Science.gov

Sample records for genome-wide linkage search

  1. A genome-wide search for linkage to allergic rhinitis in Danish sib-pair families.

    PubMed

    Kruse, Lisbeth Venø; Nyegaard, Mette; Christensen, Ulla; Møller-Larsen, Steffen; Haagerup, Annette; Deleuran, Mette; Hansen, Lars Gudmund; Venø, Stine Krogh; Goossens, Dirk; Del-Favero, Jurgen; Børglum, Anders Dupont

    2012-09-01

    Allergic rhinitis (AR) is a complex disorder with a polygenic, multifactorial aetiology. Twin studies have found the genetic contribution to be substantial. We collected and clinically characterised a sample consisting of 127 Danish nuclear families with at least two siblings suffering from AR or allergic conjunctivitis including 540 individuals (286 children and 254 parents). A whole-genome linkage scan, using 424 microsatellite markers, was performed on both this sample and an earlier collected sample consisting of 130 families with atopic dermatitis and other atopic disorders. A third sib-pair family sample, which was previously collected and genotyped, was added to the analysis increasing the total sample size to 357 families consisting of 1508 individuals. In total, 190 families with AR was included. The linkage analysis software Genehunter NPL, Genehunter MOD, and Genehunter Imprinting were used to obtain nonparametric and parametric linkage results. Family-based association analysis of positional candidate SNPs was carried out using the FBAT program. We obtained genome-wide significant linkage to a novel AR locus at 1p13 and suggestive linkage to two novel regions at 1q31-q32 and 20p12, respectively. Family-based association analysis of SNPs in the candidate locus DNND1B/CRB1 at 1q31 showed no significant association and could not explain the linkage signal observed. Suggestive evidence of linkage was also obtained at three AR loci previously reported (2q14-q23, 2q23, and 12p13) and indication of linkage was observed at a number of additional loci. Likely maternal imprinting was observed at 2q23, and possible maternal imprinting at 3q28. PMID:22419170

  2. Applying Novel Genome-Wide Linkage Strategies to Search for Loci Influencing Type 2 Diabetes and Adult Height in American Samoa

    PubMed Central

    ÅBERG, KAROLINA; SUN, GUANGYUN; SMELSER, DIANE; INDUGULA, SUBBA RAO; TSAI, HUI-JU; STEELE, MATTHEW S.; TUITELE, JOHN; DEKA, RANJAN; MCGARVEY, STEPHEN T.; WEEKS, DANIEL E.

    2013-01-01

    Type 2 diabetes mellitus (T2DM) is a common complex phenotype that by the year 2010 is predicted to affect 221 million people globally. In the present study we performed a genome-wide linkage scan using the allele-sharing statistic Sall implemented in Allegro and a novel two-dimensional genome-wide strategy implemented in Merloc that searches for pairwise interaction between genetic markers located on different chromosomes linked to T2DM. In addition, we used a robust score statistic from the newly developed QTL-ALL software to search for linkage to variation in adult height. The strategies were applied to a study sample consisting of 238 sib-pairs affected with T2DM from American Samoa. We did not detect any genome-wide significant susceptibility loci for T2DM. However, our two-dimensional linkage investigation detected several loci pairs of interest, including 11q22 and 21q21, 9q21 and 11q22, 1p22–p21 and 4p15, and 4p15 and 15q11–q14, with a two-loci maximum LOD score (MLS) greater than 2.00. Most detected individual loci have previously been identified as susceptibility loci for diabetes-related traits. Our two-dimensional linkage results may facilitate the selection of potential candidate genes and molecular pathways for further diabetes studies because these results, besides providing candidate loci, also demonstrate that polygenic effects may play an important role in T2DM. Linkage was detected (p value of 0.005) for variation in adult height on chromosome 9q31, which was reported previously in other populations. Our finding suggests that the 9q31 region may be a strong quantitative trait locus for adult height, which is likely to be of importance across populations. PMID:18720898

  3. Meta-analysis of genome-wide linkage scans for renal function traits

    PubMed Central

    Rao, Madhumathi; Mottl, Amy K.; Cole, Shelley A.; Umans, Jason G.; Freedman, Barry I.; Bowden, Donald W.; Langefeld, Carl D.; Fox, Caroline S.; Yang, Qiong; Cupples, Adrienne; Iyengar, Sudha K.; Hunt, Steven C.

    2012-01-01

    Background. Several genome scans have explored the linkage of chronic kidney disease phenotypes to chromosomic regions with disparate results. Genome scan meta-analysis (GSMA) is a quantitative method to synthesize linkage results from independent studies and assess their concordance. Methods. We searched PubMed to identify genome linkage analyses of renal function traits in humans, such as estimated glomerular filtration rate (GFR), albuminuria, serum creatinine concentration and creatinine clearance. We contacted authors for numerical data and extracted information from individual studies. We applied the GSMA nonparametric approach to combine results across 14 linkage studies for GFR, 11 linkage studies for albumin creatinine ratio, 11 linkage studies for serum creatinine and 4 linkage studies for creatinine clearance. Results. No chromosomal region reached genome-wide statistical significance in the main analysis which included all scans under each phenotype; however, regions on Chromosomes 7, 10 and 16 reached suggestive significance for linkage to two or more phenotypes. Subgroup analyses by disease status or ethnicity did not yield additional information. Conclusions. While heterogeneity across populations, methodologies and study designs likely explain this lack of agreement, it is possible that linkage scan methodologies lack the resolution for investigating complex traits. Combining family-based linkage studies with genome-wide association studies may be a powerful approach to detect private mutations contributing to complex renal phenotypes. PMID:21622988

  4. Genome-wide linkage-disequilibrium profiles from single individuals.

    PubMed

    Lynch, Michael; Xu, Sen; Maruki, Takahiro; Jiang, Xiaoqian; Pfaffelhuber, Peter; Haubold, Bernhard

    2014-09-01

    Although the analysis of linkage disequilibrium (LD) plays a central role in many areas of population genetics, the sampling variance of LD is known to be very large with high sensitivity to numbers of nucleotide sites and individuals sampled. Here we show that a genome-wide analysis of the distribution of heterozygous sites within a single diploid genome can yield highly informative patterns of LD as a function of physical distance. The proposed statistic, the correlation of zygosity, is closely related to the conventional population-level measure of LD, but is agnostic with respect to allele frequencies and hence likely less prone to outlier artifacts. Application of the method to several vertebrate species leads to the conclusion that >80% of recombination events are typically resolved by gene-conversion-like processes unaccompanied by crossovers, with the average lengths of conversion patches being on the order of one to several kilobases in length. Thus, contrary to common assumptions, the recombination rate between sites does not scale linearly with distance, often even up to distances of 100 kb. In addition, the amount of LD between sites separated by <200 bp is uniformly much greater than can be explained by the conventional neutral model, possibly because of the nonindependent origin of mutations within this spatial scale. These results raise questions about the application of conventional population-genetic interpretations to LD on short spatial scales and also about the use of spatial patterns of LD to infer demographic histories.

  5. Meta-Analysis of Genome-Wide Linkage Studies in Celiac Disease

    PubMed Central

    Forabosco, Paola; Neuhausen, Susan L.; Greco, Luigi; Naluai, Åsa Torinsson; Wijmenga, Cisca; Saavalainen, Päivi; Houlston, Richard S.; Ciclitira, Paul J.; Babron, Marie-Claude; Lewis, Cathryn M.

    2009-01-01

    Objective A meta-analysis of genome-wide linkage studies allows us to summarize the extensive information available from family-based studies, as the field moves into genome-wide association studies. Methods Here we apply the genome scan meta-analysis (GSMA) method, a rank-based, model-free approach, to combine results across eight independent genome-wide linkages performed on celiac disease (CD), including 554 families with over 1,500 affected individuals. We also investigate the agreement between signals we identified from this meta-analysis of linkage studies and those identified from genome-wide association analysis using a hypergeometric distribution. Results Not surprisingly, the most significant result was obtained in the HLA region. Outside the HLA region, suggestive evidence for linkage was obtained at the telomeric region of chromosome 10 (10q26.12-qter; p = 0.00366), and on chromosome 8 (8q22.2-q24.21; p = 0.00491). Testing signals of association and linkage within bins showed no significant evidence for co-localization of results. Conclusion This meta-analysis allowed us to pool the results from available genome-wide linkage studies and to identify novel regions potentially harboring predisposing genetic variation contributing to CD. This study also shows that linkage and association studies may identify different types of disease-predisposing variants. PMID:19622889

  6. Genome-wide linkage analysis for celiac disease in North American families.

    PubMed

    Neuhausen, Susan L; Feolo, Mike; Camp, Nicola J; Farnham, James; Book, Linda; Zone, John J

    2002-07-22

    Celiac disease (CD) is an autoimmune disease caused by sensitivity to the dietary protein gluten. It has a prevalence of 1 in 250 in the United States. Multiple-case families are common with a risk to siblings from 10-12%. Previous linkage studies have found no significant evidence for linkage other than to HLA. In this study, we performed a genome-wide search on 62 families with at least two cases of CD to identify non-HLA loci for CD. Two-point and multipoint parametric and nonparametric analyses were performed on the entire set of families and on sets stratified by the HLA genotype. Accounting for multiple testing, we found genome-wide intermediate linkage evidence at 18q (heterogeneity LOD (HLOD) = 3.6) and at 3p (HLOD = 3.2) and suggestive evidence at 5p (HLOD = 2.7). Good consensus between two-point and multipoint evidence was not found, and after genotyping with new markers in these regions, our results were inconclusive. The 18q region had intermediate two-point evidence, but weak multipoint evidence. At 3p and 5p, the addition of follow-up markers added flanking support, yet multipoint evidence was still lacking. Our results indicate that multipoint analyses may be hindered by the complexity of CD. Multipoint analyses are not robust to model misspecification, and further development of models is needed. Additional study of these and other families is necessary to validate or rule out the regions implicated in this study.

  7. A genome-wide linkage analysis of dementia in the Amish

    PubMed Central

    Hahs, Daniel W.; McCauley, Jacob L.; Crunk, Amy E.; McFarland, Lynne L.; Gaskell, Perry C.; Jiang, Lan; Slifer, Susan H.; Vance, Jeffery M.; Scott, William K.; Welsh-Bohmer, Kathleen A.; Johnson, Stephanie R.; Jackson, Charles E.; Pericak-Vance, Margaret A.; Haines, Jonathan L.

    2008-01-01

    Susceptibility genes for Alzheimer's disease are proving to be highly challenging to detect and verify. Population heterogeneity may be a significant confounding factor contributing to this difficulty. To increase the power for disease susceptibility gene detection we conducted a genome-wide genetic linkage screen using individuals from the relatively isolated, genetically homogeneous, Amish population. Our genome linkage analysis used a 407 microsatellite marker map (average density 7 cM) to search for autosomal genes linked to dementia in five Amish families from four Midwestern U.S. counties. Our highest two-point lod score (3.01) was observed at marker D4S1548 on chromosome 4q31. Five other regions (10q22, 3q28, 11p13, 4q28, 19p13) also demonstrated suggestive linkage with markers having two-point lod scores >2.0. While two of these regions are novel (4q31 and 11p13), the other regions lie close to regions identified in previous genome scans in other populations. Our results identify regions of the genome that may harbor genes involved in a subset of dementia patients, in particular the North American Amish community. PMID:16389594

  8. Autosomal genome-wide linkage analysis to identify loci for gallbladder wall thickness in Mexican Americans.

    PubMed

    Samudrala, Narahari; Farook, Vidya S; Dodd, Gerald D; Puppala, Sobha; Schneider, Jennifer; Fowler, Sharon; Granato, Richard; Dyer, Thomas D; Arya, Rector; Almasy, Laura; Jenkinson, Christopher P; Diehl, Andrew K; Blangero, John; Duggirala, Ravindranath

    2008-02-01

    The significance of gallbladder wall thickness (GBWT) in regard to gallbladder disease (GBD) is not completely understood. Thickening of the gallbladder wall has been observed in patients with acute calculous and acalculous cholecystitis and chronic cholecystitis. However, various pathologic processes, such as gallbladder cancer and nonbiliary disorders such as liver cirrhosis and viral hepatitis, could also cause thickening of the gallbladder wall. To date, there is no report available on the genetic factors influencing GBWT. Therefore we sought to estimate the heritability (h2) of GBWT and to perform a genome-wide search to identify the susceptibility genes for GBWT, using data from the San Antonio Family Diabetes/Gallbladder Study (SAFDGS), a family study of Mexican Americans. GBWT was measured by ultrasound. After adjusting for the significant effects of age, sex, GBD (i.e., asymptomatic gallstones), metabolic syndrome, and duration of type 2 diabetes (T2DM), GBWT was found to be under significant and appreciable additive genetic influences (h2 +/- SE = 0.38 +/- 0.09, P < 0.0001). The strongest evidence for linkage occurred between markers D11S912 and D11S968 on chromosome 11q24-q25 (LOD = 2.7), where we have already shown suggestive evidence for linkage of GBD (LOD = 2.7) in a subset of our SAFDGS data. Potential evidence for linkage occurred at markers D1S1728 (1p31.1; LOD = 1.4) and D16S748 (16p13.1; LOD = 1.4), respectively. In conclusion, our study provides suggestive evidence for linkage of GBWT on chromosome 11q in Mexican Americans, and future tasks of mapping susceptibility gene(s) for GBD and its related traits, such as GBWT, in this chromosomal region can be fruitful. PMID:18505042

  9. Meta-analysis of 32 genome-wide linkage studies of schizophrenia

    PubMed Central

    Ng, MYM; Levinson, DF; Faraone, SV; Suarez, BK; DeLisi, LE; Arinami, T; Riley, B; Paunio, T; Pulver, AE; Irmansyah; Holmans, PA; Escamilla, M; Wildenauer, DB; Williams, NM; Laurent, C; Mowry, BJ; Brzustowicz, LM; Maziade, M; Sklar, P; Garver, DL; Abecasis, GR; Lerer, B; Fallin, MD; Gurling, HMD; Gejman, PV; Lindholm, E; Moises, HW; Byerley, W; Wijsman, EM; Forabosco, P; Tsuang, MT; Hwu, H-G; Okazaki, Y; Kendler, KS; Wormley, B; Fanous, A; Walsh, D; O’Neill, FA; Peltonen, L; Nestadt, G; Lasseter, VK; Liang, KY; Papadimitriou, GM; Dikeos, DG; Schwab, SG; Owen, MJ; O’Donovan, MC; Norton, N; Hare, E; Raventos, H; Nicolini, H; Albus, M; Maier, W; Nimgaonkar, VL; Terenius, L; Mallet, J; Jay, M; Godard, S; Nertney, D; Alexander, M; Crowe, RR; Silverman, JM; Bassett, AS; Roy, M-A; Mérette, C; Pato, CN; Pato, MT; Roos, J Louw; Kohn, Y; Amann-Zalcenstein, D; Kalsi, G; McQuillin, A; Curtis, D; Brynjolfson, J; Sigmundsson, T; Petursson, H; Sanders, AR; Duan, J; Jazin, E; Myles-Worsley, M; Karayiorgou, M; Lewis, CM

    2009-01-01

    A genome scan meta-analysis (GSMA) was carried out on 32 independent genome-wide linkage scan analyses that included 3255 pedigrees with 7413 genotyped cases affected with schizophrenia (SCZ) or related disorders. The primary GSMA divided the autosomes into 120 bins, rank-ordered the bins within each study according to the most positive linkage result in each bin, summed these ranks (weighted for study size) for each bin across studies and determined the empirical probability of a given summed rank (PSR) by simulation. Suggestive evidence for linkage was observed in two single bins, on chromosomes 5q (142-168 Mb) and 2q (103-134 Mb). Genome-wide evidence for linkage was detected on chromosome 2q (119-152 Mb) when bin boundaries were shifted to the middle of the previous bins. The primary analysis met empirical criteria for ‘aggregate’ genome-wide significance, indicating that some or all of 10 bins are likely to contain loci linked to SCZ, including regions of chromosomes 1, 2q, 3q, 4q, 5q, 8p and 10q. In a secondary analysis of 22 studies of European-ancestry samples, suggestive evidence for linkage was observed on chromosome 8p (16-33 Mb). Although the newer genome-wide association methodology has greater power to detect weak associations to single common DNA sequence variants, linkage analysis can detect diverse genetic effects that segregate in families, including multiple rare variants within one locus or several weakly associated loci in the same region. Therefore, the regions supported by this meta-analysis deserve close attention in future studies. PMID:19349958

  10. Genome-wide Linkage Analyses of Quantitative and Categorical Autism Subphenotypes

    PubMed Central

    Liu, Xiao-Qing; Paterson, Andrew D.; Szatmari, Peter

    2008-01-01

    Background The search for susceptibility genes in autism and autism spectrum disorders (ASD) has been hindered by the possible small effects of individual genes and by genetic (locus) heterogeneity. To overcome these obstacles, one method is to use autism-related subphenotypes instead of the categorical diagnosis of autism since they may be more directly related to the underlying susceptibility loci. Another strategy is to analyze subsets of families that meet certain clinical criteria to reduce genetic heterogeneity. Methods In this study, using 976 multiplex families from the Autism Genome Project consortium, we performed genome-wide linkage analyses on two quantitative subphenotypes, the total scores of the reciprocal social interaction domain and the restricted, repetitive, and stereotyped patterns of behavior domain from the Autism Diagnostic Interview-Revised. We also selected subsets of ASD families based on four binary subphenotypes, delayed onset of first words, delayed onset of first phrases, verbal status, and IQ ≥ 70. Results When the ASD families with IQ ≥ 70 were used, a logarithm of odds (LOD) score of 4.01 was obtained on chromosome 15q13.3-q14, which was previously linked to schizophrenia. We also obtained a LOD score of 3.40 on chromosome 11p15.4-p15.3 using the ASD families with delayed onset of first phrases. No significant evidence for linkage was obtained for the two quantitative traits. Conclusions This study demonstrates that selection of informative subphenotypes to define a homogeneous set of ASD families could be very important in detecting the susceptibility loci in autism. PMID:18632090

  11. A GENOME-WIDE LINKAGE AND ASSOCIATION SCAN REVEALS NOVEL LOCI FOR AUTISM

    PubMed Central

    Weiss, Lauren A.; Arking, Dan E.

    2009-01-01

    Summary Although autism is a highly heritable neurodevelopmental disorder, attempts to identify specific susceptibility genes have thus far met with limited success 1. Genome-wide association studies (GWAS) using half a million or more markers, particularly those with very large sample sizes achieved through meta-analysis, have shown great success in mapping genes for other complex genetic traits (http://www.genome.gov/26525384). Consequently, we initiated a linkage and association mapping study using half a million genome-wide SNPs in a common set of 1,031 multiplex autism families (1,553 affected offspring). We identified regions of suggestive and significant linkage on chromosomes 6q27 and 20p13, respectively. Initial analysis did not yield genome-wide significant associations; however, genotyping of top hits in additional families revealed a SNP on chromosome 5p15 (between SEMA5A and TAS2R1) that was significantly associated with autism (P = 2 × 10−7). We also demonstrated that expression of SEMA5A is reduced in brains from autistic patients, further implicating SEMA5A as an autism susceptibility gene. The linkage regions reported here provide targets for rare variation screening while the discovery of a single novel association demonstrates the action of common variants. PMID:19812673

  12. A genome-wide linkage and association scan reveals novel loci for autism.

    PubMed

    Weiss, Lauren A; Arking, Dan E; Daly, Mark J; Chakravarti, Aravinda

    2009-10-01

    Although autism is a highly heritable neurodevelopmental disorder, attempts to identify specific susceptibility genes have thus far met with limited success. Genome-wide association studies using half a million or more markers, particularly those with very large sample sizes achieved through meta-analysis, have shown great success in mapping genes for other complex genetic traits. Consequently, we initiated a linkage and association mapping study using half a million genome-wide single nucleotide polymorphisms (SNPs) in a common set of 1,031 multiplex autism families (1,553 affected offspring). We identified regions of suggestive and significant linkage on chromosomes 6q27 and 20p13, respectively. Initial analysis did not yield genome-wide significant associations; however, genotyping of top hits in additional families revealed an SNP on chromosome 5p15 (between SEMA5A and TAS2R1) that was significantly associated with autism (P = 2 x 10(-7)). We also demonstrated that expression of SEMA5A is reduced in brains from autistic patients, further implicating SEMA5A as an autism susceptibility gene. The linkage regions reported here provide targets for rare variation screening whereas the discovery of a single novel association demonstrates the action of common variants.

  13. Genome-wide scan for linkage to obesity-associated hypertension in French Canadians.

    PubMed

    Pausova, Zdenka; Gaudet, Daniel; Gossard, Francis; Bernard, Manon; Kaldunski, Mary L; Jomphe, Michele; Tremblay, Johanne; Hudson, Thomas J; Bouchard, Gerard; Kotchen, Theodore A; Cowley, Allen W; Hamet, Pavel

    2005-12-01

    Essential hypertension is a heterogeneous disorder that is thought to develop because of several overlapping subsets of underlying mechanisms. One such causal pathway may involve pathophysiological alterations induced by obesity. In the present study, we examined whether investigating clinically defined subtypes of hypertension, such as obesity-associated hypertension, facilitates the search for its genes. Fifty-five extended families were selected on the basis of having > or =2 siblings affected by hypertension from a geographically remote French-Canadian population. Fifteen of these families showed a high prevalence (> or =70%) of obesity. Genome-wide scan using qualitative multipoint linkage analysis (GeneHunter 2.1; marker density <10 cM) was performed in the entire set of hypertensive families and the subset with high prevalence of obesity. In the scan involving all 55 families, the most significant loci (logarithm of odds [LOD] score=2.5) were identified on chromosomes 1 (D1S1597) and 11 (D11S1999). In the scan including only the subset of families with obesity-hypertension, the most significant locus (LOD score=3.1) was found on chromosome 1 in the same region as the scan involving all families (D1S1597). Genotyping additional markers increased the significance of this locus (LOD score=3.5) and refined its position (D1S2672). Several candidate genes of obesity-hypertension are located in close proximity; these include the tumor necrosis factor receptor 2 and atrial natriuretic peptide genes. These results suggest that investigating clinically defined subtypes of hypertension, such as obesity-associated hypertension, may facilitate the search for genes of this complex disorder.

  14. Genome-wide Linkage Analysis of Carotid Artery Lumen Diameter: The Strong Heart Family Study

    PubMed Central

    Bella, Jonathan N.; Cole, Shelley A.; Laston, Sandy; Almasy, Laura; Comuzzie, Anthony; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; Howard, Barbara V.; MacCluer, Jean W.; Roman, Mary J.; Devereux, Richard B.; Göring, Harald H.H.

    2014-01-01

    Background A significant proportion of the variability in carotid artery lumen diameter is attributable to genetic factors. Methods Carotid ultrasonography and genotyping were performed in the 3,300 American Indian participants in the Strong Heart Family Study (SHFS) to identify chromosomal regions harboring novel genes associated with inter-individual variation in carotid artery lumen diameter. Genome-wide linkage analysis was conducted using standard variance component linkage methods, implemented in SOLAR, based on multipoint identity-by-descent matrices. Results Genome-wide linkage analysis revealed a significant evidence for linkage for a locus for left carotid artery diastolic and systolic lumen diameter in Arizona SHFS participants on chromosome 7 at 120 cM (lod=4.85 and 3.77, respectively, after sex and age adjustment, and lod=3.12 and 2.72, respectively, after adjustment for sex, age, height, weight, systolic and diastolic blood pressure, diabetes mellitus and current smoking). Other regions with suggestive evidence of linkage for left carotid artery diastolic and systolic lumen diameter was found on chromosome 12 at 153 cM (lod=2.20 and 2.60, respectively, after sex and age adjustment, and lod=2.44 and 2.16, respectively, after full covariate adjustment) in Oklahoma SHFS participants; suggestive linkage for right carotid artery diastolic and systolic lumen diameter was found on chromosome 9 at 154 cM (lod=2.72 and 3.19, respectively after sex and age adjustment, and lod=2.36 and 2.21, respectively, after full covariate adjustment) in Oklahoma SHFS participants. Conclusion We found significant evidence for loci influencing carotid artery lumen diameter on chromosome 7q and suggestive linkage on chromosomes 12q and 9q. PMID:23871337

  15. Genome-wide estimation of linkage disequilibrium from population-level high-throughput sequencing data.

    PubMed

    Maruki, Takahiro; Lynch, Michael

    2014-08-01

    Rapidly improving sequencing technologies provide unprecedented opportunities for analyzing genome-wide patterns of polymorphisms. In particular, they have great potential for linkage-disequilibrium analyses on both global and local genetic scales, which will substantially improve our ability to derive evolutionary inferences. However, there are some difficulties with analyzing high-throughput sequencing data, including high error rates associated with base reads and complications from the random sampling of sequenced chromosomes in diploid organisms. To overcome these difficulties, we developed a maximum-likelihood estimator of linkage disequilibrium for use with error-prone sampling data. Computer simulations indicate that the estimator is nearly unbiased with a sampling variance at high coverage asymptotically approaching the value expected when all relevant information is accurately estimated. The estimator does not require phasing of haplotypes and enables the estimation of linkage disequilibrium even when all individual reads cover just single polymorphic sites.

  16. Genome-wide linkage disequilibrium in nine-spined stickleback populations.

    PubMed

    Yang, Ji; Shikano, Takahito; Li, Meng-Hua; Merilä, Juha

    2014-08-12

    Variation in the extent and magnitude of genome-wide linkage disequilibrium (LD) among populations residing in different habitats has seldom been studied in wild vertebrates. We used a total of 109 microsatellite markers to quantify the level and patterns of genome-wide LD in 13 Fennoscandian nine-spined stickleback (Pungitius pungitius) populations from four (viz. marine, lake, pond, and river) different habitat types. In general, high magnitude (D' > 0.5) of LD was found both in freshwater and marine populations, and the magnitude of LD was significantly greater in inland freshwater than in marine populations. Interestingly, three coastal freshwater populations located in close geographic proximity to the marine populations exhibited similar LD patterns and genetic diversity as their marine neighbors. The greater levels of LD in inland freshwater compared with marine and costal freshwater populations can be explained in terms of their contrasting demographic histories: founder events, long-term isolation, small effective sizes, and population bottlenecks are factors likely to have contributed to the high levels of LD in the inland freshwater populations. In general, these findings shed new light on the patterns and extent of variation in genome-wide LD, as well as the ecological and evolutionary factors driving them.

  17. Genome-wide linkage analysis for human longevity: Genetics of Healthy Ageing Study

    PubMed Central

    Beekman, Marian; Blanché, Hélène; Perola, Markus; Hervonen, Anti; Bezrukov, Vladyslav; Sikora, Ewa; Flachsbart, Frederieke; Christiansen, Lene; De Craen, Anton J.M.; Kirkwood, Tom B.L.; Rea, I. Meave; Poulain, Michel; Robine, Jean-Marie; Stazi, Maria Antonietta; Passarino, Giuseppe; Deiana, Luca; Gonos, Efstathios S.; Valensin, Silvana; Paternoster, Lavinia; Sørensen, Thorkild I.A.; Tan, Qihua; Helmer, Quinta; Van den Akker, Erik B.; Deelen, Joris; Martella, Francesca; Cordell, Heather J.; Ayers, Kristin L.; Vaupel, James W.; Törnwall, Outi; Johnson, Thomas E.; Schreiber, Stefan; Lathrop, Mark; Skytthe, Axel; Westendorp, Rudi G.J.; Christensen, Kaare; Gampe, Jutta; Nebel, Almut; Houwing-Duistermaat, Jeanine J.; Slagboom, P. Eline; Franceschi, Claudio

    2013-01-01

    Summary Clear evidence exists for heritability of human longevity, and much interest is focused on identifying genes associated with longer lives. To identify such longevity alleles, we performed the largest genome-wide linkage scan thus far reported. Linkage analyses included 2118 nonagenarian Caucasian sibling pairs that have been enrolled in fifteen study centers of eleven European countries as part of the Genetics of Healthy Ageing (GEHA) project. In the joint linkage analyses we observed four regions that show linkage with longevity; chromosome 14q11.2 (LOD=3.47), chromosome 17q12-q22 (LOD=2.95), chromosome 19p13.3-p13.11 (LOD=3.76) and chromosome 19q13.11-q13.32 (LOD=3.57). To fine map these regions linked to longevity, we performed association analysis using GWAS data in a subgroup of 1,228 unrelated nonagenarian and 1,907 geographically matched controls. Using a fixed effect meta-analysis approach, rs4420638 at the TOMM40/APOE/APOC1 gene locus showed significant association with longevity (p-value=9.6 × 10−8). By combined modeling of linkage and association we showed that association of longevity with APOEε4 and APOEε2 alleles explain the linkage at 19q13.11-q13.32 with p-value=0.02 and p-value=1.0 × 10−5, respectively. In the largest linkage scan thus far performed for human familial longevity, we confirm that the APOE locus is a longevity gene and that additional longevity loci may be identified at 14q11.2, 17q12-q22 and 19p13.3-p13.11. Since the latter linkage results are not explained by common variants, we suggest that rare variants play an important role in human familial longevity. PMID:23286790

  18. Heritability and genome-wide linkage analysis of migraine in the genetic isolate of Norfolk Island.

    PubMed

    Cox, Hannah C; Lea, Rod A; Bellis, Claire; Nyholt, Dale R; Dyer, Thomas D; Haupt, Larisa M; Charlesworth, Jac; Matovinovic, Elizabeth; Blangero, John; Griffiths, Lyn R

    2012-02-15

    Migraine is a common neurovascular disorder with a complex envirogenomic aetiology. In an effort to identify migraine susceptibility genes, we conducted a study of the isolated population of Norfolk Island, Australia. A large portion of the permanent inhabitants of Norfolk Island are descended from 18th Century English sailors involved in the infamous mutiny on the Bounty and their Polynesian consorts. In total, 600 subjects were recruited including a large pedigree of 377 individuals with lineage to the founders. All individuals were phenotyped for migraine using International Classification of Headache Disorders-II criterion. All subjects were genotyped for a genome-wide panel of microsatellite markers. Genotype and phenotype data for the pedigree were analysed using heritability and linkage methods implemented in the programme SOLAR. Follow-up association analysis was performed using the CLUMP programme. A total of 154 migraine cases (25%) were identified indicating the Norfolk Island population is high-risk for migraine. Heritability estimation of the 377-member pedigree indicated a significant genetic component for migraine (h(2)=0.53, P=0.016). Linkage analysis showed peaks on chromosome 13q33.1 (P=0.003) and chromosome 9q22.32 (P=0.008). Association analysis of the key microsatellites in the remaining 223 unrelated Norfolk Island individuals showed evidence of association, which strengthen support for the linkage findings (P≤0.05). In conclusion, a genome-wide linkage analysis and follow-up association analysis of migraine in the genetic isolate of Norfolk Island provided evidence for migraine susceptibility loci on chromosomes 9q22.22 and 13q33.1. PMID:22197687

  19. Genome-wide family-based linkage analysis of exome chip variants and cardiometabolic risk.

    PubMed

    Hellwege, Jacklyn N; Palmer, Nicholette D; Raffield, Laura M; Ng, Maggie C Y; Hawkins, Gregory A; Long, Jirong; Lorenzo, Carlos; Norris, Jill M; Ida Chen, Y-D; Speliotes, Elizabeth K; Rotter, Jerome I; Langefeld, Carl D; Wagenknecht, Lynne E; Bowden, Donald W

    2014-05-01

    Linkage analysis of complex traits has had limited success in identifying trait-influencing loci. Recently, coding variants have been implicated as the basis for some biomedical associations. We tested whether coding variants are the basis for linkage peaks of complex traits in 42 African-American (n = 596) and 90 Hispanic (n = 1,414) families in the Insulin Resistance Atherosclerosis Family Study (IRASFS) using Illumina HumanExome Beadchips. A total of 92,157 variants in African Americans (34%) and 81,559 (31%) in Hispanics were polymorphic and tested using two-point linkage and association analyses with 37 cardiometabolic phenotypes. In African Americans 77 LOD scores greater than 3 were observed. The highest LOD score was 4.91 with the APOE SNP rs7412 (MAF = 0.13) with plasma apolipoprotein B (ApoB). This SNP was associated with ApoB (P-value = 4 × 10(-19)) and accounted for 16.2% of the variance in African Americans. In Hispanic families, 104 LOD scores were greater than 3. The strongest evidence of linkage (LOD = 4.29) was with rs5882 (MAF = 0.46) in CETP with HDL. CETP variants were strongly associated with HDL (0.00049 < P-value <4.6 × 10(-12)), accounting for up to 4.5% of the variance. These loci have previously been shown to have effects on the biomedical traits evaluated here. Thus, evidence of strong linkage in this genome wide survey of primarily coding variants was uncommon. Loci with strong evidence of linkage was characterized by large contributions to the variance, and, in these cases, are common variants. Less compelling evidence of linkage and association was observed with additional loci that may require larger family sets to confirm.

  20. Genome-wide linkage analysis and association study identifies loci for polydactyly in chickens.

    PubMed

    Sun, Yanfa; Liu, Ranran; Zhao, Guiping; Zheng, Maiqing; Sun, Yan; Yu, Xiaoqiong; Li, Peng; Wen, Jie

    2014-04-21

    Polydactyly occurs in some chicken breeds, but the molecular mechanism remains incompletely understood. Combined genome-wide linkage analysis and association study (GWAS) for chicken polydactyly helps identify loci or candidate genes for the trait and potentially provides further mechanistic understanding of this phenotype in chickens and perhaps other species. The linkage analysis and GWAS for polydactyly was conducted using an F2 population derived from Beijing-You chickens and commercial broilers. The results identified two QTLs through linkage analysis and seven single-nucleotide polymorphisms (SNPs) through GWAS, associated with the polydactyly trait. One QTL located at 35 cM on the GGA2 was significant at the 1% genome-wise level and another QTL at the 1% chromosome-wide significance level was detected at 39 cM on GGA19. A total of seven SNPs, four of 5% genome-wide significance (P < 2.98 × 10(-6)) and three of suggestive significance (5.96 × 10(-5)) were identified, including two SNPs (GGaluGA132178 and Gga_rs14135036) in the QTL on GGA2. Of the identified SNPs, the eight nearest genes were sonic hedgehog (SHH), limb region 1 homolog (mouse) (LMBR1), dipeptidyl-peptidase 6, transcript variant 3 (DPP6), thyroid-stimulating hormone, beta (TSHB), sal-like 4 (Drosophila) (SALL4), par-6 partitioning defective 6 homolog beta (Caenorhabditis elegans) (PARD6B), coenzyme Q5 (COQ5), and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, etapolypeptide (YWHAH). The GWAS supports earlier reports of the importance of SHH and LMBR1 as regulating genes for polydactyly in chickens and other species, and identified others, most of which have not previously been associated with limb development. The genes and associated SNPs revealed here provide detailed information for further exploring the molecular and developmental mechanisms underlying polydactyly.

  1. Genome-wide analysis of zygotic linkage disequilibrium and its components in crossbred cattle

    PubMed Central

    2012-01-01

    Background Linkage disequilibrium (LD) between genes at linked or independent loci can occur at gametic and zygotic levels known asgametic LD and zygotic LD, respectively. Gametic LD is well known for its roles in fine-scale mapping of quantitative trait loci, genomic selection and evolutionary inference. The less-well studied is the zygotic LD and its components that can be also estimated directly from the unphased SNPs. Results This study was set up to investigate the genome-wide extent and patterns of zygotic LD and its components in a crossbred cattle population using the genomic data from the Illumina BovineSNP50 beadchip. The animal population arose from repeated crossbreeding of multiple breeds and selection for growth and cow reproduction. The study showed that similar genomic structures in gametic and zygotic LD were observed, with zygotic LD decaying faster than gametic LD over marker distance. The trigenic and quadrigenic disequilibria were generally two- to three-fold smaller than the usual digenic disequilibria (gametic or composite LD). There was less power of testing for these high-order genic disequilibria than for the digenic disequilibria. The power estimates decreased with the marker distance between markers though the decay trend is more obvious for the digenic disequilibria than for high-order disequilibria. Conclusions This study is the first major genome-wide survey of all non-allelic associations between pairs of SNPs in a cattle population. Such analysis allows us to assess the relative importance of gametic LD vs. all other non-allelic genic LDs regardless of whether or not the population is in HWE. The observed predominance of digenic LD (gametic or composite LD) coupled with insignificant high-order trigenic and quadrigenic disequilibria supports the current intensive focus on the use of high-density SNP markers for genome-wide association studies and genomic selection activities in the cattle population. PMID:22827586

  2. Refining genome-wide linkage intervals using a meta-analysis of genome-wide association studies identifies loci influencing personality dimensions.

    PubMed

    Amin, Najaf; Hottenga, Jouke-Jan; Hansell, Narelle K; Janssens, A Cecile J W; de Moor, Marleen H M; Madden, Pamela A F; Zorkoltseva, Irina V; Penninx, Brenda W; Terracciano, Antonio; Uda, Manuela; Tanaka, Toshiko; Esko, Tonu; Realo, Anu; Ferrucci, Luigi; Luciano, Michelle; Davies, Gail; Metspalu, Andres; Abecasis, Goncalo R; Deary, Ian J; Raikkonen, Katri; Bierut, Laura J; Costa, Paul T; Saviouk, Viatcheslav; Zhu, Gu; Kirichenko, Anatoly V; Isaacs, Aaron; Aulchenko, Yurii S; Willemsen, Gonneke; Heath, Andrew C; Pergadia, Michele L; Medland, Sarah E; Axenovich, Tatiana I; de Geus, Eco; Montgomery, Grant W; Wright, Margaret J; Oostra, Ben A; Martin, Nicholas G; Boomsma, Dorret I; van Duijn, Cornelia M

    2013-08-01

    Personality traits are complex phenotypes related to psychosomatic health. Individually, various gene finding methods have not achieved much success in finding genetic variants associated with personality traits. We performed a meta-analysis of four genome-wide linkage scans (N=6149 subjects) of five basic personality traits assessed with the NEO Five-Factor Inventory. We compared the significant regions from the meta-analysis of linkage scans with the results of a meta-analysis of genome-wide association studies (GWAS) (N∼17 000). We found significant evidence of linkage of neuroticism to chromosome 3p14 (rs1490265, LOD=4.67) and to chromosome 19q13 (rs628604, LOD=3.55); of extraversion to 14q32 (ATGG002, LOD=3.3); and of agreeableness to 3p25 (rs709160, LOD=3.67) and to two adjacent regions on chromosome 15, including 15q13 (rs970408, LOD=4.07) and 15q14 (rs1055356, LOD=3.52) in the individual scans. In the meta-analysis, we found strong evidence of linkage of extraversion to 4q34, 9q34, 10q24 and 11q22, openness to 2p25, 3q26, 9p21, 11q24, 15q26 and 19q13 and agreeableness to 4q34 and 19p13. Significant evidence of association in the GWAS was detected between openness and rs677035 at 11q24 (P-value=2.6 × 10(-06), KCNJ1). The findings of our linkage meta-analysis and those of the GWAS suggest that 11q24 is a susceptible locus for openness, with KCNJ1 as the possible candidate gene. PMID:23211697

  3. Genome-wide linkage analysis of multiple metabolic factors: evidence of genetic heterogeneity.

    PubMed

    Cheng, Ching-Yu; Lee, Kristine E; Duggal, Priya; Moore, Emily L; Wilson, Alexander F; Klein, Ronald; Bailey-Wilson, Joan E; Klein, Barbara E K

    2010-01-01

    The metabolic syndrome is a highly complex disease and has become one of the major public-health challenges worldwide. We sought to identify genetic loci with potential influence on multiple metabolic factors in a white population in Beaver Dam, Wisconsin, and to explore the possibility of genetic heterogeneity by family history of diabetes (FHD). Three metabolic factors were generated using principal-component factor analysis, and they represented: (i) glycemia, (ii) blood pressure, and (iii) combined (BMI, high-density lipoprotein (HDL) cholesterol, and serum uric acid) factors. Multipoint model-free linkage analysis of these factors with 385 microsatellite markers was performed on 1,055 sib-pairs, using Haseman-Elston regression. Genome-wide suggestive evidence of linkage was found at 30 cM on chromosome 22q (empirical P (P(e)) = 0.0002) for the glycemia factor, at 188-191 cM on chromosome 1q (P(e) = 0.0007) for the blood pressure factor, and at 82 cM on chromosome 17q (P(e) = 0.0007) for the combined factor. Subset analyses of the families by FHD showed evidence of genetic heterogeneity, with divergent linkage signals in the subsets on at least four chromosomes. We found evidence of genetic heterogeneity by FHD for the three metabolic factors. The results also confirmed findings of previous studies that mapped components of the metabolic syndrome to a chromosome 1q region.

  4. Genome-wide linkage analysis for loci affecting pulse pressure: the Family Blood Pressure Program.

    PubMed

    Bielinski, Suzette J; Lynch, Amy I; Miller, Michael B; Weder, Alan; Cooper, Richard; Oberman, Albert; Chen, Yii-Der Ida; Turner, Stephen T; Fornage, Myriam; Province, Michael; Arnett, Donna K

    2005-12-01

    Pulse pressure, the difference between systolic and diastolic blood pressure, is an independent risk factor for cardiovascular disease. Increased pulse pressure reflects reduced compliance of arteries and is a marker of atherosclerosis. To locate genes that affect pulse pressure, a genome-wide linkage scan for quantitative trait loci influencing pulse pressure was performed using variance components methods as implemented in sequential oligogenic linkage analysis routines. The analysis sample included 10 798 participants in 3320 families who were recruited as part of the Family Blood Pressure Program and were phenotyped with an oscillometric blood pressure measurement device using a consistent protocol across centers. Pulse pressure was adjusted for the effects of sex, age, age2, age-by-sex interaction, age2-by-sex interaction, body mass index, and field center to remove sources of variation other than the genetic effects related to pulse pressure. Significant linkage was observed on chromosome 18 (logarithm of odds [LOD]=3.2) in a combined racial sample, chromosome 20 (LOD=4.4), and 17 (LOD=3.6) in Hispanics, chromosome 21 (LOD=4.3) in whites, chromosome 19 (LOD=3.1) in a combined sample of blacks and whites, and chromosome 7 (logarithm of odds [LOD]=3.1) in blacks from the GenNet Network. Our genome scan shows significant evidence for linkage for pulse pressure in multiple areas of the genome, supporting previous published linkage studies. The identification of these loci for pulse pressure and the apparent congruence with other blood pressure phenotypes provide increased support that these regions contain genes influencing blood pressure phenotypes.

  5. Quantitative linkage analysis to the autism endophenotype social responsiveness identifies genome-wide significant linkage to two regions on chromosome 8

    PubMed Central

    Lowe, Jennifer K.; Werling, Donna M.; Constantino, John N.; Cantor, Rita M.; Geschwind, Daniel H.

    2015-01-01

    Objective Autism Spectrum Disorder (ASD) is characterized by deficits in social function and the presence of repetitive and restrictive behaviors. Following a previous test of principle, we adopted a quantitative approach to discovering genes contributing to the broader autism phenotype by using social responsiveness as an endophenotype for ASD. Method Linkage analyses using scores from the Social Responsiveness Scale (SRS) were performed in 590 families from AGRE, a largely multiplex ASD cohort. Regional and genome-wide association analyses were performed to search for common variants contributing to social responsiveness. Results SRS is unimodally distributed in male offspring from multiplex autism families, in contrast with a bimodal distribution observed in females. In correlated analyses differing by SRS respondent, genome-wide significant linkage for social responsiveness was identified at chr8p21.3 (multi-point LOD=4.11; teacher/parent scores) and chr8q24.22 (multi-point LOD=4.54; parent-only scores), respectively. Genome-wide or linkage-directed association analyses did not detect common variants contributing to social responsiveness. Conclusions The sex-differential distributions of SRS in multiplex autism families likely reflect mechanisms contributing to the sex ratio for autism observed in the general population and form a quantitative signature of reduced penetrance of inherited liability to ASD among females. The identification of two strong loci for social responsiveness validates the endophenotype approach for the identification of genetic variants contributing to complex traits such as ASD. While causal mutations have yet to be identified, these findings are consistent with segregation of rare genetic variants influencing social responsiveness and underscore the increasingly recognized role of rare inherited variants in the genetic architecture of ASD. PMID:25727539

  6. Bivariate Genome-Wide Linkage Analysis of Femoral Bone Traits and Leg Lean Mass: Framingham Study

    PubMed Central

    Karasik, David; Zhou, Yanhua; Cupples, L Adrienne; Hannan, Marian T; Kiel, Douglas P; Demissie, Serkalem

    2009-01-01

    The risk of osteoporotic fracture is a function of both applied muscle mass and bone tissue distribution. Leg lean mass (LLM) and femoral bone geometry are both known to have substantial genetic components. Therefore, we estimated shared heritability (h2) and performed linkage analysis to identify chromosomal regions governing both LLM and bone geometry. A genome-wide scan (using 636 microsatellite markers) for linkage analyses was performed on 1346 adults from 327 extended families of the Framingham study. DXA measures were LLM, femoral neck length, neck-shaft angle (NSA), subperiosteal width, cross-sectional area (CSA), and section modulus (Z) at the femoral narrow neck and shaft (S) regions. Variance component linkage analysis was performed on normalized residuals (adjusted for age, height, BMI, and estrogen status in women). The results indicated substantial h2 for LLM (0.42 ± 0.07) that was comparable to bone geometry traits. Phenotypic correlations between LLM and bone geometry phenotypes ranged from 0.033 with NSA (p > 0.05) to 0.251 with S_Z (p < 0.001); genetic correlations ranged from 0.087 (NSA, p > 0.05) to 0.454 (S_Z, p < 0.001). Univariate linkage analysis of covariate-adjusted LLM identified no chromosomal regions with LOD scores ≥2.0; however, bivariate analysis identified two loci with LOD scores >3.0, shared by LLM with S_CSA on chromosome 12p12.3–12p13.2, and with NSA, on 14q21.3–22.1. In conclusion, we identified chromosomal regions potentially linked to both LLM and femoral bone geometry. Identification and subsequent characterization of these shared loci may further elucidate the genetic contributions to both osteoporosis and sarcopenia. PMID:19063671

  7. Accounting for linkage disequilibrium in genome-wide association studies: A penalized regression method.

    PubMed

    Liu, Jin; Wang, Kai; Ma, Shuangge; Huang, Jian

    2013-01-01

    Penalized regression methods are becoming increasingly popular in genome-wide association studies (GWAS) for identifying genetic markers associated with disease. However, standard penalized methods such as LASSO do not take into account the possible linkage disequilibrium between adjacent markers. We propose a novel penalized approach for GWAS using a dense set of single nucleotide polymorphisms (SNPs). The proposed method uses the minimax concave penalty (MCP) for marker selection and incorporates linkage disequilibrium (LD) information by penalizing the difference of the genetic effects at adjacent SNPs with high correlation. A coordinate descent algorithm is derived to implement the proposed method. This algorithm is efficient in dealing with a large number of SNPs. A multi-split method is used to calculate the p-values of the selected SNPs for assessing their significance. We refer to the proposed penalty function as the smoothed MCP and the proposed approach as the SMCP method. Performance of the proposed SMCP method and its comparison with LASSO and MCP approaches are evaluated through simulation studies, which demonstrate that the proposed method is more accurate in selecting associated SNPs. Its applicability to real data is illustrated using heterogeneous stock mice data and a rheumatoid arthritis. PMID:25258655

  8. Accounting for linkage disequilibrium in genome-wide association studies: A penalized regression method.

    PubMed

    Liu, Jin; Wang, Kai; Ma, Shuangge; Huang, Jian

    2013-01-01

    Penalized regression methods are becoming increasingly popular in genome-wide association studies (GWAS) for identifying genetic markers associated with disease. However, standard penalized methods such as LASSO do not take into account the possible linkage disequilibrium between adjacent markers. We propose a novel penalized approach for GWAS using a dense set of single nucleotide polymorphisms (SNPs). The proposed method uses the minimax concave penalty (MCP) for marker selection and incorporates linkage disequilibrium (LD) information by penalizing the difference of the genetic effects at adjacent SNPs with high correlation. A coordinate descent algorithm is derived to implement the proposed method. This algorithm is efficient in dealing with a large number of SNPs. A multi-split method is used to calculate the p-values of the selected SNPs for assessing their significance. We refer to the proposed penalty function as the smoothed MCP and the proposed approach as the SMCP method. Performance of the proposed SMCP method and its comparison with LASSO and MCP approaches are evaluated through simulation studies, which demonstrate that the proposed method is more accurate in selecting associated SNPs. Its applicability to real data is illustrated using heterogeneous stock mice data and a rheumatoid arthritis.

  9. Genome-wide linkage analysis and physical mapping of the rippling muscle disease gene

    SciTech Connect

    Stephan, D.A.; Buist, N.R.M.; Bhaskar, A.C.

    1994-09-01

    Rippling muscle disease (RMD) is an inherited disorder of skeletal muscle in which mechanical stimuli provoke electrically silent contractions. The patient`s symptoms are muscle cramps, pain, and stiffness, particularly during or following exercise. Clinical signs are balling of muscle following percussion, and a characteristic lateral rolling movement of muscle occurring after contraction followed by stretching. We report a new 44-member pedigree segregating RMD as an autosomal dominant trait. A genome-wide genetic linkage study in this family, using a novel approach of testing closely spaced highly polymorphic markers in affected individuals, localized the responsible gene to the distal end of the long arm of chromosome 1 with a maximum multi-point lod score of 3.56 ({theta}=0). In this family, RMD is localized to a 6 cM region near D1S235. Physical mapping of the linked region yielded several positive YAC clones, one of which spans the entire 6 cM distance. Several candidate genes not present in the YAC contig, but in the region of 1q4, have been excluded as causative by either linkage analysis of intragenic microsatellite repeats (alpha-actinin, angiotensinogen) or by SSCP of exons (skeletal muscle alpha-actinin). We studied two previously reported German families for linkage to the same locus and this same area did not co-segregate with the disease, a finding that shows that different genetic defects can cause a similar clinical phenotype (genetic heterogeneity). An understanding of the defect in contraction control within the muscle fibers in this disease may lead to a better understanding of muscle force transduction, intracellular calcium homeostasis, or both.

  10. Genome-wide linkage using the Social Responsiveness Scale in Utah autism pedigrees

    PubMed Central

    2010-01-01

    Background Autism Spectrum Disorders (ASD) are phenotypically heterogeneous, characterized by impairments in the development of communication and social behaviour and the presence of repetitive behaviour and restricted interests. Dissecting the genetic complexity of ASD may require phenotypic data reflecting more detail than is offered by a categorical clinical diagnosis. Such data are available from the Social Responsiveness Scale (SRS) which is a continuous, quantitative measure of social ability giving scores that range from significant impairment to above average ability. Methods We present genome-wide results for 64 multiplex and extended families ranging from two to nine generations. SRS scores were available from 518 genotyped pedigree subjects, including affected and unaffected relatives. Genotypes from the Illumina 6 k single nucleotide polymorphism panel were provided by the Center for Inherited Disease Research. Quantitative and qualitative analyses were done using MCLINK, a software package that uses Markov chain Monte Carlo (MCMC) methods to perform multilocus linkage analysis on large extended pedigrees. Results When analysed as a qualitative trait, linkage occurred in the same locations as in our previous affected-only genome scan of these families, with findings on chromosomes 7q31.1-q32.3 [heterogeneity logarithm of the odds (HLOD) = 2.91], 15q13.3 (HLOD = 3.64), and 13q12.3 (HLOD = 2.23). Additional positive qualitative results were seen on chromosomes 6 and 10 in regions that may be of interest for other neuropsychiatric disorders. When analysed as a quantitative trait, results replicated a peak found in an independent sample using quantitative SRS scores on chromosome 11p15.1-p15.4 (HLOD = 2.77). Additional positive quantitative results were seen on chromosomes 7, 9, and 19. Conclusions The SRS linkage peaks reported here substantially overlap with peaks found in our previous affected-only genome scan of clinical diagnosis. In addition, we

  11. Genome-wide linkage analysis is a powerful prenatal diagnostic tool in families with unknown genetic defects.

    PubMed

    Arélin, Maria; Schulze, Bernt; Müller-Myhsok, Bertram; Horn, Denise; Diers, Alexander; Uhlenberg, Birgit; Nürnberg, Peter; Nürnberg, Gudrun; Becker, Christian; Mundlos, Stefan; Lindner, Tom H; Sperling, Karl; Hoffmann, Katrin

    2013-04-01

    Genome-wide linkage analysis is an established tool to map inherited diseases. To our knowledge it has not been used in prenatal diagnostics of any genetic disorder. We present a family with a severe recessive mental retardation syndrome, where the mother wished pregnancy termination to avoid delivering another affected child. By genome-wide scanning using the Affymetrix (Santa Clara, CA, USA) 10k chip we were able to establish the disease haplotype. Without knowing the exact genetic defect, we excluded the condition in the fetus. The woman finally gave birth to a healthy baby. We suggest that genome-wide linkage analysis--based on either SNP mapping or full-genome sequencing--is a very useful tool in prenatal diagnostics of diseases.

  12. Genome wide linkage disequilibrium in Chinese asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm: implications for domestication history and genome wide association studies.

    PubMed

    Xu, P; Wu, X; Wang, B; Luo, J; Liu, Y; Ehlers, J D; Close, T J; Roberts, P A; Lu, Z; Wang, S; Li, G

    2012-07-01

    Association mapping of important traits of crop plants relies on first understanding the extent and patterns of linkage disequilibrium (LD) in the particular germplasm being investigated. We characterize here the genetic diversity, population structure and genome wide LD patterns in a set of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm from China. A diverse collection of 99 asparagus bean and normal cowpea accessions were genotyped with 1127 expressed sequence tag-derived single nucleotide polymorphism markers (SNPs). The proportion of polymorphic SNPs across the collection was relatively low (39%), with an average number of SNPs per locus of 1.33. Bayesian population structure analysis indicated two subdivisions within the collection sampled that generally represented the 'standard vegetable' type (subgroup SV) and the 'non-standard vegetable' type (subgroup NSV), respectively. Level of LD (r(2)) was higher and extent of LD persisted longer in subgroup SV than in subgroup NSV, whereas LD decayed rapidly (0-2 cM) in both subgroups. LD decay distance varied among chromosomes, with the longest (≈ 5 cM) five times longer than the shortest (≈ 1 cM). Partitioning of LD variance into within- and between-subgroup components coupled with comparative LD decay analysis suggested that linkage group 5, 7 and 10 may have undergone the most intensive epistatic selection toward traits favorable for vegetable use. This work provides a first population genetic insight into domestication history of asparagus bean and demonstrates the feasibility of mapping complex traits by genome wide association study in asparagus bean using a currently available cowpea SNPs marker platform. PMID:22378357

  13. Genome wide linkage disequilibrium in Chinese asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm: implications for domestication history and genome wide association studies.

    PubMed

    Xu, P; Wu, X; Wang, B; Luo, J; Liu, Y; Ehlers, J D; Close, T J; Roberts, P A; Lu, Z; Wang, S; Li, G

    2012-07-01

    Association mapping of important traits of crop plants relies on first understanding the extent and patterns of linkage disequilibrium (LD) in the particular germplasm being investigated. We characterize here the genetic diversity, population structure and genome wide LD patterns in a set of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm from China. A diverse collection of 99 asparagus bean and normal cowpea accessions were genotyped with 1127 expressed sequence tag-derived single nucleotide polymorphism markers (SNPs). The proportion of polymorphic SNPs across the collection was relatively low (39%), with an average number of SNPs per locus of 1.33. Bayesian population structure analysis indicated two subdivisions within the collection sampled that generally represented the 'standard vegetable' type (subgroup SV) and the 'non-standard vegetable' type (subgroup NSV), respectively. Level of LD (r(2)) was higher and extent of LD persisted longer in subgroup SV than in subgroup NSV, whereas LD decayed rapidly (0-2 cM) in both subgroups. LD decay distance varied among chromosomes, with the longest (≈ 5 cM) five times longer than the shortest (≈ 1 cM). Partitioning of LD variance into within- and between-subgroup components coupled with comparative LD decay analysis suggested that linkage group 5, 7 and 10 may have undergone the most intensive epistatic selection toward traits favorable for vegetable use. This work provides a first population genetic insight into domestication history of asparagus bean and demonstrates the feasibility of mapping complex traits by genome wide association study in asparagus bean using a currently available cowpea SNPs marker platform.

  14. Creative Activities in Music--A Genome-Wide Linkage Analysis.

    PubMed

    Oikkonen, Jaana; Kuusi, Tuire; Peltonen, Petri; Raijas, Pirre; Ukkola-Vuoti, Liisa; Karma, Kai; Onkamo, Päivi; Järvelä, Irma

    2016-01-01

    Creative activities in music represent a complex cognitive function of the human brain, whose biological basis is largely unknown. In order to elucidate the biological background of creative activities in music we performed genome-wide linkage and linkage disequilibrium (LD) scans in musically experienced individuals characterised for self-reported composing, arranging and non-music related creativity. The participants consisted of 474 individuals from 79 families, and 103 sporadic individuals. We found promising evidence for linkage at 16p12.1-q12.1 for arranging (LOD 2.75, 120 cases), 4q22.1 for composing (LOD 2.15, 103 cases) and Xp11.23 for non-music related creativity (LOD 2.50, 259 cases). Surprisingly, statistically significant evidence for linkage was found for the opposite phenotype of creative activity in music (neither composing nor arranging; NCNA) at 18q21 (LOD 3.09, 149 cases), which contains cadherin genes like CDH7 and CDH19. The locus at 4q22.1 overlaps the previously identified region of musical aptitude, music perception and performance giving further support for this region as a candidate region for broad range of music-related traits. The other regions at 18q21 and 16p12.1-q12.1 are also adjacent to the previously identified loci with musical aptitude. Pathway analysis of the genes suggestively associated with composing suggested an overrepresentation of the cerebellar long-term depression pathway (LTD), which is a cellular model for synaptic plasticity. The LTD also includes cadherins and AMPA receptors, whose component GSG1L was linked to arranging. These results suggest that molecular pathways linked to memory and learning via LTD affect music-related creative behaviour. Musical creativity is a complex phenotype where a common background with musicality and intelligence has been proposed. Here, we implicate genetic regions affecting music-related creative behaviour, which also include genes with neuropsychiatric associations. We also propose

  15. Creative Activities in Music – A Genome-Wide Linkage Analysis

    PubMed Central

    Oikkonen, Jaana; Kuusi, Tuire; Peltonen, Petri; Raijas, Pirre; Ukkola-Vuoti, Liisa; Karma, Kai; Onkamo, Päivi; Järvelä, Irma

    2016-01-01

    Creative activities in music represent a complex cognitive function of the human brain, whose biological basis is largely unknown. In order to elucidate the biological background of creative activities in music we performed genome-wide linkage and linkage disequilibrium (LD) scans in musically experienced individuals characterised for self-reported composing, arranging and non-music related creativity. The participants consisted of 474 individuals from 79 families, and 103 sporadic individuals. We found promising evidence for linkage at 16p12.1-q12.1 for arranging (LOD 2.75, 120 cases), 4q22.1 for composing (LOD 2.15, 103 cases) and Xp11.23 for non-music related creativity (LOD 2.50, 259 cases). Surprisingly, statistically significant evidence for linkage was found for the opposite phenotype of creative activity in music (neither composing nor arranging; NCNA) at 18q21 (LOD 3.09, 149 cases), which contains cadherin genes like CDH7 and CDH19. The locus at 4q22.1 overlaps the previously identified region of musical aptitude, music perception and performance giving further support for this region as a candidate region for broad range of music-related traits. The other regions at 18q21 and 16p12.1-q12.1 are also adjacent to the previously identified loci with musical aptitude. Pathway analysis of the genes suggestively associated with composing suggested an overrepresentation of the cerebellar long-term depression pathway (LTD), which is a cellular model for synaptic plasticity. The LTD also includes cadherins and AMPA receptors, whose component GSG1L was linked to arranging. These results suggest that molecular pathways linked to memory and learning via LTD affect music-related creative behaviour. Musical creativity is a complex phenotype where a common background with musicality and intelligence has been proposed. Here, we implicate genetic regions affecting music-related creative behaviour, which also include genes with neuropsychiatric associations. We also propose

  16. Creative Activities in Music--A Genome-Wide Linkage Analysis.

    PubMed

    Oikkonen, Jaana; Kuusi, Tuire; Peltonen, Petri; Raijas, Pirre; Ukkola-Vuoti, Liisa; Karma, Kai; Onkamo, Päivi; Järvelä, Irma

    2016-01-01

    Creative activities in music represent a complex cognitive function of the human brain, whose biological basis is largely unknown. In order to elucidate the biological background of creative activities in music we performed genome-wide linkage and linkage disequilibrium (LD) scans in musically experienced individuals characterised for self-reported composing, arranging and non-music related creativity. The participants consisted of 474 individuals from 79 families, and 103 sporadic individuals. We found promising evidence for linkage at 16p12.1-q12.1 for arranging (LOD 2.75, 120 cases), 4q22.1 for composing (LOD 2.15, 103 cases) and Xp11.23 for non-music related creativity (LOD 2.50, 259 cases). Surprisingly, statistically significant evidence for linkage was found for the opposite phenotype of creative activity in music (neither composing nor arranging; NCNA) at 18q21 (LOD 3.09, 149 cases), which contains cadherin genes like CDH7 and CDH19. The locus at 4q22.1 overlaps the previously identified region of musical aptitude, music perception and performance giving further support for this region as a candidate region for broad range of music-related traits. The other regions at 18q21 and 16p12.1-q12.1 are also adjacent to the previously identified loci with musical aptitude. Pathway analysis of the genes suggestively associated with composing suggested an overrepresentation of the cerebellar long-term depression pathway (LTD), which is a cellular model for synaptic plasticity. The LTD also includes cadherins and AMPA receptors, whose component GSG1L was linked to arranging. These results suggest that molecular pathways linked to memory and learning via LTD affect music-related creative behaviour. Musical creativity is a complex phenotype where a common background with musicality and intelligence has been proposed. Here, we implicate genetic regions affecting music-related creative behaviour, which also include genes with neuropsychiatric associations. We also propose

  17. Genome Wide Search for Biomarkers to Diagnose Yersinia Infections.

    PubMed

    Kalia, Vipin Chandra; Kumar, Prasun

    2015-12-01

    Bacterial identification on the basis of the highly conserved 16S rRNA (rrs) gene is limited by its presence in multiple copies and a very high level of similarity among them. The need is to look for other genes with unique characteristics to be used as biomarkers. Fifty-one sequenced genomes belonging to 10 different Yersinia species were used for searching genes common to all the genomes. Out of 304 common genes, 34 genes of sizes varying from 0.11 to 4.42 kb, were selected and subjected to in silico digestion with 10 different Restriction endonucleases (RE) (4-6 base cutters). Yersinia species have 6-7 copies of rrs per genome, which are difficult to distinguish by multiple sequence alignments or their RE digestion patterns. However, certain unique combinations of other common gene sequences-carB, fadJ, gluM, gltX, ileS, malE, nusA, ribD, and rlmL and their RE digestion patterns can be used as markers for identifying 21 strains belonging to 10 Yersinia species: Y. aldovae, Y. enterocolitica, Y. frederiksenii, Y. intermedia, Y. kristensenii, Y. pestis, Y. pseudotuberculosis, Y. rohdei, Y. ruckeri, and Y. similis. This approach can be applied for rapid diagnostic applications.

  18. Genome Wide Search for Biomarkers to Diagnose Yersinia Infections.

    PubMed

    Kalia, Vipin Chandra; Kumar, Prasun

    2015-12-01

    Bacterial identification on the basis of the highly conserved 16S rRNA (rrs) gene is limited by its presence in multiple copies and a very high level of similarity among them. The need is to look for other genes with unique characteristics to be used as biomarkers. Fifty-one sequenced genomes belonging to 10 different Yersinia species were used for searching genes common to all the genomes. Out of 304 common genes, 34 genes of sizes varying from 0.11 to 4.42 kb, were selected and subjected to in silico digestion with 10 different Restriction endonucleases (RE) (4-6 base cutters). Yersinia species have 6-7 copies of rrs per genome, which are difficult to distinguish by multiple sequence alignments or their RE digestion patterns. However, certain unique combinations of other common gene sequences-carB, fadJ, gluM, gltX, ileS, malE, nusA, ribD, and rlmL and their RE digestion patterns can be used as markers for identifying 21 strains belonging to 10 Yersinia species: Y. aldovae, Y. enterocolitica, Y. frederiksenii, Y. intermedia, Y. kristensenii, Y. pestis, Y. pseudotuberculosis, Y. rohdei, Y. ruckeri, and Y. similis. This approach can be applied for rapid diagnostic applications. PMID:26543261

  19. Genome-wide Study of Families with Absolute Pitch Reveals Linkage to 8q24.21 and Locus Heterogeneity

    PubMed Central

    Theusch, Elizabeth; Basu, Analabha; Gitschier, Jane

    2009-01-01

    Absolute pitch (AP) is the rare ability to instantaneously recognize and label tones with their musical note names without using a reference pitch for comparison. The etiology of AP is complex. Prior studies have implicated both genetic and environmental factors in its genesis, yet the molecular basis for AP remains unknown. To locate regions of the human genome that may harbor AP-predisposing genetic variants, we performed a genome-wide linkage study on 73 multiplex AP families by genotyping them with 6090 SNP markers. Nonparametric multipoint linkage analyses were conducted, and the strongest evidence for linkage was observed on chromosome 8q24.21 in the subset of 45 families with European ancestry (exponential LOD score = 3.464, empirical genome-wide p = 0.03). Other regions with suggestive LOD scores included chromosomes 7q22.3, 8q21.11, and 9p21.3. Of these four regions, only the 7q22.3 linkage peak was also evident when 19 families with East Asian ancestry were analyzed separately. Though only one of these regions has yet reached statistical significance individually, we detected a larger number of independent linkage peaks than expected by chance overall, indicating that AP is genetically heterogeneous. PMID:19576568

  20. A genome-wide sib-pair scan for quantitative language traits reveals linkage to chromosomes 10 and 13

    PubMed Central

    Evans, P. D.; Mueller, K. L.; Gamazon, E. R.; Cox, N. J.; Tomblin, J. B.

    2016-01-01

    Although there is considerable evidence that individual differences in language development are highly heritable, there have been few genome-wide scans to locate genes associated with the trait. Previous analyses of language impairment have yielded replicable evidence for linkage to regions on chromosomes 16q, 19q, 13q (within lab) and at 13q (between labs). Here we report the first linkage study to screen the continuum of language ability, from normal to disordered, as found in the general population. 383 children from 147 sib-ships (214 sib-pairs) were genotyped on the Illumina® Linkage IVb Marker Panel using three composite language-related phenotypes and a measure of phonological memory (PM). Two regions (10q23.33; 13q33.3) yielded genome-wide significant peaks for linkage with PM. A peak suggestive of linkage was also found at 17q12 for the overall language composite. This study presents two novel genetic loci for the study of language development and disorders, but fails to replicate findings by previous groups. Possible reasons for this are discussed. PMID:25997078

  1. Combined genome-wide linkage and association analyses of fasting glucose level in healthy twins and families of Korea.

    PubMed

    Suh, Young Ju; Kim, Sunghwan; Kim, So Hun; Park, Jia; Lim, Hyun Ae; Park, Hyun Ju; Choi, Hangseok; Ng, Daniel; Lee, Mi Kyeong; Nam, Moonsuk

    2013-03-01

    This study was undertaken to identify genetic polymorphisms that are associated with the risk of an elevated fasting glucose (FG) level using genome-wide analyses. We explored a quantitative trait locus (QTL) for FG level in a genome-wide study from a Korean twin-family cohort (the Healthy Twin Study) using a combined linkage and family-based association analysis approach. We investigated 1,754 individuals, which included 432 families and 219 pairs of monozygotic twins. Regions of chromosomes 2q23.3-2q31.1, 15q26.1-15q26.3, 16p12.1, and 20p13-20p12.2, were found to show evidence of linkage with FG level, and several markers in these regions were found to be significantly associated with FG level using family-based or general association tests. In particular, a single-nucleotide polymorphism (rs6138953) on the PTPRA gene in the 20p13 region (combined P = 1.8 × 10(-6)) was found to be associated with FG level, and the PRKCB1 gene (in 16p12.1) to be possibly associated with FG level. In conclusion, multiple regions of chromosomes 2q23.3-2q31.1, 15q26.1-15q26.3, 16p12.1, and 20p13-20p12.2 are associated with FG level in our Korean twin-family cohort. The combined approach of genome-wide linkage and family-based association analysis is useful to identify novel or known genetic regions concerning FG level in a family cohort study.

  2. Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress.

    PubMed

    Rostoks, Nils; Mudie, Sharon; Cardle, Linda; Russell, Joanne; Ramsay, Luke; Booth, Allan; Svensson, Jan T; Wanamaker, Steve I; Walia, Harkamal; Rodriguez, Edmundo M; Hedley, Peter E; Liu, Hui; Morris, Jenny; Close, Timothy J; Marshall, David F; Waugh, Robbie

    2005-12-01

    More than 2,000 genome-wide barley single nucleotide polymorphisms (SNPs) were developed by resequencing unigene fragments from eight diverse accessions. The average genome-wide SNP frequency observed in 877 unigenes was 1 SNP per 200 bp. However, SNP frequency was highly variable with the least number of SNP and SNP haplotypes observed within European cultivated germplasm reflecting effects of breeding history on genetic diversity. More than 300 SNP loci were mapped genetically in three experimental mapping populations which allowed the construction of an integrated SNP map incorporating a large number of RFLP, AFLP and SSR markers (1,237 loci in total). The genes used for SNP discovery were selected based on their transcriptional response to a variety of abiotic stresses. A set of known barley abiotic stress QTL was positioned on the linkage map, while the available sequence and gene expression information facilitated the identification of genes potentially associated with these traits. Comparison of the sequenced SNP loci to the rice genome sequence identified several regions of highly conserved gene order providing a framework for marker saturation in barley genomic regions of interest. The integration of genome-wide SNP and expression data with available genetic and phenotypic information will facilitate the identification of gene function in barley and other non-model organisms. PMID:16244872

  3. Genome-wide linkage scan of prostate cancer Gleason score and confirmation of chromosome 19q.

    PubMed

    Schaid, Daniel J; Stanford, Janet L; McDonnell, Shannon K; Suuriniemi, Miia; McIntosh, Laura; Karyadi, Danielle M; Carlson, Erin E; Deutsch, Kerry; Janer, Marta; Hood, Lee; Ostrander, Elaine A

    2007-07-01

    Despite evidence that prostate cancer has a genetic etiology, it has been extremely difficult to confirm genetic linkage results across studies, emphasizing the large extent of genetic heterogeneity associated with this disease. Because prostate cancer is common--approximately one in six men will be diagnosed with prostate cancer in their life--genetic linkage studies are likely plagued by phenocopies (i.e., men with prostate cancer due to environmental or lifestyle factors), weakly penetrant alleles, or a combination of both, making it difficult to replicate linkage findings. One way to account for heterogeneous causes is to use clinical information that is related to the aggressiveness of disease as an endpoint for linkage analyses. Gleason grade is a measure of prostate tumor differentiation, with higher grades associated with more aggressive disease. This semi-quantitative score has been used as a quantitative trait for linkage analysis in several prior studies. Our aim was to determine if prior linkage reports of Gleason grade to specific loci could be replicated, and to ascertain if new regions of linkage could be found. Gleason scores were available for 391 affected sib pairs from 183 hereditary prostate cancer pedigrees as part of the PROGRESS study. Analyzing Gleason score as a quantitative trait, and using microsatellite markers, suggestive evidence for linkage (P-value linkage to chromosome 19q and suggest new loci for further investigation.

  4. Refined QTLs of osteoporosis-related traits by linkage analysis with genome-wide SNPs: Framingham SHARe

    PubMed Central

    Karasik, David; Dupuis, Josée; Cho, Kelly; Cupples, L. Adrienne; Zhou, Yanhua; Kiel, Douglas P.; Demissie, Serkalem

    2010-01-01

    Genome-wide association studies (GWAS) using high-density array of single-nucleotide polymorphisms (SNPs) offer an unbiased strategy to identify new candidate genes for osteoporosis. We used a subset of autosomal SNPs from the Affymetrix 500K+50K SNP GeneChip marker set to examine genetic linkage with multiple highly heritable osteoporosis-related traits, including BMD of the hip and spine, heel ultrasound (attenuation and speed of sound), and geometric indices of the hip, in two generations from the Framingham Osteoporosis Study. Variance component linkage analysis was performed using normalized residuals (adjusted for age, height, BMI, and estrogen status in women). Multipoint linkage analyses produced LOD scores ≥ 3.0 for BMD on chromosomes (chr.) 9 and 11, and for ultrasound speed of sound on chr. 5. Hip geometric traits were linked with higher LOD scores, such as with Shaft Width on chr. 4 (LOD = 3.9) and chr. 16 (LOD = 3.8), and with Shaft section modulus on chr. 22 (LOD = 4.0). LOD score ≥ 5.0 was obtained for femoral Neck Width on chr. 7. In conclusion, with a SNP-based linkage approach, we identified several novel potential QTLs and confirmed previously identified chromosomal regions linked to bone mass and geometry. Subsequent focus on the spectrum of genetic polymorphisms in these refined regions may contribute to finding variants predisposing to osteoporosis. PMID:20064633

  5. Taiwan Schizophrenia Linkage Study: lessons learned from endophenotype-based genome-wide linkage scans and perspective.

    PubMed

    Chen, Wei J

    2013-10-01

    Taiwan Schizophrenia Linkage Study (TSLS) was initiated with a linkage strategy for locating multiple genes, each of small to moderate effect, and aimed to recruit a large enough sample of pairs of affected siblings and their families ascertained from a multisite study. With a sample of 607 families successfully recruited, a total of 2,242 individuals (1,207 affected and 1,035 unaffected) from 557 families were genotyped using 386 microsatellite markers spaced at an average of 9-cM intervals. Here the author reviews the establishment of TSLS and initial signal derived from linkage scan using the diagnosis of schizophrenia. Based on the limited success of the initial linkage analysis, a sufficient-component causal model is proposed to incorporate endophenotypes and genes for schizophrenia. Four types of candidate endophenotype measured in TSLS, including schizotypal personality, Continuous Performance Test, Wisconsin Card Sorting Test, and niacin skin flush test, are briefly described. The author discusses different strategies of linkage analysis incorporating these endophenotypes, including quantitative trait loci (QTL) linkage analysis, clustering-derived subgroups, ordered subset analysis (OSA), and latent classes for linkage scan. Then the author summarizes the linkage signals generated from seven studies of endophenotype-based linkage analysis using TSLS, including QTL scan of neurocognitive performance, QTL scan of niacin skin flush, the family cluster of attention deficit and execution deficit, OSA by schizophrenia-schizotypy factors, nested OSA by age at onset and neurocognitive performance, and the latent class of deficit schizophrenia for linkage analysis. The perspective of combining next-generation sequencing with linkage analysis of families is also discussed.

  6. Genome-wide linkage and association analysis identifies major gene loci for guttural pouch tympany in Arabian and German warmblood horses.

    PubMed

    Metzger, Julia; Ohnesorge, Bernhard; Distl, Ottmar

    2012-01-01

    Equine guttural pouch tympany (GPT) is a hereditary condition affecting foals in their first months of life. Complex segregation analyses in Arabian and German warmblood horses showed the involvement of a major gene as very likely. Genome-wide linkage and association analyses including a high density marker set of single nucleotide polymorphisms (SNPs) were performed to map the genomic region harbouring the potential major gene for GPT. A total of 85 Arabian and 373 German warmblood horses were genotyped on the Illumina equine SNP50 beadchip. Non-parametric multipoint linkage analyses showed genome-wide significance on horse chromosomes (ECA) 3 for German warmblood at 16-26 Mb and 34-55 Mb and for Arabian on ECA15 at 64-65 Mb. Genome-wide association analyses confirmed the linked regions for both breeds. In Arabian, genome-wide association was detected at 64 Mb within the region with the highest linkage peak on ECA15. For German warmblood, signals for genome-wide association were close to the peak region of linkage at 52 Mb on ECA3. The odds ratio for the SNP with the highest genome-wide association was 0.12 for the Arabian. In conclusion, the refinement of the regions with the Illumina equine SNP50 beadchip is an important step to unravel the responsible mutations for GPT.

  7. Genome-wide linkage and association analysis identifies major gene loci for guttural pouch tympany in Arabian and German warmblood horses.

    PubMed

    Metzger, Julia; Ohnesorge, Bernhard; Distl, Ottmar

    2012-01-01

    Equine guttural pouch tympany (GPT) is a hereditary condition affecting foals in their first months of life. Complex segregation analyses in Arabian and German warmblood horses showed the involvement of a major gene as very likely. Genome-wide linkage and association analyses including a high density marker set of single nucleotide polymorphisms (SNPs) were performed to map the genomic region harbouring the potential major gene for GPT. A total of 85 Arabian and 373 German warmblood horses were genotyped on the Illumina equine SNP50 beadchip. Non-parametric multipoint linkage analyses showed genome-wide significance on horse chromosomes (ECA) 3 for German warmblood at 16-26 Mb and 34-55 Mb and for Arabian on ECA15 at 64-65 Mb. Genome-wide association analyses confirmed the linked regions for both breeds. In Arabian, genome-wide association was detected at 64 Mb within the region with the highest linkage peak on ECA15. For German warmblood, signals for genome-wide association were close to the peak region of linkage at 52 Mb on ECA3. The odds ratio for the SNP with the highest genome-wide association was 0.12 for the Arabian. In conclusion, the refinement of the regions with the Illumina equine SNP50 beadchip is an important step to unravel the responsible mutations for GPT. PMID:22848553

  8. Genome-Wide Linkage and Association Analysis Identifies Major Gene Loci for Guttural Pouch Tympany in Arabian and German Warmblood Horses

    PubMed Central

    Metzger, Julia; Ohnesorge, Bernhard; Distl, Ottmar

    2012-01-01

    Equine guttural pouch tympany (GPT) is a hereditary condition affecting foals in their first months of life. Complex segregation analyses in Arabian and German warmblood horses showed the involvement of a major gene as very likely. Genome-wide linkage and association analyses including a high density marker set of single nucleotide polymorphisms (SNPs) were performed to map the genomic region harbouring the potential major gene for GPT. A total of 85 Arabian and 373 German warmblood horses were genotyped on the Illumina equine SNP50 beadchip. Non-parametric multipoint linkage analyses showed genome-wide significance on horse chromosomes (ECA) 3 for German warmblood at 16–26 Mb and 34–55 Mb and for Arabian on ECA15 at 64–65 Mb. Genome-wide association analyses confirmed the linked regions for both breeds. In Arabian, genome-wide association was detected at 64 Mb within the region with the highest linkage peak on ECA15. For German warmblood, signals for genome-wide association were close to the peak region of linkage at 52 Mb on ECA3. The odds ratio for the SNP with the highest genome-wide association was 0.12 for the Arabian. In conclusion, the refinement of the regions with the Illumina equine SNP50 beadchip is an important step to unravel the responsible mutations for GPT. PMID:22848553

  9. Semiparametric methods for genome-wide linkage analysis of human gene expression data.

    PubMed

    Diao, Guoqing; Lin, D Y

    2007-01-01

    With the availability of high-throughput microarray technologies, investigators can simultaneously measure the expression levels of many thousands of genes in a short period. Although there are rich statistical methods for analyzing microarray data in the literature, limited work has been done in mapping expression quantitative trait loci (eQTL) that influence the variation in levels of gene expression. Most existing eQTL mapping methods assume that the expression phenotypes follow a normal distribution and violation of the normality assumption may lead to inflated type I error and reduced power. QTL analysis of expression data involves the mapping of many expression phenotypes at thousands or hundreds of thousands of marker loci across the whole genome. An appropriate procedure to adjust for multiple testing is essential for guarding against an abundance of false positive results. In this study, we applied a semiparametric quantitative trait loci (SQTL) mapping method to human gene expression data. The SQTL mapping method is rank-based and therefore robust to non-normality and outliers. Furthermore, we apply an efficient Monte Carlo procedure to account for multiple testing and assess the genome-wide significance level. Particularly, we apply the SQTL mapping method and the Monte-Carlo approach to the gene expression data provided by Genetic Analysis Workshop 15.

  10. Semiparametric methods for genome-wide linkage analysis of human gene expression data

    PubMed Central

    Diao, Guoqing; Lin, DY

    2007-01-01

    With the availability of high-throughput microarray technologies, investigators can simultaneously measure the expression levels of many thousands of genes in a short period. Although there are rich statistical methods for analyzing microarray data in the literature, limited work has been done in mapping expression quantitative trait loci (eQTL) that influence the variation in levels of gene expression. Most existing eQTL mapping methods assume that the expression phenotypes follow a normal distribution and violation of the normality assumption may lead to inflated type I error and reduced power. QTL analysis of expression data involves the mapping of many expression phenotypes at thousands or hundreds of thousands of marker loci across the whole genome. An appropriate procedure to adjust for multiple testing is essential for guarding against an abundance of false positive results. In this study, we applied a semiparametric quantitative trait loci (SQTL) mapping method to human gene expression data. The SQTL mapping method is rank-based and therefore robust to non-normality and outliers. Furthermore, we apply an efficient Monte Carlo procedure to account for multiple testing and assess the genome-wide significance level. Particularly, we apply the SQTL mapping method and the Monte-Carlo approach to the gene expression data provided by Genetic Analysis Workshop 15. PMID:18466586

  11. Systematic, genome-wide, sex-specific linkage of cardiovascular traits in French Canadians.

    PubMed

    Seda, Ondrej; Tremblay, Johanne; Gaudet, Daniel; Brunelle, Pierre-Luc; Gurau, Alexandru; Merlo, Ettore; Pilote, Louise; Orlov, Sergei N; Boulva, Francis; Petrovich, Milan; Kotchen, Theodore A; Cowley, Allen W; Hamet, Pavel

    2008-04-01

    The sexual dimorphism of cardiovascular traits, as well as susceptibility to a variety of related diseases, has long been recognized, yet their sex-specific genomic determinants are largely unknown. We systematically assessed the sex-specific heritability and linkage of 539 hemodynamic, metabolic, anthropometric, and humoral traits in 120 French-Canadian families from the Saguenay-Lac-St-Jean region of Quebec, Canada. We performed multipoint linkage analysis using microsatellite markers followed by peak-wide linkage scan based on Affymetrix Human Mapping 50K Array Xba240 single nucleotide polymorphism genotypes in 3 settings, including the entire sample and then separately in men and women. Nearly one half of the traits were age and sex independent, one quarter were both age and sex dependent, and one eighth were exclusively age or sex dependent. Sex-specific phenotypes are most frequent in heart rate and blood pressure categories, whereas sex- and age-independent determinants are predominant among humoral and biochemical parameters. Twenty sex-specific loci passing multiple testing criteria were corroborated by 2-point single nucleotide polymorphism linkage. Several resting systolic blood pressure measurements showed significant genotype-by-sex interaction, eg, male-specific locus at chromosome 12 (male-female logarithm of odds difference: 4.16; interaction P=0.0002), which was undetectable in the entire population, even after adjustment for sex. Detailed interrogation of this locus revealed a 220-kb block overlapping parts of TAO-kinase 3 and SUDS3 genes. In summary, a large number of complex cardiovascular traits display significant sexual dimorphism, for which we have demonstrated genomic determinants at the haplotype level. Many of these would have been missed in a traditional, sex-adjusted setting.

  12. Three novel quantitative trait loci for skin thickness in swine identified by linkage and genome-wide association studies.

    PubMed

    Ai, Huashui; Xiao, Shijun; Zhang, Zhiyan; Yang, Bin; Li, Lin; Guo, Yuanmei; Lin, Guoshan; Ren, Jun; Huang, Lusheng

    2014-08-01

    Skin is the largest organ in the pig body and plays a key role in protecting the body against pathogens and excessive water loss. Deciphering the genetic basis of swine skin thickness would enrich our knowledge about the skin. To identify the loci for porcine skin thickness, we first performed a genome scan with 194 microsatellite markers in a White Duroc × Erhualian F2 intercross. We identified three genome-wide significant QTL on pig chromosomes (SSC) 4, 7 and 15 using linkage analysis. The most significant QTL was found on SSC7 with a small confidence interval of ~5 cM, explaining 23.9 percent of phenotypic variance. Further, we conducted a genome-wide association study (GWAS) using Illumina PorcineSNP60 Beadchips for the F2 pedigree and a population of Chinese Sutai pigs. We confirmed significant QTL in the F2 pedigree and replicated QTL on SSC15 in Chinese Sutai pigs. A meta-analysis of GWASs on both populations detected a genomic region associated with skin thickness on SSC4. GWAS results were generally consistent with QTL mapping. Identical-by-descent analysis defined QTL on SSC7 in a 683-kb region harboring an interesting candidate gene: HMGA1. On SSC15, the linkage disequilibrium analysis showed a haplotype block of 2.20 Mb that likely harbors the gene responsible for skin thickness. Our findings provide novel insights into the genetic basis of swine skin thickness, which would benefit further understanding of porcine skin function.

  13. Genome-Wide Linkage, Exome Sequencing and Functional Analyses Identify ABCB6 as the Pathogenic Gene of Dyschromatosis Universalis Hereditaria

    PubMed Central

    Wang, Na; Wang, Chuan; Chen, Xuechao; Sheng, Donglai; Fu, Xi’an; See, Kelvin; Foo, Jia Nee; Low, Huiqi; Liany, Herty; Irwan, Ishak Darryl; Liu, Jian; Yang, Baoqi; Chen, Mingfei; Yu, Yongxiang; Yu, Gongqi; Niu, Guiye; You, Jiabao; Zhou, Yan; Ma, Shanshan; Wang, Ting; Yan, Xiaoxiao; Goh, Boon Kee; Common, John E. A.; Lane, Birgitte E.; Sun, Yonghu; Zhou, Guizhi; Lu, Xianmei; Wang, Zhenhua; Tian, Hongqing; Cao, Yuanhua; Chen, Shumin; Liu, Qiji; Liu, Jianjun; Zhang, Furen

    2014-01-01

    Background As a genetic disorder of abnormal pigmentation, the molecular basis of dyschromatosis universalis hereditaria (DUH) had remained unclear until recently when ABCB6 was reported as a causative gene of DUH. Methodology We performed genome-wide linkage scan using Illumina Human 660W-Quad BeadChip and exome sequencing analyses using Agilent SureSelect Human All Exon Kits in a multiplex Chinese DUH family to identify the pathogenic mutations and verified the candidate mutations using Sanger sequencing. Quantitative RT-PCR and Immunohistochemistry was performed to verify the expression of the pathogenic gene, Zebrafish was also used to confirm the functional role of ABCB6 in melanocytes and pigmentation. Results Genome-wide linkage (assuming autosomal dominant inheritance mode) and exome sequencing analyses identified ABCB6 as the disease candidate gene by discovering a coding mutation (c.1358C>T; p.Ala453Val) that co-segregates with the disease phenotype. Further mutation analysis of ABCB6 in four other DUH families and two sporadic cases by Sanger sequencing confirmed the mutation (c.1358C>T; p.Ala453Val) and discovered a second, co-segregating coding mutation (c.964A>C; p.Ser322Lys) in one of the four families. Both mutations were heterozygous in DUH patients and not present in the 1000 Genome Project and dbSNP database as well as 1,516 unrelated Chinese healthy controls. Expression analysis in human skin and mutagenesis interrogation in zebrafish confirmed the functional role of ABCB6 in melanocytes and pigmentation. Given the involvement of ABCB6 mutations in coloboma, we performed ophthalmological examination of the DUH carriers of ABCB6 mutations and found ocular abnormalities in them. Conclusion Our study has advanced our understanding of DUH pathogenesis and revealed the shared pathological mechanism between pigmentary DUH and ocular coloboma. PMID:24498303

  14. Nonlinear Analysis of Time Series in Genome-Wide Linkage Disequilibrium Data

    NASA Astrophysics Data System (ADS)

    Hernández-Lemus, Enrique; Estrada-Gil, Jesús K.; Silva-Zolezzi, Irma; Fernández-López, J. Carlos; Hidalgo-Miranda, Alfredo; Jiménez-Sánchez, Gerardo

    2008-02-01

    The statistical study of large scale genomic data has turned out to be a very important tool in population genetics. Quantitative methods are essential to understand and implement association studies in the biomedical and health sciences. Nevertheless, the characterization of recently admixed populations has been an elusive problem due to the presence of a number of complex phenomena. For example, linkage disequilibrium structures are thought to be more complex than their non-recently admixed population counterparts, presenting the so-called ancestry blocks, admixed regions that are not yet smoothed by the effect of genetic recombination. In order to distinguish characteristic features for various populations we have implemented several methods, some of them borrowed or adapted from the analysis of nonlinear time series in statistical physics and quantitative physiology. We calculate the main fractal dimensions (Kolmogorov's capacity, information dimension and correlation dimension, usually named, D0, D1 and D2). We also have made detrended fluctuation analysis and information based similarity index calculations for the probability distribution of correlations of linkage disequilibrium coefficient of six recently admixed (mestizo) populations within the Mexican Genome Diversity Project [1] and for the non-recently admixed populations in the International HapMap Project [2]. Nonlinear correlations showed up as a consequence of internal structure within the haplotype distributions. The analysis of these correlations as well as the scope and limitations of these procedures within the biomedical sciences are discussed.

  15. Genome-wide evaluation of genetic diversity and linkage disequilibrium in winter and spring triticale (x Triticosecale Wittmack)

    PubMed Central

    2012-01-01

    Background Recent advances in genotyping with high-density markers nowadays enable genome-wide genomic analyses in crops. A detailed characterisation of the population structure and linkage disequilibrium (LD) is essential for the application of genomic approaches and consequently for knowledge-based breeding. In this study we used the triticale-specific DArT array to analyze population structure, genetic diversity, and LD in a worldwide set of 161 winter and spring triticale lines. Results The principal coordinate analysis revealed that the first principal coordinate divides the triticale population into two clusters according to their growth habit. The density distributions of the first ten principal coordinates revealed that several show a distribution indicative of population structure. In addition, we observed relatedness within growth habits which was higher among the spring types than among the winter types. The genome-wide analysis of polymorphic information content (PIC) showed that the PIC is variable among and along chromosomes and that especially the R genome of spring types possesses a reduced genetic diversity. We also found that several chromosomes showed regions of high genetic distance between the two growth habits, indicative of divergent selection. Regarding linkage disequilibrium, the A and B genomes showed a similar LD of 0.24 for closely linked markers and a decay within approximately 12 cM. LD in the R genome was lower with 0.19 and decayed within a shorter map distance of approximately 5 cM. The extent of LD was generally higher for the spring types compared to the winter types. In addition, we observed strong variability of LD along the chromosomes. Conclusions Our results confirm winter and spring growth habit are the major contributors to population structure in triticale, and a family structure exists in both growth types. The specific patterns of genetic diversity observed within these types, such as the low diversity on some rye

  16. Heritability and Preliminary Genome-Wide Linkage Analysis of Arsenic Metabolites in Urine

    PubMed Central

    Tellez-Plaza, Maria; Gribble, Matthew O.; Voruganti, V. Saroja; Francesconi, Kevin A.; Goessler, Walter; Umans, Jason G.; Silbergeld, Ellen K.; Guallar, Eliseo; Franceschini, Nora; Kao, Wen H.; MacCluer, Jean W.; Cole, Shelley A.

    2013-01-01

    Background: Arsenic (III) methyltransferase (AS3MT) has been related to urine arsenic metabolites in association studies. Other genes might also play roles in arsenic metabolism and excretion. Objective: We evaluated genetic determinants of urine arsenic metabolites in American Indian adults from the Strong Heart Study (SHS). Methods: We evaluated heritability of urine arsenic metabolites [percent inorganic arsenic (%iAs), percent monomethylarsonate (%MMA), and percent dimethylarsinate (%DMA)] in 2,907 SHS participants with urine arsenic measurements and at least one relative within the cohort. We conducted a preliminary linkage analysis in a subset of 487 participants with available genotypes on approximately 400 short tandem repeat markers using a general pedigree variance component approach for localizing quantitative trait loci (QTL). Results: The medians (interquartile ranges) for %iAs, %MMA, and %DMA were 7.7% (5.4–10.7%), 13.6% (10.5–17.1%), and 78.4% (72.5–83.1%), respectively. The estimated heritability was 53% for %iAs, 50% for %MMA, and 59% for %DMA. After adjustment for sex, age, smoking, body mass index, alcohol consumption, region, and total urine arsenic concentrations, LOD [logarithm (to the base of 10) of the odds] scores indicated suggestive evidence for genetic linkage with QTLs influencing urine arsenic metabolites on chromosomes 5 (LOD = 2.03 for %iAs), 9 (LOD = 2.05 for %iAs and 2.10 for %MMA), and 11 (LOD = 1.94 for %iAs). A peak for %DMA on chromosome 10 within 2 Mb of AS3MT had an LOD of 1.80. Conclusions: This population-based family study in American Indian communities supports a genetic contribution to variation in the distribution of arsenic metabolites in urine and, potentially, the involvement of genes other than AS3MT. PMID:23322787

  17. Genome-Wide Linkage Scan for Quantitative Trait Loci Underlying Normal Variation in Heel Bone Ultrasound Measures

    PubMed Central

    Lee, M.; Choh, A.C.; Williams, K.D.; Schroeder, V.; Dyer, T.D.; Blangero, J.; Cole, S.A.; Chumlea, WM.C.; Duren, D.L.; Sherwood, R.J.; Siervogel, R.M.; Towne, B.; Czerwinski, S.A.

    2012-01-01

    Quantitative ultrasound (QUS) traits are correlated with bone mineral density (BMD), but predict risk for future fracture independent of BMD. Only a few studies, however, have sought to identify specific genes influencing calcaneal QUS measures. The aim of this study was to conduct a genome-wide linkage scan to identify quantitative trait loci (QTL) influencing normal variation in QUS traits. QUS measures were collected from a total of 719 individuals (336 males and 383 females) from the Fels Longitudinal Study who have been genotyped and have at least one set of QUS measurements. Participants ranged in age from 18.0 to 96.6 years and were distributed across 110 nuclear and extended families. Using the Sahara ® bone sonometer, broadband ultrasound attenuation (BUA), speed of sound (SOS) and stiffness index (QUI) were collected from the right heel. Variance components based linkage analysis was performed on the three traits using 400 polymorphic short tandem repeat (STR) markers spaced approximately 10 cM apart across the autosomes to identify QTL influencing the QUS traits. Age, sex, and other significant covariates were simultaneously adjusted. Heritability estimates (h2) for the QUS traits ranged from 0.42 to 0.57. Significant evidence for a QTL influencing BUA was found on chromosome 11p15 near marker D11S902 (LOD = 3.11). Our results provide additional evidence for a QTL on chromosome 11p that harbors a potential candidate gene(s) related to BUA and bone metabolism. PMID:22237995

  18. USH1G with unique retinal findings caused by a novel truncating mutation identified by genome-wide linkage analysis

    PubMed Central

    Taibah, Khalid; Bin-Khamis, Ghada; Kennedy, Shelley; Hemidan, Amal; Al-Qahtani, Faisal; Tabbara, Khalid; Mubarak, Bashayer Al; Ramzan, Khushnooda; Meyer, Brian F.; Al-Owain, Mohammed

    2012-01-01

    Purpose Usher syndrome (USH) is an autosomal recessive disorder divided into three distinct clinical subtypes based on the severity of the hearing loss, manifestation of vestibular dysfunction, and the age of onset of retinitis pigmentosa and visual symptoms. To date, mutations in seven different genes have been reported to cause USH type 1 (USH1), the most severe form. Patients diagnosed with USH1 are known to be ideal candidates to benefit from cochlear implantation. Methods Genome-wide linkage analysis using Affymetrix GeneChip Human Mapping 10K arrays were performed in three cochlear implanted Saudi siblings born from a consanguineous marriage, clinically diagnosed with USH1 by comprehensive clinical, audiological, and ophthalmological examinations. From the linkage results, the USH1G gene was screened for mutations by direct sequencing of the coding exons. Results We report the identification of a novel p.S243X truncating mutation in USH1G that segregated with the disease phenotype and was not present in 300 ethnically matched normal controls. We also report on the novel retinal findings and the outcome of cochlear implantation in the affected individuals. Conclusions In addition to reporting a novel truncating mutation, this report expands the retinal phenotype in USH1G and presents the first report of successful cochlear implants in this disease. PMID:22876113

  19. SNP markers-based map construction and genome-wide linkage analysis in Brassica napus.

    PubMed

    Raman, Harsh; Dalton-Morgan, Jessica; Diffey, Simon; Raman, Rosy; Alamery, Salman; Edwards, David; Batley, Jacqueline

    2014-09-01

    An Illumina Infinium array comprising 5306 single nucleotide polymorphism (SNP) markers was used to genotype 175 individuals of a doubled haploid population derived from a cross between Skipton and Ag-Spectrum, two Australian cultivars of rapeseed (Brassica napus L.). A genetic linkage map based on 613 SNP and 228 non-SNP (DArT, SSR, SRAP and candidate gene markers) covering 2514.8 cM was constructed and further utilized to identify loci associated with flowering time and resistance to blackleg, a disease caused by the fungus Leptosphaeria maculans. Comparison between genetic map positions of SNP markers and the sequenced Brassica rapa (A) and Brassica oleracea (C) genome scaffolds showed several genomic rearrangements in the B. napus genome. A major locus controlling resistance to L. maculans was identified at both seedling and adult plant stages on chromosome A07. QTL analyses revealed that up to 40.2% of genetic variation for flowering time was accounted for by loci having quantitative effects. Comparative mapping showed Arabidopsis and Brassica flowering genes such as Phytochrome A/D, Flowering Locus C and agamous-Like MADS box gene AGL1 map within marker intervals associated with flowering time in a DH population from Skipton/Ag-Spectrum. Genomic regions associated with flowering time and resistance to L. maculans had several SNP markers mapped within 10 cM. Our results suggest that SNP markers will be suitable for various applications such as trait introgression, comparative mapping and high-resolution mapping of loci in B. napus.

  20. Stratification by CARD15 variant genotype in a genome-wide search for inflammatory bowel disease susceptibility loci.

    PubMed

    Shaw, Sarah H; Hampe, Jochen; White, Ray; Mathew, Christopher G; Curran, Mark E; Schreiber, Stefan

    2003-11-01

    Previously we have conducted a genome-wide search for inflammatory bowel disease susceptibility loci in a large European cohort. Results from this study demonstrated suggestive evidence of linkage to loci at chromosomes 1q, 6p, and 10p and replicated linkages on chromosomes 12 and 16. Recently, NOD2/CARD15 on chromosome 16q12 has been found to be strongly associated with Crohn's disease. In order to determine if there are other loci in the genome that interact with the three associated functional variants in CARD15 (R702W, G908R, 1007fs), we have stratified our large inflammatory bowel disease genome scan cohort by dividing pedigrees into two groups stratified by CARD15 variant genotype. The two pedigree groups were analysed using non-parametric allele sharing methods. The group of pedigrees that contained one of the three CARD15 variants had two suggestive linkage results occurring in 6p (lod = 3.06 at D6S197, IBD phenotype) and 10p (lod=2.29 at D10S197, CD phenotype). In addition, at 16q12 where CARD15 is located, the original genome scan had a peak lod score of 2.18 at D16S415 (CD phenotype). The stratified pedigree cohort containing one of three CARD15 variants had a peak lod score of 0.90 at D16S415 (CD phenotype), accounting for approximately less than half of the genetic evidence for linkage at this locus. This result is in agreement with the existence of a substantial number of private variants at the NOD2/CARD15 locus. Interaction with NOD2/CARD15 needs to be considered in future gene identification efforts on chromosomes 6 and 10.

  1. Genome-wide distribution of genetic diversity and linkage disequilibrium in a mass-selected population of maritime pine

    PubMed Central

    2014-01-01

    Background The accessibility of high-throughput genotyping technologies has contributed greatly to the development of genomic resources in non-model organisms. High-density genotyping arrays have only recently been developed for some economically important species such as conifers. The potential for using genomic technologies in association mapping and breeding depends largely on the genome wide patterns of diversity and linkage disequilibrium in current breeding populations. This study aims to deepen our knowledge regarding these issues in maritime pine, the first species used for reforestation in south western Europe. Results Using a new map merging algorithm, we first established a 1,712 cM composite linkage map (comprising 1,838 SNP markers in 12 linkage groups) by bringing together three already available genetic maps. Using rigorous statistical testing based on kernel density estimation and resampling we identified cold and hot spots of recombination. In parallel, 186 unrelated trees of a mass-selected population were genotyped using a 12k-SNP array. A total of 2,600 informative SNPs allowed to describe historical recombination, genetic diversity and genetic structure of this recently domesticated breeding pool that forms the basis of much of the current and future breeding of this species. We observe very low levels of population genetic structure and find no evidence that artificial selection has caused a reduction in genetic diversity. By combining these two pieces of information, we provided the map position of 1,671 SNPs corresponding to 1,192 different loci. This made it possible to analyze the spatial pattern of genetic diversity (H e ) and long distance linkage disequilibrium (LD) along the chromosomes. We found no particular pattern in the empirical variogram of H e across the 12 linkage groups and, as expected for an outcrossing species with large effective population size, we observed an almost complete lack of long distance LD. Conclusions These

  2. Population genomic structure and linkage disequilibrium analysis of South African goat breeds using genome-wide SNP data.

    PubMed

    Mdladla, K; Dzomba, E F; Huson, H J; Muchadeyi, F C

    2016-08-01

    The sustainability of goat farming in marginal areas of southern Africa depends on local breeds that are adapted to specific agro-ecological conditions. Unimproved non-descript goats are the main genetic resources used for the development of commercial meat-type breeds of South Africa. Little is known about genetic diversity and the genetics of adaptation of these indigenous goat populations. This study investigated the genetic diversity, population structure and breed relations, linkage disequilibrium, effective population size and persistence of gametic phase in goat populations of South Africa. Three locally developed meat-type breeds of the Boer (n = 33), Savanna (n = 31), Kalahari Red (n = 40), a feral breed of Tankwa (n = 25) and unimproved non-descript village ecotypes (n = 110) from four goat-producing provinces of the Eastern Cape, KwaZulu-Natal, Limpopo and North West were assessed using the Illumina Goat 50K SNP Bead Chip assay. The proportion of SNPs with minor allele frequencies >0.05 ranged from 84.22% in the Tankwa to 97.58% in the Xhosa ecotype, with a mean of 0.32 ± 0.13 across populations. Principal components analysis, admixture and pairwise FST identified Tankwa as a genetically distinct population and supported clustering of the populations according to their historical origins. Genome-wide FST identified 101 markers potentially under positive selection in the Tankwa. Average linkage disequilibrium was highest in the Tankwa (r(2)  = 0.25 ± 0.26) and lowest in the village ecotypes (r(2) range = 0.09 ± 0.12 to 0.11 ± 0.14). We observed an effective population size of <150 for all populations 13 generations ago. The estimated correlations for all breed pairs were lower than 0.80 at marker distances >100 kb with the exception of those in Savanna and Tswana populations. This study highlights the high level of genetic diversity in South African indigenous goats as well as the utility of the genome-wide SNP marker panels in

  3. Population genomic structure and linkage disequilibrium analysis of South African goat breeds using genome-wide SNP data.

    PubMed

    Mdladla, K; Dzomba, E F; Huson, H J; Muchadeyi, F C

    2016-08-01

    The sustainability of goat farming in marginal areas of southern Africa depends on local breeds that are adapted to specific agro-ecological conditions. Unimproved non-descript goats are the main genetic resources used for the development of commercial meat-type breeds of South Africa. Little is known about genetic diversity and the genetics of adaptation of these indigenous goat populations. This study investigated the genetic diversity, population structure and breed relations, linkage disequilibrium, effective population size and persistence of gametic phase in goat populations of South Africa. Three locally developed meat-type breeds of the Boer (n = 33), Savanna (n = 31), Kalahari Red (n = 40), a feral breed of Tankwa (n = 25) and unimproved non-descript village ecotypes (n = 110) from four goat-producing provinces of the Eastern Cape, KwaZulu-Natal, Limpopo and North West were assessed using the Illumina Goat 50K SNP Bead Chip assay. The proportion of SNPs with minor allele frequencies >0.05 ranged from 84.22% in the Tankwa to 97.58% in the Xhosa ecotype, with a mean of 0.32 ± 0.13 across populations. Principal components analysis, admixture and pairwise FST identified Tankwa as a genetically distinct population and supported clustering of the populations according to their historical origins. Genome-wide FST identified 101 markers potentially under positive selection in the Tankwa. Average linkage disequilibrium was highest in the Tankwa (r(2)  = 0.25 ± 0.26) and lowest in the village ecotypes (r(2) range = 0.09 ± 0.12 to 0.11 ± 0.14). We observed an effective population size of <150 for all populations 13 generations ago. The estimated correlations for all breed pairs were lower than 0.80 at marker distances >100 kb with the exception of those in Savanna and Tswana populations. This study highlights the high level of genetic diversity in South African indigenous goats as well as the utility of the genome-wide SNP marker panels in

  4. Exhaustive Genome-Wide Search for SNP-SNP Interactions Across 10 Human Diseases

    PubMed Central

    Murk, William; DeWan, Andrew T.

    2016-01-01

    The identification of statistical SNP-SNP interactions may help explain the genetic etiology of many human diseases, but exhaustive genome-wide searches for these interactions have been difficult, due to a lack of power in most datasets. We aimed to use data from the Resource for Genetic Epidemiology Research on Adult Health and Aging (GERA) study to search for SNP-SNP interactions associated with 10 common diseases. FastEpistasis and BOOST were used to evaluate all pairwise interactions among approximately N = 300,000 single nucleotide polymorphisms (SNPs) with minor allele frequency (MAF) ≥ 0.15, for the dichotomous outcomes of allergic rhinitis, asthma, cardiac disease, depression, dermatophytosis, type 2 diabetes, dyslipidemia, hemorrhoids, hypertensive disease, and osteoarthritis. A total of N = 45,171 subjects were included after quality control steps were applied. These data were divided into discovery and replication subsets; the discovery subset had > 80% power, under selected models, to detect genome-wide significant interactions (P < 10−12). Interactions were also evaluated for enrichment in particular SNP features, including functionality, prior disease relevancy, and marginal effects. No interaction in any disease was significant in both the discovery and replication subsets. Enrichment analysis suggested that, for some outcomes, interactions involving SNPs with marginal effects were more likely to be nominally replicated, compared to interactions without marginal effects. If SNP-SNP interactions play a role in the etiology of the studied conditions, they likely have weak effect sizes, involve lower-frequency variants, and/or involve complex models of interaction that are not captured well by the methods that were utilized. PMID:27185397

  5. Exhaustive Genome-Wide Search for SNP-SNP Interactions Across 10 Human Diseases.

    PubMed

    Murk, William; DeWan, Andrew T

    2016-01-01

    The identification of statistical SNP-SNP interactions may help explain the genetic etiology of many human diseases, but exhaustive genome-wide searches for these interactions have been difficult, due to a lack of power in most datasets. We aimed to use data from the Resource for Genetic Epidemiology Research on Adult Health and Aging (GERA) study to search for SNP-SNP interactions associated with 10 common diseases. FastEpistasis and BOOST were used to evaluate all pairwise interactions among approximately N = 300,000 single nucleotide polymorphisms (SNPs) with minor allele frequency (MAF) ≥ 0.15, for the dichotomous outcomes of allergic rhinitis, asthma, cardiac disease, depression, dermatophytosis, type 2 diabetes, dyslipidemia, hemorrhoids, hypertensive disease, and osteoarthritis. A total of N = 45,171 subjects were included after quality control steps were applied. These data were divided into discovery and replication subsets; the discovery subset had > 80% power, under selected models, to detect genome-wide significant interactions (P < 10(-12)). Interactions were also evaluated for enrichment in particular SNP features, including functionality, prior disease relevancy, and marginal effects. No interaction in any disease was significant in both the discovery and replication subsets. Enrichment analysis suggested that, for some outcomes, interactions involving SNPs with marginal effects were more likely to be nominally replicated, compared to interactions without marginal effects. If SNP-SNP interactions play a role in the etiology of the studied conditions, they likely have weak effect sizes, involve lower-frequency variants, and/or involve complex models of interaction that are not captured well by the methods that were utilized.

  6. Exhaustive Genome-Wide Search for SNP-SNP Interactions Across 10 Human Diseases.

    PubMed

    Murk, William; DeWan, Andrew T

    2016-01-01

    The identification of statistical SNP-SNP interactions may help explain the genetic etiology of many human diseases, but exhaustive genome-wide searches for these interactions have been difficult, due to a lack of power in most datasets. We aimed to use data from the Resource for Genetic Epidemiology Research on Adult Health and Aging (GERA) study to search for SNP-SNP interactions associated with 10 common diseases. FastEpistasis and BOOST were used to evaluate all pairwise interactions among approximately N = 300,000 single nucleotide polymorphisms (SNPs) with minor allele frequency (MAF) ≥ 0.15, for the dichotomous outcomes of allergic rhinitis, asthma, cardiac disease, depression, dermatophytosis, type 2 diabetes, dyslipidemia, hemorrhoids, hypertensive disease, and osteoarthritis. A total of N = 45,171 subjects were included after quality control steps were applied. These data were divided into discovery and replication subsets; the discovery subset had > 80% power, under selected models, to detect genome-wide significant interactions (P < 10(-12)). Interactions were also evaluated for enrichment in particular SNP features, including functionality, prior disease relevancy, and marginal effects. No interaction in any disease was significant in both the discovery and replication subsets. Enrichment analysis suggested that, for some outcomes, interactions involving SNPs with marginal effects were more likely to be nominally replicated, compared to interactions without marginal effects. If SNP-SNP interactions play a role in the etiology of the studied conditions, they likely have weak effect sizes, involve lower-frequency variants, and/or involve complex models of interaction that are not captured well by the methods that were utilized. PMID:27185397

  7. Identifying Loci for the Overlap between Attention-Deficit/Hyperactivity Disorder and Autism Spectrum Disorder Using a Genome-Wide QTL Linkage Approach

    ERIC Educational Resources Information Center

    Nijmeijer, Judith S.; Arias-Vasquez, Alejandro; Rommelse, Nanda N. J.; Altink, Marieke E.; Anney, Richard J. L.; Asherson, Philip; Banaschewski, Tobias; Buschgens, Cathelijne J. M.; Fliers, Ellen A.; Gill, Michael; Minderaa, Ruud B.; Poustka, Luise; Sergeant, Joseph A.; Buitelaar, Jan K.; Franke, Barbara; Ebstein, Richard P.; Miranda, Ana; Mulas, Fernando; Oades, Robert D.; Roeyers, Herbert; Rothenberger, Aribert; Sonuga-Barke, Edmund J. S.; Steinhausen, Hans-Christoph; Faraone, Stephen V.; Hartman, Catharina A.; Hoekstra, Pieter J.

    2010-01-01

    Objective: The genetic basis for autism spectrum disorder (ASD) symptoms in children with attention-deficit/hyperactivity disorder (ADHD) was addressed using a genome-wide linkage approach. Method: Participants of the International Multi-Center ADHD Genetics study comprising 1,143 probands with ADHD and 1,453 siblings were analyzed. The total and…

  8. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  9. A genome-wide set of SNPs detects population substructure and long range linkage disequilibrium in wild sheep.

    PubMed

    Miller, J M; Poissant, J; Kijas, J W; Coltman, D W

    2011-03-01

    The development of genomic resources for wild species is still in its infancy. However, cross-species utilization of technologies developed for their domestic counterparts has the potential to unlock the genomes of organisms that currently lack genomic resources. Here, we apply the OvineSNP50 BeadChip, developed for domestic sheep, to two related wild ungulate species: the bighorn sheep (Ovis canadensis) and the thinhorn sheep (Ovis dalli). Over 95% of the domestic sheep markers were successfully genotyped in a sample of fifty-two bighorn sheep while over 90% were genotyped in two thinhorn sheep. Pooling the results from both species identified 868 single-nucleotide polymorphisms (SNPs), 570 were detected in bighorn sheep, while 330 SNPs were identified in thinhorn sheep. The total panel of SNPs was able to discriminate between the two species, assign population of origin for bighorn sheep and detect known relationship classes within one population of bighorn sheep. Using an informative subset of these SNPs (n=308), we examined the extent of genome-wide linkage disequilibrium (LD) within one population of bighorn sheep and found that high levels of LD persist over 4 Mb.

  10. Information content in genome-wide scans: concordance between patterns of genetic differentiation and linkage mapping associations

    PubMed Central

    2011-01-01

    Background Scanning the genome with high density SNP markers has become a standard approach for identifying regions of the genome showing substantial between-population genetic differentiation, and thus evidence of diversifying selection. Such regions may contain genes of large phenotypic effect. However, few studies have attempted to address the power or efficacy of such an approach. Results In this study, the patterns of allele frequency differences between two cattle breeds based on the Bovine HapMap study were compared with statistical evidence for QTL based on a linkage mapping study of an experimental population formed by a cross between the same breeds. Concordance between the two datasets was seen for chromosomes carrying QTL with strong statistical support, such as BTA5 and BTA18, which carry genes associated with coat color. For these chromosomes, there was a correspondence between the strength of the QTL signal along the chromosome and the degree of genetic differentiation between breeds. However, such an association was not seen in a broader comparison that also included chromosomes carrying QTL with lower significance levels. In addition, other chromosomal regions with substantial QTL effects did not include markers showing extreme between-breed genetic differentiation. Furthermore, the overall consistency between the two studies was weak, with low genome-wide correlation between the statistical values obtained in the linkage mapping study and between-breed genetic differentiation from the HapMap study. Conclusions These results suggest that genomic diversity scans are capable of detecting regions associated with qualitative traits but may be limited in their power to detect regions associated with quantitative phenotypic differences between populations, which may depend on the marker resolution of the study and the level of LD in the populations under investigation. PMID:21269469

  11. Genome-wide linkage analysis of congenital heart defects using MOD score analysis identifies two novel loci

    PubMed Central

    2013-01-01

    Background Congenital heart defects (CHD) is the most common cause of death from a congenital structure abnormality in newborns and is often associated with fetal loss. There are many types of CHD. Human genetic studies have identified genes that are responsible for the inheritance of a particular type of CHD and for some types of CHD previously thought to be sporadic. However, occasionally different members of the same family might have anatomically distinct defects — for instance, one member with atrial septal defect, one with tetralogy of Fallot, and one with ventricular septal defect. Our objective is to identify susceptibility loci for CHD in families affected by distinct defects. The occurrence of these apparently discordant clinical phenotypes within one family might hint at a genetic framework common to most types of CHD. Results We performed a genome-wide linkage analysis using MOD score analysis in families with diverse CHD. Significant linkage was obtained in two regions, at chromosome 15 (15q26.3, Pempirical = 0.0004) and at chromosome 18 (18q21.2, Pempirical = 0.0005). Conclusions In these two novel regions four candidate genes are located: SELS, SNRPA1, and PCSK6 on 15q26.3, and TCF4 on 18q21.2. The new loci reported here have not previously been described in connection with CHD. Although further studies in other cohorts are needed to confirm these findings, the results presented here together with recent insight into how the heart normally develops will improve the understanding of CHD. PMID:23705960

  12. Genome-wide linkage scan and association study of PARL to the expression of LHON families in Thailand.

    PubMed

    Phasukkijwatana, Nopasak; Kunhapan, Bussaraporn; Stankovich, Jim; Chuenkongkaew, Wanicha L; Thomson, Russell; Thornton, Timothy; Bahlo, Melanie; Mushiroda, Taisei; Nakamura, Yusuke; Mahasirimongkol, Surakameth; Tun, Aung Win; Srisawat, Chatchawan; Limwongse, Chanin; Peerapittayamongkol, Chayanon; Sura, Thanyachai; Suthammarak, Wichit; Lertrit, Patcharee

    2010-07-01

    Leber hereditary optic neuropathy (LHON) is the most common mitochondrially inherited disease causing blindness, preferentially in young adult males. Most of the patients carry the G11778A mitochondrial DNA (mtDNA) mutation. However, the marked incomplete penetrance and the gender bias indicate some additional genetic and/or environmental factors to disease expression. Herein, we first conducted a genome-wide linkage scan with 400 microsatellite markers in 9 large Thai LHON G11778A pedigrees. Using an affecteds-only nonparametric linkage analysis, 4 regions on chromosomes 3, 12, 13 and 18 showed Zlr scores greater than 2 (P < 0.025), which is consistently significant across several linkage statistics. The most suggestive marker D3S1565 (Zlr > 2 in 10 of 16 allele sharing models tested) was then expanded to include the region 3q26.2-3q28 covering SLC7A14 (3q26.2), MFN1 (3q26.32), MRPL47 (3q26.33), MCCC1 (3q27.1), PARL (3q27.1) and OPA1 (3q28-q29). All of these candidate genes were selected from the Maestro database and had known to be localized in mitochondria. Sixty tag SNPs were genotyped in 86 cases, 211 of their relatives and 32 unrelated Thai controls, by multiplex-PCR-based Invader assay. Analyses using a powerful association testing tool that adjusts for relatedness (the M(QLS) statistic) showed the most evidence of association between two SNPs, rs3749446 and rs1402000 (located in PARL presenilins-associated rhomboid-like) and LHON expression (both P = 8.8 x 10(-5)). The mitochondrial PARL protease has been recently known to play a role with a dynamin-related OPA1 protein in preventing apoptotic events by slowing down the release of cytochrome c out of mitochondrial cristae junctions. Moreover, PARL is required to activate the intramembranous proteolyses resulting in the degradation of an accumulated pro-apoptotic protein in the outer mitochondrial membrane. Under these circumstances, variants of PARL are suggested to influence cell death by apoptosis which

  13. Genetic Diversity, Linkage Disequilibrium and Selection Signatures in Chinese and Western Pigs Revealed by Genome-Wide SNP Markers

    PubMed Central

    Ai, Huashui; Huang, Lusheng; Ren, Jun

    2013-01-01

    To investigate population structure, linkage disequilibrium (LD) pattern and selection signature at the genome level in Chinese and Western pigs, we genotyped 304 unrelated animals from 18 diverse populations using porcine 60 K SNP chips. We confirmed the divergent evolution between Chinese and Western pigs and showed distinct topological structures of the tested populations. We acquired the evidence for the introgression of Western pigs into two Chinese pig breeds. Analysis of runs of homozygosity revealed that historical inbreeding reduced genetic variability in several Chinese breeds. We found that intrapopulation LD extents are roughly comparable between Chinese and Western pigs. However, interpopulation LD is much longer in Western pigs compared with Chinese pigs with average r20.3 values of 125 kb for Western pigs and only 10.5 kb for Chinese pigs. The finding indicates that higher-density markers are required to capture LD with causal variants in genome-wide association studies and genomic selection on Chinese pigs. Further, we looked across the genome to identify candidate loci under selection using FST outlier tests on two contrast samples: Tibetan pigs versus lowland pigs and belted pigs against non-belted pigs. Interestingly, we highlighted several genes including ADAMTS12, SIM1 and NOS1 that show signatures of natural selection in Tibetan pigs and are likely important for genetic adaptation to high altitude. Comparison of our findings with previous reports indicates that the underlying genetic basis for high-altitude adaptation in Tibetan pigs, Tibetan peoples and yaks is likely distinct from one another. Moreover, we identified the strongest signal of directional selection at the EDNRB loci in Chinese belted pigs, supporting EDNRB as a promising candidate gene for the white belt coat color in Chinese pigs. Altogether, our findings advance the understanding of the genome biology of Chinese and Western pigs. PMID:23409110

  14. Population structure and linkage disequilibrium in oat (Avena sativa L.): implications for genome-wide association studies.

    PubMed

    Newell, M A; Cook, D; Tinker, N A; Jannink, J-L

    2011-02-01

    The level of population structure and the extent of linkage disequilibrium (LD) can have large impacts on the power, resolution, and design of genome-wide association studies (GWAS) in plants. Until recently, the topics of LD and population structure have not been explored in oat due to the lack of a high-throughput, high-density marker system. The objectives of this research were to survey the level of population structure and the extent of LD in oat germplasm and determine their implications for GWAS. In total, 1,205 lines and 402 diversity array technology (DArT) markers were used to explore population structure. Principal component analysis and model-based cluster analysis of these data indicated that, for the lines used in this study, relatively weak population structure exists. To explore LD decay, map distances of 2,225 linked DArT marker pairs were compared with LD (estimated as r²). Results showed that LD between linked markers decayed rapidly to r² = 0.2 for marker pairs with a map distance of 1.0 centi-Morgan (cM). For GWAS, we suggest a minimum of one marker every cM, but higher densities of markers should increase marker-QTL association and therefore detection power. Additionally, it was found that LD was relatively consistent across the majority of germplasm clusters. These findings suggest that GWAS in oat can include germplasm with diverse origins and backgrounds. The results from this research demonstrate the feasibility of GWAS and related analyses in oat.

  15. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding.

  16. Genome-wide search for asthma susceptibility loci in a founder population. The Collaborative Study on the Genetics of Asthma.

    PubMed

    Ober, C; Cox, N J; Abney, M; Di Rienzo, A; Lander, E S; Changyaleket, B; Gidley, H; Kurtz, B; Lee, J; Nance, M; Pettersson, A; Prescott, J; Richardson, A; Schlenker, E; Summerhill, E; Willadsen, S; Parry, R

    1998-09-01

    Founder populations offer many advantages for mapping genetic traits, particularly complex traits that are likely to be genetically heterogeneous. To identify genes that influence asthma and asthma-associated phenotypes, we conducted a genome-wide screen in the Hutterites, a religious isolate of European ancestry. A primary sample of 361 individuals and a replication sample of 292 individuals were evaluated for asthma phenotypes according to a standardized protocol. A genome-wide screen has been completed using 292 autosomal and three X-Y pseudoautosomal markers. Using the semi-parametric likelihood ratio chi2 test and the transmission-disequilibrium test, we identified 12 markers in 10 regions that showed possible linkage to asthma or an associated phenotype (likelihood ratio P < 0.01). Markers in four regions (5q23-31, 12q15-24.1, 19q13 and 21q21) showed possible linkage in both the primary and replication samples and have also shown linkage to asthma phenotypes in other samples; two adjacent markers in one additional region (3p24.2-22) showing possible linkage is reported for the first time in the Hutterites. The results suggest that even in founder populations with a relatively small number of independent genomes, susceptibility alleles at many loci may influence asthma phenotypes and that these susceptibility alleles are likely to be common polymorphisms in the population. PMID:9700192

  17. Program update and novel use of the DESPAIR program to design a genome-wide linkage study using relative pairs.

    PubMed

    Ochs-Balcom, Heather M; Guo, Xiuqing; Yonebayashi, Takashi; Wiesner, Georgia; Elston, Robert C

    2010-01-01

    DESPAIR (DESign for PAIRs) is a computer program useful for designing a two-stage linkage study using relative pairs for a dichotomous phenotype. It determines the optimal two-stage study design - i.e., for specified power and significance level, how many pairs of relatives should be studied, how many equally spaced markers should be used initially, and what criterion should be used to specify the markers around which further searching should be done at a second stage. The program will calculate either the number of relative pairs required for a given number of first-stage markers or the number of markers required for a given number of relative pairs. We highlight the use of the latest version of DESPAIR to decide to what extent additional fine mapping in a candidate region of interest can lead to an increase in power in a previous linkage study sample. We also discuss new features of the program, such as the mean difference test for affected and discordant relative pairs and estimation of full sibling pair equivalents to design a study when several types of relative pairs are available. DESPAIR is part of the S.A.G.E. program package and is freely available for use online.

  18. A genome-wide linkage scan of bipolar disorder in Latino families identifies susceptibility loci at 8q24 and 14q32.

    PubMed

    Gonzalez, Suzanne; Camarillo, Cynthia; Rodriguez, Marco; Ramirez, Mercedes; Zavala, Juan; Armas, Regina; Contreras, Salvador A; Contreras, Javier; Dassori, Albana; Almasy, Laura; Flores, Deborah; Jerez, Alvaro; Raventós, Henriette; Ontiveros, Alfonso; Nicolini, Humberto; Escamilla, Michael

    2014-09-01

    A genome-wide nonparametric linkage screen was performed to localize Bipolar Disorder (BP) susceptibility loci in a sample of 3757 individuals of Latino ancestry. The sample included 963 individuals with BP phenotype (704 relative pairs) from 686 families recruited from the US, Mexico, Costa Rica, and Guatemala. Non-parametric analyses were performed over a 5 cM grid with an average genetic coverage of 0.67 cM. Multipoint analyses were conducted across the genome using non-parametric Kong & Cox LOD scores along with Sall statistics for all relative pairs. Suggestive and significant genome-wide thresholds were calculated based on 1000 simulations. Single-marker association tests in the presence of linkage were performed assuming a multiplicative model with a population prevalence of 2%. We identified two genome-wide significant susceptibly loci for BP at 8q24 and 14q32, and a third suggestive locus at 2q13-q14. Within these three linkage regions, the top associated single marker (rs1847694, P = 2.40 × 10(-5)) is located 195 Kb upstream of DPP10 in Chromosome 2. DPP10 is prominently expressed in brain neuronal populations, where it has been shown to bind and regulate Kv4-mediated A-type potassium channels. Taken together, these results provide additional evidence that 8q24, 14q32, and 2q13-q14 are susceptibly loci for BP and these regions may be involved in the pathogenesis of BP in the Latino population. PMID:25044503

  19. Genome-wide association and linkage identify modifier loci of lung disease severity in cystic fibrosis at 11p13 and 20q13.2

    PubMed Central

    Wright, Fred A.; Strug, Lisa J.; Doshi, Vishal K.; Commander, Clayton W.; Blackman, Scott M.; Sun, Lei; Berthiaume, Yves; Cutler, David; Cojocaru, Andreea; Collaco, J. Michael; Corey, Mary; Dorfman, Ruslan; Goddard, Katrina; Green, Deanna; Kent, Jack W.; Lange, Ethan M.; Lee, Seunggeun; Li, Weili; Luo, Jingchun; Mayhew, Gregory M.; Naughton, Kathleen M.; Pace, Rhonda G.; Paré, Peter; Rommens, Johanna M.; Sandford, Andrew; Stonebraker, Jaclyn R.; Sun, Wei; Taylor, Chelsea; Vanscoy, Lori L.; Zou, Fei; Blangero, John; Zielenski, Julian; O’Neal, Wanda K.; Drumm, Mitchell L.; Durie, Peter R.; Knowles, Michael R.; Cutting, Garry R.

    2012-01-01

    A combined genome-wide association and linkage study was used to identify loci causing variation in CF lung disease severity. A significant association (P=3. 34 × 10-8) near EHF and APIP (chr11p13) was identified in F508del homozygotes (n=1,978). The association replicated in F508del homozygotes (P=0.006) from a separate family-based study (n=557), with P=1.49 × 10-9 for the three-study joint meta-analysis. Linkage analysis of 486 sibling pairs from the family-based study identified a significant QTL on chromosome 20q13.2 (LOD=5.03). Our findings provide insight into the causes of variation in lung disease severity in CF and suggest new therapeutic targets for this life-limiting disorder. PMID:21602797

  20. A genome-wide linkage scan for diabetic retinopathy susceptibility genes in Mexican Americans with type 2 diabetes from Starr County, Texas.

    PubMed

    Hallman, D Michael; Boerwinkle, Eric; Gonzalez, Victor H; Klein, Barbara E K; Klein, Ronald; Hanis, Craig L

    2007-04-01

    We conducted a genome-wide linkage scan for genes contributing to retinopathy risk using 794 diabetes case subjects from 393 Mexican-American families from Starr County, Texas, having at least two diabetic siblings. The sample included 567 retinopathy case subjects comprising 282 affected sibling pairs. Retinopathy was classified as none, early nonproliferative, moderate-to-severe nonproliferative, or proliferative. Using 360 polymorphic markers (average spacing 9.4 cM), we conducted nonparametric linkage analysis followed by ordered-subset analysis (OSA) ranking families by average age of diabetes diagnosis. For any retinopathy, the highest LOD scores including all families were on chromosomes 3 (2.41 at 117 cM) and 12 (2.47 at 15.5). OSA logarithm of odds (LOD) scores >2 for any retinopathy occurred on chromosomes 12 (4.47 at 13.2 cM), 15 (3.65 at 100.6), and 20 (2.67 at 54.1). Scores >2 for either moderate-to-severe nonproliferative or proliferative retinopathy occurred on chromosomes 5 (2.53 at 11.2 cM), 6 (2.28 at 30.6), and 19 (2.21 at 100.6). Thus, unconditional linkage analysis revealed suggestive evidence of linkage with retinopathy on two chromosomes, whereas OSA revealed strong evidence of linkage on two chromosomes, and suggestive evidence on four. Candidate genes were identified in most implicated regions. PMID:17251272

  1. A genome-wide association search for type 2 diabetes genes in African Americans.

    PubMed

    Palmer, Nicholette D; McDonough, Caitrin W; Hicks, Pamela J; Roh, Bong H; Wing, Maria R; An, S Sandy; Hester, Jessica M; Cooke, Jessica N; Bostrom, Meredith A; Rudock, Megan E; Talbert, Matthew E; Lewis, Joshua P; Ferrara, Assiamira; Lu, Lingyi; Ziegler, Julie T; Sale, Michele M; Divers, Jasmin; Shriner, Daniel; Adeyemo, Adebowale; Rotimi, Charles N; Ng, Maggie C Y; Langefeld, Carl D; Freedman, Barry I; Bowden, Donald W; Voight, Benjamin F; Scott, Laura J; Steinthorsdottir, Valgerdur; Morris, Andrew P; Dina, Christian; Welch, Ryan P; Zeggini, Eleftheria; Huth, Cornelia; Aulchenko, Yurii S; Thorleifsson, Gudmar; McCulloch, Laura J; Ferreira, Teresa; Grallert, Harald; Amin, Najaf; Wu, Guanming; Willer, Cristen J; Raychaudhuri, Soumya; McCarroll, Steve A; Langenberg, Claudia; Hofmann, Oliver M; Dupuis, Josée; Qi, Lu; Segrè, Ayellet V; van Hoek, Mandy; Navarro, Pau; Ardlie, Kristin; Balkau, Beverley; Benediktsson, Rafn; Bennett, Amanda J; Blagieva, Roza; Boerwinkle, Eric; Bonnycastle, Lori L; Boström, Kristina Bengtsson; Bravenboer, Bert; Bumpstead, Suzannah; Burtt, Noël P; Charpentier, Guillaume; Chines, Peter S; Cornelis, Marilyn; Couper, David J; Crawford, Gabe; Doney, Alex S F; Elliott, Katherine S; Elliott, Amanda L; Erdos, Michael R; Fox, Caroline S; Franklin, Christopher S; Ganser, Martha; Gieger, Christian; Grarup, Niels; Green, Todd; Griffin, Simon; Groves, Christopher J; Guiducci, Candace; Hadjadj, Samy; Hassanali, Neelam; Herder, Christian; Isomaa, Bo; Jackson, Anne U; Johnson, Paul R V; Jørgensen, Torben; Kao, Wen H L; Klopp, Norman; Kong, Augustine; Kraft, Peter; Kuusisto, Johanna; Lauritzen, Torsten; Li, Man; Lieverse, Aloysius; Lindgren, Cecilia M; Lyssenko, Valeriya; Marre, Michel; Meitinger, Thomas; Midthjell, Kristian; Morken, Mario A; Narisu, Narisu; Nilsson, Peter; Owen, Katharine R; Payne, Felicity; Perry, John R B; Petersen, Ann-Kristin; Platou, Carl; Proença, Christine; Prokopenko, Inga; Rathmann, Wolfgang; Rayner, N William; Robertson, Neil R; Rocheleau, Ghislain; Roden, Michael; Sampson, Michael J; Saxena, Richa; Shields, Beverley M; Shrader, Peter; Sigurdsson, Gunnar; Sparsø, Thomas; Strassburger, Klaus; Stringham, Heather M; Sun, Qi; Swift, Amy J; Thorand, Barbara; Tichet, Jean; Tuomi, Tiinamaija; van Dam, Rob M; van Haeften, Timon W; van Herpt, Thijs; van Vliet-Ostaptchouk, Jana V; Walters, G Bragi; Weedon, Michael N; Wijmenga, Cisca; Witteman, Jacqueline; Bergman, Richard N; Cauchi, Stephane; Collins, Francis S; Gloyn, Anna L; Gyllensten, Ulf; Hansen, Torben; Hide, Winston A; Hitman, Graham A; Hofman, Albert; Hunter, David J; Hveem, Kristian; Laakso, Markku; Mohlke, Karen L; Morris, Andrew D; Palmer, Colin N A; Pramstaller, Peter P; Rudan, Igor; Sijbrands, Eric; Stein, Lincoln D; Tuomilehto, Jaakko; Uitterlinden, Andre; Walker, Mark; Wareham, Nicholas J; Watanabe, Richard M; Abecasis, Goncalo R; Boehm, Bernhard O; Campbell, Harry; Daly, Mark J; Hattersley, Andrew T; Hu, Frank B; Meigs, James B; Pankow, James S; Pedersen, Oluf; Wichmann, H-Erich; Barroso, Inês; Florez, Jose C; Frayling, Timothy M; Groop, Leif; Sladek, Rob; Thorsteinsdottir, Unnur; Wilson, James F; Illig, Thomas; Froguel, Philippe; van Duijn, Cornelia M; Stefansson, Kari; Altshuler, David; Boehnke, Michael; McCarthy, Mark I; Soranzo, Nicole; Wheeler, Eleanor; Glazer, Nicole L; Bouatia-Naji, Nabila; Mägi, Reedik; Randall, Joshua; Johnson, Toby; Elliott, Paul; Rybin, Denis; Henneman, Peter; Dehghan, Abbas; Hottenga, Jouke Jan; Song, Kijoung; Goel, Anuj; Egan, Josephine M; Lajunen, Taina; Doney, Alex; Kanoni, Stavroula; Cavalcanti-Proença, Christine; Kumari, Meena; Timpson, Nicholas J; Zabena, Carina; Ingelsson, Erik; An, Ping; O'Connell, Jeffrey; Luan, Jian'an; Elliott, Amanda; McCarroll, Steven A; Roccasecca, Rosa Maria; Pattou, François; Sethupathy, Praveen; Ariyurek, Yavuz; Barter, Philip; Beilby, John P; Ben-Shlomo, Yoav; Bergmann, Sven; Bochud, Murielle; Bonnefond, Amélie; Borch-Johnsen, Knut; Böttcher, Yvonne; Brunner, Eric; Bumpstead, Suzannah J; Chen, Yii-Der Ida; Chines, Peter; Clarke, Robert; Coin, Lachlan J M; Cooper, Matthew N; Crisponi, Laura; Day, Ian N M; de Geus, Eco J C; Delplanque, Jerome; Fedson, Annette C; Fischer-Rosinsky, Antje; Forouhi, Nita G; Frants, Rune; Franzosi, Maria Grazia; Galan, Pilar; Goodarzi, Mark O; Graessler, Jürgen; Grundy, Scott; Gwilliam, Rhian; Hallmans, Göran; Hammond, Naomi; Han, Xijing; Hartikainen, Anna-Liisa; Hayward, Caroline; Heath, Simon C; Hercberg, Serge; Hicks, Andrew A; Hillman, David R; Hingorani, Aroon D; Hui, Jennie; Hung, Joe; Jula, Antti; Kaakinen, Marika; Kaprio, Jaakko; Kesaniemi, Y Antero; Kivimaki, Mika; Knight, Beatrice; Koskinen, Seppo; Kovacs, Peter; Kyvik, Kirsten Ohm; Lathrop, G Mark; Lawlor, Debbie A; Le Bacquer, Olivier; Lecoeur, Cécile; Li, Yun; Mahley, Robert; Mangino, Massimo; Manning, Alisa K; Martínez-Larrad, María Teresa; McAteer, Jarred B; McPherson, Ruth; Meisinger, Christa; Melzer, David; Meyre, David; Mitchell, Braxton D; Mukherjee, Sutapa; Naitza, Silvia; Neville, Matthew J; Oostra, Ben A; Orrù, Marco; Pakyz, Ruth; Paolisso, Giuseppe; Pattaro, Cristian; Pearson, Daniel; Peden, John F; Pedersen, Nancy L; Perola, Markus; Pfeiffer, Andreas F H; Pichler, Irene; Polasek, Ozren; Posthuma, Danielle; Potter, Simon C; Pouta, Anneli; Province, Michael A; Psaty, Bruce M; Rayner, Nigel W; Rice, Kenneth; Ripatti, Samuli; Rivadeneira, Fernando; Rolandsson, Olov; Sandbaek, Annelli; Sandhu, Manjinder; Sanna, Serena; Sayer, Avan Aihie; Scheet, Paul; Seedorf, Udo; Sharp, Stephen J; Shields, Beverley; Sijbrands, Eric J G; Silveira, Angela; Simpson, Laila; Singleton, Andrew; Smith, Nicholas L; Sovio, Ulla; Swift, Amy; Syddall, Holly; Syvänen, Ann-Christine; Tanaka, Toshiko; Tönjes, Anke; Uitterlinden, André G; van Dijk, Ko Willems; Varma, Dhiraj; Visvikis-Siest, Sophie; Vitart, Veronique; Vogelzangs, Nicole; Waeber, Gérard; Wagner, Peter J; Walley, Andrew; Ward, Kim L; Watkins, Hugh; Wild, Sarah H; Willemsen, Gonneke; Witteman, Jaqueline C M; Yarnell, John W G; Zelenika, Diana; Zethelius, Björn; Zhai, Guangju; Zhao, Jing Hua; Zillikens, M Carola; Borecki, Ingrid B; Loos, Ruth J F; Meneton, Pierre; Magnusson, Patrik K E; Nathan, David M; Williams, Gordon H; Silander, Kaisa; Salomaa, Veikko; Smith, George Davey; Bornstein, Stefan R; Schwarz, Peter; Spranger, Joachim; Karpe, Fredrik; Shuldiner, Alan R; Cooper, Cyrus; Dedoussis, George V; Serrano-Ríos, Manuel; Lind, Lars; Palmer, Lyle J; Franks, Paul W; Ebrahim, Shah; Marmot, Michael; Kao, W H Linda; Pramstaller, Peter Paul; Wright, Alan F; Stumvoll, Michael; Hamsten, Anders; Buchanan, Thomas A; Valle, Timo T; Rotter, Jerome I; Siscovick, David S; Penninx, Brenda W J H; Boomsma, Dorret I; Deloukas, Panos; Spector, Timothy D; Ferrucci, Luigi; Cao, Antonio; Scuteri, Angelo; Schlessinger, David; Uda, Manuela; Ruokonen, Aimo; Jarvelin, Marjo-Riitta; Waterworth, Dawn M; Vollenweider, Peter; Peltonen, Leena; Mooser, Vincent; Sladek, Robert

    2012-01-01

    African Americans are disproportionately affected by type 2 diabetes (T2DM) yet few studies have examined T2DM using genome-wide association approaches in this ethnicity. The aim of this study was to identify genes associated with T2DM in the African American population. We performed a Genome Wide Association Study (GWAS) using the Affymetrix 6.0 array in 965 African-American cases with T2DM and end-stage renal disease (T2DM-ESRD) and 1029 population-based controls. The most significant SNPs (n = 550 independent loci) were genotyped in a replication cohort and 122 SNPs (n = 98 independent loci) were further tested through genotyping three additional validation cohorts followed by meta-analysis in all five cohorts totaling 3,132 cases and 3,317 controls. Twelve SNPs had evidence of association in the GWAS (P<0.0071), were directionally consistent in the Replication cohort and were associated with T2DM in subjects without nephropathy (P<0.05). Meta-analysis in all cases and controls revealed a single SNP reaching genome-wide significance (P<2.5×10(-8)). SNP rs7560163 (P = 7.0×10(-9), OR (95% CI) = 0.75 (0.67-0.84)) is located intergenically between RND3 and RBM43. Four additional loci (rs7542900, rs4659485, rs2722769 and rs7107217) were associated with T2DM (P<0.05) and reached more nominal levels of significance (P<2.5×10(-5)) in the overall analysis and may represent novel loci that contribute to T2DM. We have identified novel T2DM-susceptibility variants in the African-American population. Notably, T2DM risk was associated with the major allele and implies an interesting genetic architecture in this population. These results suggest that multiple loci underlie T2DM susceptibility in the African-American population and that these loci are distinct from those identified in other ethnic populations. PMID:22238593

  2. A Genome-Wide Association Search for Type 2 Diabetes Genes in African Americans

    PubMed Central

    Palmer, Nicholette D.; McDonough, Caitrin W.; Hicks, Pamela J.; Roh, Bong H.; Wing, Maria R.; An, S. Sandy; Hester, Jessica M.; Cooke, Jessica N.; Bostrom, Meredith A.; Rudock, Megan E.; Talbert, Matthew E.; Lewis, Joshua P.; Ferrara, Assiamira; Lu, Lingyi; Ziegler, Julie T.; Sale, Michele M.; Divers, Jasmin; Shriner, Daniel; Adeyemo, Adebowale; Rotimi, Charles N.; Ng, Maggie C. Y.; Langefeld, Carl D.; Freedman, Barry I.; Bowden, Donald W.

    2012-01-01

    African Americans are disproportionately affected by type 2 diabetes (T2DM) yet few studies have examined T2DM using genome-wide association approaches in this ethnicity. The aim of this study was to identify genes associated with T2DM in the African American population. We performed a Genome Wide Association Study (GWAS) using the Affymetrix 6.0 array in 965 African-American cases with T2DM and end-stage renal disease (T2DM-ESRD) and 1029 population-based controls. The most significant SNPs (n = 550 independent loci) were genotyped in a replication cohort and 122 SNPs (n = 98 independent loci) were further tested through genotyping three additional validation cohorts followed by meta-analysis in all five cohorts totaling 3,132 cases and 3,317 controls. Twelve SNPs had evidence of association in the GWAS (P<0.0071), were directionally consistent in the Replication cohort and were associated with T2DM in subjects without nephropathy (P<0.05). Meta-analysis in all cases and controls revealed a single SNP reaching genome-wide significance (P<2.5×10−8). SNP rs7560163 (P = 7.0×10−9, OR (95% CI) = 0.75 (0.67–0.84)) is located intergenically between RND3 and RBM43. Four additional loci (rs7542900, rs4659485, rs2722769 and rs7107217) were associated with T2DM (P<0.05) and reached more nominal levels of significance (P<2.5×10−5) in the overall analysis and may represent novel loci that contribute to T2DM. We have identified novel T2DM-susceptibility variants in the African-American population. Notably, T2DM risk was associated with the major allele and implies an interesting genetic architecture in this population. These results suggest that multiple loci underlie T2DM susceptibility in the African-American population and that these loci are distinct from those identified in other ethnic populations. PMID:22238593

  3. A Genome-Wide Search for Greek and Jewish Admixture in the Kashmiri Population.

    PubMed

    Downie, Jonathan M; Tashi, Tsewang; Lorenzo, Felipe Ramos; Feusier, Julie Ellen; Mir, Hyder; Prchal, Josef T; Jorde, Lynn B; Koul, Parvaiz A

    2016-01-01

    The Kashmiri population is an ethno-linguistic group that resides in the Kashmir Valley in northern India. A longstanding hypothesis is that this population derives ancestry from Jewish and/or Greek sources. There is historical and archaeological evidence of ancient Greek presence in India and Kashmir. Further, some historical accounts suggest ancient Hebrew ancestry as well. To date, it has not been determined whether signatures of Greek or Jewish admixture can be detected in the Kashmiri population. Using genome-wide genotyping and admixture detection methods, we determined there are no significant or substantial signs of Greek or Jewish admixture in modern-day Kashmiris. The ancestry of Kashmiri Tibetans was also determined, which showed signs of admixture with populations from northern India and west Eurasia. These results contribute to our understanding of the existing population structure in northern India and its surrounding geographical areas.

  4. A Genome-Wide Search for Greek and Jewish Admixture in the Kashmiri Population

    PubMed Central

    Tashi, Tsewang; Lorenzo, Felipe Ramos; Feusier, Julie Ellen; Mir, Hyder

    2016-01-01

    The Kashmiri population is an ethno-linguistic group that resides in the Kashmir Valley in northern India. A longstanding hypothesis is that this population derives ancestry from Jewish and/or Greek sources. There is historical and archaeological evidence of ancient Greek presence in India and Kashmir. Further, some historical accounts suggest ancient Hebrew ancestry as well. To date, it has not been determined whether signatures of Greek or Jewish admixture can be detected in the Kashmiri population. Using genome-wide genotyping and admixture detection methods, we determined there are no significant or substantial signs of Greek or Jewish admixture in modern-day Kashmiris. The ancestry of Kashmiri Tibetans was also determined, which showed signs of admixture with populations from northern India and west Eurasia. These results contribute to our understanding of the existing population structure in northern India and its surrounding geographical areas. PMID:27490348

  5. White matter lesion progression: A genome-wide search for genetic influences

    PubMed Central

    Hofer, Edith; Cavalieri, Margherita; Bis, Joshua C; DeCarli, Charles; Fornage, Myriam; Sigurdsson, Sigurdur; Srikanth, Velandai; Trompet, Stella; Verhaaren, Benjamin FJ; Wolf, Christiane; Yang, Qiong; Adams, Hieab HH; Amouyel, Philippe; Beiser, Alexa; Buckley, Brendan M; Callisaya, Michele; Chauhan, Ganesh; de Craen, Anton JM; Dufouil, Carole; van Duijn, Cornelia M; Ford, Ian; Freudenberger, Paul; Gottesman, Rebecca F; Gudnason, Vilmundur; Heiss, Gerardo; Hofman, Albert; Lumley, Thomas; Martinez, Oliver; Mazoyer, Bernard; Moran, Chris; Niessen, Wiro J.; Phan, Thanh; Psaty, Bruce M; Satizabal, Claudia L; Sattar, Naveed; Schilling, Sabrina; Shibata, Dean K; Slagboom, P Eline; Smith, Albert; Stott, David J; Taylor, Kent D; Thomson, Russell; Töglhofer, Anna M; Tzourio, Christophe; van Buchem, Mark; Wang, Jing; Westendorp, Rudi GJ; Windham, B Gwen; Vernooij, Meike W; Zijdenbos, Alex; Beare, Richard; Debette, Stéphanie; Ikram, M Arfan; Jukema, J Wouter; Launer, Lenore J; Longstreth, W T; Mosley, Thomas H; Seshadri, Sudha; Schmidt, Helena; Schmidt, Reinhold

    2016-01-01

    Background and Purpose White matter lesion (WML) progression on magnetic resonance imaging (MRI) is related to cognitive decline and stroke, but its determinants besides baseline WML burden are largely unknown. Here, we estimated heritability of WML progression, and sought common genetic variants associated with WML progression in elderly participants from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. Methods Heritability of WML progression was calculated in the Framingham Heart Study. The genome-wide association study included 7773 elderly participants from 10 cohorts. To assess the relative contribution of genetic factors to progression of WML, we compared in seven cohorts risk models including demographics, vascular risk factors plus single nucleotide polymorphisms (SNPs) that have been shown to be associated cross-sectionally with WML in the current and previous association studies. Results A total of 1085 subjects showed WML progression. The heritability estimate for WML progression was low at 6.5%, and no SNPs achieved genome-wide significance (p-value < 5×10−8). Four loci were suggestive (p-value < 1×10−5) of an association with WML progression: 10q24.32 (rs10883817, p=1.46×10−6); 12q13.13 (rs4761974, p=8.71×10−7); 20p12.1 (rs6135309, p=3.69×10−6); and 4p15.31 (rs7664442, p=2.26×10−6). Variants that have been previously related to WML explained only 0.8% to 11.7% more of the variance in WML progression than age, vascular risk factors and baseline WML burden. Conclusions Common genetic factors contribute little to the progression of age-related WML in middle-aged and older adults. Future research on determinants of WML progression should focus more on environmental, life-style or host-related biological factors. PMID:26451028

  6. A Genome-Wide Linkage and Association Scan Reveals Novel Loci for Hypertension and Blood Pressure Traits

    PubMed Central

    Guo, Youling; Tomlinson, Brian; Chu, Tanya; Fang, Yu Jing; Gui, Hongsheng; Tang, Clara S.; Yip, Benjamin H.; Cherny, Stacey S.; Hur, Yoon-Mi; Sham, Pak Chung; Lam, Tai Hing; Thomas, Neil G.

    2012-01-01

    Hypertension is caused by the interaction of environmental and genetic factors. The condition which is very common, with about 18% of the adult Hong Kong Chinese population and over 50% of older individuals affected, is responsible for considerable morbidity and mortality. To identify genes influencing hypertension and blood pressure, we conducted a combined linkage and association study using over 500,000 single nucleotide polymorphisms (SNPs) genotyped in 328 individuals comprising 111 hypertensive probands and their siblings. Using a family-based association test, we found an association with SNPs on chromosome 5q31.1 (rs6596140; P<9×10−8) for hypertension. One candidate gene, PDC, was replicated, with rs3817586 on 1q31.1 attaining P = 2.5×10−4 and 2.9×10−5 in the within-family tests for DBP and MAP, respectively. We also identified regions of significant linkage for systolic and diastolic blood pressure on chromosomes 2q22 and 5p13, respectively. Further family-based association analysis of the linkage peak on chromosome 5 yielded a significant association (rs1605685, P<7×10−5) for DBP. This is the first combined linkage and association study of hypertension and its related quantitative traits with Chinese ancestry. The associations reported here account for the action of common variants whereas the discovery of linkage regions may point to novel targets for rare variant screening. PMID:22384028

  7. First-generation linkage map of the gray, short-tailed opossum, Monodelphis domestica, reveals genome-wide reduction in female recombination rates.

    PubMed Central

    Samollow, Paul B; Kammerer, Candace M; Mahaney, Susan M; Schneider, Jennifer L; Westenberger, Scott J; VandeBerg, John L; Robinson, Edward S

    2004-01-01

    The gray, short-tailed opossum, Monodelphis domestica, is the most extensively used, laboratory-bred marsupial resource for basic biologic and biomedical research worldwide. To enhance the research utility of this species, we are building a linkage map, using both anonymous markers and functional gene loci, that will enable the localization of quantitative trait loci (QTL) and provide comparative information regarding the evolution of mammalian and other vertebrate genomes. The current map is composed of 83 loci distributed among eight autosomal linkage groups and the X chromosome. The autosomal linkage groups appear to encompass a very large portion of the genome, yet span a sex-average distance of only 633.0 cM, making this the most compact linkage map known among vertebrates. Most surprising, the male map is much larger than the female map (884.6 cM vs. 443.1 cM), a pattern contrary to that in eutherian mammals and other vertebrates. The finding of genome-wide reduction in female recombination in M. domestica, coupled with recombination data from two other, distantly related marsupial species, suggests that reduced female recombination might be a widespread metatherian attribute. We discuss possible explanations for reduced female recombination in marsupials as a consequence of the metatherian characteristic of determinate paternal X chromosome inactivation. PMID:15020427

  8. Multigenic Control of Pod Shattering Resistance in Chinese Rapeseed Germplasm Revealed by Genome-Wide Association and Linkage Analyses

    PubMed Central

    Liu, Jia; Wang, Jun; Wang, Hui; Wang, Wenxiang; Zhou, Rijin; Mei, Desheng; Cheng, Hongtao; Yang, Juan; Raman, Harsh; Hu, Qiong

    2016-01-01

    The majority of rapeseed cultivars shatter seeds upon maturity especially under hot-dry and windy conditions, reducing yield and gross margin return to growers. Here, we identified quantitative trait loci (QTL) for resistance to pod shatter in an unstructured diverse panel of 143 rapeseed accessions, and two structured populations derived from bi-parental doubled haploid (DH) and inter-mated (IF2) crosses derived from R1 (resistant to pod shattering) and R2 (prone to pod shattering) accessions. Genome-wide association analysis identified six significant QTL for resistance to pod shatter located on chromosomes A01, A06, A07, A09, C02, and C05. Two of the QTL, qSRI.A09 delimited with the SNP marker Bn-A09-p30171993 (A09) and qSRI.A06 delimited with the SNP marker Bn-A06-p115948 (A06) could be repeatedly detected across environments in a diversity panel, DH and IF2 populations, suggesting that at least two loci on chromosomes A06 and A09 were the main contributors to pod shatter resistance in Chinese germplasm. Significant SNP markers identified in this study especially those that appeared repeatedly across environments provide a cost-effective and an efficient method for introgression and pyramiding of favorable alleles for pod shatter resistance via marker-assisted selection in rapeseed improvement programs. PMID:27493651

  9. A genome-wide linkage analysis for reproductive traits in F2 Large White × Meishan cross gilts

    PubMed Central

    Hernandez, S C; Finlayson, H A; Ashworth, C J; Haley, C S; Archibald, A L

    2014-01-01

    Female reproductive performance traits in pigs have low heritabilities thus limiting improvement through traditional selective breeding programmes. However, there is substantial genetic variation found between pig breeds with the Chinese Meishan being one of the most prolific pig breeds known. In this study, three cohorts of Large White × Meishan F2 cross-bred pigs were analysed to identify quantitative trait loci (QTL) with effects on reproductive traits, including ovulation rate, teat number, litter size, total born alive and prenatal survival. A total of 307 individuals were genotyped for 174 genetic markers across the genome. The genome-wide analysis of the trait-recorded F2 gilts in their first parity/litter revealed one QTL for teat number significant at the genome level and a total of 12 QTL, which are significant at the chromosome-wide level, for: litter size (three QTL), total born alive (two QTL), ovulation rate (four QTL), prenatal survival (one QTL) and teat number (two QTL). Further support for eight of these QTL is provided by results from other studies. Four of these 12 QTL were mapped for the first time in this study: on SSC15 for ovulation rate and on SSC18 for teat number, ovulation rate and litter size. PMID:24456574

  10. Multigenic Control of Pod Shattering Resistance in Chinese Rapeseed Germplasm Revealed by Genome-Wide Association and Linkage Analyses.

    PubMed

    Liu, Jia; Wang, Jun; Wang, Hui; Wang, Wenxiang; Zhou, Rijin; Mei, Desheng; Cheng, Hongtao; Yang, Juan; Raman, Harsh; Hu, Qiong

    2016-01-01

    The majority of rapeseed cultivars shatter seeds upon maturity especially under hot-dry and windy conditions, reducing yield and gross margin return to growers. Here, we identified quantitative trait loci (QTL) for resistance to pod shatter in an unstructured diverse panel of 143 rapeseed accessions, and two structured populations derived from bi-parental doubled haploid (DH) and inter-mated (IF2) crosses derived from R1 (resistant to pod shattering) and R2 (prone to pod shattering) accessions. Genome-wide association analysis identified six significant QTL for resistance to pod shatter located on chromosomes A01, A06, A07, A09, C02, and C05. Two of the QTL, qSRI.A09 delimited with the SNP marker Bn-A09-p30171993 (A09) and qSRI.A06 delimited with the SNP marker Bn-A06-p115948 (A06) could be repeatedly detected across environments in a diversity panel, DH and IF2 populations, suggesting that at least two loci on chromosomes A06 and A09 were the main contributors to pod shatter resistance in Chinese germplasm. Significant SNP markers identified in this study especially those that appeared repeatedly across environments provide a cost-effective and an efficient method for introgression and pyramiding of favorable alleles for pod shatter resistance via marker-assisted selection in rapeseed improvement programs. PMID:27493651

  11. Multigenic Control of Pod Shattering Resistance in Chinese Rapeseed Germplasm Revealed by Genome-Wide Association and Linkage Analyses.

    PubMed

    Liu, Jia; Wang, Jun; Wang, Hui; Wang, Wenxiang; Zhou, Rijin; Mei, Desheng; Cheng, Hongtao; Yang, Juan; Raman, Harsh; Hu, Qiong

    2016-01-01

    The majority of rapeseed cultivars shatter seeds upon maturity especially under hot-dry and windy conditions, reducing yield and gross margin return to growers. Here, we identified quantitative trait loci (QTL) for resistance to pod shatter in an unstructured diverse panel of 143 rapeseed accessions, and two structured populations derived from bi-parental doubled haploid (DH) and inter-mated (IF2) crosses derived from R1 (resistant to pod shattering) and R2 (prone to pod shattering) accessions. Genome-wide association analysis identified six significant QTL for resistance to pod shatter located on chromosomes A01, A06, A07, A09, C02, and C05. Two of the QTL, qSRI.A09 delimited with the SNP marker Bn-A09-p30171993 (A09) and qSRI.A06 delimited with the SNP marker Bn-A06-p115948 (A06) could be repeatedly detected across environments in a diversity panel, DH and IF2 populations, suggesting that at least two loci on chromosomes A06 and A09 were the main contributors to pod shatter resistance in Chinese germplasm. Significant SNP markers identified in this study especially those that appeared repeatedly across environments provide a cost-effective and an efficient method for introgression and pyramiding of favorable alleles for pod shatter resistance via marker-assisted selection in rapeseed improvement programs.

  12. Genome-wide search for susceptibility genes to type 2 diabetes in West Africans: potential role of C-peptide.

    PubMed

    Chen, Guanjie; Adeyemo, Adebowale; Zhou, Jie; Chen, Yuanxiu; Huang, Hanxia; Doumatey, Ayo; Lashley, Kerrie; Agyenim-Boateng, Kofi; Eghan, Benjamin A; Acheampong, Joseph; Fasanmade, Olufemi; Johnson, Thomas; Okafor, Godfrey; Oli, Johnnie; Amoah, Albert; Rotimi, Charles

    2007-12-01

    C-peptide is a substance that the pancreas releases into the circulation in equimolar amounts to insulin and has demonstrated important physiological effects which relate to the vascular field, in particular the microcirculation. For this analysis, we included 321 full and 36 half sibling pairs affected with type 2 diabetes (T2D) from West Africa. A genome-wide panel of 390 tri-nucleotide and tetra-nucleotide repeats with an average distance of 8.9 cM was performed on a total of 691 persons. Variance components based on multipoint linkage approach as implemented in SOLAR were performed for log C-peptide. Significant linkage evidences were observed on 10q23 at D10S2327 with a LOD score of 4.04 (nominal p-value=0.000008, empirical p-value=0.0004); and on 4p15 at D4S2632 with a LOD score of 3.48 (nominal p-value=0.000031, empirical p-value=0.0013). Other suggestive evidence of linkage were observed on 15q14 at D15S659 with a LOD score 2.41 (nominal p-value=0.000435, empirical p-value=0.0068), and on 18p11 near D18S976 with a LOD score 2.18 (nominal p-value=0.000771 and empirical p-value=0.0094). Interestingly, five positional candidate genes for diabetes and related complications are located in our linkage region (the pituitary adenylate cyclase activating polypeptide (PACAP in 18p11); the peroxisome proliferator-activated receptor gamma coactivator 1 (PPARGC1 in 4p15); PTEN, PPP1R5, and IDE located in 10q23. In conclusion, we identified four major genetic loci (10q23, 4p15, 15q14, and 18p11) influencing C-peptide concentration in West Africans with T2D.

  13. Follow-up to genome-wide linkage and admixture mapping studies implicates components of the extracellular matrix in susceptibility to and size of uterine fibroids

    PubMed Central

    Aissani, Brahim; Zhang, Kui; Wiener, Howard

    2014-01-01

    Objective To conduct a follow-up association mapping to independent genome-wide linkage and admixture mapping studies of uterine leiomyoma. Design Case-control study. Setting Cross sectional study. Patients A total of 1,045 premenopausal North American women participants to the NIEHS uterine fibroid study. Intervention(s) None. Main Outcome Measure(s) We genotyped 2,772 single nucleotide polymorphisms from candidate genes located in peaks from linkage mapping (2q37, 3p21, 5p13, 10p11, 11p15, 12q14, 17q25) or admixture linkage disequilibrium mapping (2q37, 4p16.1, 10q26) and reported to have regulated expression in uterine fibroids. Results We report significant associations of variant members of the collagen gene family with the risk and tumor size, including missense variants in COL6A3 and COL13A, with replications in the African and European American study groups. Furthermore, the cell-matrix Rho GTPase-encoding ARHGAP26 gene and MAN1C1, a gene encoding a Golgi mannosidase involved in the maturation of procollagens emerged as new candidate UL genes affecting both the risk and tumor size. Conclusion Our data converge onto a model of UL pathogenesis possibly resulting from altered regulation, maintenance and/or renewal of the extracellular matrix. PMID:25455875

  14. Genome-wide scan for serum ghrelin detects linkage on chromosome 1p36 in Hispanic children: results from the Viva La Familia study.

    PubMed

    Voruganti, V Saroja; Göring, Harald H H; Diego, Vincent P; Cai, Guowen; Mehta, Nitesh R; Haack, Karin; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2007-10-01

    This study was conducted to investigate genetic influence on serum ghrelin and its relationship with adiposity-related phenotypes in Hispanic children (n=1030) from the Viva La Familia study (VFS). Anthropometric measurements and levels of serum ghrelin were estimated and genetic analyses conducted according to standard procedures. Mean age, body mass index (BMI), and serum ghrelin were 11+/-0.13 y, 25+/-0.24 kg/m2 and 38+/-0.5 ng/mL, respectively. Significant heritabilities (p<0.001) were obtained for BMI, weight, fat mass, percent fat, waist circumference, waist-to-height ratio, and ghrelin. Bivariate analyses of ghrelin with adiposity traits showed significant negative genetic correlations (p<0.0001) with weight, BMI, fat mass, percent fat, waist circumference, and waist-to-height ratio. A genome-wide scan for ghrelin detected significant linkage on chromosome 1p36.2 between STR markers D1S2697 and D1S199 (LOD=3.2). The same region on chromosome 1 was the site of linkage for insulin (LOD=3.3), insulinlike growth factor binding protein 1 (IGFBP1) (LOD=3.4), homeostatic model assessment method (HOMA) (LOD=2.9), and C-peptide (LOD=2.0). Several family-based studies have reported linkages for obesity-related phenotypes in the region of 1p36. These results indicate the importance of this region in relation to adiposity in children from the VFS.

  15. A genome-wide search for genes predisposing to manic-depression, assuming autosomal dominant inheritance

    SciTech Connect

    Coon, H.; Jensen, S.; Hoff, M.; Holik, J.; Plaetke, R.; Reimherr, F.; Wender, P.; Leppert, M.; Byerley, W. )

    1993-06-01

    Manic-depressive illness (MDI), also known as [open quotes]bipolar affective disorder[close quotes], is a common and devastating neuropsychiatric illness. Although pivotal biochemical alterations underlying the disease are unknown, results of family, twin, and adoption studies consistently implicate genetic transmission in the pathogenesis of MDI. In order to carry out linkage analysis, the authors ascertained eight moderately sized pedigrees containing multiple cases of the disease. For a four-allele marker mapping at 5 cM from the disease gene, the pedigree sample has >97% power to detect a dominant allele under genetic homogeneity and has >73% power under 20% heterogeneity. To date, the eight pedigrees have been genotyped with 328 polymorphic DNA loci throughout the genome. When autosomal dominant inheritance was assumed, 273 DNA markers gave lod scores <[minus]2.0 at [theta] = .05, and 4 DNA marker loci yielded lod scores >1 (chromosome 5 -- D5S39, D5S43, and D5S62; chromosome 11 -- D11S85). Of the markers giving lod scores >1, only D5S62 continued to show evidence for linkage when the affected-pedigree-member method was used. The D5S62 locus maps to distal 5q, a region containing neurotransmitter-receptor genes for dopamine, norepinephrine, glutamate, and gamma-aminobutyric acid. Although additional work in this region may be warranted, the linkage results should be interpreted as preliminary data, as 68 unaffected individuals are not past the age of risk. 72 refs., 2 tabs.

  16. A genome-wide linkage and association study of musical aptitude identifies loci containing genes related to inner ear development and neurocognitive functions.

    PubMed

    Oikkonen, J; Huang, Y; Onkamo, P; Ukkola-Vuoti, L; Raijas, P; Karma, K; Vieland, V J; Järvelä, I

    2015-02-01

    Humans have developed the perception, production and processing of sounds into the art of music. A genetic contribution to these skills of musical aptitude has long been suggested. We performed a genome-wide scan in 76 pedigrees (767 individuals) characterized for the ability to discriminate pitch (SP), duration (ST) and sound patterns (KMT), which are primary capacities for music perception. Using the Bayesian linkage and association approach implemented in program package KELVIN, especially designed for complex pedigrees, several single nucleotide polymorphisms (SNPs) near genes affecting the functions of the auditory pathway and neurocognitive processes were identified. The strongest association was found at 3q21.3 (rs9854612) with combined SP, ST and KMT test scores (COMB). This region is located a few dozen kilobases upstream of the GATA binding protein 2 (GATA2) gene. GATA2 regulates the development of cochlear hair cells and the inferior colliculus (IC), which are important in tonotopic mapping. The highest probability of linkage was obtained for phenotype SP at 4p14, located next to the region harboring the protocadherin 7 gene, PCDH7. Two SNPs rs13146789 and rs13109270 of PCDH7 showed strong association. PCDH7 has been suggested to play a role in cochlear and amygdaloid complexes. Functional class analysis showed that inner ear and schizophrenia-related genes were enriched inside the linked regions. This study is the first to show the importance of auditory pathway genes in musical aptitude.

  17. A genome-wide linkage and association study of musical aptitude identifies loci containing genes related to inner ear development and neurocognitive functions.

    PubMed

    Oikkonen, J; Huang, Y; Onkamo, P; Ukkola-Vuoti, L; Raijas, P; Karma, K; Vieland, V J; Järvelä, I

    2015-02-01

    Humans have developed the perception, production and processing of sounds into the art of music. A genetic contribution to these skills of musical aptitude has long been suggested. We performed a genome-wide scan in 76 pedigrees (767 individuals) characterized for the ability to discriminate pitch (SP), duration (ST) and sound patterns (KMT), which are primary capacities for music perception. Using the Bayesian linkage and association approach implemented in program package KELVIN, especially designed for complex pedigrees, several single nucleotide polymorphisms (SNPs) near genes affecting the functions of the auditory pathway and neurocognitive processes were identified. The strongest association was found at 3q21.3 (rs9854612) with combined SP, ST and KMT test scores (COMB). This region is located a few dozen kilobases upstream of the GATA binding protein 2 (GATA2) gene. GATA2 regulates the development of cochlear hair cells and the inferior colliculus (IC), which are important in tonotopic mapping. The highest probability of linkage was obtained for phenotype SP at 4p14, located next to the region harboring the protocadherin 7 gene, PCDH7. Two SNPs rs13146789 and rs13109270 of PCDH7 showed strong association. PCDH7 has been suggested to play a role in cochlear and amygdaloid complexes. Functional class analysis showed that inner ear and schizophrenia-related genes were enriched inside the linked regions. This study is the first to show the importance of auditory pathway genes in musical aptitude. PMID:24614497

  18. Using Biological Knowledge to Uncover the Mystery in the Search for Epistasis in Genome-Wide Association Studies

    PubMed Central

    Ritchie, Marylyn D.

    2011-01-01

    The search for the missing heritability in genome-wide association studies (GWAS) has become an important focus for the human genetics community. One suspected location of these genetic effects is in gene-gene interactions, or epistasis. The computational burden of exploring gene-gene interactions in the wealth of data generated in GWAS, along with small to moderate sample sizes, have led to epistasis being an afterthought, rather than a primary focus of GWAS analyses. In this review, we discuss some potential approaches to filter a GWAS dataset to a smaller, more manageable dataset where searching for epistasis is considerably more feasible. We describe a number of alternative approaches, but primarily focus on the use of prior biological knowledge from databases in the public domain to guide the search for epistasis. The manner in which prior knowledge is incorporated into a GWA study can be many and these data can be extracted from a variety of database sources. We discuss a number of these approaches and propose that a comprehensive approach will likely be most fruitful for searching for epistasis in large-scale genomic studies of the current state-of-the-art and into the future. PMID:21158748

  19. Genome-wide search for susceptibility genes to type 2 diabetes in West Africans: potential role of C-peptide.

    PubMed

    Chen, Guanjie; Adeyemo, Adebowale; Zhou, Jie; Chen, Yuanxiu; Huang, Hanxia; Doumatey, Ayo; Lashley, Kerrie; Agyenim-Boateng, Kofi; Eghan, Benjamin A; Acheampong, Joseph; Fasanmade, Olufemi; Johnson, Thomas; Okafor, Godfrey; Oli, Johnnie; Amoah, Albert; Rotimi, Charles

    2007-12-01

    C-peptide is a substance that the pancreas releases into the circulation in equimolar amounts to insulin and has demonstrated important physiological effects which relate to the vascular field, in particular the microcirculation. For this analysis, we included 321 full and 36 half sibling pairs affected with type 2 diabetes (T2D) from West Africa. A genome-wide panel of 390 tri-nucleotide and tetra-nucleotide repeats with an average distance of 8.9 cM was performed on a total of 691 persons. Variance components based on multipoint linkage approach as implemented in SOLAR were performed for log C-peptide. Significant linkage evidences were observed on 10q23 at D10S2327 with a LOD score of 4.04 (nominal p-value=0.000008, empirical p-value=0.0004); and on 4p15 at D4S2632 with a LOD score of 3.48 (nominal p-value=0.000031, empirical p-value=0.0013). Other suggestive evidence of linkage were observed on 15q14 at D15S659 with a LOD score 2.41 (nominal p-value=0.000435, empirical p-value=0.0068), and on 18p11 near D18S976 with a LOD score 2.18 (nominal p-value=0.000771 and empirical p-value=0.0094). Interestingly, five positional candidate genes for diabetes and related complications are located in our linkage region (the pituitary adenylate cyclase activating polypeptide (PACAP in 18p11); the peroxisome proliferator-activated receptor gamma coactivator 1 (PPARGC1 in 4p15); PTEN, PPP1R5, and IDE located in 10q23. In conclusion, we identified four major genetic loci (10q23, 4p15, 15q14, and 18p11) influencing C-peptide concentration in West Africans with T2D. PMID:17548123

  20. A genome-wide linkage analysis of alcoholism on microsatellite and single-nucleotide polymorphism data, using alcohol dependence phenotypes and electroencephalogram measures.

    PubMed

    Zhang, Chun; Cawley, Simon; Liu, Guoying; Cao, Manqiu; Gorrell, Harley; Kennedy, Giulia C

    2005-01-01

    The Collaborative Study on the Genetics of Alcoholism (COGA) is a large-scale family study designed to identify genes that affect the risk for alcoholism and alcohol-related phenotypes. We performed genome-wide linkage analyses on the COGA data made available to participants in the Genetic Analysis Workshop 14 (GAW 14). The dataset comprised 1,350 participants from 143 families. The samples were analyzed on three technologies: microsatellites spaced at 10 cM, Affymetrix GeneChip Human Mapping 10 K Array (HMA10K) and Illumina SNP-based Linkage III Panel. We used ALDX1 and ALDX2, the COGA definitions of alcohol dependence, as well as electrophysiological measures TTTH1 and ECB21 to detect alcoholism susceptibility loci. Many chromosomal regions were found to be significant for each of the phenotypes at a p-value of 0.05. The most significant region for ALDX1 is on chromosome 7, with a maximum LOD score of 2.25 for Affymetrix SNPs, 1.97 for Illumina SNPs, and 1.72 for microsatellites. The same regions on chromosome 7 (96-106 cM) and 10 (149-176 cM) were found to be significant for both ALDX1 and ALDX2. A region on chromosome 7 (112-153 cM) and a region on chromosome 6 (169-185 cM) were identified as the most significant regions for TTTH1 and ECB21, respectively. We also performed linkage analysis on denser maps of markers by combining the SNPs datasets from Affymetrix and Illumina. Adding the microsatellite data to the combined SNP dataset improved the results only marginally. The results indicated that SNPs outperform microsatellites with the densest marker sets performing the best.

  1. FHSA-SED: Two-Locus Model Detection for Genome-Wide Association Study with Harmony Search Algorithm

    PubMed Central

    Tuo, Shouheng; Zhang, Junying; Yuan, Xiguo; Zhang, Yuanyuan; Liu, Zhaowen

    2016-01-01

    Motivation Two-locus model is a typical significant disease model to be identified in genome-wide association study (GWAS). Due to intensive computational burden and diversity of disease models, existing methods have drawbacks on low detection power, high computation cost, and preference for some types of disease models. Method In this study, two scoring functions (Bayesian network based K2-score and Gini-score) are used for characterizing two SNP locus as a candidate model, the two criteria are adopted simultaneously for improving identification power and tackling the preference problem to disease models. Harmony search algorithm (HSA) is improved for quickly finding the most likely candidate models among all two-locus models, in which a local search algorithm with two-dimensional tabu table is presented to avoid repeatedly evaluating some disease models that have strong marginal effect. Finally G-test statistic is used to further test the candidate models. Results We investigate our method named FHSA-SED on 82 simulated datasets and a real AMD dataset, and compare it with two typical methods (MACOED and CSE) which have been developed recently based on swarm intelligent search algorithm. The results of simulation experiments indicate that our method outperforms the two compared algorithms in terms of detection power, computation time, evaluation times, sensitivity (TPR), specificity (SPC), positive predictive value (PPV) and accuracy (ACC). Our method has identified two SNPs (rs3775652 and rs10511467) that may be also associated with disease in AMD dataset. PMID:27014873

  2. Genome-wide patterns of segregation and linkage disequilibrium: the construction of a linkage genetic map of the poplar rust fungus Melampsora larici-populina

    PubMed Central

    Pernaci, Michaël; De Mita, Stéphane; Andrieux, Axelle; Pétrowski, Jérémy; Halkett, Fabien; Duplessis, Sébastien; Frey, Pascal

    2014-01-01

    The poplar rust fungus Melampsora larici-populina causes significant yield reduction and severe economic losses in commercial poplar plantations. After several decades of breeding for qualitative resistance and subsequent breakdown of the released resistance genes, breeders now focus on quantitative resistance, perceived to be more durable. But quantitative resistance also can be challenged by an increase of aggressiveness in the pathogen. Thus, it is of primary importance to better understand the genetic architecture of aggressiveness traits. To this aim, our goal is to build a genetic linkage map for M. larici-populina in order to map quantitative trait loci related to aggressiveness. First, a large progeny of M. larici-populina was generated through selfing of the reference strain 98AG31 (which genome sequence is available) on larch plants, the alternate host of the poplar rust fungus. The progeny's meiotic origin was validated through a segregation analysis of 115 offspring with 14 polymorphic microsatellite markers, of which 12 segregated in the expected 1:2:1 Mendelian ratio. A microsatellite-based linkage disequilibrium analysis allowed us to identify one potential linkage group comprising two scaffolds. The whole genome of a subset of 47 offspring was resequenced using the Illumina HiSeq 2000 technology at a mean sequencing depth of 6X. The reads were mapped onto the reference genome of the parental strain and 144,566 SNPs were identified across the genome. Analysis of distribution and polymorphism of the SNPs along the genome led to the identification of 2580 recombination blocks. A second linkage disequilibrium analysis, using the recombination blocks as markers, allowed us to group 81 scaffolds into 23 potential linkage groups. These preliminary results showed that a high-density linkage map could be constructed by using high-quality SNPs based on low-coverage resequencing of a larger number of M. larici-populina offspring. PMID:25309554

  3. Genome-wide patterns of segregation and linkage disequilibrium: the construction of a linkage genetic map of the poplar rust fungus Melampsora larici-populina.

    PubMed

    Pernaci, Michaël; De Mita, Stéphane; Andrieux, Axelle; Pétrowski, Jérémy; Halkett, Fabien; Duplessis, Sébastien; Frey, Pascal

    2014-01-01

    The poplar rust fungus Melampsora larici-populina causes significant yield reduction and severe economic losses in commercial poplar plantations. After several decades of breeding for qualitative resistance and subsequent breakdown of the released resistance genes, breeders now focus on quantitative resistance, perceived to be more durable. But quantitative resistance also can be challenged by an increase of aggressiveness in the pathogen. Thus, it is of primary importance to better understand the genetic architecture of aggressiveness traits. To this aim, our goal is to build a genetic linkage map for M. larici-populina in order to map quantitative trait loci related to aggressiveness. First, a large progeny of M. larici-populina was generated through selfing of the reference strain 98AG31 (which genome sequence is available) on larch plants, the alternate host of the poplar rust fungus. The progeny's meiotic origin was validated through a segregation analysis of 115 offspring with 14 polymorphic microsatellite markers, of which 12 segregated in the expected 1:2:1 Mendelian ratio. A microsatellite-based linkage disequilibrium analysis allowed us to identify one potential linkage group comprising two scaffolds. The whole genome of a subset of 47 offspring was resequenced using the Illumina HiSeq 2000 technology at a mean sequencing depth of 6X. The reads were mapped onto the reference genome of the parental strain and 144,566 SNPs were identified across the genome. Analysis of distribution and polymorphism of the SNPs along the genome led to the identification of 2580 recombination blocks. A second linkage disequilibrium analysis, using the recombination blocks as markers, allowed us to group 81 scaffolds into 23 potential linkage groups. These preliminary results showed that a high-density linkage map could be constructed by using high-quality SNPs based on low-coverage resequencing of a larger number of M. larici-populina offspring.

  4. Genome-Wide Linkage in a Highly Consanguineous Pedigree Reveals Two Novel Loci on Chromosome 7 for Non-Syndromic Familial Premature Ovarian Failure

    PubMed Central

    Caburet, Sandrine; Zavadakova, Petra; Ben-Neriah, Ziva; Bouhali, Kamal; Dipietromaria, Aurélie; Charon, Céline; Besse, Céline; Laissue, Paul; Chalifa-Caspi, Vered; Christin-Maitre, Sophie; Vaiman, Daniel; Levi, Giovanni; Veitia, Reiner A.; Fellous, Marc

    2012-01-01

    Background The human condition known as Premature Ovarian Failure (POF) is characterized by loss of ovarian function before the age of 40. A majority of POF cases are sporadic, but 10–15% are familial, suggesting a genetic origin of the disease. Although several causal mutations have been identified, the etiology of POF is still unknown for about 90% of the patients. Methodology/Principal Findings We report a genome-wide linkage and homozygosity analysis in one large consanguineous Middle-Eastern POF-affected family presenting an autosomal recessive pattern of inheritance. We identified two regions with a LODmax of 3.26 on chromosome 7p21.1-15.3 and 7q21.3-22.2, which are supported as candidate regions by homozygosity mapping. Sequencing of the coding exons and known regulatory sequences of three candidate genes (DLX5, DLX6 and DSS1) included within the largest region did not reveal any causal mutations. Conclusions/Significance We detect two novel POF-associated loci on human chromosome 7, opening the way to the identification of new genes involved in the control of ovarian development and function. PMID:22428046

  5. Genome-wide linkage analysis of QTL for growth and body composition employing the PorcineSNP60 BeadChip

    PubMed Central

    2012-01-01

    Background The traditional strategy to map QTL is to use linkage analysis employing a limited number of markers. These analyses report wide QTL confidence intervals, making very difficult to identify the gene and polymorphisms underlying the QTL effects. The arrival of genome-wide panels of SNPs makes available thousands of markers increasing the information content and therefore the likelihood of detecting and fine mapping QTL regions. The aims of the current study are to confirm previous QTL regions for growth and body composition traits in different generations of an Iberian x Landrace intercross (IBMAP) and especially identify new ones with narrow confidence intervals by employing the PorcineSNP60 BeadChip in linkage analyses. Results Three generations (F3, Backcross 1 and Backcross 2) of the IBMAP and their related animals were genotyped with PorcineSNP60 BeadChip. A total of 8,417 SNPs equidistantly distributed across autosomes were selected after filtering by quality, position and frequency to perform the QTL scan. The joint and separate analyses of the different IBMAP generations allowed confirming QTL regions previously identified in chromosomes 4 and 6 as well as new ones mainly for backfat thickness in chromosomes 4, 5, 11, 14 and 17 and shoulder weight in chromosomes 1, 2, 9 and 13; and many other to the chromosome-wide signification level. In addition, most of the detected QTLs displayed narrow confidence intervals, making easier the selection of positional candidate genes. Conclusions The use of higher density of markers has allowed to confirm results obtained in previous QTL scans carried out with microsatellites. Moreover several new QTL regions have been now identified in regions probably not covered by markers in previous scans, most of these QTLs displayed narrow confidence intervals. Finally, prominent putative biological and positional candidate genes underlying those QTL effects are listed based on recent porcine genome annotation. PMID

  6. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea

    PubMed Central

    Gaur, Rashmi; Chattopadhyay, Debasis; Jain, Mukesh; Parida, Swarup K.; Bhatia, Sabhyata

    2015-01-01

    The identification of informative in silico polymorphic genomic and genic microsatellite markers by comparing the genome and transcriptome sequences of crop genotypes is a rapid, cost-effective and non-laborious approach for large-scale marker validation and genotyping applications, including construction of high-density genetic maps. We designed 1494 markers, including 1016 genomic and 478 transcript-derived microsatellite markers showing in-silico fragment length polymorphism between two parental genotypes (Cicer arietinum ICC4958 and C. reticulatum PI489777) of an inter-specific reference mapping population. High amplification efficiency (87%), experimental validation success rate (81%) and polymorphic potential (55%) of these microsatellite markers suggest their effective use in various applications of chickpea genetics and breeding. Intra-specific polymorphic potential (48%) detected by microsatellite markers in 22 desi and kabuli chickpea genotypes was lower than inter-specific polymorphic potential (59%). An advanced, high-density, integrated and inter-specific chickpea genetic map (ICC4958 x PI489777) having 1697 map positions spanning 1061.16 cM with an average inter-marker distance of 0.625 cM was constructed by assigning 634 novel informative transcript-derived and genomic microsatellite markers on eight linkage groups (LGs) of our prior documented, 1063 marker-based genetic map. The constructed genome map identified 88, including four major (7–23 cM) longest high-resolution genomic regions on LGs 3, 5 and 8, where the maximum number of novel genomic and genic microsatellite markers were specifically clustered within 1 cM genetic distance. It was for the first time in chickpea that in silico FLP analysis at genome-wide level was carried out and such a large number of microsatellite markers were identified, experimentally validated and further used in genetic mapping. To best of our knowledge, in the presently constructed genetic map, we mapped highest

  7. Identification of New Resistance Loci to African Stem Rust Race TTKSK in Tetraploid Wheats Based on Linkage and Genome-Wide Association Mapping.

    PubMed

    Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A; Ficco, Donatella B M; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M

    2015-01-01

    Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the "Ug99 lineage" are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar "Cirillo" and susceptible "Neodur." The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub-species.

  8. High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

  9. Identification of New Resistance Loci to African Stem Rust Race TTKSK in Tetraploid Wheats Based on Linkage and Genome-Wide Association Mapping

    PubMed Central

    Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A.; Ficco, Donatella B. M.; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M.

    2015-01-01

    Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the “Ug99 lineage” are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar “Cirillo” and susceptible “Neodur.” The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub

  10. Genome-wide prioritization of disease genes and identification of disease-disease associations from an integrated human functional linkage network

    PubMed Central

    Linghu, Bolan; Snitkin, Evan S; Hu, Zhenjun; Xia, Yu; DeLisi, Charles

    2009-01-01

    We integrate 16 genomic features to construct an evidence-weighted functional-linkage network comprising 21,657 human genes. The functional-linkage network is used to prioritize candidate genes for 110 diseases, and to reliably disclose hidden associations between disease pairs having dissimilar phenotypes, such as hypercholesterolemia and Alzheimer's disease. Many of these disease-disease associations are supported by epidemiology, but with no previous genetic basis. Such associations can drive novel hypotheses on molecular mechanisms of diseases and therapies. PMID:19728866

  11. Discovery and replication of dopamine-related gene effects on caudate volume in young and elderly populations (N=1198) using genome-wide search

    PubMed Central

    Stein, Jason L.; Hibar, Derrek P.; Madsen, Sarah K.; Khamis, Mathew; McMahon, Katie L.; de Zubicaray, Greig I.; Hansell, Narelle K.; Montgomery, Grant W.; Martin, Nicholas G.; Wright, Margaret J.; Saykin, Andrew J.; Jack, Clifford R.; Weiner, Michael W.; Toga, Arthur W.; Thompson, Paul M.

    2011-01-01

    The caudate is a subcortical brain structure implicated in many common neurological and psychiatric disorders. To identify specific genes associated with variations in caudate volume, structural MRI and genome-wide genotypes were acquired from two large cohorts, the Alzheimer’s Disease NeuroImaging Initiative (ADNI; N=734) and the Brisbane Adolescent/Young Adult Longitudinal Twin Study (BLTS; N=464). In a preliminary analysis of heritability, around 90% of the variation in caudate volume was due to genetic factors. We then conducted genome-wide association to find common variants that contribute to this relatively high heritability. Replicated genetic association was found for the right caudate volume at SNP rs163030 in the ADNI discovery sample (P=2.36×10−6) and in the BLTS replication sample (P=0.012). This genetic variation accounted for 2.79% and 1.61% of the trait variance, respectively. The peak of association was found in and around two genes, WDR41 and PDE8B, involved in dopamine signaling and development. In addition, a previously identified mutation in PDE8B causes a rare autosomal-dominant type of striatal degeneration. Searching across both samples offers a rigorous way to screen for genes consistently influencing brain structure at different stages of life. Variants identified here may be relevant to common disorders affecting the caudate. PMID:21502949

  12. Discovery and replication of dopamine-related gene effects on caudate volume in young and elderly populations (N=1198) using genome-wide search.

    PubMed

    Stein, J L; Hibar, D P; Madsen, S K; Khamis, M; McMahon, K L; de Zubicaray, G I; Hansell, N K; Montgomery, G W; Martin, N G; Wright, M J; Saykin, A J; Jack, C R; Weiner, M W; Toga, A W; Thompson, P M

    2011-09-01

    The caudate is a subcortical brain structure implicated in many common neurological and psychiatric disorders. To identify specific genes associated with variations in caudate volume, structural magnetic resonance imaging and genome-wide genotypes were acquired from two large cohorts, the Alzheimer's Disease NeuroImaging Initiative (ADNI; N=734) and the Brisbane Adolescent/Young Adult Longitudinal Twin Study (BLTS; N=464). In a preliminary analysis of heritability, around 90% of the variation in caudate volume was due to genetic factors. We then conducted genome-wide association to find common variants that contribute to this relatively high heritability. Replicated genetic association was found for the right caudate volume at single-nucleotide polymorphism rs163030 in the ADNI discovery sample (P=2.36 × 10⁻⁶) and in the BLTS replication sample (P=0.012). This genetic variation accounted for 2.79 and 1.61% of the trait variance, respectively. The peak of association was found in and around two genes, WDR41 and PDE8B, involved in dopamine signaling and development. In addition, a previously identified mutation in PDE8B causes a rare autosomal-dominant type of striatal degeneration. Searching across both samples offers a rigorous way to screen for genes consistently influencing brain structure at different stages of life. Variants identified here may be relevant to common disorders affecting the caudate. PMID:21502949

  13. A genome-wide scan shows significant linkage between bipolar disorder and chromosome 12q24.3 and suggestive linkage to chromosomes 1p22-21, 4p16, 6q14-22, 10q26 and 16p13.3.

    PubMed

    Ewald, H; Flint, T; Kruse, T A; Mors, O

    2002-01-01

    The present study reports a genomewide scan using linkage analysis for risk genes involved in bipolar disorder with 613 microsatellite markers including additional testing of promising regions. As previously published significant linkage was obtained at chromosome 12q24.3 with a two-point parametric lod score of 3.42 at D12S1639 including all members in both families (empirical P-value 0.00004, genome-wide P-value 0.0417). The multipoint parametric lod score at D12S1639 was 3.63 (genome-wide P-value 0.0265). At chromosome 1p22-p21 a parametric, affecteds-only two-point lod score of 2.75 at marker D1S216 was found (empirical P-value 0.0002, genome-wide P-value 0.1622). A three-point lod score of 2.98 (genome-wide P-value 0.1022) at D1S216, and a multipoint non-parametric analysis with a maximum NPL-all score of 17.60 (P-value 0.00079) at D1S216 further supported this finding. A number of additional loci on chromosomes 4p16, 6q14-q22, 10q26 and 16p13.3 yielded parametric lod scores around or above 2.

  14. The catecholamine biosynthetic enzyme dopamine β-hydroxylase (DBH): first genome-wide search positions trait-determining variants acting additively in the proximal promoter

    PubMed Central

    Mustapic, Maja; Maihofer, Adam X.; Mahata, Manjula; Chen, Yuqing; Baker, Dewleen G.; O'Connor, Daniel T.; Nievergelt, Caroline M.

    2014-01-01

    Dopamine beta-hydroxylase (DBH) is the biosynthetic enzyme catalyzing formation of norepinephrine. Changes in DBH expression or activity have been implicated in the pathogenesis of cardiovascular and neuropsychiatric disorders. Genetic determination of DBH enzymatic activity and its secretion are only incompletely understood. We began with a genome-wide association search for loci contributing to DBH activity in human plasma. Initially, in a population sample of European ancestry, we identified the proximal DBH promoter as a region harboring three common trait-determining variants (top hit rs1611115, P = 7.2 × 10−51). We confirmed their effects on transcription and showed that the three variants each acted additively on gene expression. Results were replicated in a population sample of Native American descent (top hit rs1611115, P = 4.1 × 10−15). Jointly, DBH variants accounted for 57% of DBH trait variation. We further identified a genome-wide significant SNP at the LOC338797 locus on chromosome 12 as trans-quantitative trait locus (QTL) (rs4255618, P = 4.62 × 10−8). Conditional analyses on DBH identified a third genomic region contributing to DBH variation: a likely cis-QTL adjacent to DBH in SARDH (rs7040170, P = 1.31 × 10−14) on chromosome 9q. We conclude that three common SNPs in the DBH promoter act additively to control phenotypic variation in DBH levels, and that two additional novel loci (SARDH and LOC338797) may also contribute to the expression of this catecholamine biosynthetic trait. Identification of DBH variants with strong effects makes it possible to take advantage of Mendelian randomization approaches to test causal effects of this intermediate trait on disease. PMID:24986918

  15. AnABlast: a new in silico strategy for the genome-wide search of novel genes and fossil regions

    PubMed Central

    Jimenez, Juan; Duncan, Caia D. S.; Gallardo, María; Mata, Juan; Perez-Pulido, Antonio J.

    2015-01-01

    Genome annotation, assisted by computer programs, is one of the great advances in modern biology. Nevertheless, the in silico identification of small and complex coding sequences is still challenging. We observed that amino acid sequences inferred from coding—but rarely from non-coding—DNA sequences accumulated alignments in low-stringency BLAST searches, suggesting that this alignments accumulation could be used to highlight coding regions in sequenced DNA. To investigate this possibility, we developed a computer program (AnABlast) that generates profiles of accumulated alignments in query amino acid sequences using a low-stringency BLAST strategy. To validate this approach, all six-frame translations of DNA sequences between every two annotated exons of the fission yeast genome were analysed with AnABlast. AnABlast-generated profiles identified three new copies of known genes, and four new genes supported by experimental evidence. New pseudogenes, ancestral carboxyl- and amino-terminal subtractions, complex gene rearrangements, and ancient fragments of mitDNA and of bacterial origin, were also inferred. Thus, this novel in silico approach provides a powerful tool to uncover new genes, as well as fossil-coding sequences, thus providing insight into the evolutionary history of annotated genomes. PMID:26494834

  16. AnABlast: a new in silico strategy for the genome-wide search of novel genes and fossil regions.

    PubMed

    Jimenez, Juan; Duncan, Caia D S; Gallardo, María; Mata, Juan; Perez-Pulido, Antonio J

    2015-12-01

    Genome annotation, assisted by computer programs, is one of the great advances in modern biology. Nevertheless, the in silico identification of small and complex coding sequences is still challenging. We observed that amino acid sequences inferred from coding-but rarely from non-coding-DNA sequences accumulated alignments in low-stringency BLAST searches, suggesting that this alignments accumulation could be used to highlight coding regions in sequenced DNA. To investigate this possibility, we developed a computer program (AnABlast) that generates profiles of accumulated alignments in query amino acid sequences using a low-stringency BLAST strategy. To validate this approach, all six-frame translations of DNA sequences between every two annotated exons of the fission yeast genome were analysed with AnABlast. AnABlast-generated profiles identified three new copies of known genes, and four new genes supported by experimental evidence. New pseudogenes, ancestral carboxyl- and amino-terminal subtractions, complex gene rearrangements, and ancient fragments of mitDNA and of bacterial origin, were also inferred. Thus, this novel in silico approach provides a powerful tool to uncover new genes, as well as fossil-coding sequences, thus providing insight into the evolutionary history of annotated genomes.

  17. Genome-Wide SNP Linkage Mapping and QTL Analysis for Fiber Quality and Yield Traits in the Upland Cotton Recombinant Inbred Lines Population.

    PubMed

    Li, Cong; Dong, Yating; Zhao, Tianlun; Li, Ling; Li, Cheng; Yu, En; Mei, Lei; Daud, M K; He, Qiuling; Chen, Jinhong; Zhu, Shuijin

    2016-01-01

    It is of significance to discover genes related to fiber quality and yield traits and tightly linked markers for marker-assisted selection (MAS) in cotton breeding. In this study, 188 F8 recombinant inbred lines (RILs), derived from a intraspecific cross between HS46 and MARCABUCAG8US-1-88 were genotyped by the cotton 63K single nucleotide polymorphism (SNP) assay. Field trials were conducted in Sanya, Hainan Province, during the 2014-2015 cropping seasons under standard conditions. Results revealed significant differences (P < 0.05) among RILs, environments and replications for fiber quality and yield traits. Broad-sense heritabilities of all traits including fiber length, fiber uniformity, micronaire, fiber elongation, fiber strength, boll weight, and lint percentage ranged from 0.26 to 0.66. A 1784.28 cM (centimorgans) linkage map, harboring 2618 polymorphic SNP markers, was constructed, which had 0.68 cM per marker density. Seventy-one quantitative trait locus (QTLs) for fiber quality and yield traits were detected on 21 chromosomes, explaining 4.70∼32.28% phenotypic variance, in which 16 were identified as stable QTLs across two environments. Meanwhile, 12 certain regions were investigated to be involved in the control of one (hotspot) or more (cluster) traits, mainly focused on Chr05, Chr09, Chr10, Chr14, Chr19, and Chr20. Nineteen pairs of epistatic QTLs (e-QTLs) were identified, of which two pairs involved in two additive QTLs. These additive QTLs, e-QTLs, and QTL clusters were tightly linked to SNP markers, which may serve as target regions for map-based cloning, gene discovery, and MAS in cotton breeding. PMID:27660632

  18. Genome-Wide SNP Linkage Mapping and QTL Analysis for Fiber Quality and Yield Traits in the Upland Cotton Recombinant Inbred Lines Population

    PubMed Central

    Li, Cong; Dong, Yating; Zhao, Tianlun; Li, Ling; Li, Cheng; Yu, En; Mei, Lei; Daud, M. K.; He, Qiuling; Chen, Jinhong; Zhu, Shuijin

    2016-01-01

    It is of significance to discover genes related to fiber quality and yield traits and tightly linked markers for marker-assisted selection (MAS) in cotton breeding. In this study, 188 F8 recombinant inbred lines (RILs), derived from a intraspecific cross between HS46 and MARCABUCAG8US-1-88 were genotyped by the cotton 63K single nucleotide polymorphism (SNP) assay. Field trials were conducted in Sanya, Hainan Province, during the 2014–2015 cropping seasons under standard conditions. Results revealed significant differences (P < 0.05) among RILs, environments and replications for fiber quality and yield traits. Broad-sense heritabilities of all traits including fiber length, fiber uniformity, micronaire, fiber elongation, fiber strength, boll weight, and lint percentage ranged from 0.26 to 0.66. A 1784.28 cM (centimorgans) linkage map, harboring 2618 polymorphic SNP markers, was constructed, which had 0.68 cM per marker density. Seventy-one quantitative trait locus (QTLs) for fiber quality and yield traits were detected on 21 chromosomes, explaining 4.70∼32.28% phenotypic variance, in which 16 were identified as stable QTLs across two environments. Meanwhile, 12 certain regions were investigated to be involved in the control of one (hotspot) or more (cluster) traits, mainly focused on Chr05, Chr09, Chr10, Chr14, Chr19, and Chr20. Nineteen pairs of epistatic QTLs (e-QTLs) were identified, of which two pairs involved in two additive QTLs. These additive QTLs, e-QTLs, and QTL clusters were tightly linked to SNP markers, which may serve as target regions for map-based cloning, gene discovery, and MAS in cotton breeding.

  19. Genome-Wide SNP Linkage Mapping and QTL Analysis for Fiber Quality and Yield Traits in the Upland Cotton Recombinant Inbred Lines Population

    PubMed Central

    Li, Cong; Dong, Yating; Zhao, Tianlun; Li, Ling; Li, Cheng; Yu, En; Mei, Lei; Daud, M. K.; He, Qiuling; Chen, Jinhong; Zhu, Shuijin

    2016-01-01

    It is of significance to discover genes related to fiber quality and yield traits and tightly linked markers for marker-assisted selection (MAS) in cotton breeding. In this study, 188 F8 recombinant inbred lines (RILs), derived from a intraspecific cross between HS46 and MARCABUCAG8US-1-88 were genotyped by the cotton 63K single nucleotide polymorphism (SNP) assay. Field trials were conducted in Sanya, Hainan Province, during the 2014–2015 cropping seasons under standard conditions. Results revealed significant differences (P < 0.05) among RILs, environments and replications for fiber quality and yield traits. Broad-sense heritabilities of all traits including fiber length, fiber uniformity, micronaire, fiber elongation, fiber strength, boll weight, and lint percentage ranged from 0.26 to 0.66. A 1784.28 cM (centimorgans) linkage map, harboring 2618 polymorphic SNP markers, was constructed, which had 0.68 cM per marker density. Seventy-one quantitative trait locus (QTLs) for fiber quality and yield traits were detected on 21 chromosomes, explaining 4.70∼32.28% phenotypic variance, in which 16 were identified as stable QTLs across two environments. Meanwhile, 12 certain regions were investigated to be involved in the control of one (hotspot) or more (cluster) traits, mainly focused on Chr05, Chr09, Chr10, Chr14, Chr19, and Chr20. Nineteen pairs of epistatic QTLs (e-QTLs) were identified, of which two pairs involved in two additive QTLs. These additive QTLs, e-QTLs, and QTL clusters were tightly linked to SNP markers, which may serve as target regions for map-based cloning, gene discovery, and MAS in cotton breeding. PMID:27660632

  20. RNA-seq based SNPs in some agronomically important oleiferous lines of Brassica rapa and their use for genome-wide linkage mapping and specific-region fine mapping

    PubMed Central

    2013-01-01

    Background Brassica rapa (AA) contains very diverse forms which include oleiferous types and many vegetable types. Genome sequence of B. rapa line Chiifu (ssp. pekinensis), a leafy vegetable type, was published in 2011. Using this knowledge, it is important to develop genomic resources for the oleiferous types of B. rapa. This will allow more involved molecular mapping, in-depth study of molecular mechanisms underlying important agronomic traits and introgression of traits from B. rapa to major oilseed crops - B. juncea (AABB) and B. napus (AACC). The study explores the availability of SNPs in RNA-seq generated contigs of three oleiferous lines of B. rapa - Candle (ssp. oleifera, turnip rape), YSPB-24 and Tetra (ssp. trilocularis, Yellow sarson) and their use in genome-wide linkage mapping and specific-region fine mapping using a RIL population between Chiifu and Tetra. Results RNA-seq was carried out on the RNA isolated from young inflorescences containing unopened floral buds, floral axis and small leaves, using Illumina paired-end sequencing technology. Sequence assembly was carried out using the Velvet de-novo programme and the assembled contigs were organised against Chiifu gene models, available in the BRAD-CDS database. RNA-seq confirmed the presence of more than 17,000 single-copy gene models described in the BRAD database. The assembled contigs and the BRAD gene models were analyzed for the presence of SSRs and SNPs. While the number of SSRs was limited, more than 0.2 million SNPs were observed between Chiifu and the three oleiferous lines. Assays for SNPs were designed using KASPar technology and tested on a F7-RIL population derived from a Chiifu x Tetra cross. The design of the SNP assays were based on three considerations - the 50 bp flanking region of the SNPs should be strictly similar, the SNP should have a read-depth of ≥7 and no exon/intron junction should be present within the 101 bp target region. Using these criteria, a total of 640 markers

  1. In Search of Genes Associated with Risk for Psychopathic Tendencies in Children: A Two-Stage Genome-Wide Association Study of Pooled DNA

    ERIC Educational Resources Information Center

    Viding, Essi; Hanscombe, Ken B.; Curtis, Charles J. C.; Davis, Oliver S. P.; Meaburn, Emma L.; Plomin, Robert

    2010-01-01

    Background: Quantitative genetic data from our group indicates that antisocial behaviour (AB) is strongly heritable when coupled with psychopathic, callous-unemotional (CU) personality traits. We have also demonstrated that the genetic influences for AB and CU overlap considerably. We conducted a genome-wide association scan that capitalises on…

  2. A genome-wide search for eigenetically regulated genes in zebra finch using MethylCap-seq and RNA-seq

    PubMed Central

    Steyaert, Sandra; Diddens, Jolien; Galle, Jeroen; De Meester, Ellen; De Keulenaer, Sarah; Bakker, Antje; Sohnius-Wilhelmi, Nina; Frankl-Vilches, Carolina; Van der Linden, Annemie; Van Criekinge, Wim; Vanden Berghe, Wim; De Meyer, Tim

    2016-01-01

    Learning and memory formation are known to require dynamic CpG (de)methylation and gene expression changes. Here, we aimed at establishing a genome-wide DNA methylation map of the zebra finch genome, a model organism in neuroscience, as well as identifying putatively epigenetically regulated genes. RNA- and MethylCap-seq experiments were performed on two zebra finch cell lines in presence or absence of 5-aza-2′-deoxycytidine induced demethylation. First, the MethylCap-seq methodology was validated in zebra finch by comparison with RRBS-generated data. To assess the influence of (variable) methylation on gene expression, RNA-seq experiments were performed as well. Comparison of RNA-seq and MethylCap-seq results showed that at least 357 of the 3,457 AZA-upregulated genes are putatively regulated by methylation in the promoter region, for which a pathway analysis showed remarkable enrichment for neurological networks. A subset of genes was validated using Exon Arrays, quantitative RT-PCR and CpG pyrosequencing on bisulfite-treated samples. To our knowledge, this study provides the first genome-wide DNA methylation map of the zebra finch genome as well as a comprehensive set of genes of which transcription is under putative methylation control. PMID:26864856

  3. Quantification of amylose, amylopectin, and β-glucan in search for genes controlling the three major quality traits in barley by genome-wide association studies

    PubMed Central

    Shu, Xiaoli; Rasmussen, Søren K.

    2014-01-01

    Genome-wide association studies (GWAS) for amylose, amylopectin and β-glucan concentration in a collection of 254 European spring barley varieties allowed to identify 20, 17, and 21 single nucleotide polymorphic (SNP) markers, respectively, associated with these important grain quality traits. Negative correlations between the content of amylose and β-glucan (R = −0.62, P < 0.01) and amylopectin and β-glucan (R = −0.487, P < 0.01) were found in this large collection of spring barley varieties. Besides HvCslF6, amo1 and AGPL2, sex6, and waxy were identified among the major genes responsible for β-glucan, amylose and amylopectin content, respectively. Several minor genes like HvGSL4, HvGSL3, and HvCesA6, PWD were also detected by GWAS for the first time. Furthermore, the gene encoding β-fructofuranosidase, located on the short arm of chromosome 7H at 1.49 cM, and SRF6, encoding “leucine-rich repeat receptor kinase protein” on chromosome 2 H, are proposed to be new candidate genes for amylopectin formation in barley endosperm. Several of the associated SNPs on chromosome 1, 5, 6, and 7H mapped to overlapping regions containing QTLs and genes controlling the three grain constituents. In particular chromosomes 5 and 7H carry many QTLs controlling barley grain quality. Amylose, amylopectin and β-glucan were interacted among each other through a metabolic network connected by UDP showing pleiotropic effects. Taken together, these results showed that cereal quality traits related each other and regulated through an interaction network, the identified major genes and genetic regions for amylose, amylopectin and β-glucan is a helpful for further research on carbohydrates and barley breeding. PMID:24860587

  4. Integration of Genome-Wide Computation DRE Search, AhR ChIP-chip and Gene Expression Analyses of TCDD-Elicited Responses in the Mouse Liver

    PubMed Central

    2011-01-01

    Background The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor (TF) that mediates responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Integration of TCDD-induced genome-wide AhR enrichment, differential gene expression and computational dioxin response element (DRE) analyses further elucidate the hepatic AhR regulatory network. Results Global ChIP-chip and gene expression analyses were performed on hepatic tissue from immature ovariectomized mice orally gavaged with 30 μg/kg TCDD. ChIP-chip analysis identified 14,446 and 974 AhR enriched regions (1% false discovery rate) at 2 and 24 hrs, respectively. Enrichment density was greatest in the proximal promoter, and more specifically, within ± 1.5 kb of a transcriptional start site (TSS). AhR enrichment also occurred distal to a TSS (e.g. intergenic DNA and 3' UTR), extending the potential gene expression regulatory roles of the AhR. Although TF binding site analyses identified over-represented DRE sequences within enriched regions, approximately 50% of all AhR enriched regions lacked a DRE core (5'-GCGTG-3'). Microarray analysis identified 1,896 number of TCDD-responsive genes (|fold change| ≥ 1.5, P1(t) > 0.999). Integrating this gene expression data with our ChIP-chip and DRE analyses only identified 625 differentially expressed genes that involved an AhR interaction at a DRE. Functional annotation analysis of differentially regulated genes associated with AhR enrichment identified overrepresented processes related to fatty acid and lipid metabolism and transport, and xenobiotic metabolism, which are consistent with TCDD-elicited steatosis in the mouse liver. Conclusions Details of the AhR regulatory network have been expanded to include AhR-DNA interactions within intragenic and intergenic genomic regions. Moreover, the AhR can interact with DNA independent of a DRE core suggesting there are alternative mechanisms of AhR-mediated gene regulation. PMID:21762485

  5. Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.

    PubMed

    Pathak, Deepali; Srivastava, Jyoti; Samad, Rana; Parwez, Iqbal; Kumar, Sudhir; Ali, Sher

    2010-06-01

    Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

  6. Genome-Wide Linkage Mapping of QTL for Yield Components, Plant Height and Yield-Related Physiological Traits in the Chinese Wheat Cross Zhou 8425B/Chinese Spring.

    PubMed

    Gao, Fengmei; Wen, Weie; Liu, Jindong; Rasheed, Awais; Yin, Guihong; Xia, Xianchun; Wu, Xiaoxia; He, Zhonghu

    2015-01-01

    Identification of genes for yield components, plant height (PH), and yield-related physiological traits and tightly linked molecular markers is of great importance in marker-assisted selection (MAS) in wheat breeding. In the present study, 246 F8 RILs derived from the cross of Zhou 8425B/Chinese Spring were genotyped using the high-density Illumina iSelect 90K single nucleotide polymorphism (SNP) assay. Field trials were conducted at Zhengzhou and Zhoukou of Henan Province, during the 2012-2013 and 2013-2014 cropping season under irrigated conditions, providing data for four environments. Analysis of variance (ANOVA) of agronomic and physiological traits revealed significant differences (P < 0.01) among RILs, environments, and RILs × environments interactions. Broad-sense heritabilities of all traits including thousand kernel weight (TKW), PH, spike length (SL), kernel number per spike (KNS), spike number/m(2) (SN), normalized difference in vegetation index at anthesis (NDVI-A) and at 10 days post-anthesis (NDVI-10), SPAD value of chlorophyll content at anthesis (Chl-A) and at 10 days post-anthesis (Chl-10) ranged between 0.65 and 0.94. A linkage map spanning 3609.4 cM was constructed using 5636 polymorphic SNP markers, with an average chromosome length of 171.9 cM and marker density of 0.64 cM/marker. A total of 866 SNP markers were newly mapped to the hexaploid wheat linkage map. Eighty-six QTL for yield components, PH, and yield-related physiological traits were detected on 18 chromosomes except 1D, 5D, and 6D, explaining 2.3-33.2% of the phenotypic variance. Ten stable QTL were identified across four environments, viz. QTKW.caas-6A.1, QTKW.caas-7AL, QKNS.caas-4AL, QSN.caas-1AL.1, QPH.caas-4BS.2, QPH.caas-4DS.1, QSL.caas-4AS, QSL.caas-4AL.1, QChl-A.caas-5AL, and QChl-10.caas-5BL. Meanwhile, 10 QTL-rich regions were found on chromosome 1BS, 2AL (2), 3AL, 4AL (2), 4BS, 4DS, 5BL, and 7AL exhibiting pleiotropic effects. These QTL or QTL clusters are tightly linked

  7. A novel statistic for genome-wide interaction analysis.

    PubMed

    Wu, Xuesen; Dong, Hua; Luo, Li; Zhu, Yun; Peng, Gang; Reveille, John D; Xiong, Momiao

    2010-09-23

    Although great progress in genome-wide association studies (GWAS) has been made, the significant SNP associations identified by GWAS account for only a few percent of the genetic variance, leading many to question where and how we can find the missing heritability. There is increasing interest in genome-wide interaction analysis as a possible source of finding heritability unexplained by current GWAS. However, the existing statistics for testing interaction have low power for genome-wide interaction analysis. To meet challenges raised by genome-wide interactional analysis, we have developed a novel statistic for testing interaction between two loci (either linked or unlinked). The null distribution and the type I error rates of the new statistic for testing interaction are validated using simulations. Extensive power studies show that the developed statistic has much higher power to detect interaction than classical logistic regression. The results identified 44 and 211 pairs of SNPs showing significant evidence of interactions with FDR<0.001 and 0.001genome-wide interaction analysis is a valuable tool for finding remaining missing heritability unexplained by the current GWAS, and the developed novel statistic is able to search significant interaction between SNPs across the genome. Real data analysis showed that the results of genome-wide interaction analysis can be replicated in two independent studies.

  8. A genome-wide scan for Eysenckian personality dimensions in adolescent twin sibships: psychoticism, extraversion, neuroticism, and lie.

    PubMed

    Gillespie, Nathan A; Zhu, Gu; Evans, David M; Medland, Sarah E; Wright, Margie J; Martin, Nick G

    2008-12-01

    We report the first genome-wide scan of adolescent personality. We conducted a genome-wide scan to detect linkage for measures of adolescent Psychoticism, Extraversion, Neuroticism, and Lie from the Junior Eysenck Personality Questionnaire. Data are based on 1,280 genotyped Australian adolescent twins and their siblings. The highest linkage peaks were found on chromosomes 16 and 19 for Neuroticism, on chromosomes 1, 7, 10, 13 m, and 18 for Psychoticism, and on chromosomes 2 and 3 for Extraversion.

  9. A genome-wide association study of antidepressant response in Koreans

    PubMed Central

    Myung, W; Kim, J; Lim, S-W; Shim, S; Won, H-H; Kim, Seonwoo; Kim, Sangha; Lee, M-S; Chang, H S; Kim, J-W; Carroll, B J; Kim, D K

    2015-01-01

    We conducted a three-stage genome-wide association study (GWAS) of response to antidepressant drugs in an ethnically homogeneous sample of Korean patients in untreated episodes of nonpsychotic unipolar depression, mostly of mature onset. Strict quality control was maintained in case selection, diagnosis, verification of adherence and outcome assessments. Analyzed cases completed 6 weeks of treatment with adequate plasma drug concentrations. The overall successful completion rate was 85.5%. Four candidate single-nucleotide polymorphisms (SNPs) on three chromosomes were identified by genome-wide search in the discovery sample of 481 patients who received one of four allowed selective serotonin reuptake inhibitor (SSRI) antidepressant drugs (Stage 1). In a focused replication study of 230 SSRI-treated patients, two of these four SNP candidates were confirmed (Stage 2). Analysis of the Stage 1 and Stage 2 samples combined (n=711) revealed GWAS significance (P=1.60 × 10-8) for these two SNP candidates, which were in perfect linkage disequilibrium. These two significant SNPs were confirmed also in a focused cross-replication study of 159 patients treated with the non-SSRI antidepressant drug mirtazapine (Stage 3). Analysis of the Stage 1, Stage 2 and Stage 3 samples combined (n=870) also revealed GWAS significance for these two SNPs, which was sustained after controlling for gender, age, number of previous episodes, age at onset and baseline severity (P=3.57 × 10-8). For each SNP, the response rate decreased (odds ratio=0.31, 95% confidence interval: 0.20–0.47) as a function of the number of minor alleles (non-response alleles). The two SNPs significantly associated with antidepressant response are rs7785360 and rs12698828 of the AUTS2 gene, located on chromosome 7 in 7q11.22. This gene has multiple known linkages to human psychological functions and neurobehavioral disorders. Rigorous replication efforts in other ethnic populations are recommended. PMID:26348319

  10. A genome-wide quantitative trait loci scan of neurocognitive performances in families with schizophrenia.

    PubMed

    Lien, Y-J; Liu, C-M; Faraone, S V; Tsuang, M T; Hwu, H-G; Hsiao, P-C; Chen, W J

    2010-10-01

    Patients with schizophrenia frequently display neurocognitive dysfunction, and genetic studies suggest it to be an endophenotype for schizophrenia. Genetic studies of such traits may thus help elucidate the biological pathways underlying genetic susceptibility to schizophrenia. This study aimed to identify loci influencing neurocognitive performance in schizophrenia. The sample comprised of 1207 affected individuals and 1035 unaffected individuals of Han Chinese ethnicity from 557 sib-pair families co-affected with DSM-IV (Diagnostic and Statistical Manual, Fourth Edition) schizophrenia. Subjects completed a face-to-face semi-structured interview, the continuous performance test (CPT) and the Wisconsin card sorting test (WCST), and were genotyped with 386 microsatellite markers across the genome. A series of autosomal genome-wide multipoint nonparametric quantitative trait loci (QTL) linkage analysis were performed in affected individuals only. Determination of genome-wide empirical significance was performed using 1000 simulated genome scans. One linkage peak attaining genome-wide significance was identified: 12q24.32 for undegraded CPT hit rate [nonparametric linkage z (NPL-Z) scores = 3.32, genome-wide empirical P = 0.03]. This result was higher than the peak linkage signal obtained in the previous genome-wide scan using a dichotomous diagnosis of schizophrenia. The identification of 12q24.32 as a QTL has not been consistently implicated in previous linkage studies on schizophrenia, which suggests that the analysis of endophenotypes provides additional information from what is seen in analyses that rely on diagnoses. This region with linkage to a particular neurocognitive feature may inform functional hypotheses for further genetic studies for schizophrenia.

  11. Genome-wide scans for footprints of natural selection

    PubMed Central

    Oleksyk, Taras K.; Smith, Michael W.; O'Brien, Stephen J.

    2010-01-01

    Detecting recent selected ‘genomic footprints’ applies directly to the discovery of disease genes and in the imputation of the formative events that molded modern population genetic structure. The imprints of historic selection/adaptation episodes left in human and animal genomes allow one to interpret modern and ancestral gene origins and modifications. Current approaches to reveal selected regions applied in genome-wide selection scans (GWSSs) fall into eight principal categories: (I) phylogenetic footprinting, (II) detecting increased rates of functional mutations, (III) evaluating divergence versus polymorphism, (IV) detecting extended segments of linkage disequilibrium, (V) evaluating local reduction in genetic variation, (VI) detecting changes in the shape of the frequency distribution (spectrum) of genetic variation, (VII) assessing differentiating between populations (FST), and (VIII) detecting excess or decrease in admixture contribution from one population. Here, we review and compare these approaches using available human genome-wide datasets to provide independent verification (or not) of regions found by different methods and using different populations. The lessons learned from GWSSs will be applied to identify genome signatures of historic selective pressures on genes and gene regions in other species with emerging genome sequences. This would offer considerable potential for genome annotation in functional, developmental and evolutionary contexts. PMID:20008396

  12. [Peach genomics and genome-wide association study: a review].

    PubMed

    Li, Xiong-Wei; Jia, Hui-Juan; Gao, Zhong-Shan

    2013-10-01

    Peach (Prunus persica (L.) Batsch) is one of the most predominant stone fruits in Rosaceae family. The broad climate adaption, diverse cultivation region and good fruit taste make it one of the favorate fruits by consumers. Improving fruit quality and enhancing disease/pest resistance are always a focus for peach genetists and breeders to follow with interests. This paper reviews the main achievements on linkage map and physical map construction, development of various molecular markers, whole genome sequencing and transcriptome sequencing for peach in recent years, and also elaborates the applications of genome wide association study (GWAS) with high density SNP markers in peach and other plant crops. This review also provides a theoretical basis for GWAS analysis in the future study to identify high efficient markers of targeted traits for peach.

  13. A genome-wide association study of attempted suicide

    PubMed Central

    Willour, Virginia L.; Seifuddin, Fayaz; Mahon, Pamela B.; Jancic, Dubravka; Pirooznia, Mehdi; Steele, Jo; Schweizer, Barbara; Goes, Fernando S.; Mondimore, Francis M.; MacKinnon, Dean F.; Perlis, Roy H.; Lee, Phil Hyoun; Huang, Jie; Kelsoe, John R.; Shilling, Paul D.; Rietschel, Marcella; Nöthen, Markus; Cichon, Sven; Gurling, Hugh; Purcell, Shaun; Smoller, Jordan W.; Craddock, Nicholas; DePaulo, J. Raymond; Schulze, Thomas G.; McMahon, Francis J.; Zandi, Peter P.; Potash, James B.

    2011-01-01

    The heritable component to attempted and completed suicide is partly related to psychiatric disorders and also partly independent of them. While attempted suicide linkage regions have been identified on 2p11–12 and 6q25–26, there are likely many more such loci, the discovery of which will require a much higher resolution approach, such as the genome-wide association study (GWAS). With this in mind, we conducted an attempted suicide GWAS that compared the single nucleotide polymorphism (SNP) genotypes of 1,201 bipolar (BP) subjects with a history of suicide attempts to the genotypes of 1,497 BP subjects without a history of suicide attempts. 2,507 SNPs with evidence for association at p<0.001 were identified. These associated SNPs were subsequently tested for association in a large and independent BP sample set. None of these SNPs were significantly associated in the replication sample after correcting for multiple testing, but the combined analysis of the two sample sets produced an association signal on 2p25 (rs300774) at the threshold of genome-wide significance (p= 5.07 × 10−8). The associated SNPs on 2p25 fall in a large linkage disequilibrium block containing the ACP1 gene, a gene whose expression is significantly elevated in BP subjects who have completed suicide. Furthermore, the ACP1 protein is a tyrosine phosphatase that influences Wnt signaling, a pathway regulated by lithium, making ACP1 a functional candidate for involvement in the phenotype. Larger GWAS sample sets will be required to confirm the signal on 2p25 and to identify additional genetic risk factors increasing susceptibility for attempted suicide. PMID:21423239

  14. A genome-wide association study of attempted suicide.

    PubMed

    Willour, V L; Seifuddin, F; Mahon, P B; Jancic, D; Pirooznia, M; Steele, J; Schweizer, B; Goes, F S; Mondimore, F M; Mackinnon, D F; Perlis, R H; Lee, P H; Huang, J; Kelsoe, J R; Shilling, P D; Rietschel, M; Nöthen, M; Cichon, S; Gurling, H; Purcell, S; Smoller, J W; Craddock, N; DePaulo, J R; Schulze, T G; McMahon, F J; Zandi, P P; Potash, J B

    2012-04-01

    The heritable component to attempted and completed suicide is partly related to psychiatric disorders and also partly independent of them. Although attempted suicide linkage regions have been identified on 2p11-12 and 6q25-26, there are likely many more such loci, the discovery of which will require a much higher resolution approach, such as the genome-wide association study (GWAS). With this in mind, we conducted an attempted suicide GWAS that compared the single-nucleotide polymorphism (SNP) genotypes of 1201 bipolar (BP) subjects with a history of suicide attempts to the genotypes of 1497 BP subjects without a history of suicide attempts. In all, 2507 SNPs with evidence for association at P<0.001 were identified. These associated SNPs were subsequently tested for association in a large and independent BP sample set. None of these SNPs were significantly associated in the replication sample after correcting for multiple testing, but the combined analysis of the two sample sets produced an association signal on 2p25 (rs300774) at the threshold of genome-wide significance (P=5.07 × 10(-8)). The associated SNPs on 2p25 fall in a large linkage disequilibrium block containing the ACP1 (acid phosphatase 1) gene, a gene whose expression is significantly elevated in BP subjects who have completed suicide. Furthermore, the ACP1 protein is a tyrosine phosphatase that influences Wnt signaling, a pathway regulated by lithium, making ACP1 a functional candidate for involvement in the phenotype. Larger GWAS sample sets will be required to confirm the signal on 2p25 and to identify additional genetic risk factors increasing susceptibility for attempted suicide. PMID:21423239

  15. Utilizing the Dog Genome in the Search for Novel Candidate Genes Involved in Glioma Development-Genome Wide Association Mapping followed by Targeted Massive Parallel Sequencing Identifies a Strongly Associated Locus.

    PubMed

    Truvé, Katarina; Dickinson, Peter; Xiong, Anqi; York, Daniel; Jayashankar, Kartika; Pielberg, Gerli; Koltookian, Michele; Murén, Eva; Fuxelius, Hans-Henrik; Weishaupt, Holger; Swartling, Fredrik J; Andersson, Göran; Hedhammar, Åke; Bongcam-Rudloff, Erik; Forsberg-Nilsson, Karin; Bannasch, Danika; Lindblad-Toh, Kerstin

    2016-05-01

    Gliomas are the most common form of malignant primary brain tumors in humans and second most common in dogs, occurring with similar frequencies in both species. Dogs are valuable spontaneous models of human complex diseases including cancers and may provide insight into disease susceptibility and oncogenesis. Several brachycephalic breeds such as Boxer, Bulldog and Boston Terrier have an elevated risk of developing glioma, but others, including Pug and Pekingese, are not at higher risk. To identify glioma-associated genetic susceptibility factors, an across-breed genome-wide association study (GWAS) was performed on 39 dog glioma cases and 141 controls from 25 dog breeds, identifying a genome-wide significant locus on canine chromosome (CFA) 26 (p = 2.8 x 10-8). Targeted re-sequencing of the 3.4 Mb candidate region was performed, followed by genotyping of the 56 SNVs that best fit the association pattern between the re-sequenced cases and controls. We identified three candidate genes that were highly associated with glioma susceptibility: CAMKK2, P2RX7 and DENR. CAMKK2 showed reduced expression in both canine and human brain tumors, and a non-synonymous variant in P2RX7, previously demonstrated to have a 50% decrease in receptor function, was also associated with disease. Thus, one or more of these genes appear to affect glioma susceptibility. PMID:27171399

  16. Utilizing the Dog Genome in the Search for Novel Candidate Genes Involved in Glioma Development—Genome Wide Association Mapping followed by Targeted Massive Parallel Sequencing Identifies a Strongly Associated Locus

    PubMed Central

    Dickinson, Peter; Xiong, Anqi; York, Daniel; Jayashankar, Kartika; Pielberg, Gerli; Koltookian, Michele; Murén, Eva; Fuxelius, Hans-Henrik; Weishaupt, Holger; Andersson, Göran; Hedhammar, Åke; Bongcam-Rudloff, Erik; Forsberg-Nilsson, Karin

    2016-01-01

    Gliomas are the most common form of malignant primary brain tumors in humans and second most common in dogs, occurring with similar frequencies in both species. Dogs are valuable spontaneous models of human complex diseases including cancers and may provide insight into disease susceptibility and oncogenesis. Several brachycephalic breeds such as Boxer, Bulldog and Boston Terrier have an elevated risk of developing glioma, but others, including Pug and Pekingese, are not at higher risk. To identify glioma-associated genetic susceptibility factors, an across-breed genome-wide association study (GWAS) was performed on 39 dog glioma cases and 141 controls from 25 dog breeds, identifying a genome-wide significant locus on canine chromosome (CFA) 26 (p = 2.8 x 10−8). Targeted re-sequencing of the 3.4 Mb candidate region was performed, followed by genotyping of the 56 SNVs that best fit the association pattern between the re-sequenced cases and controls. We identified three candidate genes that were highly associated with glioma susceptibility: CAMKK2, P2RX7 and DENR. CAMKK2 showed reduced expression in both canine and human brain tumors, and a non-synonymous variant in P2RX7, previously demonstrated to have a 50% decrease in receptor function, was also associated with disease. Thus, one or more of these genes appear to affect glioma susceptibility. PMID:27171399

  17. Searching for epistasis and linkage heterogeneity by correlations of pedigree-specific linkage scores.

    PubMed

    Schaid, Daniel J; McDonnell, Shannon K; Carlson, Erin E; Thibodeau, Stephen N; Stanford, Janet L; Ostrander, Elaine A

    2008-07-01

    Recognizing that multiple genes are likely responsible for common complex traits, statistical methods are needed to rapidly screen for either interacting genes or locus heterogeneity in genetic linkage data. To achieve this, some investigators have proposed examining the correlation of pedigree linkage scores between pairs of chromosomal regions, because large positive correlations suggest interacting loci and large negative correlations suggest locus heterogeneity (Cox et al. [1999]; Maclean et al. [1993]). However, the statistical significance of these extreme correlations has been difficult to determine due to the autocorrelation of linkage scores along chromosomes. In this study, we provide novel solutions to this problem by using results from random field theory, combined with simulations to determine the null correlation for syntenic loci. Simulations illustrate that our new methods control the Type-I error rates, so that one can avoid the extremely conservative Bonferroni correction, as well as the extremely time-consuming permutational method to compute P-values for non-syntenic loci. Application of these methods to prostate cancer linkage studies illustrates interpretation of results and provides insights into the impact of marker information content on the resulting statistical correlations, and ultimately the asymptotic P-values.

  18. Genome-wide association studies in neurology

    PubMed Central

    Tan, Meng-Shan; Jiang, Teng

    2014-01-01

    Genome-wide association studies (GWAS) are a powerful tool for understanding the genetic underpinnings of human disease. In this article, we briefly review the role and findings of GWAS in common neurological diseases, including Stroke, Alzheimer’s disease, Parkinson’s disease, epilepsy, multiple sclerosis, migraine, amyotrophic lateral sclerosis, frontotemporal lobar degeneration, restless legs syndrome, intracranial aneurysm, human prion diseases and moyamoya disease. We then discuss the present and future implications of these findings with regards to disease prediction, uncovering basic biology, and the development of potential therapeutic agents. PMID:25568877

  19. Genome-wide identification of enhancer elements.

    PubMed

    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel

    2016-01-01

    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems.

  20. Genome-wide identification of enhancer elements.

    PubMed

    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel

    2016-01-01

    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems. PMID:27389984

  1. Genome-wide approaches to schizophrenia.

    PubMed

    Duan, Jubao; Sanders, Alan R; Gejman, Pablo V

    2010-09-30

    Schizophrenia (SZ) is a common and severe psychiatric disorder with both environmental and genetic risk factors, and a high heritability. After over 20 years of molecular genetics research, new molecular strategies, primarily genome-wide association studies (GWAS), have generated major tangible progress. This new data provides evidence for: (1) a number of chromosomal regions with common polymorphisms showing genome-wide association with SZ (the major histocompatibility complex, MHC, region at 6p22-p21; 18q21.2; and 2q32.1). The associated alleles present small odds ratios (the odds of a risk variant being present in cases vs. controls) and suggest causative involvement of gene regulatory mechanisms in SZ. (2) Polygenic inheritance. (3) Involvement of rare (<1%) and large (>100kb) copy number variants (CNVs). (4) A genetic overlap of SZ with autism and with bipolar disorder (BP) challenging the classical clinical classifications. Most new SZ findings (chromosomal regions and genes) have generated new biological leads. These new findings, however, still need to be translated into a better understanding of the underlying biology and into causal mechanisms. Furthermore, a considerable amount of heritability still remains unexplained (missing heritability). Deep resequencing for rare variants and system biology approaches (e.g., integrating DNA sequence and functional data) are expected to further improve our understanding of the genetic architecture of SZ and its underlying biology. PMID:20433910

  2. Biostatistical aspects of genome-wide association studies.

    PubMed

    Ziegler, Andreas; König, Inke R; Thompson, John R

    2008-02-01

    To search the entire human genome for association is a novel and promising approach to unravelling the genetic basis of complex genetic diseases. In these genome-wide association studies (GWAs), several hundreds of thousands of single nucleotide polymorphisms (SNPs) are analyzed at the same time, posing substantial biostatistical and computational challenges. In this paper, we discuss a number of biostatistical aspects of GWAs in detail. We specifically consider quality control issues and show that signal intensity plots are a sine qua condition non in today's GWAs. Approaches to detect and adjust for population stratification are briefly examined. We discuss different strategies aimed at tackling the problem of multiple testing, including adjustment of p -values, the false positive report probability and the false discovery rate. Another aspect of GWAs requiring special attention is the search for gene-gene and gene-environment interactions. We finally describe multistage approaches to GWAs.

  3. Genome-Wide Association Studies of Cancer

    PubMed Central

    Stadler, Zsofia K.; Thom, Peter; Robson, Mark E.; Weitzel, Jeffrey N.; Kauff, Noah D.; Hurley, Karen E.; Devlin, Vincent; Gold, Bert; Klein, Robert J.; Offit, Kenneth

    2010-01-01

    Knowledge of the inherited risk for cancer is an important component of preventive oncology. In addition to well-established syndromes of cancer predisposition, much remains to be discovered about the genetic variation underlying susceptibility to common malignancies. Increased knowledge about the human genome and advances in genotyping technology have made possible genome-wide association studies (GWAS) of human diseases. These studies have identified many important regions of genetic variation associated with an increased risk for human traits and diseases including cancer. Understanding the principles, major findings, and limitations of GWAS is becoming increasingly important for oncologists as dissemination of genomic risk tests directly to consumers is already occurring through commercial companies. GWAS have contributed to our understanding of the genetic basis of cancer and will shed light on biologic pathways and possible new strategies for targeted prevention. To date, however, the clinical utility of GWAS-derived risk markers remains limited. PMID:20585100

  4. Genome-wide Membrane Protein Structure Prediction

    PubMed Central

    Piccoli, Stefano; Suku, Eda; Garonzi, Marianna; Giorgetti, Alejandro

    2013-01-01

    Transmembrane proteins allow cells to extensively communicate with the external world in a very accurate and specific way. They form principal nodes in several signaling pathways and attract large interest in therapeutic intervention, as the majority pharmaceutical compounds target membrane proteins. Thus, according to the current genome annotation methods, a detailed structural/functional characterization at the protein level of each of the elements codified in the genome is also required. The extreme difficulty in obtaining high-resolution three-dimensional structures, calls for computational approaches. Here we review to which extent the efforts made in the last few years, combining the structural characterization of membrane proteins with protein bioinformatics techniques, could help describing membrane proteins at a genome-wide scale. In particular we analyze the use of comparative modeling techniques as a way of overcoming the lack of high-resolution three-dimensional structures in the human membrane proteome. PMID:24403851

  5. Genome-wide association and genomic selection in animal breeding.

    PubMed

    Hayes, Ben; Goddard, Mike

    2010-11-01

    Results from genome-wide association studies in livestock, and humans, has lead to the conclusion that the effect of individual quantitative trait loci (QTL) on complex traits, such as yield, are likely to be small; therefore, a large number of QTL are necessary to explain genetic variation in these traits. Given this genetic architecture, gains from marker-assisted selection (MAS) programs using only a small number of DNA markers to trace a limited number of QTL is likely to be small. This has lead to the development of alternative technology for using the available dense single nucleotide polymorphism (SNP) information, called genomic selection. Genomic selection uses a genome-wide panel of dense markers so that all QTL are likely to be in linkage disequilibrium with at least one SNP. The genomic breeding values are predicted to be the sum of the effect of these SNPs across the entire genome. In dairy cattle breeding, the accuracy of genomic estimated breeding values (GEBV) that can be achieved and the fact that these are available early in life have lead to rapid adoption of the technology. Here, we discuss the design of experiments necessary to achieve accurate prediction of GEBV in future generations in terms of the number of markers necessary and the size of the reference population where marker effects are estimated. We also present a simple method for implementing genomic selection using a genomic relationship matrix. Future challenges discussed include using whole genome sequence data to improve the accuracy of genomic selection and management of inbreeding through genomic relationships.

  6. Genome-wide analysis correlates Ayurveda Prakriti

    PubMed Central

    Govindaraj, Periyasamy; Nizamuddin, Sheikh; Sharath, Anugula; Jyothi, Vuskamalla; Rotti, Harish; Raval, Ritu; Nayak, Jayakrishna; Bhat, Balakrishna K.; Prasanna, B. V.; Shintre, Pooja; Sule, Mayura; Joshi, Kalpana S.; Dedge, Amrish P.; Bharadwaj, Ramachandra; Gangadharan, G. G.; Nair, Sreekumaran; Gopinath, Puthiya M.; Patwardhan, Bhushan; Kondaiah, Paturu; Satyamoorthy, Kapaettu; Valiathan, Marthanda Varma Sankaran; Thangaraj, Kumarasamy

    2015-01-01

    The practice of Ayurveda, the traditional medicine of India, is based on the concept of three major constitutional types (Vata, Pitta and Kapha) defined as “Prakriti”. To the best of our knowledge, no study has convincingly correlated genomic variations with the classification of Prakriti. In the present study, we performed genome-wide SNP (single nucleotide polymorphism) analysis (Affymetrix, 6.0) of 262 well-classified male individuals (after screening 3416 subjects) belonging to three Prakritis. We found 52 SNPs (p ≤ 1 × 10−5) were significantly different between Prakritis, without any confounding effect of stratification, after 106 permutations. Principal component analysis (PCA) of these SNPs classified 262 individuals into their respective groups (Vata, Pitta and Kapha) irrespective of their ancestry, which represent its power in categorization. We further validated our finding with 297 Indian population samples with known ancestry. Subsequently, we found that PGM1 correlates with phenotype of Pitta as described in the ancient text of Caraka Samhita, suggesting that the phenotypic classification of India’s traditional medicine has a genetic basis; and its Prakriti-based practice in vogue for many centuries resonates with personalized medicine. PMID:26511157

  7. Genome-wide analysis correlates Ayurveda Prakriti.

    PubMed

    Govindaraj, Periyasamy; Nizamuddin, Sheikh; Sharath, Anugula; Jyothi, Vuskamalla; Rotti, Harish; Raval, Ritu; Nayak, Jayakrishna; Bhat, Balakrishna K; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Joshi, Kalpana S; Dedge, Amrish P; Bharadwaj, Ramachandra; Gangadharan, G G; Nair, Sreekumaran; Gopinath, Puthiya M; Patwardhan, Bhushan; Kondaiah, Paturu; Satyamoorthy, Kapaettu; Valiathan, Marthanda Varma Sankaran; Thangaraj, Kumarasamy

    2015-10-29

    The practice of Ayurveda, the traditional medicine of India, is based on the concept of three major constitutional types (Vata, Pitta and Kapha) defined as "Prakriti". To the best of our knowledge, no study has convincingly correlated genomic variations with the classification of Prakriti. In the present study, we performed genome-wide SNP (single nucleotide polymorphism) analysis (Affymetrix, 6.0) of 262 well-classified male individuals (after screening 3416 subjects) belonging to three Prakritis. We found 52 SNPs (p ≤ 1 × 10(-5)) were significantly different between Prakritis, without any confounding effect of stratification, after 10(6) permutations. Principal component analysis (PCA) of these SNPs classified 262 individuals into their respective groups (Vata, Pitta and Kapha) irrespective of their ancestry, which represent its power in categorization. We further validated our finding with 297 Indian population samples with known ancestry. Subsequently, we found that PGM1 correlates with phenotype of Pitta as described in the ancient text of Caraka Samhita, suggesting that the phenotypic classification of India's traditional medicine has a genetic basis; and its Prakriti-based practice in vogue for many centuries resonates with personalized medicine.

  8. Genome-wide epigenetic modifications in cancer.

    PubMed

    Park, Yoon Jung; Claus, Rainer; Weichenhan, Dieter; Plass, Christoph

    2011-01-01

    Epigenetic alterations in cancer include changes in DNA methylation and associated histone modifications that influence the chromatin states and impact gene expression patterns. Due to recent technological advantages, the scientific community is now obtaining a better picture of the genome-wide epigenetic changes that occur in a cancer genome. These epigenetic alterations are associated with chromosomal instability and changes in transcriptional control which influence the overall gene expression differences seen in many human malignancies. In this review, we will briefly summarize our current knowledge of the epigenetic patterns and mechanisms of gene regulation in healthy tissues and relate this to what is known for cancer genomes. Our focus will be on DNA methylation. We will review the current standing of technologies that have been developed over recent years. This field is experiencing a revolution in the strategies used to measure epigenetic alterations, which includes the incorporation of next generation sequencing tools. We also will review strategies that utilize epigenetic information for translational purposes, with a special emphasis on the potential use of DNA methylation marks for early disease detection and prognosis. The review will close with an outlook on challenges that this field is facing.

  9. Genome-wide discovery of DNA polymorphism in Brassica rapa.

    PubMed

    Park, Soomin; Yu, Hee-Ju; Mun, Jeong-Hwan; Lee, Seung-Chan

    2010-02-01

    Single nucleotide polymorphisms (SNPs) and/or insertion/deletions (InDels) are frequent sequence variations in the plant genome, which can be developed as molecular markers for genetic studies on crop improvement. The ongoing Brassica rapa genome sequencing project has generated vast amounts of sequence data useful in genetic research. Here, we report a genome-wide survey of DNA polymorphisms in the B. rapa genome based on the 557 bacterial artificial clone sequences of B. rapa ssp. pekinensis cv. Chiifu. We identified and characterized 21,311 SNPs and 6,753 InDels in the gene space of the B. rapa genome by re-sequencing 1,398 sequence-tagged sites (STSs) in eight genotypes. Comparison of our findings with a B. rapa genetic linkage map confirmed that STS loci were distributed randomly over the B. rapa whole genome. In the 1.4 Mb of aligned sequences, mean nucleotide polymorphism and diversity were theta = 0.00890 and pi = 0.00917, respectively. Additionally, the nucleotide diversity in introns was almost three times greater than that in exons, and the frequency of observed InDel was almost 17 times higher in introns than in exons. Information regarding SNPs/InDels obtained here will provide an important resource for genetic studies and breeding programs of B. rapa.

  10. Genome-wide association study and premature ovarian failure.

    PubMed

    Christin-Maitre, S; Tachdjian, G

    2010-05-01

    Premature ovarian failure (POF) is defined as an amenorrhea for more than 4months, associated with elevated gonadotropins, usually higher than 20mIU/ml, occurring in a woman before the age of 40. Some candidate genes have been identified in the past 15years, such as FOXL2, FSHR, BMP15, GDF9, Xfra premutation. However, POF etiology remains unknown in more than 90% of cases. The first strategy to identify candidate gene, apart from studying genes involved in ovarian failure in animal models, relies on the study of X chromosome deletions and X;autosome translocations in patients. The second strategy is based on linkage analysis, the third one on Comparative Genomic Hybridization (CGH) array. The latest strategy relies on Genome-Wide Association Studies (GWAS). This technique consists in screening single nucleotide polymorphisms (SNPs) in patients and controls. So far, three studies have been performed and have identified different loci potentially linked to POF, such as PTHB1 and ADAMTS19. However, replications in independent cohorts need to be performed. GWAS studies on large cohorts of women with POF should find new candidate genes in the near future.

  11. Genome Wide Methylome Alterations in Lung Cancer.

    PubMed

    Mullapudi, Nandita; Ye, Bin; Suzuki, Masako; Fazzari, Melissa; Han, Weiguo; Shi, Miao K; Marquardt, Gaby; Lin, Juan; Wang, Tao; Keller, Steven; Zhu, Changcheng; Locker, Joseph D; Spivack, Simon D

    2015-01-01

    Aberrant cytosine 5-methylation underlies many deregulated elements of cancer. Among paired non-small cell lung cancers (NSCLC), we sought to profile DNA 5-methyl-cytosine features which may underlie genome-wide deregulation. In one of the more dense interrogations of the methylome, we sampled 1.2 million CpG sites from twenty-four NSCLC tumor (T)-non-tumor (NT) pairs using a methylation-sensitive restriction enzyme- based HELP-microarray assay. We found 225,350 differentially methylated (DM) sites in adenocarcinomas versus adjacent non-tumor tissue that vary in frequency across genomic compartment, particularly notable in gene bodies (GB; p<2.2E-16). Further, when DM was coupled to differential transcriptome (DE) in the same samples, 37,056 differential loci in adenocarcinoma emerged. Approximately 90% of the DM-DE relationships were non-canonical; for example, promoter DM associated with DE in the same direction. Of the canonical changes noted, promoter (PR) DM loci with reciprocal changes in expression in adenocarcinomas included HBEGF, AGER, PTPRM, DPT, CST1, MELK; DM GB loci with concordant changes in expression included FOXM1, FERMT1, SLC7A5, and FAP genes. IPA analyses showed adenocarcinoma-specific promoter DMxDE overlay identified familiar lung cancer nodes [tP53, Akt] as well as less familiar nodes [HBEGF, NQO1, GRK5, VWF, HPGD, CDH5, CTNNAL1, PTPN13, DACH1, SMAD6, LAMA3, AR]. The unique findings from this study include the discovery of numerous candidate The unique findings from this study include the discovery of numerous candidate methylation sites in both PR and GB regions not previously identified in NSCLC, and many non-canonical relationships to gene expression. These DNA methylation features could potentially be developed as risk or diagnostic biomarkers, or as candidate targets for newer methylation locus-targeted preventive or therapeutic agents. PMID:26683690

  12. Genome Wide Methylome Alterations in Lung Cancer

    PubMed Central

    Suzuki, Masako; Fazzari, Melissa; Han, Weiguo; Shi, Miao K.; Marquardt, Gaby; Lin, Juan; Wang, Tao; Keller, Steven; Zhu, Changcheng; Locker, Joseph D.; Spivack, Simon D.

    2015-01-01

    Aberrant cytosine 5-methylation underlies many deregulated elements of cancer. Among paired non-small cell lung cancers (NSCLC), we sought to profile DNA 5-methyl-cytosine features which may underlie genome-wide deregulation. In one of the more dense interrogations of the methylome, we sampled 1.2 million CpG sites from twenty-four NSCLC tumor (T)–non-tumor (NT) pairs using a methylation-sensitive restriction enzyme- based HELP-microarray assay. We found 225,350 differentially methylated (DM) sites in adenocarcinomas versus adjacent non-tumor tissue that vary in frequency across genomic compartment, particularly notable in gene bodies (GB; p<2.2E-16). Further, when DM was coupled to differential transcriptome (DE) in the same samples, 37,056 differential loci in adenocarcinoma emerged. Approximately 90% of the DM-DE relationships were non-canonical; for example, promoter DM associated with DE in the same direction. Of the canonical changes noted, promoter (PR) DM loci with reciprocal changes in expression in adenocarcinomas included HBEGF, AGER, PTPRM, DPT, CST1, MELK; DM GB loci with concordant changes in expression included FOXM1, FERMT1, SLC7A5, and FAP genes. IPA analyses showed adenocarcinoma-specific promoter DMxDE overlay identified familiar lung cancer nodes [tP53, Akt] as well as less familiar nodes [HBEGF, NQO1, GRK5, VWF, HPGD, CDH5, CTNNAL1, PTPN13, DACH1, SMAD6, LAMA3, AR]. The unique findings from this study include the discovery of numerous candidate The unique findings from this study include the discovery of numerous candidate methylation sites in both PR and GB regions not previously identified in NSCLC, and many non-canonical relationships to gene expression. These DNA methylation features could potentially be developed as risk or diagnostic biomarkers, or as candidate targets for newer methylation locus-targeted preventive or therapeutic agents. PMID:26683690

  13. Genome-Wide Methylation Profiling of Schizophrenia

    PubMed Central

    Rukova, B; Staneva, R; Hadjidekova, S; Stamenov, G; Milanova; Toncheva, D

    2014-01-01

    Schizophrenia is one of the major psychiatric disorders. It is a disorder of complex inheritance, involving both heritable and environmental factors. DNA methylation is an inheritable epigenetic modification that stably alters gene expression. We reasoned that genetic modifications that are a result of environmental stimuli could also make a contribution. We have performed 26 high-resolution genome-wide methylation array analyses to determine the methylation status of 27,627 CpG islands and compared the data between patients and healthy controls. Methylation profiles of DNAs were analyzed in six pools: 220 schizophrenia patients; 220 age-matched healthy controls; 110 female schizophrenia patients; 110 age-matched healthy females; 110 male schizophrenia patients; 110 age-matched healthy males. We also investigated the methylation status of 20 individual patient DNA samples (eight females and 12 males. We found significant differences in the methylation profile between schizophrenia and control DNA pools. We found new candidate genes that principally participate in apoptosis, synaptic transmission and nervous system development (GABRA2, LIN7B, CASP3). Methylation profiles differed between the genders. In females, the most important genes participate in apoptosis and synaptic transmission (XIAP, GABRD, OXT, KRT7), whereas in the males, the implicated genes in the molecular pathology of the disease were DHX37, MAP2K2, FNDC4 and GIPC1. Data from the individual methylation analyses confirmed, the gender-specific pools results. Our data revealed major differences in methylation profiles between schizophrenia patients and controls and between male and female patients. The dysregulated activity of the candidate genes could play a role in schizophrenia pathogenesis. PMID:25937794

  14. Genome-wide identification and characterization of simple sequence repeat loci in grape phylloxera, Daktulosphaira vitifoliae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A genome-wide sequence search was conducted to identify simple sequence repeat (SSR) loci in phylloxera, Daktulosphaira vitifoliae (Fitch), a key grape pest throughout the world. Collectively, 1,524 SSR loci containing mono, di-, tri-, tetra-, penta- and hexanucleotide motifs were identified. Among...

  15. Genome-wide discovery of drug-dependent human liver regulatory elements.

    PubMed

    Smith, Robin P; Eckalbar, Walter L; Morrissey, Kari M; Luizon, Marcelo R; Hoffmann, Thomas J; Sun, Xuefeng; Jones, Stacy L; Force Aldred, Shelley; Ramamoorthy, Anuradha; Desta, Zeruesenay; Liu, Yunlong; Skaar, Todd C; Trinklein, Nathan D; Giacomini, Kathleen M; Ahituv, Nadav

    2014-10-01

    Inter-individual variation in gene regulatory elements is hypothesized to play a causative role in adverse drug reactions and reduced drug activity. However, relatively little is known about the location and function of drug-dependent elements. To uncover drug-associated elements in a genome-wide manner, we performed RNA-seq and ChIP-seq using antibodies against the pregnane X receptor (PXR) and three active regulatory marks (p300, H3K4me1, H3K27ac) on primary human hepatocytes treated with rifampin or vehicle control. Rifampin and PXR were chosen since they are part of the CYP3A4 pathway, which is known to account for the metabolism of more than 50% of all prescribed drugs. We selected 227 proximal promoters for genes with rifampin-dependent expression or nearby PXR/p300 occupancy sites and assayed their ability to induce luciferase in rifampin-treated HepG2 cells, finding only 10 (4.4%) that exhibited drug-dependent activity. As this result suggested a role for distal enhancer modules, we searched more broadly to identify 1,297 genomic regions bearing a conditional PXR occupancy as well as all three active regulatory marks. These regions are enriched near genes that function in the metabolism of xenobiotics, specifically members of the cytochrome P450 family. We performed enhancer assays in rifampin-treated HepG2 cells for 42 of these sequences as well as 7 sequences that overlap linkage-disequilibrium blocks defined by lead SNPs from pharmacogenomic GWAS studies, revealing 15/42 and 4/7 to be functional enhancers, respectively. A common African haplotype in one of these enhancers in the GSTA locus was found to exhibit potential rifampin hypersensitivity. Combined, our results further suggest that enhancers are the predominant targets of rifampin-induced PXR activation, provide a genome-wide catalog of PXR targets and serve as a model for the identification of drug-responsive regulatory elements.

  16. Genome-Wide Discovery of Drug-Dependent Human Liver Regulatory Elements

    PubMed Central

    Morrissey, Kari M.; Luizon, Marcelo R.; Hoffmann, Thomas J.; Sun, Xuefeng; Jones, Stacy L.; Force Aldred, Shelley; Ramamoorthy, Anuradha; Desta, Zeruesenay; Liu, Yunlong; Skaar, Todd C.; Trinklein, Nathan D.; Giacomini, Kathleen M.; Ahituv, Nadav

    2014-01-01

    Inter-individual variation in gene regulatory elements is hypothesized to play a causative role in adverse drug reactions and reduced drug activity. However, relatively little is known about the location and function of drug-dependent elements. To uncover drug-associated elements in a genome-wide manner, we performed RNA-seq and ChIP-seq using antibodies against the pregnane X receptor (PXR) and three active regulatory marks (p300, H3K4me1, H3K27ac) on primary human hepatocytes treated with rifampin or vehicle control. Rifampin and PXR were chosen since they are part of the CYP3A4 pathway, which is known to account for the metabolism of more than 50% of all prescribed drugs. We selected 227 proximal promoters for genes with rifampin-dependent expression or nearby PXR/p300 occupancy sites and assayed their ability to induce luciferase in rifampin-treated HepG2 cells, finding only 10 (4.4%) that exhibited drug-dependent activity. As this result suggested a role for distal enhancer modules, we searched more broadly to identify 1,297 genomic regions bearing a conditional PXR occupancy as well as all three active regulatory marks. These regions are enriched near genes that function in the metabolism of xenobiotics, specifically members of the cytochrome P450 family. We performed enhancer assays in rifampin-treated HepG2 cells for 42 of these sequences as well as 7 sequences that overlap linkage-disequilibrium blocks defined by lead SNPs from pharmacogenomic GWAS studies, revealing 15/42 and 4/7 to be functional enhancers, respectively. A common African haplotype in one of these enhancers in the GSTA locus was found to exhibit potential rifampin hypersensitivity. Combined, our results further suggest that enhancers are the predominant targets of rifampin-induced PXR activation, provide a genome-wide catalog of PXR targets and serve as a model for the identification of drug-responsive regulatory elements. PMID:25275310

  17. Efficient strategies for genomic searching using the affected-pedigree-member method of linkage analysis

    SciTech Connect

    Brown, D.L.; Gorin, M.B.; Weeks, D.E. )

    1994-03-01

    The affected-pedigree-member (APM) method of linkage analysis is a nonparametric statistic that tests for nonrandom cosegregation of a disease and marker loci. The APM statistic is based on the observation that if a marker locus is near a disease-susceptibility locus, then affected individuals within a family should be more similar at the marker locus than is expected by chance. The APM statistic measures marker similarity in terms of identity by state (IBS) of marker alleles; that is, two alleles are IBS if they are the same, regardless of their ancestral origin. Since the APM statistic measures increased marker similarity, it makes no assumptions concerning how the disease is inherited; this can be an advantage when dealing with complex diseases for which the mode of inheritance is difficult to determine. The authors investigate here the power of the APM statistic to detect linkage in the context of a genomewide search. In such a search, the APM statistic is evaluated at a grid of markers. Then regions with high APM statistics are investigated more thoroughly by typing more markers in the region. Using simulated data, they investigate various search strategies and recommended an optimal search strategy that maximizes the power to detect linkage while minimizing the false-positive rate and number of markers. They determine an optimal series of three increasing cut-points and an independent criterion for significance. 14 refs., 7 figs., 4 tabs.

  18. Improved Statistics for Genome-Wide Interaction Analysis

    PubMed Central

    Ueki, Masao; Cordell, Heather J.

    2012-01-01

    Recently, Wu and colleagues [1] proposed two novel statistics for genome-wide interaction analysis using case/control or case-only data. In computer simulations, their proposed case/control statistic outperformed competing approaches, including the fast-epistasis option in PLINK and logistic regression analysis under the correct model; however, reasons for its superior performance were not fully explored. Here we investigate the theoretical properties and performance of Wu et al.'s proposed statistics and explain why, in some circumstances, they outperform competing approaches. Unfortunately, we find minor errors in the formulae for their statistics, resulting in tests that have higher than nominal type 1 error. We also find minor errors in PLINK's fast-epistasis and case-only statistics, although theory and simulations suggest that these errors have only negligible effect on type 1 error. We propose adjusted versions of all four statistics that, both theoretically and in computer simulations, maintain correct type 1 error rates under the null hypothesis. We also investigate statistics based on correlation coefficients that maintain similar control of type 1 error. Although designed to test specifically for interaction, we show that some of these previously-proposed statistics can, in fact, be sensitive to main effects at one or both loci, particularly in the presence of linkage disequilibrium. We propose two new “joint effects” statistics that, provided the disease is rare, are sensitive only to genuine interaction effects. In computer simulations we find, in most situations considered, that highest power is achieved by analysis under the correct genetic model. Such an analysis is unachievable in practice, as we do not know this model. However, generally high power over a wide range of scenarios is exhibited by our joint effects and adjusted Wu statistics. We recommend use of these alternative or adjusted statistics and urge caution when using Wu et al

  19. Improved statistics for genome-wide interaction analysis.

    PubMed

    Ueki, Masao; Cordell, Heather J

    2012-01-01

    Recently, Wu and colleagues [1] proposed two novel statistics for genome-wide interaction analysis using case/control or case-only data. In computer simulations, their proposed case/control statistic outperformed competing approaches, including the fast-epistasis option in PLINK and logistic regression analysis under the correct model; however, reasons for its superior performance were not fully explored. Here we investigate the theoretical properties and performance of Wu et al.'s proposed statistics and explain why, in some circumstances, they outperform competing approaches. Unfortunately, we find minor errors in the formulae for their statistics, resulting in tests that have higher than nominal type 1 error. We also find minor errors in PLINK's fast-epistasis and case-only statistics, although theory and simulations suggest that these errors have only negligible effect on type 1 error. We propose adjusted versions of all four statistics that, both theoretically and in computer simulations, maintain correct type 1 error rates under the null hypothesis. We also investigate statistics based on correlation coefficients that maintain similar control of type 1 error. Although designed to test specifically for interaction, we show that some of these previously-proposed statistics can, in fact, be sensitive to main effects at one or both loci, particularly in the presence of linkage disequilibrium. We propose two new "joint effects" statistics that, provided the disease is rare, are sensitive only to genuine interaction effects. In computer simulations we find, in most situations considered, that highest power is achieved by analysis under the correct genetic model. Such an analysis is unachievable in practice, as we do not know this model. However, generally high power over a wide range of scenarios is exhibited by our joint effects and adjusted Wu statistics. We recommend use of these alternative or adjusted statistics and urge caution when using Wu et al

  20. Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI

    PubMed Central

    Vimaleswaran, Karani S.; Tachmazidou, Ioanna; Zhao, Jing Hua; Hirschhorn, Joel N.; Dudbridge, Frank; Loos, Ruth J.F.

    2012-01-01

    Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10−7. Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits. PMID:22791748

  1. Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI.

    PubMed

    Vimaleswaran, Karani S; Tachmazidou, Ioanna; Zhao, Jing Hua; Hirschhorn, Joel N; Dudbridge, Frank; Loos, Ruth J F

    2012-10-15

    Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10(-7). Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits.

  2. Genome-Wide Specific Selection in Three Domestic Sheep Breeds

    PubMed Central

    Cao, Jiaxve; Wu, Mingming; Ma, Xiaomeng; Liu, Zhen; Liu, Ruizao; Zhao, Fuping; Wei, Caihong; Du, Lixin

    2015-01-01

    Background Commercial sheep raised for mutton grow faster than traditional Chinese sheep breeds. Here, we aimed to evaluate genetic selection among three different types of sheep breed: two well-known commercial mutton breeds and one indigenous Chinese breed. Results We first combined locus-specific branch lengths and di statistical methods to detect candidate regions targeted by selection in the three different populations. The results showed that the genetic distances reached at least medium divergence for each pairwise combination. We found these two methods were highly correlated, and identified many growth-related candidate genes undergoing artificial selection. For production traits, APOBR and FTO are associated with body mass index. For meat traits, ALDOA, STK32B and FAM190A are related to marbling. For reproduction traits, CCNB2 and SLC8A3 affect oocyte development. We also found two well-known genes, GHR (which affects meat production and quality) and EDAR (associated with hair thickness) were associated with German mutton merino sheep. Furthermore, four genes (POL, RPL7, MSL1 and SHISA9) were associated with pre-weaning gain in our previous genome-wide association study. Conclusions Our results indicated that combine locus-specific branch lengths and di statistical approaches can reduce the searching ranges for specific selection. And we got many credible candidate genes which not only confirm the results of previous reports, but also provide a suite of novel candidate genes in defined breeds to guide hybridization breeding. PMID:26083354

  3. Genome-Wide Scan Reveals Mutation Associated with Melanoma

    MedlinePlus

    ... 1999 Spotlight on Research 2012 July 2012 (historical) Genome-Wide Scan Reveals Mutation Associated with Melanoma A ... out to see if a technology called whole genome sequencing would help them find other genetic risk ...

  4. FINEMAP: efficient variable selection using summary data from genome-wide association studies

    PubMed Central

    Benner, Christian; Spencer, Chris C.A.; Havulinna, Aki S.; Salomaa, Veikko; Ripatti, Samuli; Pirinen, Matti

    2016-01-01

    Motivation: The goal of fine-mapping in genomic regions associated with complex diseases and traits is to identify causal variants that point to molecular mechanisms behind the associations. Recent fine-mapping methods using summary data from genome-wide association studies rely on exhaustive search through all possible causal configurations, which is computationally expensive. Results: We introduce FINEMAP, a software package to efficiently explore a set of the most important causal configurations of the region via a shotgun stochastic search algorithm. We show that FINEMAP produces accurate results in a fraction of processing time of existing approaches and is therefore a promising tool for analyzing growing amounts of data produced in genome-wide association studies and emerging sequencing projects. Availability and implementation: FINEMAP v1.0 is freely available for Mac OS X and Linux at http://www.christianbenner.com. Contact: christian.benner@helsinki.fi or matti.pirinen@helsinki.fi PMID:26773131

  5. Population genomic and genome-wide association studies of agroclimatic traits in sorghum.

    PubMed

    Morris, Geoffrey P; Ramu, Punna; Deshpande, Santosh P; Hash, C Thomas; Shah, Trushar; Upadhyaya, Hari D; Riera-Lizarazu, Oscar; Brown, Patrick J; Acharya, Charlotte B; Mitchell, Sharon E; Harriman, James; Glaubitz, Jeffrey C; Buckler, Edward S; Kresovich, Stephen

    2013-01-01

    Accelerating crop improvement in sorghum, a staple food for people in semiarid regions across the developing world, is key to ensuring global food security in the context of climate change. To facilitate gene discovery and molecular breeding in sorghum, we have characterized ~265,000 single nucleotide polymorphisms (SNPs) in 971 worldwide accessions that have adapted to diverse agroclimatic conditions. Using this genome-wide SNP map, we have characterized population structure with respect to geographic origin and morphological type and identified patterns of ancient crop diffusion to diverse agroclimatic regions across Africa and Asia. To better understand the genomic patterns of diversification in sorghum, we quantified variation in nucleotide diversity, linkage disequilibrium, and recombination rates across the genome. Analyzing nucleotide diversity in landraces, we find evidence of selective sweeps around starch metabolism genes, whereas in landrace-derived introgression lines, we find introgressions around known height and maturity loci. To identify additional loci underlying variation in major agroclimatic traits, we performed genome-wide association studies (GWAS) on plant height components and inflorescence architecture. GWAS maps several classical loci for plant height, candidate genes for inflorescence architecture. Finally, we trace the independent spread of multiple haplotypes carrying alleles for short stature or long inflorescence branches. This genome-wide map of SNP variation in sorghum provides a basis for crop improvement through marker-assisted breeding and genomic selection. PMID:23267105

  6. Testing untyped alleles (TUNA)-applications to genome-wide association studies.

    PubMed

    Nicolae, Dan L

    2006-12-01

    The large number of tests performed in analyzing data from genome-wide association studies has a large impact on the power of detecting risk variants, and analytic strategies specifying the optimal set of hypotheses to be tested are necessary. We propose a genome-wide strategy that is based on one degree of freedom tests for all the genotyped variants, and for all the untyped variants for which there is sufficient information in the observed data. The set of untyped variants to be tested is found using multi-locus measures of linkage disequilibrium and haplotype frequencies from a reference database such as HapMap (The International HapMap Consortium [2003] Nature 426:789-796). We introduce a novel statistic for testing differences in allele frequencies for untyped variation that is based on linear combinations of estimable haplotype frequencies. Algorithms for finding the sets of genotyped markers to be used in testing an untyped allele, and ways of incorporating haplotypes observed in the study data but not in the reference database are also described. The proposed testing strategy can be used as the first step in the analysis of genome-wide association data, and, because every performed test is directed to a marker, it can be used to specify the set of polymorphisms to genotype in follow-up studies. The described methodology provides also a tool for joint analysis of data from studies done on different platforms.

  7. Population genomic and genome-wide association studies of agroclimatic traits in sorghum

    PubMed Central

    Morris, Geoffrey P.; Ramu, Punna; Deshpande, Santosh P.; Hash, C. Thomas; Shah, Trushar; Upadhyaya, Hari D.; Riera-Lizarazu, Oscar; Brown, Patrick J.; Acharya, Charlotte B.; Mitchell, Sharon E.; Harriman, James; Glaubitz, Jeffrey C.; Buckler, Edward S.; Kresovich, Stephen

    2013-01-01

    Accelerating crop improvement in sorghum, a staple food for people in semiarid regions across the developing world, is key to ensuring global food security in the context of climate change. To facilitate gene discovery and molecular breeding in sorghum, we have characterized ∼265,000 single nucleotide polymorphisms (SNPs) in 971 worldwide accessions that have adapted to diverse agroclimatic conditions. Using this genome-wide SNP map, we have characterized population structure with respect to geographic origin and morphological type and identified patterns of ancient crop diffusion to diverse agroclimatic regions across Africa and Asia. To better understand the genomic patterns of diversification in sorghum, we quantified variation in nucleotide diversity, linkage disequilibrium, and recombination rates across the genome. Analyzing nucleotide diversity in landraces, we find evidence of selective sweeps around starch metabolism genes, whereas in landrace-derived introgression lines, we find introgressions around known height and maturity loci. To identify additional loci underlying variation in major agroclimatic traits, we performed genome-wide association studies (GWAS) on plant height components and inflorescence architecture. GWAS maps several classical loci for plant height, candidate genes for inflorescence architecture. Finally, we trace the independent spread of multiple haplotypes carrying alleles for short stature or long inflorescence branches. This genome-wide map of SNP variation in sorghum provides a basis for crop improvement through marker-assisted breeding and genomic selection. PMID:23267105

  8. Genome-wide evidence for speciation with gene flow in Heliconius butterflies.

    PubMed

    Martin, Simon H; Dasmahapatra, Kanchon K; Nadeau, Nicola J; Salazar, Camilo; Walters, James R; Simpson, Fraser; Blaxter, Mark; Manica, Andrea; Mallet, James; Jiggins, Chris D

    2013-11-01

    Most speciation events probably occur gradually, without complete and immediate reproductive isolation, but the full extent of gene flow between diverging species has rarely been characterized on a genome-wide scale. Documenting the extent and timing of admixture between diverging species can clarify the role of geographic isolation in speciation. Here we use new methodology to quantify admixture at different stages of divergence in Heliconius butterflies, based on whole-genome sequences of 31 individuals. Comparisons between sympatric and allopatric populations of H. melpomene, H. cydno, and H. timareta revealed a genome-wide trend of increased shared variation in sympatry, indicative of pervasive interspecific gene flow. Up to 40% of 100-kb genomic windows clustered by geography rather than by species, demonstrating that a very substantial fraction of the genome has been shared between sympatric species. Analyses of genetic variation shared over different time intervals suggested that admixture between these species has continued since early in speciation. Alleles shared between species during recent time intervals displayed higher levels of linkage disequilibrium than those shared over longer time intervals, suggesting that this admixture took place at multiple points during divergence and is probably ongoing. The signal of admixture was significantly reduced around loci controlling divergent wing patterns, as well as throughout the Z chromosome, consistent with strong selection for Müllerian mimicry and with known Z-linked hybrid incompatibility. Overall these results show that species divergence can occur in the face of persistent and genome-wide admixture over long periods of time.

  9. Genome-wide Association and Functional Studies Identify a Role for IGFBP3 in Hip Osteoarthritis

    PubMed Central

    Evans, Daniel S.; Cailotto, Frederic; Parimi, Neeta; Valdes, Ana M.; Castaño-Betancourt, Martha C.; Liu, Youfang; Kaplan, Robert C.; Bidlingmaier, Martin; Vasan, Ramachandran S.; Teumer, Alexander; Tranah, Gregory J.; Nevitt, Michael C.; Cummings, Steven R.; Orwoll, Eric S.; Barrett-Connor, Elizabeth; Renner, Jordan B.; Jordan, Joanne M.; Doherty, Michael; Doherty, Sally A.; Uitterlinden, Andre G.; van Meurs, Joyce B.J.; Spector, Tim D.; Lories, Rik J.; Lane, Nancy E.

    2015-01-01

    Objectives To identify genetic associations with hip osteoarthritis (HOA), we performed a meta-analysis of genome-wide association studies (GWAS) of HOA. Methods The GWAS meta-analysis included approximately 2.5 million imputed HapMap single nucleotide polymorphisms (SNPs). HOA cases and controls defined radiographically and by total hip replacement were selected from the Osteoporotic Fractures in Men (MrOS) Study and the Study of Osteoporotic Fractures (SOF) (654 cases and 4697 controls, combined). Replication of genome-wide significant SNP associations (P-value ≤ 5x10−8) was examined in five studies (3243 cases and 6891 controls, combined). Functional studies were performed using in vitro models of chondrogenesis and osteogenesis. Results The A allele of rs788748, located 65 kb upstream of the IGFBP3 gene, was associated with lower HOA odds at the genome-wide significance level in the discovery stage (OR = 0.71, P-value = 2x10−8). The association replicated in five studies (OR = 0.92, P-value = 0.020), but the joint analysis of discovery and replication results was not genome-wide significant (P-value = 1x10−6). In separate study populations, the rs788748 A allele was also associated with lower circulating IGFBP3 protein levels (P-value = 4x10−13), suggesting that this SNP or a variant in linkage disequilibrium (LD) could be an IGFBP3 regulatory variant. Results from functional studies were consistent with association results. Chondrocyte hypertrophy, a deleterious event in OA pathogenesis, was largely prevented upon IGFBP3 knockdown in chondrocytes. Furthermore, IGFBP3 overexpression induced cartilage catabolism and osteogenic differentiation. Conclusions Results from GWAS and functional studies provided suggestive links between IGFBP3 and HOA. PMID:24928840

  10. The First Pilot Genome-Wide Gene-Environment Study of Depression in the Japanese Population

    PubMed Central

    Otowa, Takeshi; Kawamura, Yoshiya; Tsutsumi, Akizumi; Kawakami, Norito; Kan, Chiemi; Shimada, Takafumi; Umekage, Tadashi; Kasai, Kiyoto; Tokunaga, Katsushi; Sasaki, Tsukasa

    2016-01-01

    Stressful events have been identified as a risk factor for depression. Although gene–environment (G × E) interaction in a limited number of candidate genes has been explored, no genome-wide search has been reported. The aim of the present study is to identify genes that influence the association of stressful events with depression. Therefore, we performed a genome-wide G × E interaction analysis in the Japanese population. A genome-wide screen with 320 subjects was performed using the Affymetrix Genome-Wide Human Array 6.0. Stressful life events were assessed using the Social Readjustment Rating Scale (SRRS) and depression symptoms were assessed with self-rating questionnaires using the Center for Epidemiologic Studies Depression (CES-D) scale. The p values for interactions between single nucleotide polymorphisms (SNPs) and stressful events were calculated using the linear regression model adjusted for sex and age. After quality control of genotype data, a total of 534,848 SNPs on autosomal chromosomes were further analyzed. Although none surpassed the level of the genome-wide significance, a marginal significant association of interaction between SRRS and rs10510057 with depression were found (p = 4.5 × 10−8). The SNP is located on 10q26 near Regulators of G-protein signaling 10 (RGS10), which encodes a regulatory molecule involved in stress response. When we investigated a similar G × E interaction between depression (K6 scale) and work-related stress in an independent sample (n = 439), a significant G × E effect on depression was observed (p = 0.015). Our findings suggest that rs10510057, interacting with stressors, may be involved in depression risk. Incorporating G × E interaction into GWAS can contribute to find susceptibility locus that are potentially missed by conventional GWAS. PMID:27529621

  11. The First Pilot Genome-Wide Gene-Environment Study of Depression in the Japanese Population.

    PubMed

    Otowa, Takeshi; Kawamura, Yoshiya; Tsutsumi, Akizumi; Kawakami, Norito; Kan, Chiemi; Shimada, Takafumi; Umekage, Tadashi; Kasai, Kiyoto; Tokunaga, Katsushi; Sasaki, Tsukasa

    2016-01-01

    Stressful events have been identified as a risk factor for depression. Although gene-environment (G × E) interaction in a limited number of candidate genes has been explored, no genome-wide search has been reported. The aim of the present study is to identify genes that influence the association of stressful events with depression. Therefore, we performed a genome-wide G × E interaction analysis in the Japanese population. A genome-wide screen with 320 subjects was performed using the Affymetrix Genome-Wide Human Array 6.0. Stressful life events were assessed using the Social Readjustment Rating Scale (SRRS) and depression symptoms were assessed with self-rating questionnaires using the Center for Epidemiologic Studies Depression (CES-D) scale. The p values for interactions between single nucleotide polymorphisms (SNPs) and stressful events were calculated using the linear regression model adjusted for sex and age. After quality control of genotype data, a total of 534,848 SNPs on autosomal chromosomes were further analyzed. Although none surpassed the level of the genome-wide significance, a marginal significant association of interaction between SRRS and rs10510057 with depression were found (p = 4.5 × 10-8). The SNP is located on 10q26 near Regulators of G-protein signaling 10 (RGS10), which encodes a regulatory molecule involved in stress response. When we investigated a similar G × E interaction between depression (K6 scale) and work-related stress in an independent sample (n = 439), a significant G × E effect on depression was observed (p = 0.015). Our findings suggest that rs10510057, interacting with stressors, may be involved in depression risk. Incorporating G × E interaction into GWAS can contribute to find susceptibility locus that are potentially missed by conventional GWAS. PMID:27529621

  12. An efficient multi-locus mixed model approach for genome-wide association studies in structured populations

    PubMed Central

    Segura, Vincent; Vilhjálmsson, Bjarni J.; Platt, Alexander; Korte, Arthur; Seren, Ümit; Long, Quan; Nordborg, Magnus

    2012-01-01

    Population structure causes genome-wide linkage disequilibrium between unlinked loci, leading to statistical confounding in genome-wide association studies. Mixed models have been shown to handle the confounding effects of a diffuse background of large numbers of loci of small effect well, but do not always account for loci of larger effect. Here we propose a multi-locus mixed model as a general method for mapping complex traits in structured populations. Simulations suggest that our method outperforms existing methods, in terms of power as well as false discovery rate. We apply our method to human and Arabidopsis thaliana data, identifying novel associations in known candidates as well as evidence for allelic heterogeneity. We also demonstrate how a priori knowledge from an A. thaliana linkage mapping study can be integrated into our method using a Bayesian approach. Our implementation is computationally efficient, making the analysis of large datasets (n > 10000) practicable. PMID:22706313

  13. An efficient multi-locus mixed-model approach for genome-wide association studies in structured populations.

    PubMed

    Segura, Vincent; Vilhjálmsson, Bjarni J; Platt, Alexander; Korte, Arthur; Seren, Ümit; Long, Quan; Nordborg, Magnus

    2012-06-17

    Population structure causes genome-wide linkage disequilibrium between unlinked loci, leading to statistical confounding in genome-wide association studies. Mixed models have been shown to handle the confounding effects of a diffuse background of large numbers of loci of small effect well, but they do not always account for loci of larger effect. Here we propose a multi-locus mixed model as a general method for mapping complex traits in structured populations. Simulations suggest that our method outperforms existing methods in terms of power as well as false discovery rate. We apply our method to human and Arabidopsis thaliana data, identifying new associations and evidence for allelic heterogeneity. We also show how a priori knowledge from an A. thaliana linkage mapping study can be integrated into our method using a Bayesian approach. Our implementation is computationally efficient, making the analysis of large data sets (n > 10,000) practicable.

  14. Design and bioinformatics analysis of genome-wide CLIP experiments

    PubMed Central

    Wang, Tao; Xiao, Guanghua; Chu, Yongjun; Zhang, Michael Q.; Corey, David R.; Xie, Yang

    2015-01-01

    The past decades have witnessed a surge of discoveries revealing RNA regulation as a central player in cellular processes. RNAs are regulated by RNA-binding proteins (RBPs) at all post-transcriptional stages, including splicing, transportation, stabilization and translation. Defects in the functions of these RBPs underlie a broad spectrum of human pathologies. Systematic identification of RBP functional targets is among the key biomedical research questions and provides a new direction for drug discovery. The advent of cross-linking immunoprecipitation coupled with high-throughput sequencing (genome-wide CLIP) technology has recently enabled the investigation of genome-wide RBP–RNA binding at single base-pair resolution. This technology has evolved through the development of three distinct versions: HITS-CLIP, PAR-CLIP and iCLIP. Meanwhile, numerous bioinformatics pipelines for handling the genome-wide CLIP data have also been developed. In this review, we discuss the genome-wide CLIP technology and focus on bioinformatics analysis. Specifically, we compare the strengths and weaknesses, as well as the scopes, of various bioinformatics tools. To assist readers in choosing optimal procedures for their analysis, we also review experimental design and procedures that affect bioinformatics analyses. PMID:25958398

  15. Genome-wide association mapping of soybean aphid resistance traits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean aphid is the most damaging insect pest of soybean in the Upper Midwest and is primarily controlled by insecticides. Soybean aphid resistance (i.e., Rag genes) has been documented in some soybean lines at chromosomes 6, 7, 13, and 16, but more sources of resistance are needed. Genome-wide ass...

  16. A super powerful method for genome wide association study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genome-Wide Association Studies shed light on the identification of genes underlying human diseases and agriculturally important traits. This potential has been shadowed by false positive findings. The Mixed Linear Model (MLM) method is flexible enough to simultaneously incorporate population struct...

  17. Massively expedited genome-wide heritability analysis (MEGHA).

    PubMed

    Ge, Tian; Nichols, Thomas E; Lee, Phil H; Holmes, Avram J; Roffman, Joshua L; Buckner, Randy L; Sabuncu, Mert R; Smoller, Jordan W

    2015-02-24

    The discovery and prioritization of heritable phenotypes is a computational challenge in a variety of settings, including neuroimaging genetics and analyses of the vast phenotypic repositories in electronic health record systems and population-based biobanks. Classical estimates of heritability require twin or pedigree data, which can be costly and difficult to acquire. Genome-wide complex trait analysis is an alternative tool to compute heritability estimates from unrelated individuals, using genome-wide data that are increasingly ubiquitous, but is computationally demanding and becomes difficult to apply in evaluating very large numbers of phenotypes. Here we present a fast and accurate statistical method for high-dimensional heritability analysis using genome-wide SNP data from unrelated individuals, termed massively expedited genome-wide heritability analysis (MEGHA) and accompanying nonparametric sampling techniques that enable flexible inferences for arbitrary statistics of interest. MEGHA produces estimates and significance measures of heritability with several orders of magnitude less computational time than existing methods, making heritability-based prioritization of millions of phenotypes based on data from unrelated individuals tractable for the first time to our knowledge. As a demonstration of application, we conducted heritability analyses on global and local morphometric measurements derived from brain structural MRI scans, using genome-wide SNP data from 1,320 unrelated young healthy adults of non-Hispanic European ancestry. We also computed surface maps of heritability for cortical thickness measures and empirically localized cortical regions where thickness measures were significantly heritable. Our analyses demonstrate the unique capability of MEGHA for large-scale heritability-based screening and high-dimensional heritability profile construction.

  18. Genome-wide analysis of genetic susceptibility to language impairment in an isolated Chilean population

    PubMed Central

    Villanueva, Pia; Newbury, Dianne F; Jara, Lilian; De Barbieri, Zulema; Mirza, Ghazala; Palomino, Hernán M; Fernández, María Angélica; Cazier, Jean-Baptiste; Monaco, Anthony P; Palomino, Hernán

    2011-01-01

    Specific language impairment (SLI) is an unexpected deficit in the acquisition of language skills and affects between 5 and 8% of pre-school children. Despite its prevalence and high heritability, our understanding of the aetiology of this disorder is only emerging. In this paper, we apply genome-wide techniques to investigate an isolated Chilean population who exhibit an increased frequency of SLI. Loss of heterozygosity (LOH) mapping and parametric and non-parametric linkage analyses indicate that complex genetic factors are likely to underlie susceptibility to SLI in this population. Across all analyses performed, the most consistently implicated locus was on chromosome 7q. This locus achieved highly significant linkage under all three non-parametric models (max NPL=6.73, P=4.0 × 10−11). In addition, it yielded a HLOD of 1.24 in the recessive parametric linkage analyses and contained a segment that was homozygous in two affected individuals. Further, investigation of this region identified a two-SNP haplotype that occurs at an increased frequency in language-impaired individuals (P=0.008). We hypothesise that the linkage regions identified here, in particular that on chromosome 7, may contain variants that underlie the high prevalence of SLI observed in this isolated population and may be of relevance to other populations affected by language impairments. PMID:21248734

  19. Anxiety genetics – findings from cross-species genome-wide approaches

    PubMed Central

    2013-01-01

    Anxiety disorders are complex diseases, which often occur in combination with major depression, alcohol use disorder, or general medical conditions. Anxiety disorders were the most common mental disorders within the EU states in 2010 with 14% prevalence. Anxiety disorders are triggered by environmental factors in genetically susceptible individuals, and therefore genetic research offers a great route to unravel molecular basis of these diseases. As anxiety is an evolutionarily conserved response, mouse models can be used to carry out genome-wide searches for specific genes in a setting that controls for the environmental factors. In this review, we discuss translational approaches that aim to bridge results from unbiased genome-wide screens using mouse models to anxiety disorders in humans. Several methods, such as quantitative trait locus mapping, gene expression profiling, and proteomics, have been used in various mouse models of anxiety to identify genes that regulate anxiety or play a role in maintaining pathological anxiety. We first discuss briefly the evolutionary background of anxiety, which justifies cross-species approaches. We then describe how several genes have been identified through genome-wide methods in mouse models and subsequently investigated in human anxiety disorder samples as candidate genes. These studies have led to the identification of completely novel biological pathways that regulate anxiety in mice and humans, and that can be further investigated as targets for therapy. PMID:23659354

  20. Genome-wide meta-analysis of longitudinal alcohol consumption across youth and early adulthood

    PubMed Central

    Adkins, Daniel E.; Clark, Shaunna L.; Copeland, William E.; Kennedy, Martin; Conway, Kevin; Angold, Adrian; Maes, Hermine; Liu, Youfang; Kumar, Gaurav; Erkanli, Alaattin; Patkar, Ashwin A.; Silberg, Judy; Brown, Tyson H.; Fergusson, David M.; Horwood, L. John; Eaves, Lindon; van den Oord, Edwin J.C.G.; Sullivan, Patrick F.; Costello, E. J.

    2016-01-01

    The public health burden of alcohol is unevenly distributed across the life course, with levels of use, abuse and dependence increasing across adolescence and peaking in early adulthood. Here we leverage this temporal patterning to search for common genetic variants predicting developmental trajectories of alcohol consumption. Comparable psychiatric evaluations measuring alcohol consumption were collected in three, longitudinal community samples (N=2,126, obs=12,166). Consumption repeated measurements spanning adolescence and early adulthood were analyzed using linear mixed models, estimating individual consumption trajectories, which were then tested for association with Illumina 660W-Quad genotype data (866,099 SNPs after imputation and QC). Association results were combined across samples using standard meta-analysis methods. Four meta-analysis associations satisfied our pre-determined genome-wide significance criterion (FDR<0.1) and 6 others met our “suggestive” criterion (FDR<0.2). Genome-wide significant associations were highly biological plausible, including associations within GABA transporter 1, SLC6A1 (solute carrier family 6, member 1), and exonic hits in LOC100129340 (mitofusin-1-like). Pathway analyses elaborated single marker results, indicating significant enriched associations to intuitive biological mechanisms including neurotransmission, xenobiotic pharmacodynamics and nuclear hormone receptors. These findings underscore the value of combining longitudinal behavioral data and genome-wide genotype information in order to study developmental patterns and improve statistical power in genomic studies. PMID:26081443

  1. High-Resolution Genetic Map for Understanding the Effect of Genome-Wide Recombination Rate on Nucleotide Diversity in Watermelon

    PubMed Central

    Reddy, Umesh K.; Nimmakayala, Padma; Levi, Amnon; Abburi, Venkata Lakshmi; Saminathan, Thangasamy; Tomason, Yan. R.; Vajja, Gopinath; Reddy, Rishi; Abburi, Lavanya; Wehner, Todd C.; Ronin, Yefim; Karol, Abraham

    2014-01-01

    We used genotyping by sequencing to identify a set of 10,480 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1096 cM for watermelon. We assessed the genome-wide variation in recombination rate (GWRR) across the map and found an association between GWRR and genome-wide nucleotide diversity. Collinearity between the map and the genome-wide reference sequence for watermelon was studied to identify inconsistency and chromosome rearrangements. We assessed genome-wide nucleotide diversity, linkage disequilibrium (LD), and selective sweep for wild, semi-wild, and domesticated accessions of Citrullus lanatus var. lanatus to track signals of domestication. Principal component analysis combined with chromosome-wide phylogenetic study based on 1563 SNPs obtained after LD pruning with minor allele frequency of 0.05 resolved the differences between semi-wild and wild accessions as well as relationships among worldwide sweet watermelon. Population structure analysis revealed predominant ancestries for wild, semi-wild, and domesticated watermelons as well as admixture of various ancestries that were important for domestication. Sliding window analysis of Tajima’s D across various chromosomes was used to resolve selective sweep. LD decay was estimated for various chromosomes. We identified a strong selective sweep on chromosome 3 consisting of important genes that might have had a role in sweet watermelon domestication. PMID:25227227

  2. Genome-wide view of genetic diversity reveals paths of selection and cultivar differentiation in peach domestication

    PubMed Central

    Akagi, Takashi; Hanada, Toshio; Yaegaki, Hideaki; Gradziel, Thomas M.; Tao, Ryutaro

    2016-01-01

    Domestication and cultivar differentiation are requisite processes for establishing cultivated crops. These processes inherently involve substantial changes in population structure, including those from artificial selection of key genes. In this study, accessions of peach (Prunus persica) and its wild relatives were analysed genome-wide to identify changes in genetic structures and gene selections associated with their differentiation. Analysis of genome-wide informative single-nucleotide polymorphism loci revealed distinct changes in genetic structures and delineations among domesticated peach and its wild relatives and among peach landraces and modern fruit (F) and modern ornamental (O-A) cultivars. Indications of distinct changes in linkage disequilibrium extension/decay and of strong population bottlenecks or inbreeding were identified. Site frequency spectrum- and extended haplotype homozygosity-based evaluation of genome-wide genetic diversities supported selective sweeps distinguishing the domesticated peach from its wild relatives and each F/O-A cluster from the landrace clusters. The regions with strong selective sweeps harboured promising candidates for genes subjected to selection. Further sequence-based evaluation further defined the candidates and revealed their characteristics. All results suggest opportunities for identifying critical genes associated with each differentiation by analysing genome-wide genetic diversity in currently established populations. This approach obviates the special development of genetic populations, which is particularly difficult for long-lived tree crops. PMID:27085183

  3. High-resolution genetic map for understanding the effect of genome-wide recombination rate on nucleotide diversity in watermelon.

    PubMed

    Reddy, Umesh K; Nimmakayala, Padma; Levi, Amnon; Abburi, Venkata Lakshmi; Saminathan, Thangasamy; Tomason, Yan R; Vajja, Gopinath; Reddy, Rishi; Abburi, Lavanya; Wehner, Todd C; Ronin, Yefim; Karol, Abraham

    2014-09-15

    We used genotyping by sequencing to identify a set of 10,480 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1096 cM for watermelon. We assessed the genome-wide variation in recombination rate (GWRR) across the map and found an association between GWRR and genome-wide nucleotide diversity. Collinearity between the map and the genome-wide reference sequence for watermelon was studied to identify inconsistency and chromosome rearrangements. We assessed genome-wide nucleotide diversity, linkage disequilibrium (LD), and selective sweep for wild, semi-wild, and domesticated accessions of Citrullus lanatus var. lanatus to track signals of domestication. Principal component analysis combined with chromosome-wide phylogenetic study based on 1563 SNPs obtained after LD pruning with minor allele frequency of 0.05 resolved the differences between semi-wild and wild accessions as well as relationships among worldwide sweet watermelon. Population structure analysis revealed predominant ancestries for wild, semi-wild, and domesticated watermelons as well as admixture of various ancestries that were important for domestication. Sliding window analysis of Tajima's D across various chromosomes was used to resolve selective sweep. LD decay was estimated for various chromosomes. We identified a strong selective sweep on chromosome 3 consisting of important genes that might have had a role in sweet watermelon domestication.

  4. Genome-wide association study of infectious bovine keratoconjunctivitis in Angus cattle

    PubMed Central

    2013-01-01

    Background Infectious Bovine Keratoconjunctivitis (IBK) in beef cattle, commonly known as pinkeye, is a bacterial disease caused by Moraxellabovis. IBK is characterized by excessive tearing and ulceration of the cornea. Perforation of the cornea may also occur in severe cases. IBK is considered the most important ocular disease in cattle production, due to the decreased growth performance of infected individuals and its subsequent economic effects. IBK is an economically important, lowly heritable categorical disease trait. Mass selection of unaffected animals has not been successful at reducing disease incidence. Genome-wide studies can determine chromosomal regions associated with IBK susceptibility. The objective of the study was to detect single-nucleotide polymorphism (SNP) markers in linkage disequilibrium (LD) with genetic variants associated with IBK in American Angus cattle. Results The proportion of phenotypic variance explained by markers was 0.06 in the whole genome analysis of IBK incidence classified as two, three or nine categories. Whole-genome analysis using any categorisation of (two, three or nine) IBK scores showed that locations on chromosomes 2, 12, 13 and 21 were associated with IBK disease. The genomic locations on chromosomes 13 and 21 overlap with QTLs associated with Bovine spongiform encephalopathy, clinical mastitis or somatic cell count. Conclusions Results of these genome-wide analyses indicated that if the underlying genetic factors confer not only IBK susceptibility but also IBK severity, treating IBK phenotypes as a two-categorical trait can cause information loss in the genome-wide analysis. These results help our overall understanding of the genetics of IBK and have the potential to provide information for future use in breeding schemes. PMID:23530766

  5. Genome-wide evidence for speciation with gene flow in Heliconius butterflies

    PubMed Central

    Martin, Simon H.; Dasmahapatra, Kanchon K.; Nadeau, Nicola J.; Salazar, Camilo; Walters, James R.; Simpson, Fraser; Blaxter, Mark; Manica, Andrea; Mallet, James; Jiggins, Chris D.

    2013-01-01

    Most speciation events probably occur gradually, without complete and immediate reproductive isolation, but the full extent of gene flow between diverging species has rarely been characterized on a genome-wide scale. Documenting the extent and timing of admixture between diverging species can clarify the role of geographic isolation in speciation. Here we use new methodology to quantify admixture at different stages of divergence in Heliconius butterflies, based on whole-genome sequences of 31 individuals. Comparisons between sympatric and allopatric populations of H. melpomene, H. cydno, and H. timareta revealed a genome-wide trend of increased shared variation in sympatry, indicative of pervasive interspecific gene flow. Up to 40% of 100-kb genomic windows clustered by geography rather than by species, demonstrating that a very substantial fraction of the genome has been shared between sympatric species. Analyses of genetic variation shared over different time intervals suggested that admixture between these species has continued since early in speciation. Alleles shared between species during recent time intervals displayed higher levels of linkage disequilibrium than those shared over longer time intervals, suggesting that this admixture took place at multiple points during divergence and is probably ongoing. The signal of admixture was significantly reduced around loci controlling divergent wing patterns, as well as throughout the Z chromosome, consistent with strong selection for Müllerian mimicry and with known Z-linked hybrid incompatibility. Overall these results show that species divergence can occur in the face of persistent and genome-wide admixture over long periods of time. PMID:24045163

  6. Genome-Wide Significant Association between Alcohol Dependence and a Variant in the ADH Gene Cluster

    PubMed Central

    Frank, Josef; Cichon, Sven; Treutlein, Jens; Ridinger, Monika; Mattheisen, Manuel; Hoffmann, Per; Herms, Stefan; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Mössner, Rainald; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Schmäl, Christine; Steffens, Michael; Lucae, Susanne; Ising, Marcus; Müller-Myhsok, Bertram; Nöthen, Markus M; Mann, Karl; Kiefer, Falk; Rietschel, Marcella

    2011-01-01

    Alcohol dependence (AD) is an important contributory factor to the global burden of disease. The etiology of AD involves both environmental and genetic factors, and the disorder has a heritability of around 50%. The aim of the present study was to identify susceptibility genes for AD by performing a genome-wide association study (GWAS). The sample comprised 1,333 male in-patients with severe DSM-IV AD and 2,168 controls. These included 487 patients and 1,358 controls from a previous GWAS study by our group. All individuals were of German descent. Single marker tests and a polygenic score based analysis to assess the combined contribution of multiple markers with small effects were performed. The SNP rs1789891, which is located between the ADH1B and ADH1C genes, achieved genome-wide significance (p=1.27E–8; OR=1.46). Other markers from this region were also associated with AD, and conditional analyses indicated that these made a partially independent contribution. The SNP rs1789891 is in complete linkage disequilibrium with the functional Arg272Gln variant (p=1.24E–7, OR=1.31) of the ADH1C gene, which has been reported to modify the rate of ethanol oxidation to acetaldehyde in vitro. A polygenic score based approach produced a significant result (p=9.66E–9). This is the first GWAS of AD to provide genome-wide significant support for the role of the ADH gene cluster and to suggest a polygenic component to the etiology of AD. The latter result suggests that many more AD susceptibility genes still await identification. PMID:22004471

  7. Siblings with Ischemic Stroke Study (SWISS): Results of a Genome-wide Scan for Stroke Loci

    PubMed Central

    Meschia, James F.; Nalls, Michael; Matarin, Mar; Brott, Thomas G.; Brown, Robert D.; Hardy, John; Kissela, Brett; Rich, Stephen S.; Singleton, Andrew; Hernandez, Dena; Ferrucci, Luigi; Pearce, Kerra; Keller, Margaret; Worrall, Bradford B.

    2011-01-01

    Background and Purpose Ischemic stroke has a strong familial component to risk. The Siblings with Ischemic Stroke Study (SWISS) is a genome-wide family-based analysis that included use of imputed genotypes. SWISS was conducted to examine associations between SNPs and risk of stroke and stroke subtypes within pairs. Methods SWISS enrolled 312 probands with ischemic stroke across 70 US and Canadian centers. Affected siblings were ascertained by centers and confirmed by central record review; unaffected siblings were ascertained by telephone contact. Ischemic stroke was subtyped using TOAST criteria. Genotyping was performed using an Illumina 610 quad array (probands) and an Illumina linkage V array (affected siblings). SNPs were imputed using 1000 Genomes Project data and MACH software. Family-based association analyses were conducted using the sibling-transmission disequilibrium test. Results For all pairs, the correlation of age at stroke within pairs of affected siblings was r = 0.83 (95%CI, 0.78 to 0.86; P < 2.2×10−16). The correlation did not differ substantially by subtype. The concordance of stroke subtypes among affected pairs was 33.8% (kappa = 0.13; P = 5.06×10−4) and did not differ by age at stroke in the proband. Although no SNP achieved genome-wide significance for risk of ischemic stroke, there was clustering of the most associated SNPs on chromosomes 3p (NOS1) and 6p. Conclusions Stroke subtype and age at stroke in affected sibling pairs exhibit significant clustering. No individual SNP reached genome-wide significance. However, two promising candidate loci were identified, including one that contains NOS1, though these risk loci warrant further examination in larger sample collections. PMID:21940970

  8. Genome-wide significant association between alcohol dependence and a variant in the ADH gene cluster.

    PubMed

    Frank, Josef; Cichon, Sven; Treutlein, Jens; Ridinger, Monika; Mattheisen, Manuel; Hoffmann, Per; Herms, Stefan; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Mössner, Rainald; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Schmäl, Christine; Steffens, Michael; Lucae, Susanne; Ising, Marcus; Müller-Myhsok, Bertram; Nöthen, Markus M; Mann, Karl; Kiefer, Falk; Rietschel, Marcella

    2012-01-01

    Alcohol dependence (AD) is an important contributory factor to the global burden of disease. The etiology of AD involves both environmental and genetic factors, and the disorder has a heritability of around 50%. The aim of the present study was to identify susceptibility genes for AD by performing a genome-wide association study (GWAS). The sample comprised 1333 male in-patients with severe AD according to the Diagnostic and Statistical Manual of Mental Disorders, 4th edition, and 2168 controls. These included 487 patients and 1358 controls from a previous GWAS study by our group. All individuals were of German descent. Single-marker tests and a polygenic score-based analysis to assess the combined contribution of multiple markers with small effects were performed. The single nucleotide polymorphism (SNP) rs1789891, which is located between the ADH1B and ADH1C genes, achieved genome-wide significance [P = 1.27E-8, odds ratio (OR) = 1.46]. Other markers from this region were also associated with AD, and conditional analyses indicated that these made a partially independent contribution. The SNP rs1789891 is in complete linkage disequilibrium with the functional Arg272Gln variant (P = 1.24E-7, OR = 1.31) of the ADH1C gene, which has been reported to modify the rate of ethanol oxidation to acetaldehyde in vitro. A polygenic score-based approach produced a significant result (P = 9.66E-9). This is the first GWAS of AD to provide genome-wide significant support for the role of the ADH gene cluster and to suggest a polygenic component to the etiology of AD. The latter result may indicate that many more AD susceptibility genes still await identification.

  9. Genome-wide patterns of selection in 230 ancient Eurasians.

    PubMed

    Mathieson, Iain; Lazaridis, Iosif; Rohland, Nadin; Mallick, Swapan; Patterson, Nick; Roodenberg, Songül Alpaslan; Harney, Eadaoin; Stewardson, Kristin; Fernandes, Daniel; Novak, Mario; Sirak, Kendra; Gamba, Cristina; Jones, Eppie R; Llamas, Bastien; Dryomov, Stanislav; Pickrell, Joseph; Arsuaga, Juan Luís; de Castro, José María Bermúdez; Carbonell, Eudald; Gerritsen, Fokke; Khokhlov, Aleksandr; Kuznetsov, Pavel; Lozano, Marina; Meller, Harald; Mochalov, Oleg; Moiseyev, Vyacheslav; Guerra, Manuel A Rojo; Roodenberg, Jacob; Vergès, Josep Maria; Krause, Johannes; Cooper, Alan; Alt, Kurt W; Brown, Dorcas; Anthony, David; Lalueza-Fox, Carles; Haak, Wolfgang; Pinhasi, Ron; Reich, David

    2015-12-24

    Ancient DNA makes it possible to observe natural selection directly by analysing samples from populations before, during and after adaptation events. Here we report a genome-wide scan for selection using ancient DNA, capitalizing on the largest ancient DNA data set yet assembled: 230 West Eurasians who lived between 6500 and 300 bc, including 163 with newly reported data. The new samples include, to our knowledge, the first genome-wide ancient DNA from Anatolian Neolithic farmers, whose genetic material we obtained by extracting from petrous bones, and who we show were members of the population that was the source of Europe's first farmers. We also report a transect of the steppe region in Samara between 5600 and 300 bc, which allows us to identify admixture into the steppe from at least two external sources. We detect selection at loci associated with diet, pigmentation and immunity, and two independent episodes of selection on height. PMID:26595274

  10. Genome wide copy number analysis of single cells

    PubMed Central

    Baslan, Timour; Kendall, Jude; Rodgers, Linda; Cox, Hilary; Riggs, Mike; Stepansky, Asya; Troge, Jennifer; Ravi, Kandasamy; Esposito, Diane; Lakshmi, B.; Wigler, Michael; Navin, Nicholas; Hicks, James

    2016-01-01

    Summary Copy number variation (CNV) is increasingly recognized as an important contributor to phenotypic variation in health and disease. Most methods for determining CNV rely on admixtures of cells, where information regarding genetic heterogeneity is lost. Here, we present a protocol that allows for the genome wide copy number analysis of single nuclei isolated from mixed populations of cells. Single nucleus sequencing (SNS), combines flow sorting of single nuclei based on DNA content, whole genome amplification (WGA), followed by next generation sequencing to quantize genomic intervals in a genome wide manner. Multiplexing of single cells is discussed. Additionally, we outline informatic approaches that correct for biases inherent in the WGA procedure and allow for accurate determination of copy number profiles. All together, the protocol takes ~3 days from flow cytometry to sequence-ready DNA libraries. PMID:22555242

  11. Genome-wide association studies in Alzheimer's disease: a review.

    PubMed

    Tosto, Giuseppe; Reitz, Christiane

    2013-10-01

    Over the past decade, research aiming to disentangle the genetic underpinnings of late-onset Alzheimer's disease has mostly focused on the identification of common variants through genome-wide association studies. The identification of several new susceptibility genes through these efforts has reinforced the importance of amyloid precursor protein and tau metabolism in the cause of the disease and has implicated immune response, inflammation, lipid metabolism, endocytosis/intracellular trafficking, and cell migration in the cause of the disease. Ongoing and future large-scale genome-wide association studies, translational studies, and next-generation whole genome or whole exome sequencing efforts, hold the promise to map the specific causative variants in these genes, to identify several additional risk variants, including rare and structural variants, and to identify novel targets for genetic testing, prevention, and treatment.

  12. Genome-wide patterns of selection in 230 ancient Eurasians

    PubMed Central

    Mathieson, Iain; Lazaridis, Iosif; Rohland, Nadin; Mallick, Swapan; Patterson, Nick; Roodenberg, Songül Alpaslan; Harney, Eadaoin; Stewardson, Kristin; Fernandes, Daniel; Novak, Mario; Sirak, Kendra; Gamba, Cristina; Jones, Eppie R.; Llamas, Bastien; Dryomov, Stanislav; Pickrel, Joseph; Arsuaga, Juan Luís; de Castro, José María Bermúdez; Carbonell, Eudald; Gerritsen, Fokke; Khokhlov, Aleksandr; Kuznetsov, Pavel; Lozano, Marina; Meller, Harald; Mochalov, Oleg; Moiseyev, Vayacheslav; Rojo Guerra, Manuel A.; Roodenberg, Jacob; Vergès, Josep Maria; Krause, Johannes; Cooper, Alan; Alt, Kurt W.; Brown, Dorcas; Anthony, David; Lalueza-Fox, Carles; Haak, Wolfgang; Pinhasi, Ron; Reich, David

    2016-01-01

    Ancient DNA makes it possible to directly witness natural selection by analyzing samples from populations before, during and after adaptation events. Here we report the first scan for selection using ancient DNA, capitalizing on the largest genome-wide dataset yet assembled: 230 West Eurasians dating to between 6500 and 1000 BCE, including 163 with newly reported data. The new samples include the first genome-wide data from the Anatolian Neolithic culture whose genetic material we extracted from the DNA-rich petrous bone and who we show were members of the population that was the source of Europe’s first farmers. We also report a complete transect of the steppe region in Samara between 5500 and 1200 BCE that allows us to recognize admixture from at least two external sources into steppe populations during this period. We detect selection at loci associated with diet, pigmentation and immunity, and two independent episodes of selection on height. PMID:26595274

  13. Genome-Wide Significant Loci: How Important Are They?

    PubMed Central

    Björkegren, Johan L.M.; Kovacic, Jason C.; Dudley, Joel T.; Schadt, Eric E.

    2015-01-01

    Genome-wide association studies (GWAS) have been extensively used to study common complex diseases such as coronary artery disease (CAD), revealing 153 suggestive CAD loci, of which at least 46 have been validated as having genome-wide significance. However, these loci collectively explain <10% of the genetic variance in CAD. Thus, we must address the key question of what factors constitute the remaining 90% of CAD heritability. We review possible limitations of GWAS, and contextually consider some candidate CAD loci identified by this method. Looking ahead, we propose systems genetics as a complementary approach to unlocking the CAD heritability and etiology. Systems genetics builds network models of relevant molecular processes by combining genetic and genomic datasets to ultimately identify key “drivers” of disease. By leveraging systems-based genetic approaches, we can help reveal the full genetic basis of common complex disorders, enabling novel diagnostic and therapeutic opportunities. PMID:25720628

  14. Genome-wide patterns of selection in 230 ancient Eurasians.

    PubMed

    Mathieson, Iain; Lazaridis, Iosif; Rohland, Nadin; Mallick, Swapan; Patterson, Nick; Roodenberg, Songül Alpaslan; Harney, Eadaoin; Stewardson, Kristin; Fernandes, Daniel; Novak, Mario; Sirak, Kendra; Gamba, Cristina; Jones, Eppie R; Llamas, Bastien; Dryomov, Stanislav; Pickrell, Joseph; Arsuaga, Juan Luís; de Castro, José María Bermúdez; Carbonell, Eudald; Gerritsen, Fokke; Khokhlov, Aleksandr; Kuznetsov, Pavel; Lozano, Marina; Meller, Harald; Mochalov, Oleg; Moiseyev, Vyacheslav; Guerra, Manuel A Rojo; Roodenberg, Jacob; Vergès, Josep Maria; Krause, Johannes; Cooper, Alan; Alt, Kurt W; Brown, Dorcas; Anthony, David; Lalueza-Fox, Carles; Haak, Wolfgang; Pinhasi, Ron; Reich, David

    2015-12-24

    Ancient DNA makes it possible to observe natural selection directly by analysing samples from populations before, during and after adaptation events. Here we report a genome-wide scan for selection using ancient DNA, capitalizing on the largest ancient DNA data set yet assembled: 230 West Eurasians who lived between 6500 and 300 bc, including 163 with newly reported data. The new samples include, to our knowledge, the first genome-wide ancient DNA from Anatolian Neolithic farmers, whose genetic material we obtained by extracting from petrous bones, and who we show were members of the population that was the source of Europe's first farmers. We also report a transect of the steppe region in Samara between 5600 and 300 bc, which allows us to identify admixture into the steppe from at least two external sources. We detect selection at loci associated with diet, pigmentation and immunity, and two independent episodes of selection on height.

  15. Genome-wide association studies in pediatric endocrinology.

    PubMed

    Dauber, Andrew; Hirschhorn, Joel N

    2011-01-01

    Genome-wide association (GWA) studies are a powerful tool for understanding the genetic underpinnings of human disease. In this article, we briefly review the role and findings of GWA studies in type 1 diabetes, stature, pubertal timing, obesity, and vitamin D deficiency. We then discuss the present and future implications of these findings with regards to disease prediction, uncovering basic biology, and the development of novel therapeutic agents.

  16. Genome-wide association study of relative telomere length.

    PubMed

    Prescott, Jennifer; Kraft, Peter; Chasman, Daniel I; Savage, Sharon A; Mirabello, Lisa; Berndt, Sonja I; Weissfeld, Joel L; Han, Jiali; Hayes, Richard B; Chanock, Stephen J; Hunter, David J; De Vivo, Immaculata

    2011-05-10

    Telomere function is essential to maintaining the physical integrity of linear chromosomes and healthy human aging. The probability of forming proper telomere structures depends on the length of the telomeric DNA tract. We attempted to identify common genetic variants associated with log relative telomere length using genome-wide genotyping data on 3,554 individuals from the Nurses' Health Study and the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial that took part in the National Cancer Institute Cancer Genetic Markers of Susceptibility initiative for breast and prostate cancer. After genotyping 64 independent SNPs selected for replication in additional Nurses' Health Study and Women's Genome Health Study participants, we did not identify genome-wide significant loci; however, we replicated the inverse association of log relative telomere length with the minor allele variant [C] of rs16847897 at the TERC locus (per allele β = -0.03, P = 0.003) identified by a previous genome-wide association study. We did not find evidence for an association with variants at the OBFC1 locus or other loci reported to be associated with telomere length. With this sample size we had >80% power to detect β estimates as small as ±0.10 for SNPs with minor allele frequencies of ≥0.15 at genome-wide significance. However, power is greatly reduced for β estimates smaller than ±0.10, such as those for variants at the TERC locus. In general, common genetic variants associated with telomere length homeostasis have been difficult to detect. Potential biological and technical issues are discussed.

  17. Genome-wide association study of schizophrenia in Ashkenazi Jews.

    PubMed

    Goes, Fernando S; McGrath, John; Avramopoulos, Dimitrios; Wolyniec, Paula; Pirooznia, Mehdi; Ruczinski, Ingo; Nestadt, Gerald; Kenny, Eimear E; Vacic, Vladimir; Peters, Inga; Lencz, Todd; Darvasi, Ariel; Mulle, Jennifer G; Warren, Stephen T; Pulver, Ann E

    2015-12-01

    Schizophrenia is a common, clinically heterogeneous disorder associated with lifelong morbidity and early mortality. Several genetic variants associated with schizophrenia have been identified, but the majority of the heritability remains unknown. In this study, we report on a case-control sample of Ashkenazi Jews (AJ), a founder population that may provide additional insights into genetic etiology of schizophrenia. We performed a genome-wide association analysis (GWAS) of 592 cases and 505 controls of AJ ancestry ascertained in the US. Subsequently, we performed a meta-analysis with an Israeli AJ sample of 913 cases and 1640 controls, followed by a meta-analysis and polygenic risk scoring using summary results from Psychiatric GWAS Consortium 2 schizophrenia study. The U.S. AJ sample showed strong evidence of polygenic inheritance (pseudo-R(2) ∼9.7%) and a SNP-heritability estimate of 0.39 (P = 0.00046). We found no genome-wide significant associations in the U.S. sample or in the combined US/Israeli AJ meta-analysis of 1505 cases and 2145 controls. The strongest AJ specific associations (P-values in 10(-6) -10(-7) range) were in the 22q 11.2 deletion region and included the genes TBX1, GLN1, and COMT. Supportive evidence (meta P < 1 × 10(-4) ) was also found for several previously identified genome-wide significant findings, including the HLA region, CNTN4, IMMP2L, and GRIN2A. The meta-analysis of the U.S. sample with the PGC2 results provided initial genome-wide significant evidence for six new loci. Among the novel potential susceptibility genes is PEPD, a gene involved in proline metabolism, which is associated with a Mendelian disorder characterized by developmental delay and cognitive deficits. PMID:26198764

  18. GStream: improving SNP and CNV coverage on genome-wide association studies.

    PubMed

    Alonso, Arnald; Marsal, Sara; Tortosa, Raül; Canela-Xandri, Oriol; Julià, Antonio

    2013-01-01

    We present GStream, a method that combines genome-wide SNP and CNV genotyping in the Illumina microarray platform with unprecedented accuracy. This new method outperforms previous well-established SNP genotyping software. More importantly, the CNV calling algorithm of GStream dramatically improves the results obtained by previous state-of-the-art methods and yields an accuracy that is close to that obtained by purely CNV-oriented technologies like Comparative Genomic Hybridization (CGH). We demonstrate the superior performance of GStream using microarray data generated from HapMap samples. Using the reference CNV calls generated by the 1000 Genomes Project (1KGP) and well-known studies on whole genome CNV characterization based either on CGH or genotyping microarray technologies, we show that GStream can increase the number of reliably detected variants up to 25% compared to previously developed methods. Furthermore, the increased genome coverage provided by GStream allows the discovery of CNVs in close linkage disequilibrium with SNPs, previously associated with disease risk in published Genome-Wide Association Studies (GWAS). These results could provide important insights into the biological mechanism underlying the detected disease risk association. With GStream, large-scale GWAS will not only benefit from the combined genotyping of SNPs and CNVs at an unprecedented accuracy, but will also take advantage of the computational efficiency of the method.

  19. GStream: Improving SNP and CNV Coverage on Genome-Wide Association Studies

    PubMed Central

    Alonso, Arnald; Marsal, Sara; Tortosa, Raül; Canela-Xandri, Oriol; Julià, Antonio

    2013-01-01

    We present GStream, a method that combines genome-wide SNP and CNV genotyping in the Illumina microarray platform with unprecedented accuracy. This new method outperforms previous well-established SNP genotyping software. More importantly, the CNV calling algorithm of GStream dramatically improves the results obtained by previous state-of-the-art methods and yields an accuracy that is close to that obtained by purely CNV-oriented technologies like Comparative Genomic Hybridization (CGH). We demonstrate the superior performance of GStream using microarray data generated from HapMap samples. Using the reference CNV calls generated by the 1000 Genomes Project (1KGP) and well-known studies on whole genome CNV characterization based either on CGH or genotyping microarray technologies, we show that GStream can increase the number of reliably detected variants up to 25% compared to previously developed methods. Furthermore, the increased genome coverage provided by GStream allows the discovery of CNVs in close linkage disequilibrium with SNPs, previously associated with disease risk in published Genome-Wide Association Studies (GWAS). These results could provide important insights into the biological mechanism underlying the detected disease risk association. With GStream, large-scale GWAS will not only benefit from the combined genotyping of SNPs and CNVs at an unprecedented accuracy, but will also take advantage of the computational efficiency of the method. PMID:23844243

  20. Development and application of a novel genome-wide SNP array reveals domestication history in soybean.

    PubMed

    Wang, Jiao; Chu, Shanshan; Zhang, Huairen; Zhu, Ying; Cheng, Hao; Yu, Deyue

    2016-02-09

    Domestication of soybeans occurred under the intense human-directed selections aimed at developing high-yielding lines. Tracing the domestication history and identifying the genes underlying soybean domestication require further exploration. Here, we developed a high-throughput NJAU 355 K SoySNP array and used this array to study the genetic variation patterns in 367 soybean accessions, including 105 wild soybeans and 262 cultivated soybeans. The population genetic analysis suggests that cultivated soybeans have tended to originate from northern and central China, from where they spread to other regions, accompanied with a gradual increase in seed weight. Genome-wide scanning for evidence of artificial selection revealed signs of selective sweeps involving genes controlling domestication-related agronomic traits including seed weight. To further identify genomic regions related to seed weight, a genome-wide association study (GWAS) was conducted across multiple environments in wild and cultivated soybeans. As a result, a strong linkage disequilibrium region on chromosome 20 was found to be significantly correlated with seed weight in cultivated soybeans. Collectively, these findings should provide an important basis for genomic-enabled breeding and advance the study of functional genomics in soybean.

  1. Genome-Wide High-Resolution Mapping by Recurrent Intermating Using Arabidopsis Thaliana as a Model

    PubMed Central

    Liu, S. C.; Kowalski, S. P.; Lan, T. H.; Feldmann, K. A.; Paterson, A. H.

    1996-01-01

    We demonstrate a method for developing populations suitable for genome-wide high-resolution genetic linkage mapping, by recurrent intermating among F(2) individuals derived from crosses between homozygous parents. Comparison of intermated progenies to F(2) and ``recombinant inbred'' (RI) populations from the same pedigree corroborate theoretical expectations that progenies intermated for four generations harbor about threefold more information for estimating recombination fraction between closely linked markers than either RI-selfed or F(2) individuals (which are, in fact, equivalent in this regard). Although intermated populations are heterozygous, homozygous ``intermated recombinant inbred'' (IRI) populations can readily be generated, combining additional information afforded by intermating with the permanence of RI populations. Intermated populations permit fine-mapping of genetic markers throughout a genome, helping to bridge the gap between genetic map resolution and the DNA-carrying capacity of modern cloning vectors, thus facilitating merger of genetic and physical maps. Intermating can also facilitate high-resolution mapping of genes and QTLs, accelerating map-based cloning. Finally, intermated populations will facilitate investigation of other fundamental genetic questions requiring a genome-wide high-resolution analysis, such as comparative mapping of distantly related species, and the genetic basis of heterosis. PMID:8770602

  2. A genome-wide SNP scan accelerates trait-regulatory genomic loci identification in chickpea.

    PubMed

    Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C L L; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K; Parida, Swarup K

    2015-06-10

    We identified 44844 high-quality SNPs by sequencing 92 diverse chickpea accessions belonging to a seed and pod trait-specific association panel using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays. A GWAS (genome-wide association study) in an association panel of 211, including the 92 sequenced accessions, identified 22 major genomic loci showing significant association (explaining 23-47% phenotypic variation) with pod and seed number/plant and 100-seed weight. Eighteen trait-regulatory major genomic loci underlying 13 robust QTLs were validated and mapped on an intra-specific genetic linkage map by QTL mapping. A combinatorial approach of GWAS, QTL mapping and gene haplotype-specific LD mapping and transcript profiling uncovered one superior haplotype and favourable natural allelic variants in the upstream regulatory region of a CesA-type cellulose synthase (Ca_Kabuli_CesA3) gene regulating high pod and seed number/plant (explaining 47% phenotypic variation) in chickpea. The up-regulation of this superior gene haplotype correlated with increased transcript expression of Ca_Kabuli_CesA3 gene in the pollen and pod of high pod/seed number accession, resulting in higher cellulose accumulation for normal pollen and pollen tube growth. A rapid combinatorial genome-wide SNP genotyping-based approach has potential to dissect complex quantitative agronomic traits and delineate trait-regulatory genomic loci (candidate genes) for genetic enhancement in crop plants, including chickpea.

  3. Integrative genome-wide approaches in embryonic stem cell research.

    PubMed

    Zhang, Xinyue; Huang, Jing

    2010-10-01

    Embryonic stem (ES) cells are derived from blastocysts. They can differentiate into the three embryonic germ layers and essentially any type of somatic cells. They therefore hold great potential in tissue regeneration therapy. The ethical issues associated with the use of human embryonic stem cells are resolved by the technical break-through of generating induced pluripotent stem (iPS) cells from various types of somatic cells. However, how ES and iPS cells self-renew and maintain their pluripotency is still largely unknown in spite of the great progress that has been made in the last two decades. Integrative genome-wide approaches, such as the gene expression microarray, chromatin immunoprecipitation based microarray (ChIP-chip) and chromatin immunoprecipitation followed by massive parallel sequencing (ChIP-seq) offer unprecedented opportunities to elucidate the mechanism of the pluripotency, reprogramming and DNA damage response of ES and iPS cells. This frontier article summarizes the fundamental biological questions about ES and iPS cells and reviews the recent advances in ES and iPS cell research using genome-wide technologies. To this end, we offer our perspectives on the future of genome-wide studies on stem cells.

  4. Genome-wide polymorphisms show unexpected targets of natural selection

    PubMed Central

    Pespeni, Melissa H.; Garfield, David A.; Manier, Mollie K.; Palumbi, Stephen R.

    2012-01-01

    Natural selection can act on all the expressed genes of an individual, leaving signatures of genetic differentiation or diversity at many loci across the genome. New power to assay these genome-wide effects of selection comes from associating multi-locus patterns of polymorphism with gene expression and function. Here, we performed one of the first genome-wide surveys in a marine species, comparing purple sea urchins, Strongylocentrotus purpuratus, from two distant locations along the species' wide latitudinal range. We examined 9112 polymorphic loci from upstream non-coding and coding regions of genes for signatures of selection with respect to gene function and tissue- and ontogenetic gene expression. We found that genetic differentiation (FST) varied significantly across functional gene classes. The strongest enrichment occurred in the upstream regions of E3 ligase genes, enzymes known to regulate protein abundance during development and environmental stress. We found enrichment for high heterozygosity in genes directly involved in immune response, particularly NALP genes, which mediate pro-inflammatory signals during bacterial infection. We also found higher heterozygosity in immune genes in the southern population, where disease incidence and pathogen diversity are greater. Similar to the major histocompatibility complex in mammals, balancing selection may enhance genetic diversity in the innate immune system genes of this invertebrate. Overall, our results show that how genome-wide polymorphism data coupled with growing databases on gene function and expression can combine to detect otherwise hidden signals of selection in natural populations. PMID:21993504

  5. Significance of genome-wide association studies in molecular anthropology.

    PubMed

    Gupta, Vipin; Khadgawat, Rajesh; Sachdeva, Mohinder Pal

    2009-12-01

    The successful advent of a genome-wide approach in association studies raises the hopes of human geneticists for solving a genetic maze of complex traits especially the disorders. This approach, which is replete with the application of cutting-edge technology and supported by big science projects (like Human Genome Project; and even more importantly the International HapMap Project) and various important databases (SNP database, CNV database, etc.), has had unprecedented success in rapidly uncovering many of the genetic determinants of complex disorders. The magnitude of this approach in the genetics of classical anthropological variables like height, skin color, eye color, and other genome diversity projects has certainly expanded the horizons of molecular anthropology. Therefore, in this article we have proposed a genome-wide association approach in molecular anthropological studies by providing lessons from the exemplary study of the Wellcome Trust Case Control Consortium. We have also highlighted the importance and uniqueness of Indian population groups in facilitating the design and finding optimum solutions for other genome-wide association-related challenges.

  6. Voxelwise genome-wide association study (vGWAS).

    PubMed

    Stein, Jason L; Hua, Xue; Lee, Suh; Ho, April J; Leow, Alex D; Toga, Arthur W; Saykin, Andrew J; Shen, Li; Foroud, Tatiana; Pankratz, Nathan; Huentelman, Matthew J; Craig, David W; Gerber, Jill D; Allen, April N; Corneveaux, Jason J; Dechairo, Bryan M; Potkin, Steven G; Weiner, Michael W; Thompson, Paul

    2010-11-15

    The structure of the human brain is highly heritable, and is thought to be influenced by many common genetic variants, many of which are currently unknown. Recent advances in neuroimaging and genetics have allowed collection of both highly detailed structural brain scans and genome-wide genotype information. This wealth of information presents a new opportunity to find the genes influencing brain structure. Here we explore the relation between 448,293 single nucleotide polymorphisms in each of 31,622 voxels of the entire brain across 740 elderly subjects (mean age+/-s.d.: 75.52+/-6.82 years; 438 male) including subjects with Alzheimer's disease, Mild Cognitive Impairment, and healthy elderly controls from the Alzheimer's Disease Neuroimaging Initiative (ADNI). We used tensor-based morphometry to measure individual differences in brain structure at the voxel level relative to a study-specific template based on healthy elderly subjects. We then conducted a genome-wide association at each voxel to identify genetic variants of interest. By studying only the most associated variant at each voxel, we developed a novel method to address the multiple comparisons problem and computational burden associated with the unprecedented amount of data. No variant survived the strict significance criterion, but several genes worthy of further exploration were identified, including CSMD2 and CADPS2. These genes have high relevance to brain structure. This is the first voxelwise genome wide association study to our knowledge, and offers a novel method to discover genetic influences on brain structure.

  7. Genome-wide analysis and identification of genes related to expansin gene family in indica rice.

    PubMed

    Hemalatha, N; Rajesh, M K; Narayanan, N K

    2011-01-01

    In this study, we carried out genome-wide analyses to explore expansin gene family in the genome of indica rice. Reference nucleotides were chosen as query sequences for searches in the indica rice genome database. Clones having genomic sequences similar to expansin were taken and converted to amino acid sequences. Putative sequences were subjected to PROSITE and Pfam databases, and 21 signature-sequences-related expansin gene family was obtained. The presence of transmembrane domains was also predicted for all 21 expansin proteins. A phylogenetic tree was generated from the alignments of the proteins sequences to examine the phylogenetic relationship of indica rice expansin proteins.

  8. Genome-Wide Association Mapping of Acid Soil Resistance in Barley (Hordeum vulgare L.)

    PubMed Central

    Zhou, Gaofeng; Broughton, Sue; Zhang, Xiao-Qi; Ma, Yanling; Zhou, Meixue; Li, Chengdao

    2016-01-01

    Genome-wide association studies (GWAS) based on linkage disequilibrium (LD) have been used to detect QTLs underlying complex traits in major crops. In this study, we collected 218 barley (Hordeum vulgare L.) lines including wild barley and cultivated barley from China, Canada, Australia, and Europe. A total of 408 polymorphic markers were used for population structure and LD analysis. GWAS for acid soil resistance were performed on the population using a general linkage model (GLM) and a mixed linkage model (MLM), respectively. A total of 22 QTLs (quantitative trait loci) were detected with the GLM and MLM analyses. Two QTLs, close to markers bPb-1959 (133.1 cM) and bPb-8013 (86.7 cM), localized on chromosome 1H and 4H respectively, were consistently detected in two different trials with both the GLM and MLM analyses. Furthermore, bPb-8013, the closest marker to the major Al3+ resistance gene HvAACT1 in barley, was identified to be QTL5. The QTLs could be used in marker-assisted selection to identify and pyramid different loci for improved acid soil resistance in barley. PMID:27064793

  9. Genome-Wide Association Mapping of Acid Soil Resistance in Barley (Hordeum vulgare L.).

    PubMed

    Zhou, Gaofeng; Broughton, Sue; Zhang, Xiao-Qi; Ma, Yanling; Zhou, Meixue; Li, Chengdao

    2016-01-01

    Genome-wide association studies (GWAS) based on linkage disequilibrium (LD) have been used to detect QTLs underlying complex traits in major crops. In this study, we collected 218 barley (Hordeum vulgare L.) lines including wild barley and cultivated barley from China, Canada, Australia, and Europe. A total of 408 polymorphic markers were used for population structure and LD analysis. GWAS for acid soil resistance were performed on the population using a general linkage model (GLM) and a mixed linkage model (MLM), respectively. A total of 22 QTLs (quantitative trait loci) were detected with the GLM and MLM analyses. Two QTLs, close to markers bPb-1959 (133.1 cM) and bPb-8013 (86.7 cM), localized on chromosome 1H and 4H respectively, were consistently detected in two different trials with both the GLM and MLM analyses. Furthermore, bPb-8013, the closest marker to the major Al(3+) resistance gene HvAACT1 in barley, was identified to be QTL5. The QTLs could be used in marker-assisted selection to identify and pyramid different loci for improved acid soil resistance in barley.

  10. The identification of loci for polydactyly in chickens using a genome-wide association study.

    PubMed

    Sheng, Xihui; Chen, Yu; Jia, Yaxiong; Qi, Xiaolong; Feng, Yun; Huang, Zhen; Guo, Yong

    2015-09-01

    Polydactyly is a commonly observed limb malformation in humans and other vertebrates. The Beijing-You chicken expressing the polydactyly phenotype provides an opportunity to investigate the potential cause for polydactyly. Here we extensively exploited genetic determinants of the chicken polydactyly in a genome wide association study using over 580,000 SNPs characterized in a Beijing-You × Lohmann F1 cross, consisting of 79 animals. A total of 10 loci clustered on the short arm of chromosome 2 were identified to be significantly associated with the trait. Among the 10 significant SNPs, 7 were located in a linkage disequilibrium block of 1737kb. The strongest association signal (rs317674023, P=5.48×10(-8)) residing nearby Bone Morphogenetic Protein Receptor-Associated Molecule 1 (BRAM1) was identified in the genomic region. Our results provide insights to the genetic basis underlying chicken polydactyly and may facilitate studies of the limb malformation in humans and other species.

  11. Comparative and parallel genome-wide association studies for metabolic and agronomic traits in cereals

    PubMed Central

    Chen, Wei; Wang, Wensheng; Peng, Meng; Gong, Liang; Gao, Yanqiang; Wan, Jian; Wang, Shouchuang; Shi, Lei; Zhou, Bin; Li, Zongmei; Peng, Xiaoxi; Yang, Chenkun; Qu, Lianghuan; Liu, Xianqing; Luo, Jie

    2016-01-01

    The plant metabolome is characterized by extensive diversity and is often regarded as a bridge between genome and phenome. Here we report metabolic and phenotypic genome-wide studies (mGWAS and pGWAS) in rice grain that, in addition to previous metabolic GWAS in rice leaf and maize kernel, show both distinct and overlapping aspects of genetic control of metabolism within and between species. We identify new candidate genes potentially influencing important metabolic and/or morphological traits. We show that the differential genetic architecture of rice metabolism between different tissues is in part determined by tissue specific expression. Using parallel mGWAS and pGWAS we identify new candidate genes potentially responsible for variation in traits such as grain colour and size, and provide evidence of metabotype-phenotype linkage. Our study demonstrates a powerful strategy for interactive functional genomics and metabolomics in plants, especially the cloning of minor QTLs for complex phenotypic traits. PMID:27698483

  12. Amyotrophic Lateral Sclerosis Genetic Studies: From Genome-wide Association Mapping to Genome Sequencing.

    PubMed

    He, Ji; Mangelsdorf, Marie; Fan, Dongsheng; Bartlett, Perry; Brown, Matthew A

    2015-12-01

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease of obscure etiology. Multiple genetic studies have been conducted to advance our understanding of the disease, employing a variety of techniques such as linkage mapping in families, to genome-wide association studies and sequencing based approaches such as whole exome sequencing and whole genome sequencing and a few epigenetic analyses. While major progress has been made, the majority of the genetic variation involved in ALS is yet to be undefined. The optimal study designs to investigate ALS depend on the genetic model for the disease, and it is likely that different approaches will be required to map genes involved in familial and sporadic disease. The potential approaches and their strengths and weaknesses are discussed.

  13. A Genome-wide Association Study of Bipolar Disorder and Co-morbid Migraine

    PubMed Central

    Oedegaard, K J; Greenwood, T A; Johansson, S; Jacobsen, K K; Halmoy, A; Fasmer, O B; Akiskal, H S; Haavik, J; Kelsoe, J R

    2010-01-01

    Both migraine and Bipolar Disorder (BPAD) are complex phenotypes with significant genetic and non-genetic components. Epidemiological and clinical studies have demonstrated a high degree of co-morbidity between migraine and BPAD, and overlapping regions of linkage have been shown in numerous genome-wide linkage studies. To identify susceptibility factors for the BPAD/migraine phenotype, we conducted a genome-wide association study (GWAS) in 1001 cases with bipolar disorder collected through the NIMH Genetics Initiative for Bipolar Disorder and genotyped at 1M SNPs as part of the Genetic Association Information Network (GAIN). We compared BPAD patients without any headache (n=699) to BPAD patients with doctor diagnosed migraine (n=56). The strongest evidence for association was found for several SNPs in a 317 kb region encompassing the uncharacterized gene KIAA0564 (e.g. rs9566845 (OR=4.98 (95%CI: 2.6–9.48), p= 7.7 ×10−8) and rs9566867 (p= 8.2 × 10−8)). Although the level of significance was significanlty reduced when using the Fisher’s Exact test (due to the low count of cases with migraine); rs9566845 p= 1.4 ×10−5 and rs9566867 p= 1.5 × 10−5, this region remained the most prominent finding. Furthermore, marker rs9566845 was genotyped and found associated with migraine in an independent Norwegian sample of adult ADHD patients with and without co-morbid migraine (n=131 and n=324 respectively), OR=2.42 (1.18–4.97), p=0.013. This is the first GWAS examining patients with bipolar disorder and co-morbid migraine. These data suggest that genetic variants in the KIAA0564 gene region may predispose to migraine headaches in subgroups of patients with both BPAD and ADHD. PMID:20528957

  14. FVGWAS: Fast Voxelwise Genome Wide Association Analysis of Large-scale Imaging Genetic Data 1

    PubMed Central

    Huang, Meiyan; Nichols, Thomas; Huang, Chao; Yang, Yu; Lu, Zhaohua; Feng, Qianjing; Knickmeyer, Rebecca C; Zhu, Hongtu

    2015-01-01

    More and more large-scale imaging genetic studies are being widely conducted to collect a rich set of imaging, genetic, and clinical data to detect putative genes for complexly inherited neuropsychiatric and neurodegenerative disorders. Several major big-data challenges arise from testing genome-wide (NC > 12 million known variants) associations with signals at millions of locations (NV ~ 106) in the brain from thousands of subjects (n ~ 103). The aim of this paper is to develop a Fast Voxelwise Genome Wide Association analysiS (FVGWAS) framework to e ciently carry out whole-genome analyses of whole-brain data. FVGWAS consists of three components including a heteroscedastic linear model, a global sure independence screening (G-SIS) procedure, and a detection procedure based on wild bootstrap methods. Specifically, for standard linear association, the computational complexity is O(nNV NC) for voxelwise genome wide association analysis (VGWAS) method compared with O((NC + NV)n2) for FVGWAS. Simulation studies show that FVGWAS is an effcient method of searching sparse signals in an extremely large search space, while controlling for the family-wise error rate. Finally, we have successfully applied FVGWAS to a large-scale imaging genetic data analysis of ADNI data with 708 subjects, 193,275 voxels in RAVENS maps, and 501,584 SNPs, and the total processing time was 203,645 seconds for a single CPU. Our FVG-WAS may be a valuable statistical toolbox for large-scale imaging genetic analysis as the field is rapidly advancing with ultra-high-resolution imaging and whole-genome sequencing. PMID:26025292

  15. Genome-wide response to selection and genetic basis of cold tolerance in rice (Oryza sativa L.)

    PubMed Central

    2014-01-01

    Background Cold stress is an important factor limiting rice yield in many areas of high latitude and altitude. Considerable efforts have been taken to genetically dissect cold tolerance (CT) in rice using DNA markers. Because of possible epistasis and gene × environment interactions associated with identified quantitative trait loci, the results of these genetic studies have unfortunately not been directly applicable to marker-assisted selection for improved rice CT. In this study, we demonstrated the utility of a selective introgression strategy for simultaneous improvement and genetic dissection of rice seedling CT. Results A set of japonica introgression lines (ILs) with significantly improved seedling CT were developed from four backcross populations based on two rounds of selection. Genetic characterization of these cold-tolerant ILs revealed two important aspects of genome-wide responses to strong phenotypic selection for rice CT: (1) significant over-introgression of donor alleles at 57 loci in 29 functional genetic units (FGUs) across the rice genome and (2) pronounced non-random associations between or among alleles at many unlinked CT loci. Linkage disequilibrium analyses of the detected CT loci allowed us to construct putative genetic networks (multi-locus structures) underlying the seedling CT of rice. Each network consisted of a single FGU, with high introgression as the putative regulator plus two to three groups of highly associated downstream FGUs. A bioinformatics search of rice genomic regions harboring these putative regulators identified a small set of candidate regulatory genes that are known to be involved in plant stress response. Conclusions Our results suggest that CT in rice is controlled by multiple pathways. Genetic complementarity between parental-derived functional alleles at many loci within a given pathway provides an appropriate explanation for the commonly observed hidden diversity and transgressive segregation of CT and other

  16. Fine-mapping of genome-wide association study-identified risk loci for colorectal cancer in African Americans

    PubMed Central

    Wang, Hansong; Haiman, Christopher A.; Burnett, Terrilea; Fortini, Barbara K.; Kolonel, Laurence N.; Henderson, Brian E.; Signorello, Lisa B.; Blot, William J.; Keku, Temitope O.; Berndt, Sonja I.; Newcomb, Polly A.; Pande, Mala; Amos, Christopher I.; West, Dee W.; Casey, Graham; Sandler, Robert S.; Haile, Robert; Stram, Daniel O.; Le Marchand, Loïc

    2013-01-01

    Genome-wide association studies of colorectal cancer (CRC) in Europeans and Asians have identified 21 risk susceptibility regions [29 index single-nucleotide polymorphisms (SNPs)]. Characterizing these risk regions in diverse racial groups with different linkage disequilibrium (LD) structure can help localize causal variants. We examined associations between CRC and all 29 index SNPs in 6597 African Americans (1894 cases and 4703 controls). Nine SNPs in eight regions (5q31.1, 6q26-q27, 8q23.3, 8q24.21, 11q13.4, 15q13.3, 18q21.1 and 20p12.3) formally replicated in our data with one-sided P-values <0.05 and the same risk directions as reported previously. We performed fine-mapping of the 21 risk regions (including 250 kb on both sides of the index SNPs) using genotyped and imputed markers at the density of the 1000 Genomes Project to search for additional or more predictive risk markers. Among the SNPs correlated with the index variants, two markers, rs12759486 (or rs7547751, a putative functional variant in perfect LD with it) in 1q41 and rs7252505 in 19q13.1, were more strongly and statistically significantly associated with CRC (P < 0.0006). The average per allele risk was improved using the replicated index variants and the two new markers (odds ratio = 1.14, P = 6.5 × 10−16) in African Americans, compared with using all index SNPs (odds ratio = 1.07, P = 3.4 × 10−10). The contribution of the two new risk SNPs to CRC heritability was estimated to be 1.5% in African Americans. This study highlights the importance of fine-mapping in diverse populations. PMID:23851122

  17. Genome-Wide Association Study of Metabolic Syndrome in Koreans

    PubMed Central

    Jeong, Seok Won; Chung, Myungguen; Park, Soo-Jung; Cho, Seong Beom

    2014-01-01

    Metabolic syndrome (METS) is a disorder of energy utilization and storage and increases the risk of developing cardiovascular disease and diabetes. To identify the genetic risk factors of METS, we carried out a genome-wide association study (GWAS) for 2,657 cases and 5,917 controls in Korean populations. As a result, we could identify 2 single nucleotide polymorphisms (SNPs) with genome-wide significance level p-values (<5 × 10-8), 8 SNPs with genome-wide suggestive p-values (5 × 10-8 ≤ p < 1 × 10-5), and 2 SNPs of more functional variants with borderline p-values (5 × 10-5 ≤ p < 1 × 10-4). On the other hand, the multiple correction criteria of conventional GWASs exclude false-positive loci, but simultaneously, they discard many true-positive loci. To reconsider the discarded true-positive loci, we attempted to include the functional variants (nonsynonymous SNPs [nsSNPs] and expression quantitative trait loci [eQTL]) among the top 5,000 SNPs based on the proportion of phenotypic variance explained by genotypic variance. In total, 159 eQTLs and 18 nsSNPs were presented in the top 5,000 SNPs. Although they should be replicated in other independent populations, 6 eQTLs and 2 nsSNP loci were located in the molecular pathways of LPL, APOA5, and CHRM2, which were the significant or suggestive loci in the METS GWAS. Conclusively, our approach using the conventional GWAS, reconsidering functional variants and pathway-based interpretation, suggests a useful method to understand the GWAS results of complex traits and can be expanded in other genomewide association studies. PMID:25705157

  18. Genome-wide association study of antisocial personality disorder.

    PubMed

    Rautiainen, M-R; Paunio, T; Repo-Tiihonen, E; Virkkunen, M; Ollila, H M; Sulkava, S; Jolanki, O; Palotie, A; Tiihonen, J

    2016-01-01

    The pathophysiology of antisocial personality disorder (ASPD) remains unclear. Although the most consistent biological finding is reduced grey matter volume in the frontal cortex, about 50% of the total liability to developing ASPD has been attributed to genetic factors. The contributing genes remain largely unknown. Therefore, we sought to study the genetic background of ASPD. We conducted a genome-wide association study (GWAS) and a replication analysis of Finnish criminal offenders fulfilling DSM-IV criteria for ASPD (N=370, N=5850 for controls, GWAS; N=173, N=3766 for controls and replication sample). The GWAS resulted in suggestive associations of two clusters of single-nucleotide polymorphisms at 6p21.2 and at 6p21.32 at the human leukocyte antigen (HLA) region. Imputation of HLA alleles revealed an independent association with DRB1*01:01 (odds ratio (OR)=2.19 (1.53-3.14), P=1.9 × 10(-5)). Two polymorphisms at 6p21.2 LINC00951-LRFN2 gene region were replicated in a separate data set, and rs4714329 reached genome-wide significance (OR=1.59 (1.37-1.85), P=1.6 × 10(-9)) in the meta-analysis. The risk allele also associated with antisocial features in the general population conditioned for severe problems in childhood family (β=0.68, P=0.012). Functional analysis in brain tissue in open access GTEx and Braineac databases revealed eQTL associations of rs4714329 with LINC00951 and LRFN2 in cerebellum. In humans, LINC00951 and LRFN2 are both expressed in the brain, especially in the frontal cortex, which is intriguing considering the role of the frontal cortex in behavior and the neuroanatomical findings of reduced gray matter volume in ASPD. To our knowledge, this is the first study showing genome-wide significant and replicable findings on genetic variants associated with any personality disorder.

  19. Voxelwise genome-wide association study (vGWAS)

    PubMed Central

    Stein, Jason L.; Hua, Xue; Lee, Suh; Ho, April J.; Leow, Alex D.; Toga, Arthur W.; Saykin, Andrew J.; Shen, Li; Foroud, Tatiana; Pankratz, Nathan; Huentelman, Matthew J.; Craig, David W.; Gerber, Jill D.; Allen, April N.; Corneveaux, Jason J.; DeChairo, Bryan M.; Potkin, Steven G.; Weiner, Michael W.; Thompson, Paul M.

    2010-01-01

    The structure of the human brain is highly heritable, and is thought to be influenced by many common genetic variants, many of which are currently unknown. Recent advances in neuroimaging and genetics have allowed collection of both highly detailed structural brain scans and genome-wide genotype information. This wealth of information presents a new opportunity to find the genes influencing brain structure. Here we explore the relation between 448,293 single nucleotide polymorphisms in each of 31,622 voxels of the entire brain across 740 elderly subjects (mean age±s.d.: 75.52±6.82 years; 438 male) including subjects with Alzheimer's disease, Mild Cognitive Impairment, and healthy elderly controls from the Alzheimer's Disease Neuroimaging Initiative (ADNI). We used tensor-based morphometry to measure individual differences in brain structure at the voxel level relative to a study-specific template based on healthy elderly subjects. We then conducted a genome-wide association at each voxel to identify genetic variants of interest. By studying only the most associated variant at each voxel, we developed a novel method to address the multiple comparisons problem and computational burden associated with the unprecedented amount of data. No variant survived the strict significance criterion, but several genes worthy of further exploration were identified, including CSMD2 and CADPS2. These genes have high relevance to brain structure. This is the first voxelwise genome wide association study to our knowledge, and offers a novel method to discover genetic influences on brain structure. PMID:20171287

  20. Genome-Wide Approaches to Drosophila Heart Development

    PubMed Central

    Frasch, Manfred

    2016-01-01

    The development of the dorsal vessel in Drosophila is one of the first systems in which key mechanisms regulating cardiogenesis have been defined in great detail at the genetic and molecular level. Due to evolutionary conservation, these findings have also provided major inputs into studies of cardiogenesis in vertebrates. Many of the major components that control Drosophila cardiogenesis were discovered based on candidate gene approaches and their functions were defined by employing the outstanding genetic tools and molecular techniques available in this system. More recently, approaches have been taken that aim to interrogate the entire genome in order to identify novel components and describe genomic features that are pertinent to the regulation of heart development. Apart from classical forward genetic screens, the availability of the thoroughly annotated Drosophila genome sequence made new genome-wide approaches possible, which include the generation of massive numbers of RNA interference (RNAi) reagents that were used in forward genetic screens, as well as studies of the transcriptomes and proteomes of the developing heart under normal and experimentally manipulated conditions. Moreover, genome-wide chromatin immunoprecipitation experiments have been performed with the aim to define the full set of genomic binding sites of the major cardiogenic transcription factors, their relevant target genes, and a more complete picture of the regulatory network that drives cardiogenesis. This review will give an overview on these genome-wide approaches to Drosophila heart development and on computational analyses of the obtained information that ultimately aim to provide a description of this process at the systems level. PMID:27294102

  1. Genetics, Genome-Wide Association Studies, and Menarche.

    PubMed

    Witchel, Selma Feldman

    2016-07-01

    Puberty is characterized by maturation of the hypothalamic-pituitary-gonadal axis, development of secondary sexual features, increased linear growth velocity, maturation of the epiphyses limiting additional growth, and achievement of menarche. The age at menarche appears to have a significant genetic component. With the advent of genome-wide association studies (GWASs), the genome has been interrogated to find associations between specific loci and age at menarche. It is apparent that multiple genetic loci, epigenetic mechanisms, and environmental factors modulate this biological event crucial for reproductive competence.

  2. Methodological challenges of genome-wide association analysis in Africa

    PubMed Central

    Teo, Yik-Ying; Small, Kerrin S.; Kwiatkowski, Dominic P.

    2013-01-01

    Medical research in Africa has yet to benefit from the advent of genome-wide association (GWA) analysis, partly because the genotyping tools and statistical methods that have been developed for European and Asian populations struggle to deal with the high levels of genome diversity and population structure in Africa. However, the haplotypic diversity of African populations might help to overcome one of the major roadblocks in GWA research, the fine mapping of causal variants. We review the methodological challenges and consider how GWA studies in Africa will be transformed by new approaches in statistical imputation and large-scale genome sequencing. PMID:20084087

  3. [Genome-wide association study for adolescent idiopathic scoliosis].

    PubMed

    Ogura, Yoji; Kou, Ikuyo; Scoliosis, Japan; Matsumoto, Morio; Watanabe, Kota; Ikegawa, Shiro

    2016-04-01

    Adolescent idiopathic scoliosis(AIS)is a polygenic disease. Genome-wide association studies(GWASs)have been performed for a lot of polygenic diseases. For AIS, we conducted GWAS and identified the first AIS locus near LBX1. After the discovery, we have extended our study by increasing the numbers of subjects and SNPs. In total, our Japanese GWAS has identified four susceptibility genes. GWASs for AIS have also been performed in the USA and China, which identified one and three susceptibility genes, respectively. Here we review GWASs in Japan and abroad and functional analysis to clarify the pathomechanism of AIS. PMID:27013625

  4. Genome-wide profiling of alternative splicing in Alzheimer's disease

    PubMed Central

    Lai, Mitchell K.P.; Esiri, Margaret M.; Tan, Michelle G.K.

    2014-01-01

    Alternative splicing is a highly regulated process which generates transcriptome and proteome diversity through the skipping or inclusion of exons within gene loci. Identification of aberrant alternative splicing associated with human diseases has become feasible with the development of new genomic technologies and powerful bioinformatics. We have previously reported genome-wide gene alterations in the neocortex of a well-characterized cohort of Alzheimer's disease (AD) patients and matched elderly controls using a commercial exon microarray platform [1]. Here, we provide detailed description of analyses aimed at identifying differential alternative splicing events associated with AD. PMID:26484111

  5. Genetics, Genome-Wide Association Studies, and Menarche.

    PubMed

    Witchel, Selma Feldman

    2016-07-01

    Puberty is characterized by maturation of the hypothalamic-pituitary-gonadal axis, development of secondary sexual features, increased linear growth velocity, maturation of the epiphyses limiting additional growth, and achievement of menarche. The age at menarche appears to have a significant genetic component. With the advent of genome-wide association studies (GWASs), the genome has been interrogated to find associations between specific loci and age at menarche. It is apparent that multiple genetic loci, epigenetic mechanisms, and environmental factors modulate this biological event crucial for reproductive competence. PMID:27513021

  6. Genome-Wide Association Studies for Polycystic Ovary Syndrome.

    PubMed

    Liu, Hongbin; Zhao, Han; Chen, Zi-Jiang

    2016-07-01

    Over the past several years, the field of reproductive medicine has witnessed great advances in genome-wide association studies (GWASs) of polycystic ovary syndrome (PCOS), leading to identification of several promising genes involved in hormone action, type 2 diabetes, and cell proliferation. This review summarizes the key findings and discusses their potential implications with regard to genetic mechanisms of PCOS. Limitations of GWAS are evaluated, emphasizing the understanding of the reasons for variability in results between individual studies. Root causes of misinterpretations of GWASs are also addressed. Finally, the impact of GWAS on future directions of multi- and interdisciplinary studies is discussed. PMID:27513023

  7. [Genome-wide association study for adolescent idiopathic scoliosis].

    PubMed

    Ogura, Yoji; Kou, Ikuyo; Scoliosis, Japan; Matsumoto, Morio; Watanabe, Kota; Ikegawa, Shiro

    2016-04-01

    Adolescent idiopathic scoliosis(AIS)is a polygenic disease. Genome-wide association studies(GWASs)have been performed for a lot of polygenic diseases. For AIS, we conducted GWAS and identified the first AIS locus near LBX1. After the discovery, we have extended our study by increasing the numbers of subjects and SNPs. In total, our Japanese GWAS has identified four susceptibility genes. GWASs for AIS have also been performed in the USA and China, which identified one and three susceptibility genes, respectively. Here we review GWASs in Japan and abroad and functional analysis to clarify the pathomechanism of AIS.

  8. Genome-wide association studies and contribution to cardiovascular physiology

    PubMed Central

    Munroe, Patricia B.

    2015-01-01

    The study of family pedigrees with rare monogenic cardiovascular disorders has revealed new molecular players in physiological processes. Genome-wide association studies of complex traits with a heritable component may afford a similar and potentially intellectually richer opportunity. In this review we focus on the interpretation of genetic associations and the issue of causality in relation to known and potentially new physiology. We mainly discuss cardiometabolic traits as it reflects our personal interests, but the issues pertain broadly in many other disciplines. We also describe some of the resources that are now available that may expedite follow up of genetic association signals into observations on causal mechanisms and pathophysiology. PMID:26106147

  9. Genome-wide association studies and contribution to cardiovascular physiology.

    PubMed

    Munroe, Patricia B; Tinker, Andrew

    2015-09-01

    The study of family pedigrees with rare monogenic cardiovascular disorders has revealed new molecular players in physiological processes. Genome-wide association studies of complex traits with a heritable component may afford a similar and potentially intellectually richer opportunity. In this review we focus on the interpretation of genetic associations and the issue of causality in relation to known and potentially new physiology. We mainly discuss cardiometabolic traits as it reflects our personal interests, but the issues pertain broadly in many other disciplines. We also describe some of the resources that are now available that may expedite follow up of genetic association signals into observations on causal mechanisms and pathophysiology.

  10. Genome-wide interaction analysis reveals replicated epistatic effects on brain structure

    PubMed Central

    Hibar, Derrek P.; Stein, Jason L.; Jahanshad, Neda; Kohannim, Omid; Hua, Xue; Toga, Arthur W.; McMahon, Katie L.; de Zubicaray, Greig I.; Martin, Nicholas G.; Wright, Margaret J.; Weiner, Michael W.; Thompson, Paul M.

    2015-01-01

    The discovery of several genes that affect risk for Alzheimer's disease ignited a worldwide search for Single Nucleotide Polymorphisms (SNPs), common genetic variants that affect the brain. Genome-wide search of all possible SNP-SNP interactions is challenging and rarely attempted, due to the complexity of conducting ∼1011 pairwise statistical tests. However, recent advances in machine learning, e.g., iterative sure independence screening (SIS), make it possible to analyze datasets with vastly more predictors than observations. Using an implementation of the SIS algorithm (called EPISIS), we performed a genome-wide interaction analysis testing all possible SNP-SNP interactions affecting regional brain volumes measured on MRI and mapped using tensor-based morphometry. We identified a significant SNP-SNP interaction between rs1345203 and rs1213205 that explains 1.9% of the variance in temporal lobe volume. We mapped the whole-brain, voxelwise effects of the interaction in the ADNI dataset and separately in an independent replication dataset of healthy twins (QTIM). Each additional loading in the interaction effect was associated with ∼5% greater brain regional brain volume (a protective effect) in both ADNI and QTIM samples. PMID:25264344

  11. A Pooled Genome-Wide Association Study of Asperger Syndrome.

    PubMed

    Warrier, Varun; Chakrabarti, Bhismadev; Murphy, Laura; Chan, Allen; Craig, Ian; Mallya, Uma; Lakatošová, Silvia; Rehnstrom, Karola; Peltonen, Leena; Wheelwright, Sally; Allison, Carrie; Fisher, Simon E; Baron-Cohen, Simon

    2015-01-01

    Asperger Syndrome (AS) is a neurodevelopmental condition characterized by impairments in social interaction and communication, alongside the presence of unusually repetitive, restricted interests and stereotyped behaviour. Individuals with AS have no delay in cognitive and language development. It is a subset of Autism Spectrum Conditions (ASC), which are highly heritable and has a population prevalence of approximately 1%. Few studies have investigated the genetic basis of AS. To address this gap in the literature, we performed a genome-wide pooled DNA association study to identify candidate loci in 612 individuals (294 cases and 318 controls) of Caucasian ancestry, using the Affymetrix GeneChip Human Mapping version 6.0 array. We identified 11 SNPs that had a p-value below 1x10-5. These SNPs were independently genotyped in the same sample. Three of the SNPs (rs1268055, rs7785891 and rs2782448) were nominally significant, though none remained significant after Bonferroni correction. Two of our top three SNPs (rs7785891 and rs2782448) lie in loci previously implicated in ASC. However, investigation of the three SNPs in the ASC genome-wide association dataset from the Psychiatric Genomics Consortium indicated that these three SNPs were not significantly associated with ASC. The effect sizes of the variants were modest, indicating that our study was not sufficiently powered to identify causal variants with precision.

  12. Genome-wide analysis of DNA methylation in hepatoblastoma tissues

    PubMed Central

    Cui, Ximao; Liu, Baihui; Zheng, Shan; Dong, Kuiran; Dong, Rui

    2016-01-01

    DNA methylation has a crucial role in cancer biology. In the present study, a genome-wide analysis of DNA methylation in hepatoblastoma (HB) tissues was performed to verify differential methylation levels between HB and normal tissues. As alpha-fetoprotein (AFP) has a critical role in HB, AFP methylation levels were also detected using pyrosequencing. Normal and HB liver tissue samples (frozen tissue) were obtained from patients with HB. Genome-wide analysis of DNA methylation in these tissues was performed using an Infinium HumanMethylation450 BeadChip, and the results were confirmed with reverse transcription-quantitative polymerase chain reaction. The Infinium HumanMethylation450 BeadChip demonstrated distinctively less methylation in HB tissues than in non-tumor tissues. In addition, methylation enrichment was observed in positions near the transcription start site of AFP, which exhibited lower methylation levels in HB tissues than in non-tumor liver tissues. Lastly, a significant negative correlation was observed between AFP messenger RNA expression and DNA methylation percentage, using linear Pearson's R correlation coefficients. The present results demonstrate differential methylation levels between HB and normal tissues, and imply that aberrant methylation of AFP in HB could reflect HB development. Expansion of these findings could provide useful insight into HB biology. PMID:27446465

  13. Genome-wide association study of blood pressure and hypertension

    PubMed Central

    Levy, Daniel; Ehret, Georg B.; Rice, Kenneth; Verwoert, Germaine C.; Launer, Lenore J.; Dehghan, Abbas; Glazer, Nicole L.; Morrison, Alanna C.; Johnson, Andrew D.; Aspelund, Thor; Aulchenko, Yurii; Lumley, Thomas; Köttgen, Anna; Vasan, Ramachandran S.; Rivadeneira, Fernando; Eiriksdottir, Gudny; Guo, Xiuqing; Arking, Dan E.; Mitchell, Gary F.; Mattace-Raso, Francesco U.S.; Smith, Albert V; Taylor, Kent; Scharpf, Robert B.; Hwang, Shih-Jen; Sijbrands, Eric J.G.; Bis, Joshua; Harris, Tamara B.; Ganesh, Santhi K.; O’Donnell, Christopher J.; Hofman, Albert; Rotter, Jerome I.; Coresh, Josef; Benjamin, Emelia J.; Uitterlinden, André G.; Heiss, Gerardo; Fox, Caroline S.; Witteman, Jacqueline C.M.; Boerwinkle, Eric; Wang, Thomas J.; Gudnason, Vilmundur; Larson, Martin G.; Chakravarti, Aravinda; Psaty, Bruce M.; van Duijn, Cornelia M.

    2010-01-01

    Blood pressure (BP) is a major cardiovascular disease risk factor. To date, few variants associated with inter-individual BP variation have been identified. A genome-wide association study of systolic (SBP), diastolic BP (DBP), and hypertension in the CHARGE Consortium (n=29,136) identified 13 SNPs for SBP, 20 for DBP, and 10 for hypertension at p <4×10-7. The top 10 loci for SBP and DBP were incorporated into a risk score; mean BP and prevalence of hypertension increased in relation to number of risk alleles carried. When 10 CHARGE SNPs for each trait were meta-analyzed jointly with the Global BPgen Consortium (n=34,433), four CHARGE loci attained genome-wide significance (p<5×10-8) for SBP (ATP2B1, CYP17A1, PLEKHA7, SH2B3), six for DBP (ATP2B1, CACNB2, CSK/ULK3, SH2B3, TBX3/TBX5, ULK4), and one for hypertension (ATP2B1). Identifying novel BP genes advances our understanding of BP regulation and highlights potential drug targets for the prevention or treatment of hypertension. PMID:19430479

  14. Phenome-wide analysis of genome-wide polygenic scores

    PubMed Central

    Krapohl, E; Euesden, J; Zabaneh, D; Pingault, J-B; Rimfeld, K; von Stumm, S; Dale, P S; Breen, G; O'Reilly, P F; Plomin, R

    2016-01-01

    Genome-wide polygenic scores (GPS), which aggregate the effects of thousands of DNA variants from genome-wide association studies (GWAS), have the potential to make genetic predictions for individuals. We conducted a systematic investigation of associations between GPS and many behavioral traits, the behavioral phenome. For 3152 unrelated 16-year-old individuals representative of the United Kingdom, we created 13 GPS from the largest GWAS for psychiatric disorders (for example, schizophrenia, depression and dementia) and cognitive traits (for example, intelligence, educational attainment and intracranial volume). The behavioral phenome included 50 traits from the domains of psychopathology, personality, cognitive abilities and educational achievement. We examined phenome-wide profiles of associations for the entire distribution of each GPS and for the extremes of the GPS distributions. The cognitive GPS yielded stronger predictive power than the psychiatric GPS in our UK-representative sample of adolescents. For example, education GPS explained variation in adolescents' behavior problems (~0.6%) and in educational achievement (~2%) but psychiatric GPS were associated with neither. Despite the modest effect sizes of current GPS, quantile analyses illustrate the ability to stratify individuals by GPS and opportunities for research. For example, the highest and lowest septiles for the education GPS yielded a 0.5 s.d. difference in mean math grade and a 0.25 s.d. difference in mean behavior problems. We discuss the usefulness and limitations of GPS based on adult GWAS to predict genetic propensities earlier in development. PMID:26303664

  15. Genome-Wide Patterns of Nucleotide Polymorphism in Domesticated Rice

    PubMed Central

    Hernandez, Ryan D; Boyko, Adam; Fledel-Alon, Adi; York, Thomas L; Polato, Nicholas R; Olsen, Kenneth M; Nielsen, Rasmus; McCouch, Susan R; Bustamante, Carlos D; Purugganan, Michael D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that selection results only in a local signature of variation. PMID:17907810

  16. A Pooled Genome-Wide Association Study of Asperger Syndrome.

    PubMed

    Warrier, Varun; Chakrabarti, Bhismadev; Murphy, Laura; Chan, Allen; Craig, Ian; Mallya, Uma; Lakatošová, Silvia; Rehnstrom, Karola; Peltonen, Leena; Wheelwright, Sally; Allison, Carrie; Fisher, Simon E; Baron-Cohen, Simon

    2015-01-01

    Asperger Syndrome (AS) is a neurodevelopmental condition characterized by impairments in social interaction and communication, alongside the presence of unusually repetitive, restricted interests and stereotyped behaviour. Individuals with AS have no delay in cognitive and language development. It is a subset of Autism Spectrum Conditions (ASC), which are highly heritable and has a population prevalence of approximately 1%. Few studies have investigated the genetic basis of AS. To address this gap in the literature, we performed a genome-wide pooled DNA association study to identify candidate loci in 612 individuals (294 cases and 318 controls) of Caucasian ancestry, using the Affymetrix GeneChip Human Mapping version 6.0 array. We identified 11 SNPs that had a p-value below 1x10-5. These SNPs were independently genotyped in the same sample. Three of the SNPs (rs1268055, rs7785891 and rs2782448) were nominally significant, though none remained significant after Bonferroni correction. Two of our top three SNPs (rs7785891 and rs2782448) lie in loci previously implicated in ASC. However, investigation of the three SNPs in the ASC genome-wide association dataset from the Psychiatric Genomics Consortium indicated that these three SNPs were not significantly associated with ASC. The effect sizes of the variants were modest, indicating that our study was not sufficiently powered to identify causal variants with precision. PMID:26176695

  17. A Pooled Genome-Wide Association Study of Asperger Syndrome

    PubMed Central

    Warrier, Varun; Chakrabarti, Bhismadev; Murphy, Laura; Chan, Allen; Craig, Ian; Mallya, Uma; Lakatošová, Silvia; Rehnstrom, Karola; Wheelwright, Sally; Allison, Carrie; Fisher, Simon E.; Baron-Cohen, Simon

    2015-01-01

    Asperger Syndrome (AS) is a neurodevelopmental condition characterized by impairments in social interaction and communication, alongside the presence of unusually repetitive, restricted interests and stereotyped behaviour. Individuals with AS have no delay in cognitive and language development. It is a subset of Autism Spectrum Conditions (ASC), which are highly heritable and has a population prevalence of approximately 1%. Few studies have investigated the genetic basis of AS. To address this gap in the literature, we performed a genome-wide pooled DNA association study to identify candidate loci in 612 individuals (294 cases and 318 controls) of Caucasian ancestry, using the Affymetrix GeneChip Human Mapping version 6.0 array. We identified 11 SNPs that had a p-value below 1x10-5. These SNPs were independently genotyped in the same sample. Three of the SNPs (rs1268055, rs7785891 and rs2782448) were nominally significant, though none remained significant after Bonferroni correction. Two of our top three SNPs (rs7785891 and rs2782448) lie in loci previously implicated in ASC. However, investigation of the three SNPs in the ASC genome-wide association dataset from the Psychiatric Genomics Consortium indicated that these three SNPs were not significantly associated with ASC. The effect sizes of the variants were modest, indicating that our study was not sufficiently powered to identify causal variants with precision. PMID:26176695

  18. Genome-wide identification of hypoxia-induced enhancer regions

    PubMed Central

    Preston, Jessica L.; Randel, Melissa A.; Johnson, Eric A.

    2015-01-01

    Here we present a genome-wide method for de novo identification of enhancer regions. This approach enables massively parallel empirical investigation of DNA sequences that mediate transcriptional activation and provides a platform for discovery of regulatory modules capable of driving context-specific gene expression. The method links fragmented genomic DNA to the transcription of randomer molecule identifiers and measures the functional enhancer activity of the library by massively parallel sequencing. We transfected a Drosophila melanogaster library into S2 cells in normoxia and hypoxia, and assayed 4,599,881 genomic DNA fragments in parallel. The locations of the enhancer regions strongly correlate with genes up-regulated after hypoxia and previously described enhancers. Novel enhancer regions were identified and integrated with RNAseq data and transcription factor motifs to describe the hypoxic response on a genome-wide basis as a complex regulatory network involving multiple stress-response pathways. This work provides a novel method for high-throughput assay of enhancer activity and the genome-scale identification of 31 hypoxia-activated enhancers in Drosophila. PMID:26713262

  19. Genome-wide association study of Tourette Syndrome

    PubMed Central

    Scharf, Jeremiah M.; Yu, Dongmei; Mathews, Carol A.; Neale, Benjamin M.; Stewart, S. Evelyn; Fagerness, Jesen A; Evans, Patrick; Gamazon, Eric; Edlund, Christopher K.; Service, Susan; Tikhomirov, Anna; Osiecki, Lisa; Illmann, Cornelia; Pluzhnikov, Anna; Konkashbaev, Anuar; Davis, Lea K; Han, Buhm; Crane, Jacquelyn; Moorjani, Priya; Crenshaw, Andrew T.; Parkin, Melissa A.; Reus, Victor I.; Lowe, Thomas L.; Rangel-Lugo, Martha; Chouinard, Sylvain; Dion, Yves; Girard, Simon; Cath, Danielle C; Smit, Jan H; King, Robert A.; Fernandez, Thomas; Leckman, James F.; Kidd, Kenneth K.; Kidd, Judith R.; Pakstis, Andrew J.; State, Matthew; Herrera, Luis Diego; Romero, Roxana; Fournier, Eduardo; Sandor, Paul; Barr, Cathy L; Phan, Nam; Gross-Tsur, Varda; Benarroch, Fortu; Pollak, Yehuda; Budman, Cathy L.; Bruun, Ruth D.; Erenberg, Gerald; Naarden, Allan L; Lee, Paul C; Weiss, Nicholas; Kremeyer, Barbara; Berrío, Gabriel Bedoya; Campbell, Desmond; Silgado, Julio C. Cardona; Ochoa, William Cornejo; Restrepo, Sandra C. Mesa; Muller, Heike; Duarte, Ana V. Valencia; Lyon, Gholson J; Leppert, Mark; Morgan, Jubel; Weiss, Robert; Grados, Marco A.; Anderson, Kelley; Davarya, Sarah; Singer, Harvey; Walkup, John; Jankovic, Joseph; Tischfield, Jay A.; Heiman, Gary A.; Gilbert, Donald L.; Hoekstra, Pieter J.; Robertson, Mary M.; Kurlan, Roger; Liu, Chunyu; Gibbs, J. Raphael; Singleton, Andrew; Hardy, John; Strengman, Eric; Ophoff, Roel; Wagner, Michael; Moessner, Rainald; Mirel, Daniel B.; Posthuma, Danielle; Sabatti, Chiara; Eskin, Eleazar; Conti, David V.; Knowles, James A.; Ruiz-Linares, Andres; Rouleau, Guy A.; Purcell, Shaun; Heutink, Peter; Oostra, Ben A.; McMahon, William; Freimer, Nelson; Cox, Nancy J.; Pauls, David L.

    2012-01-01

    Tourette Syndrome (TS) is a developmental disorder that has one of the highest familial recurrence rates among neuropsychiatric diseases with complex inheritance. However, the identification of definitive TS susceptibility genes remains elusive. Here, we report the first genome-wide association study (GWAS) of TS in 1285 cases and 4964 ancestry-matched controls of European ancestry, including two European-derived population isolates, Ashkenazi Jews from North America and Israel, and French Canadians from Quebec, Canada. In a primary meta-analysis of GWAS data from these European ancestry samples, no markers achieved a genome-wide threshold of significance (p<5 × 10−8); the top signal was found in rs7868992 on chromosome 9q32 within COL27A1 (p=1.85 × 10−6). A secondary analysis including an additional 211 cases and 285 controls from two closely-related Latin-American population isolates from the Central Valley of Costa Rica and Antioquia, Colombia also identified rs7868992 as the top signal (p=3.6 × 10−7 for the combined sample of 1496 cases and 5249 controls following imputation with 1000 Genomes data). This study lays the groundwork for the eventual identification of common TS susceptibility variants in larger cohorts and helps to provide a more complete understanding of the full genetic architecture of this disorder. PMID:22889924

  20. A genome-wide association study of aging.

    PubMed

    Walter, Stefan; Atzmon, Gil; Demerath, Ellen W; Garcia, Melissa E; Kaplan, Robert C; Kumari, Meena; Lunetta, Kathryn L; Milaneschi, Yuri; Tanaka, Toshiko; Tranah, Gregory J; Völker, Uwe; Yu, Lei; Arnold, Alice; Benjamin, Emelia J; Biffar, Reiner; Buchman, Aron S; Boerwinkle, Eric; Couper, David; De Jager, Philip L; Evans, Denis A; Harris, Tamara B; Hoffmann, Wolfgang; Hofman, Albert; Karasik, David; Kiel, Douglas P; Kocher, Thomas; Kuningas, Maris; Launer, Lenore J; Lohman, Kurt K; Lutsey, Pamela L; Mackenbach, Johan; Marciante, Kristin; Psaty, Bruce M; Reiman, Eric M; Rotter, Jerome I; Seshadri, Sudha; Shardell, Michelle D; Smith, Albert V; van Duijn, Cornelia; Walston, Jeremy; Zillikens, M Carola; Bandinelli, Stefania; Baumeister, Sebastian E; Bennett, David A; Ferrucci, Luigi; Gudnason, Vilmundur; Kivimaki, Mika; Liu, Yongmei; Murabito, Joanne M; Newman, Anne B; Tiemeier, Henning; Franceschini, Nora

    2011-11-01

    Human longevity and healthy aging show moderate heritability (20%-50%). We conducted a meta-analysis of genome-wide association studies from 9 studies from the Cohorts for Heart and Aging Research in Genomic Epidemiology Consortium for 2 outcomes: (1) all-cause mortality, and (2) survival free of major disease or death. No single nucleotide polymorphism (SNP) was a genome-wide significant predictor of either outcome (p < 5 × 10(-8)). We found 14 independent SNPs that predicted risk of death, and 8 SNPs that predicted event-free survival (p < 10(-5)). These SNPs are in or near genes that are highly expressed in the brain (HECW2, HIP1, BIN2, GRIA1), genes involved in neural development and function (KCNQ4, LMO4, GRIA1, NETO1) and autophagy (ATG4C), and genes that are associated with risk of various diseases including cancer and Alzheimer's disease. In addition to considerable overlap between the traits, pathway and network analysis corroborated these findings. These findings indicate that variation in genes involved in neurological processes may be an important factor in regulating aging free of major disease and achieving longevity.

  1. Genome-wide association interaction analysis for Alzheimer's disease.

    PubMed

    Gusareva, Elena S; Carrasquillo, Minerva M; Bellenguez, Céline; Cuyvers, Elise; Colon, Samuel; Graff-Radford, Neill R; Petersen, Ronald C; Dickson, Dennis W; Mahachie John, Jestinah M; Bessonov, Kyrylo; Van Broeckhoven, Christine; Harold, Denise; Williams, Julie; Amouyel, Philippe; Sleegers, Kristel; Ertekin-Taner, Nilüfer; Lambert, Jean-Charles; Van Steen, Kristel; Ramirez, Alfredo

    2014-11-01

    We propose a minimal protocol for exhaustive genome-wide association interaction analysis that involves screening for epistasis over large-scale genomic data combining strengths of different methods and statistical tools. The different steps of this protocol are illustrated on a real-life data application for Alzheimer's disease (AD) (2259 patients and 6017 controls from France). Particularly, in the exhaustive genome-wide epistasis screening we identified AD-associated interacting SNPs-pair from chromosome 6q11.1 (rs6455128, the KHDRBS2 gene) and 13q12.11 (rs7989332, the CRYL1 gene) (p = 0.006, corrected for multiple testing). A replication analysis in the independent AD cohort from Germany (555 patients and 824 controls) confirmed the discovered epistasis signal (p = 0.036). This signal was also supported by a meta-analysis approach in 5 independent AD cohorts that was applied in the context of epistasis for the first time. Transcriptome analysis revealed negative correlation between expression levels of KHDRBS2 and CRYL1 in both the temporal cortex (β = -0.19, p = 0.0006) and cerebellum (β = -0.23, p < 0.0001) brain regions. This is the first time a replicable epistasis associated with AD was identified using a hypothesis free screening approach.

  2. Genome-wide epigenetic alterations in cloned bovine fetuses.

    PubMed

    Cezar, Gabriela Gebrin; Bartolomei, Marisa S; Forsberg, Erik J; First, Neal L; Bishop, Michael D; Eilertsen, Kenneth J

    2003-03-01

    To gain a better understanding of global methylation differences associated with development of nuclear transfer (NT)-generated cattle, we analyzed the genome-wide methylation status of spontaneously aborted cloned fetuses, cloned fetuses, and adult clones that were derived from transgenic and nontransgenic cumulus, genital ridge, and body cell lines. Cloned fetuses were recovered from ongoing normal pregnancies and were morphologically normal. Fetuses generated by artificial insemination (AI) were used as controls. In vitro fertilization (IVF) fetuses were compared with AI controls to assess effects of in vitro culture on the 5-methylcytosine content of fetal genomes. All of the fetuses were female. Skin biopsies were obtained from cloned and AI-generated adult cows. All of the adult clones were phenotypically normal and lactating and had no history of health or reproductive disorders. Genome-wide cytosine methylation levels were monitored by reverse-phase HPLC, and results indicated reduced levels of methylated cytosine in NT-generated fetuses. In contrast, no differences were observed between adult, lactating clones and similarly aged lactating cows produced by AI. These data imply that survivability of cloned cattle may be closely related to the global DNA methylation status. This is the first report to indicate that global methylation losses may contribute to the developmental failure of cloned bovine fetuses. PMID:12604655

  3. A Genome-Wide Association Study of Aging

    PubMed Central

    Walter, Stefan; Atzmon, Gil; Demerath, Ellen W.; Garcia, Melissa E.; Kaplan, Robert C.; Kumari, Meena; Lunetta, Kathryn L.; Milaneschi, Yuri; Tanaka, Toshiko; Tranah, Gregory J.; Völker, Uwe; Yu, Lei; Arnold, Alice; Benjamin, Emelia J.; Biffar, Reiner; Buchman, Aron S.; Boerwinkle, Eric; Couper, David; De Jager, Philip L.; Evans, Denis A.; Harris, Tamara B.; Hoffmann, Wolfgang; Hofman, Albert; Karasik, David; Kiel, Douglas P.; Kocher, Thomas; Kuningas, Maris; Launer, Lenore J.; Lohman, Kurt K.; Lutsey, Pamela L.; Mackenbach, Johan; Marciante, Kristin; Psaty, Bruce M.; Reiman, Eric M.; Rotter, Jerome I.; Seshadri, Sudha; Shardell, Michelle D.; Smith, Albert V.; van Duijn, Cornelia; Walston, Jeremy; Zillikens, M. Carola; Bandinelli, Stefania; Baumeister, Sebastian E.; Bennett, David A.; Ferrucci, Luigi; Gudnason, Vilmundur; Kivimaki, Mika; Liu, Yongmei; Murabito, Joanne M.; Newman, Anne B.; Tiemeier, Henning; Franceschini, Nora

    2011-01-01

    Human longevity and healthy aging show moderate heritability (20–50%). We conducted a meta-analysis of genome-wide association studies from nine studies from the Cohorts for Heart and Aging Research in Genomic Epidemiology Consortium for two outcomes: a) all-cause mortality and b) survival free of major disease or death. No single nucleotide polymorphism (SNP) was a genome-wide significant predictor of either outcome (p < 5 × 10−8). We found fourteen independent SNPs that predicted risk of death, and eight SNPs that predicted event-free survival (p < 10−5). These SNPs are in or near genes that are highly expressed in the brain (HECW2, HIP1, BIN2, GRIA1), genes involved in neural development and function (KCNQ4, LMO4, GRIA1, NETO1) and autophagy (ATG4C), and genes that are associated with risk of various diseases including cancer and Alzheimer’s disease. In addition to considerable overlap between the traits, pathway and network analysis corroborated these findings. These findings indicate that variation in genes involved in neurological processes may be an important factor in regulating aging free of major disease and achieving longevity. PMID:21782286

  4. Genome-wide association study of Tourette's syndrome.

    PubMed

    Scharf, J M; Yu, D; Mathews, C A; Neale, B M; Stewart, S E; Fagerness, J A; Evans, P; Gamazon, E; Edlund, C K; Service, S K; Tikhomirov, A; Osiecki, L; Illmann, C; Pluzhnikov, A; Konkashbaev, A; Davis, L K; Han, B; Crane, J; Moorjani, P; Crenshaw, A T; Parkin, M A; Reus, V I; Lowe, T L; Rangel-Lugo, M; Chouinard, S; Dion, Y; Girard, S; Cath, D C; Smit, J H; King, R A; Fernandez, T V; Leckman, J F; Kidd, K K; Kidd, J R; Pakstis, A J; State, M W; Herrera, L D; Romero, R; Fournier, E; Sandor, P; Barr, C L; Phan, N; Gross-Tsur, V; Benarroch, F; Pollak, Y; Budman, C L; Bruun, R D; Erenberg, G; Naarden, A L; Lee, P C; Weiss, N; Kremeyer, B; Berrío, G B; Campbell, D D; Cardona Silgado, J C; Ochoa, W C; Mesa Restrepo, S C; Muller, H; Valencia Duarte, A V; Lyon, G J; Leppert, M; Morgan, J; Weiss, R; Grados, M A; Anderson, K; Davarya, S; Singer, H; Walkup, J; Jankovic, J; Tischfield, J A; Heiman, G A; Gilbert, D L; Hoekstra, P J; Robertson, M M; Kurlan, R; Liu, C; Gibbs, J R; Singleton, A; Hardy, J; Strengman, E; Ophoff, R A; Wagner, M; Moessner, R; Mirel, D B; Posthuma, D; Sabatti, C; Eskin, E; Conti, D V; Knowles, J A; Ruiz-Linares, A; Rouleau, G A; Purcell, S; Heutink, P; Oostra, B A; McMahon, W M; Freimer, N B; Cox, N J; Pauls, D L

    2013-06-01

    Tourette's syndrome (TS) is a developmental disorder that has one of the highest familial recurrence rates among neuropsychiatric diseases with complex inheritance. However, the identification of definitive TS susceptibility genes remains elusive. Here, we report the first genome-wide association study (GWAS) of TS in 1285 cases and 4964 ancestry-matched controls of European ancestry, including two European-derived population isolates, Ashkenazi Jews from North America and Israel and French Canadians from Quebec, Canada. In a primary meta-analysis of GWAS data from these European ancestry samples, no markers achieved a genome-wide threshold of significance (P<5 × 10(-8)); the top signal was found in rs7868992 on chromosome 9q32 within COL27A1 (P=1.85 × 10(-6)). A secondary analysis including an additional 211 cases and 285 controls from two closely related Latin American population isolates from the Central Valley of Costa Rica and Antioquia, Colombia also identified rs7868992 as the top signal (P=3.6 × 10(-7) for the combined sample of 1496 cases and 5249 controls following imputation with 1000 Genomes data). This study lays the groundwork for the eventual identification of common TS susceptibility variants in larger cohorts and helps to provide a more complete understanding of the full genetic architecture of this disorder.

  5. Genome-wide association studies of suicidal behaviors: a review.

    PubMed

    Sokolowski, Marcus; Wasserman, Jerzy; Wasserman, Danuta

    2014-10-01

    Suicidal behaviors represent a fatal dimension of mental ill-health, involving both environmental and heritable (genetic) influences. The putative genetic components of suicidal behaviors have until recent years been mainly investigated by hypothesis-driven research (of "candidate genes"). But technological progress in genotyping has opened the possibilities towards (hypothesis-generating) genomic screens and novel opportunities to explore polygenetic perspectives, now spanning a wide array of possible analyses falling under the term Genome-Wide Association Study (GWAS). Here we introduce and discuss broadly some apparent limitations but also certain developing opportunities of GWAS. We summarize the results from all the eight GWAS conducted up to date focused on suicidality outcomes; treatment emergent suicidal ideation (3 studies), suicide attempts (4 studies) and completed suicides (1 study). Clearly, there are few (if any) genome-wide significant and reproducible findings yet to be demonstrated. We then discuss and pinpoint certain future considerations in relation to sample sizes, the units of genetic associations used, study designs and outcome definitions, psychiatric diagnoses or biological measures, as well as the use of genomic sequencing. We conclude that GWAS should have a lot more potential to show in the case of suicidal outcomes, than what has yet been realized. PMID:25219938

  6. Genome-wide signals of positive selection in human evolution

    PubMed Central

    Enard, David; Messer, Philipp W.; Petrov, Dmitri A.

    2014-01-01

    The role of positive selection in human evolution remains controversial. On the one hand, scans for positive selection have identified hundreds of candidate loci, and the genome-wide patterns of polymorphism show signatures consistent with frequent positive selection. On the other hand, recent studies have argued that many of the candidate loci are false positives and that most genome-wide signatures of adaptation are in fact due to reduction of neutral diversity by linked deleterious mutations, known as background selection. Here we analyze human polymorphism data from the 1000 Genomes Project and detect signatures of positive selection once we correct for the effects of background selection. We show that levels of neutral polymorphism are lower near amino acid substitutions, with the strongest reduction observed specifically near functionally consequential amino acid substitutions. Furthermore, amino acid substitutions are associated with signatures of recent adaptation that should not be generated by background selection, such as unusually long and frequent haplotypes and specific distortions in the site frequency spectrum. We use forward simulations to argue that the observed signatures require a high rate of strongly adaptive substitutions near amino acid changes. We further demonstrate that the observed signatures of positive selection correlate better with the presence of regulatory sequences, as predicted by the ENCODE Project Consortium, than with the positions of amino acid substitutions. Our results suggest that adaptation was frequent in human evolution and provide support for the hypothesis of King and Wilson that adaptive divergence is primarily driven by regulatory changes. PMID:24619126

  7. Automated linkage analysis in psychiatric disorders

    SciTech Connect

    He, L.; Mansfield, D.C.; Brown, A.F.; Green, D.K.

    1995-06-19

    A genome-wide search for linkage of microsatellite markers to chromosomal loci containing genes responsible for the major psychoses is a laborious task which can be carried out with greater speed and economy by introducing automation to several steps in the procedure. We describe the use of the Automated Linkage Preprocessor (ALP) program for the computer analysis of the waveform generated by fluorescein-labelled markers after electrophoretic separation. (To obtain a copy send a request to A.F. Brown at the below MRC address or use Anonymous FTP to ftp.hgu.mrc.ac.uk. Software is in directory pub/ALP.) The program runs on a PC in the Microsoft Windows environment, and is used in conjunction with an automated laser fluorescence (ALF) sequencer (Pharmacia) and its Fragment Manager{trademark} software to detect and size the PCR products, filter out peaks of fluorescence due to nonallele fragments, and generate genotypes in a format suitable for direct input to standard linkage analysis programs. The method should offer the advantages of speed, accuracy, and reduced cost. Its use in linkage studies in a large family with manic-depressive illness is discussed. 14 refs., 3 figs., 1 tab.

  8. Layers of epistasis: genome-wide regulatory networks and network approaches to genome-wide association studies

    PubMed Central

    Cowper-Sal·lari, Richard; Cole, Michael D.; Karagas, Margaret R.; Lupien, Mathieu; Moore, Jason H.

    2010-01-01

    The conceptual foundation of the genome-wide association study (GWAS) has advanced unchecked since its conception. A revision might seem premature as the potential of GWAS has not been fully realized. Multiple technical and practical limitations need to be overcome before GWAS can be fairly criticized. But with the completion of hundreds of studies and a deeper understanding of the genetic architecture of disease, warnings are being raised. The results compiled to date indicate that risk-associated variants lie predominantly in non-coding regions of the genome. Additionally, alternative methodologies are uncovering large and heterogeneous sets of rare variants underlying disease. The fear is that, even in its fulfilment, the current GWAS paradigm might be incapable of dissecting all kinds of phenotypes. In the following text we review several initiatives that aim to overcome these limitations. The overarching theme of these studies is the inclusion of biological knowledge to both the analysis and interpretation of genotyping data. GWAS is uninformed of biology by design and although there is some virtue in its simplicity it is also its most conspicuous deficiency. We propose a framework in which to integrate these novel approaches, both empirical and theoretical, in the form of a genome-wide regulatory network (GWRN). By processing experimental data into networks, emerging data types based on chromatin-immunoprecipitation are made computationally tractable. This will give GWAS re-analysis efforts the most current and relevant substrates, and root them firmly on our knowledge of human disease. PMID:21197657

  9. Genome-wide association study of antisocial personality disorder

    PubMed Central

    Rautiainen, M-R; Paunio, T; Repo-Tiihonen, E; Virkkunen, M; Ollila, H M; Sulkava, S; Jolanki, O; Palotie, A; Tiihonen, J

    2016-01-01

    The pathophysiology of antisocial personality disorder (ASPD) remains unclear. Although the most consistent biological finding is reduced grey matter volume in the frontal cortex, about 50% of the total liability to developing ASPD has been attributed to genetic factors. The contributing genes remain largely unknown. Therefore, we sought to study the genetic background of ASPD. We conducted a genome-wide association study (GWAS) and a replication analysis of Finnish criminal offenders fulfilling DSM-IV criteria for ASPD (N=370, N=5850 for controls, GWAS; N=173, N=3766 for controls and replication sample). The GWAS resulted in suggestive associations of two clusters of single-nucleotide polymorphisms at 6p21.2 and at 6p21.32 at the human leukocyte antigen (HLA) region. Imputation of HLA alleles revealed an independent association with DRB1*01:01 (odds ratio (OR)=2.19 (1.53–3.14), P=1.9 × 10-5). Two polymorphisms at 6p21.2 LINC00951–LRFN2 gene region were replicated in a separate data set, and rs4714329 reached genome-wide significance (OR=1.59 (1.37–1.85), P=1.6 × 10−9) in the meta-analysis. The risk allele also associated with antisocial features in the general population conditioned for severe problems in childhood family (β=0.68, P=0.012). Functional analysis in brain tissue in open access GTEx and Braineac databases revealed eQTL associations of rs4714329 with LINC00951 and LRFN2 in cerebellum. In humans, LINC00951 and LRFN2 are both expressed in the brain, especially in the frontal cortex, which is intriguing considering the role of the frontal cortex in behavior and the neuroanatomical findings of reduced gray matter volume in ASPD. To our knowledge, this is the first study showing genome-wide significant and replicable findings on genetic variants associated with any personality disorder. PMID:27598967

  10. Genome-wide association study of antisocial personality disorder.

    PubMed

    Rautiainen, M-R; Paunio, T; Repo-Tiihonen, E; Virkkunen, M; Ollila, H M; Sulkava, S; Jolanki, O; Palotie, A; Tiihonen, J

    2016-01-01

    The pathophysiology of antisocial personality disorder (ASPD) remains unclear. Although the most consistent biological finding is reduced grey matter volume in the frontal cortex, about 50% of the total liability to developing ASPD has been attributed to genetic factors. The contributing genes remain largely unknown. Therefore, we sought to study the genetic background of ASPD. We conducted a genome-wide association study (GWAS) and a replication analysis of Finnish criminal offenders fulfilling DSM-IV criteria for ASPD (N=370, N=5850 for controls, GWAS; N=173, N=3766 for controls and replication sample). The GWAS resulted in suggestive associations of two clusters of single-nucleotide polymorphisms at 6p21.2 and at 6p21.32 at the human leukocyte antigen (HLA) region. Imputation of HLA alleles revealed an independent association with DRB1*01:01 (odds ratio (OR)=2.19 (1.53-3.14), P=1.9 × 10(-5)). Two polymorphisms at 6p21.2 LINC00951-LRFN2 gene region were replicated in a separate data set, and rs4714329 reached genome-wide significance (OR=1.59 (1.37-1.85), P=1.6 × 10(-9)) in the meta-analysis. The risk allele also associated with antisocial features in the general population conditioned for severe problems in childhood family (β=0.68, P=0.012). Functional analysis in brain tissue in open access GTEx and Braineac databases revealed eQTL associations of rs4714329 with LINC00951 and LRFN2 in cerebellum. In humans, LINC00951 and LRFN2 are both expressed in the brain, especially in the frontal cortex, which is intriguing considering the role of the frontal cortex in behavior and the neuroanatomical findings of reduced gray matter volume in ASPD. To our knowledge, this is the first study showing genome-wide significant and replicable findings on genetic variants associated with any personality disorder. PMID:27598967

  11. An integrated approach to exploit linkage disequilibrium for ultra high dimensional genome-wide data

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With the advent of recent DNA sequencing methods (determining molecule order) that quickly produce millions of DNA sequences, variation among sequences in a genome (all the DNA contained in chromosomes of an organism) can be tested for association with traits of economic interest on a relatively lar...

  12. Genome-wide association studies in pediatric chronic kidney disease.

    PubMed

    Gupta, Jayanta; Kanetsky, Peter A; Wuttke, Matthias; Köttgen, Anna; Schaefer, Franz; Wong, Craig S

    2016-08-01

    The genome-wide association study (GWAS) has become an established scientific method that provides an unbiased screen for genetic loci potentially associated with phenotypes of clinical interest, such as chronic kidney disease (CKD). Thus, GWAS provides opportunities to gain new perspectives regarding the genetic architecture of CKD progression by identifying new candidate genes and targets for intervention. As such, it has become an important arm of translational science providing a complementary line of investigation to identify novel therapeutics to treat CKD. In this review, we describe the method and the challenges of performing GWAS in the pediatric CKD population. We also provide an overview of successful GWAS for kidney disease, and we discuss the established pediatric CKD cohorts in North America and Europe that are poised to identify genetic risk variants associated with CKD progression.

  13. Genome-wide transcription factor binding: beyond direct target regulation.

    PubMed

    MacQuarrie, Kyle L; Fong, Abraham P; Morse, Randall H; Tapscott, Stephen J

    2011-04-01

    The binding of transcription factors to specific DNA target sequences is the fundamental basis of gene regulatory networks. Chromatin immunoprecipitation combined with DNA tiling arrays or high-throughput sequencing (ChIP-chip and ChIP-seq, respectively) has been used in many recent studies that detail the binding sites of various transcription factors. Surprisingly, data from a variety of model organisms and tissues have demonstrated that transcription factors vary greatly in their number of genomic binding sites, and that binding events can significantly exceed the number of known or possible direct gene targets. Thus, current understanding of transcription factor function must expand to encompass what role, if any, binding might have outside of direct transcriptional target regulation. In this review, we discuss the biological significance of genome-wide binding of transcription factors and present models that can account for this phenomenon.

  14. Implications of genome-wide association studies in cancer therapeutics.

    PubMed

    Patel, Jai N; McLeod, Howard L; Innocenti, Federico

    2013-09-01

    Genome wide association studies (GWAS) provide an agnostic approach to identifying potential genetic variants associated with disease susceptibility, prognosis of survival and/or predictive of drug response. Although these techniques are costly and interpretation of study results is challenging, they do allow for a more unbiased interrogation of the entire genome, resulting in the discovery of novel genes and understanding of novel biological associations. This review will focus on the implications of GWAS in cancer therapy, in particular germ-line mutations, including findings from major GWAS which have identified predictive genetic loci for clinical outcome and/or toxicity. Lessons and challenges in cancer GWAS are also discussed, including the need for functional analysis and replication, as well as future perspectives for biological and clinical utility. Given the large heterogeneity in response to cancer therapeutics, novel methods of identifying mechanisms and biology of variable drug response and ultimately treatment individualization will be indispensable.

  15. Ultrafast laser nanosurgery in microfluidics for genome-wide screenings

    PubMed Central

    Ben-Yakar, Adela; Bourgeois, Frederic

    2009-01-01

    Summary The use of ultrafast laser pulses in surgery has allowed for unprecedented precision with minimal collateral damage to surrounding tissues. For these reasons, ultrafast laser nanosurgery, as an injury model, has gained tremendous momentum in experimental biology ranging from in-vitro manipulations of subcellular structures to in-vivo studies in whole living organisms. For example, femtosecond laser nanosurgery on such model organism as the nematode Caenorhabditis elegans (C. elegans) has opened new opportunities for in-vivo nerve regeneration studies. Meanwhile, the development of novel microfluidic devices has brought the control in experimental environment to the level required for precise nanosurgery in various animal models. Merging microfluidics and laser nanosurgery has recently improved the specificities and increased the speed of laser surgeries enabling fast genome-wide screenings that can more readily decode the genetic map of various biological processes. PMID:19278850

  16. Genome-wide nucleosome positioning during embryonic stem cell development.

    PubMed

    Teif, Vladimir B; Vainshtein, Yevhen; Caudron-Herger, Maïwen; Mallm, Jan-Philipp; Marth, Caroline; Höfer, Thomas; Rippe, Karsten

    2012-11-01

    We determined genome-wide nucleosome occupancies in mouse embryonic stem cells and their neural progenitor and embryonic fibroblast counterparts to assess features associated with nucleosome positioning during lineage commitment. Cell-type- and protein-specific binding preferences of transcription factors to sites with either low (Myc, Klf4 and Zfx) or high (Nanog, Oct4 and Sox2) nucleosome occupancy as well as complex patterns for CTCF were identified. Nucleosome-depleted regions around transcription start and transcription termination sites were broad and more pronounced for active genes, with distinct patterns for promoters classified according to CpG content or histone methylation marks. Throughout the genome, nucleosome occupancy was correlated with certain histone methylation or acetylation modifications. In addition, the average nucleosome repeat length increased during differentiation by 5-7 base pairs, with local variations for specific regions. Our results reveal regulatory mechanisms of cell differentiation that involve nucleosome repositioning. PMID:23085715

  17. Genome-wide association studies in pharmacogenomics of antidepressants.

    PubMed

    Lin, Eugene; Lane, Hsien-Yuan

    2015-01-01

    Major depressive disorder (MDD) is one of the most common psychiatric disorders worldwide. Doctors must prescribe antidepressants based on educated guesses due to the fact that it is unmanageable to predict the effectiveness of any particular antidepressant in an individual patient. With the recent advent of scientific research, the genome-wide association study (GWAS) is extensively employed to analyze hundreds of thousands of single nucleotide polymorphisms by high-throughput genotyping technologies. In addition to the candidate-gene approach, the GWAS approach has recently been utilized to investigate the determinants of antidepressant response to therapy. In this study, we reviewed GWAS studies, their limitations and future directions with respect to the pharmacogenomics of antidepressants in MDD.

  18. Progress of genome wide association study in domestic animals

    PubMed Central

    2012-01-01

    Domestic animals are invaluable resources for study of the molecular architecture of complex traits. Although the mapping of quantitative trait loci (QTL) responsible for economically important traits in domestic animals has achieved remarkable results in recent decades, not all of the genetic variation in the complex traits has been captured because of the low density of markers used in QTL mapping studies. The genome wide association study (GWAS), which utilizes high-density single-nucleotide polymorphism (SNP), provides a new way to tackle this issue. Encouraging achievements in dissection of the genetic mechanisms of complex diseases in humans have resulted from the use of GWAS. At present, GWAS has been applied to the field of domestic animal breeding and genetics, and some advances have been made. Many genes or markers that affect economic traits of interest in domestic animals have been identified. In this review, advances in the use of GWAS in domestic animals are described. PMID:22958308

  19. Quantitative prediction of genome-wide resource allocation in bacteria.

    PubMed

    Goelzer, Anne; Muntel, Jan; Chubukov, Victor; Jules, Matthieu; Prestel, Eric; Nölker, Rolf; Mariadassou, Mahendra; Aymerich, Stéphane; Hecker, Michael; Noirot, Philippe; Becher, Dörte; Fromion, Vincent

    2015-11-01

    Predicting resource allocation between cell processes is the primary step towards decoding the evolutionary constraints governing bacterial growth under various conditions. Quantitative prediction at genome-scale remains a computational challenge as current methods are limited by the tractability of the problem or by simplifying hypotheses. Here, we show that the constraint-based modeling method Resource Balance Analysis (RBA), calibrated using genome-wide absolute protein quantification data, accurately predicts resource allocation in the model bacterium Bacillus subtilis for a wide range of growth conditions. The regulation of most cellular processes is consistent with the objective of growth rate maximization except for a few suboptimal processes which likely integrate more complex objectives such as coping with stressful conditions and survival. As a proof of principle by using simulations, we illustrated how calibrated RBA could aid rational design of strains for maximizing protein production, offering new opportunities to investigate design principles in prokaryotes and to exploit them for biotechnological applications.

  20. Quality control for genome-wide association studies.

    PubMed

    Gondro, Cedric; Lee, Seung Hwan; Lee, Hak Kyo; Porto-Neto, Laercio R

    2013-01-01

    This chapter overviews the quality control (QC) issues for SNP-based genotyping methods used in genome-wide association studies. The main metrics for evaluating the quality of the genotypes are discussed followed by a worked out example of QC pipeline starting with raw data and finishing with a fully filtered dataset ready for downstream analysis. The emphasis is on automation of data storage, filtering, and manipulation to ensure data integrity throughput the process and on how to extract a global summary from these high dimensional datasets to allow better-informed downstream analytical decisions. All examples will be run using the R statistical programming language followed by a practical example using a fully automated QC pipeline for the Illumina platform.

  1. Genome-wide genetic changes during modern breeding of maize.

    PubMed

    Jiao, Yinping; Zhao, Hainan; Ren, Longhui; Song, Weibin; Zeng, Biao; Guo, Jinjie; Wang, Baobao; Liu, Zhipeng; Chen, Jing; Li, Wei; Zhang, Mei; Xie, Shaojun; Lai, Jinsheng

    2012-06-03

    The success of modern maize breeding has been demonstrated by remarkable increases in productivity over the last four decades. However, the underlying genetic changes correlated with these gains remain largely unknown. We report here the sequencing of 278 temperate maize inbred lines from different stages of breeding history, including deep resequencing of 4 lines with known pedigree information. The results show that modern breeding has introduced highly dynamic genetic changes into the maize genome. Artificial selection has affected thousands of targets, including genes and non-genic regions, leading to a reduction in nucleotide diversity and an increase in the proportion of rare alleles. Genetic changes during breeding happen rapidly, with extensive variation (SNPs, indels and copy-number variants (CNVs)) occurring, even within identity-by-descent regions. Our genome-wide assessment of genetic changes during modern maize breeding provides new strategies as well as practical targets for future crop breeding and biotechnology.

  2. Genome-wide association study of antibody response to Newcastle disease virus in chicken

    PubMed Central

    2013-01-01

    Background Since the first outbreak in Indonesia in 1926, Newcastle disease has become one of the most common and contagious bird diseases throughout the world. To date, enhancing host antibody response by vaccination remains the most efficient strategy to control outbreaks of Newcastle disease. Antibody response plays an important role in host resistance to Newcastle disease, and selection for antibody response can effectively improve disease resistance in chickens. However, the molecular basis of the variation in antibody response to Newcastle disease virus (NDV) is not clear. The aim of this study was to detect genes modulating antibody response to NDV by a genome-wide association study (GWAS) in chickens. Results To identify genes or chromosomal regions associated with antibody response to NDV after immunization, a GWAS was performed using 39,833 SNP markers in a chicken F2 resource population derived from a cross between two broiler lines that differed in their resistance. Two SNP effects reached 5% Bonferroni genome-wide significance (P<1.26×10-6). These two SNPs, rs15354805 and rs15355555, were both on chicken (Gallus gallus) chromosome 1 and spanned approximately 600 Kb, from 100.4 Mb to 101.0 Mb. Rs15354805 is in intron 7 of the chicken Roundabout, axon guidance receptor, homolog 2 (ROBO2) gene, and rs15355555 is located about 243 Kb upstream of ROBO2. Rs15354805 explained 5% of the phenotypic variation in antibody response to NDV, post immunization, in chickens. Rs15355555 had a similar effect as rs15354805 because of its linkage disequilibrium with rs15354805 (r2=0.98). Conclusion The region at about 100 Mb from the proximal end of chicken chromosome 1, including the ROBO1 and ROBO2 genes, has a strong effect on the antibody response to the NDV in chickens. This study paves the way for further research on the host immune response to NDV. PMID:23663563

  3. A two-stage genome-wide association study of sporadic amyotrophic lateral sclerosis

    PubMed Central

    Chiò, Adriano; Schymick, Jennifer C.; Restagno, Gabriella; Scholz, Sonja W.; Lombardo, Federica; Lai, Shiao-Lin; Mora, Gabriele; Fung, Hon-Chung; Britton, Angela; Arepalli, Sampath; Gibbs, J. Raphael; Nalls, Michael; Berger, Stephen; Kwee, Lydia Coulter; Oddone, Eugene Z.; Ding, Jinhui; Crews, Cynthia; Rafferty, Ian; Washecka, Nicole; Hernandez, Dena; Ferrucci, Luigi; Bandinelli, Stefania; Guralnik, Jack; Macciardi, Fabio; Torri, Federica; Lupoli, Sara; Chanock, Stephen J.; Thomas, Gilles; Hunter, David J.; Gieger, Christian; Wichmann, H. Erich; Calvo, Andrea; Mutani, Roberto; Battistini, Stefania; Giannini, Fabio; Caponnetto, Claudia; Mancardi, Giovanni Luigi; La Bella, Vincenzo; Valentino, Francesca; Monsurrò, Maria Rosaria; Tedeschi, Gioacchino; Marinou, Kalliopi; Sabatelli, Mario; Conte, Amelia; Mandrioli, Jessica; Sola, Patrizia; Salvi, Fabrizio; Bartolomei, Ilaria; Siciliano, Gabriele; Carlesi, Cecilia; Orrell, Richard W.; Talbot, Kevin; Simmons, Zachary; Connor, James; Pioro, Erik P.; Dunkley, Travis; Stephan, Dietrich A.; Kasperaviciute, Dalia; Fisher, Elizabeth M.; Jabonka, Sibylle; Sendtner, Michael; Beck, Marcus; Bruijn, Lucie; Rothstein, Jeffrey; Schmidt, Silke; Singleton, Andrew; Hardy, John; Traynor, Bryan J.

    2009-01-01

    The cause of sporadic amyotrophic lateral sclerosis (ALS) is largely unknown, but genetic factors are thought to play a significant role in determining susceptibility to motor neuron degeneration. To identify genetic variants altering risk of ALS, we undertook a two-stage genome-wide association study (GWAS): we followed our initial GWAS of 545 066 SNPs in 553 individuals with ALS and 2338 controls by testing the 7600 most associated SNPs from the first stage in three independent cohorts consisting of 2160 cases and 3008 controls. None of the SNPs selected for replication exceeded the Bonferroni threshold for significance. The two most significantly associated SNPs, rs2708909 and rs2708851 [odds ratio (OR) = 1.17 and 1.18, and P-values = 6.98 × 10−7 and 1.16 × 10−6], were located on chromosome 7p13.3 within a 175 kb linkage disequilibrium block containing the SUNC1, HUS1 and C7orf57 genes. These associations did not achieve genome-wide significance in the original cohort and failed to replicate in an additional independent cohort of 989 US cases and 327 controls (OR = 1.18 and 1.19, P-values = 0.08 and 0.06, respectively). Thus, we chose to cautiously interpret our data as hypothesis-generating requiring additional confirmation, especially as all previously reported loci for ALS have failed to replicate successfully. Indeed, the three loci (FGGY, ITPR2 and DPP6) identified in previous GWAS of sporadic ALS were not significantly associated with disease in our study. Our findings suggest that ALS is more genetically and clinically heterogeneous than previously recognized. Genotype data from our study have been made available online to facilitate such future endeavors. PMID:19193627

  4. A two-stage genome-wide association study of sporadic amyotrophic lateral sclerosis.

    PubMed

    Chiò, Adriano; Schymick, Jennifer C; Restagno, Gabriella; Scholz, Sonja W; Lombardo, Federica; Lai, Shiao-Lin; Mora, Gabriele; Fung, Hon-Chung; Britton, Angela; Arepalli, Sampath; Gibbs, J Raphael; Nalls, Michael; Berger, Stephen; Kwee, Lydia Coulter; Oddone, Eugene Z; Ding, Jinhui; Crews, Cynthia; Rafferty, Ian; Washecka, Nicole; Hernandez, Dena; Ferrucci, Luigi; Bandinelli, Stefania; Guralnik, Jack; Macciardi, Fabio; Torri, Federica; Lupoli, Sara; Chanock, Stephen J; Thomas, Gilles; Hunter, David J; Gieger, Christian; Wichmann, H Erich; Calvo, Andrea; Mutani, Roberto; Battistini, Stefania; Giannini, Fabio; Caponnetto, Claudia; Mancardi, Giovanni Luigi; La Bella, Vincenzo; Valentino, Francesca; Monsurrò, Maria Rosaria; Tedeschi, Gioacchino; Marinou, Kalliopi; Sabatelli, Mario; Conte, Amelia; Mandrioli, Jessica; Sola, Patrizia; Salvi, Fabrizio; Bartolomei, Ilaria; Siciliano, Gabriele; Carlesi, Cecilia; Orrell, Richard W; Talbot, Kevin; Simmons, Zachary; Connor, James; Pioro, Erik P; Dunkley, Travis; Stephan, Dietrich A; Kasperaviciute, Dalia; Fisher, Elizabeth M; Jabonka, Sibylle; Sendtner, Michael; Beck, Marcus; Bruijn, Lucie; Rothstein, Jeffrey; Schmidt, Silke; Singleton, Andrew; Hardy, John; Traynor, Bryan J

    2009-04-15

    The cause of sporadic amyotrophic lateral sclerosis (ALS) is largely unknown, but genetic factors are thought to play a significant role in determining susceptibility to motor neuron degeneration. To identify genetic variants altering risk of ALS, we undertook a two-stage genome-wide association study (GWAS): we followed our initial GWAS of 545 066 SNPs in 553 individuals with ALS and 2338 controls by testing the 7600 most associated SNPs from the first stage in three independent cohorts consisting of 2160 cases and 3008 controls. None of the SNPs selected for replication exceeded the Bonferroni threshold for significance. The two most significantly associated SNPs, rs2708909 and rs2708851 [odds ratio (OR) = 1.17 and 1.18, and P-values = 6.98 x 10(-7) and 1.16 x 10(-6)], were located on chromosome 7p13.3 within a 175 kb linkage disequilibrium block containing the SUNC1, HUS1 and C7orf57 genes. These associations did not achieve genome-wide significance in the original cohort and failed to replicate in an additional independent cohort of 989 US cases and 327 controls (OR = 1.18 and 1.19, P-values = 0.08 and 0.06, respectively). Thus, we chose to cautiously interpret our data as hypothesis-generating requiring additional confirmation, especially as all previously reported loci for ALS have failed to replicate successfully. Indeed, the three loci (FGGY, ITPR2 and DPP6) identified in previous GWAS of sporadic ALS were not significantly associated with disease in our study. Our findings suggest that ALS is more genetically and clinically heterogeneous than previously recognized. Genotype data from our study have been made available online to facilitate such future endeavors. PMID:19193627

  5. A genome-wide association study of heparin-induced thrombocytopenia using an electronic medical record

    PubMed Central

    Karnes, Jason H; Cronin, Robert M; Rollin, Jerome; Teumer, Alexander; Pouplard, Claire; Shaffer, Christian M; Blanquicett, Carmelo; Bowton, Erica A; Cowan, James D; Mosley, Jonathan D; Van Driest, Sara L; Weeke, Peter E; Wells, Quinn S; Bakchoul, Tamam; Denny, Joshua C; Greinacher, Andreas; Gruel, Yves; Roden, Dan M

    2015-01-01

    Heparin-induced thrombocytopenia (HIT) is an unpredictable, potentially catastrophic adverse effect of heparin treatment resulting from an immune response to platelet factor 4 (PF4)/heparin complexes. No genome-wide evaluations have been performed to identify potential genetic influences on HIT. Here, we performed a genome-wide association study (GWAS) and candidate gene study using HIT cases and controls identified using electronic medical records (EMRs) coupled to a DNA biobank and attempted to replicate GWAS associations in an independent cohort. We subsequently investigated influences of GWAS-associated single nucleotide polymorphisms (SNPs) on PF4/heparin antibodies in non-heparin treated individuals. In a recessive model, we observed significant SNP associations (OR 18.52 [6.33–54.23], p=3.18×10−9) with HIT near the T-Cell Death-Associated Gene 8 (TDAG8). These SNPs are in linkage disequilibrium with a missense TDAG8 SNP. TDAG8 SNPs trended toward an association with HIT in replication analysis (OR 5.71 [0.47–69.22], p=0.17), and the missense SNP was associated with PF4/heparin antibody levels and positive PF4/heparin antibodies in non-heparin treated patients (OR 3.09 [1.14–8.13], p=0.02). In the candidate gene study, SNPs at HLA-DRA were nominally associated with HIT (OR 0.25 [0.15–0.44], p=2.06×10−6). Further study of TDAG8 and HLA-DRA SNPs is warranted to assess their influence on the risk of developing HIT. PMID:25503805

  6. Uncovering networks from genome-wide association studies via circular genomic permutation.

    PubMed

    Cabrera, Claudia P; Navarro, Pau; Huffman, Jennifer E; Wright, Alan F; Hayward, Caroline; Campbell, Harry; Wilson, James F; Rudan, Igor; Hastie, Nicholas D; Vitart, Veronique; Haley, Chris S

    2012-09-01

    Genome-wide association studies (GWAS) aim to detect single nucleotide polymorphisms (SNP) associated with trait variation. However, due to the large number of tests, standard analysis techniques impose highly stringent significance thresholds, leaving potentially associated SNPs undetected, and much of the trait genetic variation unexplained. Pathway- and network-based methodologies applied to GWAS aim to detect associations missed by standard single-marker approaches. The complex and non-random architecture of the genome makes it a challenge to derive an appropriate testing framework for such methodologies. We developed a rapid and simple permutation approach that uses GWAS SNP association results to establish the significance of pathway associations while accounting for the linkage disequilibrium structure of SNPs and the clustering of functionally related elements in the genome. All SNPs used in the GWAS are placed in a "circular genome" according to their location. Then the complete set of SNP association P values are permuted by rotation with respect to the genomic locations of the SNPs. Once these "simulated" P values are assigned, the joint gene P values are calculated using Fisher's combination test, and the association of pathways is tested using the hypergeometric test. The circular genomic permutation approach was applied to a human genome-wide association dataset. The data consists of 719 individuals from the ORCADES study genotyped for ~300,000 SNPs and measured for 51 traits ranging from physical to biochemical measurements. KEGG pathways (n = 225) were used as the sets of pathways to be tested. Our results demonstrate that the circular genomic permutations provide robust association P values. The non-permuted hypergeometric analysis generates ~1400 pathway-trait combination results with an association P value more significant than P ≤ 0.05, whereas applying circular genomic permutation reduces the number of significant results to a more credible

  7. A Genome-wide Combinatorial Strategy Dissects Complex Genetic Architecture of Seed Coat Color in Chickpea

    PubMed Central

    Bajaj, Deepak; Das, Shouvik; Upadhyaya, Hari D.; Ranjan, Rajeev; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. Laxmipathi; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

    2015-01-01

    The study identified 9045 high-quality SNPs employing both genome-wide GBS- and candidate gene-based SNP genotyping assays in 172, including 93 cultivated (desi and kabuli) and 79 wild chickpea accessions. The GWAS in a structured population of 93 sequenced accessions detected 15 major genomic loci exhibiting significant association with seed coat color. Five seed color-associated major genomic loci underlying robust QTLs mapped on a high-density intra-specific genetic linkage map were validated by QTL mapping. The integration of association and QTL mapping with gene haplotype-specific LD mapping and transcript profiling identified novel allelic variants (non-synonymous SNPs) and haplotypes in a MATE secondary transporter gene regulating light/yellow brown and beige seed coat color differentiation in chickpea. The down-regulation and decreased transcript expression of beige seed coat color-associated MATE gene haplotype was correlated with reduced proanthocyanidins accumulation in the mature seed coats of beige than light/yellow brown seed colored desi and kabuli accessions for their coloration/pigmentation. This seed color-regulating MATE gene revealed strong purifying selection pressure primarily in LB/YB seed colored desi and wild Cicer reticulatum accessions compared with the BE seed colored kabuli accessions. The functionally relevant molecular tags identified have potential to decipher the complex transcriptional regulatory gene function of seed coat coloration and for understanding the selective sweep-based seed color trait evolutionary pattern in cultivated and wild accessions during chickpea domestication. The genome-wide integrated approach employed will expedite marker-assisted genetic enhancement for developing cultivars with desirable seed coat color types in chickpea. PMID:26635822

  8. Comparison of genome-wide selection strategies to identify furfural tolerance genes in Escherichia coli.

    PubMed

    Glebes, Tirzah Y; Sandoval, Nicholas R; Gillis, Jacob H; Gill, Ryan T

    2015-01-01

    Engineering both feedstock and product tolerance is important for transitioning towards next-generation biofuels derived from renewable sources. Tolerance to chemical inhibitors typically results in complex phenotypes, for which multiple genetic changes must often be made to confer tolerance. Here, we performed a genome-wide search for furfural-tolerant alleles using the TRackable Multiplex Recombineering (TRMR) method (Warner et al. (2010), Nature Biotechnology), which uses chromosomally integrated mutations directed towards increased or decreased expression of virtually every gene in Escherichia coli. We employed various growth selection strategies to assess the role of selection design towards growth enrichments. We also compared genes with increased fitness from our TRMR selection to those from a previously reported genome-wide identification study of furfural tolerance genes using a plasmid-based genomic library approach (Glebes et al. (2014) PLOS ONE). In several cases, growth improvements were observed for the chromosomally integrated promoter/RBS mutations but not for the plasmid-based overexpression constructs. Through this assessment, four novel tolerance genes, ahpC, yhjH, rna, and dicA, were identified and confirmed for their effect on improving growth in the presence of furfural.

  9. Genome-Wide Detection of Gene Extinction in Early Mammalian Evolution

    PubMed Central

    Kuraku, Shigehiro; Kuratani, Shigeru

    2011-01-01

    Detecting gene losses is a novel aspect of evolutionary genomics that has been made feasible by whole-genome sequencing. However, research to date has concentrated on elucidating evolutionary patterns of genomic components shared between species, rather than identifying disparities between genomes. In this study, we searched for gene losses in the lineage leading to eutherian mammals. First, as a pilot analysis, we selected five gene families (Wnt, Fgf, Tbx, TGFβ, and Frizzled) for molecular phylogenetic analyses, and identified mammalian lineage-specific losses of Wnt11b, Tbx6L/VegT/tbx16, Nodal-related, ADMP1, ADMP2, Sizzled, and Crescent. Second, automated genome-wide phylogenetic screening was implemented based on this pilot analysis. As a result, we detected 147 chicken genes without eutherian orthologs, which resulted from 141 gene loss events. Our inventory contained a group of regulatory genes governing early embryonic axis formation, such as Noggins, and multiple members of the opsin and prolactin-releasing hormone receptor (“PRLHR”) gene families. Our findings highlight the potential of genome-wide gene phylogeny (“phylome”) analysis in detecting possible rearrangement of gene networks and the importance of identifying losses of ancestral genomic components in analyzing the molecular basis underlying phenotypic evolution. PMID:22094861

  10. Genome-wide association study of drought-related resistance traits in Aegilops tauschii

    PubMed Central

    Qin, Peng; Lin, Yu; Hu, Yaodong; Liu, Kun; Mao, Shuangshuang; Li, Zhanyi; Wang, Jirui; Liu, Yaxi; Wei, Yuming; Zheng, Youliang

    2016-01-01

    Abstract The D-genome progenitor of wheat (Triticum aestivum), Aegilops tauschii, possesses numerous genes for resistance to abiotic stresses, including drought. Therefore, information on the genetic architecture of A. tauschii can aid the development of drought-resistant wheat varieties. Here, we evaluated 13 traits in 373 A. tauschii accessions grown under normal and polyethylene glycol-simulated drought stress conditions and performed a genome-wide association study using 7,185 single nucleotide polymorphism (SNP) markers. We identified 208 and 28 SNPs associated with all traits using the general linear model and mixed linear model, respectively, while both models detected 25 significant SNPs with genome-wide distribution. Public database searches revealed several candidate/flanking genes related to drought resistance that were grouped into three categories according to the type of encoded protein (enzyme, storage protein, and drought-induced protein). This study provided essential information for SNPs and genes related to drought resistance in A. tauschii and wheat, and represents a foundation for breeding drought-resistant wheat cultivars using marker-assisted selection. PMID:27560650

  11. Genome-wide characterization of microsatellites in Triticeae species: abundance, distribution and evolution

    PubMed Central

    Deng, Pingchuan; Wang, Meng; Feng, Kewei; Cui, Licao; Tong, Wei; Song, Weining; Nie, Xiaojun

    2016-01-01

    Microsatellites are an important constituent of plant genome and distributed across entire genome. In this study, genome-wide analysis of microsatellites in 8 Triticeae species and 9 model plants revealed that microsatellite characteristics were similar among the Triticeae species. Furthermore, genome-wide microsatellite markers were designed in wheat and then used to analyze the evolutionary relationship of wheat and other Triticeae species. Results displayed that Aegilops tauschii was found to be the closest species to Triticum aestivum, followed by Triticum urartu, Triticum turgidum and Aegilops speltoides, while Triticum monococcum, Aegilops sharonensis and Hordeum vulgare showed a relatively lower PCR amplification effectivity. Additionally, a significantly higher PCR amplification effectivity was found in chromosomes at the same subgenome than its homoeologous when these markers were subjected to search against different chromosomes in wheat. After a rigorous screening process, a total of 20,666 markers showed high amplification and polymorphic potential in wheat and its relatives, which were integrated with the public available wheat markers and then anchored to the genome of wheat (CS). This study not only provided the useful resource for SSR markers development in Triticeae species, but also shed light on the evolution of polyploid wheat from the perspective of microsatellites. PMID:27561724

  12. Genome-wide association study of antipsychotic-induced QTc interval prolongation.

    PubMed

    Aberg, K; Adkins, D E; Liu, Y; McClay, J L; Bukszár, J; Jia, P; Zhao, Z; Perkins, D; Stroup, T S; Lieberman, J A; Sullivan, P F; van den Oord, E J C G

    2012-04-01

    QT prolongation is associated with increased risk of cardiac arrhythmias. Identifying the genetic variants that mediate antipsychotic-induced prolongation may help to minimize this risk, which might prevent the removal of efficacious drugs from the market. We performed candidate gene analysis and five drug-specific genome-wide association studies (GWASs) with 492K single-nucleotide polymorphisms to search for genetic variation mediating antipsychotic-induced QT prolongation in 738 schizophrenia patients from the Clinical Antipsychotic Trial of Intervention Effectiveness study. Our candidate gene study suggests the involvement of NOS1AP and NUBPL (P-values=1.45 × 10(-05) and 2.66 × 10(-13), respectively). Furthermore, our top GWAS hit achieving genome-wide significance, defined as a Q-value <0.10 (P-value=1.54 × 10(-7), Q-value=0.07), located in SLC22A23, mediated the effects of quetiapine on prolongation. SLC22A23 belongs to a family of organic ion transporters that shuttle a variety of compounds, including drugs, environmental toxins and endogenous metabolites, across the cell membrane. This gene is expressed in the heart and is integral in mouse heart development. The genes mediating antipsychotic-induced QT prolongation partially overlap with the genes affecting normal QT interval variation. However, some genes may also be unique for drug-induced prolongation. This study demonstrates the potential of GWAS to discover genes and pathways that mediate antipsychotic-induced QT prolongation.

  13. Genome-wide detection of gene extinction in early mammalian evolution.

    PubMed

    Kuraku, Shigehiro; Kuratani, Shigeru

    2011-01-01

    Detecting gene losses is a novel aspect of evolutionary genomics that has been made feasible by whole-genome sequencing. However, research to date has concentrated on elucidating evolutionary patterns of genomic components shared between species, rather than identifying disparities between genomes. In this study, we searched for gene losses in the lineage leading to eutherian mammals. First, as a pilot analysis, we selected five gene families (Wnt, Fgf, Tbx, TGFβ, and Frizzled) for molecular phylogenetic analyses, and identified mammalian lineage-specific losses of Wnt11b, Tbx6L/VegT/tbx16, Nodal-related, ADMP1, ADMP2, Sizzled, and Crescent. Second, automated genome-wide phylogenetic screening was implemented based on this pilot analysis. As a result, we detected 147 chicken genes without eutherian orthologs, which resulted from 141 gene loss events. Our inventory contained a group of regulatory genes governing early embryonic axis formation, such as Noggins, and multiple members of the opsin and prolactin-releasing hormone receptor ("PRLHR") gene families. Our findings highlight the potential of genome-wide gene phylogeny ("phylome") analysis in detecting possible rearrangement of gene networks and the importance of identifying losses of ancestral genomic components in analyzing the molecular basis underlying phenotypic evolution. PMID:22094861

  14. Genome-wide association study of drought-related resistance traits in Aegilops tauschii.

    PubMed

    Qin, Peng; Lin, Yu; Hu, Yaodong; Liu, Kun; Mao, Shuangshuang; Li, Zhanyi; Wang, Jirui; Liu, Yaxi; Wei, Yuming; Zheng, Youliang

    2016-01-01

    The D-genome progenitor of wheat (Triticum aestivum), Aegilops tauschii, possesses numerous genes for resistance to abiotic stresses, including drought. Therefore, information on the genetic architecture of A. tauschii can aid the development of drought-resistant wheat varieties. Here, we evaluated 13 traits in 373 A. tauschii accessions grown under normal and polyethylene glycol-simulated drought stress conditions and performed a genome-wide association study using 7,185 single nucleotide polymorphism (SNP) markers. We identified 208 and 28 SNPs associated with all traits using the general linear model and mixed linear model, respectively, while both models detected 25 significant SNPs with genome-wide distribution. Public database searches revealed several candidate/flanking genes related to drought resistance that were grouped into three categories according to the type of encoded protein (enzyme, storage protein, and drought-induced protein). This study provided essential information for SNPs and genes related to drought resistance in A. tauschii and wheat, and represents a foundation for breeding drought-resistant wheat cultivars using marker-assisted selection. PMID:27560650

  15. Genome-wide characterization of microsatellites in Triticeae species: abundance, distribution and evolution.

    PubMed

    Deng, Pingchuan; Wang, Meng; Feng, Kewei; Cui, Licao; Tong, Wei; Song, Weining; Nie, Xiaojun

    2016-01-01

    Microsatellites are an important constituent of plant genome and distributed across entire genome. In this study, genome-wide analysis of microsatellites in 8 Triticeae species and 9 model plants revealed that microsatellite characteristics were similar among the Triticeae species. Furthermore, genome-wide microsatellite markers were designed in wheat and then used to analyze the evolutionary relationship of wheat and other Triticeae species. Results displayed that Aegilops tauschii was found to be the closest species to Triticum aestivum, followed by Triticum urartu, Triticum turgidum and Aegilops speltoides, while Triticum monococcum, Aegilops sharonensis and Hordeum vulgare showed a relatively lower PCR amplification effectivity. Additionally, a significantly higher PCR amplification effectivity was found in chromosomes at the same subgenome than its homoeologous when these markers were subjected to search against different chromosomes in wheat. After a rigorous screening process, a total of 20,666 markers showed high amplification and polymorphic potential in wheat and its relatives, which were integrated with the public available wheat markers and then anchored to the genome of wheat (CS). This study not only provided the useful resource for SSR markers development in Triticeae species, but also shed light on the evolution of polyploid wheat from the perspective of microsatellites. PMID:27561724

  16. Employing genome-wide SNP discovery and genotyping strategy to extrapolate the natural allelic diversity and domestication patterns in chickpea

    PubMed Central

    Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

    2015-01-01

    The genome-wide discovery and high-throughput genotyping of SNPs in chickpea natural germplasm lines is indispensable to extrapolate their natural allelic diversity, domestication, and linkage disequilibrium (LD) patterns leading to the genetic enhancement of this vital legume crop. We discovered 44,844 high-quality SNPs by sequencing of 93 diverse cultivated desi, kabuli, and wild chickpea accessions using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays that were physically mapped across eight chromosomes of desi and kabuli. Of these, 22,542 SNPs were structurally annotated in different coding and non-coding sequence components of genes. Genes with 3296 non-synonymous and 269 regulatory SNPs could functionally differentiate accessions based on their contrasting agronomic traits. A high experimental validation success rate (92%) and reproducibility (100%) along with strong sensitivity (93–96%) and specificity (99%) of GBS-based SNPs was observed. This infers the robustness of GBS as a high-throughput assay for rapid large-scale mining and genotyping of genome-wide SNPs in chickpea with sub-optimal use of resources. With 23,798 genome-wide SNPs, a relatively high intra-specific polymorphic potential (49.5%) and broader molecular diversity (13–89%)/functional allelic diversity (18–77%) was apparent among 93 chickpea accessions, suggesting their tremendous applicability in rapid selection of desirable diverse accessions/inter-specific hybrids in chickpea crossbred varietal improvement program. The genome-wide SNPs revealed complex admixed domestication pattern, extensive LD estimates (0.54–0.68) and extended LD decay (400–500 kb) in a structured population inclusive of 93 accessions. These findings reflect the utility of our identified SNPs for subsequent genome-wide association study (GWAS) and selective sweep-based domestication trait dissection analysis to identify potential genomic loci (gene-associated targets) specifically

  17. Employing genome-wide SNP discovery and genotyping strategy to extrapolate the natural allelic diversity and domestication patterns in chickpea.

    PubMed

    Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C L L; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K; Parida, Swarup K

    2015-01-01

    The genome-wide discovery and high-throughput genotyping of SNPs in chickpea natural germplasm lines is indispensable to extrapolate their natural allelic diversity, domestication, and linkage disequilibrium (LD) patterns leading to the genetic enhancement of this vital legume crop. We discovered 44,844 high-quality SNPs by sequencing of 93 diverse cultivated desi, kabuli, and wild chickpea accessions using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays that were physically mapped across eight chromosomes of desi and kabuli. Of these, 22,542 SNPs were structurally annotated in different coding and non-coding sequence components of genes. Genes with 3296 non-synonymous and 269 regulatory SNPs could functionally differentiate accessions based on their contrasting agronomic traits. A high experimental validation success rate (92%) and reproducibility (100%) along with strong sensitivity (93-96%) and specificity (99%) of GBS-based SNPs was observed. This infers the robustness of GBS as a high-throughput assay for rapid large-scale mining and genotyping of genome-wide SNPs in chickpea with sub-optimal use of resources. With 23,798 genome-wide SNPs, a relatively high intra-specific polymorphic potential (49.5%) and broader molecular diversity (13-89%)/functional allelic diversity (18-77%) was apparent among 93 chickpea accessions, suggesting their tremendous applicability in rapid selection of desirable diverse accessions/inter-specific hybrids in chickpea crossbred varietal improvement program. The genome-wide SNPs revealed complex admixed domestication pattern, extensive LD estimates (0.54-0.68) and extended LD decay (400-500 kb) in a structured population inclusive of 93 accessions. These findings reflect the utility of our identified SNPs for subsequent genome-wide association study (GWAS) and selective sweep-based domestication trait dissection analysis to identify potential genomic loci (gene-associated targets) specifically regulating

  18. Species Delimitation using Genome-Wide SNP Data

    PubMed Central

    Leaché, Adam D.; Fujita, Matthew K.; Minin, Vladimir N.; Bouckaert, Remco R.

    2014-01-01

    The multispecies coalescent has provided important progress for evolutionary inferences, including increasing the statistical rigor and objectivity of comparisons among competing species delimitation models. However, Bayesian species delimitation methods typically require brute force integration over gene trees via Markov chain Monte Carlo (MCMC), which introduces a large computation burden and precludes their application to genomic-scale data. Here we combine a recently introduced dynamic programming algorithm for estimating species trees that bypasses MCMC integration over gene trees with sophisticated methods for estimating marginal likelihoods, needed for Bayesian model selection, to provide a rigorous and computationally tractable technique for genome-wide species delimitation. We provide a critical yet simple correction that brings the likelihoods of different species trees, and more importantly their corresponding marginal likelihoods, to the same common denominator, which enables direct and accurate comparisons of competing species delimitation models using Bayes factors. We test this approach, which we call Bayes factor delimitation (*with genomic data; BFD*), using common species delimitation scenarios with computer simulations. Varying the numbers of loci and the number of samples suggest that the approach can distinguish the true model even with few loci and limited samples per species. Misspecification of the prior for population size θ has little impact on support for the true model. We apply the approach to West African forest geckos (Hemidactylus fasciatus complex) using genome-wide SNP data. This new Bayesian method for species delimitation builds on a growing trend for objective species delimitation methods with explicit model assumptions that are easily tested. [Bayes factor; model testing; phylogeography; RADseq; simulation; speciation.] PMID:24627183

  19. Genome-Wide Binding Patterns of Thyroid Hormone Receptor Beta

    PubMed Central

    Ayers, Stephen; Switnicki, Michal Piotr; Angajala, Anusha; Lammel, Jan; Arumanayagam, Anithachristy S.; Webb, Paul

    2014-01-01

    Thyroid hormone (TH) receptors (TRs) play central roles in metabolism and are major targets for pharmaceutical intervention. Presently, however, there is limited information about genome wide localizations of TR binding sites. Thus, complexities of TR genomic distribution and links between TRβ binding events and gene regulation are not fully appreciated. Here, we employ a BioChIP approach to capture TR genome-wide binding events in a liver cell line (HepG2). Like other NRs, TRβ appears widely distributed throughout the genome. Nevertheless, there is striking enrichment of TRβ binding sites immediately 5′ and 3′ of transcribed genes and TRβ can be detected near 50% of T3 induced genes. In contrast, no significant enrichment of TRβ is seen at negatively regulated genes or genes that respond to unliganded TRs in this system. Canonical TRE half-sites are present in more than 90% of TRβ peaks and classical TREs are also greatly enriched, but individual TRE organization appears highly variable with diverse half-site orientation and spacing. There is also significant enrichment of binding sites for TR associated transcription factors, including AP-1 and CTCF, near TR peaks. We conclude that T3-dependent gene induction commonly involves proximal TRβ binding events but that far-distant binding events are needed for T3 induction of some genes and that distinct, indirect, mechanisms are often at play in negative regulation and unliganded TR actions. Better understanding of genomic context of TR binding sites will help us determine why TR regulates genes in different ways and determine possibilities for selective modulation of TR action. PMID:24558356

  20. Genome-Wide Association Studies for Comb Traits in Chickens

    PubMed Central

    Ma, Meng; Dou, Taocun; Lu, Jian; Guo, Jun; Hu, Yuping; Yi, Guoqiang; Yuan, Jingwei; Sun, Congjiao; Wang, Kehua; Yang, Ning

    2016-01-01

    The comb, as a secondary sexual character, is an important trait in chicken. Indicators of comb length (CL), comb height (CH), and comb weight (CW) are often selected in production. DNA-based marker-assisted selection could help chicken breeders to accelerate genetic improvement for comb or related economic characters by early selection. Although a number of quantitative trait loci (QTL) and candidate genes have been identified with advances in molecular genetics, candidate genes underlying comb traits are limited. The aim of the study was to use genome-wide association (GWA) studies by 600 K Affymetrix chicken SNP arrays to detect genes that are related to comb, using an F2 resource population. For all comb characters, comb exhibited high SNP-based heritability estimates (0.61–0.69). Chromosome 1 explained 20.80% genetic variance, while chromosome 4 explained 6.89%. Independent univariate genome-wide screens for each character identified 127, 197, and 268 novel significant SNPs with CL, CH, and CW, respectively. Three candidate genes, VPS36, AR, and WNT11B, were determined to have a plausible function in all comb characters. These genes are important to the initiation of follicle development, gonadal growth, and dermal development, respectively. The current study provides the first GWA analysis for comb traits. Identification of the genetic basis as well as promising candidate genes will help us understand the underlying genetic architecture of comb development and has practical significance in breeding programs for the selection of comb as an index for sexual maturity or reproduction. PMID:27427764

  1. A genome-wide association study of anorexia nervosa

    PubMed Central

    Boraska, Vesna; Franklin, Christopher S; Floyd, James AB; Thornton, Laura M; Huckins, Laura M; Southam, Lorraine; Rayner, N William; Tachmazidou, Ioanna; Klump, Kelly L; Treasure, Janet; Lewis, Cathryn M; Schmidt, Ulrike; Tozzi, Federica; Kiezebrink, Kirsty; Hebebrand, Johannes; Gorwood, Philip; Adan, Roger AH; Kas, Martien JH; Favaro, Angela; Santonastaso, Paolo; Fernández-Aranda, Fernando; Gratacos, Monica; Rybakowski, Filip; Dmitrzak-Weglarz, Monika; Kaprio, Jaakko; Keski-Rahkonen, Anna; Raevuori, Anu; Van Furth, Eric F; Landt, Margarita CT Slof-Op t; Hudson, James I; Reichborn-Kjennerud, Ted; Knudsen, Gun Peggy S; Monteleone, Palmiero; Kaplan, Allan S; Karwautz, Andreas; Hakonarson, Hakon; Berrettini, Wade H; Guo, Yiran; Li, Dong; Schork, Nicholas J.; Komaki, Gen; Ando, Tetsuya; Inoko, Hidetoshi; Esko, Tõnu; Fischer, Krista; Männik, Katrin; Metspalu, Andres; Baker, Jessica H; Cone, Roger D; Dackor, Jennifer; DeSocio, Janiece E; Hilliard, Christopher E; O'Toole, Julie K; Pantel, Jacques; Szatkiewicz, Jin P; Taico, Chrysecolla; Zerwas, Stephanie; Trace, Sara E; Davis, Oliver SP; Helder, Sietske; Bühren, Katharina; Burghardt, Roland; de Zwaan, Martina; Egberts, Karin; Ehrlich, Stefan; Herpertz-Dahlmann, Beate; Herzog, Wolfgang; Imgart, Hartmut; Scherag, André; Scherag, Susann; Zipfel, Stephan; Boni, Claudette; Ramoz, Nicolas; Versini, Audrey; Brandys, Marek K; Danner, Unna N; de Kovel, Carolien; Hendriks, Judith; Koeleman, Bobby PC; Ophoff, Roel A; Strengman, Eric; van Elburg, Annemarie A; Bruson, Alice; Clementi, Maurizio; Degortes, Daniela; Forzan, Monica; Tenconi, Elena; Docampo, Elisa; Escaramís, Geòrgia; Jiménez-Murcia, Susana; Lissowska, Jolanta; Rajewski, Andrzej; Szeszenia-Dabrowska, Neonila; Slopien, Agnieszka; Hauser, Joanna; Karhunen, Leila; Meulenbelt, Ingrid; Slagboom, P Eline; Tortorella, Alfonso; Maj, Mario; Dedoussis, George; Dikeos, Dimitris; Gonidakis, Fragiskos; Tziouvas, Konstantinos; Tsitsika, Artemis; Papezova, Hana; Slachtova, Lenka; Martaskova, Debora; Kennedy, James L.; Levitan, Robert D.; Yilmaz, Zeynep; Huemer, Julia; Koubek, Doris; Merl, Elisabeth; Wagner, Gudrun; Lichtenstein, Paul; Breen, Gerome; Cohen-Woods, Sarah; Farmer, Anne; McGuffin, Peter; Cichon, Sven; Giegling, Ina; Herms, Stefan; Rujescu, Dan; Schreiber, Stefan; Wichmann, H-Erich; Dina, Christian; Sladek, Rob; Gambaro, Giovanni; Soranzo, Nicole; Julia, Antonio; Marsal, Sara; Rabionet, Raquel; Gaborieau, Valerie; Dick, Danielle M; Palotie, Aarno; Ripatti, Samuli; Widén, Elisabeth; Andreassen, Ole A; Espeseth, Thomas; Lundervold, Astri; Reinvang, Ivar; Steen, Vidar M; Le Hellard, Stephanie; Mattingsdal, Morten; Ntalla, Ioanna; Bencko, Vladimir; Foretova, Lenka; Janout, Vladimir; Navratilova, Marie; Gallinger, Steven; Pinto, Dalila; Scherer, Stephen; Aschauer, Harald; Carlberg, Laura; Schosser, Alexandra; Alfredsson, Lars; Ding, Bo; Klareskog, Lars; Padyukov, Leonid; Finan, Chris; Kalsi, Gursharan; Roberts, Marion; Logan, Darren W; Peltonen, Leena; Ritchie, Graham RS; Barrett, Jeffrey C; Estivill, Xavier; Hinney, Anke; Sullivan, Patrick F; Collier, David A; Zeggini, Eleftheria; Bulik, Cynthia M

    2015-01-01

    Anorexia nervosa (AN) is a complex and heritable eating disorder characterized by dangerously low body weight. Neither candidate gene studies nor an initial genome wide association study (GWAS) have yielded significant and replicated results. We performed a GWAS in 2,907 cases with AN from 14 countries (15 sites) and 14,860 ancestrally matched controls as part of the Genetic Consortium for AN (GCAN) and the Wellcome Trust Case Control Consortium 3 (WTCCC3). Individual association analyses were conducted in each stratum and meta-analyzed across all 15 discovery datasets. Seventy-six (72 independent) SNPs were taken forward for in silico (two datasets) or de novo (13 datasets) replication genotyping in 2,677 independent AN cases and 8,629 European ancestry controls along with 458 AN cases and 421 controls from Japan. The final global meta-analysis across discovery and replication datasets comprised 5,551 AN cases and 21,080 controls. AN subtype analyses (1,606 AN restricting; 1,445 AN binge-purge) were performed. No findings reached genome-wide significance. Two intronic variants were suggestively associated: rs9839776 (P=3.01×10-7) in SOX2OT and rs17030795 (P=5.84×10-6) in PPP3CA. Two additional signals were specific to Europeans: rs1523921 (P=5.76×10-6) between CUL3 and FAM124B and rs1886797 (P=8.05×10-6) near SPATA13. Comparing discovery to replication results, 76% of the effects were in the same direction, an observation highly unlikely to be due to chance (P=4×10-6), strongly suggesting that true findings exist but that our sample, the largest yet reported, was underpowered for their detection. The accrual of large genotyped AN case-control samples should be an immediate priority for the field. PMID:24514567

  2. A genome-wide association study of anorexia nervosa

    PubMed Central

    Boraska, Vesna; Franklin, Christopher S; Floyd, James AB; Thornton, Laura M; Huckins, Laura M; Southam, Lorraine; Rayner, N William; Tachmazidou, Ioanna; Klump, Kelly L; Treasure, Janet; Lewis, Cathryn M; Schmidt, Ulrike; Tozzi, Federica; Kiezebrink, Kirsty; Hebebrand, Johannes; Gorwood, Philip; Adan, Roger AH; Kas, Martien JH; Favaro, Angela; Santonastaso, Paolo; Fernández-Aranda, Fernando; Gratacos, Monica; Rybakowski, Filip; Dmitrzak-Weglarz, Monika; Kaprio, Jaakko; Keski-Rahkonen, Anna; Raevuori, Anu; Van Furth, Eric F; Slof-Op t Landt, Margarita CT; Hudson, James I; Reichborn-Kjennerud, Ted; Knudsen, Gun Peggy S; Monteleone, Palmiero; Kaplan, Allan S; Karwautz, Andreas; Hakonarson, Hakon; Berrettini, Wade H; Guo, Yiran; Li, Dong; Schork, Nicholas J.; Komaki, Gen; Ando, Tetsuya; Inoko, Hidetoshi; Esko, Tõnu; Fischer, Krista; Männik, Katrin; Metspalu, Andres; Baker, Jessica H; Cone, Roger D; Dackor, Jennifer; DeSocio, Janiece E; Hilliard, Christopher E; O’Toole, Julie K; Pantel, Jacques; Szatkiewicz, Jin P; Taico, Chrysecolla; Zerwas, Stephanie; Trace, Sara E; Davis, Oliver SP; Helder, Sietske; Bühren, Katharina; Burghardt, Roland; de Zwaan, Martina; Egberts, Karin; Ehrlich, Stefan; Herpertz-Dahlmann, Beate; Herzog, Wolfgang; Imgart, Hartmut; Scherag, André; Scherag, Susann; Zipfel, Stephan; Boni, Claudette; Ramoz, Nicolas; Versini, Audrey; Brandys, Marek K; Danner, Unna N; de Kovel, Carolien; Hendriks, Judith; Koeleman, Bobby PC; Ophoff, Roel A; Strengman, Eric; van Elburg, Annemarie A; Bruson, Alice; Clementi, Maurizio; Degortes, Daniela; Forzan, Monica; Tenconi, Elena; Docampo, Elisa; Escaramís, Geòrgia; Jiménez-Murcia, Susana; Lissowska, Jolanta; Rajewski, Andrzej; Szeszenia-Dabrowska, Neonila; Slopien, Agnieszka; Hauser, Joanna; Karhunen, Leila; Meulenbelt, Ingrid; Slagboom, P Eline; Tortorella, Alfonso; Maj, Mario; Dedoussis, George; Dikeos, Dimitris; Gonidakis, Fragiskos; Tziouvas, Konstantinos; Tsitsika, Artemis; Papezova, Hana; Slachtova, Lenka; Martaskova, Debora; Kennedy, James L.; Levitan, Robert D.; Yilmaz, Zeynep; Huemer, Julia; Koubek, Doris; Merl, Elisabeth; Wagner, Gudrun; Lichtenstein, Paul; Breen, Gerome; Cohen-Woods, Sarah; Farmer, Anne; McGuffin, Peter; Cichon, Sven; Giegling, Ina; Herms, Stefan; Rujescu, Dan; Schreiber, Stefan; Wichmann, H-Erich; Dina, Christian; Sladek, Rob; Gambaro, Giovanni; Soranzo, Nicole; Julia, Antonio; Marsal, Sara; Rabionet, Raquel; Gaborieau, Valerie; Dick, Danielle M; Palotie, Aarno; Ripatti, Samuli; Widén, Elisabeth; Andreassen, Ole A; Espeseth, Thomas; Lundervold, Astri; Reinvang, Ivar; Steen, Vidar M; Le Hellard, Stephanie; Mattingsdal, Morten; Ntalla, Ioanna; Bencko, Vladimir; Foretova, Lenka; Janout, Vladimir; Navratilova, Marie; Gallinger, Steven; Pinto, Dalila; Scherer, Stephen; Aschauer, Harald; Carlberg, Laura; Schosser, Alexandra; Alfredsson, Lars; Ding, Bo; Klareskog, Lars; Padyukov, Leonid; Finan, Chris; Kalsi, Gursharan; Roberts, Marion; Logan, Darren W; Peltonen, Leena; Ritchie, Graham RS; Barrett, Jeffrey C; Estivill, Xavier; Hinney, Anke; Sullivan, Patrick F; Collier, David A; Zeggini, Eleftheria; Bulik, Cynthia M

    2013-01-01

    Anorexia nervosa (AN) is a complex and heritable eating disorder characterized by dangerously low body weight. Neither candidate gene studies nor an initial genome wide association study (GWAS) have yielded significant and replicated results. We performed a GWAS in 2,907 cases with AN from 14 countries (15 sites) and 14,860 ancestrally matched controls as part of the Genetic Consortium for AN (GCAN) and the Wellcome Trust Case Control Consortium 3 (WTCCC3). Individual association analyses were conducted in each stratum and meta-analyzed across all 15 discovery datasets. Seventy-six (72 independent) SNPs were taken forward for in silico (two datasets) or de novo (13 datasets) replication genotyping in 2,677 independent AN cases and 8,629 European ancestry controls along with 458 AN cases and 421 controls from Japan. The final global meta-analysis across discovery and replication datasets comprised 5,551 AN cases and 21,080 controls. AN subtype analyses (1,606 AN restricting; 1,445 AN binge-purge) were performed. No findings reached genome-wide significance. Two intronic variants were suggestively associated: rs9839776 (P=3.01×10−7) in SOX2OT and rs17030795 (P=5.84×10−6) in PPP3CA. Two additional signals were specific to Europeans: rs1523921 (P=5.76×10−6) between CUL3 and FAM124B and rs1886797 (P=8.05×10−6) near SPATA13. Comparing discovery to replication results, 76% of the effects were in the same direction, an observation highly unlikely to be due to chance (P= 4×10−6), strongly suggesting that true findings exist but that our sample, the largest yet reported, was underpowered for their detection. The accrual of large genotyped AN case-control samples should be an immediate priority for the field. PMID:21079607

  3. A genome-wide association study of anorexia nervosa.

    PubMed

    Boraska, V; Franklin, C S; Floyd, J A B; Thornton, L M; Huckins, L M; Southam, L; Rayner, N W; Tachmazidou, I; Klump, K L; Treasure, J; Lewis, C M; Schmidt, U; Tozzi, F; Kiezebrink, K; Hebebrand, J; Gorwood, P; Adan, R A H; Kas, M J H; Favaro, A; Santonastaso, P; Fernández-Aranda, F; Gratacos, M; Rybakowski, F; Dmitrzak-Weglarz, M; Kaprio, J; Keski-Rahkonen, A; Raevuori, A; Van Furth, E F; Slof-Op 't Landt, M C T; Hudson, J I; Reichborn-Kjennerud, T; Knudsen, G P S; Monteleone, P; Kaplan, A S; Karwautz, A; Hakonarson, H; Berrettini, W H; Guo, Y; Li, D; Schork, N J; Komaki, G; Ando, T; Inoko, H; Esko, T; Fischer, K; Männik, K; Metspalu, A; Baker, J H; Cone, R D; Dackor, J; DeSocio, J E; Hilliard, C E; O'Toole, J K; Pantel, J; Szatkiewicz, J P; Taico, C; Zerwas, S; Trace, S E; Davis, O S P; Helder, S; Bühren, K; Burghardt, R; de Zwaan, M; Egberts, K; Ehrlich, S; Herpertz-Dahlmann, B; Herzog, W; Imgart, H; Scherag, A; Scherag, S; Zipfel, S; Boni, C; Ramoz, N; Versini, A; Brandys, M K; Danner, U N; de Kovel, C; Hendriks, J; Koeleman, B P C; Ophoff, R A; Strengman, E; van Elburg, A A; Bruson, A; Clementi, M; Degortes, D; Forzan, M; Tenconi, E; Docampo, E; Escaramís, G; Jiménez-Murcia, S; Lissowska, J; Rajewski, A; Szeszenia-Dabrowska, N; Slopien, A; Hauser, J; Karhunen, L; Meulenbelt, I; Slagboom, P E; Tortorella, A; Maj, M; Dedoussis, G; Dikeos, D; Gonidakis, F; Tziouvas, K; Tsitsika, A; Papezova, H; Slachtova, L; Martaskova, D; Kennedy, J L; Levitan, R D; Yilmaz, Z; Huemer, J; Koubek, D; Merl, E; Wagner, G; Lichtenstein, P; Breen, G; Cohen-Woods, S; Farmer, A; McGuffin, P; Cichon, S; Giegling, I; Herms, S; Rujescu, D; Schreiber, S; Wichmann, H-E; Dina, C; Sladek, R; Gambaro, G; Soranzo, N; Julia, A; Marsal, S; Rabionet, R; Gaborieau, V; Dick, D M; Palotie, A; Ripatti, S; Widén, E; Andreassen, O A; Espeseth, T; Lundervold, A; Reinvang, I; Steen, V M; Le Hellard, S; Mattingsdal, M; Ntalla, I; Bencko, V; Foretova, L; Janout, V; Navratilova, M; Gallinger, S; Pinto, D; Scherer, S W; Aschauer, H; Carlberg, L; Schosser, A; Alfredsson, L; Ding, B; Klareskog, L; Padyukov, L; Courtet, P; Guillaume, S; Jaussent, I; Finan, C; Kalsi, G; Roberts, M; Logan, D W; Peltonen, L; Ritchie, G R S; Barrett, J C; Estivill, X; Hinney, A; Sullivan, P F; Collier, D A; Zeggini, E; Bulik, C M

    2014-10-01

    Anorexia nervosa (AN) is a complex and heritable eating disorder characterized by dangerously low body weight. Neither candidate gene studies nor an initial genome-wide association study (GWAS) have yielded significant and replicated results. We performed a GWAS in 2907 cases with AN from 14 countries (15 sites) and 14 860 ancestrally matched controls as part of the Genetic Consortium for AN (GCAN) and the Wellcome Trust Case Control Consortium 3 (WTCCC3). Individual association analyses were conducted in each stratum and meta-analyzed across all 15 discovery data sets. Seventy-six (72 independent) single nucleotide polymorphisms were taken forward for in silico (two data sets) or de novo (13 data sets) replication genotyping in 2677 independent AN cases and 8629 European ancestry controls along with 458 AN cases and 421 controls from Japan. The final global meta-analysis across discovery and replication data sets comprised 5551 AN cases and 21 080 controls. AN subtype analyses (1606 AN restricting; 1445 AN binge-purge) were performed. No findings reached genome-wide significance. Two intronic variants were suggestively associated: rs9839776 (P=3.01 × 10(-7)) in SOX2OT and rs17030795 (P=5.84 × 10(-6)) in PPP3CA. Two additional signals were specific to Europeans: rs1523921 (P=5.76 × 10(-)(6)) between CUL3 and FAM124B and rs1886797 (P=8.05 × 10(-)(6)) near SPATA13. Comparing discovery with replication results, 76% of the effects were in the same direction, an observation highly unlikely to be due to chance (P=4 × 10(-6)), strongly suggesting that true findings exist but our sample, the largest yet reported, was underpowered for their detection. The accrual of large genotyped AN case-control samples should be an immediate priority for the field.

  4. A genome-wide association study of anorexia nervosa.

    PubMed

    Boraska, V; Franklin, C S; Floyd, J A B; Thornton, L M; Huckins, L M; Southam, L; Rayner, N W; Tachmazidou, I; Klump, K L; Treasure, J; Lewis, C M; Schmidt, U; Tozzi, F; Kiezebrink, K; Hebebrand, J; Gorwood, P; Adan, R A H; Kas, M J H; Favaro, A; Santonastaso, P; Fernández-Aranda, F; Gratacos, M; Rybakowski, F; Dmitrzak-Weglarz, M; Kaprio, J; Keski-Rahkonen, A; Raevuori, A; Van Furth, E F; Slof-Op 't Landt, M C T; Hudson, J I; Reichborn-Kjennerud, T; Knudsen, G P S; Monteleone, P; Kaplan, A S; Karwautz, A; Hakonarson, H; Berrettini, W H; Guo, Y; Li, D; Schork, N J; Komaki, G; Ando, T; Inoko, H; Esko, T; Fischer, K; Männik, K; Metspalu, A; Baker, J H; Cone, R D; Dackor, J; DeSocio, J E; Hilliard, C E; O'Toole, J K; Pantel, J; Szatkiewicz, J P; Taico, C; Zerwas, S; Trace, S E; Davis, O S P; Helder, S; Bühren, K; Burghardt, R; de Zwaan, M; Egberts, K; Ehrlich, S; Herpertz-Dahlmann, B; Herzog, W; Imgart, H; Scherag, A; Scherag, S; Zipfel, S; Boni, C; Ramoz, N; Versini, A; Brandys, M K; Danner, U N; de Kovel, C; Hendriks, J; Koeleman, B P C; Ophoff, R A; Strengman, E; van Elburg, A A; Bruson, A; Clementi, M; Degortes, D; Forzan, M; Tenconi, E; Docampo, E; Escaramís, G; Jiménez-Murcia, S; Lissowska, J; Rajewski, A; Szeszenia-Dabrowska, N; Slopien, A; Hauser, J; Karhunen, L; Meulenbelt, I; Slagboom, P E; Tortorella, A; Maj, M; Dedoussis, G; Dikeos, D; Gonidakis, F; Tziouvas, K; Tsitsika, A; Papezova, H; Slachtova, L; Martaskova, D; Kennedy, J L; Levitan, R D; Yilmaz, Z; Huemer, J; Koubek, D; Merl, E; Wagner, G; Lichtenstein, P; Breen, G; Cohen-Woods, S; Farmer, A; McGuffin, P; Cichon, S; Giegling, I; Herms, S; Rujescu, D; Schreiber, S; Wichmann, H-E; Dina, C; Sladek, R; Gambaro, G; Soranzo, N; Julia, A; Marsal, S; Rabionet, R; Gaborieau, V; Dick, D M; Palotie, A; Ripatti, S; Widén, E; Andreassen, O A; Espeseth, T; Lundervold, A; Reinvang, I; Steen, V M; Le Hellard, S; Mattingsdal, M; Ntalla, I; Bencko, V; Foretova, L; Janout, V; Navratilova, M; Gallinger, S; Pinto, D; Scherer, S W; Aschauer, H; Carlberg, L; Schosser, A; Alfredsson, L; Ding, B; Klareskog, L; Padyukov, L; Courtet, P; Guillaume, S; Jaussent, I; Finan, C; Kalsi, G; Roberts, M; Logan, D W; Peltonen, L; Ritchie, G R S; Barrett, J C; Estivill, X; Hinney, A; Sullivan, P F; Collier, D A; Zeggini, E; Bulik, C M

    2014-10-01

    Anorexia nervosa (AN) is a complex and heritable eating disorder characterized by dangerously low body weight. Neither candidate gene studies nor an initial genome-wide association study (GWAS) have yielded significant and replicated results. We performed a GWAS in 2907 cases with AN from 14 countries (15 sites) and 14 860 ancestrally matched controls as part of the Genetic Consortium for AN (GCAN) and the Wellcome Trust Case Control Consortium 3 (WTCCC3). Individual association analyses were conducted in each stratum and meta-analyzed across all 15 discovery data sets. Seventy-six (72 independent) single nucleotide polymorphisms were taken forward for in silico (two data sets) or de novo (13 data sets) replication genotyping in 2677 independent AN cases and 8629 European ancestry controls along with 458 AN cases and 421 controls from Japan. The final global meta-analysis across discovery and replication data sets comprised 5551 AN cases and 21 080 controls. AN subtype analyses (1606 AN restricting; 1445 AN binge-purge) were performed. No findings reached genome-wide significance. Two intronic variants were suggestively associated: rs9839776 (P=3.01 × 10(-7)) in SOX2OT and rs17030795 (P=5.84 × 10(-6)) in PPP3CA. Two additional signals were specific to Europeans: rs1523921 (P=5.76 × 10(-)(6)) between CUL3 and FAM124B and rs1886797 (P=8.05 × 10(-)(6)) near SPATA13. Comparing discovery with replication results, 76% of the effects were in the same direction, an observation highly unlikely to be due to chance (P=4 × 10(-6)), strongly suggesting that true findings exist but our sample, the largest yet reported, was underpowered for their detection. The accrual of large genotyped AN case-control samples should be an immediate priority for the field. PMID:24514567

  5. Genome-Wide Association Studies for Comb Traits in Chickens.

    PubMed

    Shen, Manman; Qu, Liang; Ma, Meng; Dou, Taocun; Lu, Jian; Guo, Jun; Hu, Yuping; Yi, Guoqiang; Yuan, Jingwei; Sun, Congjiao; Wang, Kehua; Yang, Ning

    2016-01-01

    The comb, as a secondary sexual character, is an important trait in chicken. Indicators of comb length (CL), comb height (CH), and comb weight (CW) are often selected in production. DNA-based marker-assisted selection could help chicken breeders to accelerate genetic improvement for comb or related economic characters by early selection. Although a number of quantitative trait loci (QTL) and candidate genes have been identified with advances in molecular genetics, candidate genes underlying comb traits are limited. The aim of the study was to use genome-wide association (GWA) studies by 600 K Affymetrix chicken SNP arrays to detect genes that are related to comb, using an F2 resource population. For all comb characters, comb exhibited high SNP-based heritability estimates (0.61-0.69). Chromosome 1 explained 20.80% genetic variance, while chromosome 4 explained 6.89%. Independent univariate genome-wide screens for each character identified 127, 197, and 268 novel significant SNPs with CL, CH, and CW, respectively. Three candidate genes, VPS36, AR, and WNT11B, were determined to have a plausible function in all comb characters. These genes are important to the initiation of follicle development, gonadal growth, and dermal development, respectively. The current study provides the first GWA analysis for comb traits. Identification of the genetic basis as well as promising candidate genes will help us understand the underlying genetic architecture of comb development and has practical significance in breeding programs for the selection of comb as an index for sexual maturity or reproduction. PMID:27427764

  6. Comparative analysis of genome-wide divergence, domestication footprints and genome-wide association study of root traits for Gossypium hirsutum and Gossypium barbadense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using genome-wide distributed SNPs, we examined ...

  7. Privacy-preserving genome-wide association studies on cloud environment using fully homomorphic encryption

    PubMed Central

    2015-01-01

    Objective Developed sequencing techniques are yielding large-scale genomic data at low cost. A genome-wide association study (GWAS) targeting genetic variations that are significantly associated with a particular disease offers great potential for medical improvement. However, subjects who volunteer their genomic data expose themselves to the risk of privacy invasion; these privacy concerns prevent efficient genomic data sharing. Our goal is to presents a cryptographic solution to this problem. Methods To maintain the privacy of subjects, we propose encryption of all genotype and phenotype data. To allow the cloud to perform meaningful computation in relation to the encrypted data, we use a fully homomorphic encryption scheme. Noting that we can evaluate typical statistics for GWAS from a frequency table, our solution evaluates frequency tables with encrypted genomic and clinical data as input. We propose to use a packing technique for efficient evaluation of these frequency tables. Results Our solution supports evaluation of the D′ measure of linkage disequilibrium, the Hardy-Weinberg Equilibrium, the χ2 test, etc. In this paper, we take χ2 test and linkage disequilibrium as examples and demonstrate how we can conduct these algorithms securely and efficiently in an outsourcing setting. We demonstrate with experimentation that secure outsourcing computation of one χ2 test with 10, 000 subjects requires about 35 ms and evaluation of one linkage disequilibrium with 10, 000 subjects requires about 80 ms. Conclusions With appropriate encoding and packing technique, cryptographic solutions based on fully homomorphic encryption for secure computations of GWAS can be practical. PMID:26732892

  8. Genome-Wide Association Study Reveals a New QTL for Salinity Tolerance in Barley (Hordeum vulgare L.).

    PubMed

    Fan, Yun; Zhou, Gaofeng; Shabala, Sergey; Chen, Zhong-Hua; Cai, Shengguan; Li, Chengdao; Zhou, Meixue

    2016-01-01

    Salinity stress is one of the most severe abiotic stresses that affect agricultural production. Genome wide association study (GWAS) has been widely used to detect genetic variations in extensive natural accessions with more recombination and higher resolution. In this study, 206 barley accessions collected worldwide were genotyped with 408 Diversity Arrays Technology (DArT) markers and evaluated for salinity stress tolerance using salinity tolerance score - a reliable trait developed in our previous work. GWAS for salinity tolerance had been conducted through a general linkage model and a mixed linkage model based on population structure and kinship. A total of 24 significant marker-trait associations were identified. A QTL on 4H with the nearest marker of bPb-9668 was consistently detected in all different methods. This QTL has not been reported before and is worth to be further confirmed with bi-parental populations. PMID:27446173

  9. Genome-Wide Association Study Reveals a New QTL for Salinity Tolerance in Barley (Hordeum vulgare L.)

    PubMed Central

    Fan, Yun; Zhou, Gaofeng; Shabala, Sergey; Chen, Zhong-Hua; Cai, Shengguan; Li, Chengdao; Zhou, Meixue

    2016-01-01

    Salinity stress is one of the most severe abiotic stresses that affect agricultural production. Genome wide association study (GWAS) has been widely used to detect genetic variations in extensive natural accessions with more recombination and higher resolution. In this study, 206 barley accessions collected worldwide were genotyped with 408 Diversity Arrays Technology (DArT) markers and evaluated for salinity stress tolerance using salinity tolerance score – a reliable trait developed in our previous work. GWAS for salinity tolerance had been conducted through a general linkage model and a mixed linkage model based on population structure and kinship. A total of 24 significant marker-trait associations were identified. A QTL on 4H with the nearest marker of bPb-9668 was consistently detected in all different methods. This QTL has not been reported before and is worth to be further confirmed with bi-parental populations. PMID:27446173

  10. Analysis of Genome-Wide Association Studies with Multiple Outcomes Using Penalization

    PubMed Central

    Liu, Jin; Huang, Jian; Ma, Shuangge

    2012-01-01

    Genome-wide association studies have been extensively conducted, searching for markers for biologically meaningful outcomes and phenotypes. Penalization methods have been adopted in the analysis of the joint effects of a large number of SNPs (single nucleotide polymorphisms) and marker identification. This study is partly motivated by the analysis of heterogeneous stock mice dataset, in which multiple correlated phenotypes and a large number of SNPs are available. Existing penalization methods designed to analyze a single response variable cannot accommodate the correlation among multiple response variables. With multiple response variables sharing the same set of markers, joint modeling is first employed to accommodate the correlation. The group Lasso approach is adopted to select markers associated with all the outcome variables. An efficient computational algorithm is developed. Simulation study and analysis of the heterogeneous stock mice dataset show that the proposed method can outperform existing penalization methods. PMID:23272092

  11. A method for detecting epistasis in genome-wide studies using case-control multi-locus association analysis

    PubMed Central

    Gayán, Javier; González-Pérez, Antonio; Bermudo, Fernando; Sáez, María Eugenia; Royo, Jose Luis; Quintas, Antonio; Galan, Jose Jorge; Morón, Francisco Jesús; Ramirez-Lorca, Reposo; Real, Luis Miguel; Ruiz, Agustín

    2008-01-01

    Background The difficulty in elucidating the genetic basis of complex diseases roots in the many factors that can affect the development of a disease. Some of these genetic effects may interact in complex ways, proving undetectable by current single-locus methodology. Results We have developed an analysis tool called Hypothesis Free Clinical Cloning (HFCC) to search for genome-wide epistasis in a case-control design. HFCC combines a relatively fast computing algorithm for genome-wide epistasis detection, with the flexibility to test a variety of different epistatic models in multi-locus combinations. HFCC has good power to detect multi-locus interactions simulated under a variety of genetic models and noise conditions. Most importantly, HFCC can accomplish exhaustive genome-wide epistasis search with large datasets as demonstrated with a 400,000 SNP set typed on a cohort of Parkinson's disease patients and controls. Conclusion With the current availability of genetic studies with large numbers of individuals and genetic markers, HFCC can have a great impact in the identification of epistatic effects that escape the standard single-locus association analyses. PMID:18667089

  12. Comparative analysis of methods for genome-wide nucleosome cartography.

    PubMed

    Quintales, Luis; Vázquez, Enrique; Antequera, Francisco

    2015-07-01

    Nucleosomes contribute to compacting the genome into the nucleus and regulate the physical access of regulatory proteins to DNA either directly or through the epigenetic modifications of the histone tails. Precise mapping of nucleosome positioning across the genome is, therefore, essential to understanding the genome regulation. In recent years, several experimental protocols have been developed for this purpose that include the enzymatic digestion, chemical cleavage or immunoprecipitation of chromatin followed by next-generation sequencing of the resulting DNA fragments. Here, we compare the performance and resolution of these methods from the initial biochemical steps through the alignment of the millions of short-sequence reads to a reference genome to the final computational analysis to generate genome-wide maps of nucleosome occupancy. Because of the lack of a unified protocol to process data sets obtained through the different approaches, we have developed a new computational tool (NUCwave), which facilitates their analysis, comparison and assessment and will enable researchers to choose the most suitable method for any particular purpose. NUCwave is freely available at http://nucleosome.usal.es/nucwave along with a step-by-step protocol for its use. PMID:25296770

  13. Insights into kidney diseases from genome-wide association studies.

    PubMed

    Wuttke, Matthias; Köttgen, Anna

    2016-09-01

    Over the past decade, genome-wide association studies (GWAS) have considerably improved our understanding of the genetic basis of kidney function and disease. Population-based studies, used to investigate traits that define chronic kidney disease (CKD), have identified >50 genomic regions in which common genetic variants associate with estimated glomerular filtration rate or urinary albumin-to-creatinine ratio. Case-control studies, used to study specific CKD aetiologies, have yielded risk loci for specific kidney diseases such as IgA nephropathy and membranous nephropathy. In this Review, we summarize important findings from GWAS and clinical and experimental follow-up studies. We also compare risk allele frequency, effect sizes, and specificity in GWAS of CKD-defining traits and GWAS of specific CKD aetiologies and the implications for study design. Genomic regions identified in GWAS of CKD-defining traits can contain causal genes for monogenic kidney diseases. Population-based research on kidney function traits can therefore generate insights into more severe forms of kidney diseases. Experimental follow-up studies have begun to identify causal genes and variants, which are potential therapeutic targets, and suggest mechanisms underlying the high allele frequency of causal variants. GWAS are thus a useful approach to advance knowledge in nephrology.

  14. Genome-wide transcriptome analysis of 150 cell samples.

    PubMed

    Irimia, Daniel; Mindrinos, Michael; Russom, Aman; Xiao, Wenzhong; Wilhelmy, Julie; Wang, Shenglong; Heath, Joe Don; Kurn, Nurith; Tompkins, Ronald G; Davis, Ronald W; Toner, Mehmet

    2009-01-01

    A major challenge in molecular biology is interrogating the human transcriptome on a genome wide scale when only a limited amount of biological sample is available for analysis. Current methodologies using microarray technologies for simultaneously monitoring mRNA transcription levels require nanogram amounts of total RNA. To overcome the sample size limitation of current technologies, we have developed a method to probe the global gene expression in biological samples as small as 150 cells, or the equivalent of approximately 300 pg total RNA. The new method employs microfluidic devices for the purification of total RNA from mammalian cells and ultra-sensitive whole transcriptome amplification techniques. We verified that the RNA integrity is preserved through the isolation process, accomplished highly reproducible whole transcriptome analysis, and established high correlation between repeated isolations of 150 cells and the same cell culture sample. We validated the technology by demonstrating that the combined microfluidic and amplification protocol is capable of identifying biological pathways perturbed by stimulation, which are consistent with the information recognized in bulk-isolated samples.

  15. Genome-wide transcriptome analysis of 150 cell samples†

    PubMed Central

    Russom, Aman; Xiao, Wenzhong; Wilhelmy, Julie; Wang, Shenglong; Heath, Joe Don; Kurn, Nurith; Tompkins, Ronald G.; Davis, Ronald W.; Toner, Mehmet

    2013-01-01

    A major challenge in molecular biology is interrogating the human transcriptome on a genome wide scale when only a limited amount of biological sample is available for analysis. Current methodologies using microarray technologies for simultaneously monitoring mRNA transcription levels require nanogram amounts of total RNA. To overcome the sample size limitation of current technologies, we have developed a method to probe the global gene expression in biological samples as small as 150 cells, or the equivalent of approximately 300 pg total RNA. The new method employs microfluidic devices for the purification of total RNA from mammalian cells and ultra-sensitive whole transcriptome amplification techniques. We verified that the RNA integrity is preserved through the isolation process, accomplished highly reproducible whole transcriptome analysis, and established high correlation between repeated isolations of 150 cells and the same cell culture sample. We validated the technology by demonstrating that the combined microfluidic and amplification protocol is capable of identifying biological pathways perturbed by stimulation, which are consistent with the information recognized in bulk-isolated samples. PMID:20023796

  16. Genome-wide significant risk associations for mucinous ovarian carcinoma.

    PubMed

    Kelemen, Linda E; Lawrenson, Kate; Tyrer, Jonathan; Li, Qiyuan; Lee, Janet M; Seo, Ji-Heui; Phelan, Catherine M; Beesley, Jonathan; Chen, Xiaoqing; Spindler, Tassja J; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia

    2015-08-01

    Genome-wide association studies have identified several risk associations for ovarian carcinomas but not for mucinous ovarian carcinomas (MOCs). Our analysis of 1,644 MOC cases and 21,693 controls with imputation identified 3 new risk associations: rs752590 at 2q13 (P = 3.3 × 10(-8)), rs711830 at 2q31.1 (P = 7.5 × 10(-12)) and rs688187 at 19q13.2 (P = 6.8 × 10(-13)). We identified significant expression quantitative trait locus (eQTL) associations for HOXD9 at 2q31.1 in ovarian (P = 4.95 × 10(-4), false discovery rate (FDR) = 0.003) and colorectal (P = 0.01, FDR = 0.09) tumors and for PAX8 at 2q13 in colorectal tumors (P = 0.03, FDR = 0.09). Chromosome conformation capture analysis identified interactions between the HOXD9 promoter and risk-associated SNPs at 2q31.1. Overexpressing HOXD9 in MOC cells augmented the neoplastic phenotype. These findings provide the first evidence for MOC susceptibility variants and insights into the underlying biology of the disease. PMID:26075790

  17. Genome-wide discovery of maternal effect variants

    PubMed Central

    2009-01-01

    Many phenotypes may be influenced by the prenatal environment of the mother and/or maternal care, and these maternal effects may have a heritable component. We have implemented in the computer program SOLAR a variance components-based method for detecting indirect effects of maternal genotype on offspring phenotype. Of six phenotypes measured in three generations of the Framingham Heart Study, height showed the strongest evidence (P = 0.02) of maternal effect. We conducted a genome-wide association analysis for height, testing both the direct effect of the focal individual's genotype and the indirect effect of the maternal genotype. Offspring height showed suggestive evidence of association with maternal genotype for two single-nucleotide polymorphisms in the trafficking protein particle complex 9 gene TRAPPC9 (NIBP), which plays a role in neuronal NF-κB signalling. This work establishes a methodological framework for identifying genetic variants that may influence the contribution of the maternal environment to offspring phenotypes. PMID:20018008

  18. Genome-wide transcriptome analysis of human epidermal melanocytes

    PubMed Central

    Haltaufderhyde, Kirk D.; Oancea, Elena

    2015-01-01

    Because human epidermal melanocytes (HEMs) provide critical protection against skin cancer, sunburn, and photoaging, a genome-wide perspective of gene expression in these cells is vital to understanding human skin physiology. In this study we performed high throughput sequencing of HEMs to obtain a complete data set of transcript sizes, abundances, and splicing. As expected, we found that melanocyte specific genes that function in pigmentation were among the highest expressed genes. We analyzed receptor, ion channel and transcription factor gene families to get a better understanding of the cell signalling pathways used by melanocytes. We also performed a comparative transcriptomic analysis of lightly versus darkly pigmented HEMs and found 16 genes differentially expressed in the two pigmentation phenotypes; of those, only one putative melanosomal transporter (SLC45A2) has known function in pigmentation. In addition, we found 166 genes with splice isoforms expressed exclusively in one pigmentation phenotype, 17 of which are genes involved in signal transduction. Our melanocyte transcriptome study provides a comprehensive view and may help identify novel pigmentation genes and potential pharmacological targets. PMID:25451175

  19. Genome-wide profiling of forum domains in Drosophila melanogaster

    PubMed Central

    Tchurikov, Nickolai A.; Kretova, Olga V.; Sosin, Dmitri V.; Zykov, Ivan A.; Zhimulev, Igor F.; Kravatsky, Yuri V.

    2011-01-01

    Forum domains are stretches of chromosomal DNA that are excised from eukaryotic chromosomes during their spontaneous non-random fragmentation. Most forum domains are 50–200 kb in length. We mapped forum domain termini using FISH on polytene chromosomes and we performed genome-wide mapping using a Drosophila melanogaster genomic tiling microarray consisting of overlapping 3 kb fragments. We found that forum termini very often correspond to regions of intercalary heterochromatin and regions of late replication in polytene chromosomes. We found that forum domains contain clusters of several or many genes. The largest forum domains correspond to the main clusters of homeotic genes inside BX-C and ANTP-C, cluster of histone genes and clusters of piRNAs. PRE/TRE and transcription factor binding sites often reside inside domains and do not overlap with forum domain termini. We also found that about 20% of forum domain termini correspond to small chromosomal regions where Ago1, Ago2, small RNAs and repressive chromatin structures are detected. Our results indicate that forum domains correspond to big multi-gene chromosomal units, some of which could be coordinately expressed. The data on the global mapping of forum domains revealed a strong correlation between fragmentation sites in chromosomes, particular sets of mobile elements and regions of intercalary heterochromatin. PMID:21247882

  20. Genome-wide association study of selenium concentrations

    PubMed Central

    Cornelis, Marilyn C.; Fornage, Myriam; Foy, Millennia; Xun, Pengcheng; Gladyshev, Vadim N.; Morris, Steve; Chasman, Daniel I.; Hu, Frank B.; Rimm, Eric B.; Kraft, Peter; Jordan, Joanne M.; Mozaffarian, Dariush; He, Ka

    2015-01-01

    Selenium (Se) is an essential trace element in human nutrition, but its role in certain health conditions, particularly among Se sufficient populations, is controversial. A genome-wide association study (GWAS) of blood Se concentrations previously identified a locus at 5q14 near BHMT. We performed a GW meta-analysis of toenail Se concentrations, which reflect a longer duration of exposure than blood Se concentrations, including 4162 European descendants from four US cohorts. Toenail Se was measured using neutron activation analysis. We identified a GW-significant locus at 5q14 (P < 1 × 10−16), the same locus identified in the published GWAS of blood Se based on independent cohorts. The lead single-nucleotide polymorphism (SNP) explained ∼1% of the variance in toenail Se concentrations. Using GW-summary statistics from both toenail and blood Se, we observed statistical evidence of polygenic overlap (P < 0.001) and meta-analysis of results from studies of either trait (n = 9639) yielded a second GW-significant locus at 21q22.3, harboring CBS (P < 4 × 10−8). Proteins encoded by genes at 5q14 and 21q22.3 function in homocysteine (Hcy) metabolism, and index SNPs for each have previously been associated with betaine and Hcy levels in GWAS. Our findings show evidence of a genetic link between Se and Hcy pathways, both involved in cardiometabolic disease. PMID:25343990

  1. Genome-wide association studies and infectious disease.

    PubMed

    Bowcock, Anne M

    2010-01-01

    The identification of genetic variants predisposing to complex diseases and phenotypes represent a challenge for geneticists in the early part of the 21st century. These are not simple Mendelian disorders caused by single mutations, such as cystic fibrosis or Huntington's disease, but common diseases that are usually polygenic in origin. The predisposing genes can be susceptibility factors or protective factors. One example of such a complex disease is the inflammatory skin disease psoriasis. However, another example could be protection from an infectious disease. Both of these phenotypes are due in part to the presence of low-risk variants in the host. Moreover, all of these complex phenotypes require environmental triggers as well and, in the case of infectious diseases, these are pathogens. In the case of other common diseases such as cardiovascular disease the triggers are often lifestyle-related issues such as diet or exercise. Genome-wide association studies are now identifying some of these genetic susceptibility factors. PMID:20370638

  2. A genome-wide association study in multiple system atrophy

    PubMed Central

    Sailer, Anna; Nalls, Michael A.; Schulte, Claudia; Federoff, Monica; Price, T. Ryan; Lees, Andrew; Ross, Owen A.; Dickson, Dennis W.; Mok, Kin; Mencacci, Niccolo E.; Schottlaender, Lucia; Chelban, Viorica; Ling, Helen; O'Sullivan, Sean S.; Wood, Nicholas W.; Traynor, Bryan J.; Ferrucci, Luigi; Federoff, Howard J.; Mhyre, Timothy R.; Morris, Huw R.; Deuschl, Günther; Quinn, Niall; Widner, Hakan; Albanese, Alberto; Infante, Jon; Bhatia, Kailash P.; Poewe, Werner; Oertel, Wolfgang; Höglinger, Günter U.; Wüllner, Ullrich; Goldwurm, Stefano; Pellecchia, Maria Teresa; Ferreira, Joaquim; Tolosa, Eduardo; Bloem, Bastiaan R.; Rascol, Olivier; Meissner, Wassilios G.; Hardy, John A.; Revesz, Tamas; Holton, Janice L.; Gasser, Thomas; Wenning, Gregor K.; Singleton, Andrew B.

    2016-01-01

    Objective: To identify genetic variants that play a role in the pathogenesis of multiple system atrophy (MSA), we undertook a genome-wide association study (GWAS). Methods: We performed a GWAS with >5 million genotyped and imputed single nucleotide polymorphisms (SNPs) in 918 patients with MSA of European ancestry and 3,864 controls. MSA cases were collected from North American and European centers, one third of which were neuropathologically confirmed. Results: We found no significant loci after stringent multiple testing correction. A number of regions emerged as potentially interesting for follow-up at p < 1 × 10−6, including SNPs in the genes FBXO47, ELOVL7, EDN1, and MAPT. Contrary to previous reports, we found no association of the genes SNCA and COQ2 with MSA. Conclusions: We present a GWAS in MSA. We have identified several potentially interesting gene loci, including the MAPT locus, whose significance will have to be evaluated in a larger sample set. Common genetic variation in SNCA and COQ2 does not seem to be associated with MSA. In the future, additional samples of well-characterized patients with MSA will need to be collected to perform a larger MSA GWAS, but this initial study forms the basis for these next steps. PMID:27629089

  3. Genome-Wide Association Studies of the Human Gut Microbiota.

    PubMed

    Davenport, Emily R; Cusanovich, Darren A; Michelini, Katelyn; Barreiro, Luis B; Ober, Carole; Gilad, Yoav

    2015-01-01

    The bacterial composition of the human fecal microbiome is influenced by many lifestyle factors, notably diet. It is less clear, however, what role host genetics plays in dictating the composition of bacteria living in the gut. In this study, we examined the association of ~200K host genotypes with the relative abundance of fecal bacterial taxa in a founder population, the Hutterites, during two seasons (n = 91 summer, n = 93 winter, n = 57 individuals collected in both). These individuals live and eat communally, minimizing variation due to environmental exposures, including diet, which could potentially mask small genetic effects. Using a GWAS approach that takes into account the relatedness between subjects, we identified at least 8 bacterial taxa whose abundances were associated with single nucleotide polymorphisms in the host genome in each season (at genome-wide FDR of 20%). For example, we identified an association between a taxon known to affect obesity (genus Akkermansia) and a variant near PLD1, a gene previously associated with body mass index. Moreover, we replicate a previously reported association from a quantitative trait locus (QTL) mapping study of fecal microbiome abundance in mice (genus Lactococcus, rs3747113, P = 3.13 x 10-7). Finally, based on the significance distribution of the associated microbiome QTLs in our study with respect to chromatin accessibility profiles, we identified tissues in which host genetic variation may be acting to influence bacterial abundance in the gut. PMID:26528553

  4. Genome-Wide Association Studies of the Human Gut Microbiota

    PubMed Central

    Davenport, Emily R.; Cusanovich, Darren A.; Michelini, Katelyn; Barreiro, Luis B.; Ober, Carole; Gilad, Yoav

    2015-01-01

    The bacterial composition of the human fecal microbiome is influenced by many lifestyle factors, notably diet. It is less clear, however, what role host genetics plays in dictating the composition of bacteria living in the gut. In this study, we examined the association of ~200K host genotypes with the relative abundance of fecal bacterial taxa in a founder population, the Hutterites, during two seasons (n = 91 summer, n = 93 winter, n = 57 individuals collected in both). These individuals live and eat communally, minimizing variation due to environmental exposures, including diet, which could potentially mask small genetic effects. Using a GWAS approach that takes into account the relatedness between subjects, we identified at least 8 bacterial taxa whose abundances were associated with single nucleotide polymorphisms in the host genome in each season (at genome-wide FDR of 20%). For example, we identified an association between a taxon known to affect obesity (genus Akkermansia) and a variant near PLD1, a gene previously associated with body mass index. Moreover, we replicate a previously reported association from a quantitative trait locus (QTL) mapping study of fecal microbiome abundance in mice (genus Lactococcus, rs3747113, P = 3.13 x 10−7). Finally, based on the significance distribution of the associated microbiome QTLs in our study with respect to chromatin accessibility profiles, we identified tissues in which host genetic variation may be acting to influence bacterial abundance in the gut. PMID:26528553

  5. Genome-Wide Mapping of Yeast RNA Polymerase II Termination

    PubMed Central

    Schaughency, Paul; Merran, Jonathan; Corden, Jeffry L.

    2014-01-01

    Yeast RNA polymerase II (Pol II) terminates transcription of coding transcripts through the polyadenylation (pA) pathway and non-coding transcripts through the non-polyadenylation (non-pA) pathway. We have used PAR-CLIP to map the position of Pol II genome-wide in living yeast cells after depletion of components of either the pA or non-pA termination complexes. We show here that Ysh1, responsible for cleavage at the pA site, is required for efficient removal of Pol II from the template. Depletion of Ysh1 from the nucleus does not, however, lead to readthrough transcription. In contrast, depletion of the termination factor Nrd1 leads to widespread runaway elongation of non-pA transcripts. Depletion of Sen1 also leads to readthrough at non-pA terminators, but in contrast to Nrd1, this readthrough is less processive, or more susceptible to pausing. The data presented here provide delineation of in vivo Pol II termination regions and highlight differences in the sequences that signal termination of different classes of non-pA transcripts. PMID:25299594

  6. Assessing Predictive Properties of Genome-Wide Selection in Soybeans.

    PubMed

    Xavier, Alencar; Muir, William M; Rainey, Katy Martin

    2016-01-01

    Many economically important traits in plant breeding have low heritability or are difficult to measure. For these traits, genomic selection has attractive features and may boost genetic gains. Our goal was to evaluate alternative scenarios to implement genomic selection for yield components in soybean (Glycine max L. merr). We used a nested association panel with cross validation to evaluate the impacts of training population size, genotyping density, and prediction model on the accuracy of genomic prediction. Our results indicate that training population size was the factor most relevant to improvement in genome-wide prediction, with greatest improvement observed in training sets up to 2000 individuals. We discuss assumptions that influence the choice of the prediction model. Although alternative models had minor impacts on prediction accuracy, the most robust prediction model was the combination of reproducing kernel Hilbert space regression and BayesB. Higher genotyping density marginally improved accuracy. Our study finds that breeding programs seeking efficient genomic selection in soybeans would best allocate resources by investing in a representative training set. PMID:27317786

  7. Comparative analysis of methods for genome-wide nucleosome cartography.

    PubMed

    Quintales, Luis; Vázquez, Enrique; Antequera, Francisco

    2015-07-01

    Nucleosomes contribute to compacting the genome into the nucleus and regulate the physical access of regulatory proteins to DNA either directly or through the epigenetic modifications of the histone tails. Precise mapping of nucleosome positioning across the genome is, therefore, essential to understanding the genome regulation. In recent years, several experimental protocols have been developed for this purpose that include the enzymatic digestion, chemical cleavage or immunoprecipitation of chromatin followed by next-generation sequencing of the resulting DNA fragments. Here, we compare the performance and resolution of these methods from the initial biochemical steps through the alignment of the millions of short-sequence reads to a reference genome to the final computational analysis to generate genome-wide maps of nucleosome occupancy. Because of the lack of a unified protocol to process data sets obtained through the different approaches, we have developed a new computational tool (NUCwave), which facilitates their analysis, comparison and assessment and will enable researchers to choose the most suitable method for any particular purpose. NUCwave is freely available at http://nucleosome.usal.es/nucwave along with a step-by-step protocol for its use.

  8. Evolution of mate choice for genome-wide heterozygosity.

    PubMed

    Fromhage, Lutz; Kokko, Hanna; Reid, Jane M

    2009-03-01

    The extent to which indirect genetic benefits can drive the evolution of directional mating preferences for more ornamented mates, and the mechanisms that maintain such preferences without depleting genetic variance, remain key questions in evolutionary ecology. We used an individual-based genetic model to examine whether a directional preference for mates with higher genome-wide heterozygosity (H), and consequently greater ornamentation, could evolve and be maintained in the absence of direct fitness benefits of mate choice. We specifically considered finite populations of varying size and spatial genetic structure, in which parent-offspring resemblance in heterozygosity could provide an indirect benefit of mate choice. A directional preference for heterozygous mates evolved under broad conditions, even given a substantial direct cost of mate choice, low mutation rate, and stochastic variation in the link between individual heterozygosity and ornamentation. Furthermore, genetic variance was retained under directional sexual selection. Preference evolution was strongest in smaller populations, but weaker in populations with greater internal genetic structure in which restricted dispersal increased local inbreeding among offspring of neighboring females that all preferentially mated with the same male. These results suggest that directional preferences for heterozygous or outbred mates could evolve and be maintained in finite populations in the absence of direct fitness benefits, suggesting a novel resolution to the lek paradox.

  9. Genome-wide significant risk associations for mucinous ovarian carcinoma

    PubMed Central

    Kelemen, Linda E.; Lawrenson, Kate; Tyrer, Jonathan; Li, Qiyuan; M. Lee, Janet; Seo, Ji-Heui; Phelan, Catherine M.; Beesley, Jonathan; Chen, Xiaoqin; Spindler, Tassja J.; Aben, Katja K.H.; Anton-Culver, Hoda; Antonenkova, Natalia; Baker, Helen; Bandera, Elisa V.; Bean, Yukie; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bruinsma, Fiona; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Chen, Y. Ann; Chen, Zhihua; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; Dennis, Joe; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; du Bois, Andreas; Dürst, Matthias; Eccles, Diana; Easton, Douglas T.; Edwards, Robert P.; Eilber, Ursula; Ekici, Arif B.; Engelholm, Svend Aage; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goode, Ellen L.; Goodman, Marc T.; Grownwald, Jacek; Harrington, Patricia; Harter, Philipp; Hasmad, Hanis Nazihah; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A.T.; Hillemanns, Peter; Hogdall, Estrid; Hogdall, Claus; Hosono, Satoyo; Iversen, Edwin S.; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y; Kellar, Melissa; Kelley, Joseph L.; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Iain; Menon, Usha; Modugno, Francesmary; Moes-Sosnowska, Joanna; Moysich, Kirsten B.; Narod, Steven A.; Nedergaard, Lotte; Ness, Roberta B.; Nevanlinna, Heli; Azmi, Mat Adenan Noor; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste Leigh; Pejovic, Tanja; Pelttari, Liisa M.; Permuth-Wey, Jennifer; Pike, Malcolm C.; Poole, Elizabeth M.; Ramus, Susan J.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schildkraut, Joellen M.; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Sucheston, Lara; Tangen, Ingvild L.; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J; Tworoger, Shelley S.; van Altena, Anne M.; Van Nieuwenhuysen, Els; Vergote, Ignace; Vierkant, Robert A.; Wang-Gohrke, Shan; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wlodzimierz, Sawicki; Woo, Yin-Ling; Wu, Xifeng; Wu, Anna H.; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Sellers, Thomas A.; Freedman, Matthew L.; Chenevix-Trench, Georgia; Pharoah, Paul D.; Gayther, Simon A.; Berchuck, Andrew

    2015-01-01

    Genome-wide association studies have identified several risk associations for ovarian carcinomas (OC) but not for mucinous ovarian carcinomas (MOC). Genotypes from OC cases and controls were imputed into the 1000 Genomes Project reference panel. Analysis of 1,644 MOC cases and 21,693 controls identified three novel risk associations: rs752590 at 2q13 (P = 3.3 × 10−8), rs711830 at 2q31.1 (P = 7.5 × 10−12) and rs688187 at 19q13.2 (P = 6.8 × 10−13). Expression Quantitative Trait Locus (eQTL) analysis in ovarian and colorectal tumors (which are histologically similar to MOC) identified significant eQTL associations for HOXD9 at 2q31.1 in ovarian (P = 4.95 × 10−4, FDR = 0.003) and colorectal (P = 0.01, FDR = 0.09) tumors, and for PAX8 at 2q13 in colorectal tumors (P = 0.03, FDR = 0.09). Chromosome conformation capture analysis identified interactions between the HOXD9 promoter and risk SNPs at 2q31.1. Overexpressing HOXD9 in MOC cells augmented the neoplastic phenotype. These findings provide the first evidence for MOC susceptibility variants and insights into the underlying biology of the disease. PMID:26075790

  10. Genome-Wide Silencing in Drosophila Captures Conserved Apoptotic Effectors

    PubMed Central

    Chew, Su Kit; Chen, Po; Link, Nichole; Galindo, Kathleen A.; Pogue, Kristi; Abrams, John M.

    2009-01-01

    Summary Apoptosis is a conserved form of programmed cell death (PCD) firmly established in the etiology, pathogenesis and treatment of many human diseases. Central to the core machinery of apoptosis are the caspases and their proximal regulators. Current models for caspase control envision a balance of opposing elements, with variable contributions from positive regulators and negative regulators among different cell types and species1. To advance a comprehensive view of components that support caspase-dependent cell death, we conducted a genome-wide silencing screen in the Drosophila model. Our strategy combined a library of dsRNAs together with a chemical antagonist of Inhibitor of Apoptosis Proteins (IAPs) that simulates the action of native regulators in the Reaper/Smac family2. A highly validated set of targets necessary for death provoked by multiple stimuli was identified. Among these, Tango7 is advanced here as a novel effector. Cells depleted for this gene resisted apoptosis at a step prior to induction of effector caspase activity and directed silencing of Tango7 in the animal prevented caspase-dependent PCD. Unlike known apoptosis regulators in this model3, Tango7 activity did not influence stimulus-dependent loss of Drosophila IAP1 (DIAP1) but, instead, regulated levels of the apical caspase Dronc. Likewise, the human Tango7 counterpart, PCID1, similarly impinged on caspase 9, revealing a novel regulatory axis impacting the apoptosome. PMID:19483676

  11. Genome-Wide Analysis of Human Metapneumovirus Evolution

    PubMed Central

    Kim, Jin Il; Park, Sehee; Lee, Ilseob; Park, Kwang Sook; Kwak, Eun Jung; Moon, Kwang Mee; Lee, Chang Kyu; Bae, Joon-Yong; Park, Man-Seong; Song, Ki-Joon

    2016-01-01

    Human metapneumovirus (HMPV) has been described as an important etiologic agent of upper and lower respiratory tract infections, especially in young children and the elderly. Most of school-aged children might be introduced to HMPVs, and exacerbation with other viral or bacterial super-infection is common. However, our understanding of the molecular evolution of HMPVs remains limited. To address the comprehensive evolutionary dynamics of HMPVs, we report a genome-wide analysis of the eight genes (N, P, M, F, M2, SH, G, and L) using 103 complete genome sequences. Phylogenetic reconstruction revealed that the eight genes from one HMPV strain grouped into the same genetic group among the five distinct lineages (A1, A2a, A2b, B1, and B2). A few exceptions of phylogenetic incongruence might suggest past recombination events, and we detected possible recombination breakpoints in the F, SH, and G coding regions. The five genetic lineages of HMPVs shared quite remote common ancestors ranging more than 220 to 470 years of age with the most recent origins for the A2b sublineage. Purifying selection was common, but most protein genes except the F and M2-2 coding regions also appeared to experience episodic diversifying selection. Taken together, these suggest that the five lineages of HMPVs maintain their individual evolutionary dynamics and that recombination and selection forces might work on shaping the genetic diversity of HMPVs. PMID:27046055

  12. Genome-wide association study of aggressive behaviour in chicken

    PubMed Central

    Li, Zhenhui; Zheng, Ming; Abdalla, Bahareldin Ali; Zhang, Zhe; Xu, Zhenqiang; Ye, Qiao; Xu, Haiping; Luo, Wei; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    In the poultry industry, aggressive behaviour is a large animal welfare issue all over the world. To date, little is known about the underlying genetics of the aggressive behaviour. Here, we performed a genome-wide association study (GWAS) to explore the genetic mechanism associated with aggressive behaviour in chickens. The GWAS results showed that a total of 33 SNPs were associated with aggressive behaviour traits (P < 4.6E-6). rs312463697 on chromosome 4 was significantly associated with aggression (P = 2.10905E-07), and it was in the intron region of the sortilin-related VPS10 domain containing receptor 2 (SORCS2) gene. In addition, biological function analysis of the nearest 26 genes around the significant SNPs was performed with Ingenuity Pathway Analysis. An interaction network contained 17 genes was obtained and SORCS2 was involved in this network, interacted with nerve growth factor (NGF), nerve growth factor receptor (NGFR), dopa decarboxylase (L-dopa) and dopamine. After knockdown of SORCS2, the mRNA levels of NGF, L-dopa and dopamine receptor genes DRD1, DRD2, DRD3 and DRD4 were significantly decreased (P < 0.05). In summary, our data indicated that SORCS2 might play an important role in chicken aggressive behaviour through the regulation of dopaminergic pathways and NGF. PMID:27485826

  13. Genome-wide association study of aggressive behaviour in chicken.

    PubMed

    Li, Zhenhui; Zheng, Ming; Abdalla, Bahareldin Ali; Zhang, Zhe; Xu, Zhenqiang; Ye, Qiao; Xu, Haiping; Luo, Wei; Nie, Qinghua; Zhang, Xiquan

    2016-08-03

    In the poultry industry, aggressive behaviour is a large animal welfare issue all over the world. To date, little is known about the underlying genetics of the aggressive behaviour. Here, we performed a genome-wide association study (GWAS) to explore the genetic mechanism associated with aggressive behaviour in chickens. The GWAS results showed that a total of 33 SNPs were associated with aggressive behaviour traits (P < 4.6E-6). rs312463697 on chromosome 4 was significantly associated with aggression (P = 2.10905E-07), and it was in the intron region of the sortilin-related VPS10 domain containing receptor 2 (SORCS2) gene. In addition, biological function analysis of the nearest 26 genes around the significant SNPs was performed with Ingenuity Pathway Analysis. An interaction network contained 17 genes was obtained and SORCS2 was involved in this network, interacted with nerve growth factor (NGF), nerve growth factor receptor (NGFR), dopa decarboxylase (L-dopa) and dopamine. After knockdown of SORCS2, the mRNA levels of NGF, L-dopa and dopamine receptor genes DRD1, DRD2, DRD3 and DRD4 were significantly decreased (P < 0.05). In summary, our data indicated that SORCS2 might play an important role in chicken aggressive behaviour through the regulation of dopaminergic pathways and NGF.

  14. Genome-wide association studies in pharmacogenetics research debate

    PubMed Central

    Bailey, Kent R; Cheng, Cheng

    2016-01-01

    Will genome-wide association studies (GWAS) ‘work’ for pharmacogenetics research? This question was the topic of a staged debate, with pro and con sides, aimed to bring out the strengths and weaknesses of GWAS for pharmacogenetics studies. After a full day of seminars at the Fifth Statistical Analysis Workshop of the Pharmacogenetics Research Network, the lively debate was held – appropriately – at Goonies Comedy Club in Rochester (MN, USA). The pro side emphasized that the many GWAS successes for identifying genetic variants associated with disease risk show that it works; that the current genotyping platforms are efficient, with good imputation methods to fill in missing data; that its global assessment is always a success even if no significant associations are detected; and that genetic effects are likely to be large because humans have not evolved in a drug-therapy environment. By contrast, the con side emphasized that we have limited knowledge of the complexity of the genome; limited clinical phenotypes compromise studies; the likely multifactorial nature of drug response clouding the small genetic effects; and limitations of sample size and replication studies in pharmacogenetic studies. Lively and insightful discussions emphasized further research efforts that might benefit GWAS in pharmacogenetics. PMID:20235786

  15. Genome-wide association study of aggressive behaviour in chicken.

    PubMed

    Li, Zhenhui; Zheng, Ming; Abdalla, Bahareldin Ali; Zhang, Zhe; Xu, Zhenqiang; Ye, Qiao; Xu, Haiping; Luo, Wei; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    In the poultry industry, aggressive behaviour is a large animal welfare issue all over the world. To date, little is known about the underlying genetics of the aggressive behaviour. Here, we performed a genome-wide association study (GWAS) to explore the genetic mechanism associated with aggressive behaviour in chickens. The GWAS results showed that a total of 33 SNPs were associated with aggressive behaviour traits (P < 4.6E-6). rs312463697 on chromosome 4 was significantly associated with aggression (P = 2.10905E-07), and it was in the intron region of the sortilin-related VPS10 domain containing receptor 2 (SORCS2) gene. In addition, biological function analysis of the nearest 26 genes around the significant SNPs was performed with Ingenuity Pathway Analysis. An interaction network contained 17 genes was obtained and SORCS2 was involved in this network, interacted with nerve growth factor (NGF), nerve growth factor receptor (NGFR), dopa decarboxylase (L-dopa) and dopamine. After knockdown of SORCS2, the mRNA levels of NGF, L-dopa and dopamine receptor genes DRD1, DRD2, DRD3 and DRD4 were significantly decreased (P < 0.05). In summary, our data indicated that SORCS2 might play an important role in chicken aggressive behaviour through the regulation of dopaminergic pathways and NGF. PMID:27485826

  16. Genome-Wide Analysis of Polyadenylation Events in Schmidtea mediterranea

    PubMed Central

    Lakshmanan, Vairavan; Bansal, Dhiru; Kulkarni, Jahnavi; Poduval, Deepak; Krishna, Srikar; Sasidharan, Vidyanand; Anand, Praveen; Seshasayee, Aswin; Palakodeti, Dasaradhi

    2016-01-01

    In eukaryotes, 3′ untranslated regions (UTRs) play important roles in regulating posttranscriptional gene expression. The 3′UTR is defined by regulated cleavage/polyadenylation of the pre-mRNA. The advent of next-generation sequencing technology has now enabled us to identify these events on a genome-wide scale. In this study, we used poly(A)-position profiling by sequencing (3P-Seq) to capture all poly(A) sites across the genome of the freshwater planarian, Schmidtea mediterranea, an ideal model system for exploring the process of regeneration and stem cell function. We identified the 3′UTRs for ∼14,000 transcripts and thus improved the existing gene annotations. We found 97 transcripts, which are polyadenylated within an internal exon, resulting in the shrinking of the ORF and loss of a predicted protein domain. Around 40% of the transcripts in planaria were alternatively polyadenylated (ApA), resulting either in an altered 3′UTR or a change in coding sequence. We identified specific ApA transcript isoforms that were subjected to miRNA mediated gene regulation using degradome sequencing. In this study, we also confirmed a tissue-specific expression pattern for alternate polyadenylated transcripts. The insights from this study highlight the potential role of ApA in regulating the gene expression essential for planarian regeneration. PMID:27489207

  17. Genome-Wide Discriminatory Information Patterns of Cytosine DNA Methylation

    PubMed Central

    Sanchez, Robersy; Mackenzie, Sally A.

    2016-01-01

    Cytosine DNA methylation (CDM) is a highly abundant, heritable but reversible chemical modification to the genome. Herein, a machine learning approach was applied to analyze the accumulation of epigenetic marks in methylomes of 152 ecotypes and 85 silencing mutants of Arabidopsis thaliana. In an information-thermodynamics framework, two measurements were used: (1) the amount of information gained/lost with the CDM changes IR and (2) the uncertainty of not observing a SNP LCR. We hypothesize that epigenetic marks are chromosomal footprints accounting for different ontogenetic and phylogenetic histories of individual populations. A machine learning approach is proposed to verify this hypothesis. Results support the hypothesis by the existence of discriminatory information (DI) patterns of CDM able to discriminate between individuals and between individual subpopulations. The statistical analyses revealed a strong association between the topologies of the structured population of Arabidopsis ecotypes based on IR and on LCR, respectively. A statistical-physical relationship between IR and LCR was also found. Results to date imply that the genome-wide distribution of CDM changes is not only part of the biological signal created by the methylation regulatory machinery, but ensures the stability of the DNA molecule, preserving the integrity of the genetic message under continuous stress from thermal fluctuations in the cell environment. PMID:27322251

  18. How to interpret a genome-wide association study.

    PubMed

    Pearson, Thomas A; Manolio, Teri A

    2008-03-19

    Genome-wide association (GWA) studies use high-throughput genotyping technologies to assay hundreds of thousands of single-nucleotide polymorphisms (SNPs) and relate them to clinical conditions and measurable traits. Since 2005, nearly 100 loci for as many as 40 common diseases and traits have been identified and replicated in GWA studies, many in genes not previously suspected of having a role in the disease under study, and some in genomic regions containing no known genes. GWA studies are an important advance in discovering genetic variants influencing disease but also have important limitations, including their potential for false-positive and false-negative results and for biases related to selection of study participants and genotyping errors. Although these studies are clearly many steps removed from actual clinical use, and specific applications of GWA findings in prevention and treatment are actively being pursued, at present these studies mainly represent a valuable discovery tool for examining genomic function and clarifying pathophysiologic mechanisms. This article describes the design, interpretation, application, and limitations of GWA studies for clinicians and scientists for whom this evolving science may have great relevance.

  19. GWAPP: A Web Application for Genome-Wide Association Mapping in Arabidopsis[W][OA

    PubMed Central

    Seren, Ümit; Vilhjálmsson, Bjarni J.; Horton, Matthew W.; Meng, Dazhe; Forai, Petar; Huang, Yu S.; Long, Quan; Segura, Vincent; Nordborg, Magnus

    2012-01-01

    Arabidopsis thaliana is an important model organism for understanding the genetics and molecular biology of plants. Its highly selfing nature, small size, short generation time, small genome size, and wide geographic distribution make it an ideal model organism for understanding natural variation. Genome-wide association studies (GWAS) have proven a useful technique for identifying genetic loci responsible for natural variation in A. thaliana. Previously genotyped accessions (natural inbred lines) can be grown in replicate under different conditions and phenotyped for different traits. These important features greatly simplify association mapping of traits and allow for systematic dissection of the genetics of natural variation by the entire A. thaliana community. To facilitate this, we present GWAPP, an interactive Web-based application for conducting GWAS in A. thaliana. Using an efficient implementation of a linear mixed model, traits measured for a subset of 1386 publicly available ecotypes can be uploaded and mapped with a mixed model and other methods in just a couple of minutes. GWAPP features an extensive, interactive, and user-friendly interface that includes interactive Manhattan plots and linkage disequilibrium plots. It also facilitates exploratory data analysis by implementing features such as the inclusion of candidate polymorphisms in the model as cofactors. PMID:23277364

  20. Genome-wide and fine-resolution association analysis of malaria in West Africa.

    PubMed

    Jallow, Muminatou; Teo, Yik Ying; Small, Kerrin S; Rockett, Kirk A; Deloukas, Panos; Clark, Taane G; Kivinen, Katja; Bojang, Kalifa A; Conway, David J; Pinder, Margaret; Sirugo, Giorgio; Sisay-Joof, Fatou; Usen, Stanley; Auburn, Sarah; Bumpstead, Suzannah J; Campino, Susana; Coffey, Alison; Dunham, Andrew; Fry, Andrew E; Green, Angela; Gwilliam, Rhian; Hunt, Sarah E; Inouye, Michael; Jeffreys, Anna E; Mendy, Alieu; Palotie, Aarno; Potter, Simon; Ragoussis, Jiannis; Rogers, Jane; Rowlands, Kate; Somaskantharajah, Elilan; Whittaker, Pamela; Widden, Claire; Donnelly, Peter; Howie, Bryan; Marchini, Jonathan; Morris, Andrew; SanJoaquin, Miguel; Achidi, Eric Akum; Agbenyega, Tsiri; Allen, Angela; Amodu, Olukemi; Corran, Patrick; Djimde, Abdoulaye; Dolo, Amagana; Doumbo, Ogobara K; Drakeley, Chris; Dunstan, Sarah; Evans, Jennifer; Farrar, Jeremy; Fernando, Deepika; Hien, Tran Tinh; Horstmann, Rolf D; Ibrahim, Muntaser; Karunaweera, Nadira; Kokwaro, Gilbert; Koram, Kwadwo A; Lemnge, Martha; Makani, Julie; Marsh, Kevin; Michon, Pascal; Modiano, David; Molyneux, Malcolm E; Mueller, Ivo; Parker, Michael; Peshu, Norbert; Plowe, Christopher V; Puijalon, Odile; Reeder, John; Reyburn, Hugh; Riley, Eleanor M; Sakuntabhai, Anavaj; Singhasivanon, Pratap; Sirima, Sodiomon; Tall, Adama; Taylor, Terrie E; Thera, Mahamadou; Troye-Blomberg, Marita; Williams, Thomas N; Wilson, Michael; Kwiatkowski, Dominic P

    2009-06-01

    We report a genome-wide association (GWA) study of severe malaria in The Gambia. The initial GWA scan included 2,500 children genotyped on the Affymetrix 500K GeneChip, and a replication study included 3,400 children. We used this to examine the performance of GWA methods in Africa. We found considerable population stratification, and also that signals of association at known malaria resistance loci were greatly attenuated owing to weak linkage disequilibrium (LD). To investigate possible solutions to the problem of low LD, we focused on the HbS locus, sequencing this region of the genome in 62 Gambian individuals and then using these data to conduct multipoint imputation in the GWA samples. This increased the signal of association, from P = 4 × 10(-7) to P = 4 × 10(-14), with the peak of the signal located precisely at the HbS causal variant. Our findings provide proof of principle that fine-resolution multipoint imputation, based on population-specific sequencing data, can substantially boost authentic GWA signals and enable fine mapping of causal variants in African populations. PMID:19465909

  1. Genome-wide analysis of chromatin packing in Arabidopsis thaliana at single-gene resolution

    PubMed Central

    Liu, Chang; Wang, Congmao; Wang, George; Becker, Claude; Zaidem, Maricris; Weigel, Detlef

    2016-01-01

    The three-dimensional packing of the genome plays an important role in regulating gene expression. We have used Hi-C, a genome-wide chromatin conformation capture (3C) method, to analyze Arabidopsis thaliana chromosomes dissected into subkilobase segments, which is required for gene-level resolution in this species with a gene-dense genome. We found that the repressive H3K27me3 histone mark is overrepresented in the promoter regions of genes that are in conformational linkage over long distances. In line with the globally dispersed distribution of RNA polymerase II in A. thaliana nuclear space, actively transcribed genes do not show a strong tendency to associate with each other. In general, there are often contacts between 5′ and 3′ ends of genes, forming local chromatin loops. Such self-loop structures of genes are more likely to occur in more highly expressed genes, although they can also be found in silent genes. Silent genes with local chromatin loops are highly enriched for the histone variant H3.3 at their 5′ and 3′ ends but depleted of repressive marks such as heterochromatic histone modifications and DNA methylation in flanking regions. Our results suggest that, different from animals, a major theme of genome folding in A. thaliana is the formation of structural units that correspond to gene bodies. PMID:27225844

  2. Genome-wide characterization of genetic variation in the unicellular, green alga Chlamydomonas reinhardtii.

    PubMed

    Jang, Hyosik; Ehrenreich, Ian M

    2012-01-01

    Chlamydomonas reinhardtii is a model system for studying cilia, photosynthesis, and other core features of eukaryotes, and is also an emerging source of biofuels. Despite its importance to basic and applied biological research, the level and pattern of genetic variation in this haploid green alga has yet to be characterized on a genome-wide scale. To improve understanding of C. reinhardtii's genetic variability, we generated low coverage whole genome resequencing data for nearly all of the available isolates of this species, which were sampled from a number of sites in North America over the past ∼70 years. Based on the analysis of more than 62,000 single nucleotide polymorphisms, we identified two groups of isolates that represent geographical subpopulations of the species. We also found that measurements of genetic diversity were highly variable throughout the genome, in part due to technical factors. We studied the level and pattern of linkage disequilibrium (LD), and observed one chromosome that exhibits elevated LD. Furthermore, we detected widespread evidence of recombination across the genome, which implies that outcrossing occurs in natural populations of this species. In summary, our study provides multiple insights into the sequence diversity of C. reinhardtii that will be useful to future studies of natural genetic variation in this organism.

  3. Genome-wide association study of behavioral, physiological and gene expression traits in outbred CFW mice.

    PubMed

    Parker, Clarissa C; Gopalakrishnan, Shyam; Carbonetto, Peter; Gonzales, Natalia M; Leung, Emily; Park, Yeonhee J; Aryee, Emmanuel; Davis, Joe; Blizard, David A; Ackert-Bicknell, Cheryl L; Lionikas, Arimantas; Pritchard, Jonathan K; Palmer, Abraham A

    2016-08-01

    Although mice are the most widely used mammalian model organism, genetic studies have suffered from limited mapping resolution due to extensive linkage disequilibrium (LD) that is characteristic of crosses among inbred strains. Carworth Farms White (CFW) mice are a commercially available outbred mouse population that exhibit rapid LD decay in comparison to other available mouse populations. We performed a genome-wide association study (GWAS) of behavioral, physiological and gene expression phenotypes using 1,200 male CFW mice. We used genotyping by sequencing (GBS) to obtain genotypes at 92,734 SNPs. We also measured gene expression using RNA sequencing in three brain regions. Our study identified numerous behavioral, physiological and expression quantitative trait loci (QTLs). We integrated the behavioral QTL and eQTL results to implicate specific genes, including Azi2 in sensitivity to methamphetamine and Zmynd11 in anxiety-like behavior. The combination of CFW mice, GBS and RNA sequencing constitutes a powerful approach to GWAS in mice. PMID:27376237

  4. A genome-wide association analysis for susceptibility of pigs to enterotoxigenic Escherichia coli F41.

    PubMed

    Ji, H Y; Yang, B; Zhang, Z Y; Ouyang, J; Yang, M; Zhang, X F; Zhang, W C; Su, Y; Zhao, K W; Xiao, S J; Yan, X M; Ren, J; Huang, L S

    2016-10-01

    Enterotoxigenic Escherichia coli (ETEC) is a type of pathogenic bacteria that cause diarrhea in piglets through colonizing pig small intestine epithelial cells by their surface fimbriae. Different fimbriae type of ETEC including F4, F18, K99 and F41 have been isolated from diarrheal pigs. In this study, we performed a genome-wide association study to map the loci associated with the susceptibility of pigs to ETEC F41 using 39454 single nucleotide polymorphisms (SNPs) in 667 F2 pigs from a White Duroc×Erhualian F2 cross. The most significant SNP (ALGA0022658, P=5.59×10-13) located at 6.95 Mb on chromosome 4. ALGA0022658 was in high linkage disequilibrium (r 2>0.5) with surrounding SNPs that span a 1.21 Mb interval. Within this 1.21 Mb region, we investigated ZFAT as a positional candidate gene. We re-sequenced cDNA of ZFAT in four pigs with different susceptibility phenotypes, and identified seven coding variants. We genotyped these seven variants in 287 unrelated pigs from 15 diverse breeds that were measured with ETEC F41 susceptibility phenotype. Five variants showed nominal significant association (P<0.05) with ETEC F41 susceptibility phenotype in International commercial pigs. This study provided refined region associated with susceptibility of pigs to ETEC F41 than that reported previously. Further works are needed to uncover the underlying causal mutation(s).

  5. Informative Bayesian Model Selection: a method for identifying interactions in genome-wide data.

    PubMed

    Aflakparast, Mehran; Masoudi-Nejad, Ali; Bozorgmehr, Joseph H; Visweswaran, Shyam

    2014-10-01

    In high-dimensional genome-wide (GWA) data, a key challenge is to detect genomic variants that interact in a nonlinear fashion in their association with disease. Identifying such genomic interactions is important for elucidating the inheritance of complex phenotypes and diseases. In this paper, we introduce a new computational method called Informative Bayesian Model Selection (IBMS) that leverages correlation among variants in GWA data due to the linkage disequilibrium to identify interactions accurately in a computationally efficient manner. IBMS combines several statistical methods including canonical correlation analysis, logistic regression analysis, and a Bayesians statistical measure of evaluating interactions. Compared to BOOST and BEAM that are two widely used methods for detecting genomic interactions, IBMS had significantly higher power when evaluated on synthetic data. Furthermore, when applied to Alzheimer's disease GWA data, IBMS identified previously reported interactions. IBMS is a useful method for identifying variants in GWA data, and software that implements IBMS is freely available online from http://lbb.ut.ac.ir/Download/LBBsoft/IBMS.

  6. Genome-Wide Analysis of Branched-Chain Amino Acid Levels in Arabidopsis Seeds[W

    PubMed Central

    Angelovici, Ruthie; Lipka, Alexander E.; Deason, Nicholas; Gonzalez-Jorge, Sabrina; Lin, Haining; Cepela, Jason; Buell, Robin; Gore, Michael A.; DellaPenna, Dean

    2013-01-01

    Branched-chain amino acids (BCAAs) are three of the nine essential amino acids in human and animal diets and are important for numerous processes in development and growth. However, seed BCAA levels in major crops are insufficient to meet dietary requirements, making genetic improvement for increased and balanced seed BCAAs an important nutritional target. Addressing this issue requires a better understanding of the genetics underlying seed BCAA content and composition. Here, a genome-wide association study and haplotype analysis for seed BCAA traits in Arabidopsis thaliana revealed a strong association with a chromosomal interval containing two BRANCHED-CHAIN AMINO ACID TRANSFERASES, BCAT1 and BCAT2. Linkage analysis, reverse genetic approaches, and molecular complementation analysis demonstrated that allelic variation at BCAT2 is responsible for the natural variation of seed BCAAs in this interval. Complementation analysis of a bcat2 null mutant with two significantly different alleles from accessions Bayreuth-0 and Shahdara is consistent with BCAT2 contributing to natural variation in BCAA levels, glutamate recycling, and free amino acid homeostasis in seeds in an allele-dependent manner. The seed-specific phenotype of bcat2 null alleles, its strong transcription induction during late seed development, and its subcellular localization to the mitochondria are consistent with a unique, catabolic role for BCAT2 in BCAA metabolism in seeds. PMID:24368787

  7. Extensive genome-wide autozygosity in the population isolates of Daghestan

    PubMed Central

    Karafet, Tatiana M; Bulayeva, Kazima B; Bulayev, Oleg A; Gurgenova, Farida; Omarova, Jamilia; Yepiskoposyan, Levon; Savina, Olga V; Veeramah, Krishna R; Hammer, Michael F

    2015-01-01

    Isolated populations are valuable resources for mapping disease genes, as inbreeding increases genome-wide homozygosity and enhances the ability to map disease alleles on a genetically uniform background within a relatively homogenous environment. The populations of Daghestan are thought to have resided in the Caucasus Mountains for hundreds of generations and are characterized by a high prevalence of certain complex diseases. To explore the extent to which their unique population history led to increased levels of inbreeding, we genotyped >550 000 autosomal single-nucleotide polymorphisms (SNPs) in a set of 14 population isolates speaking Nakh-Daghestanian (ND) languages. The ND-speaking populations showed greatly elevated coefficients of inbreeding, very high numbers and long lengths of Runs of Homozygosity, and elevated linkage disequilibrium compared with surrounding groups from the Caucasus, the Near East, Europe, Central and South Asia. These results are consistent with the hypothesis that most ND-speaking groups descend from a common ancestral population that fragmented into a series of genetic isolates in the Daghestanian highlands. They have subsequently maintained a long-term small effective population size as a result of constant inbreeding and very low levels of gene flow. Given these findings, Daghestanian population isolates are likely to be useful for mapping genes associated with complex diseases. PMID:25604856

  8. A Genome-Wide Association Study Identifies Multiple Regions Associated with Head Size in Catfish

    PubMed Central

    Geng, Xin; Liu, Shikai; Yao, Jun; Bao, Lisui; Zhang, Jiaren; Li, Chao; Wang, Ruijia; Sha, Jin; Zeng, Peng; Zhi, Degui; Liu, Zhanjiang

    2016-01-01

    Skull morphology is fundamental to evolution and the biological adaptation of species to their environments. With aquaculture fish species, head size is also important for economic reasons because it has a direct impact on fillet yield. However, little is known about the underlying genetic basis of head size. Catfish is the primary aquaculture species in the United States. In this study, we performed a genome-wide association study using the catfish 250K SNP array with backcross hybrid catfish to map the QTL for head size (head length, head width, and head depth). One significantly associated region on linkage group (LG) 7 was identified for head length. In addition, LGs 7, 9, and 16 contain suggestively associated regions for head length. For head width, significantly associated regions were found on LG9, and additional suggestively associated regions were identified on LGs 5 and 7. No region was found associated with head depth. Head size genetic loci were mapped in catfish to genomic regions with candidate genes involved in bone development. Comparative analysis indicated that homologs of several candidate genes are also involved in skull morphology in various other species ranging from amphibian to mammalian species, suggesting possible evolutionary conservation of those genes in the control of skull morphologies. PMID:27558670

  9. Scalable privacy-preserving data sharing methodology for genome-wide association studies.

    PubMed

    Yu, Fei; Fienberg, Stephen E; Slavković, Aleksandra B; Uhler, Caroline

    2014-08-01

    The protection of privacy of individual-level information in genome-wide association study (GWAS) databases has been a major concern of researchers following the publication of "an attack" on GWAS data by Homer et al. (2008). Traditional statistical methods for confidentiality and privacy protection of statistical databases do not scale well to deal with GWAS data, especially in terms of guarantees regarding protection from linkage to external information. The more recent concept of differential privacy, introduced by the cryptographic community, is an approach that provides a rigorous definition of privacy with meaningful privacy guarantees in the presence of arbitrary external information, although the guarantees may come at a serious price in terms of data utility. Building on such notions, Uhler et al. (2013) proposed new methods to release aggregate GWAS data without compromising an individual's privacy. We extend the methods developed in Uhler et al. (2013) for releasing differentially-private χ(2)-statistics by allowing for arbitrary number of cases and controls, and for releasing differentially-private allelic test statistics. We also provide a new interpretation by assuming the controls' data are known, which is a realistic assumption because some GWAS use publicly available data as controls. We assess the performance of the proposed methods through a risk-utility analysis on a real data set consisting of DNA samples collected by the Wellcome Trust Case Control Consortium and compare the methods with the differentially-private release mechanism proposed by Johnson and Shmatikov (2013).

  10. Genetics of human stature: Lessons from genome-wide association studies.

    PubMed

    Perola, Markus

    2011-01-01

    Over the past 2 to 3 years, linkage disequilibrium mapping methods, or genome-wide association studies (GWAS), have made a seminal turn in the molecular genetic studies of complex human traits such as height, i.e., stature. Human stature is a highly heritable trait across populations and the phenotype for stature is easily measured and related to many other traits; therefore, it is available in most studies evaluating any phenotype. For this reason, it has become a beacon for large consortium genetic studies, during both the pre-GWAS and GWAS eras. Tens of thousands of genome-scanned individuals have been analysed together against their genome. Several loci have been implicated in association with stature (54 of these have been published), and most chromosomes have a locus linked to the trait in family studies. However, the prediction power of loci indentified by molecular genetic methods still remains inferior to clinical assessment of offspring stature using midparental height as a guide. Although the genomic methods provide important insights into heritability of stature, it will be a major challenge for molecular genetic studies to provide information that surpasses that of midparental height.

  11. Genome-wide and fine-resolution association analysis of malaria in West Africa.

    PubMed

    Jallow, Muminatou; Teo, Yik Ying; Small, Kerrin S; Rockett, Kirk A; Deloukas, Panos; Clark, Taane G; Kivinen, Katja; Bojang, Kalifa A; Conway, David J; Pinder, Margaret; Sirugo, Giorgio; Sisay-Joof, Fatou; Usen, Stanley; Auburn, Sarah; Bumpstead, Suzannah J; Campino, Susana; Coffey, Alison; Dunham, Andrew; Fry, Andrew E; Green, Angela; Gwilliam, Rhian; Hunt, Sarah E; Inouye, Michael; Jeffreys, Anna E; Mendy, Alieu; Palotie, Aarno; Potter, Simon; Ragoussis, Jiannis; Rogers, Jane; Rowlands, Kate; Somaskantharajah, Elilan; Whittaker, Pamela; Widden, Claire; Donnelly, Peter; Howie, Bryan; Marchini, Jonathan; Morris, Andrew; SanJoaquin, Miguel; Achidi, Eric Akum; Agbenyega, Tsiri; Allen, Angela; Amodu, Olukemi; Corran, Patrick; Djimde, Abdoulaye; Dolo, Amagana; Doumbo, Ogobara K; Drakeley, Chris; Dunstan, Sarah; Evans, Jennifer; Farrar, Jeremy; Fernando, Deepika; Hien, Tran Tinh; Horstmann, Rolf D; Ibrahim, Muntaser; Karunaweera, Nadira; Kokwaro, Gilbert; Koram, Kwadwo A; Lemnge, Martha; Makani, Julie; Marsh, Kevin; Michon, Pascal; Modiano, David; Molyneux, Malcolm E; Mueller, Ivo; Parker, Michael; Peshu, Norbert; Plowe, Christopher V; Puijalon, Odile; Reeder, John; Reyburn, Hugh; Riley, Eleanor M; Sakuntabhai, Anavaj; Singhasivanon, Pratap; Sirima, Sodiomon; Tall, Adama; Taylor, Terrie E; Thera, Mahamadou; Troye-Blomberg, Marita; Williams, Thomas N; Wilson, Michael; Kwiatkowski, Dominic P

    2009-06-01

    We report a genome-wide association (GWA) study of severe malaria in The Gambia. The initial GWA scan included 2,500 children genotyped on the Affymetrix 500K GeneChip, and a replication study included 3,400 children. We used this to examine the performance of GWA methods in Africa. We found considerable population stratification, and also that signals of association at known malaria resistance loci were greatly attenuated owing to weak linkage disequilibrium (LD). To investigate possible solutions to the problem of low LD, we focused on the HbS locus, sequencing this region of the genome in 62 Gambian individuals and then using these data to conduct multipoint imputation in the GWA samples. This increased the signal of association, from P = 4 × 10(-7) to P = 4 × 10(-14), with the peak of the signal located precisely at the HbS causal variant. Our findings provide proof of principle that fine-resolution multipoint imputation, based on population-specific sequencing data, can substantially boost authentic GWA signals and enable fine mapping of causal variants in African populations.

  12. Fast genome-wide pedigree quantitative trait loci analysis using MENDEL.

    PubMed

    Zhou, Hua; Zhou, Jin; Sobel, Eric M; Lange, Kenneth

    2014-01-01

    The linkage era left a rich legacy of pedigree samples that can be used for modern genome-wide association sequencing (GWAS) or next-generation sequencing (NGS) studies. Family designs are naturally equipped to detect rare variants, control for population stratification, and facilitate the study of parent-of-origin effects. Unfortunately, pedigree likelihoods are notoriously hard to compute, and current software for association mapping in pedigrees is prohibitively slow in processing dense marker maps. In a recent release of the comprehensive genetic analysis software MENDEL, we implemented an ultra-fast score test for association mapping with pedigree-based GWAS or NGS study data. Our implementation (a) works for random sample data, pedigree data, or a mix of both;(b) allows for covariate adjustment, including correction for population stratification;(c) accommodates both univariate and multivariate quantitative traits; and (d) allows missing values in multivariate traits. In this paper, we assess the capabilities of MENDEL on the Genetic Analysis Workshop 18 sequencing data. For instance, when jointly testing the 4 longitudinally measured diastolic blood pressure traits, it takes MENDEL less than 51 minutes on a standard laptop computer to read, quality check, and analyze a data set with 959 individuals and 8.3 million single-nucleotide polymorphisms (SNPs). Our analysis reveals association of one SNP in the q32.2 region of chromosome 1. MENDEL is freely available on http://www.genetics.ucla.edu/software.

  13. Genome-Wide Association Studies Using Haplotypes and Individual SNPs in Simmental Cattle

    PubMed Central

    Wu, Yang; Fan, Huizhong; Wang, Yanhui; Zhang, Lupei; Gao, Xue; Chen, Yan; Li, Junya; Ren, HongYan; Gao, Huijiang

    2014-01-01

    Recent advances in high-throughput genotyping technologies have provided the opportunity to map genes using associations between complex traits and markers. Genome-wide association studies (GWAS) based on either a single marker or haplotype have identified genetic variants and underlying genetic mechanisms of quantitative traits. Prompted by the achievements of studies examining economic traits in cattle and to verify the consistency of these two methods using real data, the current study was conducted to construct the haplotype structure in the bovine genome and to detect relevant genes genuinely affecting a carcass trait and a meat quality trait. Using the Illumina BovineHD BeadChip, 942 young bulls with genotyping data were introduced as a reference population to identify the genes in the beef cattle genome significantly associated with foreshank weight and triglyceride levels. In total, 92,553 haplotype blocks were detected in the genome. The regions of high linkage disequilibrium extended up to approximately 200 kb, and the size of haplotype blocks ranged from 22 bp to 199,266 bp. Additionally, the individual SNP analysis and the haplotype-based analysis detected similar regions and common SNPs for these two representative traits. A total of 12 and 7 SNPs in the bovine genome were significantly associated with foreshank weight and triglyceride levels, respectively. By comparison, 4 and 5 haplotype blocks containing the majority of significant SNPs were strongly associated with foreshank weight and triglyceride levels, respectively. In addition, 36 SNPs with high linkage disequilibrium were detected in the GNAQ gene, a potential hotspot that may play a crucial role for regulating carcass trait components. PMID:25330174

  14. Genome-wide association studies using haplotypes and individual SNPs in Simmental cattle.

    PubMed

    Wu, Yang; Fan, Huizhong; Wang, Yanhui; Zhang, Lupei; Gao, Xue; Chen, Yan; Li, Junya; Ren, HongYan; Gao, Huijiang

    2014-01-01

    Recent advances in high-throughput genotyping technologies have provided the opportunity to map genes using associations between complex traits and markers. Genome-wide association studies (GWAS) based on either a single marker or haplotype have identified genetic variants and underlying genetic mechanisms of quantitative traits. Prompted by the achievements of studies examining economic traits in cattle and to verify the consistency of these two methods using real data, the current study was conducted to construct the haplotype structure in the bovine genome and to detect relevant genes genuinely affecting a carcass trait and a meat quality trait. Using the Illumina BovineHD BeadChip, 942 young bulls with genotyping data were introduced as a reference population to identify the genes in the beef cattle genome significantly associated with foreshank weight and triglyceride levels. In total, 92,553 haplotype blocks were detected in the genome. The regions of high linkage disequilibrium extended up to approximately 200 kb, and the size of haplotype blocks ranged from 22 bp to 199,266 bp. Additionally, the individual SNP analysis and the haplotype-based analysis detected similar regions and common SNPs for these two representative traits. A total of 12 and 7 SNPs in the bovine genome were significantly associated with foreshank weight and triglyceride levels, respectively. By comparison, 4 and 5 haplotype blocks containing the majority of significant SNPs were strongly associated with foreshank weight and triglyceride levels, respectively. In addition, 36 SNPs with high linkage disequilibrium were detected in the GNAQ gene, a potential hotspot that may play a crucial role for regulating carcass trait components. PMID:25330174

  15. A Genome-wide Association Study of Myasthenia Gravis

    PubMed Central

    Renton, Alan E.; Pliner, Hannah A.; Provenzano, Carlo; Evoli, Amelia; Ricciardi, Roberta; Nalls, Michael A.; Marangi, Giuseppe; Abramzon, Yevgeniya; Arepalli, Sampath; Chong, Sean; Hernandez, Dena G.; Johnson, Janel O.; Bartoccioni, Emanuela; Scuderi, Flavia; Maestri, Michelangelo; Raphael Gibbs, J.; Errichiello, Edoardo; Chiò, Adriano; Restagno, Gabriella; Sabatelli, Mario; Macek, Mark; Scholz, Sonja W.; Corse, Andrea; Chaudhry, Vinay; Benatar, Michael; Barohn, Richard J.; McVey, April; Pasnoor, Mamatha; Dimachkie, Mazen M.; Rowin, Julie; Kissel, John; Freimer, Miriam; Kaminski, Henry J.; Sanders, Donald B.; Lipscomb, Bernadette; Massey, Janice M.; Chopra, Manisha; Howard, James F.; Koopman, Wilma J.; Nicolle, Michael W.; Pascuzzi, Robert M.; Pestronk, Alan; Wulf, Charlie; Florence, Julaine; Blackmore, Derrick; Soloway, Aimee; Siddiqi, Zaeem; Muppidi, Srikanth; Wolfe, Gil; Richman, David; Mezei, Michelle M.; Jiwa, Theresa; Oger, Joel; Drachman, Daniel B.; Traynor, Bryan J.

    2016-01-01

    IMPORTANCE Myasthenia gravis is a chronic, autoimmune, neuromuscular disease characterized by fluctuating weakness of voluntary muscle groups. Although genetic factors are known to play a role in this neuroimmunological condition, the genetic etiology underlying myasthenia gravis is not well understood. OBJECTIVE To identify genetic variants that alter susceptibility to myasthenia gravis, we performed a genome-wide association study. DESIGN, SETTING, AND PARTICIPANTS DNA was obtained from 1032 white individuals from North America diagnosed as having acetylcholine receptor antibody–positive myasthenia gravis and 1998 race/ethnicity-matched control individuals from January 2010 to January 2011. These samples were genotyped on Illumina OmniExpress single-nucleotide polymorphism arrays. An independent cohort of 423 Italian cases and 467 Italian control individuals were used for replication. MAIN OUTCOMES AND MEASURES We calculated P values for association between 8114394 genotyped and imputed variants across the genome and risk for developing myasthenia gravis using logistic regression modeling. A threshold P value of 5.0 × 10−8 was set for genome-wide significance after Bonferroni correction for multiple testing. RESULTS In the over all case-control cohort, we identified association signals at CTLA4 (rs231770; P = 3.98 × 10−8; odds ratio, 1.37; 95% CI, 1.25–1.49), HLA-DQA1 (rs9271871; P = 1.08 × 10−8; odds ratio, 2.31; 95% CI, 2.02 – 2.60), and TNFRSF11A (rs4263037; P = 1.60 × 10−9; odds ratio, 1.41; 95% CI, 1.29–1.53). These findings replicated for CTLA4 and HLA-DQA1 in an independent cohort of Italian cases and control individuals. Further analysis revealed distinct, but overlapping, disease-associated loci for early- and late-onset forms of myasthenia gravis. In the late-onset cases, we identified 2 association peaks: one was located in TNFRSF11A (rs4263037; P = 1.32 × 10−12; odds ratio, 1.56; 95% CI, 1.44–1.68) and the other was detected

  16. A genome-wide association study of brain lesion distribution in multiple sclerosis.

    PubMed

    Gourraud, Pierre-Antoine; Sdika, Michael; Khankhanian, Pouya; Henry, Roland G; Beheshtian, Azadeh; Matthews, Paul M; Hauser, Stephen L; Oksenberg, Jorge R; Pelletier, Daniel; Baranzini, Sergio E

    2013-04-01

    Brain magnetic resonance imaging is widely used as a diagnostic and monitoring tool in multiple sclerosis and provides a non-invasive, sensitive and reproducible way to track the disease. Topological characteristics relating to the distribution and shape of lesions are recognized as important neuroradiological markers in the diagnosis of multiple sclerosis, although these have been much less well characterized quantitatively than have traditional measures such as T2 hyperintense or T1 hypointense lesion volumes. Here, we used voxel-level 3 T magnetic resonance imaging T1-weighted scans to reconstruct the 3D topology of lesions in 284 subjects with multiple sclerosis and tested whether this is a heritable phenotype. To this end, we extracted the genotypes from a published genome-wide association study on these same individuals and searched for genetic associations with lesion load, shape and topological distribution. Lesion probability maps were created to identify frequently affected areas and to assess the overall distribution of T1 lesions in the subject population as a whole. We then developed an original algorithm to cluster adjacent lesional voxels (cluxels) in each subject and tested whether cluxel topology was significantly associated with any single-nucleotide polymorphism in our data set. To focus on patterns of lesion distribution, we computed the first 10 principal components. Although principal component 1 correlated with lesion load, none of the remaining orthogonal components correlated with any other known variable. We then conducted genome-wide association studies on each of these and found 31 significant associations (false discovery rate <0.01) with principal component 8, which represents a mode of variation of lesion topology in the population. The majority of the loci can be linked to genes related to immune cell function and to myelin and neural growth; some (SYK, MYT1L, TRAPPC9, SLITKR6 and RIC3) have been previously associated with the

  17. Multicentric Genome-Wide Association Study for Primary Spontaneous Pneumothorax

    PubMed Central

    Abrantes, Patrícia; Francisco, Vânia; Teixeira, Gilberto; Monteiro, Marta; Neves, João; Norte, Ana; Robalo Cordeiro, Carlos; Moura e Sá, João; Reis, Ernestina; Santos, Patrícia; Oliveira, Manuela; Sousa, Susana; Fradinho, Marta; Malheiro, Filipa; Negrão, Luís

    2016-01-01

    Despite elevated incidence and recurrence rates for Primary Spontaneous Pneumothorax (PSP), little is known about its etiology, and the genetics of idiopathic PSP remains unexplored. To identify genetic variants contributing to sporadic PSP risk, we conducted the first PSP genome-wide association study. Two replicate pools of 92 Portuguese PSP cases and of 129 age- and sex-matched controls were allelotyped in triplicate on the Affymetrix Human SNP Array 6.0 arrays. Markers passing quality control were ranked by relative allele score difference between cases and controls (|RASdiff|), by a novel cluster method and by a combined Z-test. 101 single nucleotide polymorphisms (SNPs) were selected using these three approaches for technical validation by individual genotyping in the discovery dataset. 87 out of 94 successfully tested SNPs were nominally associated in the discovery dataset. Replication of the 87 technically validated SNPs was then carried out in an independent replication dataset of 100 Portuguese cases and 425 controls. The intergenic rs4733649 SNP in chromosome 8 (between LINC00824 and LINC00977) was associated with PSP in the discovery (P = 4.07E-03, ORC[95% CI] = 1.88[1.22–2.89]), replication (P = 1.50E-02, ORC[95% CI] = 1.50[1.08–2.09]) and combined datasets (P = 8.61E-05, ORC[95% CI] = 1.65[1.29–2.13]). This study identified for the first time one genetic risk factor for sporadic PSP, but future studies are warranted to further confirm this finding in other populations and uncover its functional role in PSP pathogenesis. PMID:27203581

  18. Genome-wide analysis of condensin binding in Caenorhabditis elegans

    PubMed Central

    2013-01-01

    Background Condensins are multi-subunit protein complexes that are essential for chromosome condensation during mitosis and meiosis, and play key roles in transcription regulation during interphase. Metazoans contain two condensins, I and II, which perform different functions and localize to different chromosomal regions. Caenorhabditis elegans contains a third condensin, IDC, that is targeted to and represses transcription of the X chromosome for dosage compensation. Results To understand condensin binding and function, we performed ChIP-seq analysis of C. elegans condensins in mixed developmental stage embryos, which contain predominantly interphase nuclei. Condensins bind to a subset of active promoters, tRNA genes and putative enhancers. Expression analysis in kle-2-mutant larvae suggests that the primary effect of condensin II on transcription is repression. A DNA sequence motif, GCGC, is enriched at condensin II binding sites. A sequence extension of this core motif, AGGG, creates the condensin IDC motif. In addition to differences in recruitment that result in X-enrichment of condensin IDC and condensin II binding to all chromosomes, we provide evidence for a shared recruitment mechanism, as condensin IDC recruiter SDC-2 also recruits condensin II to the condensin IDC recruitment sites on the X. In addition, we found that condensin sites overlap extensively with the cohesin loader SCC-2, and that SDC-2 also recruits SCC-2 to the condensin IDC recruitment sites. Conclusions Our results provide the first genome-wide view of metazoan condensin II binding in interphase, define putative recruitment motifs, and illustrate shared loading mechanisms for condensin IDC and condensin II. PMID:24125077

  19. Susceptibility to Chronic Mucus Hypersecretion, a Genome Wide Association Study

    PubMed Central

    Dijkstra, Akkelies E.; Smolonska, Joanna; van den Berge, Maarten; Wijmenga, Ciska; Zanen, Pieter; Luinge, Marjan A.; Platteel, Mathieu; Lammers, Jan-Willem; Dahlback, Magnus; Tosh, Kerrie; Hiemstra, Pieter S.; Sterk, Peter J.; Spira, Avi; Vestbo, Jorgen; Nordestgaard, Borge G.; Benn, Marianne; Nielsen, Sune F.; Dahl, Morten; Verschuren, W. Monique; Picavet, H. Susan J.; Smit, Henriette A.; Owsijewitsch, Michael; Kauczor, Hans U.; de Koning, Harry J.; Nizankowska-Mogilnicka, Eva; Mejza, Filip; Nastalek, Pawel; van Diemen, Cleo C.; Cho, Michael H.; Silverman, Edwin K.; Crapo, James D.; Beaty, Terri H.; Lomas, David A.; Bakke, Per; Gulsvik, Amund; Bossé, Yohan; Obeidat, M. A.; Loth, Daan W.; Lahousse, Lies; Rivadeneira, Fernando; Uitterlinden, Andre G.; Hofman, Andre; Stricker, Bruno H.; Brusselle, Guy G.; van Duijn, Cornelia M.; Brouwer, Uilke; Koppelman, Gerard H.; Vonk, Judith M.; Nawijn, Martijn C.; Groen, Harry J. M.; Timens, Wim; Boezen, H. Marike; Postma, Dirkje S.

    2014-01-01

    Background Chronic mucus hypersecretion (CMH) is associated with an increased frequency of respiratory infections, excess lung function decline, and increased hospitalisation and mortality rates in the general population. It is associated with smoking, but it is unknown why only a minority of smokers develops CMH. A plausible explanation for this phenomenon is a predisposing genetic constitution. Therefore, we performed a genome wide association (GWA) study of CMH in Caucasian populations. Methods GWA analysis was performed in the NELSON-study using the Illumina 610 array, followed by replication and meta-analysis in 11 additional cohorts. In total 2,704 subjects with, and 7,624 subjects without CMH were included, all current or former heavy smokers (≥20 pack-years). Additional studies were performed to test the functional relevance of the most significant single nucleotide polymorphism (SNP). Results A strong association with CMH, consistent across all cohorts, was observed with rs6577641 (p = 4.25×10−6, OR = 1.17), located in intron 9 of the special AT-rich sequence-binding protein 1 locus (SATB1) on chromosome 3. The risk allele (G) was associated with higher mRNA expression of SATB1 (4.3×10−9) in lung tissue. Presence of CMH was associated with increased SATB1 mRNA expression in bronchial biopsies from COPD patients. SATB1 expression was induced during differentiation of primary human bronchial epithelial cells in culture. Conclusions Our findings, that SNP rs6577641 is associated with CMH in multiple cohorts and is a cis-eQTL for SATB1, together with our additional observation that SATB1 expression increases during epithelial differentiation provide suggestive evidence that SATB1 is a gene that affects CMH. PMID:24714607

  20. Genome-Wide Approaches for RNA Structure Probing.

    PubMed

    Silverman, Ian M; Berkowitz, Nathan D; Gosai, Sager J; Gregory, Brian D

    2016-01-01

    RNA molecules of all types fold into complex secondary and tertiary structures that are important for their function and regulation. Structural and catalytic RNAs such as ribosomal RNA (rRNA) and transfer RNA (tRNA) are central players in protein synthesis, and only function through their proper folding into intricate three-dimensional structures. Studies of messenger RNA (mRNA) regulation have also revealed that structural elements embedded within these RNA species are important for the proper regulation of their total level in the transcriptome. More recently, the discovery of microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) has shed light on the importance of RNA structure to genome, transcriptome, and proteome regulation. Due to the relatively small number, high conservation, and importance of structural and catalytic RNAs to all life, much early work in RNA structure analysis mapped out a detailed view of these molecules. Computational and physical methods were used in concert with enzymatic and chemical structure probing to create high-resolution models of these fundamental biological molecules. However, the recent expansion in our knowledge of the importance of RNA structure to coding and regulatory RNAs has left the field in need of faster and scalable methods for high-throughput structural analysis. To address this, nuclease and chemical RNA structure probing methodologies have been adapted for genome-wide analysis. These methods have been deployed to globally characterize thousands of RNA structures in a single experiment. Here, we review these experimental methodologies for high-throughput RNA structure determination and discuss the insights gained from each approach. PMID:27256381

  1. Genome-wide association study of sleep in Drosophila melanogaster

    PubMed Central

    2013-01-01

    Background Sleep is a highly conserved behavior, yet its duration and pattern vary extensively among species and between individuals within species. The genetic basis of natural variation in sleep remains unknown. Results We used the Drosophila Genetic Reference Panel (DGRP) to perform a genome-wide association (GWA) study of sleep in D. melanogaster. We identified candidate single nucleotide polymorphisms (SNPs) associated with differences in the mean as well as the environmental sensitivity of sleep traits; these SNPs typically had sex-specific or sex-biased effects, and were generally located in non-coding regions. The majority of SNPs (80.3%) affecting sleep were at low frequency and had moderately large effects. Additive models incorporating multiple SNPs explained as much as 55% of the genetic variance for sleep in males and females. Many of these loci are known to interact physically and/or genetically, enabling us to place them in candidate genetic networks. We confirmed the role of seven novel loci on sleep using insertional mutagenesis and RNA interference. Conclusions We identified many SNPs in novel loci that are potentially associated with natural variation in sleep, as well as SNPs within genes previously known to affect Drosophila sleep. Several of the candidate genes have human homologues that were identified in studies of human sleep, suggesting that genes affecting variation in sleep are conserved across species. Our discovery of genetic variants that influence environmental sensitivity to sleep may have a wider application to all GWA studies, because individuals with highly plastic genotypes will not have consistent phenotypes. PMID:23617951

  2. Genome-wide examination of myoblast cell cycle withdrawal duringdifferentiation

    SciTech Connect

    Shen, Xun; Collier, John Michael; Hlaing, Myint; Zhang, Leanne; Delshad, Elizabeth H.; Bristow, James; Bernstein, Harold S.

    2002-12-02

    Skeletal and cardiac myocytes cease division within weeks of birth. Although skeletal muscle retains limited capacity for regeneration through recruitment of satellite cells, resident populations of adult myocardial stem cells have not been identified. Because cell cycle withdrawal accompanies myocyte differentiation, we hypothesized that C2C12 cells, a mouse myoblast cell line previously used to characterize myocyte differentiation, also would provide a model for studying cell cycle withdrawal during differentiation. C2C12 cells were differentiated in culture medium containing horse serum and harvested at various time points to characterize the expression profiles of known cell cycle and myogenic regulatory factors by immunoblot analysis. BrdU incorporation decreased dramatically in confluent cultures 48 hr after addition of horse serum, as cells started to form myotubes. This finding was preceded by up-regulation of MyoD, followed by myogenin, and activation of Bcl-2. Cyclin D1 was expressed in proliferating cultures and became undetectable in cultures containing 40 percent fused myotubes, as levels of p21(WAF1/Cip1) increased and alpha-actin became detectable. Because C2C12 myoblasts withdraw from the cell cycle during myocyte differentiation following a course that recapitulates this process in vivo, we performed a genome-wide screen to identify other gene products involved in this process. Using microarrays containing approximately 10,000 minimally redundant mouse sequences that map to the UniGene database of the National Center for Biotechnology Information, we compared gene expression profiles between proliferating, differentiating, and differentiated C2C12 cells and verified candidate genes demonstrating differential expression by RT-PCR. Cluster analysis of differentially expressed genes revealed groups of gene products involved in cell cycle withdrawal, muscle differentiation, and apoptosis. In addition, we identified several genes, including DDAH2 and Ly

  3. Mosaic paternal genome-wide uniparental isodisomy with down syndrome.

    PubMed

    Darcy, Diana; Atwal, Paldeep Singh; Angell, Cathy; Gadi, Inder; Wallerstein, Robert

    2015-10-01

    We report on a 6-month-old girl with two apparent cell lines; one with trisomy 21, and the other with paternal genome-wide uniparental isodisomy (GWUPiD), identified using single nucleotide polymorphism (SNP) based microarray and microsatellite analysis of polymorphic loci. The patient has Beckwith-Wiedemann syndrome (BWS) due to paternal uniparental disomy (UPD) at chromosome location 11p15 (UPD 11p15), which was confirmed through methylation analysis. Hyperinsulinemic hypoglycemia is present, which is associated with paternal UPD 11p15.5; and she likely has medullary nephrocalcinosis, which is associated with paternal UPD 20, although this was not biochemically confirmed. Angelman syndrome (AS) analysis was negative but this testing is not completely informative; she has no specific features of AS. Clinical features of this patient include: dysmorphic features consistent with trisomy 21, tetralogy of Fallot, hemihypertrophy, swirled skin hyperpigmentation, hepatoblastoma, and Wilms tumor. Her karyotype is 47,XX,+21[19]/46,XX[4], and microarray results suggest that the cell line with trisomy 21 is biparentally inherited and represents 40-50% of the genomic material in the tested specimen. The difference in the level of cytogenetically detected mosaicism versus the level of mosaicism observed via microarray analysis is likely caused by differences in the test methodologies. While a handful of cases of mosaic paternal GWUPiD have been reported, this patient is the only reported case that also involves trisomy 21. Other GWUPiD patients have presented with features associated with multiple imprinted regions, as does our patient. PMID:26219535

  4. Assessing statistical significance in multivariable genome wide association analysis

    PubMed Central

    Buzdugan, Laura; Kalisch, Markus; Navarro, Arcadi; Schunk, Daniel; Fehr, Ernst; Bühlmann, Peter

    2016-01-01

    Motivation: Although Genome Wide Association Studies (GWAS) genotype a very large number of single nucleotide polymorphisms (SNPs), the data are often analyzed one SNP at a time. The low predictive power of single SNPs, coupled with the high significance threshold needed to correct for multiple testing, greatly decreases the power of GWAS. Results: We propose a procedure in which all the SNPs are analyzed in a multiple generalized linear model, and we show its use for extremely high-dimensional datasets. Our method yields P-values for assessing significance of single SNPs or groups of SNPs while controlling for all other SNPs and the family wise error rate (FWER). Thus, our method tests whether or not a SNP carries any additional information about the phenotype beyond that available by all the other SNPs. This rules out spurious correlations between phenotypes and SNPs that can arise from marginal methods because the ‘spuriously correlated’ SNP merely happens to be correlated with the ‘truly causal’ SNP. In addition, the method offers a data driven approach to identifying and refining groups of SNPs that jointly contain informative signals about the phenotype. We demonstrate the value of our method by applying it to the seven diseases analyzed by the Wellcome Trust Case Control Consortium (WTCCC). We show, in particular, that our method is also capable of finding significant SNPs that were not identified in the original WTCCC study, but were replicated in other independent studies. Availability and implementation: Reproducibility of our research is supported by the open-source Bioconductor package hierGWAS. Contact: peter.buehlmann@stat.math.ethz.ch Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27153677

  5. Genephony: a knowledge management tool for genome-wide research

    PubMed Central

    Nuzzo, Angelo; Riva, Alberto

    2009-01-01

    Background One of the consequences of the rapid and widespread adoption of high-throughput experimental technologies is an exponential increase of the amount of data produced by genome-wide experiments. Researchers increasingly need to handle very large volumes of heterogeneous data, including both the data generated by their own experiments and the data retrieved from publicly available repositories of genomic knowledge. Integration, exploration, manipulation and interpretation of data and information therefore need to become as automated as possible, since their scale and breadth are, in general, beyond the limits of what individual researchers and the basic data management tools in normal use can handle. This paper describes Genephony, a tool we are developing to address these challenges. Results We describe how Genephony can be used to manage large datesets of genomic information, integrating them with existing knowledge repositories. We illustrate its functionalities with an example of a complex annotation task, in which a set of SNPs coming from a genotyping experiment is annotated with genes known to be associated to a phenotype of interest. We show how, thanks to the modular architecture of Genephony and its user-friendly interface, this task can be performed in a few simple steps. Conclusion Genephony is an online tool for the manipulation of large datasets of genomic information. It can be used as a browser for genomic data, as a high-throughput annotation tool, and as a knowledge discovery tool. It is designed to be easy to use, flexible and extensible. Its knowledge management engine provides fine-grained control over individual data elements, as well as efficient operations on large datasets. PMID:19728881

  6. Genome-wide inference of regulatory networks in Streptomyces coelicolor

    PubMed Central

    2010-01-01

    Background The onset of antibiotics production in Streptomyces species is co-ordinated with differentiation events. An understanding of the genetic circuits that regulate these coupled biological phenomena is essential to discover and engineer the pharmacologically important natural products made by these species. The availability of genomic tools and access to a large warehouse of transcriptome data for the model organism, Streptomyces coelicolor, provides incentive to decipher the intricacies of the regulatory cascades and develop biologically meaningful hypotheses. Results In this study, more than 500 samples of genome-wide temporal transcriptome data, comprising wild-type and more than 25 regulatory gene mutants of Streptomyces coelicolor probed across multiple stress and medium conditions, were investigated. Information based on transcript and functional similarity was used to update a previously-predicted whole-genome operon map and further applied to predict transcriptional networks constituting modules enriched in diverse functions such as secondary metabolism, and sigma factor. The predicted network displays a scale-free architecture with a small-world property observed in many biological networks. The networks were further investigated to identify functionally-relevant modules that exhibit functional coherence and a consensus motif in the promoter elements indicative of DNA-binding elements. Conclusions Despite the enormous experimental as well as computational challenges, a systems approach for integrating diverse genome-scale datasets to elucidate complex regulatory networks is beginning to emerge. We present an integrated analysis of transcriptome data and genomic features to refine a whole-genome operon map and to construct regulatory networks at the cistron level in Streptomyces coelicolor. The functionally-relevant modules identified in this study pose as potential targets for further studies and verification. PMID:20955611

  7. Genome-Wide Methylation Analyses in Glioblastoma Multiforme

    PubMed Central

    Lai, Rose K.; Chen, Yanwen; Guan, Xiaowei; Nousome, Darryl; Sharma, Charu; Canoll, Peter; Bruce, Jeffrey; Sloan, Andrew E.; Cortes, Etty; Vonsattel, Jean-Paul; Su, Tao; Delgado-Cruzata, Lissette; Gurvich, Irina; Santella, Regina M.; Ostrom, Quinn; Lee, Annette; Gregersen, Peter; Barnholtz-Sloan, Jill

    2014-01-01

    Few studies had investigated genome-wide methylation in glioblastoma multiforme (GBM). Our goals were to study differential methylation across the genome in gene promoters using an array-based method, as well as repetitive elements using surrogate global methylation markers. The discovery sample set for this study consisted of 54 GBM from Columbia University and Case Western Reserve University, and 24 brain controls from the New York Brain Bank. We assembled a validation dataset using methylation data of 162 TCGA GBM and 140 brain controls from dbGAP. HumanMethylation27 Analysis Bead-Chips (Illumina) were used to interrogate 26,486 informative CpG sites in both the discovery and validation datasets. Global methylation levels were assessed by analysis of L1 retrotransposon (LINE1), 5 methyl-deoxycytidine (5m-dC) and 5 hydroxylmethyl-deoxycytidine (5hm-dC) in the discovery dataset. We validated a total of 1548 CpG sites (1307 genes) that were differentially methylated in GBM compared to controls. There were more than twice as many hypomethylated genes as hypermethylated ones. Both the discovery and validation datasets found 5 tumor methylation classes. Pathway analyses showed that the top ten pathways in hypomethylated genes were all related to functions of innate and acquired immunities. Among hypermethylated pathways, transcriptional regulatory network in embryonic stem cells was the most significant. In the study of global methylation markers, 5m-dC level was the best discriminant among methylation classes, whereas in survival analyses, high level of LINE1 methylation was an independent, favorable prognostic factor in the discovery dataset. Based on a pathway approach, hypermethylation in genes that control stem cell differentiation were significant, poor prognostic factors of overall survival in both the discovery and validation datasets. Approaches that targeted these methylated genes may be a future therapeutic goal. PMID:24586730

  8. A Comprehensive, Quantitative, and Genome-Wide Model of Translation

    PubMed Central

    Siwiak, Marlena; Zielenkiewicz, Piotr

    2010-01-01

    Translation is still poorly characterised at the level of individual proteins and its role in regulation of gene expression has been constantly underestimated. To better understand the process of protein synthesis we developed a comprehensive and quantitative model of translation, characterising protein synthesis separately for individual genes. The main advantage of the model is that basing it on only a few datasets and general assumptions allows the calculation of many important translational parameters, which are extremely difficult to measure experimentally. In the model, each gene is attributed with a set of translational parameters, namely the absolute number of transcripts, ribosome density, mean codon translation time, total transcript translation time, total time required for translation initiation and elongation, translation initiation rate, mean mRNA lifetime, and absolute number of proteins produced by gene transcripts. Most parameters were calculated based on only one experimental dataset of genome-wide ribosome profiling. The model was implemented in Saccharomyces cerevisiae, and its results were compared with available data, yielding reasonably good correlations. The calculated coefficients were used to perform a global analysis of translation in yeast, revealing some interesting aspects of the process. We have shown that two commonly used measures of translation efficiency – ribosome density and number of protein molecules produced – are affected by two distinct factors. High values of both measures are caused, i.a., by very short times of translation initiation, however, the origins of initiation time reduction are completely different in both cases. The model is universal and can be applied to any organism, if the necessary input data are available. The model allows us to better integrate transcriptomic and proteomic data. A few other possibilities of the model utilisation are discussed concerning the example of the yeast system. PMID:20686685

  9. Multicentric Genome-Wide Association Study for Primary Spontaneous Pneumothorax.

    PubMed

    Sousa, Inês; Abrantes, Patrícia; Francisco, Vânia; Teixeira, Gilberto; Monteiro, Marta; Neves, João; Norte, Ana; Robalo Cordeiro, Carlos; Moura E Sá, João; Reis, Ernestina; Santos, Patrícia; Oliveira, Manuela; Sousa, Susana; Fradinho, Marta; Malheiro, Filipa; Negrão, Luís; Feijó, Salvato; Oliveira, Sofia A

    2016-01-01

    Despite elevated incidence and recurrence rates for Primary Spontaneous Pneumothorax (PSP), little is known about its etiology, and the genetics of idiopathic PSP remains unexplored. To identify genetic variants contributing to sporadic PSP risk, we conducted the first PSP genome-wide association study. Two replicate pools of 92 Portuguese PSP cases and of 129 age- and sex-matched controls were allelotyped in triplicate on the Affymetrix Human SNP Array 6.0 arrays. Markers passing quality control were ranked by relative allele score difference between cases and controls (|RASdiff|), by a novel cluster method and by a combined Z-test. 101 single nucleotide polymorphisms (SNPs) were selected using these three approaches for technical validation by individual genotyping in the discovery dataset. 87 out of 94 successfully tested SNPs were nominally associated in the discovery dataset. Replication of the 87 technically validated SNPs was then carried out in an independent replication dataset of 100 Portuguese cases and 425 controls. The intergenic rs4733649 SNP in chromosome 8 (between LINC00824 and LINC00977) was associated with PSP in the discovery (P = 4.07E-03, ORC[95% CI] = 1.88[1.22-2.89]), replication (P = 1.50E-02, ORC[95% CI] = 1.50[1.08-2.09]) and combined datasets (P = 8.61E-05, ORC[95% CI] = 1.65[1.29-2.13]). This study identified for the first time one genetic risk factor for sporadic PSP, but future studies are warranted to further confirm this finding in other populations and uncover its functional role in PSP pathogenesis. PMID:27203581

  10. Genome-wide profiling of Populus small RNAs

    PubMed Central

    2009-01-01

    Background Short RNAs, and in particular microRNAs, are important regulators of gene expression both within defined regulatory pathways and at the epigenetic scale. We investigated the short RNA (sRNA) population (18-24 nt) of the transcriptome of green leaves from the sequenced Populus trichocarpa using a concatenation strategy in combination with 454 sequencing. Results The most abundant size class of sRNAs were 24 nt. Long Terminal Repeats were particularly associated with 24 nt sRNAs. Additionally, some repetitive elements were associated with 22 nt sRNAs. We identified an sRNA hot-spot on chromosome 19, overlapping a region containing both the proposed sex-determining locus and a major cluster of NBS-LRR genes. A number of phased siRNA loci were identified, a subset of which are predicted to target PPR and NBS-LRR disease resistance genes, classes of genes that have been significantly expanded in Populus. Additional loci enriched for sRNA production were identified and characterised. We identified 15 novel predicted microRNAs (miRNAs), including miRNA*sequences, and identified a novel locus that may encode a dual miRNA or a miRNA and short interfering RNAs (siRNAs). Conclusions The short RNA population of P. trichocarpa is at least as complex as that of Arabidopsis thaliana. We provide a first genome-wide view of short RNA production for P. trichocarpa and identify new, non-conserved miRNAs. PMID:20021695

  11. Genome-wide Association Studies of Maximum Number of Drinks

    PubMed Central

    Pan, Yue; Luo, Xingguang; Liu, Xuefeng; Wu, Long-Yang; Zhang, Qunyuan; Wang, Liang; Wang, Weize; Zuo, Lingjun; Wang, Ke-Sheng

    2014-01-01

    Maximum number of drinks (MaxDrinks) defined as “Maximum number of alcoholic drinks consumed in a 24-hour period” is an intermediate phenotype that is closely related to alcohol dependence (AD). Family, twin and adoption studies have shown that the heritability of MaxDrinks is approximately 0.5. We conducted the first genome-wide association (GWA) study and meta-analysis of MaxDrinks as a continuous phenotype. 1059 individuals were from the Collaborative Study on the Genetics of Alcoholism (COGA) sample and 1628 individuals were from the Study of Addiction – Genetics and Environment (SAGE) sample. Family sample with 3137 individuals was from the Australian twin-family study of alcohol use disorder (OZALC). Two population-based Caucasian samples (COGA and SAGE) with 1 million single-nucleotide polymorphisms (SNPs) were used for gene discovery and one family-based Caucasian sample was used for replication. Through meta-analysis we identified 162 SNPs associated with MaxDirnks (p < 10−4). The most significant association with MaxDrinks was observed with SNP rs11128951 (p = 4.27×10−8) near SGOL1 gene at 3p24.3. Furthermore, several SNPs (rs17144687 near DTWD2, rs12108602 near NDST4, and rs2128158 in KCNB2) showed significant associations with MaxDrinks (p < 5×10−7) in the meta-analysis. Especially, 8 SNPs in DDC gene showed significant associations with MaxDrinks (p< 5×10−7) in the SAGE sample. Several flanking SNPs in above genes/regions were confirmed in the OZALC family sample. In conclusions, we identified several genes/regions associated with MaxDrinks. These findings can improve the understanding about the pathogenesis of alcohol consumption phenotypes and alcohol-related disorders. PMID:23953852

  12. Genome-wide characteristics of de novo mutations in autism

    PubMed Central

    Yuen, Ryan K C; Merico, Daniele; Cao, Hongzhi; Pellecchia, Giovanna; Alipanahi, Babak; Thiruvahindrapuram, Bhooma; Tong, Xin; Sun, Yuhui; Cao, Dandan; Zhang, Tao; Wu, Xueli; Jin, Xin; Zhou, Ze; Liu, Xiaomin; Nalpathamkalam, Thomas; Walker, Susan; Howe, Jennifer L.; Wang, Zhuozhi; MacDonald, Jeffrey R.; Chan, Ada; D’Abate, Lia; Deneault, Eric; Siu, Michelle T.; Tammimies, Kristiina; Uddin, Mohammed; Zarrei, Mehdi; Wang, Mingbang; Li, Yingrui; Wang, Jun; Wang, Jian; Yang, Huanming; Bookman, Matt; Bingham, Jonathan; Gross, Samuel S.; Loy, Dion; Pletcher, Mathew; Marshall, Christian R.; Anagnostou, Evdokia; Zwaigenbaum, Lonnie; Weksberg, Rosanna; Fernandez, Bridget A; Roberts, Wendy; Szatmari, Peter; Glazer, David; Frey, Brendan J.; Ring, Robert H.; Xu, Xun; Scherer, Stephen W.

    2016-01-01

    De novo mutations (DNMs) are important in Autism Spectrum Disorder (ASD), but so far analyses have mainly been on the ~1.5% of the genome encoding genes. Here, we performed whole genome sequencing (WGS) of 200 ASD parent-child trios and characterized germline and somatic DNMs. We confirmed that the majority of germline DNMs (75.6%) originated from the father, and these increased significantly with paternal age only (p=4.2×10−10). However, when clustered DNMs (those within 20kb) were found in ASD, not only did they mostly originate from the mother (p=7.7×10−13), but they could also be found adjacent to de novo copy number variations (CNVs) where the mutation rate was significantly elevated (p=2.4×10−24). By comparing DNMs detected in controls, we found a significant enrichment of predicted damaging DNMs in ASD cases (p=8.0×10−9; OR=1.84), of which 15.6% (p=4.3×10−3) and 22.5% (p=7.0×10−5) were in the non-coding or genic non-coding, respectively. The non-coding elements most enriched for DNM were untranslated regions of genes, boundaries involved in exon-skipping and DNase I hypersensitive regions. Using microarrays and a novel outlier detection test, we also found aberrant methylation profiles in 2/185 (1.1%) of ASD cases. These same individuals carried independently identified DNMs in the ASD risk- and epigenetic- genes DNMT3A and ADNP. Our data begins to characterize different genome-wide DNMs, and highlight the contribution of non-coding variants, to the etiology of ASD. PMID:27525107

  13. Genome-wide characterization of microsatellites and marker development in the carcinogenic liver fluke Clonorchis sinensis.

    PubMed

    Nguyen, Thao T B; Arimatsu, Yuji; Hong, Sung-Jong; Brindley, Paul J; Blair, David; Laha, Thewarach; Sripa, Banchob

    2015-06-01

    Clonorchis sinensis is an important carcinogenic human liver fluke endemic in East and Southeast Asia. There are several conventional molecular markers that have been used for identification and genetic diversity; however, no information about microsatellites of this liver fluke is published so far. We here report microsatellite characterization and marker development for a genetic diversity study in C. sinensis, using a genome-wide bioinformatics approach. Based on our search criteria, a total of 256,990 microsatellites (≥12 base pairs) were identified from a genome database of C. sinensis, with hexanucleotide motif being the most abundant (51%) followed by pentanucleotide (18.3%) and trinucleotide (12.7%). The tetranucleotide, dinucleotide, and mononucleotide motifs accounted for 9.75, 7.63, and 0.14%, respectively. The total length of all microsatellites accounts for 0. 72% of 547 Mb of the whole genome size, and the frequency of microsatellites was found to be one microsatellite in every 2.13 kb of DNA. For the di-, tri-, and tetranucleotide, the repeat numbers redundant are six (28%), four (45%), and three (76%), respectively. The ATC repeat is the most abundant microsatellites followed by AT, AAT, and AC, respectively. Within 40 microsatellite loci developed, 24 microsatellite markers showed potential to differentiate between C. sinensis and Opisthorchis viverrini. Seven out of 24 loci showed to be heterozygous with observed heterozygosity that ranged from 0.467 to 1. Four primer sets could amplify both C. sinensis and O. viverrini DNA with different sizes. This study provides basic information of C. sinensis microsatellites, and the genome-wide markers developed may be a useful tool for the genetic study of C. sinensis. PMID:25782682

  14. Genome-wide association studies and gene expression profiles of rheumatoid arthritis

    PubMed Central

    Xiao, X.; Hao, J.; Wen, Y.; Wang, W.; Guo, X.

    2016-01-01

    Objectives The molecular mechanism of rheumatoid arthritis (RA) remains elusive. We conducted a protein-protein interaction network-based integrative analysis of genome-wide association studies (GWAS) and gene expression profiles of RA. Methods We first performed a dense search of RA-associated gene modules by integrating a large GWAS meta-analysis dataset (containing 5539 RA patients and 20 169 healthy controls), protein interaction network and gene expression profiles of RA synovium and peripheral blood mononuclear cells (PBMCs). Gene ontology (GO) enrichment analysis was conducted by DAVID. The protein association networks of gene modules were generated by STRING. Results For RA synovium, the top-ranked gene module is HLA-A, containing TAP2, HLA-A, HLA-C, TAPBP and LILRB1 genes. For RA PBMCs, the top-ranked gene module is GRB7, consisting of HLA-DRB5, HLA-DRA, GRB7, CD63 and KIT genes. Functional enrichment analysis identified three significant GO terms for RA synovium, including antigen processing and presentation of peptide antigen via major histocompatibility complex class I (false discovery rate (FDR) = 4.86 × 10 – 4), antigen processing and presentation of peptide antigen (FDR = 2.33 × 10 – 3) and eukaryotic translation initiation factor 4F complex (FDR = 2.52 × 10 – 2). Conclusion This study reported several RA-associated gene modules and their functional association networks. Cite this article: X. Xiao, J. Hao, Y. Wen, W. Wang, X. Guo, F. Zhang. Genome-wide association studies and gene expression profiles of rheumatoid arthritis: an analysis. Bone Joint Res 2016;5:314–319. DOI: 10.1302/2046-3758.57.2000502. PMID:27445359

  15. Genome-wide single-generation signatures of local selection in the panmictic European eel.

    PubMed

    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Munch, K; Jónsson, B; Jian, J B; Cheng, L; Maes, G E; Bernatchez, L; Hansen, M M

    2014-05-01

    Next-generation sequencing and the collection of genome-wide data allow identifying adaptive variation and footprints of directional selection. Using a large SNP data set from 259 RAD-sequenced European eel individuals (glass eels) from eight locations between 34 and 64(o) N, we examined the patterns of genome-wide genetic diversity across locations. We tested for local selection by searching for increased population differentiation using F(ST) -based outlier tests and by testing for significant associations between allele frequencies and environmental variables. The overall low genetic differentiation found (F(ST) = 0.0007) indicates that most of the genome is homogenized by gene flow, providing further evidence for genomic panmixia in the European eel. The lack of genetic substructuring was consistent at both nuclear and mitochondrial SNPs. Using an extensive number of diagnostic SNPs, results showed a low occurrence of hybrids between European and American eel, mainly limited to Iceland (5.9%), although individuals with signatures of introgression several generations back in time were found in mainland Europe. Despite panmixia, a small set of SNPs showed high genetic differentiation consistent with single-generation signatures of spatially varying selection acting on glass eels. After screening 50 354 SNPs, a total of 754 potentially locally selected SNPs were identified. Candidate genes for local selection constituted a wide array of functions, including calcium signalling, neuroactive ligand-receptor interaction and circadian rhythm. Remarkably, one of the candidate genes identified is PERIOD, possibly related to differences in local photoperiod associated with the >30° difference in latitude between locations. Genes under selection were spread across the genome, and there were no large regions of increased differentiation as expected when selection occurs within just a single generation due to panmixia. This supports the conclusion that most of the genome is

  16. Genome-wide characterization of microsatelittes and marker development in the carcinogenic liver fluke Clonorchis sinensis

    PubMed Central

    Nguyen, Thao T.B.; Arimatsu, Yuji; Hong, Sung-Jong; Brindley, Paul J.; Blair, David; Laha, Thewarach; Sripa, Banchob

    2015-01-01

    Clonorchis sinensis is an important carcinogenic human liver fluke endemic in East and Southeast Asia. There are several conventional molecular markers have been used for identification and genetic diversity, however, no information about microsatellites of this liver fluke published so far. We here report microsatellite characterization and marker development for genetic diversity study in C. sinensis using genome-wide bioinformatics approach. Based on our search criteria, a total of 256,990 microsatellites (≥ 12 base pairs) were identified from genome database of C. sinensis with hexa-nucleotide motif being the most abundant (51%) followed by penta-nucleotide (18.3%) and tri-nucleotide (12.7%). The tetra-nucleotide, di-nucleotide and mononucleotide motifs accounted for 9.75 %, 7.63% and 0.14%, respectively. The total length of all microsatellites accounts for 0. 72 % of 547 Mb of the whole genome size and the frequency of microsatellites were found to be one microsatellite in every 2.13 kb of DNA. For the di-, tri, and tetra-nucleotide, the repeat numbers redundant are six (28%), four (45%) and three (76%), respectively. The ATC repeat is the most abundant microsatellites followed by AT, AAT and AC, respectively. Within 40 microsatellite loci developed, 24 microsatellite markers showed potential to differentiate between C. sinensis and O. viverrini. Seven out of 24 loci showed heterozygous with observed heterozygosity ranged from 0.467 to 1. Four-primer sets could amplify both C. sinensis and O. viverrini DNA with different sizes. This study provides basic information of C. sinensis microsatellites and the genome-wide markers developed may be a useful tool for genetic study of C. sinensis. PMID:25782682

  17. Identification of a novel susceptibility locus for juvenile idiopathic arthritis by genome-wide association analysis

    PubMed Central

    Hinks, Anne; Barton, Anne; Shephard, Neil; Eyre, Steve; Bowes, John; Cargill, Michele; Wang, Eric; Ke, Xiayi; Kennedy, Giulia C; John, Sally; Worthington, Jane; Thomson, Wendy

    2009-01-01

    Objective Juvenile idiopathic arthritis (JIA) is a chronic rheumatic disease of childhood. Two well-established genetic factors known to contribute to JIA susceptibility, HLA and PTPN22, account for less than half of the genetic susceptibility to disease; therefore, additional genetic factors have yet to be identified. The purpose of this study was to perform a systematic search of the genome to identify novel susceptibility loci for JIA. Methods A genome-wide association study using Affymetrix GeneChip 100K arrays was performed in a discovery cohort (279 cases and 184 controls). Single-nucleotide polymorphisms (SNPs) showing the most significant differences between cases and controls were then genotyped in a validation sample of cases (n = 321) and controls, combined with control data from the 1958 UK birth cohort (n = 2,024). In one region in which association was confirmed, fine-mapping was performed (654 cases and 1,847 controls). Results Of the 112 SNPs that were significantly associated with JIA in the discovery cohort, 6 SNPs were associated with JIA in the independent validation cohort. The most strongly associated SNP mapped to the HLA region, while the second strongest association was with a SNP within the VTCN1 gene. Fine-mapping of that gene was performed, and 10 SNPs were found to be associated with JIA. Conclusion This study is the first to successfully apply a SNP-based genome-wide association approach to the investigation of JIA. The replicated association with markers in the VTCN1 gene defined an additional susceptibility locus for JIA and implicates a novel pathway in the pathogenesis of this chronic disease of childhood. PMID:19116933

  18. A genome-wide association study identifies CDHR3 as a susceptibility locus for early childhood asthma with severe exacerbations.

    PubMed

    Bønnelykke, Klaus; Sleiman, Patrick; Nielsen, Kasper; Kreiner-Møller, Eskil; Mercader, Josep M; Belgrave, Danielle; den Dekker, Herman T; Husby, Anders; Sevelsted, Astrid; Faura-Tellez, Grissel; Mortensen, Li Juel; Paternoster, Lavinia; Flaaten, Richard; Mølgaard, Anne; Smart, David E; Thomsen, Philip F; Rasmussen, Morten A; Bonàs-Guarch, Silvia; Holst, Claus; Nohr, Ellen A; Yadav, Rachita; March, Michael E; Blicher, Thomas; Lackie, Peter M; Jaddoe, Vincent W V; Simpson, Angela; Holloway, John W; Duijts, Liesbeth; Custovic, Adnan; Davies, Donna E; Torrents, David; Gupta, Ramneek; Hollegaard, Mads V; Hougaard, David M; Hakonarson, Hakon; Bisgaard, Hans

    2014-01-01

    Asthma exacerbations are among the most frequent causes of hospitalization during childhood, but the underlying mechanisms are poorly understood. We performed a genome-wide association study of a specific asthma phenotype characterized by recurrent, severe exacerbations occurring between 2 and 6 years of age in a total of 1,173 cases and 2,522 controls. Cases were identified from national health registries of hospitalization, and DNA was obtained from the Danish Neonatal Screening Biobank. We identified five loci with genome-wide significant association. Four of these, GSDMB, IL33, RAD50 and IL1RL1, were previously reported as asthma susceptibility loci, but the effect sizes for these loci in our cohort were considerably larger than in the previous genome-wide association studies of asthma. We also obtained strong evidence for a new susceptibility gene, CDHR3 (encoding cadherin-related family member 3), which is highly expressed in airway epithelium. These results demonstrate the strength of applying specific phenotyping in the search for asthma susceptibility genes. PMID:24241537

  19. On the identification of potential regulatory variants within genome wide association candidate SNP sets

    PubMed Central

    2014-01-01

    Background Genome wide association studies (GWAS) are a population-scale approach to the identification of segments of the genome in which genetic variations may contribute to disease risk. Current methods focus on the discovery of single nucleotide polymorphisms (SNPs) associated with disease traits. As there are many SNPs within identified risk loci, and the majority of these are situated within non-coding regions, a key challenge is to identify and prioritize variants affecting regulatory sequences that are likely to contribute to the phenotype assessed. Methods We focused investigation on SNPs within lung and breast cancer GWAS loci that reached genome-wide significance for potential roles in gene regulation with a specific focus on SNPs likely to disrupt transcription factor binding sites. Within risk loci, the regulatory potential of sub-regions was classified using relevant open chromatin and epigenetic high throughput sequencing data sets from the ENCODE project in available cancer and normal cell lines. Furthermore, transcription factor affinity altering variants were predicted by comparison of position weight matrix scores between disease and reference alleles. Lastly, ChIP-seq data of transcription associated factors and topological domains were included as binding evidence and potential gene target inference. Results The sets of SNPs, including both the disease-associated markers and those in high linkage disequilibrium with them, were significantly over-represented in regulatory sequences of cancer and/or normal cells; however, over-representation was generally not restricted to disease-relevant tissue specific regions. The calculated regulatory potential, allelic binding affinity scores and ChIP-seq binding evidence were the three criteria used to prioritize candidates. Fitting all three criteria, we highlighted breast cancer susceptibility SNPs and a borderline lung cancer relevant SNP located in cancer-specific enhancers overlapping multiple

  20. Genome-wide association study reveals novel variants for growth and egg traits in Dongxiang blue-shelled and White Leghorn chickens.

    PubMed

    Liao, R; Zhang, X; Chen, Q; Wang, Z; Wang, Q; Yang, C; Pan, Y

    2016-10-01

    This study was designed to investigate the genetic basis of growth and egg traits in Dongxiang blue-shelled chickens and White Leghorn chickens. In this study, we employed a reduced representation sequencing approach called genotyping by genome reducing and sequencing to detect genome-wide SNPs in 252 Dongxiang blue-shelled chickens and 252 White Leghorn chickens. The Dongxiang blue-shelled chicken breed has many specific traits and is characterized by blue-shelled eggs, black plumage, black skin, black bone and black organs. The White Leghorn chicken is an egg-type breed with high productivity. As multibreed genome-wide association studies (GWASs) can improve precision due to less linkage disequilibrium across breeds, a multibreed GWAS was performed with 156 575 SNPs to identify the associated variants underlying growth and egg traits within the two chicken breeds. The analysis revealed 32 SNPs exhibiting a significant genome-wide association with growth and egg traits. Some of the significant SNPs are located in genes that are known to impact growth and egg traits, but nearly half of the significant SNPs are located in genes with unclear functions in chickens. To our knowledge, this is the first multibreed genome-wide report for the genetics of growth and egg traits in the Dongxiang blue-shelled and White Leghorn chickens. PMID:27166871

  1. Genome-wide association study of colorectal cancer in Hispanics

    PubMed Central

    Schmit, Stephanie L.; Schumacher, Fredrick R.; Edlund, Christopher K.; Conti, David V.; Ihenacho, Ugonna; Wan, Peggy; Van Den Berg, David; Casey, Graham; Fortini, Barbara K.; Lenz, Heinz-Josef; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A.; Moreno-Macías, Hortensia; Huerta-Chagoya, Alicia; Ordóñez-Sánchez, María Luisa; Rodríguez-Guillén, Rosario; Cruz-Bautista, Ivette; Rodríguez-Torres, Maribel; Muñóz-Hernández, Linda Liliana; Arellano-Campos, Olimpia; Gómez, Donají; Alvirde, Ulices; González-Villalpando, Clicerio; González-Villalpando, María Elena; Le Marchand, Loic; Haiman, Christopher A.; Figueiredo, Jane C.

    2016-01-01

    Genome-wide association studies (GWAS) have identified 58 susceptibility alleles across 37 regions associated with the risk of colorectal cancer (CRC) with P < 5×10−8. Most studies have been conducted in non-Hispanic whites and East Asians; however, the generalizability of these findings and the potential for ethnic-specific risk variation in Hispanic and Latino (HL) individuals have been largely understudied. We describe the first GWAS of common genetic variation contributing to CRC risk in HL (1611 CRC cases and 4330 controls). We also examine known susceptibility alleles and implement imputation-based fine-mapping to identify potential ethnicity-specific association signals in known risk regions. We discovered 17 variants across 4 independent regions that merit further investigation due to suggestive CRC associations (P < 1×10−6) at 1p34.3 (rs7528276; Odds Ratio (OR) = 1.86 [95% confidence interval (CI): 1.47–2.36); P = 2.5×10−7], 2q23.3 (rs1367374; OR = 1.37 (95% CI: 1.21–1.55); P = 4.0×10−7), 14q24.2 (rs143046984; OR = 1.65 (95% CI: 1.36–2.01); P = 4.1×10−7) and 16q12.2 [rs142319636; OR = 1.69 (95% CI: 1.37–2.08); P=7.8×10−7]. Among the 57 previously published CRC susceptibility alleles with minor allele frequency ≥1%, 76.5% of SNPs had a consistent direction of effect and 19 (33.3%) were nominally statistically significant (P < 0.05). Further, rs185423955 and rs60892987 were identified as novel secondary susceptibility variants at 3q26.2 (P = 5.3×10–5) and 11q12.2 (P = 6.8×10−5), respectively. Our findings demonstrate the importance of fine mapping in HL. These results are informative for variant prioritization in functional studies and future risk prediction modeling in minority populations. PMID:27207650

  2. Genome-wide analysis of alternative splicing in Chlamydomonas reinhardtii

    PubMed Central

    2010-01-01

    Background Genome-wide computational analysis of alternative splicing (AS) in several flowering plants has revealed that pre-mRNAs from about 30% of genes undergo AS. Chlamydomonas, a simple unicellular green alga, is part of the lineage that includes land plants. However, it diverged from land plants about one billion years ago. Hence, it serves as a good model system to study alternative splicing in early photosynthetic eukaryotes, to obtain insights into the evolution of this process in plants, and to compare splicing in simple unicellular photosynthetic and non-photosynthetic eukaryotes. We performed a global analysis of alternative splicing in Chlamydomonas reinhardtii using its recently completed genome sequence and all available ESTs and cDNAs. Results Our analysis of AS using BLAT and a modified version of the Sircah tool revealed AS of 498 transcriptional units with 611 events, representing about 3% of the total number of genes. As in land plants, intron retention is the most prevalent form of AS. Retained introns and skipped exons tend to be shorter than their counterparts in constitutively spliced genes. The splice site signals in all types of AS events are weaker than those in constitutively spliced genes. Furthermore, in alternatively spliced genes, the prevalent splice form has a stronger splice site signal than the non-prevalent form. Analysis of constitutively spliced introns revealed an over-abundance of motifs with simple repetitive elements in comparison to introns involved in intron retention. In almost all cases, AS results in a truncated ORF, leading to a coding sequence that is around 50% shorter than the prevalent splice form. Using RT-PCR we verified AS of two genes and show that they produce more isoforms than indicated by EST data. All cDNA/EST alignments and splice graphs are provided in a website at http://combi.cs.colostate.edu/as/chlamy. Conclusions The extent of AS in Chlamydomonas that we observed is much smaller than observed in

  3. A Foundation for Provitamin A Biofortification of Maize: Genome-Wide Association and Genomic Prediction Models of Carotenoid Levels

    PubMed Central

    Owens, Brenda F.; Lipka, Alexander E.; Magallanes-Lundback, Maria; Tiede, Tyler; Diepenbrock, Christine H.; Kandianis, Catherine B.; Kim, Eunha; Cepela, Jason; Mateos-Hernandez, Maria; Buell, C. Robin; Buckler, Edward S.; DellaPenna, Dean; Gore, Michael A.; Rocheford, Torbert

    2014-01-01

    Efforts are underway for development of crops with improved levels of provitamin A carotenoids to help combat dietary vitamin A deficiency. As a global staple crop with considerable variation in kernel carotenoid composition, maize (Zea mays L.) could have a widespread impact. We performed a genome-wide association study (GWAS) of quantified seed carotenoids across a panel of maize inbreds ranging from light yellow to dark orange in grain color to identify some of the key genes controlling maize grain carotenoid composition. Significant associations at the genome-wide level were detected within the coding regions of zep1 and lut1, carotenoid biosynthetic genes not previously shown to impact grain carotenoid composition in association studies, as well as within previously associated lcyE and crtRB1 genes. We leveraged existing biochemical and genomic information to identify 58 a priori candidate genes relevant to the biosynthesis and retention of carotenoids in maize to test in a pathway-level analysis. This revealed dxs2 and lut5, genes not previously associated with kernel carotenoids. In genomic prediction models, use of markers that targeted a small set of quantitative trait loci associated with carotenoid levels in prior linkage studies were as effective as genome-wide markers for predicting carotenoid traits. Based on GWAS, pathway-level analysis, and genomic prediction studies, we outline a flexible strategy involving use of a small number of genes that can be selected for rapid conversion of elite white grain germplasm, with minimal amounts of carotenoids, to orange grain versions containing high levels of provitamin A. PMID:25258377

  4. A foundation for provitamin A biofortification of maize: genome-wide association and genomic prediction models of carotenoid levels.

    PubMed

    Owens, Brenda F; Lipka, Alexander E; Magallanes-Lundback, Maria; Tiede, Tyler; Diepenbrock, Christine H; Kandianis, Catherine B; Kim, Eunha; Cepela, Jason; Mateos-Hernandez, Maria; Buell, C Robin; Buckler, Edward S; DellaPenna, Dean; Gore, Michael A; Rocheford, Torbert

    2014-12-01

    Efforts are underway for development of crops with improved levels of provitamin A carotenoids to help combat dietary vitamin A deficiency. As a global staple crop with considerable variation in kernel carotenoid composition, maize (Zea mays L.) could have a widespread impact. We performed a genome-wide association study (GWAS) of quantified seed carotenoids across a panel of maize inbreds ranging from light yellow to dark orange in grain color to identify some of the key genes controlling maize grain carotenoid composition. Significant associations at the genome-wide level were detected within the coding regions of zep1 and lut1, carotenoid biosynthetic genes not previously shown to impact grain carotenoid composition in association studies, as well as within previously associated lcyE and crtRB1 genes. We leveraged existing biochemical and genomic information to identify 58 a priori candidate genes relevant to the biosynthesis and retention of carotenoids in maize to test in a pathway-level analysis. This revealed dxs2 and lut5, genes not previously associated with kernel carotenoids. In genomic prediction models, use of markers that targeted a small set of quantitative trait loci associated with carotenoid levels in prior linkage studies were as effective as genome-wide markers for predicting carotenoid traits. Based on GWAS, pathway-level analysis, and genomic prediction studies, we outline a flexible strategy involving use of a small number of genes that can be selected for rapid conversion of elite white grain germplasm, with minimal amounts of carotenoids, to orange grain versions containing high levels of provitamin A.

  5. Genome-wide Association Studies of MRI-defined Brain Infarcts: Meta-analysis from the CHARGE Consortium

    PubMed Central

    Debette, Stephanie; Bis, Joshua C.; Fornage, Myriam; Schmidt, Helena; Ikram, M. Arfan; Sigurdsson, Sigurdur; Heiss, Gerardo; Struchalin, Maksim; Smith, Albert V.; van der Lugt, Aad; DeCarli, Charles; Lumley, Thomas; Knopman, David S.; Enzinger, Christian; Eiriksdottir, Gudny; Koudstaal, Peter J.; DeStefano, Anita L.; Psaty, Bruce M.; Dufouil, Carole; Catellier, Diane J.; Fazekas, Franz; Aspelund, Thor; Aulchenko, Yurii S.; Beiser, Alexa; Rotter, Jerome I.; Tzourio, Christophe; Shibata, Dean K.; Tscherner, Maria; Harris, Tamara B.; Rivadeneira, Fernando; Atwood, Larry D.; Rice, Kenneth; Gottesman, Rebecca F.; van Buchem, Mark A.; Uitterlinden, Andre G.; Kelly-Hayes, Margaret; Cushman, Mary; Zhu, Yicheng; Boerwinkle, Eric; Gudnason, Vilmundur; Hofman, Albert; Romero, Jose R.; Lopez, Oscar; van Duijn, Cornelia M.; Au, Rhoda; Heckbert, Susan R.; Wolf, Philip A.; Mosley, Thomas H.; Seshadri, Sudha; Breteler, Monique M.B.; Schmidt, Reinhold; Launer, Lenore J.; Longstreth, WT

    2010-01-01

    Background Previous studies examining genetic associations with MRI-defined brain infarct have yielded inconsistent findings. We investigated genetic variation underlying covert MRI-infarct, in persons without histories of transient ischemic attack or stroke. We performed meta-analysis of genome-wide association studies of white participants in 6 studies comprising the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. Methods Using 2.2 million genotyped and imputed SNPs, each study performed cross-sectional genome-wide association analysis of MRI-infarct using age and sex-adjusted logistic regression models. Study-specific findings were combined in an inverse-variance weighted meta-analysis, including 9401 participants with mean age 69.7, 19.4% of whom had ≥1 MRI-infarct. Results The most significant association was found with rs2208454 (minor allele frequency: 20%), located in intron 3 of MACRO Domain Containing 2 gene and in the downstream region of Fibronectin Leucine Rich Transmembrane Protein 3 gene. Each copy of the minor allele was associated with lower risk of MRI-infarcts: odds ratio=0.76, 95% confidence interval=0.68–0.84, p=4.64×10−7. Highly suggestive associations (p<1.0×10−5) were also found for 22 other SNPs in linkage disequilibrium (r2>0.64) with rs2208454. The association with rs2208454 did not replicate in independent samples of 1822 white and 644 African-American participants, although 4 SNPs within 200kb from rs2208454 were associated with MRI-infarcts in African-American sample. Conclusions This first community-based, genome-wide association study on covert MRI-infarcts uncovered novel associations. Although replication of the association with top SNP failed, possibly due to insufficient power, results in the African American sample are encouraging, and further efforts at replication are needed. PMID:20044523

  6. Assessment of the functionality of genome-wide canine SNP arrays and implications for canine disease association studies.

    PubMed

    Ke, X; Kennedy, L J; Short, A D; Seppälä, E H; Barnes, A; Clements, D N; Wood, S H; Carter, S D; Happ, G M; Lohi, H; Ollier, W E R

    2011-04-01

    Domestic dogs share a wide range of important disease conditions with humans, including cancers, diabetes and epilepsy. Many of these conditions have similar or identical underlying pathologies to their human counterparts and thus dogs represent physiologically relevant natural models of human disorders. Comparative genomic approaches whereby disease genes can be identified in dog diseases and then mapped onto the human genome are now recognized as a valid method and are increasing in popularity. The majority of dog breeds have been created over the past few hundred years and, as a consequence, the dog genome is characterized by extensive linkage disequilibrium (LD), extending usually from hundreds of kilobases to several megabases within a breed, rather than tens of kilobases observed in the human genome. Genome-wide canine SNP arrays have been developed, and increasing success of using these arrays to map disease loci in dogs is emerging. No equivalent of the human HapMap currently exists for different canine breeds, and the LD structure for such breeds is far less understood than for humans. This study is a dedicated large-scale assessment of the functionalities (LD and SNP tagging performance) of canine genome-wide SNP arrays in multiple domestic dog breeds. We have used genotype data from 18 breeds as well as wolves and coyotes genotyped by the Illumina 22K canine SNP array and Affymetrix 50K canine SNP array. As expected, high tagging performance was observed with most of the breeds using both Illumina and Affymetrix arrays when multi-marker tagging was applied. In contrast, however, large differences in population structure, LD coverage and pairwise tagging performance were found between breeds, suggesting that study designs should be carefully assessed for individual breeds before undertaking genome-wide association studies (GWAS).

  7. Evidence for linkage of a new region (11p14) to eczema and allergic diseases

    PubMed Central

    Guilloud-Bataille, Michel; Bouzigon, Emmanuelle; Annesi-Maesano, Isabella; Bousquet, Jean; Charpin, Denis; Gormand, Frédéric; Hochez, Joëlle; Just, Jocelyne; Lemainque, Arnaud; Le Moual, Nicole; Matran, Régis; Neukirch, Françoise; Oryszczyn, Marie-Pierre; Paty, Evelyne; Pin, Isabelle; Vervloet, Daniel; Kauffmann, Francine; Lathrop, Mark; Demenais, Florence; Dizier, Marie-Hélène

    2008-01-01

    SUMMARY Asthma, allergic rhinitis (AR) and atopic dermatitis also called eczema are allergic co-morbidites which are likely to depend on pleiotropic genetic effects as well as on specific genetic factors. After a previous genome-wide linkage screen conducted for asthma and AR in a sample of 295 French EGEA families ascertained through asthmatic subjects, the aim here was to search for genetic factors involved in eczema and more particularly those ones shared by the three allergic diseases using the same EGEA data. In this sake, eczema and phenotypes of ‘allergic disease’ accounting for the joint information on the presence/absence of the three diseases were examined by linkage analyses using the Maximum Likelihood Binomial (MLB) method. A fine mapping was carried out in regions detected for potential linkage, followed by association studies using the Family Based Association Test (FBAT). Evidence for linkage to 11p14 region was shown for ‘allergic disease’ and eczema. Linkage was also indicated between eczema and 5q13 and between ‘allergic disease’ and both 5p15 and 17q21 regions. Fine mapping supported the evidence of linkage to 11p14 and FBAT analyses showed association between ‘allergic disease’ and a marker located at the linkage peak on 11p14. Further investigations in this region will allow identifying genetic factor(s) which could have pleiotropic effect in the three allergic diseases. PMID:17943316

  8. Genome-wide screening and identification of antigens for rickettsial vaccine development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The capacity to identify immunogens for vaccine development by genome-wide screening has been markedly enhanced by the availability of complete microbial genome sequences coupled to rapid proteomic and bioinformatic analysis. Critical to this genome-wide screening is in vivo testing in the context o...

  9. Assessing Genome-Wide Statistical Significance for Large p Small n Problems

    PubMed Central

    Diao, Guoqing; Vidyashankar, Anand N.

    2013-01-01

    Assessing genome-wide statistical significance is an important issue in genetic studies. We describe a new resampling approach for determining the appropriate thresholds for statistical significance. Our simulation results demonstrate that the proposed approach accurately controls the genome-wide type I error rate even under the large p small n situations. PMID:23666935

  10. Assessing genome-wide statistical significance for large p small n problems.

    PubMed

    Diao, Guoqing; Vidyashankar, Anand N

    2013-07-01

    Assessing genome-wide statistical significance is an important issue in genetic studies. We describe a new resampling approach for determining the appropriate thresholds for statistical significance. Our simulation results demonstrate that the proposed approach accurately controls the genome-wide type I error rate even under the large p small n situations.

  11. Family-Based Genome-Wide Association Scan of Attention-Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Mick, Eric; Todorov, Alexandre; Smalley, Susan; Hu, Xiaolan; Loo, Sandra; Todd, Richard D.; Biederman, Joseph; Byrne, Deirdre; Dechairo, Bryan; Guiney, Allan; McCracken, James; McGough, James; Nelson, Stanley F.; Reiersen, Angela M.; Wilens, Timothy E.; Wozniak, Janet; Neale, Benjamin M.; Faraone, Stephen V.

    2010-01-01

    Objective: Genes likely play a substantial role in the etiology of attention-deficit/hyperactivity disorder (ADHD). However, the genetic architecture of the disorder is unknown, and prior genome-wide association studies (GWAS) have not identified a genome-wide significant association. We have conducted a third, independent, multisite GWAS of…

  12. Case-Control Genome-Wide Association Study of Attention-Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Neale, Benjamin M.; Medland, Sarah; Ripke, Stephan; Anney, Richard J. L.; Asherson, Philip; Buitelaar, Jan; Franke, Barbara; Gill, Michael; Kent, Lindsey; Holmans, Peter; Middleton, Frank; Thapar, Anita; Lesch, Klaus-Peter; Faraone, Stephen V.; Daly, Mark; Nguyen, Thuy Trang; Schafer, Helmut; Steinhausen, Hans-Christoph; Reif, Andreas; Renner, Tobias J.; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Freitag, Christine; Meyer, Jobst; Palmason, Haukur; Rothenberger, Aribert; Hawi, Ziarih; Sergeant, Joseph; Roeyers, Herbert; Mick, Eric; Biederman, Joseph

    2010-01-01

    Objective: Although twin and family studies have shown attention-deficit/hyperactivity disorder (ADHD) to be highly heritable, genetic variants influencing the trait at a genome-wide significant level have yet to be identified. Thus additional genome-wide association studies (GWAS) are needed. Method: We used case-control analyses of 896 cases…

  13. Meta-Analysis of Genome-Wide Association Studies of Attention-Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Neale, Benjamin M.; Medland, Sarah E.; Ripke, Stephan; Asherson, Philip; Franke, Barbara; Lesch, Klaus-Peter; Faraone, Stephen V.; Nguyen, Thuy Trang; Schafer, Helmut; Holmans, Peter; Daly, Mark; Steinhausen, Hans-Christoph; Freitag, Christine; Reif, Andreas; Renner, Tobias J.; Romanos, Marcel; Romanos, Jasmin; Walitza, Susanne; Warnke, Andreas; Meyer, Jobst; Palmason, Haukur; Buitelaar, Jan; Vasquez, Alejandro Arias; Lambregts-Rommelse, Nanda; Gill, Michael; Anney, Richard J. L.; Langely, Kate; O'Donovan, Michael; Williams, Nigel; Owen, Michael; Thapar, Anita; Kent, Lindsey; Sergeant, Joseph; Roeyers, Herbert; Mick, Eric; Biederman, Joseph; Doyle, Alysa; Smalley, Susan; Loo, Sandra; Hakonarson, Hakon; Elia, Josephine; Todorov, Alexandre; Miranda, Ana; Mulas, Fernando; Ebstein, Richard P.; Rothenberger, Aribert; Banaschewski, Tobias; Oades, Robert D.; Sonuga-Barke, Edmund; McGough, James; Nisenbaum, Laura; Middleton, Frank; Hu, Xiaolan; Nelson, Stan

    2010-01-01

    Objective: Although twin and family studies have shown attention-deficit/hyperactivity disorder (ADHD) to be highly heritable, genetic variants influencing the trait at a genome-wide significant level have yet to be identified. As prior genome-wide association studies (GWAS) have not yielded significant results, we conducted a meta-analysis of…

  14. Genome-wide association for grain morphology in synthetic hexaploid wheats using digital imaging analysis

    PubMed Central

    2014-01-01

    Background Grain size and shape greatly influence grain weight which ultimately enhances grain yield in wheat. Digital imaging (DI) based phenomic characterization can capture the three dimensional variation in grain size and shape than has hitherto been possible. In this study, we report the results from using digital imaging of grain size and shape to understand the relationship among different components of this trait, their contribution to enhance grain weight, and to identify genomic regions (QTLs) controlling grain morphology using genome wide association mapping with high density diversity array technology (DArT) and allele-specific markers. Results Significant positive correlations were observed between grain weight and grain size measurements such as grain length (r = 0.43), width, thickness (r = 0.64) and factor from density (FFD) (r = 0.69). A total of 231 synthetic hexaploid wheats (SHWs) were grouped into five different sub-clusters by Bayesian structure analysis using unlinked DArT markers. Linkage disequilibrium (LD) decay was observed among DArT loci > 10 cM distance and approximately 28% marker pairs were in significant LD. In total, 197 loci over 60 chromosomal regions and 79 loci over 31 chromosomal regions were associated with grain morphology by genome wide analysis using general linear model (GLM) and mixed linear model (MLM) approaches, respectively. They were mainly distributed on homoeologous group 2, 3, 6 and 7 chromosomes. Twenty eight marker-trait associations (MTAs) on the D genome chromosomes 2D, 3D and 6D may carry novel alleles with potential to enhance grain weight due to the use of untapped wild accessions of Aegilops tauschii. Statistical simulations showed that favorable alleles for thousand kernel weight (TKW), grain length, width and thickness have additive genetic effects. Allelic variations for known genes controlling grain size and weight, viz. TaCwi-2A, TaSus-2B, TaCKX6-3D and TaGw2-6A, were also associated

  15. Genome-Wide Analysis of Seed Acid Detergent Lignin (ADL) and Hull Content in Rapeseed (Brassica napus L.).

    PubMed

    Wang, Jia; Jian, Hongju; Wei, Lijuan; Qu, Cunmin; Xu, Xinfu; Lu, Kun; Qian, Wei; Li, Jiana; Li, Maoteng; Liu, Liezhao

    2015-01-01

    A stable yellow-seeded variety is the breeding goal for obtaining the ideal rapeseed (Brassica napus L.) plant, and the amount of acid detergent lignin (ADL) in the seeds and the hull content (HC) are often used as yellow-seeded rapeseed screening indices. In this study, a genome-wide association analysis of 520 accessions was performed using the Q + K model with a total of 31,839 single-nucleotide polymorphism (SNP) sites. As a result, three significant associations on the B. napus chromosomes A05, A09, and C05 were detected for seed ADL content. The peak SNPs were within 9.27, 14.22, and 20.86 kb of the key genes BnaA.PAL4, BnaA.CAD2/BnaA.CAD3, and BnaC.CCR1, respectively. Further analyses were performed on the major locus of A05, which was also detected in the seed HC examination. A comparison of our genome-wide association study (GWAS) results and previous linkage mappings revealed a common chromosomal region on A09, which indicates that GWAS can be used as a powerful complementary strategy for dissecting complex traits in B. napus. Genomic selection (GS) utilizing the significant SNP markers based on the GWAS results exhibited increased predictive ability, indicating that the predictive ability of a given model can be substantially improved by using GWAS and GS.

  16. Genome-Wide Analysis of Seed Acid Detergent Lignin (ADL) and Hull Content in Rapeseed (Brassica napus L.).

    PubMed

    Wang, Jia; Jian, Hongju; Wei, Lijuan; Qu, Cunmin; Xu, Xinfu; Lu, Kun; Qian, Wei; Li, Jiana; Li, Maoteng; Liu, Liezhao

    2015-01-01

    A stable yellow-seeded variety is the breeding goal for obtaining the ideal rapeseed (Brassica napus L.) plant, and the amount of acid detergent lignin (ADL) in the seeds and the hull content (HC) are often used as yellow-seeded rapeseed screening indices. In this study, a genome-wide association analysis of 520 accessions was performed using the Q + K model with a total of 31,839 single-nucleotide polymorphism (SNP) sites. As a result, three significant associations on the B. napus chromosomes A05, A09, and C05 were detected for seed ADL content. The peak SNPs were within 9.27, 14.22, and 20.86 kb of the key genes BnaA.PAL4, BnaA.CAD2/BnaA.CAD3, and BnaC.CCR1, respectively. Further analyses were performed on the major locus of A05, which was also detected in the seed HC examination. A comparison of our genome-wide association study (GWAS) results and previous linkage mappings revealed a common chromosomal region on A09, which indicates that GWAS can be used as a powerful complementary strategy for dissecting complex traits in B. napus. Genomic selection (GS) utilizing the significant SNP markers based on the GWAS results exhibited increased predictive ability, indicating that the predictive ability of a given model can be substantially improved by using GWAS and GS. PMID:26673885

  17. Genome-Wide Analysis of Seed Acid Detergent Lignin (ADL) and Hull Content in Rapeseed (Brassica napus L.)

    PubMed Central

    Wei, Lijuan; Qu, Cunmin; Xu, Xinfu; Lu, Kun; Qian, Wei; Li, Jiana; Li, Maoteng; Liu, Liezhao

    2015-01-01

    A stable yellow-seeded variety is the breeding goal for obtaining the ideal rapeseed (Brassica napus L.) plant, and the amount of acid detergent lignin (ADL) in the seeds and the hull content (HC) are often used as yellow-seeded rapeseed screening indices. In this study, a genome-wide association analysis of 520 accessions was performed using the Q + K model with a total of 31,839 single-nucleotide polymorphism (SNP) sites. As a result, three significant associations on the B. napus chromosomes A05, A09, and C05 were detected for seed ADL content. The peak SNPs were within 9.27, 14.22, and 20.86 kb of the key genes BnaA.PAL4, BnaA.CAD2/BnaA.CAD3, and BnaC.CCR1, respectively. Further analyses were performed on the major locus of A05, which was also detected in the seed HC examination. A comparison of our genome-wide association study (GWAS) results and previous linkage mappings revealed a common chromosomal region on A09, which indicates that GWAS can be used as a powerful complementary strategy for dissecting complex traits in B. napus. Genomic selection (GS) utilizing the significant SNP markers based on the GWAS results exhibited increased predictive ability, indicating that the predictive ability of a given model can be substantially improved by using GWAS and GS. PMID:26673885

  18. Genetic Variation and Population Substructure in Outbred CD-1 Mice: Implications for Genome-Wide Association Studies

    PubMed Central

    Aldinger, Kimberly A.; Sokoloff, Greta; Rosenberg, David M.; Palmer, Abraham A.; Millen, Kathleen J.

    2009-01-01

    Outbred laboratory mouse populations are widely used in biomedical research. Since little is known about the degree of genetic variation present in these populations, they are not widely used for genetic studies. Commercially available outbred CD-1 mice are drawn from an extremely large breeding population that has accumulated many recombination events, which is desirable for genome-wide association studies. We therefore examined the degree of genome-wide variation within CD-1 mice to investigate their suitability for genetic studies. The CD-1 mouse genome displays patterns of linkage disequilibrium and heterogeneity similar to wild-caught mice. Population substructure and phenotypic differences were observed among CD-1 mice obtained from different breeding facilities. Differences in genetic variation among CD-1 mice from distinct facilities were similar to genetic differences detected between closely related human populations, consistent with a founder effect. This first large-scale genetic analysis of the outbred CD-1 mouse strain provides important considerations for the design and analysis of genetic studies in CD-1 mice. PMID:19266100

  19. Neuroinformatics for genome-wide 3D gene expression mapping in the mouse brain.

    PubMed

    Ng, Lydia; Pathak, Sayan D; Kuan, Chihchau; Lau, Chris; Dong, Hongwei; Sodt, Andrew; Dang, Chinh; Avants, Brian; Yushkevich, Paul; Gee, James C; Haynor, David; Lein, Ed; Jones, Allan; Hawrylycz, Mike

    2007-01-01

    Large scale gene expression studies in the mammalian brain offer the promise of understanding the topology, networks and ultimately the function of its complex anatomy, opening previously unexplored avenues in neuroscience. High-throughput methods permit genome-wide searches to discover genes that are uniquely expressed in brain circuits and regions that control behavior. Previous gene expression mapping studies in model organisms have employed situ hybridization (ISH), a technique that uses labeled nucleic acid probes to bind to specific mRNA transcripts in tissue sections. A key requirement for this effort is the development of fast and robust algorithms for anatomically mapping and quantifying gene expression for ISH. We describe a neuroinformatics pipeline for automatically mapping expression profiles of ISH data and its use to produce the first genomic scale 3-D mapping of gene expression in a mammalian brain. The pipeline is fully automated and adaptable to other organisms and tissues. Our automated study of over 20,000 genes indicates that at least 78.8 percent are expressed at some level in the adult C56BL/6J mouse brain. In addition to providing a platform for genomic scale search, high-resolution images and visualization tools for expression analysis are available at the Allen Brain Atlas web site (http://www.brain-map.org).

  20. More heritability probably captured by psoriasis genome-wide association study in Han Chinese.

    PubMed

    Jiang, Long; Liu, Lu; Cheng, Yuyan; Lin, Yan; Shen, Changbing; Zhu, Caihong; Yang, Sen; Yin, Xianyong; Zhang, Xuejun

    2015-11-15

    Missing heritability is a common problem in genome-wide association studies in complex diseases/traits. To quantify the unbiased heritability estimate, we applied the phenotype correlation-genotype correlation regression in psoriasis genome-wide association data in Han Chinese which comprises 1139 cases and 1132 controls. We estimated that 45.7% heritability of psoriasis in Han Chinese were captured by common variants (s.e.=12.5%), which reinforced that the majority of psoriasis heritability can be covered by common variants in genome-wide association data (68.2%). The results provided evidence that the heritability covered by psoriasis genome-wide genotyping data was probably underestimated in previous restricted maximum likelihood method. Our study highlights the broad role of common variants in the etiology of psoriasis and sheds light on the possibility to identify more common variants of small effect by increasing the sample size in psoriasis genome-wide association studies.

  1. Search for linkage to schizophrenia on the X and Y chromosomes

    SciTech Connect

    Devoto, M.; Ott, J.; Vita, A.

    1994-06-15

    Markers for X chromosome loci were used in linkage studies of a large group of small families (n = 126) with at least two schizophrenic members in one sibship. Based on the hypothesis that a gene for schizophrenia could be X-Y linked, with homologous loci on both X and Y, our analyses included all families regardless of the pattern of familial inheritance. Lod scores were computed with both standard X-linked and a novel X-Y model, and sib-pair analyses were performed for all markers examining the sharing of maternal alleles. Small positive lod scores were obtained for loci pericentromeric, from Xp11.4 to Xq12. Lod scores were also computed separately in families selected for evidence of maternal inheritance and absence of male to male transmission of psychosis. The lod scores for linkage to the locus DXS7 reached a maximum of 1.83 at 0.08% recombination, assuming dominant inheritance on the X chromosome in these families (n = 34). Further investigation of the X-Y homologous gene hypothesis focussing on this region is warranted. 39 refs. 1 fig., 6 tabs.

  2. Joint analysis of tightly linked SNPs in screening step of genome-wide association studies leads to increased power

    PubMed Central

    Becker, Tim; Herold, Christine

    2009-01-01

    Recent developments in genome-wide association studies (GWAS) have lead to the localization of disease genes for many complex diseases. The scrutiny of the respective publications reveals, first, that statistical analysis is restricted typically to single-marker analysis in the first step, and that, second, the presence of multiple, independently associated SNPs within the same linkage disequilibrium (LD) region is a common phenomenon. Motivated by this observation, we show through a power simulation study that a simultaneous analysis of tightly linked SNPs in the initial GWAS analysis step would lead to increased power, when compared with that in single-marker analysis. This is true for all the three approaches we considered (implementations in BEAGLE, FAMHAP and UNPHASED). The best performance was obtained using a two-marker haplotype analysis. In conclusion, we would expect additional gene findings for re-analyzing successful GWAS with a multi-marker approach. PMID:19223937

  3. Statistical power of model selection strategies for genome-wide association studies.

    PubMed

    Wu, Zheyang; Zhao, Hongyu

    2009-07-01

    Genome-wide association studies (GWAS) aim to identify genetic variants related to diseases by examining the associations between phenotypes and hundreds of thousands of genotyped markers. Because many genes are potentially involved in common diseases and a large number of markers are analyzed, it is crucial to devise an effective strategy to identify truly associated variants that have individual and/or interactive effects, while controlling false positives at the desired level. Although a number of model selection methods have been proposed in the literature, including marginal search, exhaustive search, and forward search, their relative performance has only been evaluated through limited simulations due to the lack of an analytical approach to calculating the power of these methods. This article develops a novel statistical approach for power calculation, derives accurate formulas for the power of different model selection strategies, and then uses the formulas to evaluate and compare these strategies in genetic model spaces. In contrast to previous studies, our theoretical framework allows for random genotypes, correlations among test statistics, and a false-positive control based on GWAS practice. After the accuracy of our analytical results is validated through simulations, they are utilized to systematically evaluate and compare the performance of these strategies in a wide class of genetic models. For a specific genetic model, our results clearly reveal how different factors, such as effect size, allele frequency, and interaction, jointly affect the statistical power of each strategy. An example is provided for the application of our approach to empirical research. The statistical approach used in our derivations is general and can be employed to address the model selection problems in other random predictor settings. We have developed an R package markerSearchPower to implement our formulas, which can be downloaded from the Comprehensive R Archive Network

  4. A genome-wide scan for signatures of differential artificial selection in ten cattle breeds

    PubMed Central

    2013-01-01

    Background Since the times of domestication, cattle have been continually shaped by the influence of humans. Relatively recent history, including breed formation and the still enduring enormous improvement of economically important traits, is expected to have left distinctive footprints of selection within the genome. The purpose of this study was to map genome-wide selection signatures in ten cattle breeds and thus improve the understanding of the genome response to strong artificial selection and support the identification of the underlying genetic variants of favoured phenotypes. We analysed 47,651 single nucleotide polymorphisms (SNP) using Cross Population Extended Haplotype Homozygosity (XP-EHH). Results We set the significance thresholds using the maximum XP-EHH values of two essentially artificially unselected breeds and found up to 229 selection signatures per breed. Through a confirmation process we verified selection for three distinct phenotypes typical for one breed (polledness in Galloway, double muscling in Blanc-Bleu Belge and red coat colour in Red Holstein cattle). Moreover, we detected six genes strongly associated with known QTL for beef or dairy traits (TG, ABCG2, DGAT1, GH1, GHR and the Casein Cluster) within selection signatures of at least one breed. A literature search for genes lying in outstanding signatures revealed further promising candidate genes. However, in concordance with previous genome-wide studies, we also detected a substantial number of signatures without any yet known gene content. Conclusions These results show the power of XP-EHH analyses in cattle to discover promising candidate genes and raise the hope of identifying phenotypically important variants in the near future. The finding of plausible functional candidates in some short signatures supports this hope. For instance, MAP2K6 is the only annotated gene of two signatures detected in Galloway and Gelbvieh cattle and is already known to be associated with carcass

  5. Genome-wide association study for endocrine fertility traits using single nucleotide polymorphism arrays and sequence variants in dairy cattle.

    PubMed

    Tenghe, A M M; Bouwman, A C; Berglund, B; Strandberg, E; de Koning, D J; Veerkamp, R F

    2016-07-01

    Endocrine fertility traits, which are defined from progesterone concentration levels in milk, are interesting indicators of dairy cow fertility because they more directly reflect the cows own reproductive physiology than classical fertility traits, which are more biased by farm management decisions. The aim of this study was to detect quantitative trait loci (QTL) for 7 endocrine fertility traits in dairy cows by performing a genome-wide association study with 85k single nucleotide polymorphisms (SNP), and then fine-map targeted QTL regions, using imputed sequence variants. Two classical fertility traits were also analyzed for QTL with 85k SNP. The association between a SNP and a phenotype was assessed by single-locus regression for each SNP, using a linear mixed model that included a random polygenic effect. A total of 2,447 Holstein Friesian cows with 5,339 lactations with both phenotypes and genotypes were used for association analysis. Heritability estimates ranged from 0.09 to 0.15 for endocrine fertility traits and 0.03 to 0.10 for classical fertility traits. The genome-wide association study identified 17 QTL regions for endocrine fertility traits on Bos taurus autosomes (BTA) 2, 3, 8, 12, 15, 17, 23, and 25. The highest number (5) of QTL regions from the genome-wide association study was identified for the endocrine trait "proportion of samples with luteal activity." Overlapping QTL regions were found between endocrine traits on BTA 2, 3, and 17. For the classical trait calving to first service, 3 QTL regions were identified on BTA 3, 15, and 23, and an overlapping region was identified on BTA 23 with endocrine traits. Fine-mapping target regions for the endocrine traits on BTA 2 and 3 using imputed sequence variants confirmed the QTL from the genome-wide association study, and identified several associated variants that can contribute to an index of markers for genetic improvement of fertility. Several potential candidate genes underlying endocrine

  6. Genome-wide association study of porcine hematological parameters in a Large White × Minzhu F2 resource population.

    PubMed

    Luo, Weizhen; Chen, Shaokang; Cheng, Duxue; Wang, Ligang; Li, Yong; Ma, Xiaojun; Song, Xin; Liu, Xin; Li, Wen; Liang, Jing; Yan, Hua; Zhao, Kebin; Wang, Chuduan; Wang, Lixian; Zhang, Longchao

    2012-01-01

    Hematological traits, which are important indicators of immune function in animals, have been commonly examined as biomarkers of disease and disease severity in humans and animals. Genome-wide significant quantitative trait loci (QTLs) provide important information for use in breeding programs of animals such as pigs. QTLs for hematological parameters (hematological traits) have been detected in pig chromosomes, although these are often mapped by linkage analysis to large intervals making identification of the underlying mutation problematic. Single nucleotide polymorphisms (SNPs) are the common form of genetic variation among individuals and are thought to account for the majority of inherited traits. In this study, a genome-wide association study (GWAS) was performed to detect regions of association with hematological traits in a three-generation resource population produced by intercrossing Large White boars and Minzhu sows during the period from 2007 to 2011. Illumina PorcineSNP60 BeadChip technology was used to genotype each animal and seven hematological parameters were measured (hematocrit (HCT), hemoglobin (HGB), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), mean corpuscular volume (MCV), red blood cell count (RBC) and red blood cell volume distribution width (RDW)). Data were analyzed in a three step Genome-wide Rapid Association using the Mixed Model and Regression-Genomic Control (GRAMMAR-GC) method. A total of 62 genome-wide significant and three chromosome-wide significant SNPs associated with hematological parameters were detected in this GWAS. Seven and five SNPs were associated with HCT and HGB, respectively. These SNPs were all located within the region of 34.6-36.5 Mb on SSC7. Four SNPs within the region of 43.7-47.0 Mb and fifty-five SNPs within the region of 42.2-73.8 Mb on SSC8 showed significant association with MCH and MCV, respectively. At chromosome-wide significant level, one SNP at 29.2 Mb on SSC1

  7. Genome-Wide Association Studies Identify the Loci for 5 Exterior Traits in a Large White × Minzhu Pig Population

    PubMed Central

    Yan, Hua; Liu, Xin; Li, Na; Liang, Jing; Pu, Lei; Zhang, Yuebo; Shi, Huibi; Zhao, Kebin; Wang, Lixian

    2014-01-01

    As one of the main breeding selection criteria, external appearance has special economic importance in the hog industry. In this study, an Illumina Porcine SNP60 BeadChip was used to conduct a genome-wide association study (GWAS) in 605 pigs of the F2 generation derived from a Large White × Minzhu intercross. Traits under study were abdominal circumference (AC), body height (BH), body length (BL), cannon bone circumference (CBC), chest depth (CD), chest width (CW), rump circumference (RC), rump width (RW), scapula width (SW), and waist width (WW). A total of 138 SNPs (the most significant being MARC0033464) on chromosome 7 were found to be associated with BH, BL, CBC, and RC (P-value  = 4.15E-6). One SNP on chromosome 1 was found to be associated with CD at genome-wide significance levels. The percentage phenotypic variance of these significant SNPs ranged from 0.1–25.48%. Moreover, a conditional analysis revealed that the significant SNPs were derived from a single quantitative trait locus (QTL) and indicated additional chromosome-wide significant association for 25 SNPs on SSC4 (BL, CBC) and 9 SNPs on SSC7 (RC). Linkage analysis revealed two complete linkage disequilibrium haplotype blocks that contained seven and four SNPs, respectively. In block 1, the most significant SNP, MARC0033464, was present. Annotations from pig reference genome suggested six genes (GRM4, HMGA1, NUDT3, RPS10, SPDEF and PACSIN1) in block 1 (495 kb), and one gene (SCUBE3) in block 3 (124 kb). Functional analysis indicated that HMGA1 and SCUBE3 genes are the potential genes controlling BH, BL, and RC in pigs, with an application in breeding programs. We screened several candidate intervals and genes based on SNP location and gene function, and predicted their function using bioinformatics analyses. PMID:25090094

  8. Genome-Wide Differentiation of Various Melon Horticultural Groups for Use in GWAS for Fruit Firmness and Construction of a High Resolution Genetic Map

    PubMed Central

    Nimmakayala, Padma; Tomason, Yan R.; Abburi, Venkata L.; Alvarado, Alejandra; Saminathan, Thangasamy; Vajja, Venkata G.; Salazar, Germania; Panicker, Girish K.; Levi, Amnon; Wechter, William P.; McCreight, James D.; Korol, Abraham B.; Ronin, Yefim; Garcia-Mas, Jordi; Reddy, Umesh K.

    2016-01-01

    Melon (Cucumis melo L.) is a phenotypically diverse eudicot diploid (2n = 2x = 24) has climacteric and non-climacteric morphotypes and show wide variation for fruit firmness, an important trait for transportation and shelf life. We generated 13,789 SNP markers using genotyping-by-sequencing (GBS) and anchored them to chromosomes to understand genome-wide fixation indices (Fst) between various melon morphotypes and genomewide linkage disequilibrium (LD) decay. The FST between accessions of cantalupensis and inodorus was 0.23. The FST between cantalupensis and various agrestis accessions was in a range of 0.19–0.53 and between inodorus and agrestis accessions was in a range of 0.21–0.59 indicating sporadic to wide ranging introgression. The EM (Expectation Maximization) algorithm was used for estimation of 1436 haplotypes. Average genome-wide LD decay for the melon genome was noted to be 9.27 Kb. In the current research, we focused on the genome-wide divergence underlying diverse melon horticultural groups. A high-resolution genetic map with 7153 loci was constructed. Genome-wide segregation distortion and recombination rate across various chromosomes were characterized. Melon has climacteric and non-climacteric morphotypes and wide variation for fruit firmness, a very important trait for transportation and shelf life. Various levels of QTLs were identified with high to moderate stringency and linked to fruit firmness using both genome-wide association study (GWAS) and biparental mapping. Gene annotation revealed some of the SNPs are located in β-D-xylosidase, glyoxysomal malate synthase, chloroplastic anthranilate phosphoribosyltransferase, and histidine kinase, the genes that were previously characterized for fruit ripening and softening in other crops. PMID:27713759

  9. Patterns of Genome-Wide Variation in Glossina fuscipes fuscipes Tsetse Flies from Uganda.

    PubMed

    Gloria-Soria, Andrea; Dunn, W Augustine; Telleria, Erich L; Evans, Benjamin R; Okedi, Loyce; Echodu, Richard; Warren, Wesley C; Montague, Michael J; Aksoy, Serap; Caccone, Adalgisa

    2016-01-01

    The tsetse fly Glossina fuscipes fuscipes (Gff) is the insect vector of the two forms of Human African Trypanosomiasis (HAT) that exist in Uganda. Understanding Gff population dynamics, and the underlying genetics of epidemiologically relevant phenotypes is key to reducing disease transmission. Using ddRAD sequence technology, complemented with whole-genome sequencing, we developed a panel of ∼73,000 single-nucleotide polymorphisms (SNPs) distributed across the Gff genome that can be used for population genomics and to perform genome-wide-association studies. We used these markers to estimate genomic patterns of linkage disequilibrium (LD) in Gff, and used the information, in combination with outlier-locus detection tests, to identify candidate regions of the genome under selection. LD in individual populations decays to half of its maximum value (r(2) max/2) between 1359 and 2429 bp. The overall LD estimated for the species reaches r(2) max/2 at 708 bp, an order of magnitude slower than in Drosophila Using 53 infected (Trypanosoma spp.) and uninfected flies from four genetically distinct Ugandan populations adapted to different environmental conditions, we were able to identify SNPs associated with the infection status of the fly and local environmental adaptation. The extent of LD in Gff likely facilitated the detection of loci under selection, despite the small sample size. Furthermore, it is probable that LD in the regions identified is much higher than the average genomic LD due to strong selection. Our results show that even modest sample sizes can reveal significant genetic associations in this species, which has implications for future studies given the difficulties of collecting field specimens with contrasting phenotypes for association analysis. PMID:27172181

  10. A hidden Markov random field model for genome-wide association studies.

    PubMed

    Li, Hongzhe; Wei, Zhi; Maris, John

    2010-01-01

    Genome-wide association studies (GWAS) are increasingly utilized for identifying novel susceptible genetic variants for complex traits, but there is little consensus on analysis methods for such data. Most commonly used methods include single single nucleotide polymorphism (SNP) analysis or haplotype analysis with Bonferroni correction for multiple comparisons. Since the SNPs in typical GWAS are often in linkage disequilibrium (LD), at least locally, Bonferroni correction of multiple comparisons often leads to conservative error control and therefore lower statistical power. In this paper, we propose a hidden Markov random field model (HMRF) for GWAS analysis based on a weighted LD graph built from the prior LD information among the SNPs and an efficient iterative conditional mode algorithm for estimating the model parameters. This model effectively utilizes the LD information in calculating the posterior probability that an SNP is associated with the disease. These posterior probabilities can then be used to define a false discovery controlling procedure in order to select the disease-associated SNPs. Simulation studies demonstrated the potential gain in power over single SNP analysis. The proposed method is especially effective in identifying SNPs with borderline significance at the single-marker level that nonetheless are in high LD with significant SNPs. In addition, by simultaneously considering the SNPs in LD, the proposed method can also help to reduce the number of false identifications of disease-associated SNPs. We demonstrate the application of the proposed HMRF model using data from a case-control GWAS of neuroblastoma and identify 1 new SNP that is potentially associated with neuroblastoma.

  11. Genome-Wide Scans for Delineation of Candidate Genes Regulating Seed-Protein Content in Chickpea

    PubMed Central

    Upadhyaya, Hari D.; Bajaj, Deepak; Narnoliya, Laxmi; Das, Shouvik; Kumar, Vinod; Gowda, C. L. L.; Sharma, Shivali; Tyagi, Akhilesh K.; Parida, Swarup K.

    2016-01-01

    Identification of potential genes/alleles governing complex seed-protein content (SPC) is essential in marker-assisted breeding for quality trait improvement of chickpea. Henceforth, the present study utilized an integrated genomics-assisted breeding strategy encompassing trait association analysis, selective genotyping in traditional bi-parental mapping population and differential expression profiling for the first-time to understand the complex genetic architecture of quantitative SPC trait in chickpea. For GWAS (genome-wide association study), high-throughput genotyping information of 16376 genome-based SNPs (single nucleotide polymorphism) discovered from a structured population of 336 sequenced desi and kabuli accessions [with 150–200 kb LD (linkage disequilibrium) decay] was utilized. This led to identification of seven most effective genomic loci (genes) associated [10–20% with 41% combined PVE (phenotypic variation explained)] with SPC trait in chickpea. Regardless of the diverse desi and kabuli genetic backgrounds, a comparable level of association potential of the identified seven genomic loci with SPC trait was observed. Five SPC-associated genes were validated successfully in parental accessions and homozygous individuals of an intra-specific desi RIL (recombinant inbred line) mapping population (ICC 12299 × ICC 4958) by selective genotyping. The seed-specific expression, including differential up-regulation (>four fold) of six SPC-associated genes particularly in accessions, parents and homozygous individuals of the aforementioned mapping population with a high level of contrasting SPC (21–22%) was evident. Collectively, the integrated genomic approach delineated diverse naturally occurring novel functional SNP allelic variants in six potential candidate genes regulating SPC trait in chickpea. Of these, a non-synonymous SNP allele-carrying zinc finger transcription factor gene exhibiting strong association with SPC trait was found to be the most

  12. Genome-Wide Scan for Adaptive Divergence and Association with Population-Specific Covariates.

    PubMed

    Gautier, Mathieu

    2015-12-01

    In population genomics studies, accounting for the neutral covariance structure across population allele frequencies is critical to improve the robustness of genome-wide scan approaches. Elaborating on the BayEnv model, this study investigates several modeling extensions (i) to improve the estimation accuracy of the population covariance matrix and all the related measures, (ii) to identify significantly overly differentiated SNPs based on a calibration procedure of the XtX statistics, and (iii) to consider alternative covariate models for analyses of association with population-specific covariables. In particular, the auxiliary variable model allows one to deal with multiple testing issues and, providing the relative marker positions are available, to capture some linkage disequilibrium information. A comprehensive simulation study was carried out to evaluate the performances of these different models. Also, when compared in terms of power, robustness, and computational efficiency to five other state-of-the-art genome-scan methods (BayEnv2, BayScEnv, BayScan, flk, and lfmm), the proposed approaches proved highly effective. For illustration purposes, genotyping data on 18 French cattle breeds were analyzed, leading to the identification of 13 strong signatures of selection. Among these, four (surrounding the KITLG, KIT, EDN3, and ALB genes) contained SNPs strongly associated with the piebald coloration pattern while a fifth (surrounding PLAG1) could be associated to morphological differences across the populations. Finally, analysis of Pool-Seq data from 12 populations of Littorina saxatilis living in two different ecotypes illustrates how the proposed framework might help in addressing relevant ecological issues in nonmodel species. Overall, the proposed methods define a robust Bayesian framework to characterize adaptive genetic differentiation across populations. The BayPass program implementing the different models is available at http://www1.montpellier

  13. Genome-Wide Maps of Circulating miRNA Biomarkers for Ulcerative Colitis

    PubMed Central

    Duttagupta, Radha; DiRienzo, Sharon; Jiang, Rong; Bowers, Jessica; Gollub, Jeremy; Kao, Jessica; Kearney, Keith; Rudolph, David; Dawany, Noor B.; Showe, Michael K.; Stamato, Tom; Getts, Robert C.; Jones, Keith W.

    2012-01-01

    Inflammatory Bowel Disease – comprised of Crohn's Disease and Ulcerative Colitis (UC) - is a complex, multi-factorial inflammatory disorder of the gastrointestinal tract. In this study we have explored the utility of naturally occurring circulating miRNAs as potential blood-based biomarkers for non-invasive prediction of UC incidences. Whole genome maps of circulating miRNAs in micro-vesicles, Peripheral Blood Mononuclear Cells and platelets have been constructed from a cohort of 20 UC patients and 20 normal individuals. Through Significance Analysis of Microarrays, a signature of 31 differentially expressed platelet-derived miRNAs has been identified and biomarker performance estimated through a non-probabilistic binary linear classification using Support Vector Machines. Through this approach, classifier measurements reveal a predictive score of 92.8% accuracy, 96.2% specificity and 89.5% sensitivity in distinguishing UC patients from normal individuals. Additionally, the platelet-derived biomarker signature can be validated at 88% accuracy through qPCR assays, and a majority of the miRNAs in this panel can be demonstrated to sub-stratify into 4 highly correlated intensity based clusters. Analysis of predicted targets of these biomarkers reveal an enrichment of pathways associated with cytoskeleton assembly, transport, membrane permeability and regulation of transcription factors engaged in a variety of regulatory cascades that are consistent with a cell-mediated immune response model of intestinal inflammation. Interestingly, comparison of the miRNA biomarker panel and genetic loci implicated in IBD through genome-wide association studies identifies a physical linkage between hsa-miR-941 and a UC susceptibility loci located on Chr 20. Taken together, analysis of these expression maps outlines a promising catalog of novel platelet-derived miRNA biomarkers of clinical utility and provides insight into the potential biological function of these candidates in

  14. Identification of Genes Promoting Skin Youthfulness by Genome-Wide Association Study

    PubMed Central

    Chang, Anne L.S.; Atzmon, Gil; Bergman, Aviv; Brugmann, Samantha; Atwood, Scott X; Chang, Howard Y; Barzilai, Nir

    2014-01-01

    To identify genes that promote facial skin youthfulness (SY), a genome-wide association study on an Ashkenazi Jewish discovery group (n=428) was performed using Affymetrix 6.0 Single-Nucleotide Polymorphism (SNP) Array. After SNP quality controls, 901,470 SNPs remained for analysis. The eigenstrat method showed no stratification. Cases and controls were identified by global facial skin aging severity including intrinsic and extrinsic parameters. Linear regression adjusted for age and gender, with no significant differences in smoking history, body mass index, menopausal status, or personal or family history of centenarians. Six SNPs met the Bonferroni threshold with Pallele<10−8; two of these six had Pgenotype<10−8. Quantitative trait loci mapping confirmed linkage disequilibrium. The six SNPs were interrogated by MassARRAY in a replication group (n=436) with confirmation of rs6975107, an intronic region of KCND2 (potassium voltage-gated channel, Shal-related family member 2) (Pgenotype=0.023). A second replication group (n=371) confirmed rs318125, downstream of DIAPH2 (diaphanous homolog 2 (Drosophila)) (Pallele=0.010, Pgenotype=0.002) and rs7616661, downstream of EDEM1 (ER degradation enhancer, mannosidase α-like 1) (Pgenotype=0.042). DIAPH2 has been associated with premature ovarian insufficiency, an aging phenotype in humans. EDEM1 associates with lifespan in animal models, although not humans. KCND2 is expressed in human skin, but has not been associated with aging. These genes represent new candidate genes to study the molecular basis of healthy skin aging. PMID:24037343

  15. The genome-wide structure of two economically important indigenous Sicilian cattle breeds.

    PubMed

    Mastrangelo, S; Saura, M; Tolone, M; Salces-Ortiz, J; Di Gerlando, R; Bertolini, F; Fontanesi, L; Sardina, M T; Serrano, M; Portolano, B

    2014-11-01

    Genomic technologies, such as high-throughput genotyping based on SNP arrays, provided background information concerning genome structure in domestic animals. The aim of this work was to investigate the genetic structure, the genome-wide estimates of inbreeding, coancestry, effective population size (Ne), and the patterns of linkage disequilibrium (LD) in 2 economically important Sicilian local cattle breeds, Cinisara (CIN) and Modicana (MOD), using the Illumina Bovine SNP50K v2 BeadChip. To understand the genetic relationship and to place both Sicilian breeds in a global context, genotypes from 134 other domesticated bovid breeds were used. Principal component analysis showed that the Sicilian cattle breeds were closer to individuals of Bos taurus taurus from Eurasia and formed nonoverlapping clusters with other breeds. Between the Sicilian cattle breeds, MOD was the most differentiated, whereas the animals belonging to the CIN breed showed a lower value of assignment, the presence of substructure, and genetic links with the MOD breed. The average molecular inbreeding and coancestry coefficients were moderately high, and the current estimates of Ne were low in both breeds. These values indicated a low genetic variability. Considering levels of LD between adjacent markers, the average r(2) in the MOD breed was comparable to those reported for others cattle breeds, whereas CIN showed a lower value. Therefore, these results support the need of more dense SNP arrays for a high-power association mapping and genomic selection efficiency, particularly for the CIN cattle breed. Controlling molecular inbreeding and coancestry would restrict inbreeding depression, the probability of losing beneficial rare alleles, and therefore the risk of extinction. The results generated from this study have important implications for the development of conservation and/or selection breeding programs in these 2 local cattle breeds.

  16. Genome-wide signatures of population bottlenecks and diversifying selection in European wolves.

    PubMed

    Pilot, M; Greco, C; vonHoldt, B M; Jędrzejewska, B; Randi, E; Jędrzejewski, W; Sidorovich, V E; Ostrander, E A; Wayne, R K

    2014-04-01

    Genomic resources developed for domesticated species provide powerful tools for studying the evolutionary history of their wild relatives. Here we use 61K single-nucleotide polymorphisms (SNPs) evenly spaced throughout the canine nuclear genome to analyse evolutionary relationships among the three largest European populations of grey wolves in comparison with other populations worldwide, and investigate genome-wide effects of demographic bottlenecks and signatures of selection. European wolves have a discontinuous range, with large and connected populations in Eastern Europe and relatively smaller, isolated populations in Italy and the Iberian Peninsula. Our results suggest a continuous decline in wolf numbers in Europe since the Late Pleistocene, and long-term isolation and bottlenecks in the Italian and Iberian populations following their divergence from the Eastern European population. The Italian and Iberian populations have low genetic variability and high linkage disequilibrium, but relatively few autozygous segments across the genome. This last characteristic clearly distinguishes them from populations that underwent recent drastic demographic declines or founder events, and implies long-term bottlenecks in these two populations. Although genetic drift due to spatial isolation and bottlenecks seems to be a major evolutionary force diversifying the European populations, we detected 35 loci that are putatively under diversifying selection. Two of these loci flank the canine platelet-derived growth factor gene, which affects bone growth and may influence differences in body size between wolf populations. This study demonstrates the power of population genomics for identifying genetic signals of demographic bottlenecks and detecting signatures of directional selection in bottlenecked populations, despite their low background variability. PMID:24346500

  17. Genome-Wide Scan for Adaptive Divergence and Association with Population-Specific Covariates.

    PubMed

    Gautier, Mathieu

    2015-12-01

    In population genomics studies, accounting for the neutral covariance structure across population allele frequencies is critical to improve the robustness of genome-wide scan approaches. Elaborating on the BayEnv model, this study investigates several modeling extensions (i) to improve the estimation accuracy of the population covariance matrix and all the related measures, (ii) to identify significantly overly differentiated SNPs based on a calibration procedure of the XtX statistics, and (iii) to consider alternative covariate models for analyses of association with population-specific covariables. In particular, the auxiliary variable model allows one to deal with multiple testing issues and, providing the relative marker positions are available, to capture some linkage disequilibrium information. A comprehensive simulation study was carried out to evaluate the performances of these different models. Also, when compared in terms of power, robustness, and computational efficiency to five other state-of-the-art genome-scan methods (BayEnv2, BayScEnv, BayScan, flk, and lfmm), the proposed approaches proved highly effective. For illustration purposes, genotyping data on 18 French cattle breeds were analyzed, leading to the identification of 13 strong signatures of selection. Among these, four (surrounding the KITLG, KIT, EDN3, and ALB genes) contained SNPs strongly associated with the piebald coloration pattern while a fifth (surrounding PLAG1) could be associated to morphological differences across the populations. Finally, analysis of Pool-Seq data from 12 populations of Littorina saxatilis living in two different ecotypes illustrates how the proposed framework might help in addressing relevant ecological issues in nonmodel species. Overall, the proposed methods define a robust Bayesian framework to characterize adaptive genetic differentiation across populations. The BayPass program implementing the different models is available at http://www1.montpellier.inra.fr/CBGP/software/baypass/.

  18. Genome-wide association study identifies a potent locus associated with human opioid sensitivity

    PubMed Central

    Nishizawa, D; Fukuda, K; Kasai, S; Hasegawa, J; Aoki, Y; Nishi, A; Saita, N; Koukita, Y; Nagashima, M; Katoh, R; Satoh, Y; Tagami, M; Higuchi, S; Ujike, H; Ozaki, N; Inada, T; Iwata, N; Sora, I; Iyo, M; Kondo, N; Won, M-J; Naruse, N; Uehara-Aoyama, K; Itokawa, M; Koga, M; Arinami, T; Kaneko, Y; Hayashida, M; Ikeda, K

    2014-01-01

    Opioids, such as morphine and fentanyl, are widely used as effective analgesics for the treatment of acute and chronic pain. In addition, the opioid system has a key role in the rewarding effects of morphine, ethanol, cocaine and various other drugs. Although opioid sensitivity is well known to vary widely among individual subjects, several candidate genetic polymorphisms reported so far are not sufficient for fully understanding the wide range of interindividual differences in human opioid sensitivity. By conducting a multistage genome-wide association study (GWAS) in healthy subjects, we found that genetic polymorphisms within a linkage disequilibrium block that spans 2q33.3–2q34 were strongly associated with the requirements for postoperative opioid analgesics after painful cosmetic surgery. The C allele of the best candidate single-nucleotide polymorphism (SNP), rs2952768, was associated with more analgesic requirements, and consistent results were obtained in patients who underwent abdominal surgery. In addition, carriers of the C allele in this SNP exhibited less vulnerability to severe drug dependence in patients with methamphetamine dependence, alcohol dependence, and eating disorders and a lower ‘Reward Dependence' score on a personality questionnaire in healthy subjects. Furthermore, the C/C genotype of this SNP was significantly associated with the elevated expression of a neighboring gene, CREB1. These results show that SNPs in this locus are the most potent genetic factors associated with human opioid sensitivity known to date, affecting both the efficacy of opioid analgesics and liability to severe substance dependence. Our findings provide valuable information for the personalized treatment of pain and drug dependence. PMID:23183491

  19. Genome-wide association study of vitamin D concentrations in Hispanic Americans: the IRAS family study.

    PubMed

    Engelman, Corinne D; Meyers, Kristin J; Ziegler, Julie T; Taylor, Kent D; Palmer, Nicholette D; Haffner, Steven M; Fingerlin, Tasha E; Wagenknecht, Lynne E; Rotter, Jerome I; Bowden, Donald W; Langefeld, Carl D; Norris, Jill M

    2010-10-01

    Vitamin D deficiency is associated with many adverse health outcomes. There are several well established environmental predictors of vitamin D concentrations, yet studies of the genetic determinants of vitamin D concentrations are in their infancy. Our objective was to conduct a pilot genome-wide association (GWA) study of 25-hydroxyvitamin D (25[OH]D) and 1,25-dihydroxyvitamin D (1,25[OH](2)D) concentrations in a subset of 229 Hispanic subjects, followed by replication genotyping of 50 single nucleotide polymorphisms (SNPs) in the entire sample of 1190 Hispanics from San Antonio, Texas and San Luis Valley, Colorado. Of the 309,200 SNPs that met all quality control criteria, three SNPs in high linkage disequilibrium (LD) with each other were significantly associated with 1,25[OH](2)D (rs6680429, rs9970802, and rs10889028) at a Bonferroni corrected P-value threshold of 1.62 × 10(-7), however none met the threshold for 25[OH]D. Of the 50 SNPs selected for replication genotyping, five for 25[OH]D (rs2806508, rs10141935, rs4778359, rs1507023, and rs9937918) and eight for 1,25[OH](2)D (rs6680429, rs1348864, rs4559029, rs12667374, rs7781309, rs10505337, rs2486443, and rs2154175) were replicated in the entire sample of Hispanics (P<0.01). In conclusion, we identified several SNPs that were associated with vitamin D metabolite concentrations in Hispanics. These candidate polymorphisms merit further investigation in independent populations and other ethnicities.

  20. Patterns of Genome-Wide Variation in Glossina fuscipes fuscipes Tsetse Flies from Uganda

    PubMed Central

    Gloria-Soria, Andrea; Dunn, W. Augustine; Telleria, Erich L.; Evans, Benjamin R.; Okedi, Loyce; Echodu, Richard; Warren, Wesley C.; Montague, Michael J.; Aksoy, Serap; Caccone, Adalgisa

    2016-01-01

    The tsetse fly Glossina fuscipes fuscipes (Gff) is the insect vector of the two forms of Human African Trypanosomiasis (HAT) that exist in Uganda. Understanding Gff population dynamics, and the underlying genetics of epidemiologically relevant phenotypes is key to reducing disease transmission. Using ddRAD sequence technology, complemented with whole-genome sequencing, we developed a panel of ∼73,000 single-nucleotide polymorphisms (SNPs) distributed across the Gff genome that can be used for population genomics and to perform genome-wide-association studies. We used these markers to estimate genomic patterns of linkage disequilibrium (LD) in Gff, and used the information, in combination with outlier-locus detection tests, to identify candidate regions of the genome under selection. LD in individual populations decays to half of its maximum value (r2max/2) between 1359 and 2429 bp. The overall LD estimated for the species reaches r2max/2 at 708 bp, an order of magnitude slower than in Drosophila. Using 53 infected (Trypanosoma spp.) and uninfected flies from four genetically distinct Ugandan populations adapted to different environmental conditions, we were able to identify SNPs associated with the infection status of the fly and local environmental adaptation. The extent of LD in Gff likely facilitated the detection of loci under selection, despite the small sample size. Furthermore, it is probable that LD in the regions identified is much higher than the average genomic LD due to strong selection. Our results show that even modest sample sizes can reveal significant genetic associations in this species, which has implications for future studies given the difficulties of collecting field specimens with contrasting phenotypes for association analysis. PMID:27172181

  1. Evaluation of Genome Wide Association Study Associated Type 2 Diabetes Susceptibility Loci in Sub Saharan Africans

    PubMed Central

    Adeyemo, Adebowale A.; Tekola-Ayele, Fasil; Doumatey, Ayo P.; Bentley, Amy R.; Chen, Guanjie; Huang, Hanxia; Zhou, Jie; Shriner, Daniel; Fasanmade, Olufemi; Okafor, Godfrey; Eghan, Benjamin; Agyenim-Boateng, Kofi; Adeleye, Jokotade; Balogun, Williams; Elkahloun, Abdel; Chandrasekharappa, Settara; Owusu, Samuel; Amoah, Albert; Acheampong, Joseph; Johnson, Thomas; Oli, Johnnie; Adebamowo, Clement; Collins, Francis; Dunston, Georgia; Rotimi, Charles N.

    2015-01-01

    Genome wide association studies (GWAS) for type 2 diabetes (T2D) undertaken in European and Asian ancestry populations have yielded dozens of robustly associated loci. However, the genomics of T2D remains largely understudied in sub-Saharan Africa (SSA), where rates of T2D are increasing dramatically and where the environmental background is quite different than in these previous studies. Here, we evaluate 106 reported T2D GWAS loci in continental Africans. We tested each of these SNPs, and SNPs in linkage disequilibrium (LD) with these index SNPs, for an association with T2D in order to assess transferability and to fine map the loci leveraging the generally reduced LD of African genomes. The study included 1775 unrelated Africans (1035 T2D cases, 740 controls; mean age 54 years; 59% female) enrolled in Nigeria, Ghana, and Kenya as part of the Africa America Diabetes Mellitus (AADM) study. All samples were genotyped on the Affymetrix Axiom PanAFR SNP array. Forty-one of the tested loci showed transferability to this African sample (p < 0.05, same direction of effect), 11 at the exact reported SNP and 30 others at SNPs in LD with the reported SNP (after adjustment for the number of tested SNPs). TCF7L2 SNP rs7903146 was the most significant locus in this study (p = 1.61 × 10−8). Most of the loci that showed transferability were successfully fine-mapped, i.e., localized to smaller haplotypes than in the original reports. The findings indicate that the genetic architecture of T2D in SSA is characterized by several risk loci shared with non-African ancestral populations and that data from African populations may facilitate fine mapping of risk loci. The study provides an important resource for meta-analysis of African ancestry populations and transferability of novel loci. PMID:26635871

  2. Genome-Wide Association Mapping of Root Traits in a Japonica Rice Panel

    PubMed Central

    Courtois, Brigitte; Audebert, Alain; Dardou, Audrey; Roques, Sandrine; Ghneim- Herrera, Thaura; Droc, Gaëtan; Frouin, Julien; Rouan, Lauriane; Gozé, Eric; Kilian, Andrzej; Ahmadi, Nourollah; Dingkuhn, Michael

    2013-01-01

    Rice is a crop prone to drought stress in upland and rainfed lowland ecosystems. A deep root system is recognized as the best drought avoidance mechanism. Genome-wide association mapping offers higher resolution for locating quantitative trait loci (QTLs) than QTL mapping in biparental populations. We performed an association mapping study for root traits using a panel of 167 japonica accessions, mostly of tropical origin. The panel was genotyped at an average density of one marker per 22.5 kb using genotyping by sequencing technology. The linkage disequilibrium in the panel was high (r2>0.6, on average, for 20 kb mean distances between markers). The plants were grown in transparent 50 cm × 20 cm × 2 cm Plexiglas nailboard sandwiches filled with 1.5 mm glass beads through which a nutrient solution was circulated. Root system architecture and biomass traits were measured in 30-day-old plants. The panel showed a moderate to high diversity in the various traits, particularly for deep (below 30 cm depth) root mass and the number of deep roots. Association analyses were conducted using a mixed model involving both population structure and kinship to control for false positives. Nineteen associations were significant at P<1e-05, and 78 were significant at P<1e-04. The greatest numbers of significant associations were detected for deep root mass and the number of deep roots, whereas no significant associations were found for total root biomass or deep root proportion. Because several QTLs for different traits were co-localized, 51 unique loci were detected; several co-localized with meta-QTLs for root traits, but none co-localized with rice genes known to be involved in root growth. Several likely candidate genes were found in close proximity to these loci. Additional work is necessary to assess whether these markers are relevant in other backgrounds and whether the genes identified are robust candidates. PMID:24223758

  3. Exploring Population Admixture Dynamics via Empirical and Simulated Genome-wide Distribution of Ancestral Chromosomal Segments

    PubMed Central

    Jin, Wenfei; Wang, Sijia; Wang, Haifeng; Jin, Li; Xu, Shuhua

    2012-01-01

    The processes of genetic admixture determine the haplotype structure and linkage disequilibrium patterns of the admixed population, which is important for medical and evolutionary studies. However, most previous studies do not consider the inherent complexity of admixture processes. Here we proposed two approaches to explore population admixture dynamics, and we demonstrated, by analyzing genome-wide empirical and simulated data, that the approach based on the distribution of chromosomal segments of distinct ancestry (CSDAs) was more powerful than that based on the distribution of individual ancestry proportions. Analysis of 1,890 African Americans showed that a continuous gene flow model, in which the African American population continuously received gene flow from European populations over about 14 generations, best explained the admixture dynamics of African Americans among several putative models. Interestingly, we observed that some African Americans had much more European ancestry than the simulated samples, indicating substructures of local ancestries in African Americans that could have been caused by individuals from some particular lineages having repeatedly admixed with people of European ancestry. In contrast, the admixture dynamics of Mexicans could be explained by a gradual admixture model in which the Mexican population continuously received gene flow from both European and Amerindian populations over about 24 generations. Our results also indicated that recent gene flows from Sub-Saharan Africans have contributed to the gene pool of Middle Eastern populations such as Mozabite, Bedouin, and Palestinian. In summary, this study not only provides approaches to explore population admixture dynamics, but also advances our understanding on population history of African Americans, Mexicans, and Middle Eastern populations. PMID:23103229

  4. Genome-wide signatures of population bottlenecks and diversifying selection in European wolves

    PubMed Central

    Pilot, M; Greco, C; vonHoldt, B M; Jędrzejewska, B; Randi, E; Jędrzejewski, W; Sidorovich, V E; Ostrander, E A; Wayne, R K

    2014-01-01

    Genomic resources developed for domesticated species provide powerful tools for studying the evolutionary history of their wild relatives. Here we use 61K single-nucleotide polymorphisms (SNPs) evenly spaced throughout the canine nuclear genome to analyse evolutionary relationships among the three largest European populations of grey wolves in comparison with other populations worldwide, and investigate genome-wide effects of demographic bottlenecks and signatures of selection. European wolves have a discontinuous range, with large and connected populations in Eastern Europe and relatively smaller, isolated populations in Italy and the Iberian Peninsula. Our results suggest a continuous decline in wolf numbers in Europe since the Late Pleistocene, and long-term isolation and bottlenecks in the Italian and Iberian populations following their divergence from the Eastern European population. The Italian and Iberian populations have low genetic variability and high linkage disequilibrium, but relatively few autozygous segments across the genome. This last characteristic clearly distinguishes them from populations that underwent recent drastic demographic declines or founder events, and implies long-term bottlenecks in these two populations. Although genetic drift due to spatial isolation and bottlenecks seems to be a major evolutionary force diversifying the European populations, we detected 35 loci that are putatively under diversifying selection. Two of these loci flank the canine platelet-derived growth factor gene, which affects bone growth and may influence differences in body size between wolf populations. This study demonstrates the power of population genomics for identifying genetic signals of demographic bottlenecks and detecting signatures of directional selection in bottlenecked populations, despite their low background variability. PMID:24346500

  5. Genome-Wide Scans for Delineation of Candidate Genes Regulating Seed-Protein Content in Chickpea.

    PubMed

    Upadhyaya, Hari D; Bajaj, Deepak; Narnoliya, Laxmi; Das, Shouvik; Kumar, Vinod; Gowda, C L L; Sharma, Shivali; Tyagi, Akhilesh K; Parida, Swarup K

    2016-01-01

    Identification of potential genes/alleles governing complex seed-protein content (SPC) is essential in marker-assisted breeding for quality trait improvement of chickpea. Henceforth, the present study utilized an integrated genomics-assisted breeding strategy encompassing trait association analysis, selective genotyping in traditional bi-parental mapping population and differential expression profiling for the first-time to understand the complex genetic architecture of quantitative SPC trait in chickpea. For GWAS (genome-wide association study), high-throughput genotyping information of 16376 genome-based SNPs (single nucleotide polymorphism) discovered from a structured population of 336 sequenced desi and kabuli accessions [with 150-200 kb LD (linkage disequilibrium) decay] was utilized. This led to identification of seven most effective genomic loci (genes) associated [10-20% with 41% combined PVE (phenotypic variation explained)] with SPC trait in chickpea. Regardless of the diverse desi and kabuli genetic backgrounds, a comparable level of association potential of the identified seven genomic loci with SPC trait was observed. Five SPC-associated genes were validated successfully in parental accessions and homozygous individuals of an intra-specific desi RIL (recombinant inbred line) mapping population (ICC 12299 × ICC 4958) by selective genotyping. The seed-specific expression, including differential up-regulation (>four fold) of six SPC-associated genes particularly in accessions, parents and homozygous individuals of the aforementioned mapping population with a high level of contrasting SPC (21-22%) was evident. Collectively, the integrated genomic approach delineated diverse naturally occurring novel functional SNP allelic variants in six potential candidate genes regulating SPC trait in chickpea. Of these, a non-synonymous SNP allele-carrying zinc finger transcription factor gene exhibiting strong association with SPC trait was found to be the most

  6. Identification of genes promoting skin youthfulness by genome-wide association study.

    PubMed

    Chang, Anne L S; Atzmon, Gil; Bergman, Aviv; Brugmann, Samantha; Atwood, Scott X; Chang, Howard Y; Barzilai, Nir

    2014-03-01

    To identify genes that promote facial skin youthfulness (SY), a genome-wide association study on an Ashkenazi Jewish discovery group (n=428) was performed using Affymetrix 6.0 Single-Nucleotide Polymorphism (SNP) Array. After SNP quality controls, 901,470 SNPs remained for analysis. The eigenstrat method showed no stratification. Cases and controls were identified by global facial skin aging severity including intrinsic and extrinsic parameters. Linear regression adjusted for age and gender, with no significant differences in smoking history, body mass index, menopausal status, or personal or family history of centenarians. Six SNPs met the Bonferroni threshold with Pallele<10(-8); two of these six had Pgenotype<10(-8). Quantitative trait loci mapping confirmed linkage disequilibrium. The six SNPs were interrogated by MassARRAY in a replication group (n=436) with confirmation of rs6975107, an intronic region of KCND2 (potassium voltage-gated channel, Shal-related family member 2) (Pgenotype=0.023). A second replication group (n=371) confirmed rs318125, downstream of DIAPH2 (diaphanous homolog 2 (Drosophila)) (Pallele=0.010, Pgenotype=0.002) and rs7616661, downstream of EDEM1 (ER degradation enhancer, mannosidase α-like 1) (Pgenotype=0.042). DIAPH2 has been associated with premature ovarian insufficiency, an aging phenotype in humans. EDEM1 associates with lifespan in animal models, although not humans. KCND2 is expressed in human skin, but has not been associated with aging. These genes represent new candidate genes to study the molecular basis of healthy skin aging.

  7. Two-Stage Two-Locus Models in Genome-Wide Association

    PubMed Central

    Evans, David M; Marchini, Jonathan; Morris, Andrew P; Cardon, Lon R

    2006-01-01

    Studies in model organisms suggest that epistasis may play an important role in the etiology of complex diseases and traits in humans. With the era of large-scale genome-wide association studies fast approaching, it is important to quantify whether it will be possible to detect interacting loci using realistic sample sizes in humans and to what extent undetected epistasis will adversely affect power to detect association when single-locus approaches are employed. We therefore investigated the power to detect association for an extensive range of two-locus quantitative trait models that incorporated varying degrees of epistasis. We compared the power to detect association using a single-locus model that ignored interaction effects, a full two-locus model that allowed for interactions, and, most important, two two-stage strategies whereby a subset of loci initially identified using single-locus tests were analyzed using the full two-locus model. Despite the penalty introduced by multiple testing, fitting the full two-locus model performed better than single-locus tests for many of the situations considered, particularly when compared with attempts to detect both individual loci. Using a two-stage strategy reduced the computational burden associated with performing an exhaustive two-locus search across the genome but was not as powerful as the exhaustive search when loci interacted. Two-stage approaches also increased the risk of missing interacting loci that contributed little effect at the margins. Based on our extensive simulations, our results suggest that an exhaustive search involving all pairwise combinations of markers across the genome might provide a useful complement to single-locus scans in identifying interacting loci that contribute to moderate proportions of the phenotypic variance. PMID:17002500

  8. RPFdb: a database for genome wide information of translated mRNA generated from ribosome profiling

    PubMed Central

    Xie, Shang-Qian; Nie, Peng; Wang, Yan; Wang, Hongwei; Li, Hongyu; Yang, Zhilong; Liu, Yizhi; Ren, Jian; Xie, Zhi

    2016-01-01

    Translational control is crucial in the regulation of gene expression and deregulation of translation is associated with a wide range of cancers and human diseases. Ribosome profiling is a technique that provides genome wide information of mRNA in translation based on deep sequencing of ribosome protected mRNA fragments (RPF). RPFdb is a comprehensive resource for hosting, analyzing and visualizing RPF data, available at www.rpfdb.org or http://sysbio.sysu.edu.cn/rpfdb/index.html. The current version of database contains 777 samples from 82 studies in 8 species, processed and reanalyzed by a unified pipeline. There are two ways to query the database: by keywords of studies or by genes. The outputs are presented in three levels. (i) Study level: including meta information of studies and reprocessed data for gene expression of translated mRNAs; (ii) Sample level: including global perspective of translated mRNA and a list of the most translated mRNA of each sample from a study; (iii) Gene level: including normalized sequence counts of translated mRNA on different genomic location of a gene from multiple samples and studies. To explore rich information provided by RPF, RPFdb also provides a genome browser to query and visualize context-specific translated mRNA. Overall our database provides a simple way to search, analyze, compare, visualize and download RPF data sets. PMID:26433228

  9. Genome-wide Identification and Structural, Functional and Evolutionary Analysis of WRKY Components of Mulberry.

    PubMed

    Baranwal, Vinay Kumar; Negi, Nisha; Khurana, Paramjit

    2016-01-01

    Mulberry is known to be sensitive to several biotic and abiotic stresses, which in turn have a direct impact on the yield of silk, because it is the sole food source for the silk worm. WRKYs are a family of transcription factors, which play an important role in combating various biotic and abiotic stresses. In this study, we identified 54 genes with conserved WRKY motifs in the Morus notabilis genome. Motif searches coupled with a phylogenetic analysis revealed seven sub-groups as well as the absence of members of Group Ib in mulberry. Analyses of the 2K upstream region in addition to a gene ontology terms enrichment analysis revealed putative functions of mulberry WRKYs under biotic and abiotic stresses. An RNA-seq-based analysis showed that several of the identified WRKYs have shown preferential expression in the leaf, bark, root, male flower, and winter bud of M. notabilis. Finally, expression analysis by qPCR under different stress and hormone treatments revealed genotype-specific responses. Taken together, our results briefs about the genome-wide identification of WRKYs as well as their differential response to stresses and hormones. Importantly, these data can also be utilized to identify potential molecular targets for conferring tolerance to various stresses in mulberry.

  10. Implication of the immune system in Alzheimer's disease: evidence from genome-wide pathway analysis.

    PubMed

    Lambert, Jean-Charles; Grenier-Boley, Benjamin; Chouraki, Vincent; Heath, Simon; Zelenika, Diana; Fievet, Nathalie; Hannequin, Didier; Pasquier, Florence; Hanon, Olivier; Brice, Alexis; Epelbaum, Jacques; Berr, Claudine; Dartigues, Jean-Francois; Tzourio, Christophe; Campion, Dominique; Lathrop, Mark; Amouyel, Philippe

    2010-01-01

    The results of several genome-wide association studies (GWASs) in the field of Alzheimer's disease (AD) have recently been published. Although these studies reported in detail on single-nucleotide polymorphisms (SNPs) and the neighboring genes with the strongest evidence of association with AD, little attention was paid to the rest of the genome. However, complementary statistical and bio-informatics approaches now enable the extraction of pertinent information from other SNPs and/or genes which are only nominally associated with the disease risk. Two different tools (the ALIGATOR and GenGen/KEGG software packages) were used to analyze a large GWAS dataset containing 2,032 AD cases and 5,328 controls. Convergent outputs from the two gene set enrichment approaches suggested an immune system dysfunction in AD. Furthermore, although these statistical approaches did not adopt a priori hypotheses concerning a biological function's putative role in the disease process, genes associated with AD risk were overrepresented in the "Alzheimer's disease" KEGG pathway. In conclusion, a systematic search for biological pathways using GWAS data set seems to comfort the primary causes already suspected but may specifically highlight the importance of the immune system in AD.

  11. Genome-wide transcript profiling reveals novel breast cancer-associated intronic sense RNAs.

    PubMed

    Kim, Sang Woo; Fishilevich, Elane; Arango-Argoty, Gustavo; Lin, Yuefeng; Liu, Guodong; Li, Zhihua; Monaghan, A Paula; Nichols, Mark; John, Bino

    2015-01-01

    Non-coding RNAs (ncRNAs) play major roles in development and cancer progression. To identify novel ncRNAs that may identify key pathways in breast cancer development, we performed high-throughput transcript profiling of tumor and normal matched-pair tissue samples. Initial transcriptome profiling using high-density genome-wide tiling arrays revealed changes in over 200 novel candidate genomic regions that map to intronic regions. Sixteen genomic loci were identified that map to the long introns of five key protein-coding genes, CRIM1, EPAS1, ZEB2, RBMS1, and RFX2. Consistent with the known role of the tumor suppressor ZEB2 in the cancer-associated epithelial to mesenchymal transition (EMT), in situ hybridization reveals that the intronic regions deriving from ZEB2 as well as those from RFX2 and EPAS1 are down-regulated in cells of epithelial morphology, suggesting that these regions may be important for maintaining normal epithelial cell morphology. Paired-end deep sequencing analysis reveals a large number of distinct genomic clusters with no coding potential within the introns of these genes. These novel transcripts are only transcribed from the coding strand. A comprehensive search for breast cancer associated genes reveals enrichment for transcribed intronic regions from these loci, pointing to an underappreciated role of introns or mechanisms relating to their biology in EMT and breast cancer. PMID:25798919

  12. Genome-wide scans provide evidence for positive selection of genes implicated in Lassa fever

    PubMed Central

    Andersen, Kristian G.; Shylakhter, Ilya; Tabrizi, Shervin; Grossman, Sharon R.; Happi, Christian T.; Sabeti, Pardis C.

    2012-01-01

    Rapidly evolving viruses and other pathogens can have an immense impact on human evolution as natural selection acts to increase the prevalence of genetic variants providing resistance to disease. With the emergence of large datasets of human genetic variation, we can search for signatures of natural selection in the human genome driven by such disease-causing microorganisms. Based on this approach, we have previously hypothesized that Lassa virus (LASV) may have been a driver of natural selection in West African populations where Lassa haemorrhagic fever is endemic. In this study, we provide further evidence for this notion. By applying tests for selection to genome-wide data from the International Haplotype Map Consortium and the 1000 Genomes Consortium, we demonstrate evidence for positive selection in LARGE and interleukin 21 (IL21), two genes implicated in LASV infectivity and immunity. We further localized the signals of selection, using the recently developed composite of multiple signals method, to introns and putative regulatory regions of those genes. Our results suggest that natural selection may have targeted variants giving rise to alternative splicing or differential gene expression of LARGE and IL21. Overall, our study supports the hypothesis that selective pressures imposed by LASV may have led to the emergence of particular alleles conferring resistance to Lassa fever, and opens up new avenues of research pursuit. PMID:22312054

  13. Genome-wide analysis and expression profiling of the Solanum tuberosum aquaporins.

    PubMed

    Venkatesh, Jelli; Yu, Jae-Woong; Park, Se Won

    2013-12-01

    Aquaporins belongs to the major intrinsic proteins involved in the transcellular membrane transport of water and other small solutes. A comprehensive genome-wide search for the homologues of Solanum tuberosum major intrinsic protein (MIP) revealed 41 full-length potato aquaporin genes. All potato aquaporins are grouped into five subfamilies; plasma membrane intrinsic proteins (PIPs), tonoplast intrinsic proteins (TIPs), NOD26-like intrinsic proteins (NIPs), small basic intrinsic proteins (SIPs) and x-intrinsic proteins (XIPs). Functional predictions based on the aromatic/arginine (ar/R) selectivity filters and Froger's positions showed a remarkable difference in substrate transport specificity among subfamilies. The expression pattern of potato aquaporins, examined by qPCR analysis, showed distinct expression profiles in various organs and tuber developmental stages. Furthermore, qPCR analysis of potato plantlets, subjected to various abiotic stresses revealed the marked effect of stresses on expression levels of aquaporins. Taken together, the expression profiles of aquaporins imply that aquaporins play important roles in plant growth and development, in addition to maintaining water homeostasis in response to environmental stresses.

  14. Genome-wide Identification and Structural, Functional and Evolutionary Analysis of WRKY Components of Mulberry

    PubMed Central

    Baranwal, Vinay Kumar; Negi, Nisha; Khurana, Paramjit

    2016-01-01

    Mulberry is known to be sensitive to several biotic and abiotic stresses, which in turn have a direct impact on the yield of silk, because it is the sole food source for the silk worm. WRKYs are a family of transcription factors, which play an important role in combating various biotic and abiotic stresses. In this study, we identified 54 genes with conserved WRKY motifs in the Morus notabilis genome. Motif searches coupled with a phylogenetic analysis revealed seven sub-groups as well as the absence of members of Group Ib in mulberry. Analyses of the 2K upstream region in addition to a gene ontology terms enrichment analysis revealed putative functions of mulberry WRKYs under biotic and abiotic stresses. An RNA-seq-based analysis showed that several of the identified WRKYs have shown preferential expression in the leaf, bark, root, male flower, and winter bud of M. notabilis. Finally, expression analysis by qPCR under different stress and hormone treatments revealed genotype-specific responses. Taken together, our results briefs about the genome-wide identification of WRKYs as well as their differential response to stresses and hormones. Importantly, these data can also be utilized to identify potential molecular targets for conferring tolerance to various stresses in mulberry. PMID:27477686

  15. Genome-wide Identification and Structural, Functional and Evolutionary Analysis of WRKY Components of Mulberry.

    PubMed

    Baranwal, Vinay Kumar; Negi, Nisha; Khurana, Paramjit

    2016-01-01

    Mulberry is known to be sensitive to several biotic and abiotic stresses, which in turn have a direct impact on the yield of silk, because it is the sole food source for the silk worm. WRKYs are a family of transcription factors, which play an important role in combating various biotic and abiotic stresses. In this study, we identified 54 genes with conserved WRKY motifs in the Morus notabilis genome. Motif searches coupled with a phylogenetic analysis revealed seven sub-groups as well as the absence of members of Group Ib in mulberry. Analyses of the 2K upstream region in addition to a gene ontology terms enrichment analysis revealed putative functions of mulberry WRKYs under biotic and abiotic stresses. An RNA-seq-based analysis showed that several of the identified WRKYs have shown preferential expression in the leaf, bark, root, male flower, and winter bud of M. notabilis. Finally, expression analysis by qPCR under different stress and hormone treatments revealed genotype-specific responses. Taken together, our results briefs about the genome-wide identification of WRKYs as well as their differential response to stresses and hormones. Importantly, these data can also be utilized to identify potential molecular targets for conferring tolerance to various stresses in mulberry. PMID:27477686

  16. Genome-wide association analyses for carcass quality in crossbred beef cattle

    PubMed Central

    2013-01-01

    Background Genetic improvement of beef quality will benefit both producers and consumers, and can be achieved by selecting animals that carry desired quantitative trait nucleotides (QTN), which result from intensive searches using genetic markers. This paper presents a genome-wide association approach utilizing single nucleotide polymorphisms (SNP) in the Illumina BovineSNP50 BeadChip to seek genomic regions that potentially harbor genes or QTN underlying variation in carcass quality of beef cattle. This study used 747 genotyped animals, mainly crossbred, with phenotypes on twelve carcass quality traits, including hot carcass weight (HCW), back fat thickness (BF), Longissimus dorsi muscle area or ribeye area (REA), marbling scores (MRB), lean yield grade by Beef Improvement Federation formulae (BIFYLD), steak tenderness by Warner-Bratzler shear force 7-day post-mortem (LM7D) as well as body composition as determined by partial rib (IMPS 103) dissection presented as a percentage of total rib weight including body cavity fat (BDFR), lean (LNR), bone (BNR), intermuscular fat (INFR), subcutaneous fat (SQFR), and total fat (TLFR). Results At the genome wide level false discovery rate (FDR < 10%), eight SNP were found significantly associated with HCW. Seven of these SNP were located on Bos taurus autosome (BTA) 6. At a less stringent significance level (P < 0.001), 520 SNP were found significantly associated with mostly individual traits (473 SNP), and multiple traits (47 SNP). Of these significant SNP, 48 were located on BTA6, and 22 of them were in association with hot carcass weight. There were 53 SNP associated with percentage of rib bone, and 12 of them were on BTA20. The rest of the significant SNP were scattered over other chromosomes. They accounted for 1.90 - 5.89% of the phenotypic variance of the traits. A region of approximately 4 Mbp long on BTA6 was found to be a potential area to harbor candidate genes influencing growth. One marker on BTA25

  17. Genome-wide microarray analysis of gene expression profiling in major depression and antidepressant therapy.

    PubMed

    Lin, Eugene; Tsai, Shih-Jen

    2016-01-01

    Major depressive disorder (MDD) is a serious health concern worldwide. Currently there are no predictive tests for the effectiveness of any particular antidepressant in an individual patient. Thus, doctors must prescribe antidepressants based on educated guesses. With the recent advent of scientific research, genome-wide gene expression microarray studies are widely utilized to analyze hundreds of thousands of biomarkers by high-throughput technologies. In addition to the candidate-gene approach, the genome-wide approach has recently been employed to investigate the determinants of MDD as well as antidepressant response to therapy. In this review, we mainly focused on gene expression studies with genome-wide approaches using RNA derived from peripheral blood cells. Furthermore, we reviewed their limitations and future directions with respect to the genome-wide gene expression profiling in MDD pathogenesis as well as in antidepressant therapy.

  18. Genome-wide synteny through highly sensitive sequence alignment: Satsuma

    PubMed Central

    Grabherr, Manfred G.; Russell, Pamela; Meyer, Miriah; Mauceli, Evan; Alföldi, Jessica; Di Palma, Federica; Lindblad-Toh, Kerstin

    2010-01-01

    Motivation: Comparative genomics heavily relies on alignments of large and often complex DNA sequences. From an engineering perspective, the problem here is to provide maximum sensitivity (to find all there is to find), specificity (to only find real homology) and speed (to accommodate the billions of base pairs of vertebrate genomes). Results: Satsuma addresses all three issues through novel strategies: (i) cross-correlation, implemented via fast Fourier transform; (ii) a match scoring scheme that eliminates almost all false hits; and (iii) an asynchronous ‘battleship’-like search that allows for aligning two entire fish genomes (470 and 217 Mb) in 120 CPU hours using 15 processors on a single machine. Availability: Satsuma is part of the Spines software package, implemented in C++ on Linux. The latest version of Spines can be freely downloaded under the LGPL license from http://www.broadinstitute.org/science/programs/genome-biology/spines/ Contact: grabherr@broadinstitute.org PMID:20208069

  19. Linkage disequilibrium analysis by searching for shared segments: Mapping a locus for benign recurrent intrahepatic cholestasis (BRIC)

    SciTech Connect

    Freimer, N.; Baharloo, S.; Blankenship, K.

    1994-09-01

    The lod score method of linkage analysis has two important drawbacks: parameters must be specified for the transmission of the disease (e.g. penetrance), and large numbers of genetically informative individuals must be studied. Although several robust non-parametric methods are available, these also require large sample sizes. The availability of dense genetic maps permits genome screening to be conducted by linkage disequilibrium (LD) mapping methods, which are statistically powerful and non-parametric. Lander & Botstein proposed that LD mapping could be employed to screen the human genome for disease loci; we have now applied this strategy to map a gene for an autosomal recessive disorder, benign recurrent intrahepatic cholestatis (BRIC). Our approach to LD mapping was based on identifying chromosome segments shared between distantly related patients; we used 256 microsatellite markers to genotype three affected individuals, and their parents, from an isolated town in The Netherlands. Because endogamy occurred in this population for several generations, all of the BRIC patients are known to be distantly related to each other, but the pedigree structure and connections could not be certainly established more than three generations before the present, so lod score analysis was impossible. A 20 cM region on chromosome 18 is shared by 5/6 patient chromosomes; subsequently, we noted that 6/6 chromosomes shared an interval of about 3 cM in this region. Calculations indicate that it is extremely unlikely that such a region could be inherited by chance rather than by descent from a common ancestor. Thus, LD mapping by searching for shared chromosomal segments is an extremely powerful approach for genome screening to identify disease loci.

  20. Genome-wide Association Study and Meta-Analysis Identify ISL1 as Genome-wide Significant Susceptibility Gene for Bladder Exstrophy

    PubMed Central

    Draaken, Markus; Knapp, Michael; Pennimpede, Tracie; Schmidt, Johanna M.; Ebert, Anne-Karolin; Rösch, Wolfgang; Stein, Raimund; Utsch, Boris; Hirsch, Karin; Boemers, Thomas M.; Mangold, Elisabeth; Heilmann, Stefanie; Ludwig, Kerstin U.; Jenetzky, Ekkehart; Zwink, Nadine; Moebus, Susanne; Herrmann, Bernhard G.; Mattheisen, Manuel; Nöthen, Markus M.

    2015-01-01

    The bladder exstrophy-epispadias complex (BEEC) represents the severe end of the uro-rectal malformation spectrum, and is thought to result from aberrant embryonic morphogenesis of the cloacal membrane and the urorectal septum. The most common form of BEEC is isolated classic bladder exstrophy (CBE). To identify susceptibility loci for CBE, we performed a genome-wide association study (GWAS) of 110 CBE patients and 1,177 controls of European origin. Here, an association was found with a region of approximately 220kb on chromosome 5q11.1. This region harbors the ISL1 (ISL LIM homeobox 1) gene. Multiple markers in this region showed evidence for association with CBE, including 84 markers with genome-wide significance. We then performed a meta-analysis using data from a previous GWAS by our group of 98 CBE patients and 526 controls of European origin. This meta-analysis also implicated the 5q11.1 locus in CBE risk. A total of 138 markers at this locus reached genome-wide significance in the meta-analysis, and the most significant marker (rs9291768) achieved a P value of 2.13 × 10−12. No other locus in the meta-analysis achieved genome-wide significance. We then performed murine expression analyses to follow up this finding. Here, Isl1 expression was detected in the genital region within the critical time frame for human CBE development. Genital regions with Isl1 expression included the peri-cloacal mesenchyme and the urorectal septum. The present study identified the first genome-wide significant locus for CBE at chromosomal region 5q11.1, and provides strong evidence for the hypothesis that ISL1 is the responsible candidate gene in this region. PMID:25763902

  1. Genome-wide association study and meta-analysis identify ISL1 as genome-wide significant susceptibility gene for bladder exstrophy.

    PubMed

    Draaken, Markus; Knapp, Michael; Pennimpede, Tracie; Schmidt, Johanna M; Ebert, Anne-Karolin; Rösch, Wolfgang; Stein, Raimund; Utsch, Boris; Hirsch, Karin; Boemers, Thomas M; Mangold, Elisabeth; Heilmann, Stefanie; Ludwig, Kerstin U; Jenetzky, Ekkehart; Zwink, Nadine; Moebus, Susanne; Herrmann, Bernhard G; Mattheisen, Manuel; Nöthen, Markus M; Ludwig, Michael; Reutter, Heiko

    2015-03-01

    The bladder exstrophy-epispadias complex (BEEC) represents the severe end of the uro-rectal malformation spectrum, and is thought to result from aberrant embryonic morphogenesis of the cloacal membrane and the urorectal septum. The most common form of BEEC is isolated classic bladder exstrophy (CBE). To identify susceptibility loci for CBE, we performed a genome-wide association study (GWAS) of 110 CBE patients and 1,177 controls of European origin. Here, an association was found with a region of approximately 220kb on chromosome 5q11.1. This region harbors the ISL1 (ISL LIM homeobox 1) gene. Multiple markers in this region showed evidence for association with CBE, including 84 markers with genome-wide significance. We then performed a meta-analysis using data from a previous GWAS by our group of 98 CBE patients and 526 controls of European origin. This meta-analysis also implicated the 5q11.1 locus in CBE risk. A total of 138 markers at this locus reached genome-wide significance in the meta-analysis, and the most significant marker (rs9291768) achieved a P value of 2.13 × 10-12. No other locus in the meta-analysis achieved genome-wide significance. We then performed murine expression analyses to follow up this finding. Here, Isl1 expression was detected in the genital region within the critical time frame for human CBE development. Genital regions with Isl1 expression included the peri-cloacal mesenchyme and the urorectal septum. The present study identified the first genome-wide significant locus for CBE at chromosomal region 5q11.1, and provides strong evidence for the hypothesis that ISL1 is the responsible candidate gene in this region.

  2. Genome-wide association mapping in plants exemplified for root growth in Arabidopsis thaliana.

    PubMed

    Slovak, Radka; Göschl, Christian; Seren, Ümit; Busch, Wolfgang

    2015-01-01

    Genome-wide association (GWA) mapping is a powerful technique to address the molecular basis of genotype to phenotype relationships and to map regulators of biological processes. This chapter presents a protocol for genome-wide association mapping in Arabidopsis thaliana using the user-friendly internet application GWAPP, and provides a specific protocol for acquiring root trait data suitable for GWA studies using the semi-automated, high-throughput phenotyping pipeline BRAT for early root growth.

  3. Genome Wide Analysis of Drug-Induced Torsades de Pointes: Lack of Common Variants with Large Effect Sizes

    PubMed Central

    Behr, Elijah R.; Ritchie, Marylyn D.; Tanaka, Toshihiro; Kääb, Stefan; Crawford, Dana C.; Nicoletti, Paola; Floratos, Aris; Sinner, Moritz F.; Kannankeril, Prince J.; Wilde, Arthur A. M.; Bezzina, Connie R.; Schulze-Bahr, Eric; Zumhagen, Sven; Guicheney, Pascale; Bishopric, Nanette H.; Marshall, Vanessa; Shakir, Saad; Dalageorgou, Chrysoula; Bevan, Steve; Jamshidi, Yalda; Bastiaenen, Rachel; Myerburg, Robert J.; Schott, Jean-Jacques; Camm, A. John; Steinbeck, Gerhard; Norris, Kris; Altman, Russ B.; Tatonetti, Nicholas P.; Jeffery, Steve; Kubo, Michiaki; Nakamura, Yusuke; Shen, Yufeng; George, Alfred L.; Roden, Dan M.

    2013-01-01

    Marked prolongation of the QT interval on the electrocardiogram associated with the polymorphic ventricular tachycardia Torsades de Pointes is a serious adverse event during treatment with antiarrhythmic drugs and other culprit medications, and is a common cause for drug relabeling and withdrawal. Although clinical risk factors have been identified, the syndrome remains unpredictable in an individual patient. Here we used genome-wide association analysis to search for common predisposing genetic variants. Cases of drug-induced Torsades de Pointes (diTdP), treatment tolerant controls, and general population controls were ascertained across multiple sites using common definitions, and genotyped on the Illumina 610k or 1M-Duo BeadChips. Principal Components Analysis was used to select 216 Northwestern European diTdP cases and 771 ancestry-matched controls, including treatment-tolerant and general population subjects. With these sample sizes, there is 80% power to detect a variant at genome-wide significance with minor allele frequency of 10% and conferring an odds ratio of ≥2.7. Tests of association were carried out for each single nucleotide polymorphism (SNP) by logistic regression adjusting for gender and population structure. No SNP reached genome wide-significance; the variant with the lowest P value was rs2276314, a non-synonymous coding variant in C18orf21 (p  =  3×10−7, odds ratio = 2, 95% confidence intervals: 1.5–2.6). The haplotype formed by rs2276314 and a second SNP, rs767531, was significantly more frequent in controls than cases (p  =  3×10−9). Expanding the number of controls and a gene-based analysis did not yield significant associations. This study argues that common genomic variants do not contribute importantly to risk for drug-induced Torsades de Pointes across multiple drugs. PMID:24223155

  4. COPS: Detecting Co-Occurrence and Spatial Arrangement of Transcription Factor Binding Motifs in Genome-Wide Datasets

    PubMed Central

    Lohmann, Ingrid

    2012-01-01

    In multi-cellular organisms, spatiotemporal activity of cis-regulatory DNA elements depends on their occupancy by different transcription factors (TFs). In recent years, genome-wide ChIP-on-Chip, ChIP-Seq and DamID assays have been extensively used to unravel the combinatorial interaction of TFs with cis-regulatory modules (CRMs) in the genome. Even though genome-wide binding profiles are increasingly becoming available for different TFs, single TF binding profiles are in most cases not sufficient for dissecting complex regulatory networks. Thus, potent computational tools detecting statistically significant and biologically relevant TF-motif co-occurrences in genome-wide datasets are essential for analyzing context-dependent transcriptional regulation. We have developed COPS (Co-Occurrence Pattern Search), a new bioinformatics tool based on a combination of association rules and Markov chain models, which detects co-occurring TF binding sites (BSs) on genomic regions of interest. COPS scans DNA sequences for frequent motif patterns using a Frequent-Pattern tree based data mining approach, which allows efficient performance of the software with respect to both data structure and implementation speed, in particular when mining large datasets. Since transcriptional gene regulation very often relies on the formation of regulatory protein complexes mediated by closely adjoining TF binding sites on CRMs, COPS additionally detects preferred short distance between co-occurring TF motifs. The performance of our software with respect to biological significance was evaluated using three published datasets containing genomic regions that are independently bound by several TFs involved in a defined biological process. In sum, COPS is a fast, efficient and user-friendly tool mining statistically and biologically significant TFBS co-occurrences and therefore allows the identification of TFs that combinatorially regulate gene expression. PMID:23272209

  5. Genome-wide association identifies genetic variants associated with lentiform nucleus volume in N=1345 young and elderly subjects

    PubMed Central

    Hibar, Derrek P.; Stein, Jason L.; Ryles, April B.; Kohannim, Omid; Jahanshad, Neda; Medland, Sarah E.; Hansell, Narelle K.; McMahon, Katie L.; de Zubicaray, Greig I.; Montgomery, Grant W.; Martin, Nicholas G.; Wright, Margaret J.; Saykin, Andrew J.; Jack, Clifford R.; Weiner, Michael W.; Toga, Arthur W.

    2013-01-01

    Deficits in lentiform nucleus volume and morphometry are implicated in a number of genetically influenced disorders, including Parkinson’s disease, schizophrenia, and ADHD. Here we performed genome-wide searches to discover common genetic variants associated with differences in lentiform nucleus volume in human populations. We assessed structural MRI scans of the brain in two large genotyped samples: the Alzheimer’s Disease Neuroimaging Initiative (ADNI; N=706) and the Queensland Twin Imaging Study (QTIM; N=639). Statistics of association from each cohort were combined meta-analytically using a fixed-effects model to boost power and to reduce the prevalence of false positive findings. We identified a number of associations in and around the flavin-containing monooxygenase (FMO) gene cluster. The most highly associated SNP, rs1795240, was located in the FMO3 gene; after meta-analysis, it showed genome-wide significant evidence of association with lentiform nucleus volume (PMA=4.79×10−8). This commonly-carried genetic variant accounted for 2.68 % and 0.84 % of the trait variability in the ADNI and QTIM samples, respectively, even though the QTIM sample was on average 50 years younger. Pathway enrichment analysis revealed significant contributions of this gene to the cytochrome P450 pathway, which is involved in metabolizing numerous therapeutic drugs for pain, seizures, mania, depression, anxiety, and psychosis. The genetic variants we identified provide replicated, genome-wide significant evidence for the FMO gene cluster’s involvement in lentiform nucleus volume differences in human populations. PMID:22903471

  6. Genome-wide association analysis of imputed rare variants: application to seven common complex diseases.

    PubMed

    Mägi, Reedik; Asimit, Jennifer L; Day-Williams, Aaron G; Zeggini, Eleftheria; Morris, Andrew P

    2012-12-01

    Genome-wide association studies have been successful in identifying loci contributing effects to a range of complex human traits. The majority of reproducible associations within these loci are with common variants, each of modest effect, which together explain only a small proportion of heritability. It has been suggested that much of the unexplained genetic component of complex traits can thus be attributed to rare variation. However, genome-wide association study genotyping chips have been designed primarily to capture common variation, and thus are underpowered to detect the effects of rare variants. Nevertheless, we demonstrate here, by simulation, that imputation from an existing scaffold of genome-wide genotype data up to high-density reference panels has the potential to identify rare variant associations with complex traits, without the need for costly re-sequencing experiments. By application of this approach to genome-wide association studies of seven common complex diseases, imputed up to publicly available reference panels, we identify genome-wide significant evidence of rare variant association in PRDM10 with coronary artery disease and multiple genes in the major histocompatibility complex (MHC) with type 1 diabetes. The results of our analyses highlight that genome-wide association studies have the potential to offer an exciting opportunity for gene discovery through association with rare variants, conceivably leading to substantial advancements in our understanding of the genetic architecture underlying complex human traits.

  7. Agronomic and Seed Quality Traits Dissected by Genome-Wide Association Mapping in Brassica napus

    PubMed Central

    Körber, Niklas; Bus, Anja; Li, Jinquan; Parkin, Isobel A. P.; Wittkop, Benjamin; Snowdon, Rod J.; Stich, Benjamin

    2016-01-01

    In Brassica napus breeding, traits related to commercial success are of highest importance for plant breeders. However, such traits can only be assessed in an advanced developmental stage. Molecular markers genetically linked to such traits have the potential to accelerate the breeding process of B. napus by marker-assisted selection. Therefore, the objectives of this study were to identify (i) genome regions associated with the examined agronomic and seed quality traits, (ii) the interrelationship of population structure and the detected associations, and (iii) candidate genes for the revealed associations. The diversity set used in this study consisted of 405 B. napus inbred lines which were genotyped using a 6K single nucleotide polymorphism (SNP) array and phenotyped for agronomic and seed quality traits in field trials. In a genome-wide association study, we detected a total of 112 associations between SNPs and the seed quality traits as well as 46 SNP-trait associations for the agronomic traits with a P < 1.28e-05 (Bonferroni correction of α = 0.05) for the inbreds of the spring and winter trial. For the seed quality traits, a single SNP-sulfur concentration in seeds (SUL) association explained up to 67.3% of the phenotypic variance, whereas for the agronomic traits, a single SNP-blossom color (BLC) association explained up to 30.2% of the phenotypic variance. In a basic local alignment search tool (BLAST) search within a distance of 2.5 Mbp around these SNP-trait associations, 62 hits of potential candidate genes with a BLAST-score of ≥100 and a sequence identity of ≥70% to A. thaliana or B. rapa could be found for the agronomic SNP-trait associations and 187 hits of potential candidate genes for the seed quality SNP-trait associations. PMID:27066036

  8. Implementing meta-analysis from genome-wide association studies for pork quality traits.

    PubMed

    Bernal Rubio, Y L; Gualdrón Duarte, J L; Bates, R O; Ernst, C W; Nonneman, D; Rohrer, G A; King, D A; Shackelford, S D; Wheeler, T L; Cantet, R J C; Steibel, J P

    2015-12-01

    Pork quality plays an important role in the meat processing industry. Thus, different methodologies have been implemented to elucidate the genetic architecture of traits affecting meat quality. One of the most common and widely used approaches is to perform genome-wide association (GWA) studies. However, a limitation of many GWA in animal breeding is the limited power due to small sample sizes in animal populations. One alternative is to implement a meta-analysis of GWA (MA-GWA) combining results from independent association studies. The objective of this study was to identify significant genomic regions associated with meat quality traits by performing MA-GWA for 8 different traits in 3 independent pig populations. Results from MA-GWA were used to search for genes possibly associated with the set of evaluated traits. Data from 3 pig data sets (U.S. Meat Animal Research Center, commercial, and Michigan State University Pig Resource Population) were used. A MA was implemented by combining -scores derived for each SNP in every population and then weighting them using the inverse of estimated variance of SNP effects. A search for annotated genes retrieved genes previously reported as candidates for shear force (calpain-1 catalytic subunit [] and calpastatin []), as well as for ultimate pH, purge loss, and cook loss (protein kinase, AMP-activated, γ 3 noncatalytic subunit []). In addition, novel candidate genes were identified for intramuscular fat and cook loss (acyl-CoA synthetase family member 3 mitochondrial []) and for the objective measure of muscle redness, CIE a* (glycogen synthase 1, muscle [] and ferritin, light polypeptide []). Thus, implementation of MA-GWA allowed integration of results for economically relevant traits and identified novel genes to be tested as candidates for meat quality traits in pig populations.

  9. Agronomic and Seed Quality Traits Dissected by Genome-Wide Association Mapping in Brassica napus.

    PubMed

    Körber, Niklas; Bus, Anja; Li, Jinquan; Parkin, Isobel A P; Wittkop, Benjamin; Snowdon, Rod J; Stich, Benjamin

    2016-01-01

    In Brassica napus breeding, traits related to commercial success are of highest importance for plant breeders. However, such traits can only be assessed in an advanced developmental stage. Molecular markers genetically linked to such traits have the potential to accelerate the breeding process of B. napus by marker-assisted selection. Therefore, the objectives of this study were to identify (i) genome regions associated with the examined agronomic and seed quality traits, (ii) the interrelationship of population structure and the detected associations, and (iii) candidate genes for the revealed associations. The diversity set used in this study consisted of 405 B. napus inbred lines which were genotyped using a 6K single nucleotide polymorphism (SNP) array and phenotyped for agronomic and seed quality traits in field trials. In a genome-wide association study, we detected a total of 112 associations between SNPs and the seed quality traits as well as 46 SNP-trait associations for the agronomic traits with a P < 1.28e-05 (Bonferroni correction of α = 0.05) for the inbreds of the spring and winter trial. For the seed quality traits, a single SNP-sulfur concentration in seeds (SUL) association explained up to 67.3% of the phenotypic variance, whereas for the agronomic traits, a single SNP-blossom color (BLC) association explained up to 30.2% of the phenotypic variance. In a basic local alignment search tool (BLAST) search within a distance of 2.5 Mbp around these SNP-trait associations, 62 hits of potential candidate genes with a BLAST-score of ≥100 and a sequence identity of ≥70% to A. thaliana or B. rapa could be found for the agronomic SNP-trait associations and 187 hits of potential candidate genes for the seed quality SNP-trait associations.

  10. Agronomic and Seed Quality Traits Dissected by Genome-Wide Association Mapping in Brassica napus.

    PubMed

    Körber, Niklas; Bus, Anja; Li, Jinquan; Parkin, Isobel A P; Wittkop, Benjamin; Snowdon, Rod J; Stich, Benjamin

    2016-01-01

    In Brassica napus breeding, traits related to commercial success are of highest importance for plant breeders. However, such traits can only be assessed in an advanced developmental stage. Molecular markers genetically linked to such traits have the potential to accelerate the breeding process of B. napus by marker-assisted selection. Therefore, the objectives of this study were to identify (i) genome regions associated with the examined agronomic and seed quality traits, (ii) the interrelationship of population structure and the detected associations, and (iii) candidate genes for the revealed associations. The diversity set used in this study consisted of 405 B. napus inbred lines which were genotyped using a 6K single nucleotide polymorphism (SNP) array and phenotyped for agronomic and seed quality traits in field trials. In a genome-wide association study, we detected a total of 112 associations between SNPs and the seed quality traits as well as 46 SNP-trait associations for the agronomic traits with a P < 1.28e-05 (Bonferroni correction of α = 0.05) for the inbreds of the spring and winter trial. For the seed quality traits, a single SNP-sulfur concentration in seeds (SUL) association explained up to 67.3% of the phenotypic variance, whereas for the agronomic traits, a single SNP-blossom color (BLC) association explained up to 30.2% of the phenotypic variance. In a basic local alignment search tool (BLAST) search within a distance of 2.5 Mbp around these SNP-trait associations, 62 hits of potential candidate genes with a BLAST-score of ≥100 and a sequence identity of ≥70% to A. thaliana or B. rapa could be found for the agronomic SNP-trait associations and 187 hits of potential candidate genes for the seed quality SNP-trait associations. PMID:27066036

  11. SNPLims: a data management system for genome wide association studies

    PubMed Central

    Orro, Alessandro; Guffanti, Guia; Salvi, Erika; Macciardi, Fabio; Milanesi, Luciano

    2008-01-01

    Background Recent progresses in genotyping technologies allow the generation high-density genetic maps using hundreds of thousands of genetic markers for each DNA sample. The availability of this large amount of genotypic data facilitates the whole genome search for genetic basis of diseases. We need a suitable information management system to efficiently manage the data flow produced by whole genome genotyping and to make it available for further analyses. Results We have developed an information system mainly devoted to the storage and management of SNP genotype data produced by the Illumina platform from the raw outputs of genotyping into a relational database. The relational database can be accessed in order to import any existing data and export user-defined formats compatible with many different genetic analysis programs. After calculating family-based or case-control association study data, the results can be imported in SNPLims. One of the main features is to allow the user to rapidly identify and annotate statistically relevant polymorphisms from the large volume of data analyzed. Results can be easily visualized either graphically or creating ASCII comma separated format output files, which can be used as input to further analyses. Conclusions The proposed infrastructure allows to manage a relatively large amount of genotypes for each sample and an arbitrary number of samples and phenotypes. Moreover, it enables the users to control the quality of the data and to perform the most common screening analyses and identify genes that become “candidate” for the disease under consideration. PMID:18387201

  12. Genome-Wide Association Studies of Anthracnose and Angular Leaf Spot Resistance in Common Bean (Phaseolus vulgaris L.).

    PubMed

    Perseguini, Juliana Morini Küpper Cardoso; Oblessuc, Paula Rodrigues; Rosa, João Ricardo Bachega Feijó; Gomes, Kleber Alves; Chiorato, Alisson Fernando; Carbonell, Sérgio Augusto Morais; Garcia, Antonio Augusto Franco; Vianello, Rosana Pereira; Benchimol-Reis, Luciana Lasry

    2016-01-01

    The common bean (Phaseolus vulgaris L.) is the world's most important legume for human consumption. Anthracnose (ANT; Colletotrichum lindemuthianum) and angular leaf spot (ALS; Pseudocercospora griseola) are complex diseases that cause major yield losses in common bean. Depending on the cultivar and environmental conditions, anthracnose and angular leaf spot infections can reduce crop yield drastically. This study aimed to estimate linkage disequilibrium levels and identify quantitative resistance loci (QRL) controlling resistance to both ANT and ALS diseases of 180 accessions of common bean using genome-wide association analysis. A randomized complete block design with four replicates was performed for the ANT and ALS experiments, with four plants per genotype in each replicate. Association mapping analyses were performed for ANT and ALS using a mixed linear model approach implemented in TASSEL. A total of 17 and 11 significant statistically associations involving SSRs were detected for ANT and ALS resistance loci, respectively. Using SNPs, 21 and 17 significant statistically associations were obtained for ANT and angular ALS, respectively, providing more associations with this marker. The SSR-IAC167 and PvM95 markers, both located on chromosome Pv03, and the SNP scaffold00021_89379, were associated with both diseases. The other markers were distributed across the entire common bean genome, with chromosomes Pv03 and Pv08 showing the greatest number of loci associated with ANT resistance. The chromosome Pv04 was the most saturated one, with six markers associated with ALS resistance. The telomeric region of this chromosome showed four markers located between approximately 2.5 Mb and 4.4 Mb. Our results demonstrate the great potential of genome-wide association studies to identify QRLs related to ANT and ALS in common bean. The results indicate a quantitative and complex inheritance pattern for both diseases in common bean. Our findings will contribute to more

  13. Penalized Multimarker vs. Single-Marker Regression Methods for Genome-Wide Association Studies of Quantitative Traits

    PubMed Central

    Yi, Hui; Breheny, Patrick; Imam, Netsanet; Liu, Yongmei; Hoeschele, Ina

    2015-01-01

    The data from genome-wide association studies (GWAS) in humans are still predominantly analyzed using single-marker association methods. As an alternative to single-marker analysis (SMA), all or subsets of markers can be tested simultaneously. This approach requires a form of penalized regression (PR) as the number of SNPs is much larger than the sample size. Here we review PR methods in the context of GWAS, extend them to perform penalty parameter and SNP selection by false discovery rate (FDR) control, and assess their performance in comparison with SMA. PR methods were compared with SMA, using realistically simulated GWAS data with a continuous phenotype and real data. Based on these comparisons our analytic FDR criterion may currently be the best approach to SNP selection using PR for GWAS. We found that PR with FDR control provides substantially more power than SMA with genome-wide type-I error control but somewhat less power than SMA with Benjamini–Hochberg FDR control (SMA-BH). PR with FDR-based penalty parameter selection controlled the FDR somewhat conservatively while SMA-BH may not achieve FDR control in all situations. Differences among PR methods seem quite small when the focus is on SNP selection with FDR control. Incorporating linkage disequilibrium into the penalization by adapting penalties developed for covariates measured on graphs can improve power but also generate more false positives or wider regions for follow-up. We recommend the elastic net with a mixing weight for the Lasso penalty near 0.5 as the best method. PMID:25354699