Herman, Raphaël; Sapunaric, Frédéric; Galleni, Moreno; Gutkind, Gabriel; Charlier, Paulette; Sauvage, Eric


    PER-2 belongs to a small (7 members to date) group of extended-spectrum β-lactamases. It has 88% amino acid identity with PER-1 and both display high catalytic efficiencies toward most β-lactams. In this study, we determined the X-ray structure of PER-2 at 2.20 Å and evaluated the possible role of several residues in the structure and activity toward β-lactams and mechanism-based inhibitors. PER-2 is defined by the presence of a singular trans bond between residues 166 to 167, which generates an inverted Ω loop, an expanded fold of this domain that results in a wide active site cavity that allows for efficient hydrolysis of antibiotics like the oxyimino-cephalosporins, and a series of exclusive interactions between residues not frequently involved in the stabilization of the active site in other class A β-lactamases. PER β-lactamases might be included within a cluster of evolutionarily related enzymes harboring the conserved residues Asp136 and Asn179. Other signature residues that define these enzymes seem to be Gln69, Arg220, Thr237, and probably Arg/Lys240A (“A” indicates an insertion according to Ambler's scheme for residue numbering in PER β-lactamases), with structurally important roles in the stabilization of the active site and proper orientation of catalytic water molecules, among others. We propose, supported by simulated models of PER-2 in combination with different β-lactams, the presence of a hydrogen-bond network connecting Ser70-Gln69-water-Thr237-Arg220 that might be important for the proper activity and inhibition of the enzyme. Therefore, we expect that mutations occurring in these positions will have impacts on the overall hydrolytic behavior. PMID:25070104

  4. Effects of age on clock gene expression in the rhesus macaque pituitary gland

    PubMed Central

    Sitzmann, Brandon D.; Lemos, Dario R.; Ottinger, Mary Ann; Urbanski, Henryk F.


    Recent studies have shown that circadian clock genes are expressed in various peripheral tissues, raising the possibility that multiple clocks regulate circadian physiology. To study clock gene expression in the rhesus macaque pituitary gland we used gene microarray data and found that the pituitary glands of young and old adult males express several components of the circadian clock (Per1, Per2, Cry1, Bmal1, Clock, Rev-erbα and Csnk1ε). Semi-quantitative reverse-transcription polymerase chain reaction (sqRT-PCR) confirmed the presence of these core-clock genes and detected significant age-related differences in expression of Per2. sqRT-PCR also showed differential expression of core-clock genes at two opposing time-points over the 24 hour day, with greater expression of Per2 and Bmal1 (P<0.05) at 1300 h as compared to 0100 h. Immunohistochemistry revealed rhythmic expression of REV-ERBα in the pituitary glands of female macaques. These data provide evidence that the rhesus macaque pituitary gland expresses core-clock genes and their associated protein products in a 24-hour rhythmic pattern, and that their expression is moderately impacted by aging processes. PMID:18614257

  5. Hypoxia disrupts the expression levels of circadian rhythm genes in hepatocellular carcinoma.


    Yu, Chao; Yang, Sheng-Li; Fang, Xiefan; Jiang, Jian-Xin; Sun, Cheng-Yi; Huang, Tao


    Disturbance in the expression of circadian rhythm genes is a common feature in certain types of cancer, however the mechanisms mediating this disturbance remain to be elucidated. The present study aimed to investigate the effect of hypoxia on the expression of circadian rhythm genes in liver cancer cells and to identify the mechanisms underlying this effect in hepatocellular carcinoma (HCC). The HCC cell line, PLC/PRF/5. was treated with either a vehicle control or CoCl2 at 50, 100 or 200 µΜ for 24 h. Following treatment, the protein expression levels of hypoxia‑inducible factor (HIF)‑1α and HIF‑2α were detected by western blotting and the mRNA expression levels of circadian rhythm genes, including circadian locomotor output cycles kaput (Clock), brain and muscle Arnt‑like 1 (Bmal1), period (Per)1, Per2, Per3, cryptochrome (Cry)1, Cry2 and casein kinase Iε (CKIε), were detected by reverse transcription quantitative polymerase chain reaction (RT‑qPCR). Expression plasmids containing HIF‑1α or HIF‑2α were transfected into the PLC/PRF/5 cells using liposomes and RT‑qPCR was used to determine the effects of the transfections on the expression levels of circadian rhythm genes. Following treatment with CoCl2, the protein expression levels of HIF‑1α and HIF‑2α were upregulated in a CoCl2 concentration‑dependent manner. The mRNA expression levels of Clock, Bmal1 and Cry2 were increased, and the mRNA expression levels of Per1, Per2, Per3, Cry1 and CKIε were decreased following CoCl2 treatment (P<0.05). In the PLC/PRF/5 cells transfected with the plasmid containing HIF‑1α, the mRNA expression levels of Clock, Bmal1 and Cry2 were increased, and the mRNA expression levels of Per1, Per2, Per3, Cry1 and CKIε were decreased. In the PLC/PRF/5 cells transfected with the plasmid containing HIF‑2α, the mRNA expression levels of Clock, Bmal1, Per1, Cry1, Cry2 and CKIε were upregulated, and the mRNA expression levels of Per2 and Per3 were

  6. Effect of circadian rhythm disturbance on morphine preference and addiction in male rats: Involvement of period genes and dopamine D1 receptor.


    Garmabi, B; Vousooghi, N; Vosough, M; Yoonessi, A; Bakhtazad, A; Zarrindast, M R


    It is claimed that a correlation exists between disturbance of circadian rhythms by factors such as alteration of normal light-dark cycle and the development of addiction. However, the exact mechanisms involved in this relationship are not much understood. Here we have studied the effect of constant light on morphine voluntary consumption and withdrawal symptoms and also investigated the involvement of Per1, Per2 and dopamine D1 receptor in these processes. Male wistar rats were kept under standard (LD) or constant light (LL) conditions for one month. The plasma concentration of melatonin was evaluated by enzyme-linked immunosorbent assay (ELISA). Real-time PCR was used to determine the mRNA expression of Per1, Per2 and dopamine D1 receptor in the striatum and prefrontal cortex. Morphine preference (50mg/L) was evaluated in a two-bottle-choice paradigm for 10 weeks and withdrawal symptoms were recorded after administration of naloxone (3mg/kg). One month exposure to constant light resulted in a significant decrease of melatonin concentration in the LL group. In addition, mRNA levels of Per2 and dopamine D1 receptor were up-regulated in both the striatum and prefrontal cortex of the LL group. However, expression of Per1 gene was only up-regulated in the striatum of LL rats in comparison to LD animals. Furthermore, after one month exposure to constant light, morphine consumption and preference ratio and also severity of naloxone-induced withdrawal syndrome were significantly greater in LL animals. It is concluded that exposure to constant light by up-regulation of Per2 and dopamine D1 receptor in the striatum and prefrontal cortex and up-regulation of Per1 in the striatum and the possible involvement of melatonin makes animals vulnerable to morphine preference and addiction.

  7. Characterization of sevoflurane effects on Per2 expression using ex vivo bioluminescence imaging of the suprachiasmatic nucleus in transgenic rats.


    Matsuo, Izumi; Iijima, Norio; Takumi, Ken; Higo, Shimpei; Aikawa, Satoko; Anzai, Megumi; Ishii, Hirotaka; Sakamoto, Atsuhiro; Ozawa, Hitoshi


    The inhalation anesthetic sevoflurane suppresses Per2 expression in the suprachiasmatic nucleus (SCN) in rodents. Here, we investigated the intra-SCN regional specificity, time-dependency, and pharmacological basis of sevoflurane-effects. Bioluminescence image was taken from the SCN explants of mPer2 promoter-destabilized luciferase transgenic rats, and each small regions of interest (ROI) of the image was analyzed. Sevoflurane suppressed bioluminescence in all ROIs, suggesting that all regions in the SCN are sensitive to sevoflurane. Clear time-dependency in sevoflurane effects were also observed; application during the trough phase of the bioluminescence cycle suppressed the subsequent increase in bioluminescence and resulted in a phase delay of the cycle; sevoflurane applied during the middle of the ascending phase induced a phase advance; sevoflurane on the descending phase showed no effect. These results indicate that the sevoflurane effect may depend on the intrinsic state of circadian machinery. Finally, we examined the involvement of GABAergic signal transduction in the sevoflurane effect. Co-application of both GABAA and GABAB receptor antagonists completely blocked the effect of sevoflurane on the bioluminescence rhythm, suggesting that sevoflurane inhibits Per2 expression via GABAergic signal transduction. Current study elucidated the anesthetic effects on the molecular mechanisms of circadian rhythm.

  8. Time-restricted feeding of rapidly digested starches causes stronger entrainment of the liver clock in PER2::LUCIFERASE knock-in mice.


    Itokawa, Misa; Hirao, Akiko; Nagahama, Hiroki; Otsuka, Makiko; Ohtsu, Teiji; Furutani, Naoki; Hirao, Kazuko; Hatta, Tamao; Shibata, Shigenobu


    Restricting feeding to daytime can entrain circadian clocks in peripheral organs of rodents, and nutrients that rapidly increase the blood glucose level are suitable for inducing entrainment. However, dietetic issues, for example, whether or not the diet comprises heated food, have not been fully explored. We therefore hypothesized that rapidly digested starch causes stronger entrainment than slowly digested starch. The entrainment ability of the liver clock in PER2::LUCIFERASE knock-in mice, blood glucose levels, insulin levels, and acute changes in liver clock gene expression were compared between a β-starch (native)-substituted AIN-93M standard diet and an α-starch (gelatinized)-substituted diet. β-Corn and β-rice starch induced larger phase delays of the liver clock, larger blood glucose increases, and higher Per2 gene expression in the liver compared with β-potato starch. Starch granule size, as examined by electron microscopy, was larger for β-potato starch than for β-corn or β-rice starch. After heating, we obtained gelatinized α-potato, α-corn, and α-rice starch, which showed destruction of the crystal structure and a high level of gelatinization. No difference in the increase of blood glucose or insulin levels was observed between β-corn and α-corn starch, or between β-rice and α-rice starch. In contrast, α-potato starch caused higher levels of glucose and insulin compared with β-potato starch. An α-potato starch-substituted diet induced larger phase delays of the liver clock than did β-potato starch. Therefore, rapidly digested starch is appropriate for peripheral clock entrainment. Dietetic issues (heated vs unheated) are important when applying basic mouse data to humans.

  9. The Transcriptional Repressor ID2 Can Interact with the Canonical Clock Components CLOCK and BMAL1 and Mediate Inhibitory Effects on mPer1 Expression*

    PubMed Central

    Ward, Sarah M.; Fernando, Shanik J.; Hou, Tim Y.; Duffield, Giles E.


    ID2 is a rhythmically expressed HLH transcriptional repressor. Deletion of Id2 in mice results in circadian phenotypes, highlighted by disrupted locomotor activity rhythms and an enhanced photoentrainment response. ID2 can suppress the transactivation potential of the positive elements of the clock, CLOCK-BMAL1, on mPer1 and clock-controlled gene (CCG) activity. Misregulation of CCGs is observed in Id2−/− liver, and mutant mice exhibit associated alterations in lipid homeostasis. These data suggest that ID2 contributes to both input and output components of the clock and that this may be via interaction with the bHLH clock proteins CLOCK and BMAL1. The aim of the present study was to explore this potential interaction. Coimmunoprecipitation analysis revealed the capability of ID2 to complex with both CLOCK and BMAL1, and mammalian two-hybrid analysis revealed direct interactions of ID2, ID1 and ID3 with CLOCK and BMAL1. Deletion of the ID2 HLH domain rendered ID2 ineffective at inhibiting CLOCK-BMAL1 transactivation, suggesting that interaction between the proteins is via the HLH region. Immunofluorescence analysis revealed overlapping localization of ID2 with CLOCK and BMAL1 in the cytoplasm. Overexpression of CLOCK and BMAL1 in the presence of ID2 resulted in a significant reduction in their nuclear localization, revealing that ID2 can sequester CLOCK and BMAL1 to the cytoplasm. Serum stimulation of Id2−/− mouse embryonic fibroblasts resulted in an enhanced induction of mPer1 expression. These data provide the basis for a molecular mechanism through which ID2 could regulate aspects of both clock input and output through a time-of-day specific interaction with CLOCK and BMAL1. PMID:20861012

  10. PER2 promotes glucose storage to liver glycogen during feeding and acute fasting by inducing Gys2 PTG and G L expression.


    Zani, Fabio; Breasson, Ludovic; Becattini, Barbara; Vukolic, Ana; Montani, Jean-Pierre; Albrecht, Urs; Provenzani, Alessandro; Ripperger, Juergen A; Solinas, Giovanni


    The interplay between hepatic glycogen metabolism and blood glucose levels is a paradigm of the rhythmic nature of metabolic homeostasis. Here we show that mice lacking a functional PER2 protein (Per2 (Brdm1) ) display reduced fasting glycemia, altered rhythms of hepatic glycogen accumulation, and altered rhythms of food intake. Per2 (Brdm1) mice show reduced hepatic glycogen content and altered circadian expression during controlled fasting and refeeding. Livers from Per2 (Brdm1) mice display reduced glycogen synthase protein levels during refeeding, and increased glycogen phosphorylase activity during fasting. The latter is explained by PER2 action on the expression of the adapter proteins PTG and GL, which target the protein phosphatase-1 to glycogen to decrease glycogen phosphorylase activity. Finally, PER2 interacts with genomic regions of Gys2, PTG, and G L . These results indicate an important role for PER2 in the hepatic transcriptional response to feeding and acute fasting that promotes glucose storage to liver glycogen.

  11. Differential responses of circadian Per2 expression rhythms in discrete brain areas to daily injection of methamphetamine and restricted feeding in rats.


    Natsubori, Akiyo; Honma, Ken-ichi; Honma, Sato


    Behavioral rhythms induced by methamphetamine (MAP) and daily restricted feeding (RF) in rats are independent of the circadian pacemaker in the suprachiasmatic nucleus (SCN), and have been regarded to share a common oscillatory mechanism. In the present study, in order to examine the responses of brain oscillatory systems to MAP and RF, circadian rhythms in clock gene, Period2, expression were measured in several brain areas in rats. Transgenic rats carrying a bioluminescence reporter of Period2-dLuciferase were subjected to either daily injection of MAP or RF of 2 h at a fixed time of day for 14 days. As a result, spontaneous movement and wheel-running activity were greatly enhanced following MAP injection and prior to daily meal under RF. Circadian Per2 rhythms were measured in the cultured brain tissues containing one of the following structures: the olfactory bulb; caudate-putamen; parietal cortex; substantia nigra; and SCN. Except for the SCN, the circadian Per2 rhythms in the brain tissues were significantly phase-delayed by 1.9 h on average in MAP-injected rats as compared with the saline-controls. On the other hand, the circadian rhythms outside the SCN were significantly phase-advanced by 6.3 h on average in rats under RF as compared with those under ad libitum feeding. These findings indicate that the circadian rhythms in specific brain areas of the central dopaminergic system respond differentially to MAP injection and RF, suggesting that different oscillatory mechanisms in the brain underlie the MAP-induced behavior and pre-feeding activity under RF.

  12. Altered Expression Pattern of Clock Genes in a Rat Model of Depression

    PubMed Central

    Christiansen, SL; Bouzinova, EV; Fahrenkrug, J


    Background: Abnormalities in circadian rhythms may be causal factors in development of major depressive disorder. The biology underlying a causal relationship between circadian rhythm disturbances and depression is slowly being unraveled. Although there is no direct evidence of dysregulation of clock gene expression in depressive patients, many studies have reported single-nucleotide polymorphisms in clock genes in these patients. Methods: In the present study we investigated whether a depression-like state in rats is associated with alternations of the diurnal expression of clock genes. The validated chronic mild stress (CMS) animal model of depression was used to investigate rhythmic expression of three clock genes: period genes 1 and 2 (Per1 and Per2) and Bmal1. Brain and liver tissue was collected from 96 animals after 3.5 weeks of CMS (48 control and 48 depression-like rats) at a 4h sampling interval within 24h. We quantified expression of clock genes on brain sections in the prefrontal cortex, nucleus accumbens, pineal gland, suprachiasmatic nucleus, substantia nigra, amygdala, ventral tegmental area, subfields of the hippocampus, and the lateral habenula using in situ hybridization histochemistry. Expression of clock genes in the liver was monitored by real-time quantitative polymerase chain reaction (PCR). Results: We found that the effect of CMS on clock gene expression was selective and region specific. Per1 exhibits a robust diurnal rhythm in most regions of interest, whereas Bmal1 and in particular Per2 were susceptible to CMS. Conclusion: The present results suggest that altered expression of investigated clock genes is likely associated with the induction of a depression-like state in the CMS model. PMID:27365111

  13. Variations in Phase and Amplitude of Rhythmic Clock Gene Expression across Prefrontal Cortex, Hippocampus, Amygdala, and Hypothalamic Paraventricular and Suprachiasmatic Nuclei of Male and Female Rats.


    Chun, Lauren E; Woodruff, Elizabeth R; Morton, Sarah; Hinds, Laura R; Spencer, Robert L


    The molecular circadian clock is a self-regulating transcription/translation cycle of positive (Bmal1, Clock/Npas2) and negative (Per1,2,3, Cry1,2) regulatory components. While the molecular clock has been well characterized in the body's master circadian pacemaker, the hypothalamic suprachiasmatic nucleus (SCN), only a few studies have examined both the positive and negative clock components in extra-SCN brain tissue. Furthermore, there has yet to be a direct comparison of male and female clock gene expression in the brain. This comparison is warranted, as there are sex differences in circadian functioning and disorders associated with disrupted clock gene expression. This study examined basal clock gene expression (Per1, Per2, Bmal1 mRNA) in the SCN, prefrontal cortex (PFC), rostral agranular insula, hypothalamic paraventricular nucleus (PVN), amygdala, and hippocampus of male and female rats at 4-h intervals throughout a 12:12 h light:dark cycle. There was a significant rhythm of Per1, Per2, and Bmal1 in the SCN, PFC, insula, PVN, subregions of the hippocampus, and amygdala with a 24-h period, suggesting the importance of an oscillating molecular clock in extra-SCN brain regions. There were 3 distinct clock gene expression profiles across the brain regions, indicative of diversity among brain clocks. Although, generally, the clock gene expression profiles were similar between male and female rats, there were some sex differences in the robustness of clock gene expression (e.g., females had fewer robust rhythms in the medial PFC, more robust rhythms in the hippocampus, and a greater mesor in the medial amygdala). Furthermore, females with a regular estrous cycle had attenuated aggregate rhythms in clock gene expression in the PFC compared with noncycling females. This suggests that gonadal hormones may modulate the expression of the molecular clock.

  14. Hepatitis B virus X protein disrupts the balance of the expression of circadian rhythm genes in hepatocellular carcinoma.


    Yang, Sheng-Li; Yu, Chao; Jiang, Jian-Xin; Liu, Li-Ping; Fang, Xiefan; Wu, Chao


    The human circadian rhythm is controlled by at least eight circadian clock genes and disruption of the circadian rhythm is associated with cancer development. The present study aims to elucidate the association between the expression of circadian clock genes and the development of hepatocellular carcinoma (HCC), and also to reveal whether the hepatitis B virus X protein (HBx) is the major regulator that contributes to the disturbance of circadian clock gene expression. The mRNA levels of circadian clock genes in 30 HCC and the paired peritumoral tissues were determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). A stable HBx-expressing cell line, Bel-7404-HBx, was established through transfection of HBx plasmids. The mRNA level of circadian clock genes was also detected by RT-qPCR in these cells. Compared with the paired peritumoral tissues, the mRNA levels of the Per1, Per2, Per3 and Cry2 genes in HCC tissue were significantly lower (P<0.05), while no significant difference was observed in the expression levels of CLOCK, BMAL1, Cry1 and casein kinase 1ɛ (CK1ɛ; P>0.05). Compared with Bel-7404 cells, the mRNA levels of the CLOCK, Per1 and Per2 genes in Bel-7404-HBx cells were significantly increased, while the mRNA levels of the BMAL1, Per3, Cry1, Cry2 and CKIɛ genes were decreased (P<0.05). Thus, the present study identified that disturbance of the expression of circadian clock genes is common in HCC. HBx disrupts the expression of circadian clock genes and may, therefore, induce the development of HCC.

  15. Addiction and reward-related genes show altered expression in the postpartum nucleus accumbens

    PubMed Central

    Zhao, Changjiu; Eisinger, Brian Earl; Driessen, Terri M.; Gammie, Stephen C.


    Motherhood involves a switch in natural rewards, whereby offspring become highly rewarding. Nucleus accumbens (NAC) is a key CNS region for natural rewards and addictions, but to date no study has evaluated on a large scale the events in NAC that underlie the maternal change in natural rewards. In this study we utilized microarray and bioinformatics approaches to evaluate postpartum NAC gene expression changes in mice. Modular Single-set Enrichment Test (MSET) indicated that postpartum (relative to virgin) NAC gene expression profile was significantly enriched for genes related to addiction and reward in five of five independently curated databases (e.g., Malacards, Phenopedia). Over 100 addiction/reward related genes were identified and these included: Per1, Per2, Arc, Homer2, Creb1, Grm3, Fosb, Gabrb3, Adra2a, Ntrk2, Cry1, Penk, Cartpt, Adcy1, Npy1r, Htr1a, Drd1a, Gria1, and Pdyn. ToppCluster analysis found maternal NAC expression profile to be significantly enriched for genes related to the drug action of nicotine, ketamine, and dronabinol. Pathway analysis indicated postpartum NAC as enriched for RNA processing, CNS development/differentiation, and transcriptional regulation. Weighted Gene Coexpression Network Analysis (WGCNA) identified possible networks for transcription factors, including Nr1d1, Per2, Fosb, Egr1, and Nr4a1. The postpartum state involves increased risk for mental health disorders and MSET analysis indicated postpartum NAC to be enriched for genes related to depression, bipolar disorder (BPD), and schizophrenia. Mental health related genes included: Fabp7, Grm3, Penk, and Nr1d1. We confirmed via quantitative PCR Nr1d1, Per2, Grm3, Penk, Drd1a, and Pdyn. This study indicates for the first time that postpartum NAC involves large scale gene expression alterations linked to addiction and reward. Because the postpartum state also involves decreased response to drugs, the findings could provide insights into how to mitigate addictions. PMID:25414651

  16. Effects of Electroacupuncture on the Daily Rhythmicity of Intestinal Movement and Circadian Rhythmicity of Colonic Per2 Expression in Rats with Spinal Cord Injury

    PubMed Central

    Wang, Xueqiang; Zhang, Wenyi; Xie, Bin; Zhu, Zhaojin; Lu, Yuemei


    Background. Spinal cord injury (SCI) leads to bowel dysfunction. Electroacupuncture (EA) may improve bowel function. Objective. To assess EA on daily rhythmicity of intestinal movement and circadian rhythmicity of colonic Per2 expression in rats with SCI. Methods. Rats were randomized to the sham, SCI, and SCI+EA groups. EA was performed at bilateral Zusanli point (ST36) during daytime (11:00–11:30) for 14 days following SCI. Intestinal transit and daily rhythmicity of intestinal movement were assessed. Circadian rhythmicity of colonic Per2 expression was assessed by real-time RT-PCR. Results. EA shortened the stool efflux time and increased the dry fecal weight within 24 h in SCI rats. Daily rhythmicity of intestinal movements was unaffected by SCI. The expression of colonic Per2 peaked at 20:00 and the nadir was observed at 8:00 in the SCI and sham groups. In the SCI+EA group, colonic Per2 expression peaked at 12:00 and 20:00, and the nadir was observed at 8:00. Conclusion. SCI did not change the circadian rhythmicity of colonic Per2 expression in rats, and daily intestinal movement rhythmicity was retained. EA changed the daily rhythmicity of intestinal movement and the circadian rhythmicity of colonic Per2 expression in rats with SCI, increasing Per2 expression shortly after EA treatment. PMID:27999821

  17. Mammalian complex I pumps 4 protons per 2 electrons at high and physiological proton motive force in living cells.


    Ripple, Maureen O; Kim, Namjoon; Springett, Roger


    Mitochondrial complex I couples electron transfer between matrix NADH and inner-membrane ubiquinone to the pumping of protons against a proton motive force. The accepted proton pumping stoichiometry was 4 protons per 2 electrons transferred (4H(+)/2e(-)) but it has been suggested that stoichiometry may be 3H(+)/2e(-) based on the identification of only 3 proton pumping units in the crystal structure and a revision of the previous experimental data. Measurement of proton pumping stoichiometry is challenging because, even in isolated mitochondria, it is difficult to measure the proton motive force while simultaneously measuring the redox potentials of the NADH/NAD(+) and ubiquinol/ubiquinone pools. Here we employ a new method to quantify the proton motive force in living cells from the redox poise of the bc(1) complex measured using multiwavelength cell spectroscopy and show that the correct stoichiometry for complex I is 4H(+)/2e(-) in mouse and human cells at high and physiological proton motive force.

  18. Forced rather than voluntary exercise entrains peripheral clocks via a corticosterone/noradrenaline increase in PER2::LUC mice

    PubMed Central

    Sasaki, Hiroyuki; Hattori, Yuta; Ikeda, Yuko; Kamagata, Mayo; Iwami, Shiho; Yasuda, Shinnosuke; Tahara, Yu; Shibata, Shigenobu


    Exercise during the inactive period can entrain locomotor activity and peripheral circadian clock rhythm in mice; however, mechanisms underlying this entrainment are yet to be elucidated. Here, we showed that the bioluminescence rhythm of peripheral clocks in PER2::LUC mice was strongly entrained by forced treadmill and forced wheel-running exercise rather than by voluntary wheel-running exercise at middle time during the inactivity period. Exercise-induced entrainment was accompanied by increased levels of serum corticosterone and norepinephrine in peripheral tissues, similar to the physical stress-induced response. Adrenalectomy with norepinephrine receptor blockers completely blocked the treadmill exercise-induced entrainment. The entrainment of the peripheral clock by exercise is independent of the suprachiasmatic nucleus clock, the main oscillator in mammals. The present results suggest that the response of forced exercise, but not voluntary exercise, may be similar to that of stress, and possesses the entrainment ability of peripheral clocks through the activation of the adrenal gland and the sympathetic nervous system. PMID:27271267

  19. From Blue Light to Clock Genes in Zebrafish ZEM-2S Cells

    PubMed Central

    Ramos, Bruno C. R.; Moraes, Maria Nathália C. M.; Poletini, Maristela O.; Lima, Leonardo H. R. G.; Castrucci, Ana Maria L.


    Melanopsin has been implicated in the mammalian photoentrainment by blue light. This photopigment, which maximally absorbs light at wavelengths between 470 and 480 nm depending on the species, is found in the retina of all classes of vertebrates so far studied. In mammals, melanopsin activation triggers a signaling pathway which resets the circadian clock in the suprachiasmatic nucleus (SCN). Unlike mammals, Drosophila melanogaster and Danio rerio do not rely only on their eyes to perceive light, in fact their whole body may be capable of detecting light and entraining their circadian clock. Melanopsin, teleost multiple tissue (tmt) opsin and others such as neuropsin and va-opsin, are found in the peripheral tissues of Danio rerio, however, there are limited data concerning the photopigment/s or the signaling pathway/s directly involved in light detection. Here, we demonstrate that melanopsin is a strong candidate to mediate synchronization of zebrafish cells. The deduced amino acid sequence of melanopsin, although being a vertebrate opsin, is more similar to invertebrate than vertebrate photopigments, and melanopsin photostimulation triggers the phosphoinositide pathway through activation of a Gq/11-type G protein. We stimulated cultured ZEM-2S cells with blue light at wavelengths consistent with melanopsin maximal absorption, and evaluated the time course expression of per1b, cry1b, per2 and cry1a. Using quantitative PCR, we showed that blue light is capable of slightly modulating per1b and cry1b genes, and drastically increasing per2 and cry1a expression. Pharmacological assays indicated that per2 and cry1a responses to blue light are evoked through the activation of the phosphoinositide pathway, which crosstalks with nitric oxide (NO) and mitogen activated protein MAP kinase (MAPK) to activate the clock genes. Our results suggest that melanopsin may be important in mediating the photoresponse in Danio rerio ZEM-2S cells, and provide new insights about the

  20. Mitomycin C modulates the circadian oscillation of clock gene period 2 expression through attenuating the glucocorticoid signaling in mouse fibroblasts.


    Kusunose, Naoki; Matsunaga, Naoya; Kimoto, Kenichi; Akamine, Takahiro; Hamamura, Kengo; Koyanagi, Satoru; Ohdo, Shigehiro; Kubota, Toshiaki


    Clock gene regulates the circadian rhythm of various physiological functions. The expression of clock gene has been shown to be attenuated by certain drugs, resulting in a rhythm disorder. Mitomycin C (MMC) is often used in combination with ophthalmic surgery, especially in trabeculectomy, a glaucoma surgical procedure. The purpose of this study was to investigate the influence of MMC on clock gene expression in fibroblasts, the target cells of MMC. Following MMC treatment, Bmal1 mRNA levels was significantly decreased, whereas Dbp, Per1, and Rev-erbα mRNA levels were significantly increased in the mouse fibroblast cell line NIH3T3 cells. Microarray analysis was performed to explore of the gene(s) responsible for MMC-induced alteration of clock gene expression, and identified Nr3c1 gene encoding glucocorticoid receptor (GR) as a candidate. MMC suppressed the induction of Per1 mRNA by dexamethasone (DEX), ligand of GR, in NIH3T3 cells. MMC also modulated the DEX-driven circadian oscillations of Per2::Luciferase bioluminescence in mouse-derived ocular fibroblasts. Our results demonstrate a previously unknown effect of MMC in GR signaling and the circadian clock system. The present findings suggest that MMC combined with trabeculectomy could increase the risk for a local circadian rhythm-disorder at the ocular surface.

  1. miR-92a Corrects CD34+ Cell Dysfunction in Diabetes by Modulating Core Circadian Genes Involved in Progenitor Differentiation.


    Bhatwadekar, Ashay D; Yan, Yuanqing; Stepps, Valerie; Hazra, Sugata; Korah, Maria; Bartelmez, Stephen; Chaqour, Brahim; Grant, Maria B


    Autologous CD34(+) cells are widely used for vascular repair; however, in individuals with diabetes and microvascular disease these cells are dysfunctional. In this study, we examine expression of the clock genes Clock, Bmal, Per1, Per2, Cry1, and Cry2 in CD34(+) cells of diabetic and nondiabetic origin and determine the small encoding RNA (miRNA) profile of these cells. The degree of diabetic retinopathy (DR) was assessed. As CD34(+) cells acquired mature endothelial markers, they exhibit robust oscillations of clock genes. siRNA treatment of CD34(+) cells revealed Per2 as the only clock gene necessary to maintain the undifferentiated state of CD34(+) cells. Twenty-five miRNAs targeting clock genes were identified. Three of the miRNAs (miR-18b, miR-16, and miR-34c) were found only in diabetic progenitors. The expression of the Per2-regulatory miRNA, miR-92a, was markedly reduced in CD34(+) cells from individuals with DR compared with control subjects and patients with diabetes with no DR. Restoration of miR-92a levels in CD34(+) cells from patients with diabetes with DR reduced the inflammatory phenotype of these cells and the diabetes-induced propensity toward myeloid differentiation. Our studies suggest that restoring levels of miR-92a could enhance the usefulness of CD34(+) cells in autologous cell therapy.

  2. Phase shifts in circadian peripheral clocks caused by exercise are dependent on the feeding schedule in PER2::LUC mice.


    Sasaki, Hiroyuki; Hattori, Yuta; Ikeda, Yuko; Kamagata, Mayo; Iwami, Shiho; Yasuda, Shinnosuke; Shibata, Shigenobu


    Circadian rhythms are regulated by the suprachiasmatic nucleus (SCN) clock, which is the main oscillator and peripheral clock. SCN clock can be entrained by both photic and non-photic stimuli, and an interaction exists between photic and non-photic entrainment. Moreover, peripheral circadian clocks can be entrained not only by scheduled restricted feeding, but also by scheduled exercise. Thus, the entrainment of peripheral circadian clocks may be the result of an interaction between the entrainment caused by feeding and exercise. In this study, we examined the effect of wheel-running exercise on the phase of the peripheral clocks (kidney, liver and submandibular gland) in PER2::LUC mice under various feeding schedules. Phase and waveforms of the peripheral clocks were not affected by voluntary wheel-running exercise. Exercise for a period of 4 h during the early dark period (morning) delayed the peripheral clocks, while exercise for the same duration during the late dark period (evening) advanced the peripheral clocks. The feeding phase was advanced and delayed by evening and morning exercise, respectively, suggesting that the feeding pattern elicited by the scheduled exercise may entrain the peripheral clocks. Exercise did not affect the phase of the peripheral clock under the 1 meal per day schedule. When the phase of the peripheral clocks was advanced by the feeding schedule of 2 or 4 meals per day during light and/or dark periods, wheel-running exercise during the morning period significantly and equally shifted the phase of all organs back to the original positions observed in mice maintained under free-feeding conditions and with no exercise. When the schedule of 2 meals per day during the dark period failed to affect the phase of peripheral clock, morning exercise did not affect the phase. Wheel-running exercise increased the levels of serum corticosterone, and the injection of dexamethasone/corticosterone instead of exercise shifted a phase that had

  3. Sleep Loss Reduces the DNA-Binding of BMAL1, CLOCK, and NPAS2 to Specific Clock Genes in the Mouse Cerebral Cortex

    PubMed Central

    Curie, Thomas; Franken, Paul


    We have previously demonstrated that clock genes contribute to the homeostatic aspect of sleep regulation. Indeed, mutations in some clock genes modify the markers of sleep homeostasis and an increase in homeostatic sleep drive alters clock gene expression in the forebrain. Here, we investigate a possible mechanism by which sleep deprivation (SD) could alter clock gene expression by quantifying DNA-binding of the core-clock transcription factors CLOCK, NPAS2, and BMAL1 to the cis-regulatory sequences of target clock genes in mice. Using chromatin immunoprecipitation (ChIP), we first showed that, as reported for the liver, DNA-binding of CLOCK and BMAL1 to target clock genes changes in function of time-of-day in the cerebral cortex. Tissue extracts were collected at ZT0 (light onset), −6, −12, and −18, and DNA enrichment of E-box or E'-box containing sequences was measured by qPCR. CLOCK and BMAL1 binding to Cry1, Dbp, Per1, and Per2 depended on time-of-day, with maximum values reached at around ZT6. We then observed that SD, performed between ZT0 and −6, significantly decreased DNA-binding of CLOCK and BMAL1 to Dbp, consistent with the observed decrease in Dbp mRNA levels after SD. The DNA-binding of NPAS2 and BMAL1 to Per2 was also decreased by SD, although SD is known to increase Per2 expression in the cortex. DNA-binding to Per1 and Cry1 was not affected by SD. Our results show that the sleep-wake history can affect the clock molecular machinery directly at the level of chromatin binding thereby altering the cortical expression of Dbp and Per2 and likely other targets. Although the precise dynamics of the relationship between DNA-binding and mRNA expression, especially for Per2, remains elusive, the results also suggest that part of the reported circadian changes in DNA-binding of core clock components in tissues peripheral to the suprachiasmatic nuclei could, in fact, be sleep-wake driven. PMID:22039518

  4. Sleep loss reduces the DNA-binding of BMAL1, CLOCK, and NPAS2 to specific clock genes in the mouse cerebral cortex.


    Mongrain, Valérie; La Spada, Francesco; Curie, Thomas; Franken, Paul


    We have previously demonstrated that clock genes contribute to the homeostatic aspect of sleep regulation. Indeed, mutations in some clock genes modify the markers of sleep homeostasis and an increase in homeostatic sleep drive alters clock gene expression in the forebrain. Here, we investigate a possible mechanism by which sleep deprivation (SD) could alter clock gene expression by quantifying DNA-binding of the core-clock transcription factors CLOCK, NPAS2, and BMAL1 to the cis-regulatory sequences of target clock genes in mice. Using chromatin immunoprecipitation (ChIP), we first showed that, as reported for the liver, DNA-binding of CLOCK and BMAL1 to target clock genes changes in function of time-of-day in the cerebral cortex. Tissue extracts were collected at ZT0 (light onset), -6, -12, and -18, and DNA enrichment of E-box or E'-box containing sequences was measured by qPCR. CLOCK and BMAL1 binding to Cry1, Dbp, Per1, and Per2 depended on time-of-day, with maximum values reached at around ZT6. We then observed that SD, performed between ZT0 and -6, significantly decreased DNA-binding of CLOCK and BMAL1 to Dbp, consistent with the observed decrease in Dbp mRNA levels after SD. The DNA-binding of NPAS2 and BMAL1 to Per2 was also decreased by SD, although SD is known to increase Per2 expression in the cortex. DNA-binding to Per1 and Cry1 was not affected by SD. Our results show that the sleep-wake history can affect the clock molecular machinery directly at the level of chromatin binding thereby altering the cortical expression of Dbp and Per2 and likely other targets. Although the precise dynamics of the relationship between DNA-binding and mRNA expression, especially for Per2, remains elusive, the results also suggest that part of the reported circadian changes in DNA-binding of core clock components in tissues peripheral to the suprachiasmatic nuclei could, in fact, be sleep-wake driven.

  5. Potent Effects of Flavonoid Nobiletin on Amplitude, Period, and Phase of the Circadian Clock Rhythm in PER2::LUCIFERASE Mouse Embryonic Fibroblasts

    PubMed Central

    Shinozaki, Ayako; Misawa, Kenichiro; Ikeda, Yuko; Haraguchi, Atsushi; Kamagata, Mayo; Tahara, Yu; Shibata, Shigenobu


    Flavonoids are natural polyphenols that are widely found in plants. The effects of flavonoids on obesity and numerous diseases such as cancer, diabetes, and Alzheimer’s have been well studied. However, little is known about the relationships between flavonoids and the circadian clock. In this study, we show that continuous or transient application of flavonoids to the culture medium of embryonic fibroblasts from PER2::LUCIFERASE (PER2::LUC) mice induced various modifications in the circadian clock amplitude, period, and phase. Transient application of some of the tested flavonoids to cultured cells induced a phase delay of the PER2::LUC rhythm at the down slope phase. In addition, continuous application of the polymethoxy flavonoids nobiletin and tangeretin increased the amplitude and lengthened the period of the PER2::LUC rhythm. The nobiletin-induced phase delay was blocked by co-treatment with U0126, an ERK inhibitor. In summary, among the tested flavonoids, polymethoxy flavones increased the amplitude, lengthened the period, and delayed the phase of the PER2::LUC circadian rhythm. Therefore, foods that contain polymethoxy flavones may have beneficial effects on circadian rhythm disorders and jet lag. PMID:28152057

  6. Daily rhythm and regulation of clock gene expression in the rat pineal gland.


    Simonneaux, V; Poirel, V-J; Garidou, M-L; Nguyen, D; Diaz-Rodriguez, E; Pévet, P


    Rhythms in pineal melatonin synthesis are controlled by the biological clock located in the suprachiasmatic nuclei. The endogenous clock oscillations rely upon genetic mechanisms involving clock genes coding for transcription factors working in negative and positive feedback loops. Most of these clock genes are expressed rhythmically in other tissues. Because of the peculiar role of the pineal gland in the photoneuroendocrine axis regulating biological rhythms, we studied whether clock genes are expressed in the rat pineal gland and how their expression is regulated.Per1, Per3, Cry2 and Cry1 clock genes are expressed in the pineal gland and their transcription is increased during the night. Analysis of the regulation of these pineal clock genes indicates that they may be categorized into two groups. Expression of Per1 and Cry2 genes shows the following features: (1) the 24 h rhythm persists, although damped, in constant darkness; (2) the nocturnal increase is abolished following light exposure or injection with a beta-adrenergic antagonist; and (3) the expression during daytime is stimulated by an injection with a beta-adrenergic agonist. In contrast, Per3 and Cry1 day and night mRNA levels are not responsive to adrenergic ligands (as previously reported for Per2) and daily expression of Per3 and Cry1 appears strongly damped or abolished in constant darkness. These data show that the expression of Per1 and Cry2 in the rat pineal gland is regulated by the clock-driven changes in norepinephrine, in a similar manner to the melatonin rhythm-generating enzyme arylalkylamine N-acetyltransferase. The expression of Per3 and Cry1 displays a daily rhythm not regulated by norepinephrine, suggesting the involvement of another day/night regulated transmitter(s).

  7. Poor Sleep Quality Is Associated with Dawn Phenomenon and Impaired Circadian Clock Gene Expression in Subjects with Type 2 Diabetes Mellitus

    PubMed Central

    Li, Yuan; Tao, Xiaoming


    Aims. We investigated whether poor sleep quality is associated with both dawn phenomenon and impaired circadian clock gene expression in subjects with diabetes. Methods. 81 subjects with diabetes on continuous glucose monitoring were divided into two groups according to the Pittsburgh Sleep Quality Index. The magnitude of dawn phenomenon was quantified by its increment from nocturnal nadir to prebreakfast. Peripheral leucocytes were sampled from 81 subjects with diabetes and 28 normal controls at 09:00. Transcript levels of circadian clock genes (BMAL1, PER1, PER2, and PER3) were determined by real-time quantitative polymerase chain reaction. Results. The levels of HbA1c and fasting glucose and the magnitude of dawn phenomenon were significantly higher in the diabetes group with poor sleep quality than that with good sleep quality. Peripheral leucocytes from subjects with poor sleep quality expressed significantly lower transcript levels of BMAL1 and PER1 compared with those with good sleep quality. Poor sleep quality was significantly correlated with magnitude of dawn phenomenon. Multiple linear regression showed that sleep quality and PER1 were significantly independently correlated with dawn phenomenon. Conclusions. Dawn phenomenon is associated with sleep quality. Furthermore, mRNA expression of circadian clock genes is dampened in peripheral leucocytes of subjects with poor sleep quality. PMID:28352282

  8. Mutations at Arg220 and Thr237 in PER-2 β-lactamase: impact on conformation, activity and susceptibility to inhibitors.


    Ruggiero, Melina; Curto, Lucrecia; Brunetti, Florencia; Sauvage, Eric; Galleni, Moreno; Power, Pablo; Gutkind, Gabriel


    PER-2 accounts for up to 10% of oxyimino-cephalosporin resistance in Klebsiella pneumoniae and Escherichia coli in Argentina, and hydrolyzes both cefotaxime and ceftazidime with high catalytic efficiencies (kcat/Km). Through crystallographic analyses, we recently proposed the existence of a hydrogen-bond network connecting Ser70-Gln69-oxyanion water-Thr237-Arg220 that might be important for the activity and inhibition of the enzyme. Mutations at Arg244 in most class A β-lactamases (as TEM and SHV) reduce susceptibility to mechanism-based inactivators, and Arg220 in PER β-lactamases is equivalent to Arg244. Alterations in the hydrogen bond network of the active site in PER-2, through modifications in key residues such as Arg220 and (to a much lesser extent) Thr237, dramatically impact the overall susceptibility to inactivation, with up to ∼300 and 500-fold reduction in the kinact/KI values for clavulanic acid and tazobactam, respectively. Hydrolysis on cephalosporins and aztreonam was also affected although in different extents compared to wild-type PER-2; for cefepime, only Arg220Gly mutation resulted in a strong reduction in the catalytic efficiency. Mutations at Arg220 entail modifications in the catalytic activity of PER-2, and probably local perturbations in the protein, but not global conformational changes. Therefore, the apparent structural stability of the mutants suggests that these enzymes could be possibly selected in vivo.

  9. Photoperiod regulates multiple gene expression in the suprachiasmatic nuclei and pars tuberalis of the Siberian hamster (Phodopus sungorus).


    Johnston, Jonathan D; Ebling, Francis J P; Hazlerigg, David G


    Photoperiod regulates the seasonal physiology of many mammals living in temperate latitudes. Photoperiodic information is decoded by the master circadian clock in the suprachiasmatic nuclei (SCN) of the hypothalamus and then transduced via pineal melatonin secretion. This neurochemical signal is interpreted by tissues expressing melatonin receptors (e.g. the pituitary pars tuberalis, PT) to drive physiological changes. In this study we analysed the photoperiodic regulation of the circadian clockwork in the SCN and PT of the Siberian hamster. Female hamsters were exposed to either long or short photoperiod for 8 weeks and sampled at 2-h intervals across the 24-h cycle. In the SCN, rhythmic expression of the clock genes Per1, Per2, Cry1, Rev-erbalpha, and the clock-controlled genes arginine vasopressin (AVP) and d-element binding protein (DBP) was modulated by photoperiod. All of these E-box-containing genes tracked dawn, with earlier peak mRNA expression in long, compared to short, photoperiod. This response occurred irrespective of the presence of additional regulatory cis-elements, suggesting photoperiodic regulation of SCN gene expression through a common E-box-related mechanism. In long photoperiod, expression of Cry1 and Per1 in the PT tracked the onset and offset of melatonin secretion, respectively. However, whereas Cry1 tracked melatonin onset in short period, Per1 expression was not detectably rhythmic. We therefore propose that, in the SCN, photoperiodic regulation of clock gene expression primarily occurs via E-boxes, whereas melatonin-driven signal transduction drives the phasing of a subset of clock genes in the PT, independently of the E-box.

  10. Cadmium-Induced Disruption in 24-h Expression of Clock and Redox Enzyme Genes in Rat Medial Basal Hypothalamus: Prevention by Melatonin

    PubMed Central

    Jiménez-Ortega, Vanesa; Cano-Barquilla, Pilar; Scacchi, Pablo A.; Cardinali, Daniel P.; Esquifino, Ana I.


    In a previous study we reported that a low daily p.o. dose of cadmium (Cd) disrupted the circadian expression of clock and redox enzyme genes in rat medial basal hypothalamus (MBH). To assess whether melatonin could counteract Cd activity, male Wistar rats (45 days of age) received CdCl2 (5 ppm) and melatonin (3 μg/mL) or vehicle (0.015% ethanol) in drinking water. Groups of animals receiving melatonin or vehicle alone were also included. After 1 month, MBH mRNA levels were measured by real-time PCR analysis at six time intervals in a 24-h cycle. In control MBH Bmal1 expression peaked at early scotophase, Per1 expression at late afternoon, and Per2 and Cry2 expression at mid-scotophase, whereas neither Clock nor Cry1 expression showed significant 24-h variations. This pattern was significantly disrupted (Clock, Bmal1) or changed in phase (Per1, Per2, Cry2) by CdCl2 while melatonin counteracted the changes brought about by Cd on Per1 expression only. In animals receiving melatonin alone the 24-h pattern of MBH Per2 and Cry2 expression was disrupted. CdCl2 disrupted the 24-h rhythmicity of Cu/Zn- and Mn-superoxide dismutase (SOD), nitric oxide synthase (NOS)-1, NOS-2, heme oxygenase (HO)-1, and HO-2 gene expression, most of the effects being counteracted by melatonin. In particular, the co-administration of melatonin and CdCl2 increased Cu/Zn-SOD gene expression and decreased that of glutathione peroxidase (GPx), glutathione reductase (GSR), and HO-2. In animals receiving melatonin alone, significant increases in mean Cu/Zn and Mn-SOD gene expression, and decreases in that of GPx, GSR, NOS-1, NOS-2, HO-1, and HO-2, were found. The results indicate that the interfering effect of melatonin on the activity of a low dose of CdCl2 on MBH clock and redox enzyme genes is mainly exerted at the level of redox enzyme gene expression. PMID:21442002

  11. Effects of Photoperiod Extension on Clock Gene and Neuropeptide RNA Expression in the SCN of the Soay Sheep

    PubMed Central

    Dardente, Hugues; Wyse, Cathy A.; Lincoln, Gerald A.; Wagner, Gabriela C.; Hazlerigg, David G.


    In mammals, changing daylength (photoperiod) is the main synchronizer of seasonal functions. The photoperiodic information is transmitted through the retino-hypothalamic tract to the suprachiasmatic nuclei (SCN), site of the master circadian clock. To investigate effects of day length change on the sheep SCN, we used in-situ hybridization to assess the daily temporal organization of expression of circadian clock genes (Per1, Per2, Bmal1 and Fbxl21) and neuropeptides (Vip, Grp and Avp) in animals acclimated to a short photoperiod (SP; 8h of light) and at 3 or 15 days following transfer to a long photoperiod (LP3, LP15, respectively; 16h of light), achieved by an acute 8-h delay of lights off. We found that waveforms of SCN gene expression conformed to those previously seen in LP acclimated animals within 3 days of transfer to LP. Mean levels of expression for Per1-2 and Fbxl21 were nearly 2-fold higher in the LP15 than in the SP group. The expression of Vip was arrhythmic and unaffected by photoperiod, while, in contrast to rodents, Grp expression was not detectable within the sheep SCN. Expression of the circadian output gene Avp cycled robustly in all photoperiod groups with no detectable change in phasing. Overall these data suggest that synchronizing effects of light on SCN circadian organisation proceed similarly in ungulates and in rodents, despite differences in neuropeptide gene expression. PMID:27458725

  12. The Light Wavelength Affects the Ontogeny of Clock Gene Expression and Activity Rhythms in Zebrafish Larvae.


    Di Rosa, Viviana; Frigato, Elena; López-Olmeda, José F; Sánchez-Vázquez, Francisco J; Bertolucci, Cristiano


    Light plays a key role in synchronizing rhythms and setting the phase of early development. However, to date, little is known about the impact of light wavelengths during the ontogeny of the molecular clock and the behavioural rhythmicity. The aim of this research was to determine the effect of light of different wavelengths (white, blue and red) on the onset of locomotor activity and clock gene (per1b, per2, clock1, bmal1 and dbp) expression rhythms. For this purpose, 4 groups of zebrafish embryo/larvae were raised from 0 to 7 days post-fertilization (dpf) under the following lighting conditions: three groups maintained under light:dark (LD) cycles with white (full visible spectrum, LDW), blue (LDB), or red light (LDR), and one group raised under constant darkness (DD). The results showed that lighting conditions influenced activity rhythms. Larvae were arrhythmic under DD, while under LD cycles they developed wavelength-dependent daily activity rhythms which appeared earlier under LDB (4 dpf) than under LDW or LDR (5 dpf). The results also revealed that development and lighting conditions influenced clock gene expression. While clock1 rhythmic expression appeared in all lighting conditions at 7 dpf, per1b, per2 and dbp showed daily variations already at 3 dpf. Curiously, bmal1 showed consistent rhythmic expression from embryonic stage (0 dpf). Summarizing, the data revealed that daily rhythms appeared earlier in the larvae reared under LDB than in those reared under LDW and LDR. These results emphasize the importance of lighting conditions and wavelengths during early development for the ontogeny of daily rhythms of gene expression and how these rhythms are reflected on the behavioural rhythmicity of zebrafish larvae.

  13. Changes in Gene Expression Patterns of Circadian-Clock, Transient Receptor Potential Vanilloid-1 and Nerve Growth Factor in Inflamed Human Esophagus

    PubMed Central

    Yang, Shu-Chuan; Chen, Chien-Lin; Yi, Chih-Hsun; Liu, Tso-Tsai; Shieh, Kun-Ruey


    Circadian rhythm is driven by the molecular circadian-clock system and regulates many physiological functions. Diurnal rhythms in the gastrointestinal tract are known to be related to feeding pattern, but whether these rhythms are also related to the gastrointestinal damage or injuries; for example, gastroesophageal reflux disease (GERD), is unclear. This study was conducted to determine whether expression of circadian-clock genes or factors involved in vagal stimulation or sensitization were altered in the esophagus of GERD patients. Diurnal patterns of PER1, PER2, BMAL1, CRY2, TRPV1, and NGF mRNA expression were found in patient controls, and these patterns were altered and significantly correlated to the GERD severity in GERD patients. Although levels of CRY1, TIM, CB1, NHE3, GDNF, and TAC1 mRNA expression did not show diurnal patterns, they were elevated and also correlated with GERD severity in GERD patients. Finally, strong correlations among PER1, TRPV1, NGF and CRY2 mRNA expression, and among PER2, TRPV1 and CRY2 expression were found. Expression levels of CRY1 mRNA highly correlated with levels of TIM, CB1, NHE3, GDNF and TAC1. This study suggests that the circadian rhythm in the esophagus may be important for the mediation of and/or the response to erosive damage in GERD patients. PMID:26337663

  14. Restricted feeding phase shifts clock gene and sodium glucose cotransporter 1 (SGLT1) expression in rats.


    Balakrishnan, Anita; Stearns, Adam T; Ashley, Stanley W; Tavakkolizadeh, Ali; Rhoads, David B


    The intestine exhibits striking diurnal rhythmicity in glucose uptake, mediated by the sodium glucose cotransporter (SGLT1); however, regulatory pathways for these rhythms remain incompletely characterized. We hypothesized that SGLT1 rhythmicity is linked to the circadian clock. To investigate this, we examined rhythmicity of Sglt1 and individual clock genes in rats that consumed food ad libitum (AL). We further compared phase shifts of Sglt1 and clock genes in a second group of rats following restricted feeding to either the dark (DF) or light (LF) phase. Rats fed during the DF were pair-fed to rats fed during the LF. Jejunal mucosa was harvested across the diurnal period to generate expression profiles of Sglt1 and clock genes Clock, Bmal1 (brain-muscle Arnt-like 1), ReverbA/B, Per(Period) 1/2, and Cry (Cryptochrome) 1/2. All clock genes were rhythmic in AL rats (P < 0.05). Sglt1 also exhibited diurnal rhythmicity, with peak expression preceding nutrient arrival (P < 0.05). Light-restricted feeding shifted the expression rhythms of Sglt1 and most clock genes (Bmal1, ReverbA and B, Per1, Per2, and Cry1) compared with dark-restricted feeding (P < 0.05). The Sglt1 rhythm shifted in parallel with rhythms of Per1 and ReverbB. These effects of restricted feeding highlight luminal nutrients as a key Zeitgeber in the intestine, capable of simultaneously shifting the phases of transporter and clock gene expression, and suggest a role for clock genes in regulating Sglt1 and therefore glucose uptake. Understanding the regulatory cues governing rhythms in intestinal function may allow new therapeutic options for conditions of dysregulated absorption such as diabetes and obesity.

  15. Daily and seasonal expression of clock genes in the pituitary of the European sea bass (Dicentrarchus labrax).


    Herrero, María Jesús; Lepesant, Julie M J


    The expression of select clock genes (clock, bmal, per1, per2, cry1, cry2) was investigated throughout the day and across the four seasons for two consecutive years in the pituitary of adult sea bass (Dicentrarchus labrax). A rhythmic pattern of daily expression was consistently observed in summer and autumn, while arrhythmicity was observed for some clock genes during spring and winter, concomitant with low water temperatures. The expression of clock and bmal showed highest values at the end of the day and during the night, while that of per and cry was mostly antiphasic, with high values during the day. Melatonin affects clock-gene expression in the pituitary of mammals. We therefore sought to test the effect of melatonin on clock-gene expression in the pituitary of sea bass both in vivo and in vitro. Melatonin modestly affected the expression of some clock genes (in particular cry genes) when added to the fish diet or the culture medium of pituitary glands. Our data show that clock genes display rhythmic daily expression in the pituitary of adult sea bass, which are profoundly modified according to the season. We suggest that the effect of photoperiod on clock gene expression may be mediated, at least in part, by melatonin, and that temperature may have a key role adjusting seasonal variations.

  16. Estradiol differently affects melanin synthesis of malignant and normal melanocytes: a relationship with clock and clock-controlled genes.


    Poletini, Maristela Oliveira; de Assis, Leonardo Vinicius Monteiro; Moraes, Maria Nathalia; Castrucci, Ana Maria de Lauro


    Melanin production within melanocytes is regulated, among others, by estradiol, whose effects on melanogenesis are still not completely elucidated. Here we show that although 10(-7) M 17β-estradiol (E2) increased tyrosinase mRNA levels in B16-F10 malignant melanocytes, there was a transient decrease and abolishment of the temporal variation of melanin content. Both parameters were much higher in the malignant than in normal Melan-a cells. Considering that silencing clock machinery in human melanocytes increases melanogenesis, we investigated clock gene expression in those cell lines. Except for Melan-a Bmal1 and B16-F10 Per2 expression of control cells, Per1, Per2, and Bmal1 expression increased independently of cell type or E2 treatment after 24 h. However, melanoma cells showed a marked increase in Per1 and Bma11 expression in response to E2 at the same time points, what may rule out E2 as a synchronizer agent since the expression of those genes were not in antiphase. Next, we investigated the expression of Xpa, a clock-controlled gene, which in Melan-a cells, peaked at 18 h, and E2 treatment shifted this peak to 24 h, whereas B16-F10 Xpa expression peaked at 24 h in both control and E2 group, and it was higher compared to Melan-a cells in both groups. Therefore, malignant and normal melanocytes display profound differences on core elements of the local clock, and how they respond to E2, what is most probably determinant of the differences seen on melanin synthesis and Tyrosinase and Xpa expression. Understanding these processes at the molecular level could bring new strategies to treat melanoma.

  17. Restricted wheel access following a light cycle inversion slows re-entrainment without internal desynchrony as measured in Per2Luc mice.


    Castillo, C; Molyneux, P; Carlson, R; Harrington, M E


    Circadian rhythms are physiological and behavioral oscillations that have period lengths of approximately 24 h. In mammals, circadian rhythms are driven by a master pacemaker in the hypothalamic suprachiasmatic nucleus (SCN). These rhythms can be entrained to light:dark cycles through photic and non-photic cues. Current research suggests that the SCN re-entrains rapidly to new light:dark (LD) cycles with the first photic cues, whereas peripheral tissues re-entrain more slowly, leading to a transient state of internal disorder while the organism adjusts to the new timing of photic input. To assess internal temporal order during the readjustment we used dim light to slow the rate of re-entrainment following a 12-h inversion of the LD cycle. We also used a wheel-restriction paradigm, which can block behavioral evidence of re-entrainment. Per2(Luc) mice were entrained to a 12:12 dim LD cycle with wheel access ad libitum. Following a 12-h shift in the LD cycle, some animals were subjected to wheel restriction; wheels were locked during the new dark period and available during the new light period. Other mice had wheels available ad lib throughout the experiment. Behavioral actograms of general locomotor activity as measured with motion sensors indicated that mice with ad lib access to wheels were able to re-entrain at a rate significantly faster than mice with restricted wheel access. Up to 2 weeks following the LD inversion many wheel-restricted animals were still active predominantly in the new light period. Phase of the PER2::LUC bioluminescence rhythms in SCN and four peripheral tissues (lung, esophagus, thymus, and spleen), measured ex vivo on days 2, 9, and 16 following the inversion, indicated that within each condition the SCN and peripheral tissues shifted at the same rate, whereas the rate of re-entrainment for the tissues differed between conditions. Ex vivo data showed that the PER2::LUC peaks in SCN and peripheral tissues were closely linked to time of

  18. Effects of bright light exposure during daytime on peripheral clock gene expression in humans

    NASA Astrophysics Data System (ADS)

    Sato, Maki; Wakamura, Tomoko; Morita, Takeshi; Okamoto, Akihiko; Akashi, Makoto; Matsui, Takuya; Sato, Motohiko


    Light is the strongest synchronizer controlling circadian rhythms. The intensity and duration of light change throughout the year, thereby influencing body weight, food preferences, and melatonin secretion in humans and animals. Although the expression of clock genes has been examined using human samples, it currently remains unknown whether bright light during the daytime affects the expression of these genes in humans. Therefore, we herein investigated the effects of bright light exposure during the daytime on clock gene expression in the hair follicular and root cells of the human scalp. Seven healthy men (20.4 ± 2.2 years old; 172.3 ± 5.8 cm; 64.3 ± 8.5 kg; BMI 21.7 ± 3.1 kg/m2, mean ± SD) participated in this study. Subjects completed 3-day experimental sessions twice in 1 month during which they were exposed to bright and dim light conditions. The mRNA expression of Per1-3, Cry1-2, Rev-erb-α (Nr1d1), Rev-erb-β (Nr1d2), and Dec1 was analyzed using branched DNA probes. No significant changes were observed in the expression of Per1, Per2, Per3, Cry1, Cry2, Rev-erb-α (Nr1d1), or Dec1 following exposure to bright light conditions. However, the expression of Rev-erb-β (Nr1d2) tended to be stronger under bright light than dim light conditions. These results suggest that the bright light stimulus did not influence the expression of clock genes in humans. Long-lasting bright light exposure during the daytime may be required to change the expression of clock genes in humans.

  19. Distinct patterns of Period gene expression in the suprachiasmatic nucleus underlie circadian clock photoentrainment by advances or delays.


    Schwartz, William J; Tavakoli-Nezhad, Mahboubeh; Lambert, Christopher M; Weaver, David R; de la Iglesia, Horacio O


    The circadian clock in the mammalian hypothalamic suprachiasmatic nucleus (SCN) is entrained by the ambient light/dark cycle, which differentially acts to cause the clock to advance or delay. Light-induced changes in the rhythmic expression of SCN clock genes are believed to be a critical step in this process, but how the two entrainment modalities--advances vs. delays--engage the molecular clockwork remains incompletely understood. We investigated molecular substrates of photic entrainment of the clock in the SCN by stably entraining hamsters to T cycles (non-24-h light/dark cycles) consisting of a single 1-h light pulse repeated as either a short (23.33-h) or a long (24.67-h) cycle; under these conditions, the light pulse of the short cycle acts as "dawn," whereas that of the long cycle acts as "dusk." Analyses of the expression of the photoinducible and rhythmic clock genes Period 1 and 2 (Per1 and Per2) in the SCN revealed fundamental differences under these two entrainment modes. Light at dawn advanced the clock, advancing the onset of the Per1 mRNA rhythm and acutely increasing mRNA transcription, whereas light at dusk delayed the clock, delaying the offset of the Per2 mRNA rhythm and tonically increasing mRNA stability. The results suggest that the underlying molecular mechanisms of circadian entrainment differ with morning (advancing) or evening (delaying) light exposure, and such differences may reflect how entrainment takes place in nocturnal animals under natural conditions.

  20. Genes


    ... Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Genes URL of this page: // ...

  1. Plastic oscillators and fixed rhythms: changes in the phase of clock-gene rhythms in the PVN are not reflected in the phase of the melatonin rhythm of grass rats.


    Martin-Fairey, C A; Ramanathan, C; Stowie, A; Walaszczyk, E; Smale, L; Nunez, A A


    The same clock-genes, including Period (PER) 1 and 2, that show rhythmic expression in the suprachiasmatic nucleus (SCN) are also rhythmically expressed in other brain regions that serve as extra-SCN oscillators. Outside the hypothalamus, the phase of these extra-SCN oscillators appears to be reversed when diurnal and nocturnal mammals are compared. Based on mRNA data, PER1 protein is expected to peak in the late night in the paraventricular nucleus of the hypothalamus (PVN) of nocturnal laboratory rats, but comparable data are not available for a diurnal species. Here we use the diurnal grass rat (Arvicanthis niloticus) to describe rhythms of PER1 and 2 proteins in the PVN of animals that either show the species-typical day-active (DA) profile, or that adopt a night-active (NA) profile when given access to running wheels. For DA animals housed with or without wheels, significant rhythms of PER1 or PER2 protein expression featured peaks in the late morning; NA animals showed patterns similar to those expected from nocturnal laboratory rats. Since the PVN is part of the circuit that controls pineal rhythms, we also measured circulating levels of melatonin during the day and night in DA animals with and without wheels and in NA wheel runners. All three groups showed elevated levels of melatonin at night, with higher levels during both the day and night being associated with the levels of activity displayed by each group. The differential phase of rhythms in the clock-gene protein in the PVN of diurnal and nocturnal animals presents a possible mechanism for explaining species differences in the phase of autonomic rhythms controlled, in part, by the PVN. The present study suggests that the phase of the oscillator of the PVN does not determine that of the melatonin rhythm in diurnal and nocturnal species or in diurnal and nocturnal chronotypes within a species.

  2. Plastic oscillators and fixed rhythms: Changes in the phase of clock-gene rhythms in the PVN are not reflected in the phase of the melatonin rhythm of grass rats

    PubMed Central

    Martin-Fairey, Carmel A.; Ramanathan, Chidambaram; Stowie, Adam; Walaszczyk, Erin; Smale, Laura; Nunez, Antonio A.


    The same clock-genes, including Period (PER) 1 and 2, that show rhythmic expression in the suprachiasmatic nucleus (SCN) are also rhythmically expressed in other brain regions that serve as extra-SCN oscillators. Outside the hypothalamus, the phase of these extra-SCN oscillators appears to be reversed when diurnal and nocturnal mammals are compared. Based on mRNA data, PER1 protein is expected to peak in the late night in the paraventricular nucleus of the hypothalamus (PVN) of nocturnal laboratory rats, but comparable data are not available for a diurnal species. Here we use the diurnal grass rat (Arvicanthis niloticus) to describe rhythms of PER1 and 2 protein in the PVN of animals that either show the species-typical day-active profile, or that adopt a night-active profile when given access to running wheels. For day-active animals housed with or without wheels, significant rhythms of PER1 or PER2 protein expression featured peaks in the late morning; night-active animals showed patterns similar to those expected from nocturnal laboratory rats. Since the PVN is part of the circuit that controls pineal rhythms, we also measured circulating levels of melatonin during the day and night in day-active animals with and without wheels and in night-active wheel runners. All three groups showed elevated levels of melatonin at night, with higher levels during both the day and night being associated with the levels of activity displayed by each group. The differential phase of rhythms in clock-gene protein in the PVN of diurnal and nocturnal animals presents a possible mechanism for explaining species differences in the phase of autonomic rhythms controlled, in part, by the PVN. The present study suggests that the phase of the oscillator of the PVN does not determine that of the melatonin rhythm in diurnal and nocturnal species or in diurnal and nocturnal chronotypes within a species. PMID:25575946

  3. Circadian and ultradian rhythms of clock gene expression in the suprachiasmatic nucleus of freely moving mice

    PubMed Central

    Ono, Daisuke; Honma, Ken-ichi; Honma, Sato


    In mammals, the temporal order of physiology and behavior is primarily regulated by the circadian pacemaker located in the hypothalamic suprachiasmatic nucleus (SCN). Rhythms are generated in cells by an auto-regulatory transcription/translation feedback loop, composed of several clock genes and their protein products. Taking advantage of bioluminescence reporters, we have succeeded in continuously monitoring the expression of clock gene reporters Per1-luc, PER2::LUC and Bmal1-ELuc in the SCN of freely moving mice for up to 3 weeks in constant darkness. Bioluminescence emitted from the SCN was collected with an implanted plastic optical fiber which was connected to a cooled photomultiplier tube. We found robust circadian rhythms in the clock gene expression, the phase-relation of which were the same as those observed ex vivo. The circadian rhythms were superimposed by episodic bursts which had ultradian periods of approximately 3.0 h. Episodic bursts often accompanied activity bouts, but stoichiometric as well as temporal analyses revealed no causality between them. Clock gene expression in the SCN in vivo is regulated by the circadian pacemaker and ultradian rhythms of unknown origin. PMID:26194231

  4. Circadian and ultradian rhythms of clock gene expression in the suprachiasmatic nucleus of freely moving mice.


    Ono, Daisuke; Honma, Ken-ichi; Honma, Sato


    In mammals, the temporal order of physiology and behavior is primarily regulated by the circadian pacemaker located in the hypothalamic suprachiasmatic nucleus (SCN). Rhythms are generated in cells by an auto-regulatory transcription/translation feedback loop, composed of several clock genes and their protein products. Taking advantage of bioluminescence reporters, we have succeeded in continuously monitoring the expression of clock gene reporters Per1-luc, PER2::LUC and Bmal1-ELuc in the SCN of freely moving mice for up to 3 weeks in constant darkness. Bioluminescence emitted from the SCN was collected with an implanted plastic optical fiber which was connected to a cooled photomultiplier tube. We found robust circadian rhythms in the clock gene expression, the phase-relation of which were the same as those observed ex vivo. The circadian rhythms were superimposed by episodic bursts which had ultradian periods of approximately 3.0 h. Episodic bursts often accompanied activity bouts, but stoichiometric as well as temporal analyses revealed no causality between them. Clock gene expression in the SCN in vivo is regulated by the circadian pacemaker and ultradian rhythms of unknown origin.

  5. Circadian Regulation Gene Polymorphisms are Associated with Sleep Disruption and Duration, and Circadian Phase and Rhythm in Adults with HIV

    PubMed Central

    Lee, Kathryn A.; Gay, Caryl; Byun, Eeeseung; Lerdal, Anners; Pullinger, Clive R.; Aouizerat, Bradley E.


    Genes involved in circadian regulation, such as circadian locomotor output cycles kaput [CLOCK], cryptochrome [CRY1], and period [PER], have been associated with sleep outcomes in prior animal and human research. However, it is unclear whether polymorphisms in these genes are associated with the sleep disturbances commonly experienced by adults living with human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS). Thus, the purpose of this study was to describe polymorphisms in selected circadian genes that are associated with sleep duration or disruption as well as the sleep-wake rhythm strength and phase timing among adults living with HIV/AIDS. A convenience sample of 289 adults with HIV/AIDS was recruited from HIV clinics and community sites in the San Francisco Bay Area. A wrist actigraph was worn for 72 hours on weekdays to estimate sleep duration or total sleep time (TST), sleep disruption or percentage of wake after sleep onset (WASO), and several circadian rhythm parameters: mesor, amplitude, the ratio of mesor to amplitude (circadian quotient), and 24-hour autocorrelation. Circadian phase measures included clock time for peak activity (acrophase) from actigraphy movement data, and bed time and final wake time from actigraphy and self-report. Genotyping was conducted for polymorphisms in 5 candidate genes involved in circadian regulation: CLOCK, CRY1, PER1, PER2, and PER3. Demographic and clinical variables were evaluated as potential covariates. Interactions between genotype and HIV variables (i.e., viral load, years since HIV diagnosis) were also evaluated. Controlling for potentially confounding variables (e.g., race, gender, CD4+ T-cell count, waist circumference, medication use, smoking, depressive symptoms), CLOCK was associated with WASO, 24-hour autocorrelation, and objectively-measured bed time; CRY1 was associated with circadian quotient; PER1 was associated with mesor and self-reported habitual wake time; PER2 was associated

  6. Circadian regulation gene polymorphisms are associated with sleep disruption and duration, and circadian phase and rhythm in adults with HIV.


    Lee, Kathryn A; Gay, Caryl; Byun, Eeeseung; Lerdal, Anners; Pullinger, Clive R; Aouizerat, Bradley E


    Genes involved in circadian regulation, such as circadian locomotor output cycles kaput [CLOCK], cryptochrome [CRY1] and period [PER], have been associated with sleep outcomes in prior animal and human research. However, it is unclear whether polymorphisms in these genes are associated with the sleep disturbances commonly experienced by adults living with human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS). Thus, the purpose of this study was to describe polymorphisms in selected circadian genes that are associated with sleep duration or disruption as well as the sleep-wake rhythm strength and phase timing among adults living with HIV/AIDS. A convenience sample of 289 adults with HIV/AIDS was recruited from HIV clinics and community sites in the San Francisco Bay Area. A wrist actigraph was worn for 72 h on weekdays to estimate sleep duration or total sleep time (TST), sleep disruption or percentage of wake after sleep onset (WASO) and several circadian rhythm parameters: mesor, amplitude, the ratio of mesor to amplitude (circadian quotient), and 24-h autocorrelation. Circadian phase measures included clock time for peak activity (acrophase) from actigraphy movement data, and bed time and final wake time from actigraphy and self-report. Genotyping was conducted for polymorphisms in five candidate genes involved in circadian regulation: CLOCK, CRY1, PER1, PER2 and PER3. Demographic and clinical variables were evaluated as potential covariates. Interactions between genotype and HIV variables (i.e. viral load, years since HIV diagnosis) were also evaluated. Controlling for potentially confounding variables (e.g. race, gender, CD4+ T-cell count, waist circumference, medication use, smoking and depressive symptoms), CLOCK was associated with WASO, 24-h autocorrelation and objectively-measured bed time; CRY1 was associated with circadian quotient; PER1 was associated with mesor and self-reported habitual wake time; PER2 was associated with TST

  7. Weight cycling promotes fat gain and altered clock gene expression in adipose tissue in C57BL/6J mice.


    Dankel, S N; Degerud, E M; Borkowski, K; Fjære, E; Midtbø, L K; Haugen, C; Solsvik, M H; Lavigne, A M; Liaset, B; Sagen, J V; Kristiansen, K; Mellgren, G; Madsen, L


    Repeated attempts to lose weight by temporary dieting may result in weight cycling, eventually further gain of body fat, and possible metabolic adaptation. We tested this with a controlled experiment in C57BL/6J mice subjected to four weight cycles (WC), continuous hypercaloric feeding (HF), or low-fat feeding (LF). To search for genes involved in an adaptive mechanism to former weight cycling and avoid acute effects of the last cycle, the last hypercaloric feeding period was prolonged by an additional 2 wk before euthanization. Total energy intake was identical in WC and HF. However, compared with HF, the WC mice gained significantly more total body mass and fat mass and showed increased levels of circulating leptin and lipids in liver. Both the HF and WC groups showed increased adipocyte size and insulin resistance. Despite these effects, we also observed an interesting maintenance of circulating adiponectin and free fatty acid levels after WC, whereas changes in these parameters were observed in HF mice. Global gene expression was analyzed by microarrays. Weight-cycled mice were characterized by a downregulation of several clock genes (Dbp, Tef, Per1, Per2, Per3, and Nr1d2) in adipose tissues, which was confirmed by quantitative PCR. In 3T3-L1 cells, we found reduced expression of Dbp and Tef early in adipogenic differentiation, which was mediated via cAMP-dependent signaling. Our data suggest that clock genes in adipose tissue may play a role in metabolic adaptation to weight cycling.

  8. Circadian rhythms of clock gene expression in the cerebellum of serotonin-deficient Pet-1 knockout mice.


    Paulus, Erin V; Mintz, Eric M


    Serotonin plays an important role in the central regulation of circadian clock function. Serotonin levels are generally higher in the brain during periods of high activity, and these periods are in turn heavily regulated by the circadian clock located in the suprachiasmatic nucleus. However, the role of serotonin as a regulator of circadian rhythms elsewhere in the brain has not been extensively examined. In this study, we examined circadian rhythms of clock gene expression in the cerebellum in mice lacking the Pet-1 transcription factor, which results in a developed brain that is deficient in serotonin neurons. If serotonin helps to synchronize rhythms in brain regions other than the suprachiasmatic nucleus, we would expect to see differences in clock gene expression in these serotonin deficient mice. We found minor differences in the expression of Per1 and Per2 in the knockout mice as compared to wild type, but these differences were small and of questionable functional importance. We also measured the response of cerebellar clocks to injections of the serotonin agonist 8-OH-DPAT during the early part of the night. No effect on clock genes was observed, though the immediate-early gene Fos showed increased expression in wild type mice but not the knockouts. These results suggest that serotonin is not an important mediator of circadian rhythms in the cerebellum in a way that parallels its regulation of the circadian clock in the suprachiasmatic nucleus.

  9. Shift Work or Food Intake during the Rest Phase Promotes Metabolic Disruption and Desynchrony of Liver Genes in Male Rats

    PubMed Central

    Salgado-Delgado, Roberto C.; Saderi, Nadia; Basualdo, María del Carmen; Guerrero-Vargas, Natali N.; Escobar, Carolina; Buijs, Ruud M.


    In the liver, clock genes are proposed to drive metabolic rhythms. These gene rhythms are driven by the suprachiasmatic nucleus (SCN) mainly by food intake and via autonomic and hormonal pathways. Forced activity during the normal rest phase, induces also food intake, thus neglecting the signals of the SCN, leading to conflicting time signals to target tissues of the SCN. The present study explored in a rodent model of night-work the influence of food during the normal sleep period on the synchrony of gene expression between clock genes and metabolic genes in the liver. Male Wistar rats were exposed to forced activity for 8 h either during the rest phase (day) or during the active phase (night) by using a slow rotating wheel. In this shift work model food intake shifts spontaneously to the forced activity period, therefore the influence of food alone without induced activity was tested in other groups of animals that were fed ad libitum, or fed during their rest or active phase. Rats forced to be active and/or eating during their rest phase, inverted their daily peak of Per1, Bmal1 and Clock and lost the rhythm of Per2 in the liver, moreover NAMPT and metabolic genes such as Pparα lost their rhythm and thus their synchrony with clock genes. We conclude that shift work or food intake in the rest phase leads to desynchronization within the liver, characterized by misaligned temporal patterns of clock genes and metabolic genes. This may be the cause of the development of the metabolic syndrome and obesity in individuals engaged in shift work. PMID:23565183

  10. Differential responses of circadian Per2 rhythms in cultured slices of discrete brain areas from rats showing internal desynchronisation by methamphetamine.


    Natsubori, Akiyo; Honma, Ken-Ichi; Honma, Sato


    Chronic methamphetamine (MAP) treatment desynchronises the behavior rhythms of rats from light-dark cycles. Our previous study (Masubuchi et al., 2000) demonstrated the phase reversal of circadian rhythms in clock gene expression in several brain areas of rats treated with MAP. However, for technical reasons, it was not clear whether the phase shifts were the consequence of phase-shifted behavior rhythms or reflected phase shifts of extra-suprachiasmatic nucleus (SCN) oscillators in these areas. In the present study, circadian gene expression rhythms in discrete brain areas were continuously monitored in slice cultures of MAP-treated rats. Methamphetamine was given to rats carrying a Period2-dLuciferase reporter system via the drinking water for more than 2 weeks. When behavior rhythms were completely phase reversed, the brain was sampled for slice cultures and circadian bioluminescence rhythms were measured for 5 days in the SCN and four areas of the dopaminergic system, the olfactory bulb, caudate putamen, parietal cortex and substantia nigra. The circadian rhythms in the SCN and caudate putamen were not significantly phase shifted, whereas those in the parietal cortex and substantia nigra showed significant phase-delay shifts of 6-8 h and that in the olfactory bulb showed phase-advance shifts of ca. 8 h. Neither the period nor the amplitude of the circadian rhythm was changed by MAP treatment. These findings indicate that the extra-SCN oscillators in several brain areas are desynchronised from the SCN circadian pacemaker by MAP treatment in parallel with the desynchronisation of behavior rhythms in rats. As the direction and extent of phase shifts of circadian rhythms were different among the areas examined, the brain extra-SCN oscillators responded differentially to MAP.

  11. Exposure to Fluorescent Light Triggers Down Regulation of Genes Involved with Mitotic Progression in Xiphophorus Skin

    PubMed Central

    Walter, Ronald B.; Walter, Dylan J.; Boswell, William T.; Caballero, Kaela L.; Boswell, Mikki; Lu, Yuan; Chang, Jordan; Savage, Markita G.


    We report RNA-Seq results from skin of X. maculatus Jp 163 B after exposure to various doses of “cool white” fluorescent light (FL). We show that FL exposure incites a genetic transcriptional response in skin nearly as great as observed for UVB exposure; however, the gene sets modulated due to exposure to the two light sources are quite different. Known light responsive genes involved in maintaining circadian cycling (e.g., clock, cry2a, cry1b, per1b, per2, per3, arntl1a, etc.) exhibited expected shifts in transcriptional expression upon FL exposure. Exposure to FL also resulted in down-regulated transcription of many genes involved with cell cycle progression (e.g., cdc20, cdc45, cdca7b, plk1, cdk1, ccnb-3, cdca7a, etc.) and chromosome segregation (e.g., cenpe, cenpf, cenpi, cenpk, cenpo, cenpp, and cenpu; cep70; knstrm, kntc, mcm2, mcm5; smc2, etc.). In addition, several DNA replication and recombination repair genes (e.g., pola1, pole, rec52, rad54l, rpa1, parpbp, etc.) exhibit reduced expression in FL exposed X. maculatus skin. Some genes down modulated by FL are known to be associated with DNA repair and human diseases (e.g., atm2, brip1, fanc1, fancl, xrcc4, etc.). The overall suppression of genes involved with mitotic progression in the skin of adult fish is consistent with entry into the light phase of the circadian cycle. Current efforts are aimed at determining specific wavelengths that may lead to differential expression among the many genes affected by fluorescent light exposure. PMID:26334372

  12. Altered dynamics in the circadian oscillation of clock genes in dermal fibroblasts of patients suffering from idiopathic hypersomnia.


    Lippert, Julian; Halfter, Hartmut; Heidbreder, Anna; Röhr, Dominik; Gess, Burkhard; Boentert, Mathias; Osada, Nani; Young, Peter


    From single cell organisms to the most complex life forms, the 24-hour circadian rhythm is important for numerous aspects of physiology and behavior such as daily periodic fluctuations in body temperature and sleep-wake cycles. Influenced by environmental cues - mainly by light input -, the central pacemaker in the thalamic suprachiasmatic nuclei (SCN) controls and regulates the internal clock mechanisms which are present in peripheral tissues. In order to correlate modifications in the molecular mechanisms of circadian rhythm with the pathophysiology of idiopathic hypersomnia, this study aimed to investigate the dynamics of the expression of circadian clock genes in dermal fibroblasts of idiopathic hypersomniacs (IH) in comparison to those of healthy controls (HC). Ten clinically and polysomnographically proven IH patients were recruited from the department of sleep medicine of the University Hospital of Muenster. Clinical diagnosis was done by two consecutive polysomnographies (PSG) and Multiple Sleep Latency Test (MSLT). Fourteen clinical healthy volunteers served as control group. Dermal fibroblasts were obtained via punch biopsy and grown in cell culture. The expression of circadian clock genes was investigated by semiquantitative Reverse Transcriptase-PCR qRT-PCR analysis, confirming periodical oscillation of expression of the core circadian clock genes BMAL1, PER1/2 and CRY1/2. The amplitude of the rhythmically expressed BMAL1, PER1 and PER2 was significantly dampened in dermal fibroblasts of IH compared to HC over two circadian periods whereas the overall expression of only the key transcriptional factor BMAL1 was significantly reduced in IH. Our study suggests for the first time an aberrant dynamics in the circadian clock in IH. These findings may serve to better understand some clinical features of the pathophysiology in sleep - wake rhythms in IH.

  13. Differential association of circadian genes with mood disorders: CRY1 and NPAS2 are associated with unipolar major depression and CLOCK and VIP with bipolar disorder.


    Soria, Virginia; Martínez-Amorós, Erika; Escaramís, Geòrgia; Valero, Joaquín; Pérez-Egea, Rosario; García, Cecilia; Gutiérrez-Zotes, Alfonso; Puigdemont, Dolors; Bayés, Mònica; Crespo, José M; Martorell, Lourdes; Vilella, Elisabet; Labad, Antonio; Vallejo, Julio; Pérez, Víctor; Menchón, José M; Estivill, Xavier; Gratacòs, Mònica; Urretavizcaya, Mikel


    Disruptions in circadian rhythms have been described in mood disorders (MD), but the involvement of genetic variation in genes pertaining to the molecular circadian machinery in the susceptibility to MD has not been conclusively determined. We examined 209 single-nucleotide polymorphisms (SNPs) covering 19 circadian genes (ADCYAP1, ARNTL, ARNTL2, BHLHB2, BHLHB3, CLOCK, CRY1, CRY2, CSNK1E, DBP, NPAS2, NR1D1, PER1, PER2, PER3, RORA, TIMELESS, VIP, and VIPR2) in a sample of 534 MD patients (335 with unipolar major mood depression (MDD) and 199 with bipolar disorder (BD)) and 440 community-based screened controls. Nominally, statistically significant associations were found in 15 circadian genes. The gene-wide test, corrected for the number of SNPs analyzed in each gene, identified significant associations in CRY1 (rs2287161), NPAS2 (rs11123857), and VIPR2 (rs885861) genes with the combined MD sample. In the MDD subsample, the same SNPs in CRY1 and NPAS2 of the combined sample remained associated, whereas in the BD subsample CLOCK (rs10462028) and VIP (rs17083008) were specifically associated. The association with an SNP located 3' near CRY1 gene in MDD remained statistically significant after permutation correction at experiment level (p=0.007). Significant additive effects were found between the SNPs that were statistically significant at the gene-wide level. We also found evidence of associations between two-marker haplotypes in CRY1 and NPAS2 genes and MD. Our data support the contribution of the circadian system to the genetic susceptibility to MD and suggest that different circadian genes may have specific effects on MD polarity.

  14. Transcriptome Profiling of the Lungs Reveals Molecular Clock Genes Expression Changes after Chronic Exposure to Ambient Air Particles

    PubMed Central

    Song, Pengcheng; Li, Zhigang; Li, Xiaoqian; Yang, Lixin; Zhang, Lulu; Li, Nannan; Guo, Chen; Lu, Shuyu; Wei, Yongjie


    The symptoms of asthma, breathlessness, insomnia, etc. all have relevance to pulmonary rhythmic disturbances. Epidemiology and toxicology studies have demonstrated that exposure to ambient air particles can result in pulmonary dysfunction. However, there are no data directly supporting a link between air pollution and circadian rhythm disorder. In the present study, we found that breathing highly polluted air resulted in changes of the molecular clock genes expression in lung by transcriptome profiling analyses in a rodent model. Compared to those exposed to filtered air, in both pregnant and offspring rats in the unfiltered group, key clock genes (Per1, Per2, Per3, Rev-erbα and Dbp) expression level decreased and Bmal1 expression level increased. In both rat dams and their offspring, after continuous exposure to unfiltered air, we observed significant histologic evidence for both perivascular and peribronchial inflammation, increased tissue and systemic oxidative stress in the lungs. Our results suggest that chronic exposure to particulate matter can induce alterations of clock genes expression, which could be another important pathway for explaining the feedbacks of ambient particle exposure in addition to oxidative stress and inflammation. PMID:28106813

  15. Glucocorticoids mediate circadian timing in peripheral osteoclasts resulting in the circadian expression rhythm of osteoclast-related genes.


    Fujihara, Yuko; Kondo, Hisataka; Noguchi, Toshihide; Togari, Akifumi


    Circadian rhythms are prevalent in bone metabolism. However, the molecular mechanisms involved are poorly understood. Recently, we suggested that output signals from the suprachiasmatic nucleus (SCN) are transmitted from the master circadian rhythm to peripheral osteoblasts through β-adrenergic and glucocorticoid signaling. In this study, we examined how the master circadian rhythm is transmitted to peripheral osteoclasts and the role of clock gene in osteoclast. Mice were maintained under 12-hour light/dark periods and sacrificed at Zeitgeber times 0, 4, 8, 12, 16 and 20. mRNA was extracted from femur (cancellous bone) and analyzed for the expression of osteoclast-related genes and clock genes. Osteoclast-related genes such as cathepsin K (CTSK) and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1) showed circadian rhythmicity like clock genes such as period 1 (PER1), PER2 and brain and muscle Arnt-like protein 1 (BMAL1). In an in vitro study, not β-agonist but glucocorticoid treatment remarkably synchronized clock and osteoclast-related genes in cultured osteoclasts. Chromatin immunoprecipitation (ChIP) assay showed the interaction between BMAL1 proteins and promoter region of CTSK and NFATc1. To examine whether endogenous glucocorticoids influence the osteoclast circadian rhythms, mice were adrenalectomized (ADX) and maintained under 12-hour light/dark periods at least two weeks before glucocorticoid injection. A glucocorticoid injection restarted the circadian expression of CTSK and NFATc1 in ADX mice. These results suggest that glucocorticoids mediate circadian timing to peripheral osteoclasts and osteoclast clock contributes to the circadian expression of osteoclast-related genes such as CTSK and NFATc1.

  16. The circadian protein period 1 contributes to blood pressure control and coordinately regulates renal sodium transport genes.


    Stow, Lisa R; Richards, Jacob; Cheng, Kit-Yan; Lynch, I Jeanette; Jeffers, Lauren A; Greenlee, Megan M; Cain, Brian D; Wingo, Charles S; Gumz, Michelle L


    The circadian clock protein period 1 (Per1) contributes to the regulation of expression of the α subunit of the renal epithelial sodium channel at the basal level and in response to the mineralocorticoid hormone aldosterone. The goals of the present study were to define the role of Per1 in the regulation of additional renal sodium handling genes in cortical collecting duct cells and to evaluate blood pressure (BP) in mice lacking functional Per1. To determine whether Per1 regulates additional genes important in renal sodium handling, a candidate gene approach was used. Immortalized collecting duct cells were transfected with a nontarget small interfering RNA or a Per1-specific small interfering RNA. Expression of the genes for α-epithelial sodium channel and Fxyd5, a positive regulator of Na, K-ATPase activity, decreased in response to Per1 knockdown. Conversely, mRNA expression of caveolin 1, Ube2e3, and ET-1, all negative effectors of epithelial sodium channel, was induced after Per1 knockdown. These results led us to evaluate BP in Per1 KO mice. Mice lacking Per1 exhibit significantly reduced BP and elevated renal ET-1 levels compared with wild-type animals. Given the established role of renal ET-1 in epithelial sodium channel inhibition and BP control, elevated renal ET-1 is one possible explanation for the lower BP observed in Per1 KO mice. These data support a role for the circadian clock protein Per1 in the coordinate regulation of genes involved in renal sodium reabsorption. Importantly, the lower BP observed in Per1 KO mice compared with wild-type mice suggests a role for Per1 in BP control as well.

  17. Period-2: a tumor suppressor gene in breast cancer

    PubMed Central

    Xiang, Shulin; Coffelt, Seth B; Mao, Lulu; Yuan, Lin; Cheng, Qi; Hill, Steven M


    Previous reports have suggested that the ablation of the Period 2 gene (Per 2) leads to enhanced development of lymphoma and leukemia in mice. Employing immunoblot analyses, we have demonstrated that PER 2 is endogenously expressed in human breast epithelial cell lines but is not expressed or is expressed at significantly reduced level in human breast cancer cell lines. Expression of PER 2 in MCF-7 breast cancer cells significantly inhibited the growth of MCF-7 human breast cancer cells, and, when PER 2 was co-expressed with the Crytochrome 2 (Cry 2) gene, an even greater growth-inhibitory effect was observed. The inhibitory effect of PER 2 on breast cancer cells was also demonstrated by its suppression of the anchorage-independent growth of MCF-7 cells as evidenced by the reduced number and size of colonies. A corresponding blockade of MCF-7 cells in the G1 phase of the cell cycle was also observed in response to the expression of PER 2 alone or in combination with CRY 2. Expression of PER 2 also induced apoptosis of MCF-7 breast cancer cells as demonstrated by an increase in PARP [poly (ADP-ribose) polymerase] cleavage. Finally, our studies demonstrate that PER 2 expression in MCF-7 breast cancer cells is associated with a significant decrease in the expression of cyclin D1 and an up-regulation of p53 levels. PMID:18334030

  18. Period-2: a tumor suppressor gene in breast cancer.


    Xiang, Shulin; Coffelt, Seth B; Mao, Lulu; Yuan, Lin; Cheng, Qi; Hill, Steven M


    Previous reports have suggested that the ablation of the Period 2 gene (Per 2) leads to enhanced development of lymphoma and leukemia in mice. Employing immunoblot analyses, we have demonstrated that PER 2 is endogenously expressed in human breast epithelial cell lines but is not expressed or is expressed at significantly reduced level in human breast cancer cell lines. Expression of PER 2 in MCF-7 breast cancer cells significantly inhibited the growth of MCF-7 human breast cancer cells, and, when PER 2 was co-expressed with the Crytochrome 2 (Cry 2) gene, an even greater growth-inhibitory effect was observed. The inhibitory effect of PER 2 on breast cancer cells was also demonstrated by its suppression of the anchorage-independent growth of MCF-7 cells as evidenced by the reduced number and size of colonies. A corresponding blockade of MCF-7 cells in the G1 phase of the cell cycle was also observed in response to the expression of PER 2 alone or in combination with CRY 2. Expression of PER 2 also induced apoptosis of MCF-7 breast cancer cells as demonstrated by an increase in PARP [poly (ADP-ribose) polymerase] cleavage. Finally, our studies demonstrate that PER 2 expression in MCF-7 breast cancer cells is associated with a significant decrease in the expression of cyclin D1 and an up-regulation of p53 levels.

  19. Diabetic retinopathy alters light-induced clock gene expression and dopamine levels in the mouse retina

    PubMed Central

    Lahouaoui, Hasna; Coutanson, Christine; Cooper, Howard M.; Bennis, Mohamed


    Purpose Diabetic retinopathy is one of the most common consequences of diabetes that affects millions of working-age adults worldwide and leads to progressive degeneration of the retina, visual loss, and blindness. Diabetes is associated with circadian disruption of the central and peripheral circadian clocks, but the mechanisms responsible for such alterations are unknown. Using a streptozotocin (STZ)-induced model of diabetes, we investigated whether diabetes alters 1) the circadian regulation of clock genes in the retina and in the central clocks, 2) the light response of clock genes in the retina, and/or 3) light-driven retinal dopamine (DA), a major output marker of the retinal clock. Methods To quantify circadian expression of clock and clock-controlled genes, retinas and suprachiasmatic nucleus (SCN) from the same animals were collected every 4 h in circadian conditions, 12 weeks post-diabetes. Induction of Per1, Per2, and c-fos mRNAs was quantified in the retina after the administration of a pulse of monochromatic light (480 nm, 1.17×1014 photons/cm2/s, 15 min) at circadian time 16. Gene expression was assessed with real-time reverse transcription PCR (RT–PCR). Pooled retinas from the control and STZ-diabetic mice were collected 2 h after light ON and light OFF (Zeitgeber time (ZT)2 and ZT14), and DA and its metabolite were analyzed with high-performance liquid chromatography (HPLC). Results We found variable effects of diabetes on the expression of clock genes in the retina and only slight differences in phase and/or amplitude in the SCN. c-fos and Per1 induction by a 480 nm light pulse was abolished in diabetic animals at 12 weeks post-induction of diabetes in comparison with the control mice, suggesting a deficit in light-induced neuronal activation of the retinal clock. Finally, we quantified a 56% reduction in the total number of tyrosine hydroxylase (TH) immunopositive cells, associated with a decrease in DA levels during the subjective day (ZT2

  20. Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor–Mediated Regulation of Period1 Gene

    PubMed Central

    Xu, Can-Xin; Krager, Stacey L.; Liao, Duan-Fang; Tischkau, Shelley A.


    The aryl hydrocarbon receptor (AhR) is a period-aryl hydrocarbon receptor nuclear transporter-simple minded domain transcription factor that shares structural similarity with circadian clock genes and readily interacts with components of the molecular clock. Activation of AhR by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters behavioral circadian rhythms and represses the Period1 (Per1) gene in murine hematopoietic stem and progenitor cells. Per1 expression is driven by circadian locomotor activity cycles kaput-brain muscle ARNT-like (CLOCK-BMAL1)–dependent activation of Eboxes in the Per1 promoter. We hypothesized that the effects of AhR activation on the circadian clock are mediated by disruption of CLOCK-BMAL1 function and subsequent Per1 gene suppression. Effects of AhR activation on rhythmic Per1 transcripts were examined in livers of mice after treatment with the AhR agonist, TCDD; the molecular mechanisms of Per1 repression by AhR were determined in hepatoma cells using TCDD and β-napthoflavone as AhR activators. This study reports, for the first time, that AhR activation by TCDD alters the Per1 rhythm in the mouse liver and that Per1 gene suppression depends upon the presence of AhR. Furthermore, AhR interaction with BMAL1 attenuates CLOCK-BMAL1 activity and decreases CLOCK binding at Ebox1 and Ebox3 in the Per1 promoter. Taken together, these data suggest that AhR activation represses Per1 through disrupting CLOCK-BMAL1 activity, producing dysregulation of rhythmic Per1 gene expression. These data define alteration of the Per1 rhythm as novel signaling events downstream of AhR activation. Downregulation of Per1 could contribute to metabolic disease, cancer, and other detrimental effects resulting from exposure to certain environmental pollutants. PMID:20106950

  1. The effect of white light on normal and malignant murine melanocytes: A link between opsins, clock genes, and melanogenesis.


    de Assis, L V M; Moraes, M N; da Silveira Cruz-Machado, S; Castrucci, A M L


    The skin possesses a photosensitive system comprised of opsins whose function is not fully understood, and clock genes which exert an important regulatory role in skin biology. Here, we evaluated the presence of opsins in normal (Melan-a cells) and malignant (B16-F10 cells) murine melanocytes. Both cell lines express Opn2, Opn4--for the first time reported in these cell types--as well as S-opsin. OPN4 protein was found in a small area capping the cell nuclei of B16-F10 cells kept in constant dark (DD); twenty-four hours after the white light pulse (WLP), OPN4 was found in the cell membrane. Despite the fact that B16-F10 cells expressed less Opn2 and Opn4 than Melan-a cells, our data indicate that the malignant melanocytes exhibited increased photoresponsiveness. The clock gene machinery is also severely downregulated in B16-F10 cells as compared to Melan-a cells. Per1, Per2, and Bmal1 expression increased in B16-F10 cells in response to WLP. Although no response in clock gene expression to WLP was observed in Melan-a cells, gene correlational data suggest a minor effect of WLP. In contrast to opsins and clock genes, melanogenesis is significantly upregulated in malignant melanocytes in comparison to Melan-a cells. Tyrosinase expression increased after WLP only in B16-F10 cells; however no increase in melanin content after WLP was seen in either cell line. Our findings may prove useful in the treatment and the development of new pharmacological approaches of depigmentation diseases and skin cancer.

  2. Chronic mild stress and imipramine treatment elicit opposite changes in behavior and in gene expression in the mouse prefrontal cortex.


    Erburu, M; Cajaleon, L; Guruceaga, E; Venzala, E; Muñoz-Cobo, I; Beltrán, E; Puerta, E; Tordera, R M


    Many studies suggest that the prefrontal cortex (PFC) is a target limbic region for stress response because a dysfunction here is linked to anhedonia, a decrease in reactivity to rewards, and to anxiety. It is suggested that stress-induced persistent molecular changes in this brain region could bring some light on the mechanisms perpetuating depressive episodes. In order to address this issue, here we have studied the long-term PFC gene expression pattern and behavioral effects induced by a chronic mild stress (CMS) model and antidepressant treatment in mice. CMS was applied to mice for six weeks and imipramine (10mg/kg, i.p.) or saline treatment was administered for five weeks starting from the third week of CMS. Mice were sacrificed one month after CMS and following two weeks after the discontinuation of drug treatment and the PFC was dissected and prepared for gene (mRNA) and protein expression studies. Using the same experimental design, a separate group of mice was tested for anhedonia, recognition memory, social interaction and anxiety. CMS induced a long-term altered gene expression profile in the PFC that was partially reverted by imipramine. Specifically, the circadian rhythm signaling pathway and functions such as gene expression, cell proliferation, survival and apoptosis as well as neurological and psychiatric disorders were affected. Of these, some changes of the circadian rhythm pathway (Hdac5, Per1, and Per2) were validated by RT-PCR and western-blot. Moreover, CMS induced long-lasting anhedonia that was reverted by imipramine treatment. Impaired memory, decreased social interaction and anxiety behavior were also induced by chronic stress. We have identified in the PFC molecular targets oppositely regulated by CMS and imipramine that could be relevant for chronic depression and antidepressant action. Among these, a possible candidate for further investigation could be the circadian rhythm pathway.

  3. Cell type-specific functions of period genes revealed by novel adipocyte and hepatocyte circadian clock models.


    Ramanathan, Chidambaram; Xu, Haiyan; Khan, Sanjoy K; Shen, Yang; Gitis, Paula J; Welsh, David K; Hogenesch, John B; Liu, Andrew C


    In animals, circadian rhythms in physiology and behavior result from coherent rhythmic interactions between clocks in the brain and those throughout the body. Despite the many tissue specific clocks, most understanding of the molecular core clock mechanism comes from studies of the suprachiasmatic nuclei (SCN) of the hypothalamus and a few other cell types. Here we report establishment and genetic characterization of three cell-autonomous mouse clock models: 3T3 fibroblasts, 3T3-L1 adipocytes, and MMH-D3 hepatocytes. Each model is genetically tractable and has an integrated luciferase reporter that allows for longitudinal luminescence recording of rhythmic clock gene expression using an inexpensive off-the-shelf microplate reader. To test these cellular models, we generated a library of short hairpin RNAs (shRNAs) against a panel of known clock genes and evaluated their impact on circadian rhythms. Knockdown of Bmal1, Clock, Cry1, and Cry2 each resulted in similar phenotypes in all three models, consistent with previous studies. However, we observed cell type-specific knockdown phenotypes for the Period and Rev-Erb families of clock genes. In particular, Per1 and Per2, which have strong behavioral effects in knockout mice, appear to play different roles in regulating period length and amplitude in these peripheral systems. Per3, which has relatively modest behavioral effects in knockout mice, substantially affects period length in the three cellular models and in dissociated SCN neurons. In summary, this study establishes new cell-autonomous clock models that are of particular relevance to metabolism and suitable for screening for clock modifiers, and reveals previously under-appreciated cell type-specific functions of clock genes.

  4. Disrupted light-dark cycle abolishes circadian expression of peripheral clock genes without inducing behavioral arrhythmicity in mice.


    Oishi, Katsutaka; Higo-Yamamoto, Sayaka; Yamamoto, Saori; Yasumoto, Yuki


    The environmental light-dark (LD) cycle entrains the central circadian clock located in the suprachiasmatic nucleus (SCN) of mammals. The present study examined the effects of disrupted LD cycles on peripheral clocks in mice housed under a normal 12 h light-12 h dark cycle (LD 12:12) or an ultradian LD 3:3 cycle. Drinking behavior seemed to be free-running with a long period (26.03 h) under ultradian LD 3:3 cycles, in addition to light-induced direct suppression (masking effect). Core body temperature completely lost robust circadian rhythm and acquired a 6-h rhythm with a low amplitude under LD 3:3. Robust circadian expression of Per1, Per2, Clock and Bmal1 mRNAs was similarly flattened to intermediate levels in the liver, heart and white adipose tissue under LD 3:3. Robust circadian expression of Rev-erbα mRNA was completely damped in these tissues. Circadian expression of Dbp, a clock-controlled gene, was also disrupted in these tissues from mice housed under LD 3:3. The aberrant LD cycle seemed to induce the loss of circadian gene expression at the level of transcription, because rhythmic pre-mRNA expression of these genes was also abolished under LD 3:3. In addition to the direct effect of the aberrant LD cycle, abolished systemic time cues such as those of plasma corticosterone and body temperature might be involved in the disrupted expression of these circadian genes under LD 3:3. Our findings suggest that disrupted environmental LD cycles abolish the normal oscillation of peripheral clocks and induce internal desynchrony in mammals.

  5. The hypersensitive glucocorticoid response specifically regulates period 1 and expression of circadian genes.


    Reddy, Timothy E; Gertz, Jason; Crawford, Gregory E; Garabedian, Michael J; Myers, Richard M


    Glucocorticoids regulate gene expression by binding and activating the glucocorticoid receptor (GR). While ligand affinity determines the global sensitivity of the response, additional proteins act on the genome to tune sensitivity of some genes. However, the genomic extent and specificity of dose-specific glucocorticoid responses are unknown. We show that dose-specific glucocorticoid responses are extraordinarily specific at the genomic scale, able to distinctly express a single gene, the circadian rhythm gene for Period 1 (PER1), at concentrations consistent with the nighttime nadir of human cortisol. We mapped the PER1 response to a single GR binding site. The specific GR binding sequence did not impact sensitivity, and we instead attributed the response to a combination of additional transcription factors and chromatin accessibility acting in the same locus. The PER1 hypersensitive response element is conserved in the mouse, where we found similar upregulation of Per1 in pituitary cells. Targeted and transient overexpression of PER1 led to regulation of additional circadian rhythm genes hours later, suggesting that hypersensitive expression of PER1 impacts circadian gene expression. These findings show that hypersensitive GR binding occurs throughout the genome, drives targeted gene expression, and may be important to endocrine mediation of peripheral circadian rhythms.

  6. The effect of chronic morphine or methadone exposure and withdrawal on clock gene expression in the rat suprachiasmatic nucleus and AA-NAT activity in the pineal gland.


    Pačesová, D; Novotný, J; Bendová, Z


    The circadian rhythms of many behavioral and physiological functions are regulated by the major circadian pacemaker in the suprachiasmatic nucleus. Long-term opiate addiction and drug withdrawal may affect circadian rhythmicity of various hormones or the sleep/activity pattern of many experimental subjects; however, limited research has been done on the long-term effects of sustained opiate administration on the intrinsic rhythmicity in the suprachiasmatic nucleus and pineal gland. Here we compared the effects of repeated daily treatment of rats with morphine or methadone and subsequent naloxone-precipitated withdrawal on the expression of the Per1, Per2, and Avp mRNAs in the suprachiasmatic nucleus and on arylalkylamine N-acetyltransferase activity in the pineal gland. We revealed that 10-day administration and withdrawal of both these drugs failed to affect clock genes and Avp expression in the SCN. Our results indicate that opioid-induced changes in behavioral and physiological rhythms originate in brain structures downstream of the suprachiasmatic nucleus regulatory output pathway. Furthermore, we observed that acute withdrawal from methadone markedly extended the period of high night AA-NAT activity in the pineal gland. This suggests that withdrawal from methadone, a widely used drug for the treatment of opioid dependence, may have stronger impact on melatonin synthesis than withdrawal from morphine.

  7. Melanopsin resets circadian rhythms in cells by inducing clock gene Period1

    NASA Astrophysics Data System (ADS)

    Yamashita, Shuhei; Uehara, Tomoe; Matsuo, Minako; Kikuchi, Yo; Numano, Rika


    The biochemical, physiological and behavioral processes are under the control of internal clocks with the period of approximately 24 hr, circadian rhythms. The expression of clock gene Period1 (Per1) oscillates autonomously in cells and is induced immediately after a light pulse. Per1 is an indispensable member of the central clock system to maintain the autonomous oscillator and synchronize environmental light cycle. Per1 expression could be detected by Per1∷luc and Per1∷GFP plasmid DNA in which firefly luciferase and Green Fluorescence Protein were rhythmically expressed under the control of the mouse Per1 promoter in order to monitor mammalian circadian rhythms. Membrane protein, MELANOPSIN is activated by blue light in the morning on the retina and lead to signals transduction to induce Per1 expression and to reset the phase of circadian rhythms. In this report Per1 induction was measured by reporter signal assay in Per1∷luc and Per1∷GFP fibroblast cell at the input process of circadian rhythms. To the result all process to reset the rhythms by Melanopsin is completed in single cell like in the retina projected to the central clock in the brain. Moreover, the phase of circadian rhythm in Per1∷luc cells is synchronized by photo-activated Melanopsin, because the definite peak of luciferase activity in one dish was found one day after light illumination. That is an available means that physiological circadian rhythms could be real-time monitor as calculable reporter (bioluminescent and fluorescent) chronological signal in both single and groups of cells.

  8. Genes and Gene Therapy


    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  9. Effects of circadian clock genes and health-related behavior on metabolic syndrome in a Taiwanese population: Evidence from association and interaction analysis

    PubMed Central

    Lin, Eugene; Kuo, Po-Hsiu; Liu, Yu-Li; Yang, Albert C.; Kao, Chung-Feng; Tsai, Shih-Jen


    Increased risk of developing metabolic syndrome (MetS) has been associated with the circadian clock genes. In this study, we assessed whether 29 circadian clock-related genes (including ADCYAP1, ARNTL, ARNTL2, BHLHE40, CLOCK, CRY1, CRY2, CSNK1D, CSNK1E, GSK3B, HCRTR2, KLF10, NFIL3, NPAS2, NR1D1, NR1D2, PER1, PER2, PER3, REV1, RORA, RORB, RORC, SENP3, SERPINE1, TIMELESS, TIPIN, VIP, and VIPR2) are associated with MetS and its individual components independently and/or through complex interactions in a Taiwanese population. We also analyzed the interactions between environmental factors and these genes in influencing MetS and its individual components. A total of 3,000 Taiwanese subjects from the Taiwan Biobank were assessed in this study. Metabolic traits such as waist circumference, triglyceride, high-density lipoprotein cholesterol, systolic and diastolic blood pressure, and fasting glucose were measured. Our data showed a nominal association of MetS with several single nucleotide polymorphisms (SNPs) in five key circadian clock genes including ARNTL, GSK3B, PER3, RORA, and RORB; but none of these SNPs persisted significantly after performing Bonferroni correction. Moreover, we identified the effect of GSK3B rs2199503 on high fasting glucose (P = 0.0002). Additionally, we found interactions among the ARNTL rs10832020, GSK3B rs2199503, PER3 rs10746473, RORA rs8034880, and RORB rs972902 SNPs influenced MetS (P < 0.001 ~ P = 0.002). Finally, we investigated the influence of interactions between ARNTL rs10832020, GSK3B rs2199503, PER3 rs10746473, and RORB rs972902 with environmental factors such as alcohol consumption, smoking status, and physical activity on MetS and its individual components (P < 0.001 ~ P = 0.002). Our study indicates that circadian clock genes such as ARNTL, GSK3B, PER3, RORA, and RORB genes may contribute to the risk of MetS independently as well as through gene-gene and gene-environment interactions. PMID:28296937

  10. Abnormal clock gene expression and locomotor activity rhythms in two month-old female APPSwe/PS1dE9 mice.


    Oyegbami, Olaide; Collins, Hilary M; Pardon, Marie C; Ebling, Fran Jp; Heery, David M; Moran, Paula M


    In addition to cognitive decline, Alzheimer's disease (AD) is also characterized by agitation and disruptions in activity and sleep. These symptoms typically occur in the evening or at night and have been referred to as 'sundowning'. These symptoms are especially difficult for carers and there are no specific drug treatments. There is increasing evidence that these symptoms reflect an underlying pathology of circadian rhythm generation and transmission. We investigated whether a transgenic mouse model relevant to AD (APPswe/PS1dE9) exhibits circadian alterations in locomotor activity and expression of clock genes involved in the regulation of the circadian cycle. Female mice at 2 months of age were investigated in their home cage. Results show that the APPswe/PS1dE9 transgene alters levels and patterns in circadian rhythm of locomotor activity. Expression of the clock genes Per1, Per2, Cry1 and Cry2 was found to increase at night compared to day in wild-type control mice in the medulla/pons. This effect was blunted for Cry1 and Cry2 gene expression in APPswe/PS1dE9. In summary, this study suggests altered circadian regulation of locomotor activity is abnormal in female APPswe/PS1dE9 mice and that this alteration has biomolecular analogies in a widely available model of AD. Furthermore, the early age at which these effects are manifest suggests that these circadian effects may precede plaque development. The APPswe/PS1dE9 mouse genetic model may have potential to serve as a tool in understanding the neuropathology of circadian abnormalities in AD and as a model system to test novel therapeutic agents for these symptoms.

  11. Expression of the circadian clock gene Period2 in the hippocampus: possible implications for synaptic plasticity and learned behaviour

    PubMed Central

    Wang, Louisa M-C; Dragich, Joanna M; Kudo, Takashi; Odom, Irene H; Welsh, David K; O'Dell, Thomas J; Colwell, Christopher S


    Genes responsible for generating circadian oscillations are expressed in a variety of brain regions not typically associated with circadian timing. The functions of this clock gene expression are largely unknown, and in the present study we sought to explore the role of the Per2 (Period 2) gene in hippocampal physiology and learned behaviour. We found that PER2 protein is highly expressed in hippocampal pyramidal cell layers and that the expression of both protein and mRNA varies with a circadian rhythm. The peaks of these rhythms occur in the late night or early morning and are almost 180° out-of-phase with the expression rhythms measured from the suprachiasmatic nucleus of the same animals. The rhythms in Per2 expression are autonomous as they are present in isolated hippocampal slices maintained in culture. Physiologically, Per2-mutant mice exhibit abnormal long-term potentiation. The underlying mechanism is suggested by the finding that levels of phosphorylated cAMP-response-element-binding protein, but not phosphorylated extracellular-signal-regulated kinase, are reduced in hippocampal tissue from mutant mice. Finally, Per2-mutant mice exhibit deficits in the recall of trace, but not cued, fear conditioning. Taken together, these results provide evidence that hippocampal cells contain an autonomous circadian clock. Furthermore, the clock gene Per2 may play a role in the regulation of long-term potentiation and in the recall of some forms of learned behaviour. PMID:19570032

  12. Restricted Feeding Schedules Modulate in a Different Manner the Expression of Clock Genes in Rat Hypothalamic Nuclei

    PubMed Central

    De Araujo, Leonardo D.; Roa, Silvia L.; Bueno, Ana C.; Coeli-Lacchini, Fernanda B.; Martins, Clarissa S.; Uchoa, Ernane T.; Antunes-Rodrigues, Jose; Elias, Lucila L.; Elias, Paula C.; Moreira, Ayrton C.; De Castro, Margaret


    Food access restriction is associated to changes in gene expression of the circadian clock system. However, there are only a few studies investigating the effects of non-photic synchronizers, such as food entrainment, on the expression of clock genes in the central oscillators. We hypothesized that different feeding restriction patterns could modulate the expression of clock genes in the suprachiasmatic nucleus (SCN) “master” clock and in extra-SCN oscillators such as the paraventricular (PVN) and arcuate (ARC) hypothalamic nuclei. Wistar rats were divided into four groups: Control group (CG; food available ad libitum), Restricted night-fed (RF-n; food access during 2 h at night), Restricted day-fed (RF-d; food access during 2 h at daytime), Day-fed (DF; food access during 12 h at daytime). After 21 days, rats were decapitated between ZT2-ZT3 (0800–0900 h); ZT11-ZT12 (1700–1800 h), or ZT17-18 (2300–2400 h). Plasma corticosterone was measured by radioimmunoassay (RIA). The expression of Clock, Bmal1, Per1, Per2, Per3, Cry1, Cry2, Rev-erbα, and Rorα were assessed in SCN, PVN, and ARC hypothalamic nuclei by RT-PCR and calculated by the 2[−DeltaDeltaCT(Cyclethreshold)](2−ΔΔCT) method. Restricted food availability during few h led to decreased body weight in RF-n and RF-d groups compared to controls and DF group. We also observed an anticipatory corticosterone peak before food availability in RF-n and RF-d groups. Furthermore, the pattern of clock gene expression in response to RF-n, RF-d, and DF schedules was affected differently in the SCN, PVN, and ARC hypothalamic nuclei. In conclusion, the master oscillator in SCN as well as the oscillator in PVN and ARC, all brain areas involved in food intake, responds in a tissue-specific manner to feeding restriction. PMID:28003802

  13. Studying Genes


    ... Area What are genes? Genes are sections of DNA that contain instructions for making the molecules—many ... material in an organism. This includes genes and DNA elements that control the activity of genes. Does ...

  14. l-Ornithine affects peripheral clock gene expression in mice

    PubMed Central

    Fukuda, Takafumi; Haraguchi, Atsushi; Kuwahara, Mari; Nakamura, Kaai; Hamaguchi, Yutaro; Ikeda, Yuko; Ishida, Yuko; Wang, Guanying; Shirakawa, Chise; Tanihata, Yoko; Ohara, Kazuaki; Shibata, Shigenobu


    The peripheral circadian clock is entrained by factors in the external environment such as scheduled feeding, exercise, and mental and physical stresses. In addition, recent studies in mice demonstrated that some food components have the potential to control the peripheral circadian clock during scheduled feeding, although information about these components remains limited. l-Ornithine is a type of non-protein amino acid that is present in foods and has been reported to have various physiological functions. In human trials, for example, l-ornithine intake improved a subjective index of sleep quality. Here we demonstrate, using an in vivo monitoring system, that repeated oral administration of l-ornithine at an early inactive period in mice induced a phase advance in the rhythm of PER2 expression. By contrast, l-ornithine administration to mouse embryonic fibroblasts did not affect the expression of PER2, indicating that l-ornithine indirectly alters the phase of PER2. l-Ornithine also increased plasma levels of insulin, glucose and glucagon-like peptide-1 alongside mPer2 expression, suggesting that it exerts its effects probably via insulin secretion. Collectively, these findings demonstrate that l-ornithine affects peripheral clock gene expression and may expand the possibilities of L-ornithine as a health food. PMID:27703199

  15. l-Ornithine affects peripheral clock gene expression in mice.


    Fukuda, Takafumi; Haraguchi, Atsushi; Kuwahara, Mari; Nakamura, Kaai; Hamaguchi, Yutaro; Ikeda, Yuko; Ishida, Yuko; Wang, Guanying; Shirakawa, Chise; Tanihata, Yoko; Ohara, Kazuaki; Shibata, Shigenobu


    The peripheral circadian clock is entrained by factors in the external environment such as scheduled feeding, exercise, and mental and physical stresses. In addition, recent studies in mice demonstrated that some food components have the potential to control the peripheral circadian clock during scheduled feeding, although information about these components remains limited. l-Ornithine is a type of non-protein amino acid that is present in foods and has been reported to have various physiological functions. In human trials, for example, l-ornithine intake improved a subjective index of sleep quality. Here we demonstrate, using an in vivo monitoring system, that repeated oral administration of l-ornithine at an early inactive period in mice induced a phase advance in the rhythm of PER2 expression. By contrast, l-ornithine administration to mouse embryonic fibroblasts did not affect the expression of PER2, indicating that l-ornithine indirectly alters the phase of PER2. l-Ornithine also increased plasma levels of insulin, glucose and glucagon-like peptide-1 alongside mPer2 expression, suggesting that it exerts its effects probably via insulin secretion. Collectively, these findings demonstrate that l-ornithine affects peripheral clock gene expression and may expand the possibilities of L-ornithine as a health food.

  16. Gene Therapy


    ... cells in an effort to treat or stop disease. Genes contain your DNA — the code that controls much of your body's form and function, from making you grow taller to regulating your body systems. Genes that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds ...

  17. Sleep interruption associated with house staff work schedules alters circadian gene expression

    PubMed Central

    Fang, Ming Zhu; Ohman-Strickland, Pamela; Kelly-McNeil, Kathie; Kipen, Howard; Crabtree, Benjamin; Lew, Jenny Pan; Zarbl, Helmut


    Background Epidemiological studies indicate that disruption of circadian rhythm by shift work increases the risk of breast and prostate cancer. Our studies demonstrated that carcinogens disrupt the circadian expression of circadian genes (CGs) and circadian-controlled genes (CCGs) during the early stages of rat mammary carcinogenesis. A chemopreventive regimen of methylselenocysteine (MSC) restored the circadian expression of CGs and CCGs, including PERIOD 2 (PER2) and estrogen receptor β (ERS2), to normal. The present study evaluated whether changes in CG and CCG expression in whole blood can serve as indicators of circadian disruption in shift workers. Methods Fifteen shift workers were recruited to a crossover study. Blood samples were drawn before (6 PM) and after (8 AM) completing a night shift after at least 7 days on floating night-shift rotation, and before (8 AM), during (1 PM), and after (6 PM) completing 7 days on day shift. The plasma melatonin level and messenger RNA (mRNA) expression of PER2, nuclear receptor subfamily 1, group d, member 1 (NR1D1), and ERS2 were measured, and the changes in levels of melatonin and gene expression were evaluated with statistical analyses. Results The mRNA expression of PER2 was affected by shift (p = 0.0079); the levels were higher in the evening for the night shift, but higher in the morning for the day shift. Increased PER2 expression (p = 0.034) was observed in the evening on the night versus day shifts. The melatonin level was higher in the morning for both day shifts (p = 0.013) and night shifts (p < 0.0001). Conclusion Changes in the level of PER2 gene expression can serve as a biomarker of disrupted circadian rhythm in blood cells. Therefore, they can be a useful intermediate indicator of efficacy in future MSC-mediated chemoprevention studies. PMID:26498241

  18. Regulation of period 1 expression in cultured rat pineal

    NASA Technical Reports Server (NTRS)

    Fukuhara, Chiaki; Dirden, James C.; Tosini, Gianluca


    The aim of the present study was to investigate the in vitro expression of Period 1 (Per1), Period 2 (Per2) and arylalkylamine N-acetyltransferase (AA-NAT) genes in the rat pineal gland to understand the mechanism(s) regulating the expression of these genes in this organ. Pineals, when maintained in vitro for 5 days, did not show circadian rhythmicity in the expression of any of the three genes monitored. Norepinephrine (NE) induced AA-NAT and Per1, whereas its effect on Per2 was negligible. Contrary to what was observed in other systems, NE stimulation did not induce circadian expression of Per1. The effect of NE on Per1 level was dose- and receptor subtype-dependent, and both cAMP and cGMP induced Per1. Per1 was not induced by repeated NE - or forskolin - stimulation. Protein synthesis was not necessary for NE-induced Per1, but it was for reduction of Per1 following NE stimulation. Per1 transcription in pinealocytes was activated by BMAL1/CLOCK. Our results indicate that important differences are present in the regulation of these genes in the mammalian pineal. Copyright 2002 S. Karger AG, Basel.

  19. Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing.


    Yang, Qiaozhen; Guo, Bin; Sun, Hongying; Zhang, Jie; Liu, Shangfeng; Hexige, Saiyin; Yu, Xuedi; Wang, Xiaxia


    Oral lichen planus (OLP) is a chronic inflammatory disease that may transform to oral squamous cell carcinoma (OSCC), while its carcinogenesis mechanisms are not entirely clear. This study was designed to identify the important genes involved in the malignant transformation of OLP to OSCC. After RNA-sequencing, the differently expressed genes (DEGs) in OLP vs. normal and OSCC vs. normal groups, respectively, were identified by limma package in R language, and then clustering analysis were conducted by Pheatmap package in R language. Weighed gene co-expression network analysis (WGCNA) was performed for the DEGs to screen disease-associated modules. Using Cytoscape software, co-expression networks were constructed for the genes involved in the modules. Enrichment analysis was conducted for the genes involved in the co-expression networks using GOstat package in R language. Finally, quantitative real-time PCR (qRT-PCR) experiments were conducted to validate the key genes. There were, respectively, 223 and 548 DEGs in OLP vs. normal and OSCC vs. normal groups. WGCNA identified the blue modules for the DEGs in the two groups as disease-associated modules. Moreover, 19 common DEGs (including upregulated BCL9L, PER2 and TSPAN33, and downregulated GMPS and HES1) associated with both OLP and OSCC were identified. In the co-expression networks, BCL9L, HES1, PER2 and TSPAN33 might function in OLP via interactions (such as BCL9L-TSPAN33 and HES1-PER2). qRT-PCR analysis showed that BCL9L, PER2 and TSPAN33 were significantly upregulated, and GMP and HES1 were downregulated. These findings indicated that BCL9L, GMPS, HES1, PER2 and TSPAN33 affected the transformation of OLP to OSCC.

  20. Crosstalk of clock gene expression and autophagy in aging

    PubMed Central

    Kalfalah, Faiza; Janke, Linda; Schiavi, Alfonso; Tigges, Julia; Ix, Alexander; Ventura, Natascia; Boege, Fritz; Reinke, Hans


    Autophagy and the circadian clock counteract tissue degeneration and support longevity in many organisms. Accumulating evidence indicates that aging compromises both the circadian clock and autophagy but the mechanisms involved are unknown. Here we show that the expression levels of transcriptional repressor components of the circadian oscillator, most prominently the human Period homologue PER2, are strongly reduced in primary dermal fibroblasts from aged humans, while raising the expression of PER2 in the same cells partially restores diminished autophagy levels. The link between clock gene expression and autophagy is corroborated by the finding that the circadian clock drives cell-autonomous, rhythmic autophagy levels in immortalized murine fibroblasts, and that siRNA-mediated downregulation of PER2 decreases autophagy levels while leaving core clock oscillations intact. Moreover, the Period homologue lin-42 regulates autophagy and life span in the nematode Caenorhabditis elegans, suggesting an evolutionarily conserved role for Period proteins in autophagy control and aging. Taken together, this study identifies circadian clock proteins as set-point regulators of autophagy and puts forward a model, in which age-related changes of clock gene expression promote declining autophagy levels. PMID:27574892

  1. Glucocorticoid-mediated Period2 induction delays the phase of circadian rhythm.


    Cheon, Solmi; Park, Noheon; Cho, Sehyung; Kim, Kyungjin


    Glucocorticoid (GC) signaling synchronizes the circadian rhythm of individual peripheral cells and induces the expression of circadian genes, including Period1 (Per1) and Period2 (Per2). However, no GC response element (GRE) has been reported in the Per2 promoter region. Here we report the molecular mechanisms of Per2 induction by GC signaling and its relevance to the regulation of circadian timing. We found that GC prominently induced Per2 expression and delayed the circadian phase. The overlapping GRE and E-box (GE2) region in the proximal Per2 promoter was responsible for GC-mediated Per2 induction. The GRE in the Per2 promoter was unique in that brain and muscle ARNT-like protein-1 (BMAL1) was essential for GC-induced Per2 expression, whereas other GRE-containing promoters, such as Per1 and mouse mammary tumor virus, responded to dexamethasone in the absence of BMAL1. This specialized regulatory mechanism was mediated by BMAL1-dependent binding of the GC receptor to GRE in Per2 promoter. When Per2 induction was abrogated by the mutation of the GRE or E-box, the circadian oscillation phase failed to be delayed compared with that of the wild-type. Therefore, the current study demonstrates that the rapid Per2 induction mediated by GC is crucial for delaying the circadian rhythm.

  2. Glucocorticoid-mediated Period2 induction delays the phase of circadian rhythm

    PubMed Central

    Cheon, Solmi; Park, Noheon; Cho, Sehyung; Kim, Kyungjin


    Glucocorticoid (GC) signaling synchronizes the circadian rhythm of individual peripheral cells and induces the expression of circadian genes, including Period1 (Per1) and Period2 (Per2). However, no GC response element (GRE) has been reported in the Per2 promoter region. Here we report the molecular mechanisms of Per2 induction by GC signaling and its relevance to the regulation of circadian timing. We found that GC prominently induced Per2 expression and delayed the circadian phase. The overlapping GRE and E-box (GE2) region in the proximal Per2 promoter was responsible for GC-mediated Per2 induction. The GRE in the Per2 promoter was unique in that brain and muscle ARNT-like protein-1 (BMAL1) was essential for GC-induced Per2 expression, whereas other GRE-containing promoters, such as Per1 and mouse mammary tumor virus, responded to dexamethasone in the absence of BMAL1. This specialized regulatory mechanism was mediated by BMAL1-dependent binding of the GC receptor to GRE in Per2 promoter. When Per2 induction was abrogated by the mutation of the GRE or E-box, the circadian oscillation phase failed to be delayed compared with that of the wild-type. Therefore, the current study demonstrates that the rapid Per2 induction mediated by GC is crucial for delaying the circadian rhythm. PMID:23620290

  3. Gene Positioning

    PubMed Central

    Ferrai, Carmelo; de Castro, Inês Jesus; Lavitas, Liron; Chotalia, Mita; Pombo, Ana


    Eukaryotic gene expression is an intricate multistep process, regulated within the cell nucleus through the activation or repression of RNA synthesis, processing, cytoplasmic export, and translation into protein. The major regulators of gene expression are chromatin remodeling and transcription machineries that are locally recruited to genes. However, enzymatic activities that act on genes are not ubiquitously distributed throughout the nucleoplasm, but limited to specific and spatially defined foci that promote preferred higher-order chromatin arrangements. The positioning of genes within the nuclear landscape relative to specific functional landmarks plays an important role in gene regulation and disease. PMID:20484389

  4. Gene doping.


    Azzazy, Hassan M E


    Gene doping abuses the legitimate approach of gene therapy. While gene therapy aims to correct genetic disorders by introducing a foreign gene to replace an existing faulty one or by manipulating existing gene(s) to achieve a therapeutic benefit, gene doping employs the same concepts to bestow performance advantages on athletes over their competitors. Recent developments in genetic engineering have contributed significantly to the progress of gene therapy research and currently numerous clinical trials are underway. Some athletes and their staff are probably watching this progress closely. Any gene that plays a role in muscle development, oxygen delivery to tissues, neuromuscular coordination, or even pain control is considered a candidate for gene dopers. Unfortunately, detecting gene doping is technically very difficult because the transgenic proteins expressed by the introduced genes are similar to their endogenous counterparts. Researchers today are racing the clock because assuring the continued integrity of sports competition depends on their ability to develop effective detection strategies in preparation for the 2012 Olympics, which may mark the appearance of genetically modified athletes.

  5. Gene therapy.


    Williamson, B


    Gene therapy is not yet possible, but may become feasible soon, particularly for well understood gene defects. Although treatment of a patient raises no ethical problems once it can be done well, changing the genes of an early embryo is more difficult, controversial and unlikely to be required clinically.

  6. Exercise influences circadian gene expression in equine skeletal muscle.


    Murphy, B A; Wagner, A L; McGlynn, O F; Kharazyan, F; Browne, J A; Elliott, J A


    Circadian rhythms are endogenously generated 24-h oscillations that coordinate numerous aspects of mammalian physiology, metabolism and behaviour. The existence of a molecular circadian clock in equine skeletal muscle has previously been demonstrated. This study investigates how the circadian 24-h expression of exercise-relevant genes in skeletal muscle is influenced by a regular exercise regime. Mid-gluteal, percutaneous muscle biopsies were obtained over a 24-h period from six Thoroughbred mares before and after an 8-week exercise programme. Real-time qPCR assays were used to assess the expression patterns of core clock genes ARNTL, PER2, NR1D1, clock-controlled gene DBP, and muscle genes MYF6, UCP3, VEGFA, FOXO1, MYOD1, PPARGC1A, PPARGC1B, FBXO32 and PDK4. Two-way repeated measures ANOVA revealed a significant interaction between circadian time and exercise for muscle genes MYF6, UCP3, MYOD1 and PDK4. A significant effect of time was observed for all genes with the exception of VEGFA, where a main effect of exercise was observed. By cosinor analysis, the core clock genes, ARNTL (P <0.01) and NR1D1 (P <0.05), showed 24-h rhythmicity both pre- and post-exercise, while PER2 expression was rhythmic post-exercise (P <0.05) but not pre-exercise. The expression profiles of muscle genes MYOD1 and MYF6 showed significant fits to a 24-h cosine waveform indicative of circadian rhythmicity post-exercise only (P <0.01). This study suggests that the metabolic capacity of muscle is influenced by scheduled exercise and that optimal athletic performance may be achieved when exercise times and competition times coincide.

  7. Effect of Mefloquine, a Gap Junction Blocker, on Circadian Period2 Gene Oscillation in the Mouse Suprachiasmatic Nucleus Ex Vivo

    PubMed Central

    Koo, Jinmi; Choe, Han Kyoung; Kim, Hee-Dae; Chun, Sung Kook; Son, Gi Hoon


    Background In mammals, the master circadian pacemaker is localized in an area of the ventral hypothalamus known as the suprachiasmatic nucleus (SCN). Previous studies have shown that pacemaker neurons in the SCN are highly coupled to one another, and this coupling is crucial for intrinsic self-sustainability of the SCN central clock, which is distinguished from peripheral oscillators. One plausible mechanism underlying the intercellular communication may involve direct electrical connections mediated by gap junctions. Methods We examined the effect of mefloquine, a neuronal gap junction blocker, on circadian Period 2 (Per2) gene oscillation in SCN slice cultures prepared from Per2::luciferase (PER2::LUC) knock-in mice using a real-time bioluminescence measurement system. Results Administration of mefloquine causes instability in the pulse period and a slight reduction of amplitude in cyclic PER2::LUC expression. Blockade of gap junctions uncouples PER2::LUC-expressing cells, in terms of phase transition, which weakens synchrony among individual cellular rhythms. Conclusion These findings suggest that neuronal gap junctions play an important role in synchronizing the central pacemaker neurons and contribute to the distinct self-sustainability of the SCN master clock. PMID:25491783

  8. Gene dispensability.


    Korona, Ryszard


    Genome-wide mutagenesis studies indicate that up to about 90% of genes in bacteria and 80% in eukaryotes can be inactivated individually leaving an organism viable, often seemingly unaffected. Several strategies are used to learn what these apparently dispensable genes contribute to fitness. Assays of growth under hundreds of physical and chemical stresses are among the most effective experimental approaches. Comparative studies of genomic DNA sequences continue to be valuable in discriminating between the core bacterial genome and the more variable niche-specific genes. The concept of the core genome appears currently unfeasible for eukaryotes but progress has been made in understanding why they contain numerous gene duplicates.

  9. Daily Rhythmicity of Clock Gene Transcripts in Atlantic Cod Fast Skeletal Muscle

    PubMed Central

    Lazado, Carlo C.; Kumaratunga, Hiruni P. S.; Nagasawa, Kazue; Babiak, Igor; Giannetto, Alessia; Fernandes, Jorge M. O.


    The classical notion of a centralized clock that governs circadian rhythmicity has been challenged with the discovery of peripheral oscillators that enable organisms to cope with daily changes in their environment. The present study aimed to identify the molecular clock components in Atlantic cod (Gadus morhua) and to investigate their daily gene expression in fast skeletal muscle. Atlantic cod clock genes were closely related to their orthologs in teleosts and tetrapods. Synteny was conserved to varying degrees in the majority of the 18 clock genes examined. In particular, aryl hydrocarbon receptor nuclear translocator-like 2 (arntl2), RAR-related orphan receptor A (rora) and timeless (tim) displayed high degrees of conservation. Expression profiling during the early ontogenesis revealed that some transcripts were maternally transferred, namely arntl2, cryptochrome 1b and 2 (cry1b and cry2), and period 2a and 2b (per2a and per2b). Most clock genes were ubiquitously expressed in various tissues, suggesting the possible existence of multiple peripheral clock systems in Atlantic cod. In particular, they were all detected in fast skeletal muscle, with the exception of neuronal PAS (Per-Arnt-Single-minded) domain-containing protein (npas1) and rora. Rhythmicity analysis revealed 8 clock genes with daily rhythmic expression, namely arntl2, circadian locomotor output cycles kaput (clock), npas2, cry2, cry3 per2a, nuclear receptor subfamily 1, group D, member 1 (nr1d1), and nr1d2a. Transcript levels of the myogenic genes myogenic factor 5 (myf5) and muscleblind-like 1 (mbnl1) strongly correlated with clock gene expression. This is the first study to unravel the molecular components of peripheral clocks in Atlantic cod. Taken together, our data suggest that the putative clock system in fast skeletal muscle of Atlantic cod has regulatory implications on muscle physiology, particularly in the expression of genes related to myogenesis. PMID:24921252

  10. Trichoderma genes


    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA


    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  11. Gene therapy.


    Drugan, A; Miller, O J; Evans, M I


    Severe genetic disorders are potentially correctable by the addition of a normal gene into tissues. Although the technical problems involving integration, stable expression, and insertional damage to the treated cell are not yet fully solved, enough scientific progress has already been made to consider somatic cell gene therapy acceptable from both the ethical and scientific viewpoints. The resolutions to problems evolving from somatic cell gene therapy will help to overcome the technical difficulties encountered presently with germ line gene manipulation. This procedure would then become morally permissible as it will cause, in time, a reduction in the pool of abnormal genes in the population. Enhancement genetic engineering is technically feasible but morally unacceptable. Eugenic genetic engineering is not technically possible or ethically permissible in the foreseeable future.

  12. [Gene and gene sequence patenting].


    Bergel, S D


    According to the author, the patenting of elements isolated or copied from the human body boils down to the issue of genes and gene sequences. He describes the current situation from the comparative law standpoint (U.S. and Spanish law mainly) and then esamines the biotechnology industry's position.

  13. The Zebrafish Period2 Protein Positively Regulates the Circadian Clock through Mediation of Retinoic Acid Receptor (RAR)-related Orphan Receptor α (Rorα)*

    PubMed Central

    Wang, Mingyong; Zhong, Zhaomin; Zhong, Yingbin; Zhang, Wei; Wang, Han


    We report the characterization of a null mutant for zebrafish circadian clock gene period2 (per2) generated by transcription activator-like effector nuclease and a positive role of PER2 in vertebrate circadian regulation. Locomotor experiments showed that per2 mutant zebrafish display reduced activities under light-dark and 2-h phase delay under constant darkness, and quantitative real time PCR analyses showed up-regulation of cry1aa, cry1ba, cry1bb, and aanat2 but down-regulation of per1b, per3, and bmal1b in per2 mutant zebrafish, suggesting that Per2 is essential for the zebrafish circadian clock. Luciferase reporter assays demonstrated that Per2 represses aanat2 expression through E-box and enhances bmal1b expression through the Ror/Rev-erb response element, implicating that Per2 plays dual roles in the zebrafish circadian clock. Cell transfection and co-immunoprecipitation assays revealed that Per2 enhances bmal1b expression through binding to orphan nuclear receptor Rorα. The enhancing effect of mouse PER2 on Bmal1 transcription is also mediated by RORα even though it binds to REV-ERBα. Moreover, zebrafish Per2 also appears to have tissue-specific regulatory roles in numerous peripheral organs. These findings help define the essential functions of Per2 in the zebrafish circadian clock and in particular provide strong evidence for a positive role of PER2 in the vertebrate circadian system. PMID:25544291

  14. Genes V.

    SciTech Connect

    Lewin, B.


    This fifth edition book encompasses a wide range of topics covering 1,272 pages. The book is arranged into nine parts with a total of 36 chapters. These nine parts include Introduction; DNA as a Store of Information; Translation; Constructing Cells; Control of Prokaryotypic Gene Expression; Perpetuation of DNA; Organization of the Eukaryotypic Genome; Eukaryotypic Transcription and RNA Processing; The Dynamic Genome; and Genes in Development.

  15. Angiotensin II-regulated transcription regulatory genes in adrenal steroidogenesis.


    Romero, Damian G; Gomez-Sanchez, Elise P; Gomez-Sanchez, Celso E


    Transcription regulatory genes are crucial modulators of cell physiology and metabolism whose intracellular levels are tightly controlled in response to extracellular stimuli. We previously reported a set of 29 transcription regulatory genes modulated by angiotensin II in H295R human adrenocortical cells and their roles in regulating the expression of the last and unique enzymes of the glucocorticoid and mineralocorticoid biosynthetic pathways, 11β-hydroxylase and aldosterone synthase, respectively, using gene expression reporter assays. To study the effect of this set of transcription regulatory genes on adrenal steroidogenesis, H295R cells were transfected by high-efficiency nucleofection and aldosterone and cortisol were measured in cell culture supernatants under basal and angiotensin II-stimulated conditions. BCL11B, BHLHB2, CITED2, ELL2, HMGA1, MAFF, NFIL3, PER1, SERTAD1, and VDR significantly stimulated aldosterone secretion, while EGR1, FOSB, and ZFP295 decreased aldosterone secretion. BTG2, HMGA1, MITF, NR4A1, and ZFP295 significantly increased cortisol secretion, while BCL11B, NFIL3, PER1, and SIX2 decreased cortisol secretion. We also report the effect of some of these regulators on the expression of endogenous aldosterone synthase and 11β-hydroxylase under basal and angiotensin II-stimulated conditions. In summary, this study reports for the first time the effects of a set of angiotensin II-modulated transcription regulatory genes on aldosterone and cortisol secretion and the expression levels of the last and unique enzymes of the mineralocorticoid and glucocorticoid biosynthetic pathways. Abnormal regulation of mineralocorticoid or glucocorticoid secretion is involved in several pathophysiological conditions. These transcription regulatory genes may be involved in adrenal steroidogenesis pathologies; thus they merit additional study as potential candidates for therapeutic intervention.

  16. A noradrenergic sensitive endogenous clock is present in the rat pineal gland.


    Wongchitrat, Prapimpun; Felder-Schmittbuhl, Marie-Paule; Govitrapong, Piyarat; Phansuwan-Pujito, Pansiri; Simonneaux, Valérie


    The aim of this study was to examine the occurrence of endogenous oscillations of Per1, Per2, Bmal1 and Rev-erbα genes in rat pineal explants and to investigate their regulation by adrenergic ligands. Our results show a significant and sustained rhythm of Per2,Bmal1 and Rev-erbα gene expression for up to 48 h in cultured pineal gland with a pattern similar to that observed in vivo. By contrast, the rhythms of Per1 and Aa-nat, the rate-limiting enzyme for melatonin synthesis, were strongly attenuated after 24 h in culture. Addition of the exogenous adrenergic agonist isoproterenol on cultured pineal glands induced a short-term increase in mRNA levels of Per1 and Aa-nat, but not those of Per2,Bmal1 and Rev-erbα. This study demonstrates that the rat pineal gland hosts a circadian oscillator as evidenced by the sustained, noradrenergic-independent, endogenous oscillations of Per2, Bmal1 and Rev-erbα mRNA levels in cultured tissues. Only expression of Per1 was stimulated by adrenergic ligands suggesting that, in vivo, the adrenergic input could synchronize the pineal clock by acting selectively on Per1.

  17. [Evolution of gene orders in genomes of cyanobacteria].


    Markov, A V; Zakharov, I A


    Genomes of 23 strains of cyanobacteria were comparatively analyzed using quantitative methods of estimation of gene order similarity. It has been found that reconstructions of phylogenesis of cyanobacteria based on the comparison of the orders of genes in chromosomes and nucleotide sequences appear to be similar. This confirms the applicability of quantitative measures of similarity of gene orders for phylogenetic reconstructions. In the evolution of marine unicellular plankton cyanobacteria, genome rearrangements are fixed with a low rate (about 3% of gene order changes per 1% of 16S rRNA changes), whereas in other groups of cyanobacteria the gene order can change several times more rapidly. The gene orders in genomes of cyanobacteria and chloroplasts preserve a considerable degree of similarity. The closest relatives of chloroplasts among the analyzed cyanobacteria are likely to be strains from hot springs belonging to the genus Synechococcus. Comparative analysis of gene orders and nucleotide sequences strongly suggests that Synechococcus strains from diferent environments (sea, fresh waters, hot springs) are not related and belong to evolutionally distant lines.

  18. Attention Genes

    ERIC Educational Resources Information Center

    Posner, Michael I.; Rothbart, Mary K.; Sheese, Brad E.


    A major problem for developmental science is understanding how the cognitive and emotional networks important in carrying out mental processes can be related to individual differences. The last five years have seen major advances in establishing links between alleles of specific genes and the neural networks underlying aspects of attention. These…

  19. Designer Genes.

    ERIC Educational Resources Information Center

    Miller, Judith; Miller, Mark


    Genetic technologies may soon help fill some of the most important needs of humanity from food to energy to health care. The research of major designer genes companies and reasons why the initial mad rush for biotechnology has slowed are reviewed. (SR)

  20. Endothelial Genes

    DTIC Science & Technology


    Suppression subtractive hybridization re- Cancer: principles and practice of oncology. Philadelphia: Lippincott- vealed an RNA sequence (GenBank accession...Lau YC, Campbell AP, et al. Suppression subtractive hybridization : A method for generating differentially regulated or tissue-tissues, EG-1 appears to...this gene, we investigated its interaction with Src and members of the called suppression subtractive hybridization (12). In human mitogen-activated

  1. T7 Endonuclease I Mediates Error Correction in Artificial Gene Synthesis.


    Sequeira, Ana Filipa; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A


    Efficacy of de novo gene synthesis largely depends on the quality of overlapping oligonucleotides used as template for PCR assembly. The error rate associated with current gene synthesis protocols limits the efficient and accurate production of synthetic genes, both in the small and large scales. Here, we analysed the ability of different endonuclease enzymes, which specifically recognize and cleave DNA mismatches resulting from incorrect impairments between DNA strands, to remove mutations accumulated in synthetic genes. The gfp gene, which encodes the green fluorescent protein, was artificially synthesized using an integrated protocol including an enzymatic mismatch cleavage step (EMC) following gene assembly. Functional and sequence analysis of resulting artificial genes revealed that number of deletions, insertions and substitutions was strongly reduced when T7 endonuclease I was used for mutation removal. This method diminished mutation frequency by eightfold relative to gene synthesis not incorporating an error correction step. Overall, EMC using T7 endonuclease I improved the population of error-free synthetic genes, resulting in an error frequency of 0.43 errors per 1 kb. Taken together, data presented here reveal that incorporation of a mutation-removal step including T7 endonuclease I can effectively improve the fidelity of artificial gene synthesis.

  2. Clock Gene Expression in Gravid Uterus and Extra-Embryonic Tissues During Late Gestation in the Mouse

    PubMed Central

    Ratajczak, Christine K.; Herzog, Erik D.; Muglia, Louis J.


    Evidence in humans and rodents suggests the importance of circadian rhythmicity in parturition. A molecular clock underlies the generation of circadian rhythmicity. While this molecular clock has been identified in numerous tissues, the expression and regulation of clock genes in tissues relevant to parturition is largely undefined. Here, we examine the expression and regulation of the clock genes Bmal1, Clock, Cry(Cryptochrome)1/2, and Per(Period)1/2 in the murine gravid uterus, placenta, and fetal membranes during late gestation. All clock genes examined were expressed in the tissues of interest throughout the last third of gestation. Upregulation of a subset of these clock genes was observed in each of these tissues in the final two days of gestation. Oscillating expression of mRNA for a subset of the examined clock genes was detected in the gravid uterus, placenta, and fetal membranes. Furthermore, bioluminescence recording on explants from gravid Per2::luciferase mice indicated rhythmic expression of PER2 protein in these tissues. These data demonstrate expression and rhythmicity of clock genes in tissues relevant to parturition indicating a potential contribution of peripheral molecular clocks to this process. PMID:20450826

  3. Compare Gene Profiles

    SciTech Connect


    Compare Gene Profiles (CGP) performs pairwise gene content comparisons among a relatively large set of related bacterial genomes. CGP performs pairwise BLAST among gene calls from a set of input genome and associated annotation files, and combines the results to generate lists of common genes, unique genes, homologs, and genes from each genome that differ substantially in length from corresponding genes in the other genomes. CGP is implemented in Python and runs in a Linux environment in serial or parallel mode.

  4. The Circadian Clock Gene Period1 Connects the Molecular Clock to Neural Activity in the Suprachiasmatic Nucleus

    PubMed Central

    Block, Gene D.; Colwell, Christopher S.


    The neural activity patterns of suprachiasmatic nucleus (SCN) neurons are dynamically regulated throughout the circadian cycle with highest levels of spontaneous action potentials during the day. These rhythms in electrical activity are critical for the function of the circadian timing system and yet the mechanisms by which the molecular clockwork drives changes in the membrane are not well understood. In this study, we sought to examine how the clock gene Period1 (Per1) regulates the electrical activity in the mouse SCN by transiently and selectively decreasing levels of PER1 through use of an antisense oligodeoxynucleotide. We found that this treatment effectively reduced SCN neural activity. Direct current injection to restore the normal membrane potential partially, but not completely, returned firing rate to normal levels. The antisense treatment also reduced baseline [Ca2+]i levels as measured by Fura2 imaging technique. Whole cell patch clamp recording techniques were used to examine which specific potassium currents were altered by the treatment. These recordings revealed that the large conductance [Ca2+]i-activated potassium currents were reduced in antisense-treated neurons and that blocking this current mimicked the effects of the anti-sense on SCN firing rate. These results indicate that the circadian clock gene Per1 alters firing rate in SCN neurons and raise the possibility that the large conductance [Ca2+]i-activated channel is one of the targets. PMID:26553726

  5. Gene and enhancer traps for gene discovery.


    Rojas-Pierce, Marcela; Springer, Patricia S


    Gene traps and enhancer traps provide a valuable tool for gene discovery. With this system, genes can be identified based solely on the expression pattern of an inserted reporter gene. The use of a reporter gene, such as beta-glucuoronidase (GUS), provides a very sensitive assay for the identification of tissue- and cell-type specific expression patterns. In this chapter, protocols for examining and documenting GUS reporter gene activity in individual lines are described. Methods for the amplification of sequences flanking transposant insertions and subsequent molecular and genetic characterization of individual insertions are provided.

  6. Effect of sleep deprivation on rhythms of clock gene expression and melatonin in humans.


    Ackermann, Katrin; Plomp, Rosina; Lao, Oscar; Middleton, Benita; Revell, Victoria L; Skene, Debra J; Kayser, Manfred


    This study investigated the impact of sleep deprivation on the human circadian system. Plasma melatonin and cortisol levels and leukocyte expression levels of 12 genes were examined over 48 h (sleep vs. no-sleep nights) in 12 young males (mean±SD: 23±5 yrs). During one night of total sleep deprivation, BMAL1 expression was suppressed, the heat shock gene HSPA1B expression was induced, and the amplitude of the melatonin rhythm increased, whereas other high-amplitude clock gene rhythms (e.g., PER1-3, REV-ERBα) remained unaffected. These data suggest that the core clock mechanism in peripheral oscillators is compromised during acute sleep deprivation.

  7. Role of monochromatic light on daily variation of clock gene expression in the pineal gland of chick.


    Jiang, Nan; Wang, Zixu; Cao, Jing; Dong, Yulan; Chen, Yaoxing


    The avian pineal gland is a master clock that can receive external photic cues and translate them into output rhythms. To clarify whether a shift in light wavelength can influence the circadian expression in chick pineal gland, a total of 240 Arbor Acre male broilers were exposed to white light (WL), red light (RL), green light (GL) or blue light (BL). After 2weeks light illumination, circadian expressions of seven core clock genes in pineal gland and the level of melatonin in plasma were examined. The results showed after illumination with monochromatic light, 24h profiles of all clock gene mRNAs retained circadian oscillation, except that RL tended to disrupt the rhythm of cCry2. Compared to WL, BL advanced the acrophases of the negative elements (cCry1, cCry2, cPer2 and cPer3) by 0.1-1.5h and delayed those of positive elements (cClock, cBmal1 and cBmal2) by 0.2-0.8h. And, RL advanced all clock genes except cClock and cPer2 by 0.3-2.1h, while GL delayed all clock genes by 0.5-1.5h except cBmal2. Meanwhile, GL increased the amplitude and mesor of positive and reduced both parameters of negative clock genes, but RL showed the opposite pattern. Although the acrophase of plasma melatonin was advanced by both GL and RL, the melatonin level was significantly increased in GL and decreased in RL. This tendency was consistent with the variations in the positive clock gene mRNA levels under monochromatic light and contrasted with those of negative clock genes. Therefore, we speculate that GL may enhance positive clock genes expression, leading to melatonin synthesis, whereas RL may enhance negative genes expression, suppressing melatonin synthesis.

  8. Inhibiting AP-1 activity alters cocaine induced gene expression and potentiates sensitization

    PubMed Central

    Paletzki, Ronald F.; Myakishev, Max V.; Polesskaya, Oksana; Orosz, Andras; Hyman, Steven E.; Vinson, Charles


    We have expressed A-FOS, an inhibitor of AP-1 DNA binding, in adult mouse striatal neurons. We observe normal behavior including locomotion and exploratory activities. Following a single injection of cocaine, locomotion increased similarly in both the A-FOS expressing and littermate controls. However, following repeated injections of cocaine, the A-FOS expressing mice showed increased locomotion relative to littermate controls, an increase that persisted following a week of withdrawal and subsequent cocaine administration. These results indicate that AP-1 suppresses this behavioral responses to cocaine. We analyzed mRNA from the striatum before and 4 and 24 hours after a single cocaine injection in both A-FOS and control striata using Affymetrix microarrays (430 2.0 Array) to identify genes mis-regulated by A-FOS that may mediate the increased locomotor sensitization to cocaine. A-FOS expression did not change gene expression in the basal state or 4 hours following cocaine treatment relative to controls. However, 24 hours after an acute cocaine treatment, 84 genes were identified that were differentially expressed between the A-FOS and control mice. 56 gene are down regulated while 28 genes are up regulated including previously identified candidates for addiction including BDNF and Per1. Using a random sample of identified genes, quantitative PCR was used to verify the microarray studies. The chromosomal location of these 84 genes was compared to human genome scans of addiction to identify potential genes in humans that are involved in addiction. PMID:18355967

  9. Gene doping: gene delivery for olympic victory.


    Gould, David


    With one recently recommended gene therapy in Europe and a number of other gene therapy treatments now proving effective in clinical trials it is feasible that the same technologies will soon be adopted in the world of sport by unscrupulous athletes and their trainers in so called 'gene doping'. In this article an overview of the successful gene therapy clinical trials is provided and the potential targets for gene doping are highlighted. Depending on whether a doping gene product is secreted from the engineered cells or is retained locally to, or inside engineered cells will, to some extent, determine the likelihood of detection. It is clear that effective gene delivery technologies now exist and it is important that detection and prevention plans are in place.

  10. Autism and Genes

    ERIC Educational Resources Information Center

    National Institutes of Health, 2005


    This document defines and discusses autism and how genes play a role in the condition. Answers to the following questions are covered: (1) What are genes? (2) What is autism? (3) What causes autism? (4) Why study genes to learn about autism? (5) How do researchers look for the genes involved in autism? (screen the whole genome; conduct cytogenetic…

  11. Compare Gene Calls

    SciTech Connect

    Ecale Zhou, Carol L.


    Compare Gene Calls (CGC) is a Python code used for combining and comparing gene calls from any number of gene callers. A gene caller is a computer program that predicts the extends of open reading frames within genomes of biological organisms.

  12. Folate deprivation modulates the expression of autophagy- and circadian-related genes in HT-22 hippocampal neuron cells through GR-mediated pathway.


    Sun, Qinwei; Yang, Yang; Li, Xi; He, Bin; Jia, Yimin; Zhang, Nana; Zhao, Ruqian


    Folic acid (FA) is an extremely important nutrient for brain formation and development. FA deficiency is highly linked to brain degeneration and age-related diseases, which are also associated with autophagic activities and circadian rhythm in hippocampal neurons. However, little is known how autophagy- and circadian-related genes in hippocampal neurons are regulated under FA deficiency. Here, hippocampal neuroncells (HT-22) were employed to determine the effect of FA deprivation (FD) on the expression of relevant genes and to reveal the potential role of glucocorticoid receptor (GR). FD increased autophagic activities in HT-22 cells, associated with significantly (P<0.05) enhanced GR activation indicated by higher ratio of GR phosphorylation. Out of 17 autophagy-related genes determined, 8 was significantly (P<0.05) up-regulated in FD group, which includes ATG2b, ATG3, ATG4c, ATG5, ATG10, ATG12, ATG13 and ATG14. Meanwhile, 4 out of 7 circadian-related genes detected, Clock, Cry1, Cry2 and Per2, were significantly (P<0.05) up-regulated. The protein content of autophagy markers, LC3A and LC3B, was also increased significantly (P<0.05). ChIP assay showed that FD promoted (P<0.05) GR binding to the promoter sequence of ATG3 and Per2. Moreover, MeDIP analysis demonstrated significant (P<0.05) hypomethylation in the promoter sequence of ATG12, ATG13 and Per2 genes. Together, we speculate that FD increases the transcription of autophagy- and circadian-related genes through, at least partly, GR-mediated pathway. Our results provide a basis for future investigations into the intracellular regulatory network in response to folate deficiency.

  13. MicroRNA-433 Dampens Glucocorticoid Receptor Signaling, Impacting Circadian Rhythm and Osteoblastic Gene Expression.


    Smith, Spenser S; Dole, Neha S; Franceschetti, Tiziana; Hrdlicka, Henry C; Delany, Anne M


    Serum glucocorticoids play a critical role in synchronizing circadian rhythm in peripheral tissues, and multiple mechanisms regulate tissue sensitivity to glucocorticoids. In the skeleton, circadian rhythm helps coordinate bone formation and resorption. Circadian rhythm is regulated through transcriptional and post-transcriptional feedback loops that include microRNAs. How microRNAs regulate circadian rhythm in bone is unexplored. We show that in mouse calvaria, miR-433 displays robust circadian rhythm, peaking just after dark. In C3H/10T1/2 cells synchronized with a pulse of dexamethasone, inhibition of miR-433 using a tough decoy altered the period and amplitude of Per2 gene expression, suggesting that miR-433 regulates rhythm. Although miR-433 does not directly target the Per2 3'-UTR, it does target two rhythmically expressed genes in calvaria, Igf1 and Hif1α. miR-433 can target the glucocorticoid receptor; however, glucocorticoid receptor protein abundance was unaffected in miR-433 decoy cells. Rather, miR-433 inhibition dramatically enhanced glucocorticoid signaling due to increased nuclear receptor translocation, activating glucocorticoid receptor transcriptional targets. Last, in calvaria of transgenic mice expressing a miR-433 decoy in osteoblastic cells (Col3.6 promoter), the amplitude of Per2 and Bmal1 mRNA rhythm was increased, confirming that miR-433 regulates circadian rhythm. miR-433 was previously shown to target Runx2, and mRNA for Runx2 and its downstream target, osteocalcin, were also increased in miR-433 decoy mouse calvaria. We hypothesize that miR-433 helps maintain circadian rhythm in osteoblasts by regulating sensitivity to glucocorticoid receptor signaling.

  14. Epilepsy-associated genes.


    Wang, Jie; Lin, Zhi-Jian; Liu, Liu; Xu, Hai-Qing; Shi, Yi-Wu; Yi, Yong-Hong; He, Na; Liao, Wei-Ping


    Development in genetic technology has led to the identification of an increasing number of genes associated with epilepsy. These discoveries will both provide the basis for including genetic tests in clinical practice and improve diagnosis and treatment of epilepsy. By searching through several databases (OMIM, HGMD, and EpilepsyGene) and recent publications on PubMed, we found 977 genes that are associated with epilepsy. We classified these genes into 4 categories according to the manifestation of epilepsy in phenotypes. We found 84 genes that are considered as epilepsy genes: genes that cause epilepsies or syndromes with epilepsy as the core symptom. 73 genes were listed as neurodevelopment-associated genes: genes associated with both brain-development malformations and epilepsy. Several genes (536) were epilepsy-related: genes associated with both physical or other systemic abnormalities and epilepsy or seizures. We found 284 additional genes putatively associated with epilepsy; this requires further verification. These integrated data will provide new insights useful for both including genetic tests in the clinical practice and evaluating the results of genetic tests. We also summarized the epilepsy-associated genes according to their function, with the goal to better characterize the association between genes and epilepsies and to further understand the mechanisms underlying epilepsy.

  15. Effect of leucine uptake on hepatic and skeletal muscle gene expression in rats: a microarray analysis

    PubMed Central

    Cheon, Wookwang


    [Purpose] This study was performed to explore the physiological functions of leucine by exploring genes with leucine-dependent variability using DNA microarray. [Methods] Sprague-Dawley rats (n = 20) were separated into a HPD (30% High Protein Diet, n = 10) group and a NPD (0% Non Protein Diet, n = 10) group and fed a protein diet for 2 weeks. At the end of the 2-week period, the rats were fasted for 12-16 hours, further separated into subgroups within the HPD (Saline, n = 5, Leucine, n = 5) and NPD (Saline, n = 5, Leucine, n = 5) groups and administered with a leucine solution. The liver and muscles were harvested after 2 hours for RNA extraction. RNA purification from the isolated muscles and target gene identification using DNA chip were performed. The target gene was determined based on the results of the DNA chip experiment, and mRNA expression of the target gene was analyzed using Real-Time PCR. [Results] In the skeletal muscle, 27 genes were upregulated while 52 genes were down regulated after leucine administration in the NPD group. In the liver, 160 genes were up-regulated while 126 were down-regulated. The per2 gene was one of the genes with leucine-dependent induction in muscles and liver. [Conclusion] This study was performed to explore the physiological functions of leucine, however, a large number of genes showed variability. Therefore, it was difficult to definitively identify the genes linked with a particular physiological function. Various nutritional effects of leucine were observed. High variability in cytokines, receptors, and various membrane proteins were observed, which suggests that leucine functions as more than a nutrient. The interpretation may depend on investigators’ perspectives, therefore, discussion with relevant experts and the BCAA (Branched-Chain Amino Acids) society may be needed for effective utilization of this data. PMID:26244133

  16. Circadian Gene Clock Regulates Psoriasis-Like Skin Inflammation in Mice.


    Ando, Noriko; Nakamura, Yuki; Aoki, Rui; Ishimaru, Kayoko; Ogawa, Hideoki; Okumura, Ko; Shibata, Shigenobu; Shimada, Shinji; Nakao, Atsuhito


    There are several reports suggesting that the pathophysiology of psoriasis may be associated with aberrant circadian rhythms. However, the mechanistic link between psoriasis and the circadian time-keeping system, "the circadian clock," remains unclear. This study determined whether the core circadian gene, Clock, had a regulatory role in the development of psoriasis. For this purpose, we compared the development of psoriasis-like skin inflammation induced by the Toll-like receptor 7 ligand imiquimod (IMQ) between wild-type mice and mice with a loss-of-function mutation of Clock. We also compared the development of IMQ-induced dermatitis between wild-type mice and mice with a loss-of-function mutation of Period2 (Per2), another key circadian gene that inhibits CLOCK activity. We found that Clock mutation ameliorated IMQ-induced dermatitis, whereas the Per2 mutation exaggerated IMQ-induced dermatitis, when compared with wild-type mice associated with decreased or increased IL-23 receptor (IL-23R) expression in γ/δ+ T cells, respectively. In addition, CLOCK directly bound to the promoter of IL-23R in γ/δ+ T cells, and IL-23R expression in the mouse skin was under circadian control. These findings suggest that Clock is a novel regulator of psoriasis-like skin inflammation in mice via direct modulation of IL-23R expression in γ/δ+ T cells, establishing a mechanistic link between psoriasis and the circadian clock.

  17. Gene regulation in cancer gene therapy strategies.


    Scanlon, Ian; Lehouritis, Panos; Niculescu-Duvaz, Ion; Marais, Richard; Springer, Caroline J


    Regulation of expression in gene therapy is considered to be a very desirable goal, preventing toxic effects and improving biological efficacy. A variety of systems have been reported in an ever widening range of applications, this paper describes these systems with specific reference to cancer gene therapy.

  18. Human Gene Therapy: Genes without Frontiers?

    ERIC Educational Resources Information Center

    Simon, Eric J.


    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  19. Human gene therapy.


    Sandhu, J S; Keating, A; Hozumi, N


    Human gene therapy and its application for the treatment of human genetic disorders, such as cystic fibrosis, cancer, and other diseases, are discussed. Gene therapy is a technique in which a functioning gene is inserted into a human cell to correct a genetic error or to introduce a new function to the cell. Many methods, including retroviral vectors and non-viral vectors, have been developed for both ex vivo and in vivo gene transfer into cells. Vectors need to be developed that efficiently transfer genes to target cells, and promoter systems are required that regulate gene expression according to physiologic needs of the host cell. There are several safety and ethical issues related to manipulating the human genome that need to be resolved. Current gene therapy efforts focus on gene insertion into somatic cells only. Gene therapy has potential for the effective treatment of genetic disorders, and gene transfer techniques are being used for basic research, for example, in cancer, to examine the underlying mechanism of disease. There are still many technical obstacles to be overcome before human gene therapy can become a routine procedure. The current human genome project provides the sequences of a vast number of human genes, leading to the identification, characterization, and understanding of genes that are responsible for many human diseases.

  20. Gene therapy for blindness.


    Sahel, José-Alain; Roska, Botond


    Sight-restoring therapy for the visually impaired and blind is a major unmet medical need. Ocular gene therapy is a rational choice for restoring vision or preventing the loss of vision because most blinding diseases originate in cellular components of the eye, a compartment that is optimally suited for the delivery of genes, and many of these diseases have a genetic origin or genetic component. In recent years we have witnessed major advances in the field of ocular gene therapy, and proof-of-concept studies are under way to evaluate the safety and efficacy of human gene therapies. Here we discuss the concepts and recent advances in gene therapy in the retina. Our review discusses traditional approaches such as gene replacement and neuroprotection and also new avenues such as optogenetic therapies. We conjecture that advances in gene therapy in the retina will pave the way for gene therapies in other parts of the brain.

  1. Scientists Spot 'Teetotaler' Gene


    ... gov/news/fullstory_162265.html Scientists Spot 'Teetotaler' Gene Discovery might one day lead to drugs to ... HealthDay News) -- Scientists say they've identified a gene variant that dampens the desire to drink alcohol. ...

  2. Genes and Hearing Loss


    ... gametes (reproductive cells). One gamete will carry the mutant form of the gene of interest, and the ... by having parents who are heterozygous carriers for mutant forms of the gene in question but are ...

  3. Differential resetting process of circadian gene expression in rat pineal glands after the reversal of the light/dark cycle via a 24 h light or dark period transition.


    Wu, Tao; Dong, Yue; Yang, Zhiqiu; Kato, Hisanori; Ni, Yinhua; Fu, Zhengwei


    Although studies involving the circadian response to time-zone transitions indicate that the circadian clock usually takes much longer to phase advance than delay, the discrepancy between the circadian resetting induced by photoperiod alteration via a dark or light period transition has yet to be investigated. In mammals, the pineal gland is an important component in the photoneuroendocrine axis, regulating biological rhythms. However, few studies have systematically examined the resetting process of pineal clock-gene expression to date. We investigated the resetting processes of four clock genes (Bmal1, Cry1, Per1, Dec1) and AANAT in the rat pineal gland after the light-dark (LD) reversal via a 24 h light or dark period transition. The resynchronization of the SCN-driven gene AANAT was nearly complete in three days in both situations, displaying similar resetting rates and processes after the differential LD reversals. The resetting processes of the clock genes were characterized by gene-specific, phase-shift modes and differential phase-shift rates between the two different LD reversal modes. The resetting processes of these clock genes were noticeably lengthened after the LD reversal via the light period transition in comparison to via the dark period transition. In addition, among the four examined clock genes, Per1 adjusted most rapidly after the differential LD reversals, while the rhythmic Cry1 expression adjusted most slowly.

  4. Myocardial gene therapy

    NASA Astrophysics Data System (ADS)

    Isner, Jeffrey M.


    Gene therapy is proving likely to be a viable alternative to conventional therapies in coronary artery disease and heart failure. Phase 1 clinical trials indicate high levels of safety and clinical benefits with gene therapy using angiogenic growth factors in myocardial ischaemia. Although gene therapy for heart failure is still at the pre-clinical stage, experimental data indicate that therapeutic angiogenesis using short-term gene expression may elicit functional improvement in affected individuals.

  5. Unconjugated Bile Acids Influence Expression of Circadian Genes: A Potential Mechanism for Microbe-Host Crosstalk

    PubMed Central

    Govindarajan, Kalaimathi; MacSharry, John; Casey, Patrick G.; Shanahan, Fergus


    Disruptions to circadian rhythm in mice and humans have been associated with an increased risk of obesity and metabolic syndrome. The gut microbiota is known to be essential for the maintenance of circadian rhythm in the host suggesting a role for microbe-host interactions in the regulation of the peripheral circadian clock. Previous work suggested a role for gut bacterial bile salt hydrolase (BSH) activity in the regulation of host circadian gene expression. Here we demonstrate that unconjugated bile acids, known to be generated through the BSH activity of the gut microbiota, are potentially chronobiological regulators of host circadian gene expression. We utilised a synchronised Caco-2 epithelial colorectal cell model and demonstrated that unconjugated bile acids, but not the equivalent tauro-conjugated bile salts, enhance the expression levels of genes involved in circadian rhythm. In addition oral administration of mice with unconjugated bile acids significantly altered expression levels of circadian clock genes in the ileum and colon as well as the liver with significant changes to expression of hepatic regulators of circadian rhythm (including Dbp) and associated genes (Per2, Per3 and Cry2). The data demonstrate a potential mechanism for microbe-host crosstalk that significantly impacts upon host circadian gene expression. PMID:27907092

  6. Reading and Generalist Genes

    ERIC Educational Resources Information Center

    Haworth, Claire M. A.; Meaburn, Emma L.; Harlaar, Nicole; Plomin, Robert


    Twin-study research suggests that many (but not all) of the same genes contribute to genetic influence on diverse learning abilities and disabilities, a hypothesis called "generalist genes". This generalist genes hypothesis was tested using a set of 10 DNA markers (single nucleotide polymorphisms [SNPs]) found to be associated with early reading…

  7. Inhibitory role of REV-ERBα in the expression of bone morphogenetic protein gene family in rat uterus endometrium stromal cells.


    Tasaki, Hirotaka; Zhao, Lijia; Isayama, Keishiro; Chen, Huatao; Yamauchi, Nobuhiko; Shigeyoshi, Yasufumi; Hashimoto, Seiichi; Hattori, Masa-aki


    Uterus circadian rhythms have been implicated in the gestation processes of mammals through entraining of the clock proteins to numerous downstream genes. Bone morphogenetic proteins (BMPs), having clock-controlled regulatory sites in their gene promoters, are expressed in the uterus during decidualization, but the regulation of the Bmp gene expression is poorly understood. The present study was designed to dissect the physiological roles of the uterus oscillators in the Bmp expression using the uterus endometrial stromal cells (UESCs) isolated from Per2-dLuc transgenic rats on day 4.5 of gestation. The in vitro decidualization of UESCs was induced by medroxyprogesterone acetate and 2-O-dibutyryl cAMP. A significant decline of Per2-dLuc bioluminescence activity was induced in decidual cells, and concomitantly, the expression of canonical clock genes was downregulated. Conversely, the expression of the core Bmp genes Bmp2, Bmp4, Bmp6, and Bmp7 was upregulated. In UESCs transfected with Bmal1-specific siRNA, in which Rev-erbα expression was downregulated, Bmp genes, such as Bmp2, Bmp4, and Bmp6 were upregulated. However, Bmp1, Bmp7, and Bmp8a were not significantly affected by Bmal1 silencing. The expression of all Bmp genes was enhanced after treatment with the REV-ERBα antagonist (SR8278), although their rhythmic profiles were differed from each other. The binding of REV-ERBα to the proximal regions of the Bmp2 and Bmp4 promoters was revealed by chromatin immunoprecipitation-PCR analysis. Collectively, these results indicate that the Bmp genes are upregulated by the attenuation of the cellular circadian clock; in particular, its core component REV-ERBα functions as a transcriptional silencer in the Bmp gene family.

  8. Gene hunting in autoinflammation

    PubMed Central


    Steady progress in our understanding of the genetic basis of autoinflammatory diseases has been made over the past 16 years. Since the discovery of the familial Mediterranean fever gene MEFV (also known as marenostrin) in 1997, 18 other genes responsible for monogenic autoinflammatory diseases have been identified to date. The discovery of these genes was made through the utilisation of many genetic mapping techniques, including next generation sequencing platforms. This review article clearly describes the gene hunting approaches, methods of data analysis and the technological platforms used, which has relevance to all those working within the field of gene discovery for Mendelian disorders. PMID:24070009

  9. Gene therapy review.


    Moss, Joseph Anthony


    The use of genes to treat disease, more commonly known as gene therapy, is a valid and promising tool to manage and treat diseases that conventional drug therapies cannot cure. Gene therapy holds the potential to control a wide range of diseases, including cystic fibrosis, heart disease, diabetes, cancer, and blood diseases. This review assesses the current status of gene therapy, highlighting therapeutic methodologies and applications, terminology, and imaging strategies. This article presents an overview of roadblocks associated with each therapeutic methodology, along with some of the scientific, social, and ethical issues associated with gene therapy.

  10. Regulated Gene Therapy.


    Breger, Ludivine; Wettergren, Erika Elgstrand; Quintino, Luis; Lundberg, Cecilia


    Gene therapy represents a promising approach for the treatment of monogenic and multifactorial neurological disorders. It can be used to replace a missing gene and mutated gene or downregulate a causal gene. Despite the versatility of gene therapy, one of the main limitations lies in the irreversibility of the process: once delivered to target cells, the gene of interest is constitutively expressed and cannot be removed. Therefore, efficient, safe and long-term gene modification requires a system allowing fine control of transgene expression.Different systems have been developed over the past decades to regulate transgene expression after in vivo delivery, either at transcriptional or post-translational levels. The purpose of this chapter is to give an overview on current regulatory system used in the context of gene therapy for neurological disorders. Systems using external regulation of transgenes using antibiotics are commonly used to control either gene expression using tetracycline-controlled transcription or protein levels using destabilizing domain technology. Alternatively, specific promoters of genes that are regulated by disease mechanisms, increasing expression as the disease progresses or decreasing expression as disease regresses, are also examined. Overall, this chapter discusses advantages and drawbacks of current molecular methods for regulated gene therapy in the central nervous system.

  11. Gene therapy in periodontics.


    Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini


    GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is 'the use of genes as medicine'. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.

  12. Genes, dreams, and cancer.


    Sikora, K


    There have been tremendous advances in our understanding of cancer from the application of molecular biology over the past decade. The disease is caused by a series of defects in the genes that accelerate growth--oncogenes--and those that slow down cellular turnover--tumour suppressor genes. The proteins they encode provide a promising hunting ground in which to design and test new anticancer drugs. Several treatment strategies are now under clinical trial entailing direct gene transfer. These include the use of gene marking to detect minimal residual disease, the production of novel cancer vaccines by the insertion of genes which uncloak cancer cells so making them visible to the host's immune system, the isolation and coupling of cancer specific molecular switches upstream of drug activating genes, and the correction of aberrant oncogenes or tumour suppressor genes. The issues in these approaches are likely to have a profound impact on the management of cancer patients as we enter the next century.

  13. Conventional murine gene targeting.


    Zimmermann, Albert G; Sun, Yue


    Murine gene knockout models engineered over the last two decades have continued to demonstrate their potential as invaluable tools in understanding the role of gene function in the context of normal human development and disease. The more recent elucidation of the human and mouse genomes through sequencing has opened up the capability to elucidate the function of every human gene. State-of-the-art mouse model generation allows, through a multitude of experimental steps requiring careful standardization, gene function to be reliably and predictably ablated in a live model system. The application of these standardized methodologies to directly target gene function through murine gene knockout has to date provided comprehensive and verifiable genetic models that have contributed tremendously to our understanding of the cellular and molecular pathways underlying normal and disease states in humans. The ensuing chapter provides an overview of the latest steps and procedures required to ablate gene function in a murine model.

  14. Primetime for Learning Genes.


    Keifer, Joyce


    Learning genes in mature neurons are uniquely suited to respond rapidly to specific environmental stimuli. Expression of individual learning genes, therefore, requires regulatory mechanisms that have the flexibility to respond with transcriptional activation or repression to select appropriate physiological and behavioral responses. Among the mechanisms that equip genes to respond adaptively are bivalent domains. These are specific histone modifications localized to gene promoters that are characteristic of both gene activation and repression, and have been studied primarily for developmental genes in embryonic stem cells. In this review, studies of the epigenetic regulation of learning genes in neurons, particularly the brain-derived neurotrophic factor gene (BDNF), by methylation/demethylation and chromatin modifications in the context of learning and memory will be highlighted. Because of the unique function of learning genes in the mature brain, it is proposed that bivalent domains are a characteristic feature of the chromatin landscape surrounding their promoters. This allows them to be "poised" for rapid response to activate or repress gene expression depending on environmental stimuli.

  15. Human HOX gene disorders.


    Quinonez, Shane C; Innis, Jeffrey W


    The Hox genes are an evolutionarily conserved family of genes, which encode a class of important transcription factors that function in numerous developmental processes. Following their initial discovery, a substantial amount of information has been gained regarding the roles Hox genes play in various physiologic and pathologic processes. These processes range from a central role in anterior-posterior patterning of the developing embryo to roles in oncogenesis that are yet to be fully elucidated. In vertebrates there are a total of 39 Hox genes divided into 4 separate clusters. Of these, mutations in 10 Hox genes have been found to cause human disorders with significant variation in their inheritance patterns, penetrance, expressivity and mechanism of pathogenesis. This review aims to describe the various phenotypes caused by germline mutation in these 10 Hox genes that cause a human phenotype, with specific emphasis paid to the genotypic and phenotypic differences between allelic disorders. As clinical whole exome and genome sequencing is increasingly utilized in the future, we predict that additional Hox gene mutations will likely be identified to cause distinct human phenotypes. As the known human phenotypes closely resemble gene-specific murine models, we also review the homozygous loss-of-function mouse phenotypes for the 29 Hox genes without a known human disease. This review will aid clinicians in identifying and caring for patients affected with a known Hox gene disorder and help recognize the potential for novel mutations in patients with phenotypes informed by mouse knockout studies.

  16. Primetime for Learning Genes

    PubMed Central

    Keifer, Joyce


    Learning genes in mature neurons are uniquely suited to respond rapidly to specific environmental stimuli. Expression of individual learning genes, therefore, requires regulatory mechanisms that have the flexibility to respond with transcriptional activation or repression to select appropriate physiological and behavioral responses. Among the mechanisms that equip genes to respond adaptively are bivalent domains. These are specific histone modifications localized to gene promoters that are characteristic of both gene activation and repression, and have been studied primarily for developmental genes in embryonic stem cells. In this review, studies of the epigenetic regulation of learning genes in neurons, particularly the brain-derived neurotrophic factor gene (BDNF), by methylation/demethylation and chromatin modifications in the context of learning and memory will be highlighted. Because of the unique function of learning genes in the mature brain, it is proposed that bivalent domains are a characteristic feature of the chromatin landscape surrounding their promoters. This allows them to be “poised” for rapid response to activate or repress gene expression depending on environmental stimuli. PMID:28208656

  17. Do Housekeeping Genes Exist?

    PubMed Central

    Sun, Bingyun


    The searching of human housekeeping (HK) genes has been a long quest since the emergence of transcriptomics, and is instrumental for us to understand the structure of genome and the fundamentals of biological processes. The resolved genes are frequently used in evolution studies and as normalization standards in quantitative gene-expression analysis. Within the past 20 years, more than a dozen HK-gene studies have been conducted, yet none of them sampled human tissues completely. We believe an integration of these results will help remove false positive genes owing to the inadequate sampling. Surprisingly, we only find one common gene across 15 examined HK-gene datasets comprising 187 different tissue and cell types. Our subsequent analyses suggest that it might not be appropriate to rigidly define HK genes as expressed in all tissue types that have diverse developmental, physiological, and pathological states. It might be beneficial to use more robustly identified HK functions for filtering criteria, in which the representing genes can be a subset of genome. These genes are not necessarily the same, and perhaps need not to be the same, everywhere in our body. PMID:25970694

  18. Diurnal expression of clock genes in pineal gland and brain and plasma levels of melatonin and cortisol in Atlantic salmon parr and smolts.


    Huang, Tien-sheng; Ruoff, Peter; Fjelldal, Per G


    In Atlantic salmon, the preadaptation to a marine life, i.e., parr-smolt transformation, and melatonin production in the pineal gland are regulated by the photoperiod. However, the clock genes have never been studied in the pineal gland of this species. The aim of the present study was to describe the diurnal expression of clock genes (Per1-like, Cry2, and Clock) in the pineal gland and brain of Atlantic salmon parr and smolts in freshwater, as well as plasma levels of melatonin and cortisol. By employing an out-of-season smolt production model, the parr-smolt transformation was induced by subjecting triplicate groups of parr to 6 wks (wks 0 to 6) under a 12 h:12 h light-dark (LD) regime followed by 6 wks (wks 6 to 12) of continuous light (LL). The measured clock genes in both pineal gland and brain and the plasma levels of melatonin and cortisol showed significant daily variations in parr under LD in wk 6, whereas these rhythms were abolished in smolts under LL in wk 12. In parr, the pineal Per1-like and Cry2 expression peaked in the dark phase, whereas the pineal Clock expression was elevated during the light phase. Although this study presents novel findings on the clock gene system in the teleost pineal gland, the role of this system in the regulation of smoltification needs to be studied in more detail.

  19. Parkinson's disease: gene therapies.


    Coune, Philippe G; Schneider, Bernard L; Aebischer, Patrick


    With the recent development of effective gene delivery systems, gene therapy for the central nervous system is finding novel applications. Here, we review existing viral vectors and discuss gene therapy strategies that have been proposed for Parkinson's disease. To date, most of the clinical trials were based on viral vectors to deliver therapeutic transgenes to neurons within the basal ganglia. Initial trials used genes to relieve the major motor symptoms caused by nigrostriatal degeneration. Although these new genetic approaches still need to prove more effective than existing symptomatic treatments, there is a need for disease-modifying strategies. The investigation of the genetic factors implicated in Parkinson's disease is providing precious insights in disease pathology that, combined with innovative gene delivery systems, will hopefully offer novel opportunities for gene therapy interventions to slow down, or even halt disease progression.

  20. Green genes gleaned.


    Beale, Samuel I


    A recent paper by Ayumi Tanaka and colleagues identifying an Arabidopsis thaliana gene for 3,8-divinyl(proto)chlorophyllide 8-vinyl reductase brings a satisfying conclusion to the hunt for genes encoding enzymes for the steps in the chlorophyll biosynthetic pathway. Now, at least in angiosperm plants represented by Arabidopsis, genes for all 15 steps in the pathway from glutamyl-tRNA to chlorophylls a and b have been identified.

  1. Gene-Category Analysis.


    Bauer, Sebastian


    Gene-category analysis is one important knowledge integration approach in biomedical sciences that combines knowledge bases such as Gene Ontology with lists of genes or their products, which are often the result of high-throughput experiments, gained from either wet-lab or synthetic experiments. In this chapter, we will motivate this class of analyses and describe an often used variant that is based on Fisher's exact test. We show that this approach has some problems in the context of Gene Ontology of which users should be aware. We then describe some more recent algorithms that try to address some of the shortcomings of the standard approach.

  2. Antiangiogenic Eye Gene Therapy.


    Corydon, Thomas J


    The idea of treating disease in humans with genetic material was conceived over two decades ago and with that a promising journey involving development and efficacy studies in cells and animals of a large number of novel therapeutic reagents unfolded. In the footsteps of this process, successful gene therapy treatment of genetic conditions in humans has shown clear signs of efficacy. Notably, significant advancements using gene supplementation and silencing strategies have been made in the field of ocular gene therapy, thereby pinpointing ocular gene therapy as one of the compelling "actors" bringing gene therapy to the clinic. Most of all, this success has been facilitated because of (1) the fact that the eye is an effortlessly accessible, exceedingly compartmentalized, and immune-privileged organ offering a unique advantage as a gene therapy target, and (2) significant progress toward efficient, sustained transduction of cells within the retina having been achieved using nonintegrating vectors based on recombinant adeno-associated virus and nonintegrating lentivirus vectors. The results from in vivo experiments and trials suggest that treatment of inherited retinal dystrophies, ocular angiogenesis, and inflammation with gene therapy can be both safe and effective. Here, the progress of ocular gene therapy is examined with special emphasis on the potential use of RNAi- and protein-based antiangiogenic gene therapy to treat exudative age-related macular degeneration.

  3. History of gene therapy.


    Wirth, Thomas; Parker, Nigel; Ylä-Herttuala, Seppo


    Two decades after the initial gene therapy trials and more than 1700 approved clinical trials worldwide we not only have gained much new information and knowledge regarding gene therapy in general, but also learned to understand the concern that has persisted in society. Despite the setbacks gene therapy has faced, success stories have increasingly emerged. Examples for these are the positive recommendation for a gene therapy product (Glybera) by the EMA for approval in the European Union and the positive trials for the treatment of ADA deficiency, SCID-X1 and adrenoleukodystrophy. Nevertheless, our knowledge continues to grow and during the course of time more safety data has become available that helps us to develop better gene therapy approaches. Also, with the increased understanding of molecular medicine, we have been able to develop more specific and efficient gene transfer vectors which are now producing clinical results. In this review, we will take a historical view and highlight some of the milestones that had an important impact on the development of gene therapy. We will also discuss briefly the safety and ethical aspects of gene therapy and address some concerns that have been connected with gene therapy as an important therapeutic modality.

  4. Towards Consensus Gene Ages

    PubMed Central

    Liebeskind, Benjamin J.; McWhite, Claire D.; Marcotte, Edward M.


    Correctly estimating the age of a gene or gene family is important for a variety of fields, including molecular evolution, comparative genomics, and phylogenetics, and increasingly for systems biology and disease genetics. However, most studies use only a point estimate of a gene’s age, neglecting the substantial uncertainty involved in this estimation. Here, we characterize this uncertainty by investigating the effect of algorithm choice on gene-age inference and calculate consensus gene ages with attendant error distributions for a variety of model eukaryotes. We use 13 orthology inference algorithms to create gene-age datasets and then characterize the error around each age-call on a per-gene and per-algorithm basis. Systematic error was found to be a large factor in estimating gene age, suggesting that simple consensus algorithms are not enough to give a reliable point estimate. We also found that different sources of error can affect downstream analyses, such as gene ontology enrichment. Our consensus gene-age datasets, with associated error terms, are made fully available at so that researchers can propagate this uncertainty through their analyses ( PMID:27259914

  5. Cell and gene therapy.


    Rao, Rajesh C; Zacks, David N


    Replacement or repair of a dysfunctional gene combined with promoting cell survival is a two-pronged approach that addresses an unmet need in the therapy of retinal degenerative diseases. In this chapter, we discuss various strategies toward achieving both goals: transplantation of wild-type cells to replace degenerating cells and to rescue gene function, sequential gene and cell therapy, and in vivo reprogramming of rods to cones. These approaches highlight cutting-edge advances in cell and gene therapy, and cellular lineage conversion in order to devise new therapies for various retinal degenerative diseases.

  6. Smart Genes, Stupid Science.

    ERIC Educational Resources Information Center

    Randerson, Sherman; Mahadeva, Madhu N.


    Because many people still believe that specific, identifiable genes dictate the level of human intelligence and that the number/quality of these genes can be evaluated, presents evidence from human genetics (related to nervous system development) to counter this view. Also disputes erroneous assumptions made in "heritability studies" of human…

  7. Genes, genome and Gestalt.


    Grisolia, Cesar Koppe


    According to Gestalt thinking, biological systems cannot be viewed as the sum of their elements, but as processes of the whole. To understand organisms we must start from the whole, observing how the various parts are related. In genetics, we must observe the genome over and above the sum of its genes. Either loss or addition of one gene in a genome can change the function of the organism. Genomes are organized in networks of genes, which need to be well integrated. In the case of genetically modified organisms (GMOs), for example, soybeans, rats, Anopheles mosquitoes, and pigs, the insertion of an exogenous gene into a receptive organism generally causes disturbance in the networks, resulting in the breakdown of gene interactions. In these cases, genetic modification increased the genetic load of the GMO and consequently decreased its adaptability (fitness). Therefore, it is hard to claim that the production of such organisms with an increased genetic load does not have ethical implications.

  8. [Gene therapy and ethics].


    Müller, H; Rehmann-Sutter, C


    Gene therapy represents a new strategy to treat human disorders. It was originally conceived as a cure for severe monogenetic disorders. Since its conception, the spectrum of possible application for gene therapy has been to include the treatment of acquired diseases, such as various forms of cancer and some viral infections, most notably human immune deficiency virus (HIV) and hepatitis B virus. Since somatic gene therapy does not cause substantially new ethical problems, it has gained broad approval. This is by no means the case with germ-line gene therapy. Practically all bodies who were evaluating the related ethical aspects wanted to ban its medical application on grounds of fundamental and pragmatic considerations. In this review, practical and ethical views concerning gene therapy are summarized which were presented at the "Junitagung 1994" of the Swiss Society for Biomedical Ethics in Basle.

  9. Circadian clock components in the rat neocortex: daily dynamics, localization and regulation.


    Rath, Martin F; Rohde, Kristian; Fahrenkrug, Jan; Møller, Morten


    The circadian master clock of the mammalian brain resides in the suprachiasmatic nucleus (SCN) of the hypothalamus. At the molecular level, the clock of the SCN is driven by a transcriptional/posttranslational autoregulatory network with clock gene products as core elements. Recent investigations have shown the presence of peripheral clocks in extra-hypothalamic areas of the central nervous system. However, knowledge on the clock gene network in the cerebral cortex is limited. We here show that the mammalian clock genes Per1, Per2, Per3, Cry1, Cry2, Bmal1, Clock, Nr1d1 and Dbp are expressed in the rat neocortex. Among these, Per1, Per2, Per3, Cry1, Bmal1, Nr1d1 and Dbp were found to exhibit daily rhythms. The amplitude of circadian oscillation in neocortical clock gene expression was damped and the peak delayed as compared with the SCN. Lesions of the SCN revealed that rhythmic clock gene expression in the neocortex is dependent on the SCN. In situ hybridization and immunohistochemistry showed that products of the canonical clock gene Per2 are located in perikarya throughout all areas of the neocortex. These findings show that local circadian oscillators driven by the SCN reside within neurons of the neocortex.

  10. Catabolic cytokines disrupt the circadian clock and the expression of clock-controlled genes in cartilage via an NFкB-dependent pathway

    PubMed Central

    Guo, B.; Yang, N.; Borysiewicz, E.; Dudek, M.; Williams, J.L.; Li, J.; Maywood, E.S.; Adamson, A.; Hastings, M.H.; Bateman, J.F.; White, M.R.H.; Boot-Handford, R.P.; Meng, Q.J.


    Summary Objective To define how the catabolic cytokines (Interleukin 1 (IL-1) and tumor necrosis factor alpha (TNFα)) affect the circadian clock mechanism and the expression of clock-controlled catabolic genes within cartilage, and to identify the downstream pathways linking the cytokines to the molecular clock within chondrocytes. Methods Ex vivo cartilage explants were isolated from the Cry1-luc or PER2::LUC clock reporter mice. Clock gene dynamics were monitored in real-time by bioluminescence photon counting. Gene expression changes were studied by qRT-PCR. Functional luc assays were used to study the function of the core Clock/BMAL1 complex in SW-1353 cells. NFкB pathway inhibitor and fluorescence live-imaging of cartilage were performed to study the underlying mechanisms. Results Exposure to IL-1β severely disrupted circadian gene expression rhythms in cartilage. This effect was reversed by an anti-inflammatory drug dexamethasone, but not by other clock synchronizing agents. Circadian disruption mediated by IL-1β was accompanied by disregulated expression of endogenous clock genes and clock-controlled catabolic pathways. Mechanistically, NFкB signalling was involved in the effect of IL-1β on the cartilage clock in part through functional interference with the core Clock/BMAL1 complex. In contrast, TNFα had little impact on the circadian rhythm and clock gene expression in cartilage. Conclusion In our experimental system (young healthy mouse cartilage), we demonstrate that IL-1β (but not TNFα) abolishes circadian rhythms in Cry1-luc and PER2::LUC gene expression. These data implicate disruption of the chondrocyte clock as a novel aspect of the catabolic responses of cartilage to pro-inflammatory cytokines, and provide an additional mechanism for how chronic joint inflammation may contribute to osteoarthritis (OA). PMID:26521744


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. AERIAL VIEW OF GENE WASH RESERVOIR AND GENE CAMP LOOKING SOUTHWEST. DAM AND SPILLWAY VISIBLE IN BOTTOM OF PHOTO. - Gene Wash Reservoir & Dam, 2 miles west of Parker Dam, Parker Dam, San Bernardino County, CA

  12. Extra-hypothalamic brain clocks in songbirds: Photoperiodic state dependent clock gene oscillations in night-migratory blackheaded buntings, Emberiza melanocephala.


    Singh, Devraj; Kumar, Vinod


    The avian circadian pacemaker system is comprised of independent clocks in the retina, pineal and hypothalamus, as shown by daily and circadian oscillations of core clock genes (Per2, Cry1, Bmal1 and Clock) in several birds including migratory blackheaded buntings (Emberiza melanocephala). This study investigated the extra-hypothalamic brain circadian clocks in blackheaded buntings, and measured Per2, Cry1, Cry2, Bmal1 and Clock mRNA expressions at 4h intervals over 24h beginning 1h after light-on in the left and right telencephalon, optic tectum and cerebellum, the brain regions involved in several physiological and cognitive functions. Because of seasonal alterations in the circadian clock dependent brain functions, we measured daily clock gene oscillations in buntings photoperiod-induced with the non-migratory state under short days (SDnM), and the pre-migratory (LDpM), migratory (LDM) and post-migratory (refractory, LDR) states under long days. Daily Per2 oscillations were not altered with changes in the photoperiodic states, except for about 2-3h phase difference in the optic tectum between the SDnM and LDpM states. However, there were about 3-5h differences in the phase and 2 to 4 fold change in the amplitude of daily Bmal1 and Cry1 mRNA oscillations between the photoperiod-induced states. Further, Cry2 and Clock genes lacked a significant oscillation, except in Cb (Cry2) and TeO and Rt (Clock) under LDR state. Overall, these results show the presence of circadian clocks in extra-hypothalamic brain regions of blackheaded buntings, and suggest tissue-dependent alterations in the waveforms of mRNA oscillations with transitions in the photoperiod-induced seasonal states in a long-day species.

  13. Fecundity genes in sheep.


    Davis, G H


    Since 1980 there has been increasing interest in the identification and utilisation of major genes for prolificacy in sheep. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. DNA tests enable some of these mutations to be used in genetic improvement programmes based on marker assisted selection.

  14. Gene therapy for hemophilia.


    Chuah, M K; Evens, H; VandenDriessche, T


    Hemophilia A and B are X-linked monogenic disorders resulting from deficiencies of factor VIII and FIX, respectively. Purified clotting factor concentrates are currently intravenously administered to treat hemophilia, but this treatment is non-curative. Therefore, gene-based therapies for hemophilia have been developed to achieve sustained high levels of clotting factor expression to correct the clinical phenotype. Over the past two decades, different types of viral and non-viral gene delivery systems have been explored for hemophilia gene therapy research with a variety of target cells, particularly hepatocytes, hematopoietic stem cells, skeletal muscle cells, and endothelial cells. Lentiviral and adeno-associated virus (AAV)-based vectors are among the most promising vectors for hemophilia gene therapy. In preclinical hemophilia A and B animal models, the bleeding phenotype was corrected with these vectors. Some of these promising preclinical results prompted clinical translation to patients suffering from a severe hemophilic phenotype. These patients receiving gene therapy with AAV vectors showed long-term expression of therapeutic FIX levels, which is a major step forwards in this field. Nevertheless, the levels were insufficient to prevent trauma or injury-induced bleeding episodes. Another challenge that remains is the possible immune destruction of gene-modified cells by effector T cells, which are directed against the AAV vector antigens. It is therefore important to continuously improve the current gene therapy approaches to ultimately establish a real cure for hemophilia.

  15. Differentially Coexpressed Disease Gene Identification Based on Gene Coexpression Network.


    Jiang, Xue; Zhang, Han; Quan, Xiongwen


    Screening disease-related genes by analyzing gene expression data has become a popular theme. Traditional disease-related gene selection methods always focus on identifying differentially expressed gene between case samples and a control group. These traditional methods may not fully consider the changes of interactions between genes at different cell states and the dynamic processes of gene expression levels during the disease progression. However, in order to understand the mechanism of disease, it is important to explore the dynamic changes of interactions between genes in biological networks at different cell states. In this study, we designed a novel framework to identify disease-related genes and developed a differentially coexpressed disease-related gene identification method based on gene coexpression network (DCGN) to screen differentially coexpressed genes. We firstly constructed phase-specific gene coexpression network using time-series gene expression data and defined the conception of differential coexpression of genes in coexpression network. Then, we designed two metrics to measure the value of gene differential coexpression according to the change of local topological structures between different phase-specific networks. Finally, we conducted meta-analysis of gene differential coexpression based on the rank-product method. Experimental results demonstrated the feasibility and effectiveness of DCGN and the superior performance of DCGN over other popular disease-related gene selection methods through real-world gene expression data sets.

  16. Differentially Coexpressed Disease Gene Identification Based on Gene Coexpression Network

    PubMed Central

    Quan, Xiongwen


    Screening disease-related genes by analyzing gene expression data has become a popular theme. Traditional disease-related gene selection methods always focus on identifying differentially expressed gene between case samples and a control group. These traditional methods may not fully consider the changes of interactions between genes at different cell states and the dynamic processes of gene expression levels during the disease progression. However, in order to understand the mechanism of disease, it is important to explore the dynamic changes of interactions between genes in biological networks at different cell states. In this study, we designed a novel framework to identify disease-related genes and developed a differentially coexpressed disease-related gene identification method based on gene coexpression network (DCGN) to screen differentially coexpressed genes. We firstly constructed phase-specific gene coexpression network using time-series gene expression data and defined the conception of differential coexpression of genes in coexpression network. Then, we designed two metrics to measure the value of gene differential coexpression according to the change of local topological structures between different phase-specific networks. Finally, we conducted meta-analysis of gene differential coexpression based on the rank-product method. Experimental results demonstrated the feasibility and effectiveness of DCGN and the superior performance of DCGN over other popular disease-related gene selection methods through real-world gene expression data sets. PMID:28042568

  17. Genes and social behavior.


    Robinson, Gene E; Fernald, Russell D; Clayton, David F


    What genes and regulatory sequences contribute to the organization and functioning of neural circuits and molecular pathways in the brain that support social behavior? How does social experience interact with information in the genome to modulate brain activity? Here, we address these questions by highlighting progress that has been made in identifying and understanding two key "vectors of influence" that link genes, the brain, and social behavior: (i) Social information alters gene expression in the brain to influence behavior, and (ii) genetic variation influences brain function and social behavior. We also discuss how evolutionary changes in genomic elements influence social behavior and outline prospects for a systems biology of social behavior.

  18. Novel ISCR1-linked resistance genes found in multidrug-resistant Gram-negative bacteria in southern China.


    Wang, Fengping; Wu, Kuihai; Sun, Jingjing; Wang, Qian; Chen, Qing; Yu, Shouyi; Rui, Yongyu


    Non-duplicate multidrug-resistant (MDR) Gram-negative bacteria (n=1329) isolated from southern China between January 2008 and December 2009 were investigated for the presence of ISCR1 as well as characterisation of ISCR1-linked resistance genes. Of 433 ISCR1-positive strains, 151 appeared to carry ISCR1-linked resistance genes. Seven different ISCR1-linked resistance gene arrays were identified by restriction fragment length polymorphism (RFLP) and DNA sequencing analysis. Many of these arrays are reported in some species for the first time. A total of 12 genes, including a novel ABC transporter (GenBank accession no. GU944725), qnrA1, qnrB2, qnrB6, bla(DHA-1), ampR, bla(CTX-M-9), bla(PER-1), insB, sapA-like peptide transport periplasmic protein, putative glutathione S-transferase and short-chain dehydrogenase/reductase, were detected. This study was the first to employ PCR-RFLP using HinfI and RsaI to analyse ISCR1-linked genes. ISCR1 was widely disseminated among MDR Gram-negative bacteria and was in close association with quinolone resistance and β-lactamase genes (class A and class C) in southern China.

  19. Associations between polymorphisms in the antiviral TRIM genes and measles vaccine immunity.


    Ovsyannikova, Inna G; Haralambieva, Iana H; Vierkant, Robert A; O'Byrne, Megan M; Poland, Gregory A


    The role of polymorphisms within the antiviral tripartite motif (TRIM) genes in measles vaccine adaptive immune responses was examined. A limited association was found between TRIM5 (rs7122620) and TRIM25 (rs205499) gene polymorphisms and measles-specific antibody levels. However, many associations were found between TRIM gene SNPs and variations in cellular responses (IFN-γ Elispot and secreted cytokines IL-2, IL-6, IL-10, IFN-γ, and TNF-α). TRIM22 rs2291841 was significantly associated with an increased IFN-γ Elispot response (35 vs. 102 SFC per 2×10(5)PBMC, p=0.009, q=0.71) in Caucasians. A non-synonymous TRIM25 rs205498 (in LD with other SNPs, r(2)≥0.56), as well as the TRIM25 AAAGGAAAGGAGT haplotype, was associated with a decreased IFN-γ Elispot response (t-statistic -2.32, p=0.02) in African-Americans. We also identified polymorphisms in the TRIM5, TRIM22, and TRIM25 genes that were associated with significant differences in cytokine responses. Additional studies are necessary to replicate our findings and to examine the functional consequences of these associations.

  20. "Bad genes" & criminal responsibility.


    González-Tapia, María Isabel; Obsuth, Ingrid


    The genetics of the accused is trying to break into the courts. To date several candidate genes have been put forward and their links to antisocial behavior have been examined and documented with some consistency. In this paper, we focus on the so called "warrior gene", or the low-activity allele of the MAOA gene, which has been most consistently related to human behavior and specifically to violence and antisocial behavior. In preparing this paper we had two objectives. First, to summarize and analyze the current scientific evidence, in order to gain an in depth understanding of the state of the issue and determine whether a dominant line of generally accepted scientific knowledge in this field can be asserted. Second, to derive conclusions and put forward recommendations related to the use of genetic information, specifically the presence of the low-activity genotype of the MAOA gene, in modulation of criminal responsibility in European and US courts.

  1. Genes underlying altruism.


    Thompson, Graham J; Hurd, Peter L; Crespi, Bernard J


    William D. Hamilton postulated the existence of 'genes underlying altruism', under the rubric of inclusive fitness theory, a half-century ago. Such genes are now poised for discovery. In this article, we develop a set of intuitive criteria for the recognition and analysis of genes for altruism and describe the first candidate genes affecting altruism from social insects and humans. We also provide evidence from a human population for genetically based trade-offs, underlain by oxytocin-system polymorphisms, between alleles for altruism and alleles for non-social cognition. Such trade-offs between self-oriented and altruistic behaviour may influence the evolution of phenotypic diversity across all social animals.

  2. Clock genes and sleep.


    Landgraf, Dominic; Shostak, Anton; Oster, Henrik


    In most species--from cyanobacteria to humans--endogenous clocks have evolved that drive 24-h rhythms of behavior and physiology. In mammals, these circadian rhythms are regulated by a hierarchical network of cellular oscillators controlled by a set of clock genes organized in a system of interlocked transcriptional feedback loops. One of the most prominent outputs of the circadian system is the synchronization of the sleep-wake cycle with external (day-) time. Clock genes also have a strong impact on many other biological functions, such as memory formation, energy metabolism, and immunity. Remarkably, large overlaps exist between clock gene and sleep (loss) mediated effects on these processes. This review summarizes sleep clock gene interactions for these three phenomena, highlighting potential mediators linking sleep and/or clock function to physiological output in an attempt to better understand the complexity of diurnal adaptation and its consequences for health and disease.

  3. GeneLab

    NASA Technical Reports Server (NTRS)

    Berrios, Daniel C.; Thompson, Terri G.


    NASA GeneLab is expected to capture and distribute omics data and experimental and process conditions most relevant to research community in their statistical and theoretical analysis of NASAs omics data.

  4. Evolutionary Fingerprinting of Genes

    PubMed Central

    Kosakovsky Pond, Sergei L.; Scheffler, Konrad; Gravenor, Michael B.; Poon, Art F.Y.; Frost, Simon D.W.


    Over time, natural selection molds every gene into a unique mosaic of sites evolving rapidly or resisting change—an “evolutionary fingerprint” of the gene. Aspects of this evolutionary fingerprint, such as the site-specific ratio of nonsynonymous to synonymous substitution rates (dN/dS), are commonly used to identify genetic features of potential biological interest; however, no framework exists for comparing evolutionary fingerprints between genes. We hypothesize that protein-coding genes with similar protein structure and/or function tend to have similar evolutionary fingerprints and that comparing evolutionary fingerprints can be useful for discovering similarities between genes in a way that is analogous to, but independent of, discovery of similarity via sequence-based comparison tools such as Blast. To test this hypothesis, we develop a novel model of coding sequence evolution that uses a general bivariate discrete parameterization of the evolutionary rates. We show that this approach provides a better fit to the data using a smaller number of parameters than existing models. Next, we use the model to represent evolutionary fingerprints as probability distributions and present a methodology for comparing these distributions in a way that is robust against variations in data set size and divergence. Finally, using sequences of three rapidly evolving RNA viruses (HIV-1, hepatitis C virus, and influenza A virus), we demonstrate that genes within the same functional group tend to have similar evolutionary fingerprints. Our framework provides a sound statistical foundation for efficient inference and comparison of evolutionary rate patterns in arbitrary collections of gene alignments, clustering homologous and nonhomologous genes, and investigation of biological and functional correlates of evolutionary rates. PMID:19864470

  5. Cystic fibrosis modifier genes.

    PubMed Central

    Davies, Jane; Alton, Eric; Griesenbach, Uta


    Since the recognition that CFTR genotype was not a good predictor of pulmonary disease severity in CF, several candidate modifier genes have been identified. It is unlikely that a single modifier gene will be found, but more probable that several haplotypes in combination may contribute, which in itself presents a major methodological challenge. The aims of such studies are to increase our understanding of disease pathogenesis, to aid prognosis and ultimately to lead to the development of novel treatments. PMID:16025767

  6. Evidence for homosexuality gene

    SciTech Connect

    Pool, R.


    A genetic analysis of 40 pairs of homosexual brothers has uncovered a region on the X chromosome that appears to contain a gene or genes for homosexuality. When analyzing the pedigrees of homosexual males, the researcheres found evidence that the trait has a higher likelihood of being passed through maternal genes. This led them to search the X chromosome for genes predisposing to homosexuality. The researchers examined the X chromosomes of pairs of homosexual brothers for regions of DNA that most or all had in common. Of the 40 sets of brothers, 33 shared a set of five markers in the q28 region of the long arm of the X chromosome. The linkage has a LOD score of 4.0, which translates into a 99.5% certainty that there is a gene or genes in this area that predispose males to homosexuality. The chief researcher warns, however, that this one site cannot explain all instances of homosexuality, since there were some cases where the trait seemed to be passed paternally. And even among those brothers where there was no evidence that the trait was passed paternally, seven sets of brothers did not share the Xq28 markers. It seems likely that homosexuality arises from a variety of causes.

  7. GeneClinics

    PubMed Central

    Tarczy-Hornoch, Peter; Shannon, Paul; Baskin, Patty; Espeseth, Miriam; Pagon, Roberta A.


    GeneClinics is an online genetic information resource consisting of descriptions of specific inherited disorders (“disease profiles”) as well as information on the role of genetic testing in the diagnosis, management, and genetic counseling of patients with these inherited conditions. GeneClinics is intended to promote the use of genetic services in medical care and personal decision making by providing health care practitioners and patients with information on genetic testing for specific inherited disorders. GeneClinics is implemented as an object-oriented database containing a combination of data and semistructured text that is rendered as HTML for publishing a given “disease profile” on the Web. Content is acquired from authors via templates, converted to an XML document reflecting the underlying database schema (with tagging of embedded data), and then loaded into the database and subjected to peer review. The initial implementation of a production system and the first phase of population of the GeneClinics database content are complete. Further expansion of the content to cover more disease, significant scaling up of rate of content creation, and evaluation redesign are under way. The ultimate goal is to have an entry in GeneClinics for each entry in the GeneTests directory of medical genetics laboratories—that is, for each disease for which clinical genetic testing is available. PMID:10833163

  8. Gene therapy for newborns.


    Kohn, D B; Parkman, R


    Application of gene therapy to treat genetic and infectious diseases may have several advantages if performed in newborns. Because of the minimal adverse effect of the underlying disease on cells of the newborn, the relatively small size of infants, and the large amount of future growth, gene therapy may be more successful in newborns than in older children or adults. The presence of umbilical cord blood from newborns provides a unique and susceptible target for the genetic modification of hematopoietic stem cells. In our first trial of gene therapy in newborns, we inserted a normal adenosine deaminase gene into umbilical cord blood cells of three neonates with a congenital immune deficiency. The trial demonstrated the successful transduction and engraftment of stem cells, which continue to contribute to leukocyte production more than 3 years later. A similar approach may be taken to insert genes that inhibit replication of HIV-1 into umbilical cord blood cells of HIV-1-infected neonates. Many other metabolic and infectious disorders could be treated by gene therapy during the neonatal period if prenatal diagnoses are made and the appropriate technical and regulatory requirements have been met.

  9. Direct gene transfer in the Gottingen minipig CNS using stereotaxic lentiviral microinjections.


    Norgaard Glud, Andreas; Hedegaard, Claus; Nielsen, Mette Slot; Sørensen, Jens Christian; Bendixen, Christian; Jensen, Poul Henning; Larsen, Knud; Bjarkam, Carsten Reidies


    We aim to induce direct viral mediated gene transfer in the substantia nigra (SN) of the Gottingen minipig using MRI guided stereotaxic injections of lentiviral vectors encoding enhanced green fluorescent protein (EGFP). Nine female Gottingen minipigs were injected unilaterally into the SN with 6 per 2.5 microliters lentivirus capable of transducing cells and mediating expression of recombinant EGFP. The animals were euthanized after four (n=3) or twenty weeks (n=6). Fresh brain tissue from three animals was used for PCR. The remaining six brains were cryo- or paraffin-sectioned for fluorescence, Nissl-, and immunohistochemical EGFP visualization. EGFP was seen in nigral neurons, axons, glial cells, endothelial cells, and in nigral fibers targeting the striatum. PCR-based detection confirmed the presence of the transgene in SN, whereas all other examined brain areas were negative, indicating that the immunohistochemically detected EGFP in the striatum derived from transfected nigral cells.

  10. Gene indexing: characterization and analysis of NLM's GeneRIFs.


    Mitchell, Joyce A; Aronson, Alan R; Mork, James G; Folk, Lillian C; Humphrey, Susanne M; Ward, Janice M


    We present an initial analysis of the National Library of Medicine's (NLM) Gene Indexing initiative. Gene Indexing occurs at the time of indexing for all 4600 journals and over 500,000 articles added to PubMed/MEDLINE each year. Gene Indexing links articles about the basic biology of a gene or protein within eight model organisms to a specific record in the NLM's LocusLink database of gene products. The result is an entry called a Gene Reference Into Function (GeneRIF) within the LocusLink database. We analyzed the numbers of GeneRIFs produced in the first year of GeneRIF production. 27,645 GeneRIFs were produced, pertaining to 9126 loci over eight model organisms. 60% of these were associated with human genes and 27% with mouse genes. About 80% discuss genes with an established MeSH Heading or other MeSH term. We developed a prototype functional alerting system for researchers based on the GeneRIFs, and a strategy to find all of the literature related to genes. We conclude that the Gene Indexing initiative adds considerable value to the life sciences research community.

  11. Harnessing gene expression networks to prioritize candidate epileptic encephalopathy genes.


    Oliver, Karen L; Lukic, Vesna; Thorne, Natalie P; Berkovic, Samuel F; Scheffer, Ingrid E; Bahlo, Melanie


    We apply a novel gene expression network analysis to a cohort of 182 recently reported candidate Epileptic Encephalopathy genes to identify those most likely to be true Epileptic Encephalopathy genes. These candidate genes were identified as having single variants of likely pathogenic significance discovered in a large-scale massively parallel sequencing study. Candidate Epileptic Encephalopathy genes were prioritized according to their co-expression with 29 known Epileptic Encephalopathy genes. We utilized developing brain and adult brain gene expression data from the Allen Human Brain Atlas (AHBA) and compared this to data from Celsius: a large, heterogeneous gene expression data warehouse. We show replicable prioritization results using these three independent gene expression resources, two of which are brain-specific, with small sample size, and the third derived from a heterogeneous collection of tissues with large sample size. Of the nineteen genes that we predicted with the highest likelihood to be true Epileptic Encephalopathy genes, two (GNAO1 and GRIN2B) have recently been independently reported and confirmed. We compare our results to those produced by an established in silico prioritization approach called Endeavour, and finally present gene expression networks for the known and candidate Epileptic Encephalopathy genes. This highlights sub-networks of gene expression, particularly in the network derived from the adult AHBA gene expression dataset. These networks give clues to the likely biological interactions between Epileptic Encephalopathy genes, potentially highlighting underlying mechanisms and avenues for therapeutic targets.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  13. Classification of genes based on gene expression analysis

    SciTech Connect

    Angelova, M. Myers, C. Faith, J.


    Systems biology and bioinformatics are now major fields for productive research. DNA microarrays and other array technologies and genome sequencing have advanced to the point that it is now possible to monitor gene expression on a genomic scale. Gene expression analysis is discussed and some important clustering techniques are considered. The patterns identified in the data suggest similarities in the gene behavior, which provides useful information for the gene functionalities. We discuss measures for investigating the homogeneity of gene expression data in order to optimize the clustering process. We contribute to the knowledge of functional roles and regulation of E. coli genes by proposing a classification of these genes based on consistently correlated genes in expression data and similarities of gene expression patterns. A new visualization tool for targeted projection pursuit and dimensionality reduction of gene expression data is demonstrated.

  14. Circadian rhythms in Mexican blind cavefish Astyanax mexicanus in the lab and in the field.


    Beale, Andrew; Guibal, Christophe; Tamai, T Katherine; Klotz, Linda; Cowen, Sophie; Peyric, Elodie; Reynoso, Víctor H; Yamamoto, Yoshiyuki; Whitmore, David


    Biological clocks have evolved as an adaptation to life on a rhythmic planet, synchronising physiological processes to the environmental light-dark cycle. Here we examine circadian clock function in Mexican blind cavefish Astyanax mexicanus and its surface counterpart. In the lab, adult surface fish show robust circadian rhythms in per1, which are retained in cave populations, but with substantial alterations. These changes may be due to increased levels of light-inducible genes in cavefish, including clock repressor per2. From a molecular standpoint, cavefish appear as if they experience 'constant light' rather than perpetual darkness. Micos River samples show similar per1 oscillations to those in the lab. However, data from Chica Cave shows complete repression of clock function, while expression of several light-responsive genes is raised, including DNA repair genes. We propose that altered expression of light-inducible genes provides a selective advantage to cavefish at the expense of a damped circadian oscillator.

  15. GeneCards Version 3: the human gene integrator.


    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron


    GeneCards ( is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73,000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards' unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene's functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite. Database

  16. Neighboring Genes Show Correlated Evolution in Gene Expression.


    Ghanbarian, Avazeh T; Hurst, Laurence D


    When considering the evolution of a gene's expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking.

  17. Hox genes and evolution.


    Hrycaj, Steven M; Wellik, Deneen M


    Hox proteins are a deeply conserved group of transcription factors originally defined for their critical roles in governing segmental identity along the antero-posterior (AP) axis in Drosophila. Over the last 30 years, numerous data generated in evolutionarily diverse taxa have clearly shown that changes in the expression patterns of these genes are closely associated with the regionalization of the AP axis, suggesting that Hox genes have played a critical role in the evolution of novel body plans within Bilateria. Despite this deep functional conservation and the importance of these genes in AP patterning, key questions remain regarding many aspects of Hox biology. In this commentary, we highlight recent reports that have provided novel insight into the origins of the mammalian Hox cluster, the role of Hox genes in the generation of a limbless body plan, and a novel putative mechanism in which Hox genes may encode specificity along the AP axis. Although the data discussed here offer a fresh perspective, it is clear that there is still much to learn about Hox biology and the roles it has played in the evolution of the Bilaterian body plan.

  18. Selenoprotein Gene Nomenclature.


    Gladyshev, Vadim N; Arnér, Elias S; Berry, Marla J; Brigelius-Flohé, Regina; Bruford, Elspeth A; Burk, Raymond F; Carlson, Bradley A; Castellano, Sergi; Chavatte, Laurent; Conrad, Marcus; Copeland, Paul R; Diamond, Alan M; Driscoll, Donna M; Ferreiro, Ana; Flohé, Leopold; Green, Fiona R; Guigó, Roderic; Handy, Diane E; Hatfield, Dolph L; Hesketh, John; Hoffmann, Peter R; Holmgren, Arne; Hondal, Robert J; Howard, Michael T; Huang, Kaixun; Kim, Hwa-Young; Kim, Ick Young; Köhrle, Josef; Krol, Alain; Kryukov, Gregory V; Lee, Byeong Jae; Lee, Byung Cheon; Lei, Xin Gen; Liu, Qiong; Lescure, Alain; Lobanov, Alexei V; Loscalzo, Joseph; Maiorino, Matilde; Mariotti, Marco; Sandeep Prabhu, K; Rayman, Margaret P; Rozovsky, Sharon; Salinas, Gustavo; Schmidt, Edward E; Schomburg, Lutz; Schweizer, Ulrich; Simonović, Miljan; Sunde, Roger A; Tsuji, Petra A; Tweedie, Susan; Ursini, Fulvio; Whanger, Philip D; Zhang, Yan


    The human genome contains 25 genes coding for selenocysteine-containing proteins (selenoproteins). These proteins are involved in a variety of functions, most notably redox homeostasis. Selenoprotein enzymes with known functions are designated according to these functions: TXNRD1, TXNRD2, and TXNRD3 (thioredoxin reductases), GPX1, GPX2, GPX3, GPX4, and GPX6 (glutathione peroxidases), DIO1, DIO2, and DIO3 (iodothyronine deiodinases), MSRB1 (methionine sulfoxide reductase B1), and SEPHS2 (selenophosphate synthetase 2). Selenoproteins without known functions have traditionally been denoted by SEL or SEP symbols. However, these symbols are sometimes ambiguous and conflict with the approved nomenclature for several other genes. Therefore, there is a need to implement a rational and coherent nomenclature system for selenoprotein-encoding genes. Our solution is to use the root symbol SELENO followed by a letter. This nomenclature applies to SELENOF (selenoprotein F, the 15-kDa selenoprotein, SEP15), SELENOH (selenoprotein H, SELH, C11orf31), SELENOI (selenoprotein I, SELI, EPT1), SELENOK (selenoprotein K, SELK), SELENOM (selenoprotein M, SELM), SELENON (selenoprotein N, SEPN1, SELN), SELENOO (selenoprotein O, SELO), SELENOP (selenoprotein P, SeP, SEPP1, SELP), SELENOS (selenoprotein S, SELS, SEPS1, VIMP), SELENOT (selenoprotein T, SELT), SELENOV (selenoprotein V, SELV), and SELENOW (selenoprotein W, SELW, SEPW1). This system, approved by the HUGO Gene Nomenclature Committee, also resolves conflicting, missing, and ambiguous designations for selenoprotein genes and is applicable to selenoproteins across vertebrates.

  19. Engineered Gene Circuits

    NASA Astrophysics Data System (ADS)

    Hasty, Jeff


    Uncovering the structure and function of gene regulatory networks has become one of the central challenges of the post-genomic era. Theoretical models of protein-DNA feedback loops and gene regulatory networks have long been proposed, and recently, certain qualitative features of such models have been experimentally corroborated. This talk will focus on model and experimental results that demonstrate how a naturally occurring gene network can be used as a ``parts list'' for synthetic network design. The model formulation leads to computational and analytical approaches relevant to nonlinear dynamics and statistical physics, and the utility of such a formulation will be demonstrated through the consideration of specific design criteria for several novel genetic devices. Fluctuations originating from small molecule-number effects will be discussed in the context of model predictions, and the experimental validation of these stochastic effects underscores the importance of internal noise in gene expression. Potential biotech applications will be highlighted within the framework of cellular control schemes. Specifically, the coupling of an oscillating cellular process to a synthetic oscillator will be considered, and the resulting model behavior will be analyzed in the context of synchronization. The underlying methodology highlights the utility of engineering-based methods in the design of synthetic gene regulatory networks.

  20. Hox genes and evolution

    PubMed Central

    Hrycaj, Steven M.; Wellik, Deneen M.


    Hox proteins are a deeply conserved group of transcription factors originally defined for their critical roles in governing segmental identity along the antero-posterior (AP) axis in Drosophila. Over the last 30 years, numerous data generated in evolutionarily diverse taxa have clearly shown that changes in the expression patterns of these genes are closely associated with the regionalization of the AP axis, suggesting that Hox genes have played a critical role in the evolution of novel body plans within Bilateria. Despite this deep functional conservation and the importance of these genes in AP patterning, key questions remain regarding many aspects of Hox biology. In this commentary, we highlight recent reports that have provided novel insight into the origins of the mammalian Hox cluster, the role of Hox genes in the generation of a limbless body plan, and a novel putative mechanism in which Hox genes may encode specificity along the AP axis. Although the data discussed here offer a fresh perspective, it is clear that there is still much to learn about Hox biology and the roles it has played in the evolution of the Bilaterian body plan. PMID:27239281

  1. Gene therapy prospects--intranasal delivery of therapeutic genes.


    Podolska, Karolina; Stachurska, Anna; Hajdukiewicz, Karolina; Małecki, Maciej


    Gene therapy is recognized to be a novel method for the treatment of various disorders. Gene therapy strategies involve gene manipulation on broad biological processes responsible for the spreading of diseases. Cancer, monogenic diseases, vascular and infectious diseases are the main targets of gene therapy. In order to obtain valuable experimental and clinical results, sufficient gene transfer methods are required. Therapeutic genes can be administered into target tissues via gene carriers commonly defined as vectors. The retroviral, adenoviral and adeno-associated virus based vectors are most frequently used in the clinic. So far, gene preparations may be administered directly into target organs or by intravenous, intramuscular, intratumor or intranasal injections. It is common knowledge that the number of gene therapy clinical trials has rapidly increased. However, some limitations such as transfection efficiency and stable and long-term gene expression are still not resolved. Consequently, great effort is focused on the evaluation of new strategies of gene delivery. There are many expectations associated with intranasal delivery of gene preparations for the treatment of diseases. Intranasal delivery of therapeutic genes is regarded as one of the most promising forms of pulmonary gene therapy research. Gene therapy based on inhalation of gene preparations offers an alternative way for the treatment of patients suffering from such lung diseases as cystic fibrosis, alpha-1-antitrypsin defect, or cancer. Experimental and first clinical trials based on plasmid vectors or recombinant viruses have revealed that gene preparations can effectively deliver therapeutic or marker genes to the cells of the respiratory tract. The noninvasive intranasal delivery of gene preparations or conventional drugs seems to be very encouraging, although basic scientific research still has to continue.

  2. FunGene: the functional gene pipeline and repository

    PubMed Central

    Fish, Jordan A.; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C. Titus; Tiedje, James M.; Cole, James R.


    Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes. PMID:24101916

  3. Gene Therapy for Skin Diseases

    PubMed Central

    Gorell, Emily; Nguyen, Ngon; Lane, Alfred; Siprashvili, Zurab


    The skin possesses qualities that make it desirable for gene therapy, and studies have focused on gene therapy for multiple cutaneous diseases. Gene therapy uses a vector to introduce genetic material into cells to alter gene expression, negating a pathological process. This can be accomplished with a variety of viral vectors or nonviral administrations. Although results are promising, there are several potential pitfalls that must be addressed to improve the safety profile to make gene therapy widely available clinically. PMID:24692191

  4. Orexin signaling regulates both the hippocampal clock and the circadian oscillation of Alzheimer’s disease-risk genes

    PubMed Central

    Ma, Zhixiong; Jiang, Weiliang; Zhang, Eric Erquan


    Alzheimer’s disease (AD) is a circadian clock-related disease. However, it is not very clear whether pre-symptomatic AD leads to circadian disruption or whether malfunction of circadian rhythms exerts influence on development of AD. Here, we report a functional clock that exists in the hippocampus. This oscillator both receives input signals and maintains the cycling of the hippocampal Per2 gene. One of the potential inputs to the oscillator is orexin signaling, which can shorten the hippocampal clock period and thereby regulate the expression of clock-controlled-genes (CCGs). A 24-h time course qPCR analysis followed by a JTK_CYCLE algorithm analysis indicated that a number of AD-risk genes are potential CCGs in the hippocampus. Specifically, we found that Bace1 and Bace2, which are related to the production of the amyloid-beta peptide, are CCGs. BACE1 is inhibited by E4BP4, a repressor of D-box genes, while BACE2 is activated by CLOCK:BMAL1. Finally, we observed alterations in the rhythmic expression patterns of Bace2 and ApoE in the hippocampus of aged APP/PS1dE9 mice. Our results therefore indicate that there is a circadian oscillator in the hippocampus whose oscillation could be regulated by orexins. Hence, orexin signaling regulates both the hippocampal clock and the circadian oscillation of AD-risk genes. PMID:27796320

  5. Orexin signaling regulates both the hippocampal clock and the circadian oscillation of Alzheimer's disease-risk genes.


    Ma, Zhixiong; Jiang, Weiliang; Zhang, Eric Erquan


    Alzheimer's disease (AD) is a circadian clock-related disease. However, it is not very clear whether pre-symptomatic AD leads to circadian disruption or whether malfunction of circadian rhythms exerts influence on development of AD. Here, we report a functional clock that exists in the hippocampus. This oscillator both receives input signals and maintains the cycling of the hippocampal Per2 gene. One of the potential inputs to the oscillator is orexin signaling, which can shorten the hippocampal clock period and thereby regulate the expression of clock-controlled-genes (CCGs). A 24-h time course qPCR analysis followed by a JTK_CYCLE algorithm analysis indicated that a number of AD-risk genes are potential CCGs in the hippocampus. Specifically, we found that Bace1 and Bace2, which are related to the production of the amyloid-beta peptide, are CCGs. BACE1 is inhibited by E4BP4, a repressor of D-box genes, while BACE2 is activated by CLOCK:BMAL1. Finally, we observed alterations in the rhythmic expression patterns of Bace2 and ApoE in the hippocampus of aged APP/PS1dE9 mice. Our results therefore indicate that there is a circadian oscillator in the hippocampus whose oscillation could be regulated by orexins. Hence, orexin signaling regulates both the hippocampal clock and the circadian oscillation of AD-risk genes.

  6. The in vitro maintenance of clock genes expression within the rat pineal gland under standard and norepinephrine-synchronized stimulation.


    Andrade-Silva, Jéssica; Cipolla-Neto, José; Peliciari-Garcia, Rodrigo A


    Although the norepinephrine (NE) synchronization protocol was proved to be an important procedure for further modulating in vitro pineal melatonin synthesis, the maintenance of clock genes under the same conditions remained to be investigated. The aim of this study was to investigate the maintenance of the clock genes expression in pineal gland cultures under standard and NE-synchronized stimulation. The glands were separated into three experimental groups: Control, Standard (acute NE-stimulation), and NE-synchronized. The expression of Bmal1, Per2, Cry2, Rev-erbα, the clock controlled gene Dbp and Arylalkylamine-N-acetyltransferase were investigated, as well as melatonin content. No oscillations were observed in the expression of the investigated genes from the control group. Under Standard NE stimulation, the clock genes did not exhibit a rhythmic pattern of expression. However, in the NE-synchronized condition, a rhythmic expression pattern was observed in all cases. An enhancement in pineal gland responsiveness to NE stimulation, reflected in an advanced synthesis of melatonin was also observed. Our results reinforce our previous hypothesis that NE synchronization of pineal gland culture mimics the natural rhythmic release of NE in the gland, increasing melatonin synthesis and keeping the pineal circadian clock synchronized, ensuring the fine adjustments that are relied in the clockwork machinery.

  7. Characterizing gene family evolution

    PubMed Central

    Liberles, David A.


    Gene families are widely used in comparative genomics, molecular evolution, and in systematics. However, they are constructed in different manners, their data analyzed and interpreted differently, with different underlying assumptions, leading to sometimes divergent conclusions. In systematics, concepts like monophyly and the dichotomy between homoplasy and homology have been central to the analysis of phylogenies. We critique the traditional use of such concepts as applied to gene families and give examples of incorrect inferences they may lead to. Operational definitions that have emerged within functional genomics are contrasted with the common formal definitions derived from systematics. Lastly, we question the utility of layers of homology and the meaning of homology at the character state level in the context of sequence evolution. From this, we move forward to present an idealized strategy for characterizing gene family evolution for both systematic and functional purposes, including recent methodological improvements. PMID:19461954

  8. Alphaviruses in Gene Therapy

    PubMed Central

    Lundstrom, Kenneth


    Alphavirus vectors present an attractive approach for gene therapy applications due to the rapid and simple recombinant virus particle production and their broad range of mammalian host cell transduction. Mainly three types of alphavirus vectors, namely naked RNA, recombinant particles and DNA/RNA layered vectors, have been subjected to preclinical studies with the goal of achieving prophylactic or therapeutic efficacy, particularly in oncology. In this context, immunization with alphavirus vectors has provided protection against challenges with tumor cells. Moreover, alphavirus intratumoral and systemic delivery has demonstrated substantial tumor regression and significant prolonged survival rates in various animal tumor models. Recent discoveries of the strong association of RNA interference and disease have accelerated gene therapy based approaches, where alphavirus-based gene delivery can play an important role. PMID:25961488

  9. Functional analysis of autophagy genes via Agrobacterium-mediated transformation in the vascular Wilt fungus Verticillium dahliae.


    Zhou, Lei; Zhao, Jun; Guo, Wangzhen; Zhang, Tianzhen


    Autophagy is a widely conserved intracellular process for degradation and recycling of proteins, organelles and cytoplasm in eukaryotic organisms and is now emerging as an important process in foliar infection by many plant pathogenic fungi. However, the role of autophagy in soil-borne fungal physiology and infection biology is poorly understood. Here, we report the establishment of an Agrobacterium tumefaciens-mediated transformation (ATMT) system and its application to investigate two autophagy genes, VdATG8 and VdATG12, by means of targeted gene replacement and complementation. Transformation of a cotton-infecting Verticillium dahliae strain Vd8 with a novel binary vector pCOM led to the production of 384 geneticin-resistant transformants per 1 × 10(6) conidia. V. dahliae mutants lacking either VdATG8 or VdATG12 exhibited reduced conidiation and impaired aerial hyphae production. Disease development on Arabidopsis plants was slightly delayed when inoculated with VdATG8 or VdATG12 gene deletion mutants, compared with the wild-type and gene complemented strains. Surprisingly, in vitro inoculation with unimpaired roots revealed that the abilities of root invasion were not affected in gene deletion mutants. These results indicate that autophagy is necessary for aerial hyphae development and plant colonization but not for root infection in V. dahliae.

  10. Influence of simulated microgravity on clock genes expression rhythmicity and underlying blood circulating miRNAs-mRNA co-expression regulatory mechanism in C57BL/6J mice

    NASA Astrophysics Data System (ADS)

    Lv, Ke; Qu, Lina

    were consecutively performed. Blood samples and liver tissues were collected from tail-suspended and control mice under LD 12:12h and DD conditions during the 12th, 13th and 14th testing days at 4h intervals. Melatonin and corticosterone in mice plasma at different time points were assayed. NIH-3T3 cells were plated in culture dish for 22h before the experiment. For ground-based simulation of weightlessness, the medium was exchanged with DMEM containing 50% horse serum to synchronization, after 2 h, this medium was replaced with DMEM and 10% FBS. Then, at various time point (0, 6, 12, 18, 24, 30, 36, 42, 48h), cells were cultured on the roating clinostat at 30r/min. Total RNA was extracted from liver and NIH-3T3 cells and subsequently reverse-transcribed. The SYBR green I real-time quantitative PCR system was conducted to examine the mRNA expression level of clock, bmal1, per1, per2, cry1 and cry2 in mice and NIH-3T3 cells, respectively. Paired comparisons of the circadian genes expression between period, peak values, amplitude and mesor (midline estimating statistic of rhythm) were examined for evidence of circadian variation using Chronos-Fit software in mice and Cosine analyses in NIH-3T3 cells. Statistical analysis: All numerical data were expressed as the mean ± standard deviation (SD). Statistical differences among groups were analyzed by one-way analysis of variance (ANOVA) to determine time points differences in the study parameters. Statistical differences between two groups were determined by the Student's t test. Results: (1) Circadian rhythm of clock and bmal1 mRNA expression was found in each testing day with similar peak phase in both tail suspension group and control group. Compared with control group, tail suspension group showed that the peak phase of clock gene mRNA level advanced approximately 4 hours and the amplitude of bmal1 gene mRNA level significantly reduced at ZT2 and ZT6. (2) The expression of circadian genes in NIH-3T3 cells demonstrated

  11. Dissecting Daily and Circadian Expression Rhythms of Clock-Controlled Genes in Human Blood.


    Lech, Karolina; Ackermann, Katrin; Revell, Victoria L; Lao, Oscar; Skene, Debra J; Kayser, Manfred


    The identification and investigation of novel clock-controlled genes (CCGs) has been conducted thus far mainly in model organisms such as nocturnal rodents, with limited information in humans. Here, we aimed to characterize daily and circadian expression rhythms of CCGs in human peripheral blood during a sleep/sleep deprivation (S/SD) study and a constant routine (CR) study. Blood expression levels of 9 candidate CCGs (SREBF1, TRIB1, USF1, THRA1, SIRT1, STAT3, CAPRIN1, MKNK2, and ROCK2), were measured across 48 h in 12 participants in the S/SD study and across 33 h in 12 participants in the CR study. Statistically significant rhythms in expression were observed for STAT3, SREBF1, TRIB1, and THRA1 in samples from both the S/SD and the CR studies, indicating that their rhythmicity is driven by the endogenous clock. The MKNK2 gene was significantly rhythmic in the S/SD but not the CR study, which implies its exogenously driven rhythmic expression. In addition, we confirmed the circadian expression of PER1, PER3, and REV-ERBα in the CR study samples, while BMAL1 and HSPA1B were not significantly rhythmic in the CR samples; all 5 genes previously showed significant expression in the S/SD study samples. Overall, our results demonstrate that rhythmic expression patterns of clock and selected clock-controlled genes in human blood cells are in part determined by exogenous factors (sleep and fasting state) and in part by the endogenous circadian timing system. Knowledge of the exogenous and endogenous regulation of gene expression rhythms is needed prior to the selection of potential candidate marker genes for future applications in medical and forensic settings.

  12. Virus induced gene silencing of Arabidopsis gene homologues in wheat identify genes conferring improved drought tolerance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a non-model staple crop like wheat, functional validation of potential drought stress responsive genes identified in Arabidopsis could provide gene targets for wheat breeding. Virus induced gene silencing (VIGS) of genes of interest can overcome the inherent problems of polyploidy and limited tra...

  13. GeneTIER: prioritization of candidate disease genes using tissue-specific gene expression profiles

    PubMed Central

    Antanaviciute, Agne; Daly, Catherine; Crinnion, Laura A.; Markham, Alexander F.; Watson, Christopher M.; Bonthron, David T.; Carr, Ian M.


    Motivation: In attempts to determine the genetic causes of human disease, researchers are often faced with a large number of candidate genes. Linkage studies can point to a genomic region containing hundreds of genes, while the high-throughput sequencing approach will often identify a great number of non-synonymous genetic variants. Since systematic experimental verification of each such candidate gene is not feasible, a method is needed to decide which genes are worth investigating further. Computational gene prioritization presents itself as a solution to this problem, systematically analyzing and sorting each gene from the most to least likely to be the disease-causing gene, in a fraction of the time it would take a researcher to perform such queries manually. Results: Here, we present Gene TIssue Expression Ranker (GeneTIER), a new web-based application for candidate gene prioritization. GeneTIER replaces knowledge-based inference traditionally used in candidate disease gene prioritization applications with experimental data from tissue-specific gene expression datasets and thus largely overcomes the bias toward the better characterized genes/diseases that commonly afflict other methods. We show that our approach is capable of accurate candidate gene prioritization and illustrate its strengths and weaknesses using case study examples. Availability and Implementation: Freely available on the web at Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25861967

  14. Genes and functions controlled by floral organ identity genes.


    Sablowski, Robert


    Floral organ identity genes specify the identity of floral organs in a manner analogous to the specification of body segments by Hox genes in animals. Different combinations of organ identity genes co-ordinate the expression of genes required for the development of each type of floral organ, from organ initiation until final differentiation. Here, I review what is known about the genes and functions subordinate to the organ identity genes. The sets of target genes change as organ development progresses and ultimately organ identity genes modify the expression of thousands of genes with a multitude of predicted functions, particularly in reproductive organs. However, genes involved in transcriptional control and hormone functions feature prominently among the early and direct targets. Functional analysis showed that control of organ-specific tissues and structures can be delegated to specialised intermediate regulators, but organ identity genes also fine-tune genes with general roles in shoot organ development, consistent with the notion that organ identity genes modify a core leaf-like developmental program. Future challenges include obtaining data with cellular resolution, predictive modelling of the regulatory network, and quantitative analysis of how organ identity genes and their targets control cell behaviour and ultimately organ shape.

  15. Gene Therapy and Children (For Parents)


    ... Old Feeding Your 1- to 2-Year-Old Gene Therapy and Children KidsHealth > For Parents > Gene Therapy and ... by a "bad" gene. continue Two Types of Gene Therapy The two forms of gene therapy are: Somatic ...

  16. The gene tree delusion.


    Springer, Mark S; Gatesy, John


    Higher-level relationships among placental mammals are mostly resolved, but several polytomies remain contentious. Song et al. (2012) claimed to have resolved three of these using shortcut coalescence methods (MP-EST, STAR) and further concluded that these methods, which assume no within-locus recombination, are required to unravel deep-level phylogenetic problems that have stymied concatenation. Here, we reanalyze Song et al.'s (2012) data and leverage these re-analyses to explore key issues in systematics including the recombination ratchet, gene tree stoichiometry, the proportion of gene tree incongruence that results from deep coalescence versus other factors, and simulations that compare the performance of coalescence and concatenation methods in species tree estimation. Song et al. (2012) reported an average locus length of 3.1 kb for the 447 protein-coding genes in their phylogenomic dataset, but the true mean length of these loci (start codon to stop codon) is 139.6 kb. Empirical estimates of recombination breakpoints in primates, coupled with consideration of the recombination ratchet, suggest that individual coalescence genes (c-genes) approach ∼12 bp or less for Song et al.'s (2012) dataset, three to four orders of magnitude shorter than the c-genes reported by these authors. This result has general implications for the application of coalescence methods in species tree estimation. We contend that it is illogical to apply coalescence methods to complete protein-coding sequences. Such analyses amalgamate c-genes with different evolutionary histories (i.e., exons separated by >100,000 bp), distort true gene tree stoichiometry that is required for accurate species tree inference, and contradict the central rationale for applying coalescence methods to difficult phylogenetic problems. In addition, Song et al.'s (2012) dataset of 447 genes includes 21 loci with switched taxonomic names, eight duplicated loci, 26 loci with non-homologous sequences that are

  17. Genes and Vocal Learning

    PubMed Central

    White, Stephanie A.


    Could a mutation in a single gene be the evolutionary lynchpin supporting the development of human language? A rare mutation in the molecule known as FOXP2 discovered in a human family seemed to suggest so, and its sequence phylogeny reinforced a Chomskian view that language emerged wholesale in humans. Spurred by this discovery, research in primates, rodents and birds suggests that FoxP2 and other language-related genes are interactors in the neuromolecular networks that underlie subsystems of language, such symbolic understanding, vocal learning and theory of mind. The whole picture will only come together through comparative and integrative study into how the human language singularity evolved. PMID:19913899

  18. A tunable artificial circadian clock in clock-defective mice

    PubMed Central

    D'Alessandro, Matthew; Beesley, Stephen; Kim, Jae Kyoung; Chen, Rongmin; Abich, Estela; Cheng, Wayne; Yi, Paul; Takahashi, Joseph S.; Lee, Choogon


    Self-sustaining oscillations are essential for diverse physiological functions such as the cell cycle, insulin secretion and circadian rhythms. Synthetic oscillators using biochemical feedback circuits have been generated in cell culture. These synthetic systems provide important insight into design principles for biological oscillators, but have limited similarity to physiological pathways. Here we report the generation of an artificial, mammalian circadian clock in vivo, capable of generating robust, tunable circadian rhythms. In mice deficient in Per1 and Per2 genes (thus lacking circadian rhythms), we artificially generate PER2 rhythms and restore circadian sleep/wake cycles with an inducible Per2 transgene. Our artificial clock is tunable as the period and phase of the rhythms can be modulated predictably. This feature, and other design principles of our work, might enhance the study and treatment of circadian dysfunction and broader aspects of physiology involving biological oscillators. PMID:26617050

  19. A Prader-Willi locus lncRNA cloud modulates diurnal genes and energy expenditure.


    Powell, Weston T; Coulson, Rochelle L; Crary, Florence K; Wong, Spencer S; Ach, Robert A; Tsang, Peter; Alice Yamada, N; Yasui, Dag H; Lasalle, Janine M


    Prader-Willi syndrome (PWS), a genetic disorder of obesity, intellectual disability and sleep abnormalities, is caused by loss of non-coding RNAs on paternal chromosome 15q11-q13. The imprinted minimal PWS locus encompasses a long non-coding RNA (lncRNA) transcript processed into multiple SNORD116 small nucleolar RNAs and the spliced exons of the host gene, 116HG. However, both the molecular function and the disease relevance of the spliced lncRNA 116HG are unknown. Here, we show that 116HG forms a subnuclear RNA cloud that co-purifies with the transcriptional activator RBBP5 and active metabolic genes, remains tethered to the site of its transcription and increases in size in post-natal neurons and during sleep. Snord116del mice lacking 116HG exhibited increased energy expenditure corresponding to the dysregulation of diurnally expressed Mtor and circadian genes Clock, Cry1 and Per2. These combined genomic and metabolic analyses demonstrate that 116HG regulates the diurnal energy expenditure of the brain. These novel molecular insights into the energy imbalance in PWS should lead to improved therapies and understanding of lncRNA roles in complex neurodevelopmental and metabolic disorders.

  20. Gene network biological validity based on gene-gene interaction relevance.


    Gómez-Vela, Francisco; Díaz-Díaz, Norberto


    In recent years, gene networks have become one of the most useful tools for modeling biological processes. Many inference gene network algorithms have been developed as techniques for extracting knowledge from gene expression data. Ensuring the reliability of the inferred gene relationships is a crucial task in any study in order to prove that the algorithms used are precise. Usually, this validation process can be carried out using prior biological knowledge. The metabolic pathways stored in KEGG are one of the most widely used knowledgeable sources for analyzing relationships between genes. This paper introduces a new methodology, GeneNetVal, to assess the biological validity of gene networks based on the relevance of the gene-gene interactions stored in KEGG metabolic pathways. Hence, a complete KEGG pathway conversion into a gene association network and a new matching distance based on gene-gene interaction relevance are proposed. The performance of GeneNetVal was established with three different experiments. Firstly, our proposal is tested in a comparative ROC analysis. Secondly, a randomness study is presented to show the behavior of GeneNetVal when the noise is increased in the input network. Finally, the ability of GeneNetVal to detect biological functionality of the network is shown.

  1. Gene therapy in pancreatic cancer.


    Liu, Si-Xue; Xia, Zhong-Sheng; Zhong, Ying-Qiang


    Pancreatic cancer (PC) is a highly lethal disease and notoriously difficult to treat. Only a small proportion of PC patients are eligible for surgical resection, whilst conventional chemoradiotherapy only has a modest effect with substantial toxicity. Gene therapy has become a new widely investigated therapeutic approach for PC. This article reviews the basic rationale, gene delivery methods, therapeutic targets and developments of laboratory research and clinical trials in gene therapy of PC by searching the literature published in English using the PubMed database and analyzing clinical trials registered on the Gene Therapy Clinical Trials Worldwide website (http://www. clinical). Viral vectors are main gene delivery tools in gene therapy of cancer, and especially, oncolytic virus shows brighter prospect due to its tumor-targeting property. Efficient therapeutic targets for gene therapy include tumor suppressor gene p53, mutant oncogene K-ras, anti-angiogenesis gene VEGFR, suicide gene HSK-TK, cytosine deaminase and cytochrome p450, multiple cytokine genes and so on. Combining different targets or combination strategies with traditional chemoradiotherapy may be a more effective approach to improve the efficacy of cancer gene therapy. Cancer gene therapy is not yet applied in clinical practice, but basic and clinical studies have demonstrated its safety and clinical benefits. Gene therapy will be a new and promising field for the treatment of PC.

  2. Lateral gene transfer, rearrangement, reconciliation

    PubMed Central


    Background Models of ancestral gene order reconstruction have progressively integrated different evolutionary patterns and processes such as unequal gene content, gene duplications, and implicitly sequence evolution via reconciled gene trees. These models have so far ignored lateral gene transfer, even though in unicellular organisms it can have an important confounding effect, and can be a rich source of information on the function of genes through the detection of transfers of clusters of genes. Result We report an algorithm together with its implementation, DeCoLT, that reconstructs ancestral genome organization based on reconciled gene trees which summarize information on sequence evolution, gene origination, duplication, loss, and lateral transfer. DeCoLT optimizes in polynomial time on the number of rearrangements, computed as the number of gains and breakages of adjacencies between pairs of genes. We apply DeCoLT to 1099 gene families from 36 cyanobacteria genomes. Conclusion DeCoLT is able to reconstruct adjacencies in 35 ancestral bacterial genomes with a thousand gene families in a few hours, and detects clusters of co-transferred genes. DeCoLT may also be used with any relationship between genes instead of adjacencies, to reconstruct ancestral interactions, functions or complexes. Availability PMID:24564205

  3. Genes and Vocal Learning

    ERIC Educational Resources Information Center

    White, Stephanie A.


    Could a mutation in a single gene be the evolutionary lynchpin supporting the development of human language? A rare mutation in the molecule known as FOXP2 discovered in a human family seemed to suggest so, and its sequence phylogeny reinforced a Chomskian view that language emerged wholesale in humans. Spurred by this discovery, research in…

  4. Gene stacking by recombinases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Efficient methods of stacking genes into plant genomes are needed to expedite transfer of multigenic traits into diverse crops grown in a variety of environments. Over two decades of research has identified several site-specific recombinases that carry out efficient cis and trans recombination betw...

  5. Genes in mammalian reproduction

    SciTech Connect

    Gwatkin, R.B.L.


    This is an informative book which deals mainly with genomic imprinting, the role of steroid hormones in development, the expression of a variety of genes during development and the link to hereditary diseases. It is an up-to-date review in a field that is quickly changing and provides valuable basic information and current research trends.

  6. Inferring Horizontal Gene Transfer

    PubMed Central

    Lassalle, Florent; Dessimoz, Christophe


    Horizontal or Lateral Gene Transfer (HGT or LGT) is the transmission of portions of genomic DNA between organisms through a process decoupled from vertical inheritance. In the presence of HGT events, different fragments of the genome are the result of different evolutionary histories. This can therefore complicate the investigations of evolutionary relatedness of lineages and species. Also, as HGT can bring into genomes radically different genotypes from distant lineages, or even new genes bearing new functions, it is a major source of phenotypic innovation and a mechanism of niche adaptation. For example, of particular relevance to human health is the lateral transfer of antibiotic resistance and pathogenicity determinants, leading to the emergence of pathogenic lineages [1]. Computational identification of HGT events relies upon the investigation of sequence composition or evolutionary history of genes. Sequence composition-based ("parametric") methods search for deviations from the genomic average, whereas evolutionary history-based ("phylogenetic") approaches identify genes whose evolutionary history significantly differs from that of the host species. The evaluation and benchmarking of HGT inference methods typically rely upon simulated genomes, for which the true history is known. On real data, different methods tend to infer different HGT events, and as a result it can be difficult to ascertain all but simple and clear-cut HGT events. PMID:26020646

  7. Naming genes beyond Caenorhabditis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The nomenclature of genes in Caenorhabditis elegans is based on long-standing, successful guidelines established in the late 1970s. Over time these guidelines have matured into a comprehensive, systematic nomenclature that is easy to apply, descriptive and therefore highly informative. Recently, a f...

  8. Gene-Environment Interdependence

    ERIC Educational Resources Information Center

    Rutter, Michael


    Behavioural genetics was initially concerned with partitioning population variance into that due to genetics and that due to environmental influences. The implication was that the two were separate and it was assumed that gene-environment interactions were usually of so little importance that they could safely be ignored. Theoretical…

  9. The outer atmospheres of cool M giants: High-dispersion ultraviolet spectra of Rho Per, 2 Cen, and g Her

    NASA Technical Reports Server (NTRS)

    Eaton, Joel A.; Johnson, Hollis R.


    Long duration IUE spectra were obtained to extend coverage of cool giants studied in the ultraviolet at high dispersion to M6. The chromospheric spectra of the three stars, which consist of a profusion of Fe II lines and a few lines of Mg II, Mg I, Al II, C II, C I, Cr II, and Fe I, are remarkably similar, both among themselves and with respect to stars of earlier spectral type. These lines present a picture of a warm chromosphere that is static in the average but may be far from uniform in density and ionization. The Mg II emission lines of 2 Cen show 2 unresolved absorption components, the shorter at the velocity of the local interstellar medium. The longer is blueshifted from the star by 12 to 18 km/sec and must be one of very few observed shell lines uncontaminated by interstellar absorption.

  10. Entrez Gene: gene-centered information at NCBI.


    Maglott, Donna; Ostell, Jim; Pruitt, Kim D; Tatusova, Tatiana


    Entrez Gene ( is NCBI's database for gene-specific information. Entrez Gene includes records from genomes that have been completely sequenced, that have an active research community to contribute gene-specific information or that are scheduled for intense sequence analysis. The content of Entrez Gene represents the result of both curation and automated integration of data from NCBI's Reference Sequence project (RefSeq), from collaborating model organism databases and from other databases within NCBI. Records in Entrez Gene are assigned unique, stable and tracked integers as identifiers. The content (nomenclature, map location, gene products and their attributes, markers, phenotypes and links to citations, sequences, variation details, maps, expression, homologs, protein domains and external databases) is provided via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programing utilities (E-Utilities), and for bulk transfer by ftp.

  11. Entrez Gene: gene-centered information at NCBI.


    Maglott, Donna; Ostell, Jim; Pruitt, Kim D; Tatusova, Tatiana


    Entrez Gene ( is National Center for Biotechnology Information (NCBI)'s database for gene-specific information. Entrez Gene maintains records from genomes which have been completely sequenced, which have an active research community to submit gene-specific information, or which are scheduled for intense sequence analysis. The content represents the integration of curation and automated processing from NCBI's Reference Sequence project (RefSeq), collaborating model organism databases, consortia such as Gene Ontology and other databases within NCBI. Records in Entrez Gene are assigned unique, stable and tracked integers as identifiers. The content (nomenclature, genomic location, gene products and their attributes, markers, phenotypes and links to citations, sequences, variation details, maps, expression, homologs, protein domains and external databases) is available via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programming utilities (E-Utilities) and for bulk transfer by FTP.

  12. Endovascular Gene Delivery from a Stent Platform: Gene- Eluting Stents.


    Fishbein, Ilia; Chorny, Michael; Adamo, Richard F; Forbes, Scott P; Corrales, Ricardo A; Alferiev, Ivan S; Levy, Robert J

    A synergistic impact of research in the fields of post-angioplasty restenosis, drug-eluting stents and vascular gene therapy over the past 15 years has shaped the concept of gene-eluting stents. Gene-eluting stents hold promise of overcoming some biological and technical problems inherent to drug-eluting stent technology. As the field of gene-eluting stents matures it becomes evident that all three main design modules of a gene-eluting stent: a therapeutic transgene, a vector and a delivery system are equally important for accomplishing sustained inhibition of neointimal formation in arteries treated with gene delivery stents. This review summarizes prior work on stent-based gene delivery and discusses the main optimization strategies required to move the field of gene-eluting stents to clinical translation.

  13. Endovascular Gene Delivery from a Stent Platform: Gene- Eluting Stents

    PubMed Central

    Fishbein, Ilia; Chorny, Michael; Adamo, Richard F; Forbes, Scott P; Corrales, Ricardo A; Alferiev, Ivan S; Levy, Robert J


    A synergistic impact of research in the fields of post-angioplasty restenosis, drug-eluting stents and vascular gene therapy over the past 15 years has shaped the concept of gene-eluting stents. Gene-eluting stents hold promise of overcoming some biological and technical problems inherent to drug-eluting stent technology. As the field of gene-eluting stents matures it becomes evident that all three main design modules of a gene-eluting stent: a therapeutic transgene, a vector and a delivery system are equally important for accomplishing sustained inhibition of neointimal formation in arteries treated with gene delivery stents. This review summarizes prior work on stent-based gene delivery and discusses the main optimization strategies required to move the field of gene-eluting stents to clinical translation. PMID:26225356

  14. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.


    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana


    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  15. Immunotherapy and gene therapy.


    Simpson, Elizabeth


    The Immunotherapy and Gene Therapy meeting of the Academy of Medical Sciences reviewed the state-of-the-art and translational prospects for therapeutic interventions aimed at killing tumor cells, correcting genetic defects and developing vaccines for chronic infections. Crucial basic science concepts and information about dendritic cells, the structure and function of T-cell receptors, and manipulation of the immune response by cytokine antagonists and peptides were presented. This information underpins vaccine design and delivery, as well as attempts to immunomodulate autoimmune disease. Results from studies using anticancer DNA vaccines, which include appropriate signals for both the innate and adaptive immune response, were presented in several talks. The vaccines incorporated helper epitopes and cancer target epitopes such as immunoglobulin idiotypes (for lymphomas and myelomas), melanoma-associated antigens (for melanoma and other solid tumors) and minor histocompatibility antigens (for leukemia). The results of using vaccines employing similar principles and designed to reduce viral load in HIV/AIDS patients were also presented. The introduction of suicide genes incorporating the bacterial enzyme nitroreductase gene (ntr) targeted at tumor cells prior to administration of the prodrug CB-1954, converted by ntr into a toxic alkylating agent, was discussed against the background of clinical trials and improved suicide gene design. The introduction into hematopoietic stem cells of missing genes for the common gamma-chain, deficiency of which causes severe combined immunodeficiency (SCID), used similar retroviral transduction. The outcome of treating six SCID patients in the UK, and ten in France was successful immune reconstitution in the majority of patients, but in two of the French cases a complication of lymphoproliferative disease due to insertional mutagenesis was observed. The adoptive transfer of T-cells specific for minor histocompatibility antigens (for

  16. Gene Testing for Hereditary Ataxia


    ... have a family history of ataxia, but diagnostic tests for known ataxia genes cannot explain the ataxia in their family. In recent years, scientists have developed technologies to sequence thousands of genes at the same ...

  17. Chapter 15: Disease Gene Prioritization

    PubMed Central

    Bromberg, Yana


    Disease-causing aberrations in the normal function of a gene define that gene as a disease gene. Proving a causal link between a gene and a disease experimentally is expensive and time-consuming. Comprehensive prioritization of candidate genes prior to experimental testing drastically reduces the associated costs. Computational gene prioritization is based on various pieces of correlative evidence that associate each gene with the given disease and suggest possible causal links. A fair amount of this evidence comes from high-throughput experimentation. Thus, well-developed methods are necessary to reliably deal with the quantity of information at hand. Existing gene prioritization techniques already significantly improve the outcomes of targeted experimental studies. Faster and more reliable techniques that account for novel data types are necessary for the development of new diagnostics, treatments, and cure for many diseases. PMID:23633938

  18. SOX genes: architects of development.


    Prior, H M; Walter, M A


    Development in higher organisms involves complex genetic regulation at the molecular level. The emerging picture of development control includes several families of master regulatory genes which can affect the expression of down-stream target genes in developmental cascade pathways. One new family of such development regulators is the SOX gene family. The SOX genes are named for a shared motif called the SRY box a region homologous to the DNA-binding domain of SRY, the mammalian sex determining gene. Like SRY, SOX genes play important roles in chordate development. At least a dozen human SOX genes have been identified and partially characterized (Tables 1 and 2). Mutations in SOX9 have recently been linked to campomelic dysplasia and autosomal sex reversal, and other SOX genes may also be associated with human disease.

  19. Brains, Genes and Primates

    PubMed Central

    Belmonte, Juan Carlos Izpisua; Callaway, Edward M.; Churchland, Patricia; Caddick, Sarah J.; Feng, Guoping; Homanics, Gregg E.; Lee, Kuo-Fen; Leopold, David A.; Miller, Cory T.; Mitchell, Jude F.; Mitalipov, Shoukhrat; Moutri, Alysson R.; Movshon, J. Anthony; Okano, Hideyuki; Reynolds, John H.; Ringach, Dario; Sejnowski, Terrence J.; Silva, Afonso C.; Strick, Peter L.; Wu, Jun; Zhang, Feng


    One of the great strengths of the mouse model is the wide array of genetic tools that have been developed. Striking examples include methods for directed modification of the genome, and for regulated expression or inactivation of genes. Within neuroscience, it is now routine to express reporter genes, neuronal activity indicators and opsins in specific neuronal types in the mouse. However, there are considerable anatomical, physiological, cognitive and behavioral differences between the mouse and the human that, in some areas of inquiry, limit the degree to which insights derived from the mouse can be applied to understanding human neurobiology. Several recent advances have now brought into reach the goal of applying these tools to understanding the primate brain. Here we describe these advances, consider their potential to advance our understanding of the human brain and brain disorders, discuss bioethical considerations, and describe what will be needed to move forward. PMID:25950631

  20. Graphene based gene transfection

    NASA Astrophysics Data System (ADS)

    Feng, Liangzhu; Zhang, Shuai; Liu, Zhuang


    Graphene as a star in materials research has been attracting tremendous attentions in the past few years in various fields including biomedicine. In this work, for the first time we successfully use graphene as a non-toxic nano-vehicle for efficient gene transfection. Graphene oxide (GO) is bound with cationic polymers, polyethyleneimine (PEI) with two different molecular weights at 1.2 kDa and 10 kDa, forming GO-PEI-1.2k and GO-PEG-10k complexes, respectively, both of which are stable in physiological solutions. Cellular toxicity tests reveal that our GO-PEI-10k complex exhibits significantly reduced toxicity to the treated cells compared to the bare PEI-10k polymer. The positively charged GO-PEI complexes are able to further bind with plasmid DNA (pDNA) for intracellular transfection of the enhanced green fluorescence protein (EGFP) gene in HeLa cells. While EGFP transfection with PEI-1.2k appears to be ineffective, high EGFP expression is observed using the corresponding GO-PEI-1.2k as the transfection agent. On the other hand, GO-PEI-10k shows similar EGFP transfection efficiency but lower toxicity compared with PEI-10k. Our results suggest graphene to be a novel gene delivery nano-vector with low cytotoxicity and high transfection efficiency, promising for future applications in non-viral based gene therapy.Graphene as a star in materials research has been attracting tremendous attentions in the past few years in various fields including biomedicine. In this work, for the first time we successfully use graphene as a non-toxic nano-vehicle for efficient gene transfection. Graphene oxide (GO) is bound with cationic polymers, polyethyleneimine (PEI) with two different molecular weights at 1.2 kDa and 10 kDa, forming GO-PEI-1.2k and GO-PEG-10k complexes, respectively, both of which are stable in physiological solutions. Cellular toxicity tests reveal that our GO-PEI-10k complex exhibits significantly reduced toxicity to the treated cells compared to the bare PEI

  1. Beyond the Gene

    PubMed Central

    Fox Keller, Evelyn; Harel, David


    This paper is a response to the increasing difficulty biologists find in agreeing upon a definition of the gene, and indeed, the increasing disarray in which that concept finds itself. After briefly reviewing these problems, we propose an alternative to both the concept and the word gene—an alternative that, like the gene, is intended to capture the essence of inheritance, but which is both richer and more expressive. It is also clearer in its separation of what the organism statically is (what it tangibly inherits) and what it dynamically does (its functionality and behavior). Our proposal of a genetic functor, or genitor, is a sweeping extension of the classical genotype/phenotype paradigm, yet it appears to be faithful to the findings of contemporary biology, encompassing many of the recently emerging—and surprisingly complex—links between structure and functionality. PMID:18043738

  2. Genes and nerves.


    Dieu, Tam; Johnstone, Bruce R; Newgreen, Don F


    The unpredictability of a brachial plexus graft, a median nerve repair, or a facial-nerve reconstruction is well known. No matter how precise the technical skills, a perfect recovery from a peripheral-nerve lesion is elusive. To resolve this problem, understanding of the normal development of the peripheral nervous system is needed. Presently, the development of the innervation in the upper limb is complex and not fully understood. However, many of the genes involved in this process are now known, and the link between anatomy and genetics is becoming clearer. This short review aims to acquaint the clinical surgeon with some of the main genes. The principal steps in the establishment of neural circuits will be summarized, in particular, the specification and development of neurons and glia, the pathfinding of cells and axons towards their target, and the downstream molecules that control the circuitry of these neurons.

  3. Gene therapy in keratoconus

    PubMed Central

    Farjadnia, Mahgol; Naderan, Mohammad; Mohammadpour, Mehrdad


    Keratoconus (KC) is the most common ectasia of the cornea and is a common reason for corneal transplant. Therapeutic strategies that can arrest the progression of this disease and modify the underlying pathogenesis are getting more and more popularity among scientists. Cumulating data represent strong evidence of a genetic role in the pathogenesis of KC. Different loci have been identified, and certain mutations have also been mapped for this disease. Moreover, Biophysical properties of the cornea create an appropriate candidate of this tissue for gene therapy. Immune privilege, transparency and ex vivo stability are among these properties. Recent advantage in vectors, besides the ability to modulate the corneal milieu for accepting the target gene for a longer period and fruitful translation, make a big hope for stupendous results reasonable. PMID:25709266

  4. The sulfatase gene family.


    Parenti, G; Meroni, G; Ballabio, A


    During the past few years, molecular analyses have provided important insights into the biochemistry and genetics of the sulfatase family of enzymes, identifying the molecular bases of inherited diseases caused by sulfatase deficiencies. New members of the sulfatase gene family have been identified in man and other species using a genomic approach. These include the gene encoding arylsulfatase E, which is involved in X-linked recessive chondrodysplasia punctata, a disorder of cartilage and bone development. Another important breakthrough has been the discovery of the biochemical basis of multiple sulfatase deficiency, an autosomal recessive disorder characterized by a severe of all sulfatase activities. These discoveries, together with the resolution of the crystallographic structure of sulfatases, have improved our understanding of the function and evolution of this fascinating family of enzymes.

  5. RNA-mediated gene activation

    PubMed Central

    Jiao, Alan L; Slack, Frank J


    The regulation of gene expression by non-coding RNAs (ncRNAs) has become a new paradigm in biology. RNA-mediated gene silencing pathways have been studied extensively, revealing diverse epigenetic and posttranscriptional mechanisms. In contrast, the roles of ncRNAs in activating gene expression remains poorly understood. In this review, we summarize the current knowledge of gene activation by small RNAs, long non-coding RNAs, and enhancer-derived RNAs, with an emphasis on epigenetic mechanisms. PMID:24185374

  6. Gene Porter Bridwell

    NASA Technical Reports Server (NTRS)


    Gene Porter Bridwell served as the director of the Marshall Space Flight Center from January 6, 1994 until February 3, 1996, when he retired from NASA after thirty-four years service. Bridwell, a Marshall employee since 1962, had been Marshall's Space Shuttle Projects Office Director and Space Station Redesign Team deputy manager. Under Bridwell, Marshall worked to develop its role as a Center of Excellence for propulsion and for providing access to space.

  7. [Patenting human genes].


    Brdicka, R


    The problem of patenting of human genes, which was discussed at the Workshop organized by OECD, has become very actual due to granted patents that concern testing of genetic disposition for breast cancer. Companies that had made large investments into this research clearly support patenting of their discoveries. But such patents can reduce general accessibility of genetic testing. Existing laws, and namely the Directive of the European Council unfortunately are not unambiguous and allow rather free explanation.

  8. Pure genes, pure genius.


    McKnight, Steven L


    The 2012 Albert Lasker Special Achievement Award in Medical Science will be shared by Donald Brown and Tom Maniatis for their scientific work leading to the purification and study of single genes by physical and molecular biological methodologies. Brown and Maniatis are also recognized for their extraordinary commitment and generosity in promoting the careers of young scientists. The impact of these accomplishments has transformed biological and medical science over the past four decades.

  9. Genealogy and gene trees.


    Rasmuson, Marianne


    Heredity can be followed in persons or in genes. Persons can be identified only a few generations back, but simplified models indicate that universal ancestors to all now living persons have occurred in the past. Genetic variability can be characterized as variants of DNA sequences. Data are available only from living persons, but from the pattern of variation gene trees can be inferred by means of coalescence models. The merging of lines backwards in time leads to a MRCA (most recent common ancestor). The time and place of living for this inferred person can give insights in human evolutionary history. Demographic processes are incorporated in the model, but since culture and customs are known to influence demography the models used ought to be tested against available genealogy. The Icelandic data base offers a possibility to do so and points to some discrepancies. Mitochondrial DNA and Y chromosome patterns give a rather consistent view of human evolutionary history during the latest 100 000 years but the earlier epochs of human evolution demand gene trees with longer branches. The results of such studies reveal as yet unsolved problems about the sources of our genome.

  10. nanosheets for gene therapy

    NASA Astrophysics Data System (ADS)

    Kou, Zhongyang; Wang, Xin; Yuan, Renshun; Chen, Huabin; Zhi, Qiaoming; Gao, Ling; Wang, Bin; Guo, Zhaoji; Xue, Xiaofeng; Cao, Wei; Guo, Liang


    A new class of two-dimensional (2D) nanomaterial, transition metal dichalcogenides (TMDCs) such as MoS2, MoSe2, WS2, and WSe2 which have fantastic physical and chemical properties, has drawn tremendous attention in different fields recently. Herein, we for the first time take advantage of the great potential of MoS2 with well-engineered surface as a novel type of 2D nanocarriers for gene delivery and therapy of cancer. In our system, positively charged MoS2-PEG-PEI is synthesized with lipoic acid-modified polyethylene glycol (LA-PEG) and branched polyethylenimine (PEI). The amino end of positively charged nanomaterials can bind to the negatively charged small interfering RNA (siRNA). After detection of physical and chemical characteristics of the nanomaterial, cell toxicity was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Polo-like kinase 1 (PLK1) was investigated as a well-known oncogene, which was a critical regulator of cell cycle transmission at multiple levels. Through knockdown of PLK1 with siRNA carried by novel nanovector, qPCR and Western blot were used to measure the interfering efficiency; apoptosis assay was used to detect the transfection effect of PLK1. All results showed that the novel nanocarrier revealed good biocompatibility, reduced cytotoxicity, as well as high gene-carrying ability without serum interference, thus would have great potential for gene delivery and therapy.

  11. [Basic principles of gene therapy].


    Vieweg, J


    The rapid development of recombinant DNA technology and our enhanced understanding of the genetic basis of human disease has facilitated the development of new molecular therapeutic modalities, termed gene therapy. Gene therapy involves the transfer of functional genes into somatic cells and their expression in target tissues in order to replace absent genes, correct defective genes, or induce antitumoral activity in the tumor-bearing host. Currently, an increasing number of gene therapy strategies are being investigated in experimental and clinical trials. Despite substantial progress, a number of technical and logistical hurdles must still be overcome before gene therapy can be safety and effectively applied in the human patient. Since gene therapy involves complex cell processing and can be time consuming and costly, simplifications or even alternative approaches will be necessary in order to establish this therapy as suitable for clinical use. This report reviews various gene therapy strategies and gene delivery techniques currently under clinical or experimental investigation. Special emphasis is given to cytokine gene therapy using gene-modified tumor vaccines for cancer treatment.

  12. Gene therapy for Down syndrome.


    Fillat, Cristina; Altafaj, Xavier


    The presence of an additional copy of HSA21 chromosome in Down syndrome (DS) individuals leads to the overexpression of 30-50% of HSA21 genes. This upregulation can, in turn, trigger a deregulation on the expression of non-HSA21 genes. Moreover, the overdose of HSA21 microRNAs (miRNAs) may result in the downregulation of its target genes. Additional complexity can also arise from epigenetic changes modulating gene expression. Thus, a myriad of transcriptional and posttranscriptional alterations participate to produce abnormal phenotypes in almost all tissues and organs of DS individuals. The study of the physiological roles of genes dysregulated in DS, as well as their characterization in murine models with gene(s) dosage imbalance, pointed out several genes, and functional noncoding elements to be particularly critical in the etiology of DS. Recent findings indicate that gene therapy strategies-based on the introduction of genetic elements by means of delivery vectors-toward the correction of phenotypic abnormalities in DS are also very promising tool to identify HSA21 and non-HSA21 gene candidates, contributing to DS phenotype. In this chapter, we focus on the impact of normalizing the expression levels of up or downregulated genes to rescue particular phenotypes of DS. Attempts toward gene-based treatment approaches in mouse models will be discussed as new opportunities to ameliorate DS alterations.

  13. Independent Gene Discovery and Testing

    ERIC Educational Resources Information Center

    Palsule, Vrushalee; Coric, Dijana; Delancy, Russell; Dunham, Heather; Melancon, Caleb; Thompson, Dennis; Toms, Jamie; White, Ashley; Shultz, Jeffry


    A clear understanding of basic gene structure is critical when teaching molecular genetics, the central dogma and the biological sciences. We sought to create a gene-based teaching project to improve students' understanding of gene structure and to integrate this into a research project that can be implemented by instructors at the secondary level…

  14. Optimal gene partition into operons correlates with gene functional order

    NASA Astrophysics Data System (ADS)

    Zaslaver, Alon; Mayo, Avi; Ronen, Michal; Alon, Uri


    Gene arrangement into operons varies between bacterial species. Genes in a given system can be on one operon in some organisms and on several operons in other organisms. Existing theories explain why genes that work together should be on the same operon, since this allows for advantageous lateral gene transfer and accurate stoichiometry. But what causes the frequent separation into multiple operons of co-regulated genes that act together in a pathway? Here we suggest that separation is due to benefits made possible by differential regulation of each operon. We present a simple mathematical model for the optimal distribution of genes into operons based on a balance of the cost of operons and the benefit of regulation that provides 'just-when-needed' temporal order. The analysis predicts that genes are arranged such that genes on the same operon do not skip functional steps in the pathway. This prediction is supported by genomic data from 137 bacterial genomes. Our work suggests that gene arrangement is not only the result of random historical drift, genome re-arrangement and gene transfer, but has elements that are solutions of an evolutionary optimization problem. Thus gene functional order may be inferred by analyzing the operon structure across different genomes.

  15. The ethics of gene therapy.


    Chan, Sarah; Harris, John


    Recent developments have progressed in areas of science that pertain to gene therapy and its ethical implications. This review discusses the current state of therapeutic gene technologies, including stem cell therapies and genetic modification, and identifies ethical issues of concern in relation to the science of gene therapy and its application, including the ethics of embryonic stem cell research and therapeutic cloning, the risks associated with gene therapy, and the ethics of clinical research in developing new therapeutic technologies. Additionally, ethical issues relating to genetic modification itself are considered: the significance of the human genome, the distinction between therapy and enhancement, and concerns regarding gene therapy as a eugenic practice.

  16. Gene Therapy for Metabolic Diseases

    PubMed Central

    Chandler, Randy J.; Venditti, Charles P.


    SUMMARY Gene therapy has recently shown great promise as an effective treatment for a number of metabolic diseases caused by genetic defects in both animal models and human clinical trials. Most of the current success has been achieved using a viral mediated gene addition approach, but gene-editing technology has progressed rapidly and gene modification is being actively pursued in clinical trials. This review focuses on viral mediated gene addition approaches, because most of the current clinical trials utilize this approach to treat metabolic diseases. PMID:27853673

  17. Gene Therapy for Autoimmune Disease.


    Shu, Shang-An; Wang, Jinjun; Tao, Mi-Hua; Leung, Patrick S C


    Advances in understanding the immunological and molecular basis of autoimmune diseases have made gene therapy a promising approach to treat the affected patients. Gene therapy for autoimmune diseases aims to regulate the levels of proinflammatory cytokines or molecules and the infiltration of lymphocytes to the effected sites through successful delivery and expression of therapeutic genes in appropriate cells. The ultimate goal of gene therapy is to restore and maintain the immune tolerance to the relevant autoantigens and improve clinical outcomes for patients. Here, we summarize the recent progress in identifying genes responsible for autoimmune diseases and present examples where gene therapy has been applied as treatments or prevention in autoimmune diseases both in animal models and the clinical trials. Discussion on the advantages and pitfalls of gene therapy strategies employed is provided. The intent of this review is to inspire further studies toward the development of new strategies for successful treatment of autoimmune diseases.

  18. RANGE: Gene Transfer of Reversibly Controlled Polycistronic Genes

    PubMed Central

    Chen, Yiwei; Cao, Liji; Luo, Chonglin; Ditzel, Désirée AW; Peter, Jörg; Sprengel, Rolf


    We developed a single vector recombinant adeno-associated viral (rAAV) expression system for spatial and reversible control of polycistronic gene expression. Our approach (i) integrates the advantages of the tetracycline (Tet)-controlled transcriptional silencer tTSKid and the self-cleaving 2A peptide bridge, (ii) combines essential regulatory components as an autoregulatory loop, (iii) simplifies the gene delivery scheme, and (iv) regulates multiple genes in a synchronized manner. Controlled by an upstream Tet-responsive element (TRE), both the ubiquitous chicken β-actin promoter (CAG) and the neuron-specific synapsin-1 promoter (Syn) could regulate expression of tTSKid together with two 2A-linked reporter genes. Transduction in vitro exhibited maximally 50-fold regulation by doxycycline (Dox). Determined by gene delivery method as well as promoter, highly specific tissues were transduced in vivo. Bioluminescence imaging (BLI) visualized reversible “ON/OFF” gene switches over repeated “Doxy-Cycling” in living mice. Thus, the reversible rAAV-mediated N-cistronic gene expression system, termed RANGE, may serve as a versatile tool to achieve reversible polycistronic gene regulation for the study of gene function as well as gene therapy. PMID:23571608

  19. Diseases originate and terminate by genes: unraveling nonviral gene delivery.


    Swami, Rajan; Singh, Indu; Khan, Wahid; Ramakrishna, Sistla


    The world is driving in to the era of transformation of chemical therapeutic molecules to biological genetic material therapeutics, and that is where the biological drugs especially "genes" come into existence. These genes worked as "magical bullets" to specifically silence faulty genes responsible for progression of diseases. Viral gene delivery research is far ahead of nonviral gene delivery technique. However, with more advancement in polymer science, new ways are opening for better and efficient nonviral gene delivery. But efficient delivery method is always considered as a bottleneck for gene delivery as success of which will decide the fate of gene in cells. During the past decade, it became evident that extracellular as well as intracellular barriers compromise the transfection efficiency of nonviral vectors. The challenge for gene therapy research is to pinpoint the rate-limiting steps in this complex process and implement strategies to overcome the biological physiochemical and metabolic barriers encountered during targeting. The synergy between studies that investigate the mechanism of breaking in and breaking out of nonviral gene delivery carrier through various extracellular and intracellular barriers with desired characteristics will enable the rational design of vehicles and revolutionize the treatment of various diseases.

  20. Network analysis reveals crosstalk between autophagy genes and disease genes

    PubMed Central

    Wang, Ji-Ye; Yao, Wei-Xuan; Wang, Yun; Fan, Yi-lei; Wu, Jian-Bing


    Autophagy is a protective and life-sustaining process in which cytoplasmic components are packaged into double-membrane vesicles and targeted to lysosomes for degradation. Accumulating evidence supports that autophagy is associated with several pathological conditions. However, research on the functional cross-links between autophagy and disease genes remains in its early stages. In this study, we constructed a disease-autophagy network (DAN) by integrating known disease genes, known autophagy genes and protein-protein interactions (PPI). Dissecting the topological properties of the DAN suggested that nodes that both autophagy and disease genes (inter-genes), are topologically important in the DAN structure. Next, a core network from the DAN was extracted to analyze the functional links between disease and autophagy genes. The genes in the core network were significantly enriched in multiple disease-related pathways, suggesting that autophagy genes may function in various disease processes. Of 17 disease classes, 11 significantly overlapped with autophagy genes, including cancer diseases, metabolic diseases and hematological diseases, a finding that is supported by the literatures. We also found that autophagy genes have a bridging role in the connections between pairs of disease classes. Altogether, our study provides a better understanding of the molecular mechanisms underlying human diseases and the autophagy process. PMID:28295050

  1. Identification of genes and gene products necessary for bacterial bioluminescence.


    Engebrecht, J; Silverman, M


    Expression of luminescence in Escherichia coli was recently achieved by cloning genes from the marine bacterium Vibrio fischeri. One DNA fragment on a hybrid plasmid encoded regulatory functions and enzymatic activities necessary for light production. We report the results of a genetic analysis to identify the luminescence genes (lux) that reside on this recombinant plasmid. lux gene mutations were generated by hydroxylamine treatment, and these mutations were ordered on a linear map by complementation in trans with a series of polar transposon insertions on other plasmids. lux genes were defined by complementation of lux gene defects on pairs of plasmids in trans in E. coli. Hybrid plasmids were also used to direct the synthesis of polypeptides in the E. coli minicell system. Seven lux genes and the corresponding gene products were identified from the complementation analysis and the minicell programing experiments. These genes, in the order of their position on a linear map, and the apparent molecular weights of the gene products are luxR (27,000), luxI (25,000), luxC (53,000), luxD (33,000), luxA (40,000), luxB (38,000), and luxE (42,000). From the luminescence phenotypes of E. coli containing mutant plasmids, functions were assigned to these genes: luxA, luxB, luxC, luxD, and luxE encode enzymes for light production and luxR and luxI encode regulatory functions.

  2. Gene Circuit Analysis of the Terminal Gap Gene huckebein

    PubMed Central

    Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes


    The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network. PMID:19876378

  3. Gene Therapy and Children (For Parents)


    ... Old Feeding Your 1- to 2-Year-Old Gene Therapy and Children KidsHealth > For Parents > Gene Therapy ... that don't respond to conventional therapies. About Genes Our genes help make us unique. Inherited from ...

  4. Gene Discoveries Offer New Height Insights


    ... Health and Human Services. More Health News on: Child Development Genes and Gene Therapy Recent Health News Related MedlinePlus Health Topics Child Development Genes and Gene Therapy About MedlinePlus Site Map ...

  5. Cloning of circadian rhythmic pathway genes and perturbation of oscillation patterns in endocrine disrupting chemicals (EDCs)-exposed mangrove killifish Kryptolebias marmoratus.


    Rhee, Jae-Sung; Kim, Bo-Mi; Lee, Bo-Young; Hwang, Un-Ki; Lee, Yong Sung; Lee, Jae-Seong


    To investigate the effect of endocrine disrupting chemicals (EDCs) on the circadian rhythm pathway, we cloned clock and circadian rhythmic pathway-associated genes (e.g. Per2, Cry1, Cry2, and BMAL1) in the self-fertilizing mangrove killifish Kryptolebias marmoratus. The promoter region of Km-clock had 1 aryl hydrocarbon receptor element (AhRE, GTGCGTGACA) and 8 estrogen receptor (ER) half-sites, indicating that the AhRE and ER half sites would likely be associated with regulation of clock protein activity during EDCs-induced cellular stress. The Km-clock protein domains (bHLH, PAS1, PAS2) were highly conserved in five additional fish species (zebrafish, Japanese medaka, Southern platyfish, Nile tilapia, and spotted green pufferfish), suggesting that the fish clock protein may play an important role in controlling endogenous circadian rhythms. The promoter regions of Km-BMAL1, -Cry1, -Cry2, and -Per2 were found to contain several xenobiotic response elements (XREs), indicating that EDCs may be able to alter the expression of these genes. To analyze the endogenous circadian rhythm in K. marmoratus, we measured expression of Km-clock and other circadian rhythmic genes (e.g. Per2, Cry1, Cry2, and BMAL1) in different tissues, and found ubiquitous expression, although there were different patterns of transcript amplification during different developmental stages. In an estrogen (E2)-exposed group, Km-clock expression was down-regulated, however, a hydroxytamoxifen (TMX, nonsteroid estrogen antagonist)-exposed group showed an upregulated pattern of Km-clock expression, suggesting that the expression of Km-clock is closely associated with exposure to EDCs. In response to the exposure of bisphenol A (BPA) and 4-tert-octyphenol (OP), Km-clock expression was down-regulated in the pituitary/brain, muscle, and skin in both gender types (hermaphrodite and secondary male). In juvenile K. marmoratus liver tissue, expression of Km-clock and other circadian rhythmic pathway

  6. Prevalence of PER and VEB Type Extended Spectrum Betalactamases among Multidrug Resistant Acinetobacter baumannii Isolates in North-West of Iran

    PubMed Central

    Farajnia, Safar; Azhari, Fatemeh; Alikhani, Mohammad Yousef; Hosseini, Mohammad Kazem; Peymani, Amir; Sohrabi, Nasrolah


    Objective(s): Drug resistant Acinetobacter baumannii have emerged as a major problem in many hospitals and intensive care units. Various types of extended spectrum beta-lactamases (ESBLs) are responsible for resistance to beta-lactam antibiotics in different parts of the world. The objective of this study was to determine the prevalence of integron class1 (INT 1) and ESBL types PER-1, PER-2 and VEB-1 among A. baumannii strains isolated from Tabriz, North-West of Iran. Material and Methods: A total of 100 A. baumannii isolates collected from different clinical samples were included in the study. Antimicrobial susceptibility profiles were determined using the Kirby Bauer disk diffusion method. Production of ESBL was investigated by testing resistance against ceftazidime, cefotaxime, ceftriaxone and verified by Double Disk Synergy Test. DNA was extracted from the isolates and the frequency of INT 1 and ESBL types PER-1, PER-2 and VEB-1 were determined by PCR using specific primers. Results: Among 100 A. baumannii isolates screened, 80 isolates were multidrug-resistant and 70 isolates were positive for ESBL production. PCR screening revealed that 74 % of the isolates contained class 1 integron, 51% were positive for PER-1 gene, 10% positive for VEB1 whereas none of the isolates were positive for PER2 type gene. Conclusion: This is the first report of ESBL types VEB and PER in A. baumannii from North West of Iran. The results of this study demonstrated high prevalence of PER-1 and VEB-1 type ESBLs among A. baumannii isolates in the study region and reminded the necessity of appropriate infection control strategy to prevent further spread of infection by these organisms. PMID:23997900

  7. Human AZU-1 gene, variants thereof and expressed gene products


    Chen, Huei-Mei; Bissell, Mina


    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  8. Cardiac gene therapy: optimization of gene delivery techniques in vivo.


    Katz, Michael G; Swain, JaBaris D; White, Jennifer D; Low, David; Stedman, Hansell; Bridges, Charles R


    Vector-mediated cardiac gene therapy holds tremendous promise as a translatable platform technology for treating many cardiovascular diseases. The ideal technique is one that is efficient and practical, allowing for global cardiac gene expression, while minimizing collateral expression in other organs. Here we survey the available in vivo vector-mediated cardiac gene delivery methods--including transcutaneous, intravascular, intramuscular, and cardiopulmonary bypass techniques--with consideration of the relative merits and deficiencies of each. Review of available techniques suggests that an optimal method for vector-mediated gene delivery to the large animal myocardium would ideally employ retrograde and/or anterograde transcoronary gene delivery,extended vector residence time in the coronary circulation, an increased myocardial transcapillary gradient using physical methods, increased endothelial permeability with pharmacological agents, minimal collateral gene expression by isolation of the cardiac circulation from the systemic, and have low immunogenicity.

  9. Vectors for cancer gene therapy.


    Zhang, J; Russell, S J


    Many viral and non-viral vector systems have now been developed for gene therapy applications. In this article, the pros and cons of these vector systems are discussed in relation to the different cancer gene therapy strategies. The protocols used in cancer gene therapy can be broadly divided into six categories including gene transfer to explanted cells for use as cell-based cancer vaccines; gene transfer to a small number of tumour cells in situ to achieve a vaccine effect; gene transfer to vascular endothelial cells (VECs) lining the blood vessels of the tumour to interfere with tumour angiogenesis; gene transfer to T lymphocytes to enhance their antitumour effector capability; gene transfer to haemopoietic stem cells (HSCs) to enhance their resistance to cytotoxic drugs and gene transfer to a large number of tumour cells in situ to achieve nonimmune tumour reduction with or without bystander effect. Each of the six strategies makes unique demands on the vector system and these are discussed with reference to currently available vectors. Aspects of vector biology that are in need of further development are discussed in some detail. The final section points to the potential use of replicating viruses as delivery vehicles for efficient in vivo gene transfer to disseminated cancers.

  10. Reverse engineering transcriptional gene networks.


    Belcastro, Vincenzo; di Bernardo, Diego


    The aim of this chapter is a step-by-step guide on how to infer gene networks from gene expression profiles. The definition of a gene network is given in Subheading 1, where the different types of networks are discussed. The chapter then guides the readers through a data-gathering process in order to build a compendium of gene expression profiles from a public repository. Gene expression profiles are then discretized and a statistical relationship between genes, called mutual information (MI), is computed. Gene pairs with insignificant MI scores are then discarded by applying one of the described pruning steps. The retained relationships are then used to build up a Boolean adjacency matrix used as input for a clustering algorithm to divide the network into modules (or communities). The gene network can then be used as a hypothesis generator for discovering gene function and analyzing gene signatures. Some case studies are presented, and an online web-tool called Netview is described.

  11. Identifying driver genes in cancer by triangulating gene expression, gene location, and survival data.


    Rouam, Sigrid; Miller, Lance D; Karuturi, R Krishna Murthy


    Driver genes are directly responsible for oncogenesis and identifying them is essential in order to fully understand the mechanisms of cancer. However, it is difficult to delineate them from the larger pool of genes that are deregulated in cancer (ie, passenger genes). In order to address this problem, we developed an approach called TRIAngulating Gene Expression (TRIAGE through clinico-genomic intersects). Here, we present a refinement of this approach incorporating a new scoring methodology to identify putative driver genes that are deregulated in cancer. TRIAGE triangulates - or integrates - three levels of information: gene expression, gene location, and patient survival. First, TRIAGE identifies regions of deregulated expression (ie, expression footprints) by deriving a newly established measure called the Local Singular Value Decomposition (LSVD) score for each locus. Driver genes are then distinguished from passenger genes using dual survival analyses. Incorporating measurements of gene expression and weighting them according to the LSVD weight of each tumor, these analyses are performed using the genes located in significant expression footprints. Here, we first use simulated data to characterize the newly established LSVD score. We then present the results of our application of this refined version of TRIAGE to gene expression data from five cancer types. This refined version of TRIAGE not only allowed us to identify known prominent driver genes, such as MMP1, IL8, and COL1A2, but it also led us to identify several novel ones. These results illustrate that TRIAGE complements existing tools, allows for the identification of genes that drive cancer and could perhaps elucidate potential future targets of novel anticancer therapeutics.

  12. Ancient origins of axial patterning genes: Hox genes and ParaHox genes in the Cnidaria.


    Finnerty, J R; Martindale, M Q


    Among the bilaterally symmetrical, triploblastic animals (the Bilateria), a conserved set of developmental regulatory genes are known to function in patterning the anterior-posterior (AP) axis. This set includes the well-studied Hox cluster genes, and the recently described genes of the ParaHox cluster, which is believed to be the evolutionary sister of the Hox cluster (Brooke et al. 1998). The conserved role of these axial patterning genes in animals as diverse as frogs and flies is believed to reflect an underlying homology (i.e., all bilaterians derive from a common ancestor which possessed an AP axis and the developmental mechanisms responsible for patterning the axis). However, the origin and early evolution of Hox genes and ParaHox genes remain obscure. Repeated attempts have been made to reconstruct the early evolution of Hox genes by analyzing data from the triphoblastic animals, the Bilateria (Schubert et al. 1993; Zhang and Nei 1996). A more precise dating of Hox origins has been elusive due to a lack of sufficient information from outgroup taxa such as the phylum Cnidaria (corals, hydras, jellyfishes, and sea anemones). In combination with outgroup taxa, another potential source of information about Hox origins is outgroup genes (e.g., the genes of the ParaHox cluster). In this article, we present cDNA sequences of two Hox-like genes (anthox2 and anthox6) from the sea anemone, Nematostella vectensis. Phylogenetic analysis indicates that anthox2 (= Cnox2) is homologous to the GSX class of ParaHox genes, and anthox6 is homologous to the anterior class of Hox genes. Therefore, the origin of Hox genes and ParaHox genes occurred prior to the evolutionary split between the Cnidaria and the Bilateria and predated the evolution of the anterior-posterior axis of bilaterian animals. Our analysis also suggests that the central Hox class was invented in the bilaterian lineage, subsequent to their split from the Cnidaria.

  13. Gene-gene interaction between tuberculosis candidate genes in a South African population.


    de Wit, Erika; van der Merwe, Lize; van Helden, Paul D; Hoal, Eileen G


    In a complex disease such as tuberculosis (TB) it is increasingly evident that gene-gene interactions play a far more important role in an individual's susceptibility to develop the disease than single polymorphisms on their own, as one gene can enhance or hinder the expression of another gene. Gene-gene interaction analysis is a new approach to elucidate susceptibility to TB. The possibility of gene-gene interactions was assessed, focusing on 11 polymorphisms in nine genes (DC-SIGN, IFN-γ, IFNGR1, IL-8, IL-1Ra, MBL, NRAMP1, RANTES, and SP-D) that have been associated with TB, some repeatedly. An optimal model, which best describes and predicts TB case-control status, was constructed. Significant interactions were detected between eight pairs of variants. The models fitted the observed data extremely well, with p < 0.0001 for all eight models. A highly significant interaction was detected between INFGR1 and NRAMP1, which is not surprising because macrophage activation is greatly enhanced by IFN-γ and IFN-γ response elements that are present in the human NRAMP1 promoter region, providing further evidence for their interaction. This study enabled us to test the theory that disease outcome may be due to interaction of several gene effects. With eight instances of statistically significant gene-gene interactions, the importance of epistasis is clearly identifiable in this study. Methods for studying gene-gene interactions are based on a multilocus and multigene approach, consistent with the nature of complex-trait diseases, and may provide the paradigm for future genetic studies of TB.

  14. Conotoxin Gene Superfamilies

    PubMed Central

    Robinson, Samuel D.; Norton, Raymond S.


    Conotoxins are the peptidic components of the venoms of marine cone snails (genus Conus). They are remarkably diverse in terms of structure and function. Unique potency and selectivity profiles for a range of neuronal targets have made several conotoxins valuable as research tools, drug leads and even therapeutics, and has resulted in a concerted and increasing drive to identify and characterise new conotoxins. Conotoxins are translated from mRNA as peptide precursors, and cDNA sequencing is now the primary method for identification of new conotoxin sequences. As a result, gene superfamily, a classification based on precursor signal peptide identity, has become the most convenient method of conotoxin classification. Here we review each of the described conotoxin gene superfamilies, with a focus on the structural and functional diversity present in each. This review is intended to serve as a practical guide to conotoxin superfamilies and to facilitate interpretation of the increasing number of conotoxin precursor sequences being identified by targeted-cDNA sequencing and more recently high-throughput transcriptome sequencing. PMID:25522317

  15. Genes and causation.


    Noble, Denis


    Relating genotypes to phenotypes is problematic not only owing to the extreme complexity of the interactions between genes, proteins and high-level physiological functions but also because the paradigms for genetic causality in biological systems are seriously confused. This paper examines some of the misconceptions, starting with the changing definitions of a gene, from the cause of phenotype characters to the stretches of DNA. I then assess whether the 'digital' nature of DNA sequences guarantees primacy in causation compared to non-DNA inheritance, whether it is meaningful or useful to refer to genetic programs, and the role of high-level (downward) causation. The metaphors that served us well during the molecular biological phase of recent decades have limited or even misleading impacts in the multilevel world of systems biology. New paradigms are needed if we are to succeed in unravelling multifactorial genetic causation at higher levels of physiological function and so to explain the phenomena that genetics was originally about. Because it can solve the 'genetic differential effect problem', modelling of biological function has an essential role to play in unravelling genetic causation.

  16. XLMR genes: Update 1996

    SciTech Connect

    Lubs, H.A.; Tranebjaerg, L.; Arena, J.F.


    A current list of all known forms of X-linked mental retardation (XLMR) and a slightly revised classification are presented. The number of known disorders has not increased because 6 disorders have been combined based on new molecular data or on clinical grounds and only 6 newly described XLMR disorders have been reported. Of the current 105 XLMR disorders, 34 have been mapped, and 18 disorders and 1 non-specific XLMR (FRAXE) have been cloned. The number of families with nonspecific XLMR with a LOD score of {ge}2.0 has more than doubled, with 42 (including FRAXE) now being known. A summary of the localization of presumed nonspecific mental retardation (MR) genes from well-studied X-chromosomal translocations and deletions is also included. Only 10-12 nonoverlapping loci are required to explain all localizations of non-specific MR from both approaches. These new trends mark the beginning of a significantly improved understanding of the role of genes on the X chromosome in producing MR. Continued close collaboration between clinical and molecular investigators will be required to complete the process. 105 refs., 2 figs., 6 tabs.

  17. Alcoholism: genes and mechanisms.


    Oroszi, Gabor; Goldman, David


    Alcoholism is a chronic relapsing/remitting disease that is frequently unrecognized and untreated, in part because of the partial efficacy of treatment. Only approximately one-third of patients remain abstinent and one-third have fully relapsed 1 year after withdrawal from alcohol, with treated patients doing substantially better than untreated [1]. The partial effectiveness of strategies for prevention and treatment, and variation in clinical course and side effects, represent a challenge and an opportunity to better understand the neurobiology of addiction. The strong heritability of alcoholism suggests the existence of inherited functional variants of genes that alter the metabolism of alcohol and variants of other genes that alter the neurobiologies of reward, executive cognitive function, anxiety/dysphoria, and neuronal plasticity. Each of these neurobiologies has been identified as a critical domain in the addictions. Functional alleles that alter alcoholism-related intermediate phenotypes include common alcohol dehydrogenase 1B and aldehyde dehydrogenase 2 variants that cause the aversive flushing reaction; catechol-O-methyltransferase (COMT) Val158Met leading to differences in three aspects of neurobiology: executive cognitive function, stress/anxiety response, and opioid function; opioid receptor micro1 (OPRM1) Asn40Asp, which may serve as a gatekeeper molecule in the action of naltrexone, a drug used in alcoholism treatment; and HTTLPR, which alters serotonin transporter function and appears to affect stress response and anxiety/dysphoria, which are factors relevant to initial vulnerability, the process of addiction, and relapse.

  18. Regulation of gene expression by Goodwin's loop with many genes

    NASA Astrophysics Data System (ADS)

    Sielewiesiuk, Jan; Łopaciuk, Agata


    The paper presents a simple analysis of a long Goodwin's loop containing many genes. The genes form a closed series. The rate of transcription of any gene is up or down regulated by theprotein product of the preceding gene. We describe the loop with a system of ordinary differential equations of order s. Oscillatory solutions of the system are possible at the odd number of repressions and any number of inductions if the product of all Hill's coefficients, related to both repressions and inductions, is larger than:

  19. Entrez Gene: gene-centered information at NCBI.


    Maglott, Donna; Ostell, Jim; Pruitt, Kim D; Tatusova, Tatiana


    Entrez Gene ( is NCBI's database for gene-specific information. It does not include all known or predicted genes; instead Entrez Gene focuses on the genomes that have been completely sequenced, that have an active research community to contribute gene-specific information, or that are scheduled for intense sequence analysis. The content of Entrez Gene represents the result of curation and automated integration of data from NCBI's Reference Sequence project (RefSeq), from collaborating model organism databases, and from many other databases available from NCBI. Records are assigned unique, stable and tracked integers as identifiers. The content (nomenclature, map location, gene products and their attributes, markers, phenotypes, and links to citations, sequences, variation details, maps, expression, homologs, protein domains and external databases) is updated as new information becomes available. Entrez Gene is a step forward from NCBI's LocusLink, with both a major increase in taxonomic scope and improved access through the many tools associated with NCBI Entrez.

  20. Gene: a gene-centered information resource at NCBI.


    Brown, Garth R; Hem, Vichet; Katz, Kenneth S; Ovetsky, Michael; Wallin, Craig; Ermolaeva, Olga; Tolstoy, Igor; Tatusova, Tatiana; Pruitt, Kim D; Maglott, Donna R; Murphy, Terence D


    The National Center for Biotechnology Information's (NCBI) Gene database ( integrates gene-specific information from multiple data sources. NCBI Reference Sequence (RefSeq) genomes for viruses, prokaryotes and eukaryotes are the primary foundation for Gene records in that they form the critical association between sequence and a tracked gene upon which additional functional and descriptive content is anchored. Additional content is integrated based on the genomic location and RefSeq transcript and protein sequence data. The content of a Gene record represents the integration of curation and automated processing from RefSeq, collaborating model organism databases, consortia such as Gene Ontology, and other databases within NCBI. Records in Gene are assigned unique, tracked integers as identifiers. The content (citations, nomenclature, genomic location, gene products and their attributes, phenotypes, sequences, interactions, variation details, maps, expression, homologs, protein domains and external databases) is available via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programming utilities (E-Utilities and Entrez Direct) and for bulk transfer by FTP.

  1. Gene repair and transposon-mediated gene therapy.


    Richardson, Paul D; Augustin, Lance B; Kren, Betsy T; Steer, Clifford J


    The main strategy of gene therapy has traditionally been focused on gene augmentation. This approach typically involves the introduction of an expression system designed to express a specific protein in the transfected cell. Both the basic and clinical sciences have generated enough information to suggest that gene therapy would eventually alter the fundamental practice of modern medicine. However, despite progress in the field, widespread clinical applications and success have not been achieved. The myriad deficiencies associated with gene augmentation have resulted in the development of alternative approaches to treat inherited and acquired genetic disorders. One, derived primarily from the pioneering work of homologous recombination, is gene repair. Simply stated, the process involves targeting the mutation in situ for gene correction and a return to normal gene function. Site-specific genetic repair has many advantages over augmentation although it too is associated with significant limitations. This review outlines the advantages and disadvantages of gene correction. In particular, we discuss technologies based on chimeric RNA/DNA oligonucleotides, single-stranded and triplex-forming oligonucleotides, and small fragment homologous replacement. While each of these approaches is different, they all share a number of common characteristics, including the need for efficient delivery of nucleic acids to the nucleus. In addition, we review the potential application of a novel and exciting nonviral gene augmentation strategy--the Sleeping Beauty transposon system.

  2. Stratified gene expression analysis identifies major amyotrophic lateral sclerosis genes.


    Jones, Ashley R; Troakes, Claire; King, Andrew; Sahni, Vibhu; De Jong, Simone; Bossers, Koen; Papouli, Efterpi; Mirza, Muddassar; Al-Sarraj, Safa; Shaw, Christopher E; Shaw, Pamela J; Kirby, Janine; Veldink, Jan H; Macklis, Jeffrey D; Powell, John F; Al-Chalabi, Ammar


    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease of motor neurons resulting in progressive paralysis. Gene expression studies of ALS only rarely identify the same gene pathways as gene association studies. We hypothesized that analyzing tissues by matching on degree of disease severity would identify different patterns of gene expression from a traditional case-control comparison. We analyzed gene expression changes in 4 postmortem central nervous system regions, stratified by severity of motor neuron loss. An overall comparison of cases (n = 6) and controls (n = 3) identified known ALS gene, SOX5, as showing differential expression (log2 fold change = 0.09, p = 5.5 × 10(-5)). Analyses stratified by disease severity identified expression changes in C9orf72 (p = 2.77 × 10(-3)), MATR3 (p = 3.46 × 10(-3)), and VEGFA (p = 8.21 × 10(-4)), all implicated in ALS through genetic studies, and changes in other genes in pathways involving RNA processing and immune response. These findings suggest that analysis of gene expression stratified by disease severity can identify major ALS genes and may be more efficient than traditional case-control comparison.

  3. Screening for mutations in kidney-related genes using SURVEYOR nuclease for cleavage at heteroduplex mismatches.


    Voskarides, Konstantinos; Deltas, Constantinos


    SURVEYOR is a new mismatch-specific plant DNA endonuclease that is very efficient for mutation scanning in heteroduplex DNA. It is much faster, cheaper, more sensitive, and easier to perform than other "traditional" mutation detection methods such as single-strand conformation polymorphism analysis, denaturing high-performance liquid chromatography, heteroduplex analysis, and phage resolvases. This is the first comprehensive report on the use of SURVEYOR for screening genes implicated in a spectrum of inherited renal diseases. Of the 48.2 kb screened, 44 variations were identified, accounting for one variation per 1.1 kb. The re-sequencing of multiple samples did not reveal any variation that had not been identified by SURVEYOR, attesting to its high fidelity. Additionally, we tested this enzyme against 15 known variants, 14 of which it identified, thus showing a sensitivity of 93%. We showed that the genetic heterogeneity of renal diseases can be easily overcome using this enzyme with a high degree of confidence and no bias for any specific variations. We also showed for the first time that SURVEYOR does not demonstrate any preference regarding mismatch cleavage at specific positions. Disadvantages of using SURVEYOR include enhanced exonucleolytic activity for some polymerase chain reaction products and less than 100% sensitivity. We report that SURVEYOR can be used as a mutation detection method with a high degree of confidence, offering an excellent alternative for low-budget laboratories and for the rapid manipulation of multiple genes.

  4. Gene replacement in Lactobacillus helveticus.

    PubMed Central

    Bhowmik, T; Fernández, L; Steele, J L


    An efficient method for gene replacement in Lactobacillus helveticus CNRZ32 was developed by utilizing pSA3 as an integration vector. This plasmid is stably maintained in CNRZ32 at 37 degrees C but is unstable at 45 degrees C. This method consisted of a two-step gene-targeting technique: (i) chromosomal integration of a plasmid carrying an internal deletion in the gene of interest via homologous recombination and (ii) excision of the vector and the wild-type gene via homologous recombination, resulting in gene replacement. By using this procedure, the chromosomal X-prolyl dipeptidyl aminopeptidase gene (pepXP) of CNRZ32 was successfully inactivated. Images PMID:8104928

  5. Gene therapy for psychiatric disorders.


    Gelfand, Yaroslav; Kaplitt, Michael G


    Gene therapy has become of increasing interest in clinical neurosurgery with the completion of numerous clinical trials for Parkinson disease, Alzheimer disease, and pediatric genetic disorders. With improved understanding of the dysfunctional circuitry mediating various psychiatric disorders, deep brain stimulation for refractory psychiatric diseases is being increasingly explored in human patients. These factors are likely to facilitate development of gene therapy for psychiatric diseases. Because delivery of gene therapy agents would require the same surgical techniques currently being employed for deep brain stimulation, neurosurgeons are likely to lead the development of this field, as has occurred in other areas of clinical gene therapy for neurologic disorders. We review the current state of gene therapy for psychiatric disorders and focus specifically on particular areas of promising research that may translate into human trials for depression, drug addiction, obsessive-compulsive disorder, and schizophrenia. Issues that are relatively unique to psychiatric gene therapy are also discussed.

  6. Daily oscillation of gene expression in the retina is phase-advanced with respect to the pineal gland.


    Bai, Lin; Zimmer, Sybille; Rickes, Oliver; Rohleder, Nils; Holthues, Heike; Engel, Lydia; Leube, Rudolf; Spessert, Rainer


    The photoreceptive retina and the non-photoreceptive pineal gland are components of the circadian and the melatonin forming system in mammals. To contribute to our understanding of the functional integrity of the circadian system and the melatonin forming system we have compared the daily oscillation of the two tissues under various seasonal lighting conditions. For this purpose, the 24-h profiles of the expression of the genes coding for arylalkylamine N-acetyltransferase (AA-NAT), nerve growth factor inducible gene-A (NGFI-A), nerve growth factor inducible gene-B (NGFI-B), retinoic acid related orphan receptor beta (RORbeta), dopamine D4 receptor, and period2 (Per2) have been simultaneously recorded in the retina and the pineal gland of rats under short day (light/dark 8:16) and long day (light/dark 16:8) conditions. We have found that the cyclical patterns of all genes are phase-advanced in the retina, often with a lengthened temporal interval under short day conditions. In both tissues, the AA-NAT gene expression represents an indication of the output of the relevant pacemakers. The temporal phasing in the AA-NAT transcript amount between the retina and the pineal gland is retained under constant darkness suggesting that the intrinsic self-cycling clock of the retina oscillates in a phase-advanced manner with respect to the self-cycling clock in the suprachiasmatic nucleus, which controls the pineal gland. We therefore conclude that daily rhythms in gene expression in the retina are phase-advanced with respect to the pineal gland, and that the same temporal relationship appears to be valid for the self-cycling clocks influencing the tissues.

  7. Gene therapy for malignant glioma.


    Okura, Hidehiro; Smith, Christian A; Rutka, James T


    Glioblastoma multiforme (GBM) is the most frequent and devastating primary brain tumor in adults. Despite current treatment modalities, such as surgical resection followed by chemotherapy and radiotherapy, only modest improvements in median survival have been achieved. Frequent recurrence and invasiveness of GBM are likely due to the resistance of glioma stem cells to conventional treatments; therefore, novel alternative treatment strategies are desperately needed. Recent advancements in molecular biology and gene technology have provided attractive novel treatment possibilities for patients with GBM. Gene therapy is defined as a technology that aims to modify the genetic complement of cells to obtain therapeutic benefit. To date, gene therapy for the treatment of GBM has demonstrated anti-tumor efficacy in pre-clinical studies and promising safety profiles in clinical studies. However, while this approach is obviously promising, concerns still exist regarding issues associated with transduction efficiency, viral delivery, the pathologic response of the brain, and treatment efficacy. Tumor development and progression involve alterations in a wide spectrum of genes, therefore a variety of gene therapy approaches for GBM have been proposed. Improved viral vectors are being evaluated, and the potential use of gene therapy alone or in synergy with other treatments against GBM are being studied. In this review, we will discuss the most commonly studied gene therapy approaches for the treatment of GBM in preclinical and clinical studies including: prodrug/suicide gene therapy; oncolytic gene therapy; cytokine mediated gene therapy; and tumor suppressor gene therapy. In addition, we review the principles and mechanisms of current gene therapy strategies as well as advantages and disadvantages of each.

  8. Gene therapy in metachromatic leukodystrophy.


    Sevin, C; Cartier-Lacave, N; Aubourg, P


    Metachromatic leukodystrophy (MLD) is a lysosomal storage disease caused by deficiency of the lysosomal enzyme arylsulfatase A. Deficiency of this enzyme results in intralysosomal storage of sphingolipid cerebroside 3-sulfates (sulfatides), which are abundant in myelin and neurons. A pathological hallmark of MLD is demyelination and neurodegeneration, causing various and ultimately lethal neurological symptoms. This review discusses the potential therapeutic application of hematopoietic stem cell gene therapy and intracerebral gene transfer (brain gene therapy) in patients with MLD.

  9. A genetic ensemble approach for gene-gene interaction identification

    PubMed Central


    Background It has now become clear that gene-gene interactions and gene-environment interactions are ubiquitous and fundamental mechanisms for the development of complex diseases. Though a considerable effort has been put into developing statistical models and algorithmic strategies for identifying such interactions, the accurate identification of those genetic interactions has been proven to be very challenging. Methods In this paper, we propose a new approach for identifying such gene-gene and gene-environment interactions underlying complex diseases. This is a hybrid algorithm and it combines genetic algorithm (GA) and an ensemble of classifiers (called genetic ensemble). Using this approach, the original problem of SNP interaction identification is converted into a data mining problem of combinatorial feature selection. By collecting various single nucleotide polymorphisms (SNP) subsets as well as environmental factors generated in multiple GA runs, patterns of gene-gene and gene-environment interactions can be extracted using a simple combinatorial ranking method. Also considered in this study is the idea of combining identification results obtained from multiple algorithms. A novel formula based on pairwise double fault is designed to quantify the degree of complementarity. Conclusions Our simulation study demonstrates that the proposed genetic ensemble algorithm has comparable identification power to Multifactor Dimensionality Reduction (MDR) and is slightly better than Polymorphism Interaction Analysis (PIA), which are the two most popular methods for gene-gene interaction identification. More importantly, the identification results generated by using our genetic ensemble algorithm are highly complementary to those obtained by PIA and MDR. Experimental results from our simulation studies and real world data application also confirm the effectiveness of the proposed genetic ensemble algorithm, as well as the potential benefits of combining identification

  10. Using Genes to Guide Prescriptions


    ... Medical Sciences - Basic Discoveries for Better Health Site Map Staff Search My Order ... > Science Education > Inside Life Science > Using Genes to Guide Prescriptions Inside Life Science View All ...

  11. MEIS homeobox genes in neuroblastoma.


    Geerts, Dirk; Revet, Ingrid; Jorritsma, Gerda; Schilderink, Nathalie; Versteeg, Rogier


    The common pediatric tumor neuroblastoma originates from primitive neural crest-derived precursor cells of the peripheral nervous system. Neuroblastoma especially affects very young children, and can already be present at birth. Its early onset and cellular origin predict the involvement of developmental control genes in neuroblastoma etiology. These genes are indispensable for the tight regulation of normal embryonic development but as a consequence cause cancer and congenital diseases upon mutation or aberrant expression. To date however, the connotation of these genes in neuroblastoma pathogenesis is scant. This review recapitulates data on the MEIS homeobox control genes in cancer and focuses on neuroblastoma.

  12. The search for essential genes.


    Reich, K A


    The bacterial genomic era began with the publication of the chromosomal sequence of Haemophilus influenzae. As few of the observed genes had been examined experimentally, functional assignments were made by comparative analysis and for many genes no annotation could be made. This mini-review briefly describes the genomic-scale experimental approaches being used to identify genes required for the growth of microorganisms. Identifying 'essential genes', the simplest possible annotation for the unknown open reading frames, is important for antibacterial and antifungal research and is a first step to defining the minimum functional requirement for autonomous growth.

  13. Discovering modulators of gene expression

    PubMed Central

    Babur, Özgün; Demir, Emek; Gönen, Mithat; Sander, Chris; Dogrusoz, Ugur


    Proteins that modulate the activity of transcription factors, often called modulators, play a critical role in creating tissue- and context-specific gene expression responses to the signals cells receive. GEM (Gene Expression Modulation) is a probabilistic framework that predicts modulators, their affected targets and mode of action by combining gene expression profiles, protein–protein interactions and transcription factor–target relationships. Using GEM, we correctly predicted a significant number of androgen receptor modulators and observed that most modulators can both act as co-activators and co-repressors for different target genes. PMID:20466809

  14. Copyright and gene technology.


    Coke, Sue


    The rapid growth of gene technology and its commercialisation raises concerns for scientific researchers and research institutions wishing to place information in the public domain. This article examines whether copyright laws in the United States, United Kingdom and Australia provide any protection for genetically modified DNA, proteins, and genetically modified organisms, in contrast with any copyright protection extending to a record of the lettering of a sequence representing a series of nucleotides of modified DNA or the amino acids comprising a protein. Whilst it is arguable that protection may be available in the United States and the United Kingdom, it is submitted that it would be difficult to persuade a court in Australia that genetically modified DNA and genetically modified organisms directly constitute "literary" or "artistic" works.

  15. Introduction: Cancer Gene Networks.


    Clarke, Robert


    Constructing, evaluating, and interpreting gene networks generally sits within the broader field of systems biology, which continues to emerge rapidly, particular with respect to its application to understanding the complexity of signaling in the context of cancer biology. For the purposes of this volume, we take a broad definition of systems biology. Considering an organism or disease within an organism as a system, systems biology is the study of the integrated and coordinated interactions of the network(s) of genes, their variants both natural and mutated (e.g., polymorphisms, rearrangements, alternate splicing, mutations), their proteins and isoforms, and the organic and inorganic molecules with which they interact, to execute the biochemical reactions (e.g., as enzymes, substrates, products) that reflect the function of that system. Central to systems biology, and perhaps the only approach that can effectively manage the complexity of such systems, is the building of quantitative multiscale predictive models. The predictions of the models can vary substantially depending on the nature of the model and its inputoutput relationships. For example, a model may predict the outcome of a specific molecular reaction(s), a cellular phenotype (e.g., alive, dead, growth arrest, proliferation, and motility), a change in the respective prevalence of cell or subpopulations, a patient or patient subgroup outcome(s). Such models necessarily require computers. Computational modeling can be thought of as using machine learning and related tools to integrate the very high dimensional data generated from modern, high throughput omics technologies including genomics (next generation sequencing), transcriptomics (gene expression microarrays; RNAseq), metabolomics and proteomics (ultra high performance liquid chromatography, mass spectrometry), and "subomic" technologies to study the kinome, methylome, and others. Mathematical modeling can be thought of as the use of ordinary

  16. Genes, evolution and intelligence.


    Bouchard, Thomas J


    I argue that the g factor meets the fundamental criteria of a scientific construct more fully than any other conception of intelligence. I briefly discuss the evidence regarding the relationship of brain size to intelligence. A review of a large body of evidence demonstrates that there is a g factor in a wide range of species and that, in the species studied, it relates to brain size and is heritable. These findings suggest that many species have evolved a general-purpose mechanism (a general biological intelligence) for dealing with the environments in which they evolved. In spite of numerous studies with considerable statistical power, we know of very few genes that influence g and the effects are very small. Nevertheless, g appears to be highly polygenic. Given the complexity of the human brain, it is not surprising that that one of its primary faculties-intelligence-is best explained by the near infinitesimal model of quantitative genetics.

  17. Gene therapy for hemophilia.


    Rogers, Geoffrey L; Herzog, Roland W


    Hemophilia is an X-linked inherited bleeding disorder consisting of two classifications, hemophilia A and hemophilia B, depending on the underlying mutation. Although the disease is currently treatable with intravenous delivery of replacement recombinant clotting factor, this approach represents a significant cost both monetarily and in terms of quality of life. Gene therapy is an attractive alternative approach to the treatment of hemophilia that would ideally provide life-long correction of clotting activity with a single injection. In this review, we will discuss the multitude of approaches that have been explored for the treatment of both hemophilia A and B, including both in vivo and ex vivo approaches with viral and nonviral delivery vectors.

  18. Gene therapy for deafness.


    Kohrman, D C; Raphael, Y


    Hearing loss is the most common sensory deficit in humans and can result from genetic, environmental or combined etiologies that prevent normal function of the cochlea, the peripheral sensory organ. Recent advances in understanding the genetic pathways that are critical for the development and maintenance of cochlear function, as well as the molecular mechanisms that underlie cell trauma and death, have provided exciting opportunities for modulating these pathways to correct genetic mutations, to enhance the endogenous protective pathways for hearing preservation and to regenerate lost sensory cells with the possibility of ameliorating hearing loss. A number of recent animal studies have used gene-based therapies in innovative ways toward realizing these goals. With further refinement, some of the protective and regenerative approaches reviewed here may become clinically applicable.

  19. Gene-gene Interaction Analyses for Atrial Fibrillation

    PubMed Central

    Lin, Honghuang; Mueller-Nurasyid, Martina; Smith, Albert V.; Arking, Dan E.; Barnard, John; Bartz, Traci M.; Lunetta, Kathryn L.; Lohman, Kurt; Kleber, Marcus E.; Lubitz, Steven A.; Geelhoed, Bastiaan; Trompet, Stella; Niemeijer, Maartje N.; Kacprowski, Tim; Chasman, Daniel I.; Klarin, Derek; Sinner, Moritz F.; Waldenberger, Melanie; Meitinger, Thomas; Harris, Tamara B.; Launer, Lenore J.; Soliman, Elsayed Z.; Chen, Lin Y.; Smith, Jonathan D.; Van Wagoner, David R.; Rotter, Jerome I.; Psaty, Bruce M.; Xie, Zhijun; Hendricks, Audrey E.; Ding, Jingzhong; Delgado, Graciela E.; Verweij, Niek; van der Harst, Pim; Macfarlane, Peter W.; Ford, Ian; Hofman, Albert; Uitterlinden, André; Heeringa, Jan; Franco, Oscar H.; Kors, Jan A.; Weiss, Stefan; Völzke, Henry; Rose, Lynda M.; Natarajan, Pradeep; Kathiresan, Sekar; Kääb, Stefan; Gudnason, Vilmundur; Alonso, Alvaro; Chung, Mina K.; Heckbert, Susan R.; Benjamin, Emelia J.; Liu, Yongmei; März, Winfried; Rienstra, Michiel; Jukema, J. Wouter; Stricker, Bruno H.; Dörr, Marcus; Albert, Christine M.; Ellinor, Patrick T.


    Atrial fibrillation (AF) is a heritable disease that affects more than thirty million individuals worldwide. Extensive efforts have been devoted to the study of genetic determinants of AF. The objective of our study is to examine the effect of gene-gene interaction on AF susceptibility. We performed a large-scale association analysis of gene-gene interactions with AF in 8,173 AF cases, and 65,237 AF-free referents collected from 15 studies for discovery. We examined putative interactions between genome-wide SNPs and 17 known AF-related SNPs. The top interactions were then tested for association in an independent cohort for replication, which included more than 2,363 AF cases and 114,746 AF-free referents. One interaction, between rs7164883 at the HCN4 locus and rs4980345 at the SLC28A1 locus, was found to be significantly associated with AF in the discovery cohorts (interaction OR = 1.44, 95% CI: 1.27–1.65, P = 4.3 × 10–8). Eight additional gene-gene interactions were also marginally significant (P < 5 × 10–7). However, none of the top interactions were replicated. In summary, we did not find significant interactions that were associated with AF susceptibility. Future increases in sample size and denser genotyping might facilitate the identification of gene-gene interactions associated with AF. PMID:27824142

  20. Why are essential genes essential? - The essentiality of Saccharomyces genes

    PubMed Central

    Zhang, Zhaojie; Ren, Qun


    Essential genes are defined as required for the survival of an organism or a cell. They are of particular interests, not only for their essential biological functions, but also in practical applications, such as identifying effective drug targets to pathogenic bacteria and fungi. The budding yeast Saccharomyces cerevisiae has approximately 6,000 open reading frames, 15 to 20% of which are deemed as essential. Some of the essential genes, however, appear to perform non-essential functions, such as aging and cell death, while many of the non-essential genes play critical roles in cell survival. In this paper, we reviewed and analyzed the levels of essentiality of the Saccharomyces cerevisiae genes and have grouped the genes into four categories: (1) Conditional essential: essential only under certain circumstances or growth conditions; (2) Essential: required for survival under optimal growth conditions; (3) Redundant essential: synthetic lethal due to redundant pathways or gene duplication; and (4) Absolute essential: the minimal genes required for maintaining a cellular life under a stress-free environment. The essential and non-essential functions of the essential genes were further analyzed. PMID:28357303

  1. Peripheral circadian clocks are diversely affected by adrenalectomy.


    Soták, M; Bryndová, J; Ergang, P; Vagnerová, K; Kvapilová, P; Vodička, M; Pácha, J; Sumová, A


    Glucocorticoids are considered to synchronize the rhythmicity of clock genes in peripheral tissues; however, the role of circadian variations of endogenous glucocorticoids is not well defined. In the present study, we examined whether peripheral circadian clocks were impaired by adrenalectomy. To achieve this, we tested the circadian rhythmicity of core clock genes (Bmal1, Per1-3, Cry1, RevErbα, Rora), clock-output genes (Dbp, E4bp4) and a glucocorticoid- and clock-controlled gene (Gilz) in liver, jejunum, kidney cortex, splenocytes and visceral adipose tissue (VAT). Adrenalectomy did not affect the phase of clock gene rhythms but distinctly modulated clock gene mRNA levels, and this effect was partially tissue-dependent. Adrenalectomy had a significant inhibitory effect on the level of Per1 mRNA in VAT, liver and jejunum, but not in kidney and splenocytes. Similarly, adrenalectomy down-regulated mRNA levels of Per2 in splenocytes and VAT, Per3 in jejunum, RevErbα in VAT and Dbp in VAT, kidney and splenocytes, whereas the mRNA amounts of Per1 and Per2 in kidney and Per3 in VAT and splenocytes were up-regulated. On the other hand, adrenalectomy had minimal effects on Rora and E4bp4 mRNAs. Adrenalectomy also resulted in decreased level of Gilz mRNA but did not alter the phase of its diurnal rhythm. Collectively, these findings suggest that adrenalectomy alters the mRNA levels of core clock genes and clock-output genes in peripheral organs and may cause tissue-specific modulations of their circadian profiles, which are reflected in changes of the amplitudes but not phases. Thus, the circulating corticosteroids are necessary for maintaining the high-amplitude rhythmicity of the peripheral clocks in a tissue-specific manner.

  2. Altered energy intake and the amplitude of the body temperature rhythm are associated with changes in phase, but not amplitude, of clock gene expression in the rat suprachiasmatic nucleus in vivo.


    Goh, Grace H; Mark, Peter J; Maloney, Shane K


    Circadian rhythms in mammals are driven by a central clock in the suprachiasmatic nucleus (SCN). In vitro, temperature cycles within the physiological range can act as potent entraining cues for biological clocks. We altered the body temperature (Tc) rhythm in rats by manipulating energy intake (EI) to determine whether EI-induced changes in Tc oscillations are associated with changes in SCN clock gene rhythms in vivo. Male Wistar rats (n = 16 per diet) were maintained on either an ad libitum diet (CON), a high energy cafeteria diet (CAF), or a calorie restricted diet (CR), and Tc was recorded every 30 min for 6-7 weeks. SCN tissue was harvested from rats at zeitgeber time (ZT) 0, ZT6, ZT12, or ZT18. Expression of the clock genes Bmal1, Per2, Cry1, and Rev-erbα, the heat shock transcription factor Hsf1, and the heat shock protein Hsp90aa1, were determined using qPCR. The circadian profile of gene expression for each gene was characterized using cosinor analysis. Compared to the CON rats, the amplitude of Tc was decreased in CAF rats by 0.1 °C (p < 0.001), and increased in CR rats by 0.3 °C (p < 0.001). The amplitude of Hsp90aa1 expression was lowest in CAF rats and highest in CR rats (p = 0.045), but the amplitude of all of the clock genes and Hsf1 were unaffected by diet (p > 0.25). Compared to CON, phase advances of the Tc, Bmal1, and Per2 rhythms were observed with CR feeding (p < 0.05), but CAF feeding elicited no significant changes in phase. The present results indicate that in vivo, the SCN is largely resistant to entrainment by EI-induced changes in the Tc rhythm, although some phase entrainment may occur.

  3. Apoptotic genes in cancer therapy.


    Opalka, Bertram; Dickopp, Alexandra; Kirch, Hans-Christoph


    Induction of apoptosis in malignant cells is a major goal of cancer therapy in general and of certain cancer gene therapy strategies in particular. Numerous apoptosis-regulating genes have been evaluated for this purpose. Besides the most prominent p53 gene others include p16, p21, p27, E2F genes, FHIT, PTEN and CASPASE genes. Recently, the potential for therapy of an adenoviral gene, E1A, known for a long time for its apoptosis-inducing activity, has been discovered. In experimental settings, these genes have proven their tumor-suppressive and apoptosis-inducing activity. Clinical trials are currently being performed with selected genes. By far the most studies transfer the p53 gene using retro- or adenoviral vectors. Disease stabilization or other benefits were observed in a limited number of patients when p53 was applied alone or in combination with cytotoxic drugs. A second proapoptotic gene that has entered clinical trials is adenovirus E1A. Here, too, disease stabilization as well as/or local regression in one case have been demonstrated in selected patients. In all cases, side effects were tolerable. To further improve E1A as a therapeutic transgene, we have deleted transforming domains from the adenovirus 5 and 12 13S cDNAs. Mutants were derived which had completely lost their transforming activity in combination with the E1B oncogene but retained a pronounced tumor-suppressive activity. Cells transduced with these constructs showed a highly reduced ability to grow in soft agar, and tumor growth in nude mice could be substantially suppressed. Outgrowing tumors had lost E1A expression when analyzed in Western blots. These E1A constructs may represent valuable tools for cancer gene therapy in the future.

  4. Indirect effects of glucagon-like peptide-1 receptor agonist exendin-4 on the peripheral circadian clocks in mice.


    Ando, Hitoshi; Ushijima, Kentarou; Fujimura, Akio


    Circadian clocks in peripheral tissues are powerfully entrained by feeding. The mechanisms underlying this food entrainment remain unclear, although various humoral and neural factors have been reported to affect peripheral clocks. Because glucagon-like peptide-1 (GLP-1), which is rapidly secreted in response to food ingestion, influences multiple humoral and neural signaling pathways, we suggest that GLP-1 plays a role in the food entrainment of peripheral clocks. To test this, we compared the effects of exendin-4, a GLP-1 receptor agonist, on mRNA expression of the clock genes (Clock, Bmal1, Nr1d1, Per1, Per2, and Cry1) with those of refeeding. In addition, we investigated whether exendin-4 could affect the rhythms of the peripheral clocks. In male C57BL/6J mice, although refeeding rapidly (within 2 h) altered mRNA levels of Per1 and Per2 in the liver and that of Per1 in adipose tissue, a single i.p. injection of exendin-4 did not cause such changes. However, unlike the GLP-1 receptor antagonist exendin-(9-39), exendin-4 significantly influenced Per1 mRNA levels in the liver at 12 h after injection. Moreover, pretreatment with exendin-4 affected the rapid-feeding-induced change in Per1 not only in the liver, but also in adipose tissue, without effect on food intake. Furthermore, during light-phase restricted feeding, repeated dosing of exendin-4 at the beginning of the dark phase profoundly influenced both the food intake and daily rhythms of clock gene expression in peripheral tissues. Thus, these results suggest that exendin-4 modulates peripheral clocks via multiple mechanisms different from those of refeeding.

  5. Gene-centric view on the human proteome project: the example of the Russian roadmap for chromosome 18.


    Archakov, Alexander; Aseev, Alexander; Bykov, Victor; Grigoriev, Anatoly; Govorun, Vadim; Ivanov, Vadim; Khlunov, Alexander; Lisitsa, Andrey; Mazurenko, Sergey; Makarov, Alexander A; Ponomarenko, Elena; Sagdeev, Renad; Skryabin, Konstantin


    During the 2010 Human Proteome Organization Congress in Sydney, a gene-centric approach emerged as a feasible and tractable scaffold for assemblage of the Human Proteome Project. Bringing the gene-centric principle into practice, a roadmap for the 18th chromosome was drafted, postulating the limited sensitivity of analytical methods, as a serious bottleneck in proteomics. In the context of the sensitivity problem, we refer to the "copy number of protein molecules" as a measurable assessment of protein abundance. The roadmap is focused on the development of technology to attain the low- and ultralow -"copied" portion of the proteome. Roadmap merges the genomic, transcriptomic and proteomic levels to identify the majority of 285 proteins from 18th chromosome - master proteins. Master protein is the primary translation of the coding sequence and resembling at least one of the known isoforms, coded by the gene. The executive phase of the roadmap includes the expansion of the study of the master proteins with alternate splicing, single amino acid polymorphisms (SAPs) and post-translational modifications. In implementing the roadmap, Russian scientists are expecting to establish proteomic technologies for integrating MS and atomic force microscopy (AFM). These technologies are anticipated to unlock the value of new biomarkers at a detection limit of 10(-18) M, i.e. 1 protein copy per 1 μL of plasma. The roadmap plan is posted at and a forum for discussion of the document is supported.

  6. Feeding cycle-dependent circulating insulin fluctuation is not a dominant Zeitgeber for mouse peripheral clocks except in the liver: Differences between endogenous and exogenous insulin effects.


    Oishi, Katsutaka; Yasumoto, Yuki; Higo-Yamamoto, Sayaka; Yamamoto, Saori; Ohkura, Naoki


    The master clock in the suprachiasmatic nucleus synchronizes peripheral clocks via humoral and neural signals in mammals. Insulin is thought to be a critical Zeitgeber (synchronizer) for peripheral clocks because it induces transient clock gene expression in cultured cells. However, the extent to which fluctuations in feeding-dependent endogenous insulin affect the temporal expression of clock genes remains unclear. We therefore investigated the temporal expression profiles of clock genes in the peripheral tissues of mice fed for 8 h during either the daytime (DF) or the nighttime (NF) for one week to determine the involvement of feeding cycle-dependent endogenous insulin rhythms in the circadian regulation of peripheral clocks. The phase of circulating insulin fluctuations was reversed in DF compared with NF mice, although those of circulating corticosterone fluctuations and nocturnal locomotor activity were identical between these mice. The reversed feeding cycle affected the circadian phases of Per1 and Per2 gene expression in the liver and not in heart, lung, white adipose and skeletal muscle tissues. On the other hand, injected exogenous insulin significantly induced Akt phosphorylation in the heart and skeletal muscle as well as the liver, and significantly induced Per1 and Per2 gene expression in all examined tissues. These findings suggest that feeding cycles and feeding cycle-dependent endogenous insulin fluctuations are not dominant entrainment signals for peripheral clocks other than the liver, although exogenous insulin might reset peripheral oscillators in mammals.

  7. Susceptibility Genes in Thyroid Autoimmunity

    PubMed Central

    Ban, Yoshiyuki; Tomer, Yaron


    The autoimmune thyroid diseases (AITD) are complex diseases which are caused by an interaction between susceptibility genes and environmental triggers. Genetic susceptibility in combination with external factors (e.g. dietary iodine) is believed to initiate the autoimmune response to thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITD. Various techniques have been employed to identify the genes contributing to the etiology of AITD, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions) that are linked with AITD, and in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to Graves' disease (GD) and Hashimoto's thyroiditis (HT) and some are common to both the diseases, indicating that there is a shared genetic susceptibility to GD and HT. The putative GD and HT susceptibility genes include both immune modifying genes (e.g. HLA, CTLA-4) and thyroid specific genes (e.g. TSHR, Tg). Most likely, these loci interact and their interactions may influence disease phenotype and severity. PMID:15712599

  8. Gene therapy on the move

    PubMed Central

    Kaufmann, Kerstin B; Büning, Hildegard; Galy, Anne; Schambach, Axel; Grez, Manuel


    The first gene therapy clinical trials were initiated more than two decades ago. In the early days, gene therapy shared the fate of many experimental medicine approaches and was impeded by the occurrence of severe side effects in a few treated patients. The understanding of the molecular and cellular mechanisms leading to treatment- and/or vector-associated setbacks has resulted in the development of highly sophisticated gene transfer tools with improved safety and therapeutic efficacy. Employing these advanced tools, a series of Phase I/II trials were started in the past few years with excellent clinical results and no side effects reported so far. Moreover, highly efficient gene targeting strategies and site-directed gene editing technologies have been developed and applied clinically. With more than 1900 clinical trials to date, gene therapy has moved from a vision to clinical reality. This review focuses on the application of gene therapy for the correction of inherited diseases, the limitations and drawbacks encountered in some of the early clinical trials and the revival of gene therapy as a powerful treatment option for the correction of monogenic disorders. PMID:24106209

  9. HOX genes in ovarian cancer.


    Kelly, Zoë L; Michael, Agnieszka; Butler-Manuel, Simon; Pandha, Hardev S; Morgan, Richard Gl


    The HOX genes are a family of homeodomain-containing transcription factors that determine cellular identity during development. Here we review a number of recent studies showing that HOX genes are strongly expressed in ovarian cancer, and that in some cases the expression of specific HOX genes is sufficient to confer a particular identity and phenotype upon cancer cells. We also review the recent advances in elucidating the different functions of HOX genes in ovarian cancer. A literature search was performed using the search terms HOX genes (including specific HOX genes), ovarian cancer and oncogenesis. Articles were accessed through searches performed in ISI Web of Knowledge, PubMed and ScienceDirect. Taken together, these studies have shown that HOX genes play a role in the oncogenesis of ovarian cancer and function in the inhibition of apoptosis, DNA repair and enhanced cell motility. The function of HOX genes in ovarian cancer oncogenesis supports their potential role as prognostic and diagnostic markers, and as therapeutic targets in this disease.

  10. Method of controlling gene expression


    Peters, Norman K.; Frost, John W.; Long, Sharon R.


    A method of controlling expression of a DNA segment under the control of a nod gene promoter which comprises administering to a host containing a nod gene promoter an amount sufficient to control expression of the DNA segment of a compound of the formula: ##STR1## in which each R is independently H or OH, is described.

  11. The flow of gene expression.


    Misteli, Tom


    Gene expression is a highly interconnected multistep process. A recent meeting in Iguazu Falls, Argentina, highlighted the need to uncover both the molecular details of each single step as well as the mechanisms of coordination among processes in order to fully understand the expression of genes.

  12. Candidate gene prioritization with Endeavour.


    Tranchevent, Léon-Charles; Ardeshirdavani, Amin; ElShal, Sarah; Alcaide, Daniel; Aerts, Jan; Auboeuf, Didier; Moreau, Yves


    Genomic studies and high-throughput experiments often produce large lists of candidate genes among which only a small fraction are truly relevant to the disease, phenotype or biological process of interest. Gene prioritization tackles this problem by ranking candidate genes by profiling candidates across multiple genomic data sources and integrating this heterogeneous information into a global ranking. We describe an extended version of our gene prioritization method, Endeavour, now available for six species and integrating 75 data sources. The performance (Area Under the Curve) of Endeavour on cross-validation benchmarks using 'gold standard' gene sets varies from 88% (for human phenotypes) to 95% (for worm gene function). In addition, we have also validated our approach using a time-stamped benchmark derived from the Human Phenotype Ontology, which provides a setting close to prospective validation. With this benchmark, using 3854 novel gene-phenotype associations, we observe a performance of 82%. Altogether, our results indicate that this extended version of Endeavour efficiently prioritizes candidate genes. The Endeavour web server is freely available at

  13. Determining Semantically Related Significant Genes.


    Taha, Kamal


    GO relation embodies some aspects of existence dependency. If GO term xis existence-dependent on GO term y, the presence of y implies the presence of x. Therefore, the genes annotated with the function of the GO term y are usually functionally and semantically related to the genes annotated with the function of the GO term x. A large number of gene set enrichment analysis methods have been developed in recent years for analyzing gene sets enrichment. However, most of these methods overlook the structural dependencies between GO terms in GO graph by not considering the concept of existence dependency. We propose in this paper a biological search engine called RSGSearch that identifies enriched sets of genes annotated with different functions using the concept of existence dependency. We observe that GO term xcannot be existence-dependent on GO term y, if x- and y- have the same specificity (biological characteristics). After encoding into a numeric format the contributions of GO terms annotating target genes to the semantics of their lowest common ancestors (LCAs), RSGSearch uses microarray experiment to identify the most significant LCA that annotates the result genes. We evaluated RSGSearch experimentally and compared it with five gene set enrichment systems. Results showed marked improvement.

  14. On meme--gene coevolution.


    Bull, L; Holland, O; Blackmore, S


    In this article we examine the effects of the emergence of a new replicator, memes, on the evolution of a pre-existing replicator, genes. Using a version of the NKCS model we examine the effects of increasing the rate of meme evolution in relation to the rate of gene evolution, for various degrees of interdependence between the two replicators. That is, the effects of memes' (suggested) more rapid rate of evolution in comparison to that of genes is investigated using a tunable model of coevolution. It is found that, for almost any degree of interdependence between the two replicators, as the rate of meme evolution increases, a phase transition-like dynamic occurs under which memes have a significantly detrimental effect on the evolution of genes, quickly resulting in the cessation of effective gene evolution. Conversely, the memes experience a sharp increase in benefit from increasing their rate of evolution. We then examine the effects of enabling genes to reduce the percentage of gene-detrimental evolutionary steps taken by memes. Here a critical region emerges as the comparative rate of meme evolution increases, such that if genes cannot effectively select memes a high percentage of the time, they suffer from meme evolution as if they had almost no selective capability.

  15. Multifunctional nanorods for gene delivery

    NASA Astrophysics Data System (ADS)

    Salem, Aliasger K.; Searson, Peter C.; Leong, Kam W.


    The goal of gene therapy is to introduce foreign genes into somatic cells to supplement defective genes or provide additional biological functions, and can be achieved using either viral or synthetic non-viral delivery systems. Compared with viral vectors, synthetic gene-delivery systems, such as liposomes and polymers, offer several advantages including ease of production and reduced risk of cytotoxicity and immunogenicity, but their use has been limited by the relatively low transfection efficiency. This problem mainly stems from the difficulty in controlling their properties at the nanoscale. Synthetic inorganic gene carriers have received limited attention in the gene-therapy community, the only notable example being gold nanoparticles with surface-immobilized DNA applied to intradermal genetic immunization by particle bombardment. Here we present a non-viral gene-delivery system based on multisegment bimetallic nanorods that can simultaneously bind compacted DNA plasmids and targeting ligands in a spatially defined manner. This approach allows precise control of composition, size and multifunctionality of the gene-delivery system. Transfection experiments performed in vitro and in vivo provide promising results that suggest potential in genetic vaccination applications.

  16. Nonviral Vectors for Gene Delivery

    NASA Astrophysics Data System (ADS)

    Baoum, Abdulgader Ahmed


    The development of nonviral vectors for safe and efficient gene delivery has been gaining considerable attention recently. An ideal nonviral vector must protect the gene against degradation by nuclease in the extracellular matrix, internalize the plasma membrane, escape from the endosomal compartment, unpackage the gene at some point and have no detrimental effects. In comparison to viruses, nonviral vectors are relatively easy to synthesize, less immunogenic, low in cost, and have no limitation in the size of a gene that can be delivered. Significant progress has been made in the basic science and applications of various nonviral gene delivery vectors; however, the majority of nonviral approaches are still inefficient and often toxic. To this end, two nonviral gene delivery systems using either biodegradable poly(D,L-lactide- co-glycolide) (PLG) nanoparticles or cell penetrating peptide (CPP) complexes have been designed and studied using A549 human lung epithelial cells. PLG nanoparticles were optimized for gene delivery by varying particle surface chemistry using different coating materials that adsorb to the particle surface during formation. A variety of cationic coating materials were studied and compared to more conventional surfactants used for PLG nanoparticle fabrication. Nanoparticles (˜200 nm) efficiently encapsulated plasmids encoding for luciferase (80-90%) and slowly released the same for two weeks. After a delay, moderate levels of gene expression appeared at day 5 for certain positively charged PLG particles and gene expression was maintained for at least two weeks. In contrast, gene expression mediated by polyethyleneimine (PEI) ended at day 5. PLG particles were also significantly less cytotoxic than PEI suggesting the use of these vehicles for localized, sustained gene delivery to the pulmonary epithelium. On the other hand, a more simple method to synthesize 50-200 nm complexes capable of high transfection efficiency or high gene knockdown was

  17. Nanoparticle-Mediated Gene Delivery

    NASA Astrophysics Data System (ADS)

    Jin, Sha; Leach, John C.; Ye, Kaiming

    Nonviral gene delivery has been gaining considerable attention recently. Although the efficacy of DNA transfection, which is a major concern, is low in nonviral vector-mediated gene transfer compared with viral ones, nonviral vectors are relatively easy to prepare, less immunogenic and oncogenic, and have no potential of virus recombination and no limitation on the size of a transferred gene. The ability to incorporate genetic materials such as plasmid DNA, RNA, and siRNA into functionalized nanoparticles with little toxicity demonstrates a new era in pharmacotherapy for delivering genes selectively to tissues and cells. In this chapter, we highlight the basic concepts and applications of nonviral gene delivery using super paramagnetic iron oxide nanoparticles and functionalized silica nanoparticles. The experimental protocols related to these topics are described in the chapter.

  18. Nanoparticles for Retinal Gene Therapy

    PubMed Central

    Conley, Shannon M.; Naash, Muna I.


    Ocular gene therapy is becoming a well-established field. Viral gene therapies for the treatment of Leber’s congentinal amaurosis (LCA) are in clinical trials, and many other gene therapy approaches are being rapidly developed for application to diverse ophthalmic pathologies. Of late, development of non-viral gene therapies has been an area of intense focus and one technology, polymer-compacted DNA nanoparticles, is especially promising. However, development of pharmaceutically and clinically viable therapeutics depends not only on having an effective and safe vector but also on a practical treatment strategy. Inherited retinal pathologies are caused by mutations in over 220 genes, some of which contain over 200 individual disease-causing mutations, which are individually very rare. This review will focus on both the progress and future of nanoparticles and also on what will be required to make them relevant ocular pharmaceutics. PMID:20452457

  19. Gene-gene interactions in gastrointestinal cancer susceptibility

    PubMed Central

    Kang, Changwon; Kang, Suk-Jo


    Cancer arises from complex, multi-layer interactions between diverse genetic and environmental factors. Genetic studies have identified multiple loci associated with tumor susceptibility. However, little is known about how germline polymorphisms interact with one another and with somatic mutations within a tumor to mediate acquisition of cancer traits. Here, we survey recent studies showing gene-gene interactions, also known as epistases, affecting genetic susceptibility in colorectal, gastric and esophageal cancers. We also catalog epistasis types and cancer hallmarks with respect to the interacting genes. A total of 22 gene variation pairs displayed all levels of statistical epistasis, including synergistic, redundant, suppressive and co-suppressive interactions. Five genes primarily involved in base excision repair formed a linear topology in the interaction network, MUTYH-OGG1-XRCC1-PARP1-MMP2, and three genes in mTOR cell-proliferation pathway formed another linear network, PRKAG2-RPS6KB1-PIK3CA. Discrete pairwise epistasis was also found in nucleotide excision repair, detoxification, proliferation, TP53, TGF-β and other pathways. We propose that three modes of biological interaction underlie the molecular mechanisms for statistical epistasis. The direct binding, linear pathway and convergence modes can exhibit any level of statistical epistasis in susceptibility to gastrointestinal cancers, and this is likely true for other complex diseases as well. This review highlights the link between cancer hallmarks and susceptibility genes. PMID:27588484

  20. Immunoglobulin λ Gene Rearrangement Can Precede κ Gene Rearrangement


    Berg, Jörg; Mcdowell, Mindy; Jäck, Hans-Martin; ...


    Imore » mmunoglobulin genes are generated during differentiation of B lymphocytes by joining gene segments. A mouse pre-B cell contains a functional immunoglobulin heavy-chain gene, but no light-chain gene. Although there is only one heavy-chain locus, there are two lightchain loci: κ and λ .It has been reported that κ loci in the germ-line configuration are never (in man) or very rarely (in the mouse) present in cells with functionally rearranged λ -chain genes. Two explanations have been proposed to explain this: (a) the ordered rearrangement theory, which postulates that light-chain gene rearrangement in the pre-B cell is first attempted at the κ locus, and that only upon failure to produce a functional κ chain is there an attempt to rearrange the λ locus; and (b) the stochastic theory, which postulates that rearrangement at the λ locus proceeds at a rate that is intrinsically much slower than that at the κ locus. We show here that λ -chain genes are generated whether or not the κ locus has lost its germ-line arrangement, a result that is compatible only with the stochastic theory.« less

  1. Therapeutic genes for anti-HIV/AIDS gene therapy.


    Bovolenta, Chiara; Porcellini, Simona; Alberici, Luca


    The multiple therapeutic approaches developed so far to cope HIV-1 infection, such as anti-retroviral drugs, germicides and several attempts of therapeutic vaccination have provided significant amelioration in terms of life-quality and survival rate of AIDS patients. Nevertheless, no approach has demonstrated efficacy in eradicating this lethal, if untreated, infection. The curative power of gene therapy has been proven for the treatment of monogenic immunodeficiensies, where permanent gene modification of host cells is sufficient to correct the defect for life-time. No doubt, a similar concept is not applicable for gene therapy of infectious immunodeficiensies as AIDS, where there is not a single gene to be corrected; rather engineered cells must gain immunotherapeutic or antiviral features to grant either short- or long-term efficacy mostly by acquisition of antiviral genes or payloads. Anti-HIV/AIDS gene therapy is one of the most promising strategy, although challenging, to eradicate HIV-1 infection. In fact, genetic modification of hematopoietic stem cells with one or multiple therapeutic genes is expected to originate blood cell progenies resistant to viral infection and thereby able to prevail on infected unprotected cells. Ultimately, protected cells will re-establish a functional immune system able to control HIV-1 replication. More than hundred gene therapy clinical trials against AIDS employing different viral vectors and transgenes have been approved or are currently ongoing worldwide. This review will overview anti-HIV-1 infection gene therapy field evaluating strength and weakness of the transgenes and payloads used in the past and of those potentially exploitable in the future.

  2. Genes, Economics, and Happiness.


    De Neve, Jan-Emmanuel; Christakis, Nicholas A; Fowler, James H; Frey, Bruno S


    We explore the influence of genetic variation on subjective well-being by employing a twin design and genetic association study. In a nationally-representative twin sample, we first show that about 33% of the variation in life satisfaction is explained by genetic variation. Although previous studies have shown that baseline happiness is significantly heritable, little research has considered molecular genetic associations with subjective well-being. We study the relationship between a functional polymorphism on the serotonin transporter gene (5-HTTLPR) and life satisfaction. We initially find that individuals with the longer, transcriptionally more efficient variant of this genotype report greater life satisfaction (n=2,545, p=0.012). However, our replication attempts on independent samples produce mixed results indicating that more work needs to be done to better understand the relationship between this genotype and subjective well-being. This work has implications for how economists think about the determinants of utility, and the extent to which exogenous shocks might affect individual well-being.

  3. Environment, genes, and cancer

    SciTech Connect

    Manuel, J.


    In January, comedian George Burns turned 100 years old. In recent appearances in the media, he still seems sharp as a tack, and is still seen smoking his trademark cigars. Others of us, however, were never very funny, and would die of cancer at age 60 if we continuously smoked cigars or cigarettes. Burns presents a common but perplexing paradox; some people are able to tolerate at least moderate exposure to toxins such as cigarette smoke with little adverse affect, while others develop cancer, emphysema, or heart disease. New studies support the idea that there is an interaction between genes and the environment, and that this interaction may be an important determinant of cancer risk. To understand such risks, it is essential to look at both an individual`s genetic makeup and environmental exposures. Such studies require the collaboration of molecular epidemiologists and molecular biologists. At the NIEHS, Jack A. Taylor, a lead clinical investigator in the Epidemiology Branch, and Douglas A. Bell, an investigator with the Genetic Risk Group of the Laboratory of Biochemical Risk Analysis, have worked together and with other scientists to uncover new information in this area.

  4. Melanoma-restricted genes

    PubMed Central

    Wang, Ena; Panelli, Monica C; Zavaglia, Katia; Mandruzzato, Susanna; Hu, Nan; Taylor, Phil R; Seliger, Barbara; Zanovello, Paola; Freedman, Ralph S; Marincola, Francesco M


    Human metastatic cutaneous melanoma has gained a well deserved reputation for its immune responsiveness. The reason(s) remain(s) unknown. We attempted previously to characterize several variables that may affect the relationship between tumor and host immune cells but, taken one at the time, none yielded a convincing explanation. With explorative purposes, high-throughput technology was applied here to portray transcriptional characteristics unique to metastatic cutaneous melanoma that may or may not be relevant to its immunogenic potential. Several functional signatures could be identified descriptive of immune or other biological functions. In addition, the transcriptional profile of metastatic melanoma was compared with that of primary renal cell cancers (RCC) identifying several genes co-coordinately expressed by the two tumor types. Since RCC is another immune responsive tumor, commonalities between RCC and melanoma may help untangle the enigma of their potential immune responsiveness. This purely descriptive study provides, therefore, a map for the investigation of metastatic melanoma in future clinical trials and at the same time may invite consideration of novel therapeutic targets. PMID:15488140

  5. Myeloid cell-specific disruption of Period1 and Period2 exacerbates diet-induced inflammation and insulin resistance.


    Xu, Hang; Li, Honggui; Woo, Shih-Lung; Kim, Sam-Moon; Shende, Vikram R; Neuendorff, Nichole; Guo, Xin; Guo, Ting; Qi, Ting; Pei, Ya; Zhao, Yan; Hu, Xiang; Zhao, Jiajia; Chen, Lili; Chen, Lulu; Ji, Jun-Yuan; Alaniz, Robert C; Earnest, David J; Wu, Chaodong


    The circadian clockworks gate macrophage inflammatory responses. Given the association between clock dysregulation and metabolic disorders, we conducted experiments to determine the extent to which over-nutrition modulates macrophage clock function and whether macrophage circadian dysregulation is a key factor linking over-nutrition to macrophage proinflammatory activation, adipose tissue inflammation, and systemic insulin resistance. Our results demonstrate that 1) macrophages from high fat diet-fed mice are marked by dysregulation of the molecular clockworks in conjunction with increased proinflammatory activation, 2) global disruption of the clock genes Period1 (Per1) and Per2 recapitulates this amplified macrophage proinflammatory activation, 3) adoptive transfer of Per1/2-disrupted bone marrow cells into wild-type mice potentiates high fat diet-induced adipose and liver tissue inflammation and systemic insulin resistance, and 4) Per1/2-disrupted macrophages similarly exacerbate inflammatory responses and decrease insulin sensitivity in co-cultured adipocytes in vitro. Furthermore, PPARγ levels are decreased in Per1/2-disrupted macrophages and PPARγ2 overexpression ameliorates Per1/2 disruption-associated macrophage proinflammatory activation, suggesting that this transcription factor may link the molecular clockworks to signaling pathways regulating macrophage polarization. Thus, macrophage circadian clock dysregulation is a key process in the physiological cascade by which diet-induced obesity triggers macrophage proinflammatory activation, adipose tissue inflammation, and insulin resistance.

  6. Myeloid Cell-specific Disruption of Period1 and Period2 Exacerbates Diet-induced Inflammation and Insulin Resistance*

    PubMed Central

    Xu, Hang; Li, Honggui; Woo, Shih-Lung; Kim, Sam-Moon; Shende, Vikram R.; Neuendorff, Nichole; Guo, Xin; Guo, Ting; Qi, Ting; Pei, Ya; Zhao, Yan; Hu, Xiang; Zhao, Jiajia; Chen, Lili; Chen, Lulu; Ji, Jun-Yuan; Alaniz, Robert C.; Earnest, David J.; Wu, Chaodong


    The circadian clockworks gate macrophage inflammatory responses. Given the association between clock dysregulation and metabolic disorders, we conducted experiments to determine the extent to which over-nutrition modulates macrophage clock function and whether macrophage circadian dysregulation is a key factor linking over-nutrition to macrophage proinflammatory activation, adipose tissue inflammation, and systemic insulin resistance. Our results demonstrate that 1) macrophages from high fat diet-fed mice are marked by dysregulation of the molecular clockworks in conjunction with increased proinflammatory activation, 2) global disruption of the clock genes Period1 (Per1) and Per2 recapitulates this amplified macrophage proinflammatory activation, 3) adoptive transfer of Per1/2-disrupted bone marrow cells into wild-type mice potentiates high fat diet-induced adipose and liver tissue inflammation and systemic insulin resistance, and 4) Per1/2-disrupted macrophages similarly exacerbate inflammatory responses and decrease insulin sensitivity in co-cultured adipocytes in vitro. Furthermore, PPARγ levels are decreased in Per1/2-disrupted macrophages and PPARγ2 overexpression ameliorates Per1/2 disruption-associated macrophage proinflammatory activation, suggesting that this transcription factor may link the molecular clockworks to signaling pathways regulating macrophage polarization. Thus, macrophage circadian clock dysregulation is a key process in the physiological cascade by which diet-induced obesity triggers macrophage proinflammatory activation, adipose tissue inflammation, and insulin resistance. PMID:24770415

  7. Identifying gene-environment and gene-gene interactions using a progressive penalization approach.


    Zhu, Ruoqing; Zhao, Hongyu; Ma, Shuangge


    In genomic studies, identifying important gene-environment and gene-gene interactions is a challenging problem. In this study, we adopt the statistical modeling approach, where interactions are represented by product terms in regression models. For the identification of important interactions, we adopt penalization, which has been used in many genomic studies. Straightforward application of penalization does not respect the "main effect, interaction" hierarchical structure. A few recently proposed methods respect this structure by applying constrained penalization. However, they demand very complicated computational algorithms and can only accommodate a small number of genomic measurements. We propose a computationally fast penalization method that can identify important gene-environment and gene-gene interactions and respect a strong hierarchical structure. The method takes a stagewise approach and progressively expands its optimization domain to account for possible hierarchical interactions. It is applicable to multiple data types and models. A coordinate descent method is utilized to produce the entire regularized solution path. Simulation study demonstrates the superior performance of the proposed method. We analyze a lung cancer prognosis study with gene expression measurements and identify important gene-environment interactions.

  8. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.


    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  9. Gene-environment interactions linking air pollution and inflammation in Parkinson's disease.


    Lee, Pei-Chen; Raaschou-Nielsen, Ole; Lill, Christina M; Bertram, Lars; Sinsheimer, Janet S; Hansen, Johnni; Ritz, Beate


    Both air pollution exposure and systemic inflammation have been linked to Parkinson's disease (PD). In the PASIDA study, 408 incident cases of PD diagnosed in 2006-2009 and their 495 population controls were interviewed and provided DNA samples. Markers of long term traffic related air pollution measures were derived from geographic information systems (GIS)-based modeling. Furthermore, we genotyped functional polymorphisms in genes encoding proinflammatory cytokines, namely rs1800629 in TNFα (tumor necrosis factor alpha) and rs16944 in IL1B (interleukin-1β). In logistic regression models, long-term exposure to NO2 increased PD risk overall (odds ratio (OR)=1.06 per 2.94μg/m(3) increase, 95% CI=1.00-1.13). The OR for PD in individuals with high NO2 exposure (≧75th percentile) and the AA genotype of IL1B rs16944 was 3.10 (95% CI=1.14-8.38) compared with individuals with lower NO2 exposure (<75th percentile) and the GG genotype. The interaction term was nominally significant on the multiplicative scale (p=0.01). We did not find significant gene-environment interactions with TNF rs1800629. Our finds may provide suggestive evidence that a combination of traffic-related air pollution and genetic variation in the proinflammatory cytokine gene IL1B contribute to risk of developing PD. However, as statistical evidence was only modest in this large sample we cannot rule out that these results represent a chance finding, and additional replication efforts are warranted.

  10. Mining gene-chip data

    NASA Astrophysics Data System (ADS)

    Kloster, Morten


    DNA microarray (``gene chip'') technology has enabled a rapid accumulation of gene-expression data for model organisms such as S. cerevisiae and C. elegans, as well as for H. sapiens, raising the issue of how best to extract information about the gene regulatory networks of these organisms from this data. While basic clustering algorithms have been successful at finding genes that are coregulated for a small, specific set of experimental conditions, these algorithms are less effective when applied to large, varied data sets. One of the major challenges in analyzing the data is the diversity in both size and signal strength of the various transcriptional modules, i.e. sets of coregulated genes along with the sets of conditions for which the genes are strongly coregulated. One method that has proven successful at identifying large and/or strong modules is the Iterative Signature Algorithm (ISA) [1]. A modified version of the ISA algorithm, the Progressive Iterative Signature Algorithm (PISA), is also able to identify smaller, weaker modules by sequentially eliminating transcriptional modules as they are identified. Applying these algorithms to a large set of yeast gene expression data illustrates the strengths and weaknesses of each approach. [1] Bergmann, S., Ihmels, J., and Barkai, N., Phys. Rev. E 67, 031902 (2002).

  11. Gene Therapy in Heart Failure.


    Fargnoli, Anthony S; Katz, Michael G; Bridges, Charles R; Hajjar, Roger J


    Heart failure is a significant burden to the global healthcare system and represents an underserved market for new pharmacologic strategies, especially therapies which can address root cause myocyte dysfunction. Modern drugs, surgeries, and state-of-the-art interventions are costly and do not improve survival outcome measures. Gene therapy is an attractive strategy, whereby selected gene targets and their associated regulatory mechanisms can be permanently managed therapeutically in a single treatment. This in theory could be sustainable for the patient's life. Despite the promise, however, gene therapy has numerous challenges that must be addressed together as a treatment plan comprising these key elements: myocyte physiologic target validation, gene target manipulation strategy, vector selection for the correct level of manipulation, and carefully utilizing an efficient delivery route that can be implemented in the clinic to efficiently transfer the therapy within safety limits. This chapter summarizes the key developments in cardiac gene therapy from the perspective of understanding each of these components of the treatment plan. The latest pharmacologic gene targets, gene therapy vectors, delivery routes, and strategies are reviewed.

  12. Human Lacrimal Gland Gene Expression

    PubMed Central

    Aakalu, Vinay Kumar; Parameswaran, Sowmya; Maienschein-Cline, Mark; Bahroos, Neil; Shah, Dhara; Ali, Marwan; Krishnakumar, Subramanian


    Background The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development. Methods We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium. Results The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described. Conclusions Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas. PMID:28081151

  13. Linking Genes to Cardiovascular Diseases: Gene Action and Gene-Environment Interactions.


    Pasipoularides, Ares


    A unique myocardial characteristic is its ability to grow/remodel in order to adapt; this is determined partly by genes and partly by the environment and the milieu intérieur. In the "post-genomic" era, a need is emerging to elucidate the physiologic functions of myocardial genes, as well as potential adaptive and maladaptive modulations induced by environmental/epigenetic factors. Genome sequencing and analysis advances have become exponential lately, with escalation of our knowledge concerning sometimes controversial genetic underpinnings of cardiovascular diseases. Current technologies can identify candidate genes variously involved in diverse normal/abnormal morphomechanical phenotypes, and offer insights into multiple genetic factors implicated in complex cardiovascular syndromes. The expression profiles of thousands of genes are regularly ascertained under diverse conditions. Global analyses of gene expression levels are useful for cataloging genes and correlated phenotypes, and for elucidating the role of genes in maladies. Comparative expression of gene networks coupled to complex disorders can contribute insights as to how "modifier genes" influence the expressed phenotypes. Increasingly, a more comprehensive and detailed systematic understanding of genetic abnormalities underlying, for example, various genetic cardiomyopathies is emerging. Implementing genomic findings in cardiology practice may well lead directly to better diagnosing and therapeutics. There is currently evolving a strong appreciation for the value of studying gene anomalies, and doing so in a non-disjointed, cohesive manner. However, it is challenging for many-practitioners and investigators-to comprehend, interpret, and utilize the clinically increasingly accessible and affordable cardiovascular genomics studies. This survey addresses the need for fundamental understanding in this vital area.

  14. The human RHOX gene cluster: target genes and functional analysis of gene variants in infertile men.


    Borgmann, Jennifer; Tüttelmann, Frank; Dworniczak, Bernd; Röpke, Albrecht; Song, Hye-Won; Kliesch, Sabine; Wilkinson, Miles F; Laurentino, Sandra; Gromoll, Jörg


    The X-linked reproductive homeobox (RHOX) gene cluster encodes transcription factors preferentially expressed in reproductive tissues. This gene cluster has important roles in male fertility based on phenotypic defects of Rhox-mutant mice and the finding that aberrant RHOX promoter methylation is strongly associated with abnormal human sperm parameters. However, little is known about the molecular mechanism of RHOX function in humans. Using gene expression profiling, we identified genes regulated by members of the human RHOX gene cluster. Some genes were uniquely regulated by RHOXF1 or RHOXF2/2B, while others were regulated by both of these transcription factors. Several of these regulated genes encode proteins involved in processes relevant to spermatogenesis; e.g. stress protection and cell survival. One of the target genes of RHOXF2/2B is RHOXF1, suggesting cross-regulation to enhance transcriptional responses. The potential role of RHOX in human infertility was addressed by sequencing all RHOX exons in a group of 250 patients with severe oligozoospermia. This revealed two mutations in RHOXF1 (c.515G > A and c.522C > T) and four in RHOXF2/2B (-73C > G, c.202G > A, c.411C > T and c.679G > A), of which only one (c.202G > A) was found in a control group of men with normal sperm concentration. Functional analysis demonstrated that c.202G > A and c.679G > A significantly impaired the ability of RHOXF2/2B to regulate downstream genes. Molecular modelling suggested that these mutations alter RHOXF2/F2B protein conformation. By combining clinical data with in vitro functional analysis, we demonstrate how the X-linked RHOX gene cluster may function in normal human spermatogenesis and we provide evidence that it is impaired in human male fertility.

  15. Differential effects of transient constant light-dark conditions on daily rhythms of Period and Clock transcripts during Senegalese sole metamorphosis.


    Martín-Robles, Águeda J; Whitmore, David; Pendón, Carlos; Muñoz-Cueto, José A


    Studies on the developmental onset of the teleost circadian clock have been carried out in zebrafish and, recently, in rainbow trout and Senegalese sole, where rhythms of clock gene expression entrained by light-dark (LD) cycles have been reported from the first days post fertilization. However, investigations of molecular clock rhythms during crucial developmental phases such as metamorphosis are absent in vertebrates. In this study, we documented the daily expression profile of Per1, Per2, Per3, and Clock during Senegalese sole pre-, early-, middle-, and post-metamorphic stages under LD 14:10 cycles (LD group), as well as under transient exposure to constant light (LL-LD group) or constant dark (DD-LD group) conditions. Our results revealed that robust rhythms of clock genes were maintained along the metamorphic process, although with declining amplitudes and expression levels. All daily profiles were affected by transient constant conditions, in particular Per1, Per3, and Clock amplitudes and Per2 acrophase. Rhythm parameters were progressively restored upon reversion to LD cycles but even after 9 d under cycling conditions, a prolonged effect on clock function was observed, especially in the LL-LD group. These results reflect the differential sensitivity of clock machinery of sole to transitory light cues, being Per1 and Per3 predominantly clock regulated and supporting the role of Per2 as part of the light input pathway. Interestingly, there is no reversal in the phase of clock gene rhythms between pre- and post-metamorphic animals that would be coincident with the switch from diurnal to nocturnal locomotor activity, which occurs in this species just before the beginning of this process. Whether specialized central pacemakers dictate the phase of locomotor activity or this control is exerted outside of the core clock mechanism remains to be elucidated. Our results emphasize the importance of maintaining cycling light-dark conditions in aquaculture practices

  16. Gene therapy for bone regeneration.


    Luo, Jeffrey; Sun, Michael H; Kang, Quan; Peng, Ying; Jiang, Wei; Luu, Hue H; Luo, Qing; Park, Jae Yoon; Li, Yien; Haydon, Rex C; He, Tong-Chuan


    Efficacious bone regeneration could revolutionize the clinical management of many bone and musculoskeletal disorders. Bone has the unique ability to regenerate and continuously remodel itself throughout life. However, clinical situations arise when bone is unable to heal itself, as with segmental bone loss, fracture non-union, and failed spinal fusion. This leads to significant morbidity and mortality. Current attempts at improved bone healing have been met with limited success, fueling the development of improved techniques. Gene therapy in many ways represents an ideal approach for augmenting bone regeneration. Gene therapy allows specific gene products to be delivered to a precise anatomic location. In addition, the level of transgene expression as well as the duration of expression can be regulated with current techniques. For bone regeneration, the gene of interest should be delivered to the fracture site, expressed at appropriate levels, and then deactivated once the fracture has healed. Delivery of biological factors, mostly bone morphogenetic proteins (BMPs), has yielded promising results both in animal and clinical studies. There has also been tremendous work on discovering new growth factors and exploring previously defined ones. Finally, significant advances are being made in the delivery systems of the genes, ranging from viral and non-viral vectors to tissue engineering scaffolds. Despite some public hesitation to gene therapy, its use has great potential to expand our ability to treat a variety of human bone and musculoskeletal disorders. It is conceivable that in the near future gene therapy can be utilized to induce bone formation in virtually any region of the body in a minimally invasive manner. As bone biology and gene therapy research progresses, the goal of successful human gene transfer for augmentation of bone regeneration draws nearer.

  17. Viral vectors for gene transfer: current status of gene therapeutics.


    Heilbronn, Regine; Weger, Stefan


    Gene therapy for the correction of inherited or acquired disease has gained increasing importance in recent years. Successful treatment of children suffering from severe combined immunodeficiency (SCID) was achieved using retrovirus vectors for gene transfer. Encouraging improvements of vision were reported in a genetic eye disorder (LCA) leading to early childhood blindness. Adeno-associated virus (AAV) vectors were used for gene transfer in these trials. This chapter gives an overview of the design and delivery of viral vectors for the transport of a therapeutic gene into a target cell or tissue. The construction and production of retrovirus, lentivirus, and AAV vectors are covered. The focus is on production methods suitable for biopharmaceutical upscaling and for downstream processing. Quality control measures and biological safety considerations for the use of vectors in clinical trials are discussed.

  18. [Gene doping: gene transfer and possible molecular detection].


    Argüelles, Carlos Francisco; Hernández-Zamora, Edgar


    The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.

  19. Gene Insertion Into Genomic Safe Harbors for Human Gene Therapy

    PubMed Central

    Papapetrou, Eirini P; Schambach, Axel


    Genomic safe harbors (GSHs) are sites in the genome able to accommodate the integration of new genetic material in a manner that ensures that the newly inserted genetic elements: (i) function predictably and (ii) do not cause alterations of the host genome posing a risk to the host cell or organism. GSHs are thus ideal sites for transgene insertion whose use can empower functional genetics studies in basic research and therapeutic applications in human gene therapy. Currently, no fully validated GSHs exist in the human genome. Here, we review our formerly proposed GSH criteria and discuss additional considerations on extending these criteria, on strategies for the identification and validation of GSHs, as well as future prospects on GSH targeting for therapeutic applications. In view of recent advances in genome biology, gene targeting technologies, and regenerative medicine, gene insertion into GSHs can potentially catalyze nearly all applications in human gene therapy. PMID:26867951

  20. GenePRIMP: A GENE PRediction IMprovement Pipeline for Prokaryotic genomes

    SciTech Connect

    Pati, Amrita; Ivanova, Natalia N.; Mikhailova, Natalia; Ovchinnikova, Galina; Hooper, Sean D.; Lykidis, Athanasios; Kyrpides, Nikos C.


    We present 'gene prediction improvement pipeline' (GenePRIMP;, a computational process that performs evidence-based evaluation of gene models in prokaryotic genomes and reports anomalies including inconsistent start sites, missed genes and split genes. We found that manual curation of gene models using the anomaly reports generated by GenePRIMP improved their quality, and demonstrate the applicability of GenePRIMP in improving finishing quality and comparing different genome-sequencing and annotation technologies.

  1. Comparing the evolutionary conservation between human essential genes, human orthologs of mouse essential genes and human housekeeping genes.


    Lv, Wenhua; Zheng, Jiajia; Luan, Meiwei; Shi, Miao; Zhu, Hongjie; Zhang, Mingming; Lv, Hongchao; Shang, Zhenwei; Duan, Lian; Zhang, Ruijie; Jiang, Yongshuai


    Human housekeeping genes are often confused with essential human genes, and several studies regard both types of genes as having the same level of evolutionary conservation. However, this is not necessarily the case. To clarify this, we compared the differences between human housekeeping genes and essential human genes with respect to four aspects: the evolutionary rate (dN/dS), protein sequence identity, single-nucleotide polymorphism (SNP) density and level of linkage disequilibrium (LD). The results showed that housekeeping genes had lower evolutionary rates, higher sequence identities, lower SNP densities and higher levels of LD compared with essential genes. Together, these findings indicate that housekeeping and essential genes are two distinct types of genes, and that housekeeping genes have a higher level of evolutionary conservation. Therefore, we suggest that researchers should pay careful attention to the distinctions between housekeeping genes and essential genes. Moreover, it is still controversial whether we should substitute human orthologs of mouse essential genes for human essential genes. Therefore, we compared the evolutionary features between human orthologs of mouse essential genes and human housekeeping genes and we got inconsistent results in long-term and short-term evolutionary characteristics implying the irrationality of simply replacing human essential genes with human orthologs of mouse essential genes.

  2. The Ensembl gene annotation system

    PubMed Central

    Aken, Bronwen L.; Ayling, Sarah; Barrell, Daniel; Clarke, Laura; Curwen, Valery; Fairley, Susan; Fernandez Banet, Julio; Billis, Konstantinos; García Girón, Carlos; Hourlier, Thibaut; Howe, Kevin; Kähäri, Andreas; Kokocinski, Felix; Martin, Fergal J.; Murphy, Daniel N.; Nag, Rishi; Ruffier, Magali; Schuster, Michael; Tang, Y. Amy; Vogel, Jan-Hinnerk; White, Simon; Zadissa, Amonida; Flicek, Paul


    The Ensembl gene annotation system has been used to annotate over 70 different vertebrate species across a wide range of genome projects. Furthermore, it generates the automatic alignment-based annotation for the human and mouse GENCODE gene sets. The system is based on the alignment of biological sequences, including cDNAs, proteins and RNA-seq reads, to the target genome in order to construct candidate transcript models. Careful assessment and filtering of these candidate transcripts ultimately leads to the final gene set, which is made available on the Ensembl website. Here, we describe the annotation process in detail. Database URL: PMID:27337980

  3. Gene therapy: proceed with caution.


    Grobstein, C; Flower, M


    On 6 February 1984 the Recombinant DNA Advisory Committee of the National Institutes of Health approved a recommendation that the committee provide prior review of research protocols involving human gene therapy. Grobstein and Flower trace the development of public policy in response to concerns about the dangers of gene therapy, especially as it applies to germ line alteration. They offer guidelines and propose principles for an oversight body to confront the immediate and long term technical, social, and ethical implications of human genetic modification. An accompanying article presents a plea for the development of gene therapy by the mother of three children who have sickle cell anemia.

  4. Gene networks controlling petal organogenesis.


    Huang, Tengbo; Irish, Vivian F


    One of the biggest unanswered questions in developmental biology is how growth is controlled. Petals are an excellent organ system for investigating growth control in plants: petals are dispensable, have a simple structure, and are largely refractory to environmental perturbations that can alter their size and shape. In recent studies, a number of genes controlling petal growth have been identified. The overall picture of how such genes function in petal organogenesis is beginning to be elucidated. This review will focus on studies using petals as a model system to explore the underlying gene networks that control organ initiation, growth, and final organ morphology.

  5. Gene Delivery to the Airway

    PubMed Central

    Keiser, Nicholas W.; Engelhardt, John F.


    This unit describes generation of and gene transfer to several commonly used airway models. Isolation and transduction of primary airway epithelial cells are first described. Next, the preparation of polarized airway epithelial monolayers is outlined. Transduction of these polarized cells is also described. Methods are presented for generation of tracheal xenografts as well as both ex vivo and in vivo gene transfer to these xenografts. Finally, a method for in vivo gene delivery to the lungs of rodents is included. Methods for evaluating transgene expression are given in the support protocols. PMID:23853081

  6. Panspermia and horizontal gene transfer

    NASA Astrophysics Data System (ADS)

    Klyce, Brig


    Evidence that extremophiles are hardy and ubiquitous is helping to make panspermia a respectable theory. But even if life on Earth originally came from space, biologists assume that the subsequent evolution of life is still governed by the darwinian paradigm. In this review we show how panspermia could amend darwinism and point to a cosmic source for, not only extremophiles but, all of life. This version of panspermia can be called "strong panspermia." To support this theory we will discuss recent evidence pertaining to horizontal gene transfer, viruses, genes apparently older than the Earthly evolution of the features they encode, and primate-specific genes without identifiable precursors.

  7. Basics on Genes and Genetic Disorders


    ... Healthy Breakfasts Shyness The Basics on Genes and Genetic Disorders KidsHealth > For Teens > The Basics on Genes ... repair" the gene change. previous continue What Are Genetic Disorders? Researchers have identified more than 4,000 ...

  8. Identification of pathogenicity-related genes in the rice pathogen Ustilaginoidea virens through random insertional mutagenesis.


    Yu, Mina; Yu, Junjie; Hu, Jiankun; Huang, Lei; Wang, Yahui; Yin, Xiaole; Nie, Yafeng; Meng, Xiangkun; Wang, Weiduo; Liu, Yongfeng


    Agrobacterium tumefaciens-mediated transformation (ATMT) is becoming a popular effective system as an insertional mutagenesis tool in filamentous fungi. To gain more insight into the cellular and molecular mechanisms in the pathogenesis of Ustilaginoidea virens, the causal agent of rice false smut disease, a T-DNA insertion mutant library of U. virens was established using ATMT. We optimized a range of conditions to improve the transformation efficiency. Transformants were most effectively obtained when the optimal co-cultivation time is 72h, with 50μM AS in medium and 100μl A. tumefaciens for co-cultivation, leading to the production of 160-185 hygromycin B resistant transformants per 1×10(5) conidia. Southern blot analysis indicated that 58.14% of transformants had a single T-DNA copy. Among 5600 transformants tested for virulence, 37 mutants with reproducible pathogenic defects were obtained. The flanking sequences of three avirulent tranformants (B20, B1015 and B1465) and two pathogenicity-reduced transformants (B726 and B785) were amplified by high-efficiency thermal asymmetric interlaced PCR. Sequence analyses revealed that single T-DNA insertion in mutant B20 targeted the coding region of a gene encoding a protein highly similar to SUN family protein, and in mutant B726 targeted upstream of a gene with unknown function. The two T-DNA insertion sites in mutant B785 were found in the coding region of a gene encoding C6 transcription factor, but failed in amplified flanking sequence of another T-DNA. Chromosomal rearrangement occurred in the genome of mutant B1016 and B1465 with single T-DNA insertion. Among avirulent mutants, B20 showed altered colony growth and pigmentation. The T-DNA insert in B20 was detected in the coding region of a gene named UvSUN2. Morphophysiological characterization analysis suggested that UvSUN2 might be a virulence factor, and possibly required for proper fungal growth, cell wall construction, and stress responses in U. virens

  9. Identifying genes of gene regulatory networks using formal concept analysis.


    Gebert, Jutta; Motameny, Susanne; Faigle, Ulrich; Forst, Christian V; Schrader, Rainer


    In order to understand the behavior of a gene regulatory network, it is essential to know the genes that belong to it. Identifying the correct members (e.g., in order to build a model) is a difficult task even for small subnetworks. Usually only few members of a network are known and one needs to guess the missing members based on experience or informed speculation. It is beneficial if one can additionally rely on experimental data to support this guess. In this work we present a new method based on formal concept analysis to detect unknown members of a gene regulatory network from gene expression time series data. We show that formal concept analysis is able to find a list of candidate genes for inclusion into a partially known basic network. This list can then be reduced by a statistical analysis so that the resulting genes interact strongly with the basic network and therefore should be included when modeling the network. The method has been applied to the DNA repair system of Mycobacterium tuberculosis. In this application, our method produces comparable results to an already existing method of component selection while it is applicable to a broader range of problems.

  10. Gene function prediction based on the Gene Ontology hierarchical structure.


    Cheng, Liangxi; Lin, Hongfei; Hu, Yuncui; Wang, Jian; Yang, Zhihao


    The information of the Gene Ontology annotation is helpful in the explanation of life science phenomena, and can provide great support for the research of the biomedical field. The use of the Gene Ontology is gradually affecting the way people store and understand bioinformatic data. To facilitate the prediction of gene functions with the aid of text mining methods and existing resources, we transform it into a multi-label top-down classification problem and develop a method that uses the hierarchical relationships in the Gene Ontology structure to relieve the quantitative imbalance of positive and negative training samples. Meanwhile the method enhances the discriminating ability of classifiers by retaining and highlighting the key training samples. Additionally, the top-down classifier based on a tree structure takes the relationship of target classes into consideration and thus solves the incompatibility between the classification results and the Gene Ontology structure. Our experiment on the Gene Ontology annotation corpus achieves an F-value performance of 50.7% (precision: 52.7% recall: 48.9%). The experimental results demonstrate that when the size of training set is small, it can be expanded via topological propagation of associated documents between the parent and child nodes in the tree structure. The top-down classification model applies to the set of texts in an ontology structure or with a hierarchical relationship.

  11. A Gene Recommender Algorithm to Identify Coexpressed Genes in C. elegans

    PubMed Central

    Owen, Art B.; Stuart, Josh; Mach, Kathy; Villeneuve, Anne M.; Kim, Stuart


    One of the most important uses of whole-genome expression data is for the discovery of new genes with similar function to a given list of genes (the query) already known to have closely related function. We have developed an algorithm, called the gene recommender, that ranks genes according to how strongly they correlate with a set of query genes in those experiments for which the query genes are most strongly coregulated. We used the gene recommender to find other genes coexpressed with several sets of query genes, including genes known to function in the retinoblastoma complex. Genetic experiments confirmed that one gene (JC8.6) identified by the gene recommender acts with lin-35 Rb to regulate vulval cell fates, and that another gene (wrm-1) acts antagonistically. We find that the gene recommender returns lists of genes with better precision, for fixed levels of recall, than lists generated using the C. elegans expression topomap. PMID:12902378

  12. How eukaryotic genes are transcribed

    PubMed Central

    Venters, Bryan J.; Pugh, B. Franklin


    Summary Regulation of eukaryotic gene expression is far more complex than one might have imagined thirty years ago. However, progress towards understanding gene regulatory mechanisms has been rapid and comprehensive, which has made the integration of detailed observations into broadly connected concepts a challenge. This review attempts to integrate the following concepts: 1) a well-defined organization of nucleosomes and modification states at most genes, 2) regulatory networks of sequence-specific transcription factors, 3) chromatin remodeling coupled to promoter assembly of the general transcription factors and RNA polymerase II, and 4) phosphorylation states of RNA polymerase II coupled to chromatin modification states during transcription. The wealth of new insights arising from the tools of biochemistry, genomics, cell biology, and genetics is providing a remarkable view into the mechanics of gene regulation. PMID:19514890

  13. Hox genes regulation in vertebrates.


    Soshnikova, Natalia


    Hox genes encode transcription factors defining cellular identities along the major and secondary body axes. Their coordinated expression in both space and time is critical for embryonic patterning. Accordingly, Hox genes transcription is tightly controlled at multiple levels, and involves an intricate combination of local and long-range cis-regulatory elements. Recent studies revealed that in addition to transcription factors, dynamic patterns of histone marks and higher-order chromatin structure are important determinants of Hox gene regulation. Furthermore, the emerging picture suggests an involvement of various species of non-coding RNA in targeting activating and repressive complexes to Hox clusters. I review these recent developments and discuss their relevance to the control of Hox gene expression in vivo, as well as to our understanding of transcriptional regulatory mechanisms.

  14. Molecular biology of epilepsy genes.


    Williams, Charles A; Battaglia, Agatino


    Multifactorial inheritance is the most important model accounting for the genetic behavior of the common epilepsies. Important to this model is the concept that many cumulative or synergistic risk genes ultimately lead to a threshold effect. Sophisticated molecular testing indicates that the common epilepsies are very polygenic without evidence of any single gene having even a mild-to-modest risk effect. However, enrichment of copy number variants in cohorts of individuals with epilepsy indicates that certain structural changes in the genome can confer significant risk for epilepsy. The mechanisms whereby copy number variants confer this effect are not yet known. The study of epilepsy due to single gene defects however has helped clarify certain seizure mechanisms. For example, discoveries using animal models of SCN1A or ARX mutations implicate a predominant role for interneurons due to disturbed GABAergic function. It is hoped that future genetic and neurobiological studies will provide better insight into how multiple genes contribute to the common epilepsies.

  15. Gene Cernan on Apollo 17

    NASA Video Gallery

    Apollo 17 Commander Gene Cernan recalls fixing a lunar rover problem with duct tape during his December 1972 mission. Cernan's interview was part of the commemoration of NASA's 50th anniversary in ...

  16. Regulation of ABO gene expression.


    Kominato, Yoshihiko; Hata, Yukiko; Matsui, Kazuhiro; Takizawa, Hisao


    The ABO blood group system is important in blood transfusions and in identifying individuals during criminal investigations. Two carbohydrate antigens, the A and B antigens, and their antibodies constitute this system. Although biochemical and molecular genetic studies have demonstrated the molecular basis of the histo-blood group ABO system, some aspects remain to be elucidated. To explain the molecular basis of how the ABO genes are controlled in cell type-specific expression, during normal cell differentiation, and in cancer cells with invasive and metastatic potential that lack A/B antigens, it is essential to understand the regulatory mechanism of ABO gene transcription. We review the transcriptional regulation of the ABO gene, including positive and negative elements in the upstream region of the gene, and draw some inferences that help to explain the phenomena described above.

  17. The circadian clock is functional in eosinophils and mast cells.


    Baumann, Anja; Gönnenwein, Simone; Bischoff, Stephan C; Sherman, Hadas; Chapnik, Nava; Froy, Oren; Lorentz, Axel


    Allergic diseases are frequently exacerbated between midnight and early morning, suggesting a role for the biological clock. Mast cells (MC) and eosinophils are the main effector cells of allergic diseases and some MC-specific or eosinophil-specific markers, such as tryptase or eosinophil cationic protein, exhibit circadian variation. Here, we analysed whether the circadian clock is functional in mouse and human eosinophils and MC. Mouse jejunal MC and polymorphonuclear cells from peripheral blood (PMNC) were isolated around the circadian cycle. Human eosinophils were purified from peripheral blood of non-allergic and allergic subjects. Human MC were purified from intestinal tissue. We found a rhythmic expression of the clock genes mPer1, mPer2, mClock and mBmal1 and eosinophil-specific genes mEcp, mEpo and mMbp in murine PMNC. We also found circadian variations for hPer1, hPer2, hBmal1, hClock, hEdn and hEcp mRNA and eosinophil cationic protein (ECP) in human eosinophils of both healthy and allergic people. Clock genes mPer1, mPer2, mClock and mBmal1 and MC-specific genes mMcpt-5, mMcpt-7, mc-kit and mFcεRI α-chain and protein levels of mMCPT5 and mc-Kit showed robust oscillation in mouse jejunum. Human intestinal MC expressed hPer1, hPer2 and hBmal1 as well as hTryptase and hFcεRI α-chain, in a circadian manner. We found that pre-stored histamine and de novo synthesized cysteinyl leukotrienes, were released in a circadian manner by MC following IgE-mediated activation. In summary, the biological clock controls MC and eosinophils leading to circadian expression and release of their mediators and, hence it might be involved in the pathophysiology of allergy.

  18. Transgenic Arabidopsis Gene Expression System

    NASA Technical Reports Server (NTRS)

    Ferl, Robert; Paul, Anna-Lisa


    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  19. Gene Therapy for Childhood Neurofibromatosis

    DTIC Science & Technology


    AD_________________ Award Number: W81XWH-13-1-0101 TITLE: Gene Therapy for Childhood ...May 2014 4. TITLE AND SUBTITLE Gene Therapy for Childhood Neurofibromatosis 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-13-1-0101 This approach still represents a plausible and very different way to treat childhood neurofibromatosis, as well as other solid tumors

  20. [Genes for extreme violent behaviour?].


    Jordan, Bertrand


    A new genetic study focussing on the degree of violence in criminals and using both candidate gene and GWAS approaches finds statistically significant associations of extreme violent behaviour with low activity alleles of monoamine oxydase A (MAOA) and with the CD13 gene. However, the alleles implicated are common in the general population, thus they cannot be causal, and only represent potential indicators of increased risk.

  1. Cationic Bolaamphiphiles for Gene Delivery

    NASA Astrophysics Data System (ADS)

    Tan, Amelia Li Min; Lim, Alisa Xue Ling; Zhu, Yiting; Yang, Yi Yan; Khan, Majad


    Advances in medical research have shed light on the genetic cause of many human diseases. Gene therapy is a promising approach which can be used to deliver therapeutic genes to treat genetic diseases at its most fundamental level. In general, nonviral vectors are preferred due to reduced risk of immune response, but they are also commonly associated with low transfection efficiency and high cytotoxicity. In contrast to viral vectors, nonviral vectors do not have a natural mechanism to overcome extra- and intracellular barriers when delivering the therapeutic gene into cell. Hence, its design has been increasingly complex to meet challenges faced in targeting of, penetration of and expression in a specific host cell in achieving more satisfactory transfection efficiency. Flexibility in design of the vector is desirable, to enable a careful and controlled manipulation of its properties and functions. This can be met by the use of bolaamphiphile, a special class of lipid. Unlike conventional lipids, bolaamphiphiles can form asymmetric complexes with the therapeutic gene. The advantage of having an asymmetric complex lies in the different purposes served by the interior and exterior of the complex. More effective gene encapsulation within the interior of the complex can be achieved without triggering greater aggregation of serum proteins with the exterior, potentially overcoming one of the great hurdles faced by conventional single-head cationic lipids. In this review, we will look into the physiochemical considerations as well as the biological aspects of a bolaamphiphile-based gene delivery system.

  2. Immunoglobulin genes of the turtles.


    Magadán-Mompó, Susana; Sánchez-Espinel, Christian; Gambón-Deza, Francisco


    The availability of reptile genomes for the use of the scientific community is an exceptional opportunity to study the evolution of immunoglobulin genes. The genome of Chrysemys picta bellii and Pelodiscus sinensis is the first one that has been reported for turtles. The scanning for immunoglobulin genes resulted in the presence of a complex locus for the immunoglobulin heavy chain (IGH). This IGH locus in both turtles contains genes for 13 isotypes in C. picta bellii and 17 in P. sinensis. These correspond with one immunoglobulin M, one immunoglobulin D, several immunoglobulins Y (six in C. picta bellii and eight in P. sinensis), and several immunoglobulins that are similar to immunoglobulin D2 (five in C. picta belli and seven in P. sinensis) that was previously described in Eublepharis macularius. It is worthy to note that IGHD2 are placed in an inverted transcriptional orientation and present sequences for two immunoglobulin domains that are similar to bird IgA domains. Furthermore, its phylogenetic analysis allows us to consider about the presence of IGHA gene in a primitive reptile, so we would be dealing with the memory of the gene that originated from the bird IGHA. In summary, we provide a clear picture of the immunoglobulins present in a turtle, whose analysis supports the idea that turtles emerged from the evolutionary line from the differentiation of birds and the presence of the IGHA gene present in a common ancestor.

  3. PET genes of Saccharomyces cerevisiae.

    PubMed Central

    Tzagoloff, A; Dieckmann, C L


    We describe a collection of nuclear respiratory-defective mutants (pet mutants) of Saccharomyces cerevisiae consisting of 215 complementation groups. This set of mutants probably represents a substantial fraction of the total genetic information of the nucleus required for the maintenance of functional mitochondria in S. cerevisiae. The biochemical lesions of mutants in approximately 50 complementation groups have been related to single enzymes or biosynthetic pathways, and the corresponding wild-type genes have been cloned and their structures have been determined. The genes defined by an additional 20 complementation groups were identified by allelism tests with mutants characterized in other laboratories. Mutants representative of the remaining complementation groups have been assigned to one of the following five phenotypic classes: (i) deficiency in cytochrome oxidase, (ii) deficiency in coenzyme QH2-cytochrome c reductase, (iii) deficiency in mitochondrial ATPase, (iv) absence of mitochondrial protein synthesis, and (v) normal composition of respiratory-chain complexes and of oligomycin-sensitive ATPase. In addition to the genes identified through biochemical and genetic analyses of the pet mutants, we have cataloged PET genes not matched to complementation groups in the mutant collection and other genes whose products function in the mitochondria but are not necessary for respiration. Together, this information provides an up-to-date list of the known genes coding for mitochondrial constituents and for proteins whose expression is vital for the respiratory competence of S. cerevisiae. PMID:2215420

  4. Gene Therapy in Heart Failure

    PubMed Central

    Vinge, Leif Erik; Raake, Philip W.; Koch, Walter J.


    With increasing knowledge of basic molecular mechanisms governing the development of heart failure (HF), the possibility of specifically targeting key pathological players is evolving. Technology allowing for efficient in vivo transduction of myocardial tissue with long-term expression of a transgene enables translation of basic mechanistic knowledge into potential gene therapy approaches. Gene therapy in HF is in its infancy clinically with the predominant amount of experience being from animal models. Nevertheless, this challenging and promising field is gaining momentum as recent preclinical studies in larger animals have been carried out and, importantly, there are 2 newly initiated phase I clinical trials for HF gene therapy. To put it simply, 2 parameters are needed for achieving success with HF gene therapy: (1) clearly identified detrimental/beneficial molecular targets; and (2) the means to manipulate these targets at a molecular level in a sufficient number of cardiac cells. However, several obstacles do exist on our way to efficient and safe gene transfer to human myocardium. Some of these obstacles are discussed in this review; however, it primarily focuses on the molecular target systems that have been subjected to intense investigation over the last decade in an attempt to make gene therapy for human HF a reality. PMID:18566312

  5. Transcriptional gene silencing in humans

    PubMed Central

    Weinberg, Marc S.; Morris, Kevin V.


    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  6. 1,3-propanediol production by Escherichia coli expressing genes of dha operon from Clostridium butyricum 2CR371.5.


    Dąbrowski, Sławomir; Pietrewicz-Kubicz, Dorota; Zabłotna, Ewa; Długołęcka, Anna


    1,3-propanediol is used as a monomer in the production of some polymers e.g. polytrimethylene terephthalate used in the production of carpets and textile fibers and in the thermoplastics engineering. However, the traditional chemical synthesis is expensive, generates some toxic intermediates and requires a reduction step under high hydrogen pressure. Biological production of 1,3-propanediol could be an attractive alternative to the traditional chemical methods. Moreover, crude glycerol which is a by-product of biodiesel production, can be used. We constructed a recombinant Escherichia coli strain producing 1,3-propanediol from glycerol by introducing genes of the dha operon from Clostridium butyricum 2CR371.5, a strain from our collection of environmental samples and strains. The E. coli strain produced 3.7 g of 1,3-propanediol per one litre of culture with the yield of 0.3 g per 1 g of glycerol consumed.

  7. Homology-dependent Gene Silencing in Paramecium

    PubMed Central

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa


    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  8. Novel gene transfer systems: intelligent gene transfer vectors for gene medicines.


    Nakajima, Toshihiro


    Drug delivery systems for gene transfer are called 'vectors'. These systems were originally invented as a delivery system for the transfection in vitro or in vivo. Several vectors are then developed for clinical use of gene medicines and currently some of them are approved as animal drugs. Conventional drug delivery system generally consists of approved (existing) materials to avoid additional pre-clinical or clinical studies. However, current vectors contain novel materials to improve an efficacy of gene medicines. Thus, these vectors have functions more than a mere delivery of active ingredients. For example some vectors have immunological functions such as adjuvants in vaccines. These new types of vectors are called 'intelligent' or 'innovative' vector system', since the concept or strategy for the development is completely different from conventional drug delivery systems. In this article, we described a current status of 'intelligent gene transfer vectors and discussed on the potentials of them.

  9. Fetal muscle gene therapy/gene delivery in large animals.


    Abi-Nader, Khalil N; David, Anna L


    Gene delivery to the fetal muscles is a potential strategy for the early treatment of muscular dystrophies. In utero muscle gene therapy can also be used to treat other genetic disorders such as hemophilia, where the missing clotting proteins may be secreted from the treated muscle. In the past few years, studies in small animal models have raised the hopes that a phenotypic cure can be obtained after fetal application of gene therapy. Studies of efficacy and safety in large animals are, however, essential before clinical application can be considered in the human fetus. For this reason, the development of clinically applicable strategies for the delivery of gene therapy to the fetal muscles is of prime importance. In this chapter, we describe the protocols for in utero ultrasound-guided gene delivery to the ovine fetal muscle in early gestation. In particular, procedures to inject skeletal muscle groups such as the thigh and thoracic musculature and targeting the diaphragm in the fetus are described in detail.

  10. Newer gene editing technologies toward HIV gene therapy.


    Manjunath, N; Yi, Guohua; Dang, Ying; Shankar, Premlata


    Despite the great success of highly active antiretroviral therapy (HAART) in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called "Berlin patient" who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy.

  11. Noninvasive tracking of gene transcript and neuroprotection after gene therapy.


    Ren, J; Chen, Y I; Liu, C H; Chen, P-C; Prentice, H; Wu, J-Y; Liu, P K


    Gene therapy holds exceptional potential for translational medicine by improving the products of defective genes in diseases and/or providing necessary biologics from endogenous sources during recovery processes. However, validating methods for the delivery, distribution and expression of the exogenous genes from such therapy can generally not be applicable to monitor effects over the long term because they are invasive. We report here that human granulocyte colony-stimulating factor (hG-CSF) complimentary DNA (cDNA) encoded in self-complementary adeno-associated virus-type 2 adeno-associated virus, as delivered through eye drops at multiple time points after cerebral ischemia using bilateral carotid occlusion for 60 min (BCAO-60) led to significant reduction in mortality rates, cerebral atrophy and neurological deficits in C57black6 mice. Most importantly, we validated hG-CSF cDNA expression using translatable magnetic resonance imaging (MRI) in living brains. This noninvasive approach for monitoring exogenous gene expression in the brains has potential for great impact in the area of experimental gene therapy in animal models of heart attack, stroke, Alzheimer's dementia, Parkinson's disorder and amyotrophic lateral sclerosis, and the translation of such techniques to emergency medicine.

  12. The biology of novel animal genes: Mouse APEX gene knockout

    SciTech Connect

    MacInnes, M.; Altherr, M.R.; Ludwig, D.; Pedersen, R.; Mold, C.


    This is the final report of a one-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The controlled breeding of novel genes into mice, including the gene knockout (KO), or conversely by adding back transgenes provide powerful genetic technologies that together suffice to determine in large part the biological role(s) of novel genes. Inbred mouse remains the best understood and most useful mammalian experimental system available for tackling the biology of novel genes. The major mammalian apurinic/apyrimidinic (AP) endonuclease (APE), is involved in a key step in the repair of spontaneous and induced AP sites in DNA. Efficient repair of these lesions is imperative to prevent the stable incorporation of mutations into the cellular genome which may lead to cell death or transformation. Loss or modulation of base excison repair activity in vivo may elevate the spontaneous mutation rate in cells, and may lead to a substantial increase in the incidence of cancer. Despite extensive biochemical analysis, however, the significance of these individual APE functions in vivo has not been elucidated. Mouse embryonic stem (ES) cells heterozygous for a deletion mutation in APE have been generated and whole animals containing the APE mutation have been derived from these ES cells. Animals homozygous for the APE null mutation die early in gestation, underscoring the biological significance of this DNA repair gene.

  13. [Developments in gene delivery vectors for ocular gene therapy].


    Khabou, Hanen; Dalkara, Deniz


    Gene therapy is quickly becoming a reality applicable in the clinic for inherited retinal diseases. Its remarkable success in safety and efficacy, in clinical trials for Leber's congenital amaurosis (LCA) type II generated significant interest and opened up possibilities for a new era of retinal gene therapies. Success in these clinical trials was mainly due to the favorable characteristics of the retina as a target organ. The eye offers several advantages as it is readily accessible and has some degree of immune privilege making it suitable for application of viral vectors. The viral vectors most frequently used for retinal gene delivery are lentivirus, adenovirus and adeno-associated virus (AAV). Here we will discuss the use of these viral vectors in retinal gene delivery with a strong focus on favorable properties of AAV. Thanks to its small size, AAV diffuses well in the inter-neural matrix making it suitable for applications in neural retina. Building on this initial clinical success with LCA II, we have now many opportunities to extend this proof-of-concept to other retinal diseases using AAV as a vector. This article will discuss what are some of the most imminent cellular targets for such therapies and the AAV toolkit that has been built to target these cells successfully. We will also discuss some of the challenges that we face in translating AAV-based gene therapies to the clinic.

  14. Regulation of gene expression in brain tissues of rats repeatedly treated by the highly abused opioid agonist, oxycodone: microarray profiling and gene mapping analysis.


    Hassan, Hazem E; Myers, Alan L; Lee, Insong J; Chen, Hegang; Coop, Andrew; Eddington, Natalie D


    Although oxycodone is the most often used opioid agonist, it remains one of the most understudied drugs. We used microarray analysis to better understand the global changes in gene expression in brain tissues of rats repeatedly treated with oxycodone. Many genes were significantly regulated by oxycodone (e.g., Fkbp5, Per2, Rt1.Dalpha, Slc16a1, and Abcg2). Validation of the microarray data by quantitative real-time-polymerase chain reaction (Q-PCR) indicated that there was a strong significant correlation (r = 0.979, p < 0.0000001) between the Q-PCR and the microarray data. Using MetaCore (a computational platform), many biological processes were identified [e.g., organic anion transport (p = 7.251 x 10(-4)) and regulation of immune response (p = 5.090 x 10(-4))]. Among the regulated genes, Abcg2 mRNA was up-regulated by 2.1-fold, which was further confirmed by immunoblotting (1.8-fold up-regulation). Testing the Abcg2 affinity status of oxycodone using an Abcg2 ATPase assay suggests that oxycodone behaves as an Abcg2 substrate only at higher concentrations (> or = 500 microM). Furthermore, brain uptake studies demonstrated that oxycodone-induced Abcg2 up-regulation resulted in a significant (p < 0.05) decrease (approximately 2-fold) in brain/plasma ratios of mitoxantrone. These results highlight markers/mediators of neuronal responses and identify regulatory pathways involved in the pharmacological action of oxycodone. These results also identify genes that potentially modulate tolerance, dependence, immune response, and drug-drug interactions. Finally, our findings suggest that oxycodone-induced up-regulation of Abcg2 enhanced the efflux of the Abcg2 substrate, mitoxantrone, limiting its brain accumulation and resulting in an undesirable drug-drug interaction. Extrapolating these results to other Abcg2 substrates (e.g., daunorubicin and doxorubicin) indicates that the brain uptake of these agents may be affected if they are administered concomitantly with

  15. GenePANDA—a novel network-based gene prioritizing tool for complex diseases

    PubMed Central

    Yin, Tianshu; Chen, Shu; Wu, Xiaohui; Tian, Weidong


    Here we describe GenePANDA, a novel network-based tool for prioritizing candidate disease genes. GenePANDA assesses whether a gene is likely a candidate disease gene based on its relative distance to known disease genes in a functional association network. A unique feature of GenePANDA is the introduction of adjusted network distance derived by normalizing the raw network distance between two genes with their respective mean raw network distance to all other genes in the network. The use of adjusted network distance significantly improves GenePANDA’s performance on prioritizing complex disease genes. GenePANDA achieves superior performance over five previously published algorithms for prioritizing disease genes. Finally, GenePANDA can assist in prioritizing functionally important SNPs identified by GWAS. PMID:28252032

  16. [Polymeric nanoparticles with therapeutic gene for gene therapy: I. Preparation and in vivo gene transfer study].


    Yang, Jing; Song, Cunxian; Sun, Hongfan; Wu, Li; Tang, Lina; Leng, Xigang; Wang, Pengyan; Xu, Yiyao; Li, Yongjun; Guan, Heng


    VEGF nanoparticle (VEGF-NP) was prepared by a multi-emulsification technique using a biodegradable poly-dl-lactic-co-glycolic (PLGA) as matrix material. The nanoparticles were characterized for size, VEGF loading capacity, and in vitro release. VEGF-NP and naked VEGF plasmid were intramuscularly injected into the ischemia site of the rabbit chronic hindlimb ischemia model and the efficiency of VEGF-NP as gene delivery carrier for gene therapy in animal model was evaluated. Gene therapuetic effect was assessed evaluated by RT-PCR, immunohistochemistry and angiography assay. The average size of VEGF-NP was around 300 nm. The encapsulation efficiency of VEGF was above 96%. Loading amount of VEGF in the nanoparticles was about 4%. In vitro, nanoparticles maintained sustained-release of VEGF for two weeks. Two weeks post gene injection the capillary density in VEGF-NP group (81.22 per mm2) was significantly higher than that in control group (29.54 mm2). RT-PCR results showed greatly higher VEGF expression in VEGF-NP group (31.79au * mm) than that in naked VEGF group (9.15 au * mm). As a carrier system for gene therapy in animal model, VEGF-NP is much better than naked DNA plasmid. The results demonstrate great possibility of using NP carrier in human gene therapy.

  17. Circadian Rhythmicity of Active GSK3 Isoforms Modulates Molecular Clock Gene Rhythms in the Suprachiasmatic Nucleus

    PubMed Central

    Besing, R.C.; Paul, J.R.; Hablitz, L.M.; Rogers, C.O.; Johnson, R.L.; Young, M.E.; Gamble, K.L.


    The suprachiasmatic nucleus (SCN) drives and synchronizes daily rhythms at the cellular level via transcriptional-translational feedback loops comprised of clock genes such as Bmal1 and Period (Per). Glycogen synthase kinase 3 (GSK3), a serine/threonine kinase, phosphorylates at least five core clock proteins and shows diurnal variation in phosphorylation state (inactivation) of the GSK3β isoform. Whether phosphorylation of the other primary isoform (GSK3α) varies across the subjective day-night cycle is unknown. The purpose of this study was to determine if the endogenous rhythm of GSK3 (α and β) phosphorylation is critical for rhythmic BMAL1 expression and normal amplitude and periodicity of the molecular clock in the SCN. Significant circadian rhythmicity of phosphorylated GSK3 (α and β) was observed in the SCN from wild-type mice housed in constant darkness for two weeks. Importantly, chronic activation of both GSK3 isoforms impaired rhythmicity of the GSK3 target BMAL1. Furthermore, chronic pharmacological inhibition of GSK3 with 20 μM CHIR-99021 enhanced the amplitude and shortened the period of PER2::luciferase rhythms in organotypic SCN slice cultures. These results support the model that GSK3 activity status is regulated by the circadian clock and that GSK3 feeds back to regulate the molecular clock amplitude in the SCN. PMID:25724980

  18. Palmitate Inhibits SIRT1-Dependent BMAL1/CLOCK Interaction and Disrupts Circadian Gene Oscillations in Hepatocytes

    PubMed Central

    Tong, Xin; Zhang, Deqiang; Arthurs, Blake; Li, Pei; Durudogan, Leigh; Gupta, Neil; Yin, Lei


    Elevated levels of serum saturated fatty acid palmitate have been shown to promote insulin resistance, increase cellular ROS production, and trigger cell apoptosis in hepatocytes during the development of obesity. However, it remains unclear whether palmitate directly impacts the circadian clock in hepatocytes, which coordinates nutritional inputs and hormonal signaling with downstream metabolic outputs. Here we presented evidence that the molecular clock is a novel target of palmitate in hepatocytes. Palmitate exposure at low dose inhibits the molecular clock activity and suppresses the cyclic expression of circadian targets including Dbp, Nr1d1 and Per2 in hepatocytes. Palmitate treatment does not seem to alter localization or reduce protein expression of BMAL1 and CLOCK, the two core components of the molecular clock in hepatocytes. Instead, palmitate destabilizes the protein-protein interaction between BMAL1-CLOCK in a dose and time-dependent manner. Furthermore, we showed that SIRT1 activators could reverse the inhibitory action of palmitate on BMAL1-CLOCK interaction and the clock gene expression, whereas inhibitors of NAD synthesis mimic the palmitate effects on the clock function. In summary, our findings demonstrated that palmitate inhibits the clock function by suppressing SIRT1 function in hepatocytes. PMID:26075729

  19. Familial aggregation analysis of gene expressions

    PubMed Central

    Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K


    Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

  20. A Gene Ontology Tutorial in Python.


    Vesztrocy, Alex Warwick; Dessimoz, Christophe


    This chapter is a tutorial on using Gene Ontology resources in the Python programming language. This entails querying the Gene Ontology graph, retrieving Gene Ontology annotations, performing gene enrichment analyses, and computing basic semantic similarity between GO terms. An interactive version of the tutorial, including solutions, is available at .

  1. Pulmonary Gene Expression Profiling of Inhaled Ricin

    DTIC Science & Technology


    in which 34 genes had statistically significant changes in gene expression. Transcripts identified by the assay included those that facilitate...gene expression. Transcripts identified by the assay included those that facilitate tissue healing (early growth response gene (egr)-1), regulate...impingement to determine aerosol concentration. Ricin concentrations from impinger samples were measured by protein assay (Pierce, MicroBCA, Rockford

  2. 'Uncombable' Hair? Maybe Genes Are to Blame


    ... Health, or the U.S. Department of Health and Human Services. More Health News on: Genes and Gene Therapy Recent Health News Related MedlinePlus Health Topics Genes and Gene Therapy Hair Problems About MedlinePlus Site Map FAQs Customer Support ...

  3. In-depth Characterization of Firefly Luciferase as a Reporter of Circadian Gene Expression in Mammalian Cells

    PubMed Central

    Feeney, Kevin A.; Putker, Marrit; Brancaccio, Marco; O’Neill, John S.


    Firefly luciferase (Fluc) is frequently used to report circadian gene expression rhythms in mammalian cells and tissues. During longitudinal assays it is generally assumed that enzymatic substrates are in saturating excess, such that total bioluminescence is directly proportional to Fluc protein level. To test this assumption, we compared the enzyme kinetics of purified luciferase with its activity in mammalian cells. We found that Fluc activity in solution has a lower Michaelis constant (Km) for luciferin, lower temperature dependence, and lower catalytic half-life than Fluc in cells. In consequence, extracellular luciferin concentration significantly affects the apparent circadian amplitude and phase of the widely used PER2::LUC reporter in cultured fibroblasts, but not in SCN, and we suggest that this arises from differences in plasma membrane luciferin transporter activity. We found that at very high concentrations (>1 mM), luciferin lengthens circadian period, in both fibroblasts and organotypic SCN slices. We conclude that the amplitude and phase of circadian gene expression inferred from bioluminescence recordings should be treated with some caution, and we suggest that optimal luciferin concentration should be determined empirically for each luciferase reporter and cell type. PMID:28112045

  4. A hybrid approach of gene sets and single genes for the prediction of survival risks with gene expression data.


    Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong


    Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.

  5. Molecular Analysis and Expression of bap Gene in Biofilm-Forming Multi-Drug-Resistant Acinetobacter baumannii

    PubMed Central

    Azizi, Omid; Shahcheraghi, Fereshteh; Salimizand, Himen; Modarresi, Farzan; Shakibaie, Mohammad Reza; Mansouri, Shahla; Ramazanzadeh, Rashid; Badmasti, Farzad; Nikbin, Vajihe


    Background: Acinetobacter baumannii is commonly resistant to nearly all antibiotics due to presence of antibiotic resistance genes and biofilm formation. In this study we determined the presence of certain antibiotic-resistance genes associated with biofilm production and the influence of low iron concentration on expression of the biofilm-associated protein gene (bap) in development of biofilm among multi-drug-resistant A. baumannii (MDRAB) Methods: Sixty-five MDRAB isolates from clinical samples were collected. Molecular typing was carried out by random amplified polymorphism DNA polymerase chain reaction (RAPD-PCR). Biofilm formation was assayed by the microtiter method. Results: The sequence of bap was determined and deposited in the GenBank database (accession no. KR080550.1). Expression of bap in the presence of low iron was analyzed by relative quantitative real time PCR (rqRT-PCR). Nearly half of the isolates belonged to RAPD-types A and B remaining were either small clusters or singleton. The results of biofilm formation revealed that 23 (35.4%), 18 (27.7%), 13 (20%), and 11 (16.9%) of the isolates had strong, moderate, weak, and no biofilm activities, respectively. ompA and csuE genes were detected in all, while bap and blaPER-1 were detected in 43 (66%) and 42 (64%) of the isolates that showed strong and moderate biofilm activities (p ≤ 0.05), respectively. Analysis of bap expression by rqRT-PCR revealed five isolates with four-fold bap overexpression in the presence of low iron concentration (20 µM). Conclusion: The results suggest that bap overexpression may influence biofilm formation in presence of low iron concentration PMID:28070537

  6. Strategies to identify disease genes.


    Ashton, Gabrielle H S; McGrath, John A; South, Andrew P


    The correlation between genes and disease began in earnest in the early 1900s with the identification of Mendelian-like inheritance of "inborn errors of metabolism." Since then, the ever-broadening field of genetics has been established as one of the most important and groundbreaking branches of science and medicine to date. With the announcement of a "working draft" sequence of the human genome in 2001, the vast array of both genomic and expressed sequence information available in the public databases alone has meant that the concept of hunting for genes is evolving. Nowadays, researchers can substitute many labor-intensive hours in the lab for less time searching on the World Wide Web. Specialization within genetics has been continuously providing subsets of the genre such as genomics, pharmacogenetics, chemogenomics, gene therapy, proteomics and functional genomics, all of which are based on the fundamental starting block, the gene. This review aims to summarize both traditional and current strategies for identifying susceptibility and monogenetic disease genes and describes how these strategies have evolved in tune with the ever-expanding wealth of information now available at our fingertips.

  7. Gene Therapy for Pituitary Tumors

    PubMed Central

    Seilicovich, Adriana; Pisera, Daniel; Sciascia, Sandra A.; Candolfi, Marianela; Puntel, Mariana; Xiong, Weidong; Jaita, Gabriela; Castro, Maria G.


    Pituitary tumors are the most common primary intracranial neoplasms. Although most pituitary tumors are considered typically benign, others can cause severe and progressive disease. The principal aims of pituitary tumor treatment are the elimination or reduction of the tumor mass, normalization of hormone secretion and preservation of remaining pituitary function. In spite of major advances in the therapy of pituitary tumors, for some of the most difficult tumors, current therapies that include medical, surgical and radiotherapeutic methods are often unsatisfactory and there is a need to develop new treatment strategies. Gene therapy, which uses nucleic acids as drugs, has emerged as an attractive therapeutic option for the treatment of pituitary tumors that do not respond to classical treatment strategies if the patients become intolerant to the therapy. The development of animal models for pituitary tumors and hormone hypersecretion has proven to be critical for the implementation of novel treatment strategies and gene therapy approaches. Preclinical trials using several gene therapy approaches for the treatment of anterior pituitary diseases have been successfully implemented. Several issues need to be addressed before clinical implementation becomes a reality, including the development of more effective and safer viral vectors, uncovering novel therapeutic targets and development of targeted expression of therapeutic transgenes. With the development of efficient gene delivery vectors allowing long-term transgene expression with minimal toxicity, gene therapy will become one of the most promising approaches for treating pituitary adenomas. PMID:16457646

  8. Gene Chips and Functional Genomics

    NASA Astrophysics Data System (ADS)

    Hamadeh, Hisham; Afshari, Cynthia


    These past few years of scientific discovery will undoubtedly be remembered as the "genomics era," the period in which biologists succeeded in enumerating the sequence of nucleotides making up all, or at least most, of human DNA. And while this achievement has been heralded as a technological feat equal to the moon landing, it is only the first of many advances in DNA technology. Scientists are now faced with the task of understanding the meaning of the DNA sequence. Specifically, they want to learn how the DNA code relates to protein function. An important tool in the study of "functional genomics," is the cDNA microarray—also known as the gene chip. Inspired by computer microchips, gene chips allow scientists to monitor the expression of hundreds, even thousands, of genes in a fraction of the time it used to take to monitor the expression of a single one. By altering the conditions under which a particular tissue expresses genes—say, by exposing it to toxins or growth factors—scientists can determine the suite of genes expressed in different situations and hence start to get a handle on the function of these genes. The authors discuss this important new technology and some of its practical applications.

  9. Combinatorial methods for gene recognition

    SciTech Connect

    Pevzner, P.A.


    The major result of the project is the development of a new approach to gene recognition called spliced alignment algorithm. They have developed an algorithm and implemented a software tool (for both IBM PC and UNIX platforms) which explores all possible exon assemblies in polynomial time and finds the multi-exon structure with the best fit to a related protein. Unlike other existing methods, the algorithm successfully performs exons assemblies even in the case of short exons or exons with unusual codon usage; they also report correct assemblies for the genes with more than 10 exons provided a homologous protein is already known. On a test sample of human genes with known mammalian relatives the average overlap between the predicted and the actual genes was 99%, which is remarkably well as compared to other existing methods. At that, the algorithm absolute correctly reconstructed 87% of genes. The rare discrepancies between the predicted and real axon-intron structures were restricted either to extremely short initial or terminal exons or proved to be results of alternative splicing. Moreover, the algorithm performs reasonably well with non-vertebrate and even prokaryote targets. The spliced alignment software PROCRUSTES has been in extensive use by the academic community since its announcement in August, 1996 via the WWW server ( and by biotech companies via the in-house UNIX version.

  10. Gene Ontology Consortium: going forward

    PubMed Central


    The Gene Ontology (GO; is a community-based bioinformatics resource that supplies information about gene product function using ontologies to represent biological knowledge. Here we describe improvements and expansions to several branches of the ontology, as well as updates that have allowed us to more efficiently disseminate the GO and capture feedback from the research community. The Gene Ontology Consortium (GOC) has expanded areas of the ontology such as cilia-related terms, cell-cycle terms and multicellular organism processes. We have also implemented new tools for generating ontology terms based on a set of logical rules making use of templates, and we have made efforts to increase our use of logical definitions. The GOC has a new and improved web site summarizing new developments and documentation, serving as a portal to GO data. Users can perform GO enrichment analysis, and search the GO for terms, annotations to gene products, and associated metadata across multiple species using the all-new AmiGO 2 browser. We encourage and welcome the input of the research community in all biological areas in our continued effort to improve the Gene Ontology. PMID:25428369

  11. Gene methylation in gastric cancer.


    Qu, Yiping; Dang, Siwen; Hou, Peng


    Gastric cancer is one of the most common malignancies and remains the second leading cause of cancer-related death worldwide. Over 70% of new cases and deaths occur in developing countries. In the early years of the molecular biology revolution, cancer research mainly focuses on genetic alterations, including gastric cancer. Epigenetic mechanisms are essential for normal development and maintenance of tissue-specific gene expression patterns in mammals. Disruption of epigenetic processes can lead to altered gene function and malignant cellular transformation. Recent advancements in the rapidly evolving field of cancer epigenetics have shown extensive reprogramming of every component of the epigenetic machinery in cancer, including DNA methylation, histone modifications, nucleosome positioning, noncoding RNAs, and microRNAs. Aberrant DNA methylation in the promoter regions of gene, which leads to inactivation of tumor suppressor and other cancer-related genes in cancer cells, is the most well-defined epigenetic hallmark in gastric cancer. The advantages of gene methylation as a target for detection and diagnosis of cancer in biopsy specimens and non-invasive body fluids such as serum and gastric washes have led to many studies of application in gastric cancer. This review focuses on the most common and important phenomenon of epigenetics, DNA methylation, in gastric cancer and illustrates the impact epigenetics has had on this field.

  12. Stem cell directed gene therapy.


    Engel, B C; Kohn, D B


    A potential therapeutic approach to HIV-1 infection is the genetic modification of cells of a patient to make them resistant to HIV-1. Hematopoietic stem cells are an attractive target for gene therapy of AIDS because of their ability to generate a broad repertoire of mature T lymphocytes, as well as the monocytic cells (macrophages, dendritic cells and microglia) which are also involved in HIV-1 pathogenesis. A number of synthetic "anti-HIV-1 genes" have been developed which inhibit HIV-1 replication. However, current methods for gene transfer into human hematopoietic stem cells, using retroviral vectors derived from the Moloney murine leukemia virus, have been minimally effective. Clinical trials performed to date in which hematopoietic cells from HIV-1-positive patients have been transduced with retroviral vectors and then reinfused have produced low to undetectable levels of gene-containing peripheral blood leukocytes. New vector delivery systems, such as lentiviral vectors, need to be developed to ensure efficient gene transfer and persistent transgene expression to provide life-long resistance to the cells targeted by HIV-1.

  13. Gene Ontology Consortium: going forward.



    The Gene Ontology (GO; is a community-based bioinformatics resource that supplies information about gene product function using ontologies to represent biological knowledge. Here we describe improvements and expansions to several branches of the ontology, as well as updates that have allowed us to more efficiently disseminate the GO and capture feedback from the research community. The Gene Ontology Consortium (GOC) has expanded areas of the ontology such as cilia-related terms, cell-cycle terms and multicellular organism processes. We have also implemented new tools for generating ontology terms based on a set of logical rules making use of templates, and we have made efforts to increase our use of logical definitions. The GOC has a new and improved web site summarizing new developments and documentation, serving as a portal to GO data. Users can perform GO enrichment analysis, and search the GO for terms, annotations to gene products, and associated metadata across multiple species using the all-new AmiGO 2 browser. We encourage and welcome the input of the research community in all biological areas in our continued effort to improve the Gene Ontology.

  14. Clock Genes in Glia Cells

    PubMed Central

    Chi-Castañeda, Donají


    Circadian rhythms are periodic patterns in biological processes that allow the organisms to anticipate changes in the environment. These rhythms are driven by the suprachiasmatic nucleus (SCN), the master circadian clock in vertebrates. At a molecular level, circadian rhythms are regulated by the so-called clock genes, which oscillate in a periodic manner. The protein products of clock genes are transcription factors that control their own and other genes’ transcription, collectively known as “clock-controlled genes.” Several brain regions other than the SCN express circadian rhythms of clock genes, including the amygdala, the olfactory bulb, the retina, and the cerebellum. Glia cells in these structures are expected to participate in rhythmicity. However, only certain types of glia cells may be called “glial clocks,” since they express PER-based circadian oscillators, which depend of the SCN for their synchronization. This contribution summarizes the current information about clock genes in glia cells, their plausible role as oscillators and their medical implications. PMID:27666286

  15. Metazoan Gene Families from Metazome

    DOE Data Explorer

    Metazome is a joint project of the Department of Energy's Joint Genome Institute and the Center for Integrative Genomics to facilitate comparative genomic studies amongst metazoans. Clusters of orthologous and paralogous genes that represent the modern descendents of ancestral gene sets are constructed at key phylogenetic nodes. These clusters allow easy access to clade specific orthology/paralogy relationships as well as clade specific genes and gene expansions. As of version 2.0.4, Metazome provides access to twenty-four sequenced and annotated metazoan genomes, clustered at nine evolutionarily significant nodes. Where possible, each gene has been annotated with PFAM, KOG, KEGG, and PANTHER assignments, and publicly available annotations from RefSeq, UniProt, Ensembl, and JGI are hyper-linked and searchable. The included organisms (by common name) are: Human, Mouse, Rat, Dog, Opossum, Chicken, Frog, Stickleback, Medaka, Fugu pufferfish; Zebrafish, Seasquirt - savignyi, Seasquirt - intestinalis, Amphioxus, Sea Urchin, Fruitfly, Mosquite, Yellow Fever Mosquito, Silkworm, Red Flour Beetle, Worm, Briggsae Worm, Owl limpet (snail), and Sea anemone. [Copied from Metazome Overview at

  16. Decationized polyplexes for gene delivery.


    Novo, Luís; Mastrobattista, Enrico; van Nostrum, Cornelus F; Lammers, Twan; Hennink, Wim E


    Gene therapy has received much attention in the field of drug delivery. Synthetic, nonviral gene delivery systems have gained increasing attention as vectors for gene therapy mainly due to a favorable immunogenicity profile and ease of manufacturing as compared to viral vectors. The great majority of these formulations are based on polycationic structures, due to their ability to interact with negatively charged nucleic acids to spontaneously form nanoparticles. In recent years, several polycationic systems have demonstrated high transfection in vitro. However, progress toward clinical applications has been slow, mainly because the cationic nature of these systems leads to intolerable toxicity levels, inappropriate biodistribution and unsatisfactory efficiency in vivo, particularly after systemic administration. Decationized polyplexes are a new class of gene delivery systems that have been developed as an alternative for conventional polycation-based systems. The major innovation introduced by decationized polyplexes is that these systems are based on neutral polymers, without any detrimental effect on the physicochemical stability or encapsulation ability, due to the transient presence of cationic charge and disulfide cross-links between the polymer chains by which the nucleic acids are physically entrapped in the particles. This editorial summarizes the most important features of decationized polyplexes and discusses potential implications for the development of new safe and efficient gene delivery systems.

  17. Ultradian feeding in mice not only affects the peripheral clock in the liver, but also the master clock in the brain.


    Sen, Satish; Raingard, Hélène; Dumont, Stéphanie; Kalsbeek, Andries; Vuillez, Patrick; Challet, Etienne


    Restricted feeding during the resting period causes pronounced shifts in a number of peripheral clocks, but not the central clock in the suprachiasmatic nucleus (SCN). By contrast, daily caloric restriction impacts also the light-entrained SCN clock, as indicated by shifted oscillations of clock (PER1) and clock-controlled (vasopressin) proteins. To determine if these SCN changes are due to the metabolic or timing cues of the restricted feeding, mice were challenged with an ultradian 6-meals schedule (1 food access every 4 h) to abolish the daily periodicity of feeding. Mice fed with ultradian feeding that lost <10% body mass (i.e. isocaloric) displayed 1.5-h phase-advance of body temperature rhythm, but remained mostly nocturnal, together with up-regulated vasopressin and down-regulated PER1 and PER2 levels in the SCN. Hepatic expression of clock genes (Per2, Rev-erbα, and Clock) and Fgf21 was, respectively, phase-advanced and up-regulated by ultradian feeding. Mice fed with ultradian feeding that lost >10% body mass (i.e. hypocaloric) became more diurnal, hypothermic in late night, and displayed larger (3.5 h) advance of body temperature rhythm, more reduced PER1 expression in the SCN, and further modified gene expression in the liver (e.g. larger phase-advance of Per2 and up-regulated levels of Pgc-1α). While glucose rhythmicity was lost under ultradian feeding, the phase of daily rhythms in liver glycogen and plasma corticosterone (albeit increased in amplitude) remained unchanged. In conclusion, the additional impact of hypocaloric conditions on the SCN are mainly due to the metabolic and not the timing effects of restricted daytime feeding.

  18. Photic entrainment of Period mutant mice is predicted from their phase response curves

    PubMed Central

    Pendergast, Julie S.; Friday, Rio C.; Yamazaki, Shin


    A fundamental property of circadian clocks is that they entrain to environmental cues. The circadian genes, Period1 and Period2, are involved in entrainment of the mammalian circadian system. To investigate the roles of the Period genes in photic entrainment, we constructed phase response curves (PRC) to light pulses for C57BL/6J wild-type, Per1−/−, Per2−/−, and Per3−/− mice and tested whether the PRCs accurately predict entrainment to non-24 light-dark cycles (T-cycles) and constant light (LL). The PRCs of wild-type and Per3−/− mice are similar in shape and amplitude and have relatively large delay zones and small advance zones, resulting in successful entrainment to T26, but not T21, with similar phase angles. Per1−/− mice have a high-amplitude PRC, resulting in entrainment to a broad range of T-cycles. Per2−/− mice also entrain to a wide range of T-cycles because the advance portion of their PRC is larger than wild-types. Period aftereffects following entrainment to T-cycles were similar among all genotypes. We found that the ratio of the advance portion to the delay portion of the PRC accurately predicts the lengthening of the period of the activity rhythm in LL. Wild-type, Per1−/−, and Per3−/− mice had larger delay zones than advance zones and lengthened (>24hrs) periods in LL, while Per2−/− mice had delay and advance zones that were equal in size and no period lengthening in LL. Together, these results demonstrate that PRCs are powerful tools for predicting and understanding photic entrainment of circadian mutant mice. PMID:20826680

  19. Hox gene dysregulation in acute myeloid leukemia.


    De Braekeleer, Etienne; Douet-Guilbert, Nathalie; Basinko, Audrey; Le Bris, Marie-Josée; Morel, Frédéric; De Braekeleer, Marc


    In humans, class I homeobox genes (HOX genes) are distributed in four clusters. Upstream regulators include transcriptional activators and members of the CDX family of transcription factors. HOX genes encode proteins and need cofactor interactions, to increase their specificity and selectivity. HOX genes contribute to the organization and regulation of hematopoiesis by controlling the balance between proliferation and differentiation. Changes in HOX gene expression can be associated with chromosomal rearrangements generating fusion genes, such as those involving MLL and NUP98, or molecular defects, such as mutations in NPM1 and CEBPA for example. Several miRNAs are involved in the control of HOX gene expression and their expression correlates with HOX gene dysregulation. HOX genes dysregulation is a dominant mechanism of leukemic transformation. A better knowledge of their target genes and the mechanisms by which their dysregulated expression contributes to leukemogenesis could lead to the development of new drugs.

  20. Advancement and prospects of tumor gene therapy.


    Zhang, Chao; Wang, Qing-Tao; Liu, He; Zhang, Zhen-Zhu; Huang, Wen-Lin


    Gene therapy is one of the most attractive fields in tumor therapy. In past decades, significant progress has been achieved. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. Several therapeutic strategies have evolved, including gene-based (tumor suppressor genes, suicide genes, antiangiogenic genes, cytokine and oxidative stress-based genes) and RNA-based (antisense oligonucleotides and RNA interference) approaches. In addition, immune response-based strategies (dendritic cell- and T cell-based therapy) are also under investigation in tumor gene therapy. This review highlights the progress and recent developments in gene delivery systems, therapeutic strategies, and possible clinical directions for gene therapy.

  1. Novel Genes from Formation to Function

    PubMed Central

    Ponce, Rita; Martinsen, Lene; Vicente, Luís M.; Hartl, Daniel L.


    The study of the evolution of novel genes generally focuses on the formation of new coding sequences. However, equally important in the evolution of novel functional genes are the formation of regulatory regions that allow the expression of the genes and the effects of the new genes in the organism as well. Herein, we discuss the current knowledge on the evolution of novel functional genes, and we examine in more detail the youngest genes discovered. We examine the existing data on a very recent and rapidly evolving cluster of duplicated genes, the Sdic gene cluster. This cluster of genes is an excellent model for the evolution of novel genes, as it is very recent and may still be in the process of evolving. PMID:22811949

  2. Gene-Gene and Gene-Environment Interactions in Ulcerative Colitis

    PubMed Central

    Wang, Ming-Hsi; Fiocchi, Claudio; Zhu, Xiaofeng; Ripke, Stephan; Kamboh, M. Ilyas; Rebert, Nancy; Duerr, Richard H.; Achkar, Jean-Paul


    Genome-wide association studies (GWAS) have identified at least 133 ulcerative colitis (UC) associated loci. The role of genetic factors in clinical practice is not clearly defined. The relevance of genetic variants to disease pathogenesis is still uncertain because of not characterized gene-gene and gene-environment interactions. We examined the predictive value of combining the 133 UC risk loci with genetic interactions in an ongoing inflammatory bowel disease (IBD) GWAS. The Wellcome Trust Case-Control Consortium (WTCCC) IBD GWAS was used as a replication cohort. We applied logic regression (LR), a novel adaptive regression methodology, to search for high order interactions. Exploratory genotype correlations with UC sub-phenotypes (extent of disease, need of surgery, age of onset, extra-intestinal manifestations and primary sclerosing cholangitis (PSC)) were conducted. The combination of 133 UC loci yielded good UC risk predictability (area under the curve [AUC] of 0.86). A higher cumulative allele score predicted higher UC risk. Through LR, several lines of evidence for genetic interactions were identified and successfully replicated in the WTCCC cohort. The genetic interactions combined with the gene-smoking interaction significantly improved predictability in the model (AUC, from 0.86 to 0.89, P=3.26E-05). Explained UC variance increased from 37% to 42% after adding the interaction terms. A within case analysis found suggested genetic association with PSC. Our study demonstrates that the LR methodology allows the identification and replication of high order genetic interactions in UC GWAS datasets. UC risk can be predicted by a 133 loci and improved by adding gene-gene and gene-environment interactions. PMID:24241240

  3. Activities of Human Gene Nomenclature Committee

    SciTech Connect


    The objective of this project, shared between NIH and DOE, has been and remains to enable the medical genetics communities to use common names for genes that are discovered by different gene hunting groups, in different species. This effort provides consistent gene nomenclature and approved gene symbols to the community at large. This contributes to a uniform and consistent understanding of genomes, particularly the human as well as functional genomics based on comparisons between homologous genes in related species (human and mice).

  4. Characterization of the mammalian DNA polymerase gene(s) and enzyme(s). Annual progress report

    SciTech Connect

    Mishra, N.C.


    Two Genes for DNA polymerase delta were identified from the wild type Chinese hamster ovary cells. These genes were cloned via RT-PCR from mRNA prepared the Chinese hamster ovary cells using primers specific to conserved sequences of the DNA polymerase {delta} gene. The first gene encodes a PCNA dependent DNA polymerase {delta} gene whereas the second gene encodes a PCNA independent DNA polymerase {delta} gene. Methods were developed to clone these genes in expression vector and host systems. The role of the two genes in DNA replication and repair was determined.

  5. Metagenomics and novel gene discovery

    PubMed Central

    Culligan, Eamonn P; Sleator, Roy D; Marchesi, Julian R; Hill, Colin


    Metagenomics provides a means of assessing the total genetic pool of all the microbes in a particular environment, in a culture-independent manner. It has revealed unprecedented diversity in microbial community composition, which is further reflected in the encoded functional diversity of the genomes, a large proportion of which consists of novel genes. Herein, we review both sequence-based and functional metagenomic methods to uncover novel genes and outline some of the associated problems of each type of approach, as well as potential solutions. Furthermore, we discuss the potential for metagenomic biotherapeutic discovery, with a particular focus on the human gut microbiome and finally, we outline how the discovery of novel genes may be used to create bioengineered probiotics. PMID:24317337

  6. Comparative gene map of hypertriglyceridaemia.


    Seda, O


    Elevated triglyceride levels in the circulation are currently recognized as an independent risk factor for coronary artery disease. Hypertriglyceridaemia represents one of the attributes of metabolic syndrome and is present in the most common genetic dyslipidaemia, the familial combined hyperlipidaemia. The factual concentration of triglycerides is determined by a complex interaction of environmental and genetic components. Deeper understanding of the causative gene variants and the mode of their participation in the pathogenesis of hypertriglyceridaemia is required for devising efficient therapy of hypertriglyceridaemia. This is the first systematic review of linkage and candidate gene studies dealing with the dissection of genetic determinants of (hyper)triglyceridaemia in human and two major mammalian model species, mouse and rat. Based on the merged sets of data, a synthetic view of the genetic component of triglyceridaemia, the "hypertriglyceridaemia gene map", is presented.

  7. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.


    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  8. Differential gene expression in glaucoma.


    Jakobs, Tatjana C


    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  9. Osmotic regulation of gene action.

    PubMed Central

    Douzou, P


    Most reactions involved in gene translation systems are ionic-dependent and may be explained in electrostatic terms. However, a number of observations of equilibria and rate processes making up the overall reactions clearly indicate that there is still an enormous gap between the rough picture of the mechanism of ionic regulation and the detailed behavior of reactions at the molecular level that hold the key to specific mechanisms. The present paper deals with possible osmotic contributions arising from the gel state of gene systems that are complementary to, and interdependent of, electrostatic contributions. This treatment, although still oversimplified, explains many previous observations by relating them to a general osmotic mechanism and suggests experimental approaches to studying the mechanisms of gene regulation in organelle-free and intact systems. PMID:8127862

  10. [Gene therapy and Alzheimer's disease].


    Li, Jian; Li, Wenwen; Zhou, Jun


    Alzheimer's disease (AD) is a progressive neurodegenerative disease characterized by the presence of extracellular β-amyloid in the senile plaques, intracellular aggregates of abnormal phosphorylation of tau protein in the neurofibrillary tangles, neuronal loss and cerebrovascular amyloidosis. The manifestations of clinical symptoms include memory impairment, cognitive decline, altered behavior and language deficit. Currently available drugs in AD therapy consist of acetylcholinesterase inhibitors, NMDA receptor antagonists, non-steroidal anti-inflammatory drugs, etc. These drugs can only alleviate the symptoms of AD. Gene therapy is achieved by vector-mediated gene transfer technology, which can delivery DNA or RNA into target cells to promote the expression of a protective or therapeutic protein and silence certain virulence genes.

  11. Gene encoding plant asparagine synthetase


    Coruzzi, Gloria M.; Tsai, Fong-Ying


    The identification and cloning of the gene(s) for plant asparagine synthetase (AS), an important enzyme involved in the formation of asparagine, a major nitrogen transport compound of higher plants is described. Expression vectors constructed with the AS coding sequence may be utilized to produce plant AS; to engineer herbicide resistant plants, salt/drought tolerant plants or pathogen resistant plants; as a dominant selectable marker; or to select for novel herbicides or compounds useful as agents that synchronize plant cells in culture. The promoter for plant AS, which directs high levels of gene expression and is induced in an organ specific manner and by darkness, is also described. The AS promoter may be used to direct the expression of heterologous coding sequences in appropriate hosts.

  12. Coevolution of languages and genes.


    Pakendorf, Brigitte


    The evolution of languages shares certain characteristics with that of genes, such as the predominantly vertical line of transmission and the retention of traces of past events such as contact. Thus, studies of language phylogenies and their correlations with genetic phylogenies can enrich our understanding of human prehistory, while insights gained from genetic studies of past population contact can help shed light on the processes underlying language contact and change. As demonstrated by recent research, these evolutionary processes are more complex than simple models of gene-language coevolution predict, with linguistic boundaries only occasionally functioning as barriers to gene flow. More frequently, admixture takes place irrespective of linguistic differences, but with a detectable impact of contact-induced changes in the languages concerned.

  13. Gene Therapy in Corneal Transplantation

    PubMed Central

    Qazi, Yureeda; Hamrah, Pedram


    Corneal transplantation is the most commonly performed organ transplantation. Immune privilege of the cornea is widely recognized, partly because of the relatively favorable outcome of corneal grafts. The first-time recipient of corneal allografts in an avascular, low-risk setting can expect a 90% success rate without systemic immunosuppressive agents and histocompatibility matching. However, immunologic rejection remains the major cause of graft failure, particularly in patients with a high risk for rejection. Corticosteroids remain the first-line therapy for the prevention and treatment of immune rejection. However, current pharmacological measures are limited in their side-effect profiles, repeated application, lack of targeted response, and short duration of action. Experimental ocular gene therapy may thus present new horizons in immunomodulation. From efficient viral vectors to sustainable alternative splicing, we discuss the progress of gene therapy in promoting graft survival and postulate further avenues for gene-mediated prevention of allogeneic graft rejection. PMID:24138037

  14. Composite Nanoparticles for Gene Delivery

    PubMed Central

    Wang, Yuhua; Huang, Leaf


    Nanoparticle-mediated gene and siRNA delivery has been an appealing area to gene therapists when they attempt to treat the diseases by manipulating the genetic information in the target cells. However, the advances in materials science could not keep up with the demand for multifunctional nanomaterials to achieve desired delivery efficiency. Researchers have thus taken an alternative approach to incorporate various materials into single composite nanoparticle using different fabrication methods. This approach allows nanoparticles to possess defined nanostructures as well as multiple functionalities to overcome the critical extracellular and intracellular barriers to successful gene delivery. This chapter will highlight the advances of fabrication methods that have the most potential to translate nanoparticles from bench to bedside. Furthermore, a major class of composite nanoparticle–lipid-based composite nanoparticles will be classified based on the components and reviewed in details. PMID:25409605

  15. Does inbreeding affect gene expression in birds?


    Hansson, Bengt; Naurin, Sara; Hasselquist, Dennis


    Inbreeding increases homozygosity, exposes genome-wide recessive deleterious alleles and often reduces fitness. The physiological and reproductive consequences of inbreeding may be manifested already during gene regulation, but the degree to which inbreeding influences gene expression is unknown in most organisms, including in birds. To evaluate the pattern of inbreeding-affected gene expression over the genome and in relation to sex, we performed a transcriptome-wide gene expression (10 695 genes) study of brain tissue of 10-day-old inbred and outbred, male and female zebra finches. We found significantly lower gene expression in females compared with males at Z-linked genes, confirming that dosage compensation is incomplete in female birds. However, inbreeding did not affect gene expression at autosomal or sex-linked genes, neither in males nor in females. Analyses of single genes again found a clear sex-biased expression at Z-linked genes, whereas only a single gene was significantly affected by inbreeding. The weak effect of inbreeding on gene expression in zebra finches contrasts to the situation, for example, in Drosophila where inbreeding has been found to influence gene expression more generally and at stress-related genes in particular.

  16. Gene expression throughout a vertebrate's embryogenesis

    PubMed Central


    Background Describing the patterns of gene expression during embryonic development has broadened our understanding of the processes and patterns that define morphogenesis. Yet gene expression patterns have not been described throughout vertebrate embryogenesis. This study presents statistical analyses of gene expression during all 40 developmental stages in the teleost Fundulus heteroclitus using four biological replicates per stage. Results Patterns of gene expression for 7,000 genes appear to be important as they recapitulate developmental timing. Among the 45% of genes with significant expression differences between pairs of temporally adjacent stages, significant differences in gene expression vary from as few as five to more than 660. Five adjacent stages have disproportionately more significant changes in gene expression (> 200 genes) relative to other stages: four to eight and eight to sixteen cell stages, onset of circulation, pre and post-hatch, and during complete yolk absorption. The fewest differences among adjacent stages occur during gastrulation. Yet, at stage 16, (pre-mid-gastrulation) the largest number of genes has peak expression. This stage has an over representation of genes in oxidative respiration and protein expression (ribosomes, translational genes and proteases). Unexpectedly, among all ribosomal genes, both strong positive and negative correlations occur. Similar correlated patterns of expression occur among all significant genes. Conclusions These data provide statistical support for the temporal dynamics of developmental gene expression during all stages of vertebrate development. PMID:21356103

  17. A gene-based information gain method for detecting gene-gene interactions in case-control studies.


    Li, Jin; Huang, Dongli; Guo, Maozu; Liu, Xiaoyan; Wang, Chunyu; Teng, Zhixia; Zhang, Ruijie; Jiang, Yongshuai; Lv, Hongchao; Wang, Limei


    Currently, most methods for detecting gene-gene interactions (GGIs) in genome-wide association studies are divided into SNP-based methods and gene-based methods. Generally, the gene-based methods can be more powerful than SNP-based methods. Some gene-based entropy methods can only capture the linear relationship between genes. We therefore proposed a nonparametric gene-based information gain method (GBIGM) that can capture both linear relationship and nonlinear correlation between genes. Through simulation with different odds ratio, sample size and prevalence rate, GBIGM was shown to be valid and more powerful than classic KCCU method and SNP-based entropy method. In the analysis of data from 17 genes on rheumatoid arthritis, GBIGM was more effective than the other two methods as it obtains fewer significant results, which was important for biological verification. Therefore, GBIGM is a suitable and powerful tool for detecting GGIs in case-control studies.

  18. Identification of genes and gene clusters involved in mycotoxin synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research methods to identify and characterize genes involved in mycotoxin biosynthetic pathways have evolved considerably over the years. Before whole genome sequences were available (e.g. pre-genomics), work focused primarily on chemistry, biosynthetic mutant strains and molecular analysis of sing...

  19. Mutagenesis of diploid mammalian genes by gene entrapment

    PubMed Central

    Lin, Qing; Donahue, Sarah L.; Moore-Jarrett, Tracy; Cao, Shang; Osipovich, Anna B.; Ruley, H. Earl


    The present study describes a genome-wide method for biallelic mutagenesis in mammalian cells. Novel poly(A) gene trap vectors, which contain features for direct cloning vector–cell fusion transcripts and for post-entrapment genome engineering, were used to generate a library of 979 mutant ES cells. The entrapment mutations generally disrupted gene expression and were readily transmitted through the germline, establishing the library as a resource for constructing mutant mice. Cells homozygous for most entrapment loci could be isolated by selecting for enhanced expression of an inserted neomycin-resistance gene that resulted from losses of heterozygosity (LOH). The frequencies of LOH measured at 37 sites in the genome ranged from 1.3 × 10−5 to 1.2 × 10−4 per cell and increased with increasing distance from the centromere, implicating mitotic recombination in the process. The ease and efficiency of obtaining homozygous mutations will (i) facilitate genetic studies of gene function in cultured cells, (ii) permit genome-wide studies of recombination events that result in LOH and mediate a type of chromosomal instability important in carcinogenesis, and (iii) provide new strategies for phenotype-driven mutagenesis screens in mammalian cells. PMID:17062627

  20. Mutagenesis of diploid mammalian genes by gene entrapment.


    Lin, Qing; Donahue, Sarah L; Moore-Jarrett, Tracy; Cao, Shang; Osipovich, Anna B; Ruley, H Earl


    The present study describes a genome-wide method for biallelic mutagenesis in mammalian cells. Novel poly(A) gene trap vectors, which contain features for direct cloning vector-cell fusion transcripts and for post-entrapment genome engineering, were used to generate a library of 979 mutant ES cells. The entrapment mutations generally disrupted gene expression and were readily transmitted through the germline, establishing the library as a resource for constructing mutant mice. Cells homozygous for most entrapment loci could be isolated by selecting for enhanced expression of an inserted neomycin-resistance gene that resulted from losses of heterozygosity (LOH). The frequencies of LOH measured at 37 sites in the genome ranged from 1.3 x 10(-5) to 1.2 x 10(-4) per cell and increased with increasing distance from the centromere, implicating mitotic recombination in the process. The ease and efficiency of obtaining homozygous mutations will (i) facilitate genetic studies of gene function in cultured cells, (ii) permit genome-wide studies of recombination events that result in LOH and mediate a type of chromosomal instability important in carcinogenesis, and (iii) provide new strategies for phenotype-driven mutagenesis screens in mammalian cells.

  1. Machine Learning for Detecting Gene-Gene Interactions

    PubMed Central

    McKinney, Brett A.; Reif, David M.; Ritchie, Marylyn D.; Moore, Jason H.


    Complex interactions among genes and environmental factors are known to play a role in common human disease aetiology. There is a growing body of evidence to suggest that complex interactions are ‘the norm’ and, rather than amounting to a small perturbation to classical Mendelian genetics, interactions may be the predominant effect. Traditional statistical methods are not well suited for detecting such interactions, especially when the data are high dimensional (many attributes or independent variables) or when interactions occur between more than two polymorphisms. In this review, we discuss machine-learning models and algorithms for identifying and characterising susceptibility genes in common, complex, multifactorial human diseases. We focus on the following machine-learning methods that have been used to detect gene-gene interactions: neural networks, cellular automata, random forests, and multifactor dimensionality reduction. We conclude with some ideas about how these methods and others can be integrated into a comprehensive and flexible framework for data mining and knowledge discovery in human genetics. PMID:16722772

  2. The frustrated gene: origins of eukaryotic gene expression

    PubMed Central

    Madhani, Hiten D.


    Eukarytotic gene expression is frustrated by a series of steps that are generally not observed in prokaryotes and are therefore not essential for the basic chemistry of transcription and translation. Their evolution may have been driven by the need to defend against parasitic nucleic acids. PMID:24209615

  3. Gene therapy: Myth or reality?


    Fischer, Alain


    Gene therapy has become a reality, although still a fragile one. Clinical benefit has been achieved over the last 17years in a limited number of medical conditions for which pathophysiological studies determined that they were favorable settings. They include inherited disorders of the immune system, leukodystrophies, possibly hemoglobinopathies, hemophilia B, and retinal dystrophies. Advances in the treatment of B-cell leukemias and lymphomas have also been achieved. Advances in vector development and possible usage of gene editing may lead to significant advances over the next years.

  4. JavaGenes Molecular Evolution

    NASA Technical Reports Server (NTRS)

    Lohn, Jason; Smith, David; Frank, Jeremy; Globus, Al; Crawford, James


    JavaGenes is a general-purpose, evolutionary software system written in Java. It implements several versions of a genetic algorithm, simulated annealing, stochastic hill climbing, and other search techniques. This software has been used to evolve molecules, atomic force field parameters, digital circuits, Earth Observing Satellite schedules, and antennas. This version differs from version 0.7.28 in that it includes the molecule evolution code and other improvements. Except for the antenna code, JaveGenes is available for NASA Open Source distribution.

  5. Zipf's Law in Gene Expression

    NASA Astrophysics Data System (ADS)

    Furusawa, Chikara; Kaneko, Kunihiko


    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1; i.e., they obey Zipf’s law. Furthermore, by simulations of a simple model with an intracellular reaction network, we found that Zipf’s law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  6. Lipid Nanoparticles for Gene Delivery

    PubMed Central

    Zhao, Yi; Huang, Leaf


    Nonviral vectors which offer a safer and versatile alternative to viral vectors have been developed to overcome problems caused by viral carriers. However, their transfection efficacy or level of expression is substantially lower than viral vectors. Among various nonviral gene vectors, lipid nanoparticles are an ideal platform for the incorporation of safety and efficacy into a single delivery system. In this chapter, we highlight current lipidic vectors that have been developed for gene therapy of tumors and other diseases. The pharmacokinetic, toxic behaviors and clinic trials of some successful lipids particles are also presented. PMID:25409602

  7. Gene therapy on demand: site specific regulation of gene therapy.


    Jazwa, Agnieszka; Florczyk, Urszula; Jozkowicz, Alicja; Dulak, Jozef


    Since 1990 when the first clinical