Sample records for germline mutation analysis

  1. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed Central

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  2. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  3. Variation in genome-wide mutation rates within and between human families.

    PubMed

    Conrad, Donald F; Keebler, Jonathan E M; DePristo, Mark A; Lindsay, Sarah J; Zhang, Yujun; Casals, Ferran; Idaghdour, Youssef; Hartl, Chris L; Torroja, Carlos; Garimella, Kiran V; Zilversmit, Martine; Cartwright, Reed; Rouleau, Guy A; Daly, Mark; Stone, Eric A; Hurles, Matthew E; Awadalla, Philip

    2011-06-12

    J.B.S. Haldane proposed in 1947 that the male germline may be more mutagenic than the female germline. Diverse studies have supported Haldane's contention of a higher average mutation rate in the male germline in a variety of mammals, including humans. Here we present, to our knowledge, the first direct comparative analysis of male and female germline mutation rates from the complete genome sequences of two parent-offspring trios. Through extensive validation, we identified 49 and 35 germline de novo mutations (DNMs) in two trio offspring, as well as 1,586 non-germline DNMs arising either somatically or in the cell lines from which the DNA was derived. Most strikingly, in one family, we observed that 92% of germline DNMs were from the paternal germline, whereas, in contrast, in the other family, 64% of DNMs were from the maternal germline. These observations suggest considerable variation in mutation rates within and between families.

  4. Differential analysis between somatic mutation and germline variation profiles reveals cancer-related genes.

    PubMed

    Przytycki, Pawel F; Singh, Mona

    2017-08-25

    A major aim of cancer genomics is to pinpoint which somatically mutated genes are involved in tumor initiation and progression. We introduce a new framework for uncovering cancer genes, differential mutation analysis, which compares the mutational profiles of genes across cancer genomes with their natural germline variation across healthy individuals. We present DiffMut, a fast and simple approach for differential mutational analysis, and demonstrate that it is more effective in discovering cancer genes than considerably more sophisticated approaches. We conclude that germline variation across healthy human genomes provides a powerful means for characterizing somatic mutation frequency and identifying cancer driver genes. DiffMut is available at https://github.com/Singh-Lab/Differential-Mutation-Analysis .

  5. Mutation analysis of the APC gene in Taiwanese FAP families: low incidence of APC germline mutation in a distinct subgroup of FAP families.

    PubMed

    Chiang, J M; Chen, H W; Tang, R P; Chen, J S; Changchien, C R; Hsieh, P S; Wang, J Y

    2010-06-01

    Familial adenomatous polyposis (FAP) is an autosomal-dominant disease caused by germline mutations in the adenomatous polyposis coli (APC) gene. The affected individuals develop colorectal polyposis and show various extra-colonic manifestations. In this study, we aimed to investigate the genetic and clinical characteristics of FAP in Taiwanese families and analyze the genotype-phenotype correlations. Blood samples were obtained from 66 FAP patients registered in the hereditary colorectal cancer database. Then, germline mutations in the APC genes of these 66 polyposis patients from 47 unrelated FAP families were analyzed. The germline-mutation-negative cases were analyzed by performing multiplex ligation-dependent probe amplification (MLPA) and single-strand conformation polymorphism (SSCP) analysis of the MUTYH gene. Among the analyzed families, 79% (37/47) of the families showed 28 APC mutations, including 19 frameshift mutations, 4 nonsense mutations, 3 genomic deletion mutations, 1 missense mutation, and 1 splice-site mutation. In addition, we identified 15 novel mutations in 32% (15/47) of the families. The cases in which APC mutations were not identified showed significantly lower incidence of profuse polyposis (P = 0.034) and gastroduodenal polyps (P = 0.027). Furthermore, FAP families in which some affected individuals had less than 100 polyps showed significant association with low incidence of APC germline mutations (P = 0.002). We have added the APC germline-mutation data for Taiwanese FAP patients and indicated the presence of an FAP subgroup comprising affected individuals with nonadenomatous polyps or less than 100 adenomatous polyps; this form of FAP is less frequently caused by germline mutations of the APC gene.

  6. Timing, rates and spectra of human germline mutation.

    PubMed

    Rahbari, Raheleh; Wuster, Arthur; Lindsay, Sarah J; Hardwick, Robert J; Alexandrov, Ludmil B; Turki, Saeed Al; Dominiczak, Anna; Morris, Andrew; Porteous, David; Smith, Blair; Stratton, Michael R; Hurles, Matthew E

    2016-02-01

    Germline mutations are a driving force behind genome evolution and genetic disease. We investigated genome-wide mutation rates and spectra in multi-sibling families. The mutation rate increased with paternal age in all families, but the number of additional mutations per year differed by more than twofold between families. Meta-analysis of 6,570 mutations showed that germline methylation influences mutation rates. In contrast to somatic mutations, we found remarkable consistency in germline mutation spectra between the sexes and at different paternal ages. In parental germ line, 3.8% of mutations were mosaic, resulting in 1.3% of mutations being shared by siblings. The number of these shared mutations varied significantly between families. Our data suggest that the mutation rate per cell division is higher during both early embryogenesis and differentiation of primordial germ cells but is reduced substantially during post-pubertal spermatogenesis. These findings have important consequences for the recurrence risks of disorders caused by de novo mutations.

  7. Germline MLH1 Mutations Are Frequently Identified in Lynch Syndrome Patients With Colorectal and Endometrial Carcinoma Demonstrating Isolated Loss of PMS2 Immunohistochemical Expression.

    PubMed

    Dudley, Beth; Brand, Randall E; Thull, Darcy; Bahary, Nathan; Nikiforova, Marina N; Pai, Reetesh K

    2015-08-01

    Current guidelines on germline mutation testing for patients suspected of having Lynch syndrome are not entirely clear in patients with tumors demonstrating isolated loss of PMS2 immunohistochemical expression. We analyzed the clinical and pathologic features of patients with tumors demonstrating isolated loss of PMS2 expression in an attempt to (1) determine the frequency of germline MLH1 and PMS2 mutations and (2) correlate mismatch-repair protein immunohistochemistry and tumor histology with germline mutation results. A total of 3213 consecutive colorectal carcinomas and 215 consecutive endometrial carcinomas were prospectively analyzed for DNA mismatch-repair protein expression by immunohistochemistry. In total, 32 tumors from 31 patients demonstrated isolated loss of PMS2 immunohistochemical expression, including 16 colorectal carcinomas and 16 endometrial carcinomas. Microsatellite instability (MSI) polymerase chain reaction was performed in 29 tumors from 28 patients with the following results: 28 tumors demonstrated high-level MSI, and 1 tumor demonstrated low-level MSI. Twenty of 31 (65%) patients in the study group had tumors demonstrating histopathology associated with high-level MSI. Seventeen patients underwent germline mutation analysis with the following results: 24% with MLH1 mutations, 35% with PMS2 mutations, 12% with PMS2 variants of undetermined significance, and 29% with no mutations in either MLH1 or PMS2. Three of the 4 patients with MLH1 germline mutations had a mutation that results in decreased stability and quantity of the MLH1 protein that compromises the MLH1-PMS2 protein complex, helping to explain the presence of immunogenic but functionally inactive MLH1 protein within the tumor. The high frequency of MLH1 germline mutations identified in our study has important implications for testing strategies in patients suspected of having Lynch syndrome and indicates that patients with tumors demonstrating isolated loss of PMS2 expression without a germline PMS2 mutation must have MLH1 mutation analysis performed.

  8. Pitfalls in molecular analysis for mismatch repair deficiency in a family with biallelic pms2 germline mutations.

    PubMed

    Leenen, C H M; Geurts-Giele, W R R; Dubbink, H J; Reddingius, R; van den Ouweland, A M; Tops, C M J; van de Klift, H M; Kuipers, E J; van Leerdam, M E; Dinjens, W N M; Wagner, A

    2011-12-01

    Heterozygous germline mutations in the mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 cause Lynch syndrome. Biallelic mutations in the MMR genes are associated with a childhood cancer syndrome [constitutional mismatch repair deficiency (CMMR-D)]. This is predominantly characterized by hematological malignancies and tumors of the bowel and brain, often associated with signs of neurofibromatosis type 1 (NF1). Diagnostic strategies for selection of patients for MMR gene analysis include analysis of microsatellite instability (MSI) and immunohistochemical (IHC) analysis of MMR proteins in tumor tissue. We report the clinical characterization and molecular analyses of tumor specimens from a family with biallelic PMS2 germline mutations. This illustrates the pitfalls of present molecular screening strategies. Tumor tissues of five family members were analyzed for MSI and IHC. MSI was observed in only one of the analyzed tissues. However, IHC analysis of brain tumor tissue of the index patient and his sister showed absence of PMS2 expression, and germline mutation analyses showed biallelic mutations in PMS2: p.Ser46IIe and p.Pro246fs. The same heterozygous mutations were confirmed in the father and mother, respectively. These data support the conclusion that in case of a clinical phenotype of CMMR-D, it is advisable to routinely combine MSI analysis with IHC analysis for the expression of MMR proteins. With inconclusive or conflicting results, germline mutation analysis of the MMR genes should be considered after thorough counselling of the patients and/or their relatives. © 2011 John Wiley & Sons A/S.

  9. Germline mutation of CBL is associated with moyamoya disease in a child with juvenile myelomonocytic leukemia and Noonan syndrome-like disorder.

    PubMed

    Hyakuna, Nobuyuki; Muramatsu, Hideki; Higa, Takeshi; Chinen, Yasutsugu; Wang, Xinan; Kojima, Seiji

    2015-03-01

    Germline mutations in CBL have been identified in patients with Noonan syndrome-like phenotypes, while juvenile myelomonocytic leukemia (JMML) harbors duplication of a germline CBL, resulting in acquired isodisomy. The association between moyamoya disease and Noonan syndrome carrying a PTPN11 mutation has recently been reported. We present a patient with JMML who developed moyamoya disease and neovascular glaucoma. Our patient exhibited a Noonan syndrome-like phenotype. Genetic analysis revealed acquired isodisomy and a germline heterozygous mutation in CBL. This is a rare case of CBL mutation associated with moyamoya disease. Prolonged RAS pathway signaling may cause disruption of cerebrovascular development. © 2014 Wiley Periodicals, Inc.

  10. Frequency of CDH1 germline mutations in gastric carcinoma coming from high- and low-risk areas: metanalysis and systematic review of the literature

    PubMed Central

    2012-01-01

    Background The frequency of E-cadherin germline mutations in countries with different incidence rates for gastric carcinoma has not been well established. The goal of this study was to assess the worldwide frequency of CDH1 germline mutations in gastric cancers coming from low- and high-risk areas. Methods English articles using MEDLINE access (from 1998 to 2011). Search terms included CDH1, E-cadherin, germline mutation, gastric cancer, hereditary, familial and diffuse histotype. The study included all E-cadherin germline mutations identified in gastric cancer patients; somatic mutations and germline mutations reported in other tumors were excluded. The method of this study was scheduled in accordance with the "PRISMA statement for reporting systematic reviews and meta-analyses". Countries were classified as low- or middle/high risk-areas for gastric carcinoma incidence. Statistical analysis was performed to correlate the CDH1 mutation frequency with gastric cancer incidence areas. Results A total of 122 E-cadherin germline mutations have been identified; the majority (87.5%) occurred in gastric cancers coming from low-risk areas. In high-risk areas, we identified 16 mutations in which missense mutations were predominant. (68.8%). We verified a significant association between the mutation frequency and the gastric cancer risk area (p < 0.001: overall identified mutations in low- vs. middle/high-risk areas). Conclusions E-cadherin genetic screenings performed in low-risk areas for gastric cancer identified a higher frequency of CDH1 germline mutations. This data could open new approaches in the gastric cancer prevention test; before proposing a proband candidate for the CDH1 genetic screening, geographic variability, alongside the family history should be considered. PMID:22225527

  11. Colon and Endometrial Cancers with Mismatch Repair Deficiency can Arise from Somatic, Rather Than Germline, Mutations

    PubMed Central

    Haraldsdottir, Sigurdis; Hampel, Heather; Tomsic, Jerneja; Frankel, Wendy L.; Pearlman, Rachel; de la Chapelle, Albert; Pritchard, Colin C.

    2014-01-01

    Background & Aims Patients with Lynch syndrome carry germline mutations in single alleles of genes encoding the MMR proteins MLH1, MSH2, MSH6 and PMS2; when the second allele becomes mutated, cancer can develop. Increased screening for Lynch syndrome has identified patients with tumors that have deficiency in MMR, but no germline mutations in genes encoding MMR proteins. We investigated whether tumors with deficient MMR had acquired somatic mutations in patients without germline mutations in MMR genes using next-generation sequencing. Methods We analyzed blood and tumor samples from 32 patients with colorectal or endometrial cancer who participated in Lynch syndrome screening studies in Ohio and were found to have tumors with MMR deficiency (based on microsatellite instability and/or absence of MMR proteins in immunohistochemical analysis, without hypermethylation of MLH1), but no germline mutations in MMR genes. Tumor DNA was sequenced for MLH1, MSH2, MSH6, PMS2, EPCAM, POLE and POLD1 with ColoSeq and mutation frequencies were established. Results Twenty-two of 32 patients (69%) were found to have two somatic (tumor) mutations in MMR genes encoding proteins that were lost from tumor samples, based on immunohistochemistry. Of the 10 tumors without somatic mutations in MMR genes, 3 had somatic mutations with possible loss of heterozygosity that could lead to MMR deficiency, 6 were found to be false-positive results (19%), and 1 had no mutations known to be associated with MMR deficiency. All of the tumors found to have somatic MMR mutations were of the hypermutated phenotype (>12 mutations/Mb); 6 had mutation frequencies >200 per Mb, and 5 of these had somatic mutations in POLE, which encodes a DNA polymerase. Conclusions Some patients are found to have tumors with MMR deficiency during screening for Lynch syndrome, yet have no identifiable germline mutations in MMR genes. We found that almost 70% of these patients acquire somatic mutations in MMR genes, leading to a hypermutated phenotype of tumor cells. Patients with colon or endometrial cancers with MMR deficiency not explained by germline mutations might undergo analysis for tumor mutations in MMR genes, to guide future surveillance guidelines. PMID:25194673

  12. Mutations in LZTR1 add to the complex heterogeneity of schwannomatosis.

    PubMed

    Smith, Miriam J; Isidor, Bertand; Beetz, Christian; Williams, Simon G; Bhaskar, Sanjeev S; Richer, Wilfrid; O'Sullivan, James; Anderson, Beverly; Daly, Sarah B; Urquhart, Jill E; Fryer, Alan; Rustad, Cecilie F; Mills, Samantha J; Samii, Amir; du Plessis, Daniel; Halliday, Dorothy; Barbarot, Sebastien; Bourdeaut, Franck; Newman, William G; Evans, D Gareth

    2015-01-13

    We aimed to determine the proportion of individuals in our schwannomatosis cohort whose disease is associated with an LZTR1 mutation. We used exome sequencing, Sanger sequencing, and copy number analysis to screen 65 unrelated individuals with schwannomatosis who were negative for a germline NF2 or SMARCB1 mutation. We also screened samples from 39 patients with a unilateral vestibular schwannoma (UVS), plus at least one other schwannoma, but who did not have an identifiable germline or mosaic NF2 mutation. We identified germline LZTR1 mutations in 6 of 16 patients (37.5%) with schwannomatosis who had at least one affected relative, 11 of 49 (22%) sporadic patients, and 2 of 39 patients with UVS in our cohort. Three germline mutation-positive patients in total had developed a UVS. Mosaicism was excluded in 3 patients without germline mutation in NF2, SMARCB1, or LZTR1 by mutation screening in 2 tumors from each. Our data confirm the relationship between mutations in LZTR1 and schwannomatosis. They indicate that germline mutations in LZTR1 confer an increased risk of vestibular schwannoma, providing further overlap with NF2, and that further causative genes for schwannomatosis remain to be identified. © 2014 American Academy of Neurology.

  13. Mutations in LZTR1 add to the complex heterogeneity of schwannomatosis

    PubMed Central

    Smith, Miriam J.; Isidor, Bertand; Beetz, Christian; Williams, Simon G.; Bhaskar, Sanjeev S.; Richer, Wilfrid; O'Sullivan, James; Anderson, Beverly; Daly, Sarah B.; Urquhart, Jill E.; Fryer, Alan; Rustad, Cecilie F.; Mills, Samantha J.; Samii, Amir; du Plessis, Daniel; Halliday, Dorothy; Barbarot, Sebastien; Bourdeaut, Franck

    2015-01-01

    Objectives: We aimed to determine the proportion of individuals in our schwannomatosis cohort whose disease is associated with an LZTR1 mutation. Methods: We used exome sequencing, Sanger sequencing, and copy number analysis to screen 65 unrelated individuals with schwannomatosis who were negative for a germline NF2 or SMARCB1 mutation. We also screened samples from 39 patients with a unilateral vestibular schwannoma (UVS), plus at least one other schwannoma, but who did not have an identifiable germline or mosaic NF2 mutation. Results: We identified germline LZTR1 mutations in 6 of 16 patients (37.5%) with schwannomatosis who had at least one affected relative, 11 of 49 (22%) sporadic patients, and 2 of 39 patients with UVS in our cohort. Three germline mutation–positive patients in total had developed a UVS. Mosaicism was excluded in 3 patients without germline mutation in NF2, SMARCB1, or LZTR1 by mutation screening in 2 tumors from each. Conclusions: Our data confirm the relationship between mutations in LZTR1 and schwannomatosis. They indicate that germline mutations in LZTR1 confer an increased risk of vestibular schwannoma, providing further overlap with NF2, and that further causative genes for schwannomatosis remain to be identified. PMID:25480913

  14. Isolated Loss of PMS2 Immunohistochemical Expression is Frequently Caused by Heterogenous MLH1 Promoter Hypermethylation in Lynch Syndrome Screening for Endometrial Cancer Patients

    PubMed Central

    Sato, Naoki; Sugawara, Tae; Takahashi, Kazue; Kito, Masahiko; Makino, Kenichi; Sato, Toshiharu; Shimizu, Dai; Shirasawa, Hiromistu; Miura, Hiroshi; Sato, Wataru; Kumazawa, Yukiyo; Sato, Akira; Kumagai, Jin; Terada, Yukihiro

    2016-01-01

    Lynch syndrome (LS) is an autosomal-dominant inherited disorder mainly caused by a germline mutation in the DNA mismatch repair (MMR) genes (MLH1, MSH2, MSH6, and PMS2) and is associated with increased risk for various cancers, particularly colorectal cancer and endometrial cancer (EC). Women with LS account for 2% to 6% of EC patients; it is clinically important to identify LS in such individuals for predicting and/or preventing additional LS-associated cancers. PMS2 germline mutation (PMS2-LS) is the rarest contribution to LS etiology among the 4 LS-associated MMR germline mutations, and its detection is complicated. Therefore, prudent screening for PMS2-LS is important as it leads to an efficient LS identification strategy. Immunohistochemistry is recommended as a screening method for LS in EC. Isolated loss of PMS2 (IL-PMS2) expression is caused not only by PMS2-LS but also by MLH1 germline mutation or MLH1 promoter hypermethylation (MLH-PHM). This study aimed to determine the association between MLH1-PHM and IL-PMS2 to avoid inappropriate genetic analysis. We performed MLH1 methylation analysis and MLH1/PMS2 germline mutation testing on the IL-PMS2 cases. By performing MMR-immunohistochemistry on 360 unselected ECs, we could select 8 (2.2%) cases as IL-PMS2. Heterogenous MLH1 staining and MLH1-PHM were detected in 4 of 8 (50%) IL-PMS2 tumors. Of the 5 IL-PMS2 patients who underwent genetic analysis, 1 had PMS2 germline mutation with normal MLH1 expression (without MLH1-PHM), and no MLH1 germline mutation was detected. We suggest that MLH1 promoter methylation analysis for IL-PMS2 EC should be performed to exclude sporadic cases before further PMS2 genetic testing. PMID:26848797

  15. Isolated Loss of PMS2 Immunohistochemical Expression is Frequently Caused by Heterogenous MLH1 Promoter Hypermethylation in Lynch Syndrome Screening for Endometrial Cancer Patients.

    PubMed

    Kato, Aya; Sato, Naoki; Sugawara, Tae; Takahashi, Kazue; Kito, Masahiko; Makino, Kenichi; Sato, Toshiharu; Shimizu, Dai; Shirasawa, Hiromistu; Miura, Hiroshi; Sato, Wataru; Kumazawa, Yukiyo; Sato, Akira; Kumagai, Jin; Terada, Yukihiro

    2016-06-01

    Lynch syndrome (LS) is an autosomal-dominant inherited disorder mainly caused by a germline mutation in the DNA mismatch repair (MMR) genes (MLH1, MSH2, MSH6, and PMS2) and is associated with increased risk for various cancers, particularly colorectal cancer and endometrial cancer (EC). Women with LS account for 2% to 6% of EC patients; it is clinically important to identify LS in such individuals for predicting and/or preventing additional LS-associated cancers. PMS2 germline mutation (PMS2-LS) is the rarest contribution to LS etiology among the 4 LS-associated MMR germline mutations, and its detection is complicated. Therefore, prudent screening for PMS2-LS is important as it leads to an efficient LS identification strategy. Immunohistochemistry is recommended as a screening method for LS in EC. Isolated loss of PMS2 (IL-PMS2) expression is caused not only by PMS2-LS but also by MLH1 germline mutation or MLH1 promoter hypermethylation (MLH-PHM). This study aimed to determine the association between MLH1-PHM and IL-PMS2 to avoid inappropriate genetic analysis. We performed MLH1 methylation analysis and MLH1/PMS2 germline mutation testing on the IL-PMS2 cases. By performing MMR-immunohistochemistry on 360 unselected ECs, we could select 8 (2.2%) cases as IL-PMS2. Heterogenous MLH1 staining and MLH1-PHM were detected in 4 of 8 (50%) IL-PMS2 tumors. Of the 5 IL-PMS2 patients who underwent genetic analysis, 1 had PMS2 germline mutation with normal MLH1 expression (without MLH1-PHM), and no MLH1 germline mutation was detected. We suggest that MLH1 promoter methylation analysis for IL-PMS2 EC should be performed to exclude sporadic cases before further PMS2 genetic testing.

  16. Screening for germline mutations of MLH1, MSH2, MSH6 and PMS2 genes in Slovenian colorectal cancer patients: implications for a population specific detection strategy of Lynch syndrome.

    PubMed

    Berginc, Gasper; Bracko, Matej; Ravnik-Glavac, Metka; Glavac, Damjan

    2009-01-01

    Microsatellite instability (MSI) is present in more than 90% of colorectal cancers of patients with Lynch syndrome, and is therefore a feasible marker for the disease. Mutations in MLH1, MSH2, MSH6 and PMS2, which are one of the main causes of deficient mismatch repair and subsequent MSI, have been linked to the disease. In order to establish the role of each of the 4 genes in Slovenian Lynch syndrome patients, we performed MSI analysis on 593 unselected CRC patients and subsequently searched for the presence of point mutations, larger genomic rearrangements and MLH1 promoter hypermethylation in patients with MSI-high tumours. We detected 43 (7.3%) patients with MSI-H tumours, of which 7 patients (1.3%) harboured germline defects: 2 in MLH1, 4 in MSH2, 1 in PMS2 and none in MSH6. Twenty-nine germline sequence variations of unknown significance and 17 deleterious somatic mutations were found. MLH1 promoter methylation was detected in 56% of patients without detected germline defects and in 1 (14%) suspected Lynch syndrome. Due to the minor role of germline MSH6 mutations, we adapted the Lynch syndrome detection strategy for the Slovenian population of CRC patients, whereby germline alterations should be first sought in MLH1 and MSH2 followed by a search for larger genomic rearrangements in these two genes. When no germline mutations are found tumors should be further tested for the presence of germline defects in PMS2 and MSH6. The choice about which gene should be tested first can be guided more accurately by the immunohistochemical analysis. Our study demonstrates that the incidence of MMR mutations in a population should be known prior to the application of one of several suggested strategies for detection of Lynch syndrome.

  17. A population-based analysis of germline BAP1 mutations in melanoma.

    PubMed

    O'Shea, Sally J; Robles-Espinoza, Carla Daniela; McLellan, Lauren; Harrigan, Jeanine; Jacq, Xavier; Hewinson, James; Iyer, Vivek; Merchant, Will; Elliott, Faye; Harland, Mark; Bishop, D Timothy; Newton-Bishop, Julia A; Adams, David J

    2017-02-15

    Germline mutation of the BRCA1 associated protein-1 (BAP1) gene has been linked to uveal melanoma, mesothelioma, meningioma, renal cell carcinoma and basal cell carcinoma. Germline variants have also been found in familial cutaneous melanoma pedigrees, but their contribution to sporadic melanoma has not been fully assessed. We sequenced BAP1 in 1,977 melanoma cases and 754 controls and used deubiquitinase assays, a pedigree analysis, and a histopathological review to assess the consequences of the mutations found. Sequencing revealed 30 BAP1 variants in total, of which 27 were rare (ExAc allele frequency <0.002). Of the 27 rare variants, 22 were present in cases (18 missense, one splice acceptor, one frameshift and two near splice regions) and five in controls (all missense). A missense change (S98R) in a case that completely abolished BAP1 deubiquitinase activity was identified. Analysis of cancers in the pedigree of the proband carrying the S98R variant and in two other pedigrees carrying clear loss-of-function alleles showed the presence of BAP1-associated cancers such as renal cell carcinoma, mesothelioma and meningioma, but not uveal melanoma. Two of these three probands carrying BAP1 loss-of-function variants also had melanomas with histopathological features suggestive of a germline BAP1 mutation. The remaining cases with germline mutations, which were predominantly missense mutations, were associated with less typical pedigrees and tumours lacking a characteristic BAP1-associated histopathological appearances, but may still represent less penetrant variants. Germline BAP1 alleles defined as loss-of-function or predicted to be deleterious/damaging are rare in cutaneous melanoma. © The Author 2017. Published by Oxford University Press.

  18. A population-based analysis of germline BAP1 mutations in melanoma

    PubMed Central

    O’Shea, Sally J.; Robles-Espinoza, Carla Daniela; Harrigan, Jeanine; Jacq, Xavier; Hewinson, James; Iyer, Vivek; Merchant, Will; Elliott, Faye; Harland, Mark; Bishop, D. Timothy; Newton-Bishop, Julia A.

    2017-01-01

    Abstract Germline mutation of the BRCA1 associated protein-1 (BAP1) gene has been linked to uveal melanoma, mesothelioma, meningioma, renal cell carcinoma and basal cell carcinoma. Germline variants have also been found in familial cutaneous melanoma pedigrees, but their contribution to sporadic melanoma has not been fully assessed. We sequenced BAP1 in 1,977 melanoma cases and 754 controls and used deubiquitinase assays, a pedigree analysis, and a histopathological review to assess the consequences of the mutations found. Sequencing revealed 30 BAP1 variants in total, of which 27 were rare (ExAc allele frequency <0.002). Of the 27 rare variants, 22 were present in cases (18 missense, one splice acceptor, one frameshift and two near splice regions) and five in controls (all missense). A missense change (S98R) in a case that completely abolished BAP1 deubiquitinase activity was identified. Analysis of cancers in the pedigree of the proband carrying the S98R variant and in two other pedigrees carrying clear loss-of-function alleles showed the presence of BAP1-associated cancers such as renal cell carcinoma, mesothelioma and meningioma, but not uveal melanoma. Two of these three probands carrying BAP1 loss-of-function variants also had melanomas with histopathological features suggestive of a germline BAP1 mutation. The remaining cases with germline mutations, which were predominantly missense mutations, were associated with less typical pedigrees and tumours lacking a characteristic BAP1-associated histopathological appearances, but may still represent less penetrant variants. Germline BAP1 alleles defined as loss-of-function or predicted to be deleterious/damaging are rare in cutaneous melanoma. PMID:28062663

  19. Mutational analysis of the RB1 gene and the inheritance patterns of retinoblastoma in Jordan.

    PubMed

    Yousef, Yacoub A; Tbakhi, Abdelghani; Al-Hussaini, Maysa; AlNawaiseh, Ibrahim; Saab, Ala; Afifi, Amal; Naji, Maysa; Mohammad, Mona; Deebajah, Rasha; Jaradat, Imad; Sultan, Iyad; Mehyar, Mustafa

    2018-04-01

    Retinoblastoma (RB) is a childhood cancer developing in the retina due to RB1 pathologic variant. Herein we are evaluating the oncogenic mutations in the RB1 gene and the inheritance patterns of RB in the Jordanian patients. In this prospective study, the peripheral blood of 50 retinoblastoma patients was collected, genomic DNA was extracted, mutations were identified using Quantitative multiplex PCR (QM-PCR), Allele-specific PCR, Next Generation Sequencing analysis, and Sanger sequencing. In this cohort of 50 patients, 20(40%) patients had unilateral RB and 30(60%) were males. Overall, 36(72%) patients had germline disease, 17(47%) of whom had the same RB1 pathologic variant detected in one of the parents (inherited disease). In the bilateral group, all (100%) patients had germline disease; 13(43%) of them had inherited mutation. In the unilateral group, 6(30%) had germline disease, 4(20%) of them had inherited mutation. Nonsense mutation generating a stop codon and producing a truncated non-functional protein was the most frequent detected type of mutations (n = 15/36, 42%). Only one (2%) of the patients had mosaic mutation, and of the 17 inherited cases, 16(94%) had an unaffected carrier parent. In conclusion, in addition to all bilateral RB patients in our cohort, 30% of unilateral cases showed germline mutation. Almost half (47%) of germline cases had inherited disease from affected (6%) parent or unaffected carrier (94%). Therefore molecular screening is critical for the genetic counseling regarding the risk for inherited RB in both unilateral and bilateral cases including those with no family history.

  20. Monoallelic mutation analysis (MAMA) for identifying germline mutations.

    PubMed

    Papadopoulos, N; Leach, F S; Kinzler, K W; Vogelstein, B

    1995-09-01

    Dissection of germline mutations in a sensitive and specific manner presents a continuing challenge. In dominantly inherited diseases, mutations occur in only one allele and are often masked by the normal allele. Here we report the development of a sensitive and specific diagnostic strategy based on somatic cell hybridization termed MAMA (monoallelic mutation analysis). We have demonstrated the utility of this strategy in two different hereditary colorectal cancer syndromes, one caused by a defective tumour suppressor gene on chromosome 5 (familial adenomatous polyposis, FAP) and the other caused by a defective mismatch repair gene on chromosome 2 (hereditary non-polyposis colorectal cancer, HNPCC).

  1. Germline mutations in PMS2 and MLH1 in individuals with solitary loss of PMS2 expression in colorectal carcinomas from the Colon Cancer Family Registry Cohort.

    PubMed

    Rosty, Christophe; Clendenning, Mark; Walsh, Michael D; Eriksen, Stine V; Southey, Melissa C; Winship, Ingrid M; Macrae, Finlay A; Boussioutas, Alex; Poplawski, Nicola K; Parry, Susan; Arnold, Julie; Young, Joanne P; Casey, Graham; Haile, Robert W; Gallinger, Steven; Le Marchand, Loïc; Newcomb, Polly A; Potter, John D; DeRycke, Melissa; Lindor, Noralane M; Thibodeau, Stephen N; Baron, John A; Win, Aung Ko; Hopper, John L; Jenkins, Mark A; Buchanan, Daniel D

    2016-02-19

    Immunohistochemistry for DNA mismatch repair proteins is used to screen for Lynch syndrome in individuals with colorectal carcinoma (CRC). Although solitary loss of PMS2 expression is indicative of carrying a germline mutation in PMS2, previous studies reported MLH1 mutation in some cases. We determined the prevalence of MLH1 germline mutations in a large cohort of individuals with a CRC demonstrating solitary loss of PMS2 expression. This cohort study included 88 individuals affected with a PMS2-deficient CRC from the Colon Cancer Family Registry Cohort. Germline PMS2 mutation analysis (long-range PCR and multiplex ligation-dependent probe amplification) was followed by MLH1 mutation testing (Sanger sequencing and multiplex ligation-dependent probe amplification). Of the 66 individuals with complete mutation screening, we identified a pathogenic PMS2 mutation in 49 (74%), a pathogenic MLH1 mutation in 8 (12%) and a MLH1 variant of uncertain clinical significance predicted to be damaging by in silico analysis in 3 (4%); 6 (9%) carried variants likely to have no clinical significance. Missense point mutations accounted for most alterations (83%; 9/11) in MLH1. The MLH1 c.113A> G p.Asn38Ser mutation was found in 2 related individuals. One individual who carried the MLH1 intronic mutation c.677+3A>G p.Gln197Argfs*8 leading to the skipping of exon 8, developed 2 tumours, both of which retained MLH1 expression. A substantial proportion of CRCs with solitary loss of PMS2 expression are associated with a deleterious MLH1 germline mutation supporting the screening for MLH1 in individuals with tumours of this immunophenotype, when no PMS2 mutation has been identified. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  2. Germline mutations in PMS2 and MLH1 in individuals with solitary loss of PMS2 expression in colorectal carcinomas from the Colon Cancer Family Registry Cohort

    PubMed Central

    Rosty, Christophe; Clendenning, Mark; Walsh, Michael D; Eriksen, Stine V; Southey, Melissa C; Winship, Ingrid M; Macrae, Finlay A; Boussioutas, Alex; Parry, Susan; Arnold, Julie; Young, Joanne P; Casey, Graham; Haile, Robert W; Gallinger, Steven; Le Marchand, Loïc; Newcomb, Polly A; Potter, John D; DeRycke, Melissa; Lindor, Noralane M; Thibodeau, Stephen N; Baron, John A; Win, Aung Ko; Hopper, John L; Jenkins, Mark A; Buchanan, Daniel D

    2016-01-01

    Objectives Immunohistochemistry for DNA mismatch repair proteins is used to screen for Lynch syndrome in individuals with colorectal carcinoma (CRC). Although solitary loss of PMS2 expression is indicative of carrying a germline mutation in PMS2, previous studies reported MLH1 mutation in some cases. We determined the prevalence of MLH1 germline mutations in a large cohort of individuals with a CRC demonstrating solitary loss of PMS2 expression. Design This cohort study included 88 individuals affected with a PMS2-deficient CRC from the Colon Cancer Family Registry Cohort. Germline PMS2 mutation analysis (long-range PCR and multiplex ligation-dependent probe amplification) was followed by MLH1 mutation testing (Sanger sequencing and multiplex ligation-dependent probe amplification). Results Of the 66 individuals with complete mutation screening, we identified a pathogenic PMS2 mutation in 49 (74%), a pathogenic MLH1 mutation in 8 (12%) and a MLH1 variant of uncertain clinical significance predicted to be damaging by in silico analysis in 3 (4%); 6 (9%) carried variants likely to have no clinical significance. Missense point mutations accounted for most alterations (83%; 9/11) in MLH1. The MLH1 c.113A> G p.Asn38Ser mutation was found in 2 related individuals. One individual who carried the MLH1 intronic mutation c.677+3A>G p.Gln197Argfs*8 leading to the skipping of exon 8, developed 2 tumours, both of which retained MLH1 expression. Conclusions A substantial proportion of CRCs with solitary loss of PMS2 expression are associated with a deleterious MLH1 germline mutation supporting the screening for MLH1 in individuals with tumours of this immunophenotype, when no PMS2 mutation has been identified. PMID:26895986

  3. The Landscape of Somatic Genetic Alterations in Breast Cancers From ATM Germline Mutation Carriers.

    PubMed

    Weigelt, Britta; Bi, Rui; Kumar, Rahul; Blecua, Pedro; Mandelker, Diana L; Geyer, Felipe C; Pareja, Fresia; James, Paul A; Couch, Fergus J; Eccles, Diana M; Blows, Fiona; Pharoah, Paul; Li, Anqi; Selenica, Pier; Lim, Raymond S; Jayakumaran, Gowtham; Waddell, Nic; Shen, Ronglai; Norton, Larry; Wen, Hannah Y; Powell, Simon N; Riaz, Nadeem; Robson, Mark E; Reis-Filho, Jorge S; Chenevix-Trench, Georgia

    2018-02-28

    Pathogenic germline variants in ataxia-telangiectasia mutated (ATM), a gene that plays a role in DNA damage response and cell cycle checkpoints, confer an increased breast cancer (BC) risk. Here, we investigated the phenotypic characteristics and landscape of somatic genetic alterations in 24 BCs from ATM germline mutation carriers by whole-exome and targeted sequencing. ATM-associated BCs were consistently hormone receptor positive and largely displayed minimal immune infiltrate. Although 79.2% of these tumors exhibited loss of heterozygosity of the ATM wild-type allele, none displayed high activity of mutational signature 3 associated with defective homologous recombination DNA (HRD) repair. No TP53 mutations were found in the ATM-associated BCs. Analysis of an independent data set confirmed that germline ATM variants and TP53 somatic mutations are mutually exclusive. Our findings indicate that ATM-associated BCs often harbor bi-allelic inactivation of ATM, are phenotypically distinct from BRCA1/2-associated BCs, lack HRD-related mutational signatures, and that TP53 and ATM genetic alterations are likely epistatic.

  4. Mutational signature analysis identifies MUTYH deficiency in colorectal cancers and adrenocortical carcinomas: Mutational signature associated with MUTYH deficiency in cancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pilati, Camilla; Shinde, Jayendra; Alexandrov, Ludmil B.

    Germline alterations in DNA repair genes are implicated in cancer predisposition and can result in characteristic mutational signatures. However, specific mutational signatures associated with base excision repair (BER) defects remain to be characterized. Here, by analysing a series of colorectal cancers (CRCs) using exome sequencing, we identified a particular spectrum of somatic mutations characterized by an enrichment of C > A transversions in NpCpA or NpCpT contexts in three tumours from a MUTYH-associated polyposis (MAP) patient and in two cases harbouring pathogenic germline MUTYH mutations. In two series of adrenocortical carcinomas (ACCs), we identified four tumours with a similar signaturemore » also presenting germline MUTYH mutations. Altogether, these findings demonstrate that MUTYH inactivation results in a particular mutational signature, which may serve as a useful marker of BER-related genomic instability in new cancer types.« less

  5. Mutational signature analysis identifies MUTYH deficiency in colorectal cancers and adrenocortical carcinomas: Mutational signature associated with MUTYH deficiency in cancers

    DOE PAGES

    Pilati, Camilla; Shinde, Jayendra; Alexandrov, Ludmil B.; ...

    2017-03-29

    Germline alterations in DNA repair genes are implicated in cancer predisposition and can result in characteristic mutational signatures. However, specific mutational signatures associated with base excision repair (BER) defects remain to be characterized. Here, by analysing a series of colorectal cancers (CRCs) using exome sequencing, we identified a particular spectrum of somatic mutations characterized by an enrichment of C > A transversions in NpCpA or NpCpT contexts in three tumours from a MUTYH-associated polyposis (MAP) patient and in two cases harbouring pathogenic germline MUTYH mutations. In two series of adrenocortical carcinomas (ACCs), we identified four tumours with a similar signaturemore » also presenting germline MUTYH mutations. Altogether, these findings demonstrate that MUTYH inactivation results in a particular mutational signature, which may serve as a useful marker of BER-related genomic instability in new cancer types.« less

  6. Constitutional NRAS mutations are rare among patients with Noonan syndrome or juvenile myelomonocytic leukemia.

    PubMed

    Kraoua, Lilia; Journel, Hubert; Bonnet, Philippe; Amiel, Jeanne; Pouvreau, Nathalie; Baumann, Clarisse; Verloes, Alain; Cavé, Hélène

    2012-10-01

    Recently, germline mutations of NRAS have been shown to be associated with Noonan syndrome (NS), a relatively common developmental disorder characterized by short stature, congenital heart disease, and distinctive facial features. We report on the mutational analysis of NRAS in a cohort of 125 French patients with NS and no known mutation for PTPN11, KRAS, SOS1, MEK1, MEK2, RAF1, BRAF, and SHOC2. The c.179G>A (p.G60E) mutation was identified in two patients with typical NS, confirming that NRAS germline mutations are a rare cause of this syndrome. We also screened our cohort of 95 patients with juvenile myelomonocytic leukemia (JMML). Among 17 patients with NRAS-mutated JMML, none had clinical features suggestive of NS. None of the 11 JMML patients for which germline DNA was available had a constitutional NRAS mutation. Copyright © 2012 Wiley Periodicals, Inc.

  7. Germline mutations of KIT in gastrointestinal stromal tumor (GIST) and mastocytosis.

    PubMed

    Ke, Hengning; Kazi, Julhash U; Zhao, Hui; Sun, Jianmin

    2016-01-01

    Somatic mutations of KIT are frequently found in mastocytosis and gastrointestinal stromal tumor (GIST), while germline mutations of KIT are rare, and only found in few cases of familial GIST and mastocytosis. Although ligand-independent activation is the common feature of KIT mutations, the phenotypes mediated by various germline KIT mutations are different. Germline KIT mutations affect different tissues such as interstitial cells of Cajal (ICC), mast cells or melanocytes, and thereby lead to GIST, mastocytosis, or abnormal pigmentation. In this review, we summarize germline KIT mutations in familial mastocytosis and GIST and discuss the possible cellular context dependent transforming activity of KIT mutations.

  8. Germline mutations in the proof-reading domains of POLE and POLD1 predispose to colorectal adenomas and carcinomas

    PubMed Central

    Palles, Claire; Cazier, Jean-Baptiste; Howarth, Kimberley M; Domingo, Enric; Jones, Angela M.; Broderick, Peter; Kemp, Zoe; Spain, Sarah L; Almeida, Estrella Guarino; Salguero, Israel; Sherborne, Amy; Chubb, Daniel; Carvajal-Carmona, Luis G; Ma, Yusanne; Kaur, Kulvinder; Dobbins, Sara; Barclay, Ella; Gorman, Maggie; Martin, Lynn; Kovac, Michal B; Humphray, Sean; Lucassen, Anneke; Holmes, Christopher; Bentley, David; Donnelly, Peter; Taylor, Jenny; Petridis, Christos; Roylance, Rebecca; Sawyer, Elinor J; Kerr, David J.; Clark, Susan; Grimes, Jonathan; Kearsey, Stephen E; Thomas, Huw JW; McVean, Gilean; Houlston, Richard S; Tomlinson, Ian

    2013-01-01

    Many individuals with multiple or large colorectal adenomas, or early-onset colorectal cancer (CRC), have no detectable germline mutations in the known cancer predisposition genes. Using whole-genome sequencing, supplemented by linkage and association analysis, we identified specific heterozygous POLE or POLD1 germline variants in several multiple adenoma and/or CRC cases, but in no controls. The susceptibility variants appear to have high penetrance. POLD1 is also associated with endometrial cancer predisposition. The mutations map to equivalent sites in the proof-reading (exonuclease) domain of DNA polymerases ε and δ, and are predicted to impair correction of mispaired bases inserted during DNA replication. In agreement with this prediction, mutation carriers’ tumours were microsatellite-stable, but tended to acquire base substitution mutations, as confirmed by yeast functional assays. Further analysis of published data showed that the recently-described group of hypermutant, microsatellite-stable CRCs is likely to be caused by somatic POLE exonuclease domain mutations. PMID:23263490

  9. RAD50 germline mutations are associated with poor survival in BRCA1/2-negative breast cancer patients.

    PubMed

    Fan, Cong; Zhang, Juan; Ouyang, Tao; Li, Jinfeng; Wang, Tianfeng; Fan, Zhaoqing; Fan, Tie; Lin, Benyao; Xie, Yuntao

    2018-05-04

    RAD50 is a highly conserved DNA double-strand break (DSB) repair gene. However, the associations between RAD50 germline mutations and the survival and risk of breast cancer have not been fully elucidated. Here, we aimed to investigate the clinical impact of RAD50 germline mutations in a large cohort of unselected breast cancer patients. In this study, RAD50 germline mutations were determined using next-generation sequencing in 7657 consecutive unselected breast cancer patients without BRCA1/2 mutations. We also screened for RAD50 recurrent mutations (L719fs, K994fs, and H1269fs) in 5000 healthy controls using Sanger sequencing. We found that 26 out of 7657 (0.34%) patients had RAD50 pathogenic mutations, and 16 patients carried one of the three recurrent mutations (L719fs, n=6 cases; K994fs, n=5 cases; and H1269fs, n=5 cases); the recurrent mutation rate was 0.21%. The frequency of the three recurrent mutations in the 5000 healthy controls was 0.18% (9/5000). These mutations did not confer an increased risk of breast cancer in the studied patients [odds ratios (OR), 1.16; 95% confidence interval (CI), 0.51-2.63; P = 0.72]. Nevertheless, multivariate analysis revealed that RAD50 pathogenic mutations were an independent unfavourable predictor of recurrence-free survival (RFS) [adjusted hazard ratio (HR) 2.66; 95% CI, 1.18-5.98; P=0.018] and disease-specific survival (DSS) (adjusted HR 4.36; 95% CI, 1.58-12.03; P=0.004) in the entire study cohort. Our study suggested that RAD50 germline mutations are not associated with an increased risk of breast cancer, but patients with RAD50 germline mutations have unfavourable survival compared with patients without these mutations. This article is protected by copyright. All rights reserved. © 2018 UICC.

  10. Multiple endocrine neoplasia type 2 syndromes (MEN 2): results from the ItaMEN network analysis on the prevalence of different genotypes and phenotypes.

    PubMed

    Romei, Cristina; Mariotti, Stefano; Fugazzola, Laura; Taccaliti, Augusto; Pacini, Furio; Opocher, Giuseppe; Mian, Caterina; Castellano, Maurizio; degli Uberti, Ettore; Ceccherini, Isabella; Cremonini, Nadia; Seregni, Ettore; Orlandi, Fabio; Ferolla, Piero; Puxeddu, Efisio; Giorgino, Francesco; Colao, Annamaria; Loli, Paola; Bondi, Fabio; Cosci, Barbara; Bottici, Valeria; Cappai, Antonello; Pinna, Giovanni; Persani, Luca; Verga, Uberta; Uberta, Verga; Boscaro, Marco; Castagna, Maria Grazia; Cappelli, Carlo; Zatelli, Maria Chiara; Faggiano, Antongiulio; Francia, Giuseppe; Brandi, Maria Luisa; Falchetti, Alberto; Pinchera, Aldo; Elisei, Rossella

    2010-08-01

    Multiple endocrine neoplasia type 2 (MEN 2) is a genetic disease characterized by medullary thyroid carcinoma (MTC) associated (MEN 2A and 2B) or not familial MTC (FMTC) with other endocrine neoplasia due to germline RET gene mutations. The prevalence of these rare genetic diseases and their corresponding RET mutations are unknown due to the small size of the study population. We collected data on germline RET mutations of 250 families with hereditary MTC followed in 20 different Italian centres. The most frequent RET amino acid substitution was Val804Met (19.6%) followed by Cys634Arg (13.6%). A total of 40 different germline RET mutations were present. Six families (2.4%) were negative for germline RET mutations. The comparison of the prevalence of RET germline mutations in the present study with those published by other European studies showed a higher prevalence of Val804Met and Ser891Ala mutations and a lower prevalence of Leu790Phe and Tyr791Phe (P<0.0001). A statistically significant higher prevalence of mutations affecting non-cysteine codons was also found (P<0.0001). Furthermore, the phenotype data collection showed an unexpected higher prevalence of FMTC (57.6%) with respect to other MEN 2 syndromes (34% MEN 2A and 6.8% of MEN 2B). In conclusion, we observed a statistically significant different pattern of RET mutations in Italian MEN 2 families with respect to other European studies and a higher prevalence of FMTC phenotype. The different ethnic origins of the patients and the particular attention given to analysing apparently sporadic MTC for RET germline mutations may explain these findings.

  11. Germline mutations affecting the proofreading domains of POLE and POLD1 predispose to colorectal adenomas and carcinomas.

    PubMed

    Palles, Claire; Cazier, Jean-Baptiste; Howarth, Kimberley M; Domingo, Enric; Jones, Angela M; Broderick, Peter; Kemp, Zoe; Spain, Sarah L; Guarino, Estrella; Guarino Almeida, Estrella; Salguero, Israel; Sherborne, Amy; Chubb, Daniel; Carvajal-Carmona, Luis G; Ma, Yusanne; Kaur, Kulvinder; Dobbins, Sara; Barclay, Ella; Gorman, Maggie; Martin, Lynn; Kovac, Michal B; Humphray, Sean; Lucassen, Anneke; Holmes, Christopher C; Bentley, David; Donnelly, Peter; Taylor, Jenny; Petridis, Christos; Roylance, Rebecca; Sawyer, Elinor J; Kerr, David J; Clark, Susan; Grimes, Jonathan; Kearsey, Stephen E; Thomas, Huw J W; McVean, Gilean; Houlston, Richard S; Tomlinson, Ian

    2013-02-01

    Many individuals with multiple or large colorectal adenomas or early-onset colorectal cancer (CRC) have no detectable germline mutations in the known cancer predisposition genes. Using whole-genome sequencing, supplemented by linkage and association analysis, we identified specific heterozygous POLE or POLD1 germline variants in several multiple-adenoma and/or CRC cases but in no controls. The variants associated with susceptibility, POLE p.Leu424Val and POLD1 p.Ser478Asn, have high penetrance, and POLD1 mutation was also associated with endometrial cancer predisposition. The mutations map to equivalent sites in the proofreading (exonuclease) domain of DNA polymerases ɛ and δ and are predicted to cause a defect in the correction of mispaired bases inserted during DNA replication. In agreement with this prediction, the tumors from mutation carriers were microsatellite stable but tended to acquire base substitution mutations, as confirmed by yeast functional assays. Further analysis of published data showed that the recently described group of hypermutant, microsatellite-stable CRCs is likely to be caused by somatic POLE mutations affecting the exonuclease domain.

  12. Proven germline mosaicism in a father of two children with CHARGE syndrome.

    PubMed

    Pauli, S; Pieper, L; Häberle, J; Grzmil, P; Burfeind, P; Steckel, M; Lenz, U; Michelmann, H W

    2009-05-01

    CHARGE syndrome is an autosomal dominant malformation syndrome caused by mutations in the CHD7 gene. The majority of cases are sporadic and only few familial cases have been reported. In these families, mosaicism in one parent, as well as parent- to-child transmission of a CHD7 mutation, has been described. In some further cases, germline mosaicism has been suggested. Here, we report the first case in which germline mosaicism could be demonstrated in a father of two affected children with CHARGE syndrome. The truncating mutation c.7302dupA in exon 34 of the CHD7 gene was found in both affected children but was not detected in parental lymphocytes. However, in DNA extracted from the father's spermatozoa, the c.7302dupA mutation could be identified. Furthermore, mutation analysis of DNA isolated from 59 single spermatozoa revealed that the c.7302dupA mutation occurs in 16 spermatozoa, confirming germline mosaicism in the father of the affected children. This result has a high impact for genetic counselling of the family and for their recurrence risk in further pregnancies.

  13. Brooke-Spiegler syndrome: report of 10 patients from 8 families with novel germline mutations: evidence of diverse somatic mutations in the same patient regardless of tumor type.

    PubMed

    Sima, Radek; Vanecek, Tomas; Kacerovska, Denisa; Trubac, Pavel; Cribier, Bernard; Rutten, Arno; Vazmitel, Marina; Spagnolo, Dominic V; Litvik, Radek; Vantuchova, Yvetta; Weyers, Wolfgang; Pearce, Robert L; Pearn, John; Michal, Michal; Kazakov, Dmitry V

    2010-06-01

    Brooke-Spiegler syndrome (BSS) is an inherited autosomal dominant disease characterized by the development of multiple adnexal cutaneous neoplasms including spiradenoma, cylindroma, spiradenocylindroma, and trichoepithelioma (cribriform trichoblastoma). BSS patients have various mutations in the CYLD gene, a tumor suppressor gene located on chromosome 16q. Our search of the literature revealed 51 germline CYLD mutations reported to date. Somatic CYLD mutations have rarely been investigated. We studied 10 patients from 8 families with BSS. Analysis of germline mutations of the CYLD gene was performed using either peripheral blood or nontumorous tissue. In addition, 19 formalin-fixed paraffin-embedded tumor samples were analyzed for somatic mutations, including loss of heterozygosity studies. A total of 38 tumors were available for histopathologic review. We have identified 8 novel germline mutations, all of which consisted of substitutions, deletions, and insertions/duplications and all except one led to premature stop codons. The substitution mutation in a single case was also predicted to disrupt protein function and seems causally implicated in tumor formation. We demonstrate for the first time that somatic events, loss of heterozygosity, or sequence mutations may differ among multiple neoplasms even of the same histologic type, occurring in the same patient.

  14. Clinical analysis of PMS2: mutation detection and avoidance of pseudogenes.

    PubMed

    Vaughn, Cecily P; Robles, Jorge; Swensen, Jeffrey J; Miller, Christine E; Lyon, Elaine; Mao, Rong; Bayrak-Toydemir, Pinar; Samowitz, Wade S

    2010-05-01

    Germline mutation detection in PMS2, one of four mismatch repair genes associated with Lynch syndrome, is greatly complicated by the presence of numerous pseudogenes. We used a modification of a long-range PCR method to evaluate PMS2 in 145 clinical samples. This modification avoids potential interference from the pseudogene PMS2CL by utilizing a long-range product spanning exons 11-15, with the forward primer anchored in exon 10, an exon not shared by PMS2CL. Large deletions were identified by MLPA. Pathogenic PMS2 mutations were identified in 22 of 59 patients whose tumors showed isolated loss of PMS2 by immunohistochemistry (IHC), the IHC profile most commonly associated with a germline PMS2 mutation. Three additional patients with pathogenic mutations were identified from 53 samples without IHC data. Thirty-seven percent of the identified mutations were large deletions encompassing one or more exons. In 27 patients whose tumors showed absence of either another protein or combination of proteins, no pathogenic mutations were identified. We conclude that modified long-range PCR can be used to preferentially amplify the PMS2 gene and avoid pseudogene interference, thus providing a clinically useful germline analysis of PMS2. Our data also support the use of IHC screening to direct germline testing of PMS2. (c) 2010 Wiley-Liss, Inc.

  15. Mutation Detection in Patients With Advanced Cancer by Universal Sequencing of Cancer-Related Genes in Tumor and Normal DNA vs Guideline-Based Germline Testing.

    PubMed

    Mandelker, Diana; Zhang, Liying; Kemel, Yelena; Stadler, Zsofia K; Joseph, Vijai; Zehir, Ahmet; Pradhan, Nisha; Arnold, Angela; Walsh, Michael F; Li, Yirong; Balakrishnan, Anoop R; Syed, Aijazuddin; Prasad, Meera; Nafa, Khedoudja; Carlo, Maria I; Cadoo, Karen A; Sheehan, Meg; Fleischut, Megan H; Salo-Mullen, Erin; Trottier, Magan; Lipkin, Steven M; Lincoln, Anne; Mukherjee, Semanti; Ravichandran, Vignesh; Cambria, Roy; Galle, Jesse; Abida, Wassim; Arcila, Marcia E; Benayed, Ryma; Shah, Ronak; Yu, Kenneth; Bajorin, Dean F; Coleman, Jonathan A; Leach, Steven D; Lowery, Maeve A; Garcia-Aguilar, Julio; Kantoff, Philip W; Sawyers, Charles L; Dickler, Maura N; Saltz, Leonard; Motzer, Robert J; O'Reilly, Eileen M; Scher, Howard I; Baselga, Jose; Klimstra, David S; Solit, David B; Hyman, David M; Berger, Michael F; Ladanyi, Marc; Robson, Mark E; Offit, Kenneth

    2017-09-05

    Guidelines for cancer genetic testing based on family history may miss clinically actionable genetic changes with established implications for cancer screening or prevention. To determine the proportion and potential clinical implications of inherited variants detected using simultaneous sequencing of the tumor and normal tissue ("tumor-normal sequencing") compared with genetic test results based on current guidelines. From January 2014 until May 2016 at Memorial Sloan Kettering Cancer Center, 10 336 patients consented to tumor DNA sequencing. Since May 2015, 1040 of these patients with advanced cancer were referred by their oncologists for germline analysis of 76 cancer predisposition genes. Patients with clinically actionable inherited mutations whose genetic test results would not have been predicted by published decision rules were identified. Follow-up for potential clinical implications of mutation detection was through May 2017. Tumor and germline sequencing compared with the predicted yield of targeted germline sequencing based on clinical guidelines. Proportion of clinically actionable germline mutations detected by universal tumor-normal sequencing that would not have been detected by guideline-directed testing. Of 1040 patients, the median age was 58 years (interquartile range, 50.5-66 years), 65.3% were male, and 81.3% had stage IV disease at the time of genomic analysis, with prostate, renal, pancreatic, breast, and colon cancer as the most common diagnoses. Of the 1040 patients, 182 (17.5%; 95% CI, 15.3%-19.9%) had clinically actionable mutations conferring cancer susceptibility, including 149 with moderate- to high-penetrance mutations; 101 patients tested (9.7%; 95% CI, 8.1%-11.7%) would not have had these mutations detected using clinical guidelines, including 65 with moderate- to high-penetrance mutations. Frequency of inherited mutations was related to case mix, stage, and founder mutations. Germline findings led to discussion or initiation of change to targeted therapy in 38 patients tested (3.7%) and predictive testing in the families of 13 individuals (1.3%), including 6 for whom genetic evaluation would not have been initiated by guideline-based testing. In this referral population with selected advanced cancers, universal sequencing of a broad panel of cancer-related genes in paired germline and tumor DNA samples was associated with increased detection of individuals with potentially clinically significant heritable mutations over the predicted yield of targeted germline testing based on current clinical guidelines. Knowledge of these additional mutations can help guide therapeutic and preventive interventions, but whether all of these interventions would improve outcomes for patients with cancer or their family members requires further study. clinicaltrials.gov Identifier: NCT01775072.

  16. Schwannomatosis associated with multiple meningiomas due to a familial SMARCB1 mutation.

    PubMed

    Bacci, Costanza; Sestini, Roberta; Provenzano, Aldesia; Paganini, Irene; Mancini, Irene; Porfirio, Berardino; Vivarelli, Rossella; Genuardi, Maurizio; Papi, Laura

    2010-02-01

    Schwannomatosis (MIM 162091) is a condition predisposing to the development of central and peripheral schwannomas; most cases are sporadic without a clear family history but a few families with a clear autosomal dominant pattern of transmission have been described. Germline mutations in SMARCB1 are associated with schwannomatosis. We report a family with multiple schwannomas and meningiomas. A SMARCB1 germline mutation in exon 1 was identified. The mutation, c.92A>T (p.Glu31Val), occurs in a highly conserved amino acid in the SMARCB1 protein. In addition, in silico analysis demonstrated that the mutation disrupts the donor consensus sequence of exon 1. RNA studies verified the absence of mRNA transcribed by the mutant allele. This is the first report of a SMARCB1 germline mutation in a family with schwannomatosis characterized by the development of multiple meningiomas.

  17. Germline mutation of CHEK2 in neurofibromatosis 1 and 2: Two case reports.

    PubMed

    Li, Qiang; Zhao, Feilong; Ju, Yan

    2018-06-01

    Neurofibromatosis, including type 1 and type 2, is inherited dominant disease that causes serious consequences. The genetic mechanism of these diseases has been described, but germline mutation of checkpoint 2 kinase gene, together with other DNA repair related genes, has not been fully elucidated in the context of neurofibromatosis. In this article, we reported identical germline mutation of CHEK2 gene (p.R180C) in a 7-year-old Tibetan boy with NF1, and in a 12-year-old Chinese girl with NF2. Neurofibromatosis 1 and 2 with CHECK2 gene germline mutation. Both patients underwent operation to obtain tumor tissue, and peripheral blood of their family was tested. Identical germline mutation of CHEK2 gene (p.R180C) was detected in both patients, and germline mutations of POLE, MUTYH and ATR were also detected. This is the first article to describe CHEK2 mutation in both NF1 and NF2. This article highlights a possible role of CHEK2, in association with other germline genetic mutations, in tumorigenesis of NF1 and NF2.

  18. Inducible Transgenic Models of BRCAl Function

    DTIC Science & Technology

    1997-10-01

    TIC Fort Detrick, Maryland 21702-5012. 13. ABSTRACT (Maximum 200 words) Germline mutations in the breast and ovarian cancer susceptibility gene ...breast cancer cases result from the inheritance of germline mutations in autosomal dominant susceptibility genes ", 2. Germline mutations in one of these...BRCA1, account for a large proportion of families with inherited breast and ovarian cancer. Interestingly, while germline BRCA1 mutations predispose

  19. BRCA1 and BRCA2 germline mutations in lymphoma patients.

    PubMed

    Yossepowitch, Orit; Olvera, Narciso; Satagopan, Jaya M; Huang, Helen; Jhanwar, Sabrina; Rapaport, Beth; Boyd, Jeff; Offit, Kenneth

    2003-01-01

    Mutations in the BRCA1 and BRCA2 tumor suppressor genes are associated with an increased risk for breast and ovarian cancers as well as other types of malignancies. The observation of a germline BRCA1 mutation in an index case with a lymphoid neoplasm in the setting of a family history of breast cancer prompted us to explore the role of BRCA germline mutations as lymphoma susceptibility alleles. A panel of 286 DNA samples from Jewish lymphoma patients was analyzed for the three most frequent BRCA1 and BRCA2 germline mutations in those of Ashkenazi Jewish heritage, and compared to a cohort of 5010 DNA samples from healthy controls. Of the 286 cases, 2 patients carried a germline BRCA mutation; both were diagnosed at an early age with an intermediate grade non-Hodgkin's lymphoma. This data indicate that germline BRCA mutations are not associated with an increased risk for lymphoid malignancies.

  20. Familial schwannomatosis with a germline mutation of SMARCB1 in Japan.

    PubMed

    Asai, Katsunori; Tani, Shoichi; Mineharu, Yohei; Tsurusaki, Yoshinori; Imai, Yukihiro; Agawa, Yuji; Iwaki, Koichi; Matsumoto, Naomichi; Sakai, Nobuyuki

    2015-07-01

    Schwannomatosis is the third major form of neurofibromatosis (NF) and is distinct from NF1 and NF2. The disease is not well recognized in Asian countries and the role of germline SMARCB1 mutations requires investigation. A 35-year-old Japanese man complaining of headache underwent an MRI examination, which showed a cystic tumor at the left cerebellopontine angle. The tumor was surgically removed and diagnosed as vagus nerve schwannoma. He had a past medical history of multiple schwannomas of the neck, groin and intercostal nerves, which were also treated surgically. He had a family history of multiple schwannomas for his father and sister. Systemic examinations of these family members ruled out a diagnosis of NF1 or NF2, and thus schwannomatosis was suspected. Genetic analysis revealed a germline mutation (c. *82C > T) of SMARCB1, and a somatic mutation of NF2 without loss of heterozygosity at the chromosome 22 locus. This is the first report of familial schwannomatosis associated with a germline mutation of SMARCB1 in an Asian country.

  1. MSH6 and MSH3 are rarely involved in genetic predisposition to nonpolypotic colon cancer.

    PubMed

    Huang, J; Kuismanen, S A; Liu, T; Chadwick, R B; Johnson, C K; Stevens, M W; Richards, S K; Meek, J E; Gao, X; Wright, F A; Mecklin, J P; Järvinen, H J; Grönberg, H; Bisgaard, M L; Lindblom, A; Peltomäki, P

    2001-02-15

    A set of 90 nonpolypotic colon cancer families in which germ-line mutations of MSH2 and MLH1 had been excluded were screened for mutations in two additional DNA mismatch repair genes, MSH6 and MSH3. Kindreds fulfilling and not fulfilling the Amsterdam I criteria, showing early and late onset colorectal (and other) cancers, and having microsatellite stable and unstable tumors were included. Two partly parallel approaches were used: genetic linkage analysis (19 large families) and the protein truncation test (85, mostly smaller, families). Whereas MSH3 was not involved in any family, a large Amsterdam-positive, late-onset family showed a novel germ-line mutation in MSH6 (deletion of CT at nucleotide 3052 in exon 4). The mutation was identified through genetic linkage (multipoint lod score 2.4) and subsequent sequencing of MSH6. Furthermore, the entire MSH6 gene was sequenced exon by exon in families with frameshift mutations in the (C)8 tract in tumors, previously suggested as a predictor of MSH6 germ-line mutations; no mutations were found. We conclude that germ-line involvement of MSH6 and MSH3 is rare and that other genes are likely to account for a majority of MSH2-, MLH1-mutation negative families with nonpolypotic colon cancer.

  2. A comprehensive evaluation of CHEK2 germline mutations in men with prostate cancer.

    PubMed

    Wu, Yishuo; Yu, Hongjie; Zheng, S Lilly; Na, Rong; Mamawala, Mufaddal; Landis, Tricia; Wiley, Kathleen; Petkewicz, Jacqueline; Shah, Sameep; Shi, Zhuqing; Novakovic, Kristian; McGuire, Michael; Brendler, Charles B; Ding, Qiang; Helfand, Brian T; Carter, H Ballentine; Cooney, Kathleen A; Isaacs, William B; Xu, Jianfeng

    2018-06-01

    Germline mutations in CHEK2 have been associated with prostate cancer (PCa) risk. Our objective is to examine whether germline pathogenic CHEK2 mutations can differentiate risk of lethal from indolent PCa. A case-case study of 703 lethal PCa patients and 1455 patients with low-risk localized PCa of European, African, and Chinese origin was performed. Germline DNA samples from these patients were sequenced for CHEK2. Mutation carrier rates and their association with lethal PCa were analyzed using the Fisher exact test and Kaplan-Meier survival analysis. In the entire study population, 40 (1.85%) patients were identified as carrying one of 15 different germline CHEK2 pathogenic or likely pathogenic mutations. CHEK2 mutations were detected in 16 (2.28%) of 703 lethal PCa patients compared with 24 (1.65%) of 1455 low-risk PCa patients (P = 0.31). No association was found between CHEK2 mutation status and early-diagnosis or PCa-specific survival time. However, the most common mutation in CHEK2, c.1100delC (p.T367 fs), had a significantly higher carrier rate (1.28%) in lethal PCa patients than low-risk PCa patients of European American origin (0.16%), P = 0.0038. The estimated Odds Ratio of this mutation for lethal PCa was 7.86. The carrier rate in lethal PCa was also significantly higher than that (0.46%) in 32 461 non-Finnish European subjects from the Exome Aggregation Consortium (ExAC) (P = 0.01). While overall CHEK2 mutations were not significantly more common in men with lethal compared to low-risk PCa, the specific CHEK2 mutation, c.1100delC, appears to contribute to an increased risk of lethal PCa in European American men. © 2018 Wiley Periodicals, Inc.

  3. An immunohistochemical procedure to detect patients with paraganglioma and phaeochromocytoma with germline SDHB, SDHC, or SDHD gene mutations: a retrospective and prospective analysis

    PubMed Central

    van Nederveen, Francien H; Gaal, José; Favier, Judith; Korpershoek, Esther; Oldenburg, Rogier A; de Bruyn, Elly M C A; Sleddens, Hein F B M; Derkx, Pieter; Rivière, Julie; Dannenberg, Hilde; Petri, Bart-Jeroen; Komminoth, Paul; Pacak, Karel; Hop, Wim C J; Pollard, Patrick J; Mannelli, Massimo; Bayley, Jean-Pierre; Perren, Aurel; Niemann, Stephan; Verhofstad, Albert A; de Bruïne, Adriaan P; Maher, Eamonn R; Tissier, Frédérique; Méatchi, Tchao; Badoual, Cécile; Bertherat, Jérôme; Amar, Laurence; Alataki, Despoina; Van Marck, Eric; Ferrau, Francesco; François, Jerney; de Herder, Wouter W; Peeters, Mark-Paul F M Vrancken; van Linge, Anne; Lenders, Jacques W M; Gimenez-Roqueplo, Anne-Paule; de Krijger, Ronald R; Dinjens, Winand N M

    2016-01-01

    Summary Background Phaeochromocytomas and paragangliomas are neuro-endocrine tumours that occur sporadically and in several hereditary tumour syndromes, including the phaeochromocytoma–paraganglioma syndrome. This syndrome is caused by germline mutations in succinate dehydrogenase B (SDHB), C (SDHC), or D (SDHD) genes. Clinically, the phaeochromocytoma–paraganglioma syndrome is often unrecognised, although 10–30% of apparently sporadic phaeochromocytomas and paragangliomas harbour germline SDH-gene mutations. Despite these figures, the screening of phaeochromocytomas and paragangliomas for mutations in the SDH genes to detect phaeochromocytoma–paraganglioma syndrome is rarely done because of time and financial constraints. We investigated whether SDHB immunohistochemistry could effectively discriminate between SDH-related and non-SDH-related phaeochromocytomas and paragangliomas in large retrospective and prospective tumour series. Methods Immunohistochemistry for SDHB was done on 220 tumours. Two retrospective series of 175 phaeochromocytomas and paragangliomas with known germline mutation status for phaeochromocytoma-susceptibility or paraganglioma-susceptibility genes were investigated. Additionally, a prospective series of 45 phaeochromocytomas and paragangliomas was investigated for SDHB immunostaining followed by SDHB, SDHC, and SDHD mutation testing. Findings SDHB protein expression was absent in all 102 phaeochromocytomas and paragangliomas with an SDHB, SDHC, or SDHD mutation, but was present in all 65 paraganglionic tumours related to multiple endocrine neoplasia type 2, von Hippel–Lindau disease, and neurofibromatosis type 1. 47 (89%) of the 53 phaeochromocytomas and paragangliomas with no syndromic germline mutation showed SDHB expression. The sensitivity and specificity of the SDHB immunohistochemistry to detect the presence of an SDH mutation in the prospective series were 100% (95% CI 87–100) and 84% (60–97), respectively. Interpretation Phaeochromocytoma–paraganglioma syndrome can be diagnosed reliably by an immunohistochemical procedure. SDHB, SDHC, and SDHD germline mutation testing is indicated only in patients with SDHB-negative tumours. SDHB immunohistochemistry on phaeochromocytomas and paragangliomas could improve the diagnosis of phaeochromocytoma–paraganglioma syndrome. PMID:19576851

  4. Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome.

    PubMed

    Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

    2014-01-01

    Germline mutations are responsible for familial cancer syndromes which account for approximately 5-10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. Two co-existing germline mutations P53 V157D and PMS2 R20Q promote tumorigenesis in a familial cancer syndrome

    PubMed Central

    Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin

    2014-01-01

    Germline mutations are responsible for familial cancer syndromes which account for approximately 5–10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22 years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. PMID:23981578

  6. Mutation analysis of HIF prolyl hydroxylases (PHD/EGLN) in individuals with features of phaeochromocytoma and renal cell carcinoma susceptibility.

    PubMed

    Astuti, Dewi; Ricketts, Christopher J; Chowdhury, Rasheduzzaman; McDonough, Michael A; Gentle, Dean; Kirby, Gail; Schlisio, Susanne; Kenchappa, Rajappa S; Carter, Bruce D; Kaelin, William G; Ratcliffe, Peter J; Schofield, Christopher J; Latif, Farida; Maher, Eamonn R

    2011-02-01

    Germline mutations in the von Hippel-Lindau disease (VHL) and succinate dehydrogenase subunit B (SDHB) genes can cause inherited phaeochromocytoma and/or renal cell carcinoma (RCC). Dysregulation of the hypoxia-inducible factor (HIF) transcription factors has been linked to VHL and SDHB-related RCC; both HIF dysregulation and disordered function of a prolyl hydroxylase domain isoform 3 (PHD3/EGLN3)-related pathway of neuronal apoptosis have been linked to the development of phaeochromocytoma. The 2-oxoglutarate-dependent prolyl hydroxylase enzymes PHD1 (EGLN2), PHD2 (EGLN1) and PHD3 (EGLN3) have a key role in regulating the stability of HIF-α subunits (and hence expression of the HIF-α transcription factors). A germline PHD2 mutation has been reported in association with congenital erythrocytosis and recurrent extra-adrenal phaeochromocytoma. We undertook mutation analysis of PHD1, PHD2 and PHD3 in two cohorts of patients with features of inherited phaeochromocytoma (n=82) and inherited RCC (n=64) and no evidence of germline mutations in known susceptibility genes. No confirmed pathogenic mutations were detected suggesting that mutations in these genes are not a frequent cause of inherited phaeochromocytoma or RCC.

  7. Identification of a Comprehensive Spectrum of Genetic Factors for Hereditary Breast Cancer in a Chinese Population by Next-Generation Sequencing

    PubMed Central

    Yang, Xiaochen; Wu, Jiong; Lu, Jingsong; Liu, Guangyu; Di, Genhong; Chen, Canming; Hou, Yifeng; Sun, Menghong; Yang, Wentao; Xu, Xiaojing; Zhao, Ying; Hu, Xin; Li, Daqiang; Cao, Zhigang; Zhou, Xiaoyan; Huang, Xiaoyan; Liu, Zhebin; Chen, Huan; Gu, Yanzi; Chi, Yayun; Yan, Xia; Han, Qixia; Shen, Zhenzhou; Shao, Zhimin; Hu, Zhen

    2015-01-01

    The genetic etiology of hereditary breast cancer has not been fully elucidated. Although germline mutations of high-penetrance genes such as BRCA1/2 are implicated in development of hereditary breast cancers, at least half of all breast cancer families are not linked to these genes. To identify a comprehensive spectrum of genetic factors for hereditary breast cancer in a Chinese population, we performed an analysis of germline mutations in 2,165 coding exons of 152 genes associated with hereditary cancer using next-generation sequencing (NGS) in 99 breast cancer patients from families of cancer patients regardless of cancer types. Forty-two deleterious germline mutations were identified in 21 genes of 34 patients, including 18 (18.2%) BRCA1 or BRCA2 mutations, 3 (3%) TP53 mutations, 5 (5.1%) DNA mismatch repair gene mutations, 1 (1%) CDH1 mutation, 6 (6.1%) Fanconi anemia pathway gene mutations, and 9 (9.1%) mutations in other genes. Of seven patients who carried mutations in more than one gene, 4 were BRCA1/2 mutation carriers, and their average onset age was much younger than patients with only BRCA1/2 mutations. Almost all identified high-penetrance gene mutations in those families fulfill the typical phenotypes of hereditary cancer syndromes listed in the National Comprehensive Cancer Network (NCCN) guidelines, except two TP53 and three mismatch repair gene mutations. Furthermore, functional studies of MSH3 germline mutations confirmed the association between MSH3 mutation and tumorigenesis, and segregation analysis suggested antagonism between BRCA1 and MSH3. We also identified a lot of low-penetrance gene mutations. Although the clinical significance of those newly identified low-penetrance gene mutations has not been fully appreciated yet, these new findings do provide valuable epidemiological information for the future studies. Together, these findings highlight the importance of genetic testing based on NCCN guidelines and a multi-gene analysis using NGS may be a supplement to traditional genetic counseling. PMID:25927356

  8. Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline

    PubMed Central

    Giannoulatou, Eleni; McVean, Gilean; Taylor, Indira B.; McGowan, Simon J.; Maher, Geoffrey J.; Iqbal, Zamin; Pfeifer, Susanne P.; Turner, Isaac; Burkitt Wright, Emma M. M.; Shorto, Jennifer; Itani, Aysha; Turner, Karen; Gregory, Lorna; Buck, David; Rajpert-De Meyts, Ewa; Looijenga, Leendert H. J.; Kerr, Bronwyn; Wilkie, Andrew O. M.; Goriely, Anne

    2013-01-01

    The RAS proto-oncogene Harvey rat sarcoma viral oncogene homolog (HRAS) encodes a small GTPase that transduces signals from cell surface receptors to intracellular effectors to control cellular behavior. Although somatic HRAS mutations have been described in many cancers, germline mutations cause Costello syndrome (CS), a congenital disorder associated with predisposition to malignancy. Based on the epidemiology of CS and the occurrence of HRAS mutations in spermatocytic seminoma, we proposed that activating HRAS mutations become enriched in sperm through a process akin to tumorigenesis, termed selfish spermatogonial selection. To test this hypothesis, we quantified the levels, in blood and sperm samples, of HRAS mutations at the p.G12 codon and compared the results to changes at the p.A11 codon, at which activating mutations do not occur. The data strongly support the role of selection in determining HRAS mutation levels in sperm, and hence the occurrence of CS, but we also found differences from the mutation pattern in tumorigenesis. First, the relative prevalence of mutations in sperm correlates weakly with their in vitro activating properties and occurrence in cancers. Second, specific tandem base substitutions (predominantly GC>TT/AA) occur in sperm but not in cancers; genomewide analysis showed that this same mutation is also overrepresented in constitutional pathogenic and polymorphic variants, suggesting a heightened vulnerability to these mutations in the germline. We developed a statistical model to show how both intrinsic mutation rate and selfish selection contribute to the mutational burden borne by the paternal germline. PMID:24259709

  9. Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline.

    PubMed

    Giannoulatou, Eleni; McVean, Gilean; Taylor, Indira B; McGowan, Simon J; Maher, Geoffrey J; Iqbal, Zamin; Pfeifer, Susanne P; Turner, Isaac; Burkitt Wright, Emma M M; Shorto, Jennifer; Itani, Aysha; Turner, Karen; Gregory, Lorna; Buck, David; Rajpert-De Meyts, Ewa; Looijenga, Leendert H J; Kerr, Bronwyn; Wilkie, Andrew O M; Goriely, Anne

    2013-12-10

    The RAS proto-oncogene Harvey rat sarcoma viral oncogene homolog (HRAS) encodes a small GTPase that transduces signals from cell surface receptors to intracellular effectors to control cellular behavior. Although somatic HRAS mutations have been described in many cancers, germline mutations cause Costello syndrome (CS), a congenital disorder associated with predisposition to malignancy. Based on the epidemiology of CS and the occurrence of HRAS mutations in spermatocytic seminoma, we proposed that activating HRAS mutations become enriched in sperm through a process akin to tumorigenesis, termed selfish spermatogonial selection. To test this hypothesis, we quantified the levels, in blood and sperm samples, of HRAS mutations at the p.G12 codon and compared the results to changes at the p.A11 codon, at which activating mutations do not occur. The data strongly support the role of selection in determining HRAS mutation levels in sperm, and hence the occurrence of CS, but we also found differences from the mutation pattern in tumorigenesis. First, the relative prevalence of mutations in sperm correlates weakly with their in vitro activating properties and occurrence in cancers. Second, specific tandem base substitutions (predominantly GC>TT/AA) occur in sperm but not in cancers; genomewide analysis showed that this same mutation is also overrepresented in constitutional pathogenic and polymorphic variants, suggesting a heightened vulnerability to these mutations in the germline. We developed a statistical model to show how both intrinsic mutation rate and selfish selection contribute to the mutational burden borne by the paternal germline.

  10. SDHAF2 mutations in familial and sporadic paraganglioma and phaeochromocytoma.

    PubMed

    Bayley, Jean-Pierre; Kunst, Henricus P M; Cascon, Alberto; Sampietro, Maria Lourdes; Gaal, José; Korpershoek, Esther; Hinojar-Gutierrez, Adolfo; Timmers, Henri J L M; Hoefsloot, Lies H; Hermsen, Mario A; Suárez, Carlos; Hussain, A Karim; Vriends, Annette H J T; Hes, Frederik J; Jansen, Jeroen C; Tops, Carli M; Corssmit, Eleonora P; de Knijff, Peter; Lenders, Jacques W M; Cremers, Cor W R J; Devilee, Peter; Dinjens, Winand N M; de Krijger, Ronald R; Robledo, Mercedes

    2010-04-01

    Paragangliomas and phaeochromocytomas are neuroendocrine tumours associated frequently with germline mutations of SDHD, SDHC, and SDHB. Previous studies have shown the imprinted SDHAF2 gene to be mutated in a large Dutch kindred with paragangliomas. We aimed to identify SDHAF2 mutation carriers, assess the clinical genetic significance of SDHAF2, and describe the associated clinical phenotype. We undertook a multicentre study in Spain and The Netherlands in 443 apparently sporadic patients with paragangliomas and phaeochromocytomas who did not have mutations in SDHD, SDHC, or SDHB. We analysed DNA of 315 patients for germline mutations of SDHAF2; a subset (n=200) was investigated for gross gene deletions. DNA from a group of 128 tumours was studied for somatic mutations. We also examined a Spanish family with head and neck paragangliomas with a young age of onset for the presence of SDHAF2 mutations, undertook haplotype analysis in this kindred, and assessed their clinical phenotype. We did not identify any germline or somatic mutations of SDHAF2, and no gross gene deletions were noted in the subset of apparently sporadic patients analysed. Investigation of the Spanish family identified a pathogenic germline DNA mutation of SDHAF2, 232G-->A (Gly78Arg), identical to the Dutch kindred. SDHAF2 mutations do not have an important role in phaeochromocytoma and are rare in head and neck paraganglioma. Identification of a second family with the Gly78Arg mutation suggests that this is a crucial residue for the function of SDHAF2. We conclude that SDHAF2 mutation analysis is justified in very young patients with isolated head and neck paraganglioma without mutations in SDHD, SDHC, or SDHB, and in individuals with familial antecedents who are negative for mutations in all other risk genes. Dutch Cancer Society, European Union 6th Framework Program, Fondo Investigaciones Sanitarias, Fundación Mutua Madrileña, and Red Temática de Investigación Cooperativa en Cáncer. 2010 Elsevier Ltd. All rights reserved.

  11. Prevalence of Lynch syndrome in unselected patients with endometrial or ovarian cancer.

    PubMed

    Kast, Karin; Dobberschütz, Catharina; Sadowski, Carolin Eva; Pistorius, Steffen; Wimberger, Pauline

    2016-11-01

    Lynch syndrome is known by healthcare providers mainly for patients with colorectal cancer. Awareness of other associated tumors, such as endometrial or ovarian cancer, is low. This study aimed to analyze the prevalence of Lynch syndrome in unselected patients with endometrial or ovarian cancer. In addition, the willingness of patients and family members to undergo germline mutation testing was investigated. The medical records of all patients diagnosed with endometrial or ovarian cancer at the Department of Gynecology and Obsterics, University Hospital Dresden, between 1998 and 2012, were screened for a family history of HNPCC-associated cancer. Telephone interviews were used to screen, inform, and enroll patients in this genetic analysis study. Molecular analysis was performed by prescreening of tumor tissue, followed by germline mutation analysis. Two hundred and eighty-three patients were diagnosed with endometrial cancer, 291 with ovarian cancer, and 14 with both. A positive family history for tumors associated with Lynch syndrome was documented for 61 patients. Two pathogenic mutations in the genes MLH1 and MSH2 in nine genetic analyses had already been detected before. After genetic counseling, only 10 of 31 index patients (32.3 %) consented for mutation analysis. However, no additional pathogenic heterozygous mutations were found. In this retrospective cohort study in unselected patients with endometrial or ovarian cancer, only a small number of patients with suspected Lynch syndrome could be identified. Of those, acceptance of germline analyses was moderate, only. As a result, the rate of identified pathogenic germline mutations was lower than expected. Therefore, we are convinced that more information on cancer risks, options for predictive molecular testing and preventive procedures, needs to be provided to patients and gynecologists.

  12. Germline mosaicism of PHOX2B mutation accounts for familial recurrence of congenital central hypoventilation syndrome (CCHS).

    PubMed

    Rand, Casey M; Yu, Min; Jennings, Lawrence J; Panesar, Kelvin; Berry-Kravis, Elizabeth M; Zhou, Lili; Weese-Mayer, Debra E

    2012-09-01

    Congenital central hypoventilation syndrome (CCHS), a rare disorder characterized by alveolar hypoventilation and autonomic dysregulation, is caused by mutations in the PHOX2B gene. Most mutations occur de novo, but recent evidence suggests that up to 25% are inherited from asymptomatic parents with somatic mosaicism for these mutations. However, to date, germline mosaicism has not been reported. This report describes a family with recurrence of PHOX2B mutation-confirmed CCHS due to germline mosaicism. The first occurrence was a baby girl, noted on day 2 of life to have multiple episodes of apnea, bradycardia, and cyanosis while breathing room air. PHOX2B gene testing confirmed the diagnosis of CCHS with a heterozygous polyalanine repeat expansion mutation (PARM); genotype 20/27 (normal 20/20). Both parents tested negative for this mutation using fragment analysis (limit of detection<1%). Upon subsequent pregnancy [paternity confirmed using short tandem repeat (STR) analysis], amniocentesis testing identified the PHOX2B 20/27 genotype, confirmed with repeat testing. Elective abortion was performed at 21.5 weeks gestation. Testing of abortus tissue confirmed amniocentesis testing. The PHOX2B 20/27 expansion was not observed in a paternal sperm sample. This case represents the first reported family with recurrence of PHOX2B mutation-confirmed CCHS without detection of a parental carrier state or mosaicism, confirming the previously hypothesized possibility of germline mosaicism for PHOX2B mutations. This is an important finding for genetic counseling of CCHS families, suggesting that even if somatic mosaicism is not detected in parental samples, there is still reason for careful genetic counseling and consideration of prenatal testing during subsequent pregnancies. Copyright © 2012 Wiley Periodicals, Inc.

  13. Revisiting neurofibromatosis type 2 diagnostic criteria to exclude LZTR1-related schwannomatosis.

    PubMed

    Smith, Miriam J; Bowers, Naomi L; Bulman, Michael; Gokhale, Carolyn; Wallace, Andrew J; King, Andrew T; Lloyd, Simon K L; Rutherford, Scott A; Hammerbeck-Ward, Charlotte L; Freeman, Simon R; Evans, D Gareth

    2017-01-03

    To determine the specificity of the current clinical diagnostic criteria for neurofibromatosis type 2 (NF2) relative to the requirement for unilateral vestibular schwannoma (VS) and at least 2 other NF2-related tumors. We interrogated our Manchester NF2 database, which contained 205 individuals meeting NF2 criteria who initially presented with a unilateral VS. Of these, 83 (40.7%) went on to develop a contralateral VS. We concentrated our genetic analysis on a group of 70 who initially fulfilled NF2 criteria with a unilateral vestibular schwannoma and at least 2 additional nonintradermal schwannomas. Overall, 5/70 (7%) individuals with unilateral VS and at least 2 other schwannomas had a pathogenic or likely pathogenic LZTR1 mutation. Twenty of the 70 subsequently developed bilateral disease. Of the remaining 50, 5 (10%) had a germline LZTR1 mutation, equivalent to the number (n = 5) with a germline NF2 mutation. The most common etiology for unilateral VS and 2 additional NF2-associated tumors in this cohort was mosaic NF2. Germline LZTR1 and germline NF2 mutations were equally common in our cohort. This indicates that LZTR1 must be considered when making a diagnosis of NF2 in the presence of unilateral VS in individuals without a germline NF2 mutation. © 2016 American Academy of Neurology.

  14. Revisiting neurofibromatosis type 2 diagnostic criteria to exclude LZTR1-related schwannomatosis

    PubMed Central

    Smith, Miriam J.; Bowers, Naomi L.; Bulman, Michael; Gokhale, Carolyn; Wallace, Andrew J.; King, Andrew T.; Lloyd, Simon K.L.; Rutherford, Scott A.; Hammerbeck-Ward, Charlotte L.; Freeman, Simon R.

    2017-01-01

    Objective: To determine the specificity of the current clinical diagnostic criteria for neurofibromatosis type 2 (NF2) relative to the requirement for unilateral vestibular schwannoma (VS) and at least 2 other NF2-related tumors. Methods: We interrogated our Manchester NF2 database, which contained 205 individuals meeting NF2 criteria who initially presented with a unilateral VS. Of these, 83 (40.7%) went on to develop a contralateral VS. We concentrated our genetic analysis on a group of 70 who initially fulfilled NF2 criteria with a unilateral vestibular schwannoma and at least 2 additional nonintradermal schwannomas. Results: Overall, 5/70 (7%) individuals with unilateral VS and at least 2 other schwannomas had a pathogenic or likely pathogenic LZTR1 mutation. Twenty of the 70 subsequently developed bilateral disease. Of the remaining 50, 5 (10%) had a germline LZTR1 mutation, equivalent to the number (n = 5) with a germline NF2 mutation. Conclusions: The most common etiology for unilateral VS and 2 additional NF2-associated tumors in this cohort was mosaic NF2. Germline LZTR1 and germline NF2 mutations were equally common in our cohort. This indicates that LZTR1 must be considered when making a diagnosis of NF2 in the presence of unilateral VS in individuals without a germline NF2 mutation. PMID:27856782

  15. Performance of Lynch syndrome predictive models in quantifying the likelihood of germline mutations in patients with abnormal MLH1 immunoexpression.

    PubMed

    Cabreira, Verónica; Pinto, Carla; Pinheiro, Manuela; Lopes, Paula; Peixoto, Ana; Santos, Catarina; Veiga, Isabel; Rocha, Patrícia; Pinto, Pedro; Henrique, Rui; Teixeira, Manuel R

    2017-01-01

    Lynch syndrome (LS) accounts for up to 4 % of all colorectal cancers (CRC). Detection of a pathogenic germline mutation in one of the mismatch repair genes is the definitive criterion for LS diagnosis, but it is time-consuming and expensive. Immunohistochemistry is the most sensitive prescreening test and its predictive value is very high for loss of expression of MSH2, MSH6, and (isolated) PMS2, but not for MLH1. We evaluated if LS predictive models have a role to improve the molecular testing algorithm in this specific setting by studying 38 individuals referred for molecular testing and who were subsequently shown to have loss of MLH1 immunoexpression in their tumors. For each proband we calculated a risk score, which represents the probability that the patient with CRC carries a pathogenic MLH1 germline mutation, using the PREMM 1,2,6 and MMRpro predictive models. Of the 38 individuals, 18.4 % had a pathogenic MLH1 germline mutation. MMRpro performed better for the purpose of this study, presenting a AUC of 0.83 (95 % CI 0.67-0.9; P < 0.001) compared with a AUC of 0.68 (95 % CI 0.51-0.82, P = 0.09) for PREMM 1,2,6 . Considering a threshold of 5 %, MMRpro would eliminate unnecessary germline mutation analysis in a significant proportion of cases while keeping very high sensitivity. We conclude that MMRpro is useful to correctly predict who should be screened for a germline MLH1 gene mutation and propose an algorithm to improve the cost-effectiveness of LS diagnosis.

  16. Lynch syndrome and Lynch syndrome mimics: The growing complex landscape of hereditary colon cancer

    PubMed Central

    Carethers, John M; Stoffel, Elena M

    2015-01-01

    Hereditary non-polyposis colorectal cancer (HNPCC) was previously synonymous with Lynch syndrome; however, identification of the role of germline mutations in the DNA mismatch repair (MMR) genes has made it possible to differentiate Lynch syndrome from other conditions associated with familial colorectal cancer (CRC). Broadly, HNPCC may be dichotomized into conditions that demonstrate defective DNA MMR and microsatellite instability (MSI) vs those conditions that demonstrate intact DNA MMR. Conditions characterized by MMR deficient CRCs include Lynch syndrome (germline MMR mutation), Lynch-like syndrome (biallelic somatic MMR mutations), constitutional MMR deficiency syndrome (biallelic germline MMR mutations), and sporadic MSI CRC (somatic biallelic methylation of MLH1). HNPCC conditions with intact DNA MMR associated with familial CRC include polymerase proofreading associated polyposis and familial colorectal cancer type X. Although next generation sequencing technologies have elucidated the genetic cause for some HNPCC conditions, others remain genetically undefined. Differentiating between Lynch syndrome and the other HNPCC disorders has profound implications for cancer risk assessment and surveillance of affected patients and their at-risk relatives. Clinical suspicion coupled with molecular tumor analysis and testing for germline mutations can help differentiate the clinical mimicry within HNPCC and facilitate diagnosis and management. PMID:26309352

  17. Lynch syndrome and Lynch syndrome mimics: The growing complex landscape of hereditary colon cancer.

    PubMed

    Carethers, John M; Stoffel, Elena M

    2015-08-21

    Hereditary non-polyposis colorectal cancer (HNPCC) was previously synonymous with Lynch syndrome; however, identification of the role of germline mutations in the DNA mismatch repair (MMR) genes has made it possible to differentiate Lynch syndrome from other conditions associated with familial colorectal cancer (CRC). Broadly, HNPCC may be dichotomized into conditions that demonstrate defective DNA MMR and microsatellite instability (MSI) vs those conditions that demonstrate intact DNA MMR. Conditions characterized by MMR deficient CRCs include Lynch syndrome (germline MMR mutation), Lynch-like syndrome (biallelic somatic MMR mutations), constitutional MMR deficiency syndrome (biallelic germline MMR mutations), and sporadic MSI CRC (somatic biallelic methylation of MLH1). HNPCC conditions with intact DNA MMR associated with familial CRC include polymerase proofreading associated polyposis and familial colorectal cancer type X. Although next generation sequencing technologies have elucidated the genetic cause for some HNPCC conditions, others remain genetically undefined. Differentiating between Lynch syndrome and the other HNPCC disorders has profound implications for cancer risk assessment and surveillance of affected patients and their at-risk relatives. Clinical suspicion coupled with molecular tumor analysis and testing for germline mutations can help differentiate the clinical mimicry within HNPCC and facilitate diagnosis and management.

  18. Familial solitary chondrosarcoma resulting from germline EXT2 mutation.

    PubMed

    Heddar, Abdelkader; Fermey, Pierre; Coutant, Sophie; Angot, Emilie; Sabourin, Jean-Christophe; Michelin, Paul; Parodi, Nathalie; Charbonnier, Françoise; Vezain, Myriam; Bougeard, Gaëlle; Baert-Desurmont, Stéphanie; Frébourg, Thierry; Tournier, Isabelle

    2017-02-01

    Germline mutations of EXT2, encoding Exostosin Glycosyltransferase 2, are associated with multiple osteochondromas (MO), an autosomal dominant disease characterized by the development of multiple peripheral cartilaginous benign tumors with a weak risk of malignant transformation. We report here a family with a remarkable clinical presentation characterized by the development of isolated chondrosarcomas, mostly located in ribs. Comparative analysis of exomes from two third-degree affected relatives led us to identify a single common disruptive variation, corresponding to a stop mutation (c.237G > A, p.Trp79*; (NM_000401.3); c.138G > A, p.Trp46*; (NM_207122.1)) within exon 2 of the EXT2 gene. Interestingly, no obvious sign of MO was detected in affected members by radiological examination. This report shows that germline mutations of EXT2 can result, not only in the development of multiple benign osteochondromas, but also in the development of isolated malignant cartilaginous tumors including central tumors, and that the presence of germline EXT2 mutation should be considered in patients suspected to have an inherited predisposition to chondrosarcoma, even in the absence of MO. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Germline truncating-mutations in BRCA1 and MSH6 in a patient with early onset endometrial cancer.

    PubMed

    Kast, Karin; Neuhann, Teresa M; Görgens, Heike; Becker, Kerstin; Keller, Katja; Klink, Barbara; Aust, Daniela; Distler, Wolfgang; Schröck, Evelin; Schackert, Hans K

    2012-11-20

    Hereditary Breast and Ovarian Cancer Syndrome (HBOCS) and Hereditary Non-Polyposis Colorectal Cancer Syndrome (HNPCC, Lynch Syndrome) are two tumor predisposition syndromes responsible for the majority of hereditary breast and colorectal cancers. Carriers of both germline mutations in breast cancer genes BRCA1 or BRCA2 and in mismatch repair (MMR) genes MLH1, MSH2, MSH6 or PMS2 are very rare. We identified germline mutations in BRCA1 and in MSH6 in a patient with increased risk for HBOC diagnosed with endometrial cancer at the age of 46 years. Although carriers of mutations in both MMR and BRCA genes are rare in Caucasian populations and anamnestical and histopathological findings may guide clinicians to identify these families, both syndromes can only be diagnosed through a complete gene analysis of the respective genes.

  20. Approaches to integrating germline and tumor genomic data in cancer research

    PubMed Central

    Feigelson, Heather Spencer; Goddard, Katrina A.B.; Hollombe, Celine; Tingle, Sharna R.; Gillanders, Elizabeth M.; Mechanic, Leah E.; Nelson, Stefanie A.

    2014-01-01

    Cancer is characterized by a diversity of genetic and epigenetic alterations occurring in both the germline and somatic (tumor) genomes. Hundreds of germline variants associated with cancer risk have been identified, and large amounts of data identifying mutations in the tumor genome that participate in tumorigenesis have been generated. Increasingly, these two genomes are being explored jointly to better understand how cancer risk alleles contribute to carcinogenesis and whether they influence development of specific tumor types or mutation profiles. To understand how data from germline risk studies and tumor genome profiling is being integrated, we reviewed 160 articles describing research that incorporated data from both genomes, published between January 2009 and December 2012, and summarized the current state of the field. We identified three principle types of research questions being addressed using these data: (i) use of tumor data to determine the putative function of germline risk variants; (ii) identification and analysis of relationships between host genetic background and particular tumor mutations or types; and (iii) use of tumor molecular profiling data to reduce genetic heterogeneity or refine phenotypes for germline association studies. We also found descriptive studies that compared germline and tumor genomic variation in a gene or gene family, and papers describing research methods, data sources, or analytical tools. We identified a large set of tools and data resources that can be used to analyze and integrate data from both genomes. Finally, we discuss opportunities and challenges for cancer research that integrates germline and tumor genomics data. PMID:25115441

  1. An immunohistochemical procedure to detect patients with paraganglioma and phaeochromocytoma with germline SDHB, SDHC, or SDHD gene mutations: a retrospective and prospective analysis.

    PubMed

    van Nederveen, Francien H; Gaal, José; Favier, Judith; Korpershoek, Esther; Oldenburg, Rogier A; de Bruyn, Elly M C A; Sleddens, Hein F B M; Derkx, Pieter; Rivière, Julie; Dannenberg, Hilde; Petri, Bart-Jeroen; Komminoth, Paul; Pacak, Karel; Hop, Wim C J; Pollard, Patrick J; Mannelli, Massimo; Bayley, Jean-Pierre; Perren, Aurel; Niemann, Stephan; Verhofstad, Albert A; de Bruïne, Adriaan P; Maher, Eamonn R; Tissier, Frédérique; Méatchi, Tchao; Badoual, Cécile; Bertherat, Jérôme; Amar, Laurence; Alataki, Despoina; Van Marck, Eric; Ferrau, Francesco; François, Jerney; de Herder, Wouter W; Peeters, Mark-Paul F M Vrancken; van Linge, Anne; Lenders, Jacques W M; Gimenez-Roqueplo, Anne-Paule; de Krijger, Ronald R; Dinjens, Winand N M

    2009-08-01

    Phaeochromocytomas and paragangliomas are neuro-endocrine tumours that occur sporadically and in several hereditary tumour syndromes, including the phaeochromocytoma-paraganglioma syndrome. This syndrome is caused by germline mutations in succinate dehydrogenase B (SDHB), C (SDHC), or D (SDHD) genes. Clinically, the phaeochromocytoma-paraganglioma syndrome is often unrecognised, although 10-30% of apparently sporadic phaeochromocytomas and paragangliomas harbour germline SDH-gene mutations. Despite these figures, the screening of phaeochromocytomas and paragangliomas for mutations in the SDH genes to detect phaeochromocytoma-paraganglioma syndrome is rarely done because of time and financial constraints. We investigated whether SDHB immunohistochemistry could effectively discriminate between SDH-related and non-SDH-related phaeochromocytomas and paragangliomas in large retrospective and prospective tumour series. Immunohistochemistry for SDHB was done on 220 tumours. Two retrospective series of 175 phaeochromocytomas and paragangliomas with known germline mutation status for phaeochromocytoma-susceptibility or paraganglioma-susceptibility genes were investigated. Additionally, a prospective series of 45 phaeochromocytomas and paragangliomas was investigated for SDHB immunostaining followed by SDHB, SDHC, and SDHD mutation testing. SDHB protein expression was absent in all 102 phaeochromocytomas and paragangliomas with an SDHB, SDHC, or SDHD mutation, but was present in all 65 paraganglionic tumours related to multiple endocrine neoplasia type 2, von Hippel-Lindau disease, and neurofibromatosis type 1. 47 (89%) of the 53 phaeochromocytomas and paragangliomas with no syndromic germline mutation showed SDHB expression. The sensitivity and specificity of the SDHB immunohistochemistry to detect the presence of an SDH mutation in the prospective series were 100% (95% CI 87-100) and 84% (60-97), respectively. Phaeochromocytoma-paraganglioma syndrome can be diagnosed reliably by an immunohistochemical procedure. SDHB, SDHC, and SDHD germline mutation testing is indicated only in patients with SDHB-negative tumours. SDHB immunohistochemistry on phaeochromocytomas and paragangliomas could improve the diagnosis of phaeochromocytoma-paraganglioma syndrome. The Netherlands Organisation for Scientific Research, Dutch Cancer Society, Vanderes Foundation, Association pour la Recherche contre le Cancer, Institut National de la Santé et de la Recherche Médicale, and a PHRC grant COMETE 3 for the COMETE network.

  2. Exome Sequencing Identifies Biallelic MSH3 Germline Mutations as a Recessive Subtype of Colorectal Adenomatous Polyposis.

    PubMed

    Adam, Ronja; Spier, Isabel; Zhao, Bixiao; Kloth, Michael; Marquez, Jonathan; Hinrichsen, Inga; Kirfel, Jutta; Tafazzoli, Aylar; Horpaopan, Sukanya; Uhlhaas, Siegfried; Stienen, Dietlinde; Friedrichs, Nicolaus; Altmüller, Janine; Laner, Andreas; Holzapfel, Stefanie; Peters, Sophia; Kayser, Katrin; Thiele, Holger; Holinski-Feder, Elke; Marra, Giancarlo; Kristiansen, Glen; Nöthen, Markus M; Büttner, Reinhard; Möslein, Gabriela; Betz, Regina C; Brieger, Angela; Lifton, Richard P; Aretz, Stefan

    2016-08-04

    In ∼30% of families affected by colorectal adenomatous polyposis, no germline mutations have been identified in the previously implicated genes APC, MUTYH, POLE, POLD1, and NTHL1, although a hereditary etiology is likely. To uncover further genes with high-penetrance causative mutations, we performed exome sequencing of leukocyte DNA from 102 unrelated individuals with unexplained adenomatous polyposis. We identified two unrelated individuals with differing compound-heterozygous loss-of-function (LoF) germline mutations in the mismatch-repair gene MSH3. The impact of the MSH3 mutations (c.1148delA, c.2319-1G>A, c.2760delC, and c.3001-2A>C) was indicated at the RNA and protein levels. Analysis of the diseased individuals' tumor tissue demonstrated high microsatellite instability of di- and tetranucleotides (EMAST), and immunohistochemical staining illustrated a complete loss of nuclear MSH3 in normal and tumor tissue, confirming the LoF effect and causal relevance of the mutations. The pedigrees, genotypes, and frequency of MSH3 mutations in the general population are consistent with an autosomal-recessive mode of inheritance. Both index persons have an affected sibling carrying the same mutations. The tumor spectrum in these four persons comprised colorectal and duodenal adenomas, colorectal cancer, gastric cancer, and an early-onset astrocytoma. Additionally, we detected one unrelated individual with biallelic PMS2 germline mutations, representing constitutional mismatch-repair deficiency. Potentially causative variants in 14 more candidate genes identified in 26 other individuals require further workup. In the present study, we identified biallelic germline MSH3 mutations in individuals with a suspected hereditary tumor syndrome. Our data suggest that MSH3 mutations represent an additional recessive subtype of colorectal adenomatous polyposis. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  3. Clinicopathological comparison of colorectal and endometrial carcinomas in patients with Lynch-like syndrome versus patients with Lynch syndrome.

    PubMed

    Mas-Moya, Jenny; Dudley, Beth; Brand, Randall E; Thull, Darcy; Bahary, Nathan; Nikiforova, Marina N; Pai, Reetesh K

    2015-11-01

    Screening for DNA mismatch repair (MMR) deficiency in colorectal and endometrial carcinomas identifies patients at risk for Lynch syndrome. Some patients with MMR-deficient tumors have no evidence of a germline mutation and have been described as having Lynch-like syndrome. We compared the clinicopathological features of colorectal and endometrial carcinomas in patients with Lynch-like syndrome and Lynch syndrome. Universal screening identified 356 (10.6%) of 3352 patients with colorectal carcinoma and 72 (33%) of 215 patients with endometrial carcinoma with deficient DNA MMR. Sixty-six patients underwent germline mutation analysis with 45 patients (68%) having evidence of a germline MMR gene mutation confirming Lynch syndrome and 21 patients (32%) having Lynch-like syndrome with no evidence of a germline mutation. Most patients with Lynch-like syndrome had carcinoma involving the right colon compared to patients with Lynch syndrome (93% versus 45%; P < .002). All patients with colorectal carcinomas demonstrating isolated loss of MSH6 expression had Lynch syndrome confirmed by germline mutation analysis. Synchronous or metachronous Lynch syndrome-associated carcinoma was more frequently identified in patients with Lynch syndrome compared to Lynch-like syndrome (38% versus 7%; P = .04). There were no significant differences in clinicopathological variables between patients with Lynch-like syndrome and Lynch syndrome with endometrial carcinoma. In summary, 32% of patients with MMR deficiency concerning Lynch syndrome will have Lynch-like syndrome. Our results demonstrate that patients with Lynch-like syndrome are more likely to have right-sided colorectal carcinoma, less likely to have synchronous or metachronous Lynch syndrome-associated carcinoma, and less likely to demonstrate isolated loss of MSH6 expression within their tumor. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Effect of BRCA germline mutations on breast cancer prognosis

    PubMed Central

    Baretta, Zora; Mocellin, Simone; Goldin, Elena; Olopade, Olufunmilayo I.; Huo, Dezheng

    2016-01-01

    Abstract Background: The contribution of BRCA germline mutational status to breast cancer patients’ prognosis is unclear. We aimed to systematically review and perform meta-analysis of the available evidence of effects of BRCA germline mutations on multiple survival outcomes of breast cancer patients as a whole and in specific subgroups of interest, including those with triple negative breast cancer, those with Ashkenazi Jewish ancestry, and patients with stage I–III disease. Methods: Sixty studies met all inclusion criteria and were considered for this meta-analysis. These studies involved 105,220 breast cancer patients, whose 3588 (3.4%) were BRCA mutations carriers. The associations between BRCA genes mutational status and overall survival (OS), breast cancer-specific survival (BCSS), recurrence-free survival (RFS), and distant metastasis-free survival (DMFS) were evaluated using random-effect models. Results: BRCA1 mutation carriers have worse OS than BRCA-negative/sporadic cases (hazard ratio, HR 1.30, 95% CI: 1.11–1.52) and worse BCSS than sporadic/BRCA-negative cases among patients with stage I–III breast cancer (HR 1.45, 95% CI: 1.01–2.07). BRCA2 mutation carriers have worse BCSS than sporadic/BRCA-negative cases (HR 1.29, 95% CI: 1.03–1.62), although they have similar OS. Among triple negative breast cancer, BRCA1/2 mutations carriers had better OS than BRCA-negative counterpart (HR 0.49, 95% CI: 0.26–0.92). Among Ashkenazi Jewish women, BRCA1/2 mutations carriers presented higher risk of death from breast cancer (HR 1.44, 95% CI: 1.05–1.97) and of distant metastases (HR 1.82, 95% CI: 1.05–3.16) than sporadic/BRCA-negative patients. Conclusion: Our results support the evaluation of BRCA mutational status in patients with high risk of harboring BRCA germline mutations to better define the prognosis of breast cancer in these patients. PMID:27749552

  5. Combining molecular and immunohistochemical analyses of key drivers in primary melanomas: interplay between germline and somatic variations.

    PubMed

    Bruno, William; Martinuzzi, Claudia; Dalmasso, Bruna; Andreotti, Virginia; Pastorino, Lorenza; Cabiddu, Francesco; Gualco, Marina; Spagnolo, Francesco; Ballestrero, Alberto; Queirolo, Paola; Grillo, Federica; Mastracci, Luca; Ghiorzo, Paola

    2018-01-19

    Due to the high mutational somatic burden of Cutaneous Malignant Melanoma (CMM) a thorough profiling of the driver mutations and their interplay is necessary to explain the timing of tumorigenesis or for the identification of actionable genetic events. The aim of this study was to establish the mutation rate of some of the key drivers in melanoma tumorigenesis combining molecular analyses and/or immunohistochemistry in 93 primary CMMs from an Italian cohort also characterized for germline status, and to investigate an interplay between germline and somatic variants. BRAF mutations were present in 68% of cases, while CDKN2A germline mutations were found in 16 % and p16 loss in tissue was found in 63%. TERT promoter somatic mutations were detected in 38% of cases while the TERT -245T>C polymorphism was found in 51% of cases. NRAS mutations were found in 39% of BRAF negative or undetermined cases. NF1 was expressed in all cases analysed. MC1R variations were both considered as a dichotomous variable or scored. While a positive, although not significant association between CDKN2A germline mutations, but not MC1R variants, and BRAF somatic mutation was found, we did not observe other associations between germline and somatic events. A yet undescribed inverse correlation between TERT -245T>C polymorphism and the presence of BRAF mutation was found. It is possible to hypothesize that -245T>C polymorphism could be included in those genotypes which may influence the occurrence of BRAF mutations. Further studies are needed to investigate the role of -245T>C polymorphism as a germline predictor of BRAF somatic mutation status.

  6. Evidence of a four-hit mechanism involving SMARCB1 and NF2 in schwannomatosis-associated schwannomas.

    PubMed

    Sestini, Roberta; Bacci, Costanza; Provenzano, Aldesia; Genuardi, Maurizio; Papi, Laura

    2008-02-01

    Schwannomatosis is characterized by the onset of multiple intracranial, spinal, or peripheral schwannomas, without involvement of the vestibular nerve, which is instead pathognomonic of neurofibromatosis type 2 (NF2). Recently, a schwannomatosis family with a germline mutation of the SMARCB1 gene on chromosome 22 has been described. We report on the molecular analysis of the SMARCB1 and NF2 genes in a series of 21 patients with schwannomatosis and in eight schwannomatosis-associated tumors from four different patients. A novel germline SMARCB1 mutation was found in one patient; inactivating somatic mutations of NF2, associated with loss of heterozygosity (LOH) of 22q, were found in two schwannomas of this patient. This is the second report of a germline SMARCB1 mutation in patients affected by schwannomatosis and the first report of SMARCB1 mutations associated with somatic NF2 mutations in schwannomatosis-associated tumors. The latter observation suggests that a four-hit mechanism involving the SMARCB1 and NF2 genes may be implicated in schwannomatosis-related tumorigenesis. (c) 2007 Wiley-Liss, Inc.

  7. TumorNext: A comprehensive tumor profiling assay that incorporates high resolution copy number analysis and germline status to improve testing accuracy

    PubMed Central

    Gray, Phillip N.; Vuong, Huy; Tsai, Pei; Lu, Hsaio-Mei; Mu, Wenbo; Hsuan, Vickie; Hoo, Jayne; Shah, Swati; Uyeda, Lisa; Fox, Susanne; Patel, Harshil; Janicek, Mike; Brown, Sandra; Dobrea, Lavinia; Wagman, Lawrence; Plimack, Elizabeth; Mehra, Ranee; Golemis, Erica A.; Bilusic, Marijo; Zibelman, Matthew; Elliott, Aaron

    2016-01-01

    The development of targeted therapies for both germline and somatic DNA mutations has increased the need for molecular profiling assays to determine the mutational status of specific genes. Moreover, the potential of off-label prescription of targeted therapies favors classifying tumors based on DNA alterations rather than traditional tissue pathology. Here we describe the analytical validation of a custom probe-based NGS tumor panel, TumorNext, which can detect single nucleotide variants, small insertions and deletions in 142 genes that are frequently mutated in somatic and/or germline cancers. TumorNext also detects gene fusions and structural variants, such as tandem duplications and inversions, in 15 frequently disrupted oncogenes and tumor suppressors. The assay uses a matched control and custom bioinformatics pipeline to differentiate between somatic and germline mutations, allowing precise variant classification. We tested 170 previously characterized samples, of which > 95% were formalin-fixed paraffin embedded tissue from 8 different cancer types, and highlight examples where lack of germline status may have led to the inappropriate prescription of therapy. We also describe the validation of the Affymetrix OncoScan platform, an array technology for high resolution copy number variant detection for use in parallel with the NGS panel that can detect single copy amplifications and hemizygous deletions. We analyzed 80 previously characterized formalin-fixed paraffin-embedded specimens and provide examples of hemizygous deletion detection in samples with known pathogenic germline mutations. Thus, the TumorNext combined approach of NGS and OncoScan potentially allows for the identification of the “second hit” in hereditary cancer patients. PMID:27626691

  8. Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

    PubMed

    Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

    1999-07-19

    Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

  9. Factors predicting the occurrence of germline mutations in candidate genes among patients with cutaneous malignant melanoma from South Italy.

    PubMed

    Casula, Milena; Colombino, Maria; Satta, Maria P; Cossu, Antonio; Lissia, Amelia; Budroni, Mario; Simeone, Ester; Calemma, Rosa; Loddo, Cinzia; Caracò, Corrado; Mozzillo, Nicola; Daponte, Antonio; Comella, Giuseppe; Canzanella, Sergio; Guida, Michele; Castello, Giuseppe; Ascierto, Paolo A; Palmieri, Giuseppe

    2007-01-01

    Clinical predictors for germline mutations of candidate genes in large clinic based population of patients with cutaneous malignant melanoma (CMM) are widely awaited. Using denaturing high-performance liquid chromatography (DHPLC) analysis and DNA sequencing, 557 consecutively-collected CMM patients originating from South Italy were screened for CDKN2A germline mutations; subsets of them were screened for mutations in the BRAF and BRCA2 genes. Seven CDKN2A mutations were detected in 14 (2.5%) CMM patients. Relative risk of carrying a CDKN2A mutation for CMM patients was demonstrated to significantly increase with the presence of familial recurrence of melanoma (risk ratio (RR)=6.31; p=0.0009), multiple primary melanomas (RR=3.43; p=0.0014), and early onset age (RR=4.56; p=0.0026). All CDKN2A mutations were observed in non-Sardinian patients (14/441; 3.2%), whereas BRAF and BRCA2 genes were found mutated in Sardinian patients (3/116; 2.6%). Such indicators of the presence of CDKN2A mutations will be useful in counselling patients about undergoing genetic testing. Our findings strongly suggest that mutation rates of candidate cancer genes may deeply vary among CMM patients from different geographical areas.

  10. Germline Mutations in BMPR1A/ALK3 Cause a Subset of Cases of Juvenile Polyposis Syndrome and of Cowden and Bannayan-Riley-Ruvalcaba Syndromes*

    PubMed Central

    Zhou, Xiao-Ping; Woodford-Richens, Kelly; Lehtonen, Rainer; Kurose, Keisuke; Aldred, Micheala; Hampel, Heather; Launonen, Virpi; Virta, Sanno; Pilarski, Robert; Salovaara, Reijo; Bodmer, Walter F.; Conrad, Beth A.; Dunlop, Malcolm; Hodgson, Shirley V.; Iwama, Takeo; Järvinen, Heikki; Kellokumpu, Ilmo; Kim, J. C.; Leggett, Barbara; Markie, David; Mecklin, Jukka-Pekka; Neale, Kay; Phillips, Robin; Piris, Juan; Rozen, Paul; Houlston, Richard S.; Aaltonen, Lauri A.; Tomlinson, Ian P. M.; Eng, Charis

    2001-01-01

    Juvenile polyposis syndrome (JPS) is an inherited hamartomatous-polyposis syndrome with a risk for colon cancer. JPS is a clinical diagnosis by exclusion, and, before susceptibility genes were identified, JPS could easily be confused with other inherited hamartoma syndromes, such as Bannayan-Riley-Ruvalcaba syndrome (BRRS) and Cowden syndrome (CS). Germline mutations of MADH4 (SMAD4) have been described in a variable number of probands with JPS. A series of familial and isolated European probands without MADH4 mutations were analyzed for germline mutations in BMPR1A, a member of the transforming growth-factor β–receptor superfamily, upstream from the SMAD pathway. Overall, 10 (38%) probands were found to have germline BMPR1A mutations, 8 of which resulted in truncated receptors and 2 of which resulted in missense alterations (C124R and C376Y). Almost all available component tumors from mutation-positive cases showed loss of heterozygosity (LOH) in the BMPR1A region, whereas those from mutation-negative cases did not. One proband with CS/CS-like phenotype was also found to have a germline BMPR1A missense mutation (A338D). Thus, germline BMPR1A mutations cause a significant proportion of cases of JPS and might define a small subset of cases of CS/BRRS with specific colonic phenotype. PMID:11536076

  11. Overlapping SETBP1 gain-of-function mutations in Schinzel-Giedion syndrome and hematologic malignancies

    PubMed Central

    Steehouwer, Marloes; Gilissen, Christian; Graham, Sarah A.; Hoover-Fong, Julie; Telegrafi, Aida B.; Destree, Anne; Smigiel, Robert; Lambie, Lindsday A.; Kayserili, Hülya; Altunoglu, Umut; Lapi, Elisabetta; Uzielli, Maria Luisa; Aracena, Mariana; Nur, Banu G.; Mihci, Ercan; Moreira, Lilia M. A.; Borges Ferreira, Viviane; Horovitz, Dafne D. G.; da Rocha, Katia M.; Jezela-Stanek, Aleksandra; Brooks, Alice S.; Reutter, Heiko; Cohen, Julie S.; Fatemi, Ali; Smitka, Martin; Grebe, Theresa A.; Di Donato, Nataliya; Deshpande, Charu; Vandersteen, Anthony; Marques Lourenço, Charles; Dufke, Andreas; Rossier, Eva; Andre, Gwenaelle; Baumer, Alessandra; Spencer, Careni; McGaughran, Julie; Franke, Lude; Veltman, Joris A.; De Vries, Bert B. A.; Schinzel, Albert; Fisher, Simon E.; Hoischen, Alexander

    2017-01-01

    Schinzel-Giedion syndrome (SGS) is a rare developmental disorder characterized by multiple malformations, severe neurological alterations and increased risk of malignancy. SGS is caused by de novo germline mutations clustering to a 12bp hotspot in exon 4 of SETBP1. Mutations in this hotspot disrupt a degron, a signal for the regulation of protein degradation, and lead to the accumulation of SETBP1 protein. Overlapping SETBP1 hotspot mutations have been observed recurrently as somatic events in leukemia. We collected clinical information of 47 SGS patients (including 26 novel cases) with germline SETBP1 mutations and of four individuals with a milder phenotype caused by de novo germline mutations adjacent to the SETBP1 hotspot. Different mutations within and around the SETBP1 hotspot have varying effects on SETBP1 stability and protein levels in vitro and in in silico modeling. Substitutions in SETBP1 residue I871 result in a weak increase in protein levels and mutations affecting this residue are significantly more frequent in SGS than in leukemia. On the other hand, substitutions in residue D868 lead to the largest increase in protein levels. Individuals with germline mutations affecting D868 have enhanced cell proliferation in vitro and higher incidence of cancer compared to patients with other germline SETBP1 mutations. Our findings substantiate that, despite their overlap, somatic SETBP1 mutations driving malignancy are more disruptive to the degron than germline SETBP1 mutations causing SGS. Additionally, this suggests that the functional threshold for the development of cancer driven by the disruption of the SETBP1 degron is higher than for the alteration in prenatal development in SGS. Drawing on previous studies of somatic SETBP1 mutations in leukemia, our results reveal a genotype-phenotype correlation in germline SETBP1 mutations spanning a molecular, cellular and clinical phenotype. PMID:28346496

  12. A Novel Germline Mutation in BRCA1 Causes Exon 20 Skipping in a Korean Family with a History of Breast Cancer.

    PubMed

    Yoon, Kyong-Ah; Kong, Sun-Young; Lee, Eun Ji; Cho, Jeong Nam; Chang, Suhwan; Lee, Eun Sook

    2017-09-01

    Germline mutations in the BRCA1 and BRCA2 genes are strong genetic factors for predispositions to breast, ovarian, and other related cancers. This report describes a family with a history of breast and ovarian cancers that harbored a novel BRCA1 germline mutation. A single nucleotide deletion in intron 20, namely c.5332+4delA, was detected in a 43-year-old patient with breast cancer. This mutation led to the skipping of exon 20, which in turn resulted in the production of a truncated BRCA1 protein that was 1773 amino acids in length. The mother of the proband had died due to ovarian cancer and had harbored the same germline mutation. Ectopically expressed mutant BRCA1 protein interacted with the BARD1 protein, but showed a reduced transcriptional function, as demonstrated by the expression of cyclin B1 . This novel germline mutation in the BRCA1 gene caused familial breast and ovarian cancers.

  13. Remarkable effects of imatinib in a family with young onset gastrointestinal stromal tumors and cutaneous hyperpigmentation associated with a germline KIT-Trp557Arg mutation: case report and literature overview.

    PubMed

    Farag, S; van der Kolk, L E; van Boven, H H; van Akkooi, A C J; Beets, G L; Wilmink, J W; Steeghs, N

    2018-04-01

    Gastrointestinal stromal tumors (GISTs) occur mostly sporadically. GISTs associated with a familial syndrome are very rare and are mostly wild type for KIT and platelet-derived growth factor alpha (PDGFRA). To date 35 kindreds and 8 individuals have been described with GISTs associated with germline KIT mutations. This is the third family described with a germline p.Trp557Arg mutation in exon 11 of the KIT gene. The effect of imatinib in patients harboring a germline KIT mutation has been rarely described. Moreover, in some studies imatinib treatment was withheld considering the lack of evidence for efficacy of this treatment in GIST patients harboring a germline KIT mutation. This paper describes a 52-year old patient with a de novo germline p.Trp557Arg mutation with multiple GISTs throughout the gastrointestinal tract and cutaneous hyperpigmentation. Imatinib treatment showed long-term regression of the GISTs and evident pathological response was seen after resection. Remarkably, the hyperpigmentation of the skin also diminished during imatinib treatment. Genetic screening of the family revealed the same mutation in two daughters, both with similar cutaneous hyperpigmentation. One daughter, aged 23, was diagnosed with multiple small intestine GISTs, which were resected. She was treated with adjuvant imatinib which prompted rapid regression of the cutaneous hyperpigmentation. Imatinib treatment in GIST patients harboring a germline KIT mutation shows favorable and long-term responses in both the tumor and the phenotypical hyperpigmentation.

  14. Biallelic germline and somatic mutations in malignant mesothelioma: multiple mutations in transcription regulators including mSWI/SNF genes.

    PubMed

    Yoshikawa, Yoshie; Sato, Ayuko; Tsujimura, Tohru; Otsuki, Taiichiro; Fukuoka, Kazuya; Hasegawa, Seiki; Nakano, Takashi; Hashimoto-Tamaoki, Tomoko

    2015-02-01

    We detected low levels of acetylation for histone H3 tail lysines in malignant mesothelioma (MM) cell lines resistant to histone deacetylase inhibitors. To identify the possible genetic causes related to the low histone acetylation levels, whole-exome sequencing was conducted with MM cell lines established from eight patients. A mono-allelic variant of BRD1 was common to two MM cell lines with very low acetylation levels. We identified 318 homozygous protein-damaging variants/mutations (18-78 variants/mutations per patient); annotation analysis showed enrichment of the molecules associated with mammalian SWI/SNF (mSWI/SNF) chromatin remodeling complexes and co-activators that facilitate initiation of transcription. In seven of the patients, we detected a combination of variants in histone modifiers or transcription factors/co-factors, in addition to variants in mSWI/SNF. Direct sequencing showed that homozygous mutations in SMARCA4, PBRM1 and ARID2 were somatic. In one patient, homozygous germline variants were observed for SMARCC1 and SETD2 in chr3p22.1-3p14.2. These exhibited extended germline homozygosity and were in regions containing somatic mutations, leading to a loss of BAP1 and PBRM1 expression in MM cell line. Most protein-damaging variants were heterozygous in normal tissues. Heterozygous germline variants were often converted into hemizygous variants by mono-allelic deletion, and were rarely homozygous because of acquired uniparental disomy. Our findings imply that MM might develop through the somatic inactivation of mSWI/SNF complex subunits and/or histone modifiers, including BAP1, in subjects that have rare germline variants of these transcription regulators and/or transcription factors/co-factors, and in regions prone to mono-allelic deletion during oncogenesis. © 2014 UICC.

  15. Tumor mismatch repair immunohistochemistry and DNA MLH1 methylation testing of patients with endometrial cancer diagnosed at age younger than 60 years optimizes triage for population-level germline mismatch repair gene mutation testing.

    PubMed

    Buchanan, Daniel D; Tan, Yen Y; Walsh, Michael D; Clendenning, Mark; Metcalf, Alexander M; Ferguson, Kaltin; Arnold, Sven T; Thompson, Bryony A; Lose, Felicity A; Parsons, Michael T; Walters, Rhiannon J; Pearson, Sally-Ann; Cummings, Margaret; Oehler, Martin K; Blomfield, Penelope B; Quinn, Michael A; Kirk, Judy A; Stewart, Colin J; Obermair, Andreas; Young, Joanne P; Webb, Penelope M; Spurdle, Amanda B

    2014-01-10

    Clinicopathologic data from a population-based endometrial cancer cohort, unselected for age or family history, were analyzed to determine the optimal scheme for identification of patients with germline mismatch repair (MMR) gene mutations. Endometrial cancers from 702 patients recruited into the Australian National Endometrial Cancer Study (ANECS) were tested for MMR protein expression using immunohistochemistry (IHC) and for MLH1 gene promoter methylation in MLH1-deficient cases. MMR mutation testing was performed on germline DNA of patients with MMR-protein deficient tumors. Prediction of germline mutation status was compared for combinations of tumor characteristics, age at diagnosis, and various clinical criteria (Amsterdam, Bethesda, Society of Gynecologic Oncology, ANECS). Tumor MMR-protein deficiency was detected in 170 (24%) of 702 cases. Germline testing of 158 MMR-deficient cases identified 22 truncating mutations (3% of all cases) and four unclassified variants. Tumor MLH1 methylation was detected in 99 (89%) of 111 cases demonstrating MLH1/PMS2 IHC loss; all were germline MLH1 mutation negative. A combination of MMR IHC plus MLH1 methylation testing in women younger than 60 years of age at diagnosis provided the highest positive predictive value for the identification of mutation carriers at 46% versus ≤ 41% for any other criteria considered. Population-level identification of patients with MMR mutation-positive endometrial cancer is optimized by stepwise testing for tumor MMR IHC loss in patients younger than 60 years, tumor MLH1 methylation in individuals with MLH1 IHC loss, and germline mutations in patients exhibiting loss of MSH6, MSH2, or PMS2 or loss of MLH1/PMS2 with absence of MLH1 methylation.

  16. An evaluation of germline mutations and reproductive impacts in fathead minnow (Pimephales promelas) exposed to contaminated sediment.

    PubMed

    Miller, Jason L; Sherry, Jim; Parrott, Joanne; Quinn, James S

    2018-06-18

    Polycyclic aromatic hydrocarbons (PAHs) have become ubiquitous in the aquatic environment. Some PAHs are mutagenic, potentially causing germline mutations in fish that inhabit PAH contaminated waters. We evaluated the effect of exposure to sediment-borne PAHs on reproduction and germline mutation rates in fathead minnows (Pimephales promelas). Exposure to the contaminated sediment had no significant impact on the reproductive endpoints measured in this study. Germline mutations rates at three microsatellite DNA loci were 1.69 × 10 -3 in fish exposed to PAH-contaminated sediment and 0.55 × 10 -3 in control fish, with zero mutations being observed in fish exposed to sediment from a reference site. While the difference in mutation rates between treatments was not statistically significant for the sample size used (15-19 families per treatment), the observed mutations rates enabled us to estimate the sample size required to detect a significant effect. To our knowledge, this is the first report of germline mutation rates in fathead minnow exposed to an environmental contaminant, providing baseline data for use in the design of future experiments. Crown Copyright © 2018. Published by Elsevier Inc. All rights reserved.

  17. Ovarian Tumors related to Intronic Mutations in DICER1: A Report from the International Ovarian and Testicular Stromal Tumor Registry

    PubMed Central

    Schultz, Kris Ann; Harris, Anne; Messinger, Yoav; Sencer, Susan; Baldinger, Shari; Dehner, Louis P.; Hill, D. Ashley

    2015-01-01

    Germline DICER1 mutations have been described in individuals with pleuropulmonary blastoma (PPB), ovarian Sertoli-Leydig cell tumor (SLCT), sarcomas, multinodular goiter, thyroid carcinoma, cystic nephroma and other neoplastic conditions. Early results from the International Ovarian and Testicular Stromal Tumor Registry show germline DICER1 mutations in 48% of girls and women with SLCT. In this report, a young woman presented with ovarian undifferentiated sarcoma. Four years later, she presented with SLCT. She was successfully treated for both malignancies. Sequence results showed a germline intronic mutation in DICER1. This mutation results in an exact duplication of the six bases at the splice site at the intron 23 and exon 24 junction. Predicted improper splicing leads to inclusion of 10 bases of intronic sequence, frameshift and premature truncation of the protein disrupting the RNase IIIb domain. A second individual with SLCT was found to have an identical germline mutation. In each of the ovarian tumors, an additional somatic mutation in the RNase IIIb domain of DICER1 was found. In rare patients, germline intronic mutations in DICER1 that are predicted to cause incorrect splicing can also contribute to the pathogenesis of SLCT. PMID:26289771

  18. High-resolution melting (HRM) assay for the detection of recurrent BRCA1/BRCA2 germline mutations in Tunisian breast/ovarian cancer families.

    PubMed

    Riahi, Aouatef; Kharrat, Maher; Lariani, Imen; Chaabouni-Bouhamed, Habiba

    2014-12-01

    Germline deleterious mutations in the BRCA1/BRCA2 genes are associated with an increased risk for the development of breast and ovarian cancer. Given the large size of these genes the detection of such mutations represents a considerable technical challenge. Therefore, the development of cost-effective and rapid methods to identify these mutations became a necessity. High resolution melting analysis (HRM) is a rapid and efficient technique extensively employed as high-throughput mutation scanning method. The purpose of our study was to assess the specificity and sensitivity of HRM for BRCA1 and BRCA2 genes scanning. As a first step we estimate the ability of HRM for detection mutations in a set of 21 heterozygous samples harboring 8 different known BRCA1/BRCA2 variations, all samples had been preliminarily investigated by direct sequencing, and then we performed a blinded analysis by HRM in a set of 68 further sporadic samples of unknown genotype. All tested heterozygous BRCA1/BRCA2 variants were easily identified. However the HRM assay revealed further alteration that we initially had not searched (one unclassified variant). Furthermore, sequencing confirmed all the HRM detected mutations in the set of unknown samples, including homozygous changes, indicating that in this cohort, with the optimized assays, the mutations detections sensitivity and specificity were 100 %. HRM is a simple, rapid and efficient scanning method for known and unknown BRCA1/BRCA2 germline mutations. Consequently the method will allow for the economical screening of recurrent mutations in Tunisian population.

  19. Whole exome sequencing reveals recurrent mutations in BRCA2 and FAT genes in acinar cell carcinomas of the pancreas.

    PubMed

    Furukawa, Toru; Sakamoto, Hitomi; Takeuchi, Shoko; Ameri, Mitra; Kuboki, Yuko; Yamamoto, Toshiyuki; Hatori, Takashi; Yamamoto, Masakazu; Sugiyama, Masanori; Ohike, Nobuyuki; Yamaguchi, Hiroshi; Shimizu, Michio; Shibata, Noriyuki; Shimizu, Kyoko; Shiratori, Keiko

    2015-03-06

    Acinar cell carcinoma of the pancreas is a rare tumor with a poor prognosis. Compared to pancreatic ductal adenocarcinoma, its molecular features are poorly known. We studied a total of 11 acinar cell carcinomas, including 3 by exome and 4 by target sequencing. Exome sequencing revealed 65 nonsynonymous mutations and 22 indels with a mutation rate of 3.4 mutations/Mb per tumor, on average. By accounting for not only somatic but also germline mutations with loss of the wild-type allele, we identified recurrent mutations of BRCA2 and FAT genes. BRCA2 showed somatic or germline premature termination mutations, with loss of the wild-type allele in 3 of 7 tumors. FAT1, FAT3, and FAT4 showed somatic or germline missense mutations in 4 of 7 tumors. The germline FAT mutations were with loss of the wild-type allele. Loss of BRCA2 expression was observed in 5 of 11 tumors. One patient with a BRCA2-mutated tumor experienced complete remission of liver metastasis following cisplatinum chemotherapy. In conclusion, acinar cell carcinomas show a distinct mutation pattern and often harbor somatic or germline mutations of BRCA2 and FAT genes. This result may warrant assessment of BRCA2 abrogation in patients with the carcinoma to determine their sensitivity to chemotherapy.

  20. Ovarian cancer patients at high risk of BRCA mutation: the constitutional genetic characterization does not change prognosis.

    PubMed

    Sabatier, Renaud; Lavit, Elise; Moretta, Jessica; Lambaudie, Eric; Noguchi, Tetsuro; Eisinger, François; Cherau, Elisabeth; Provansal, Magali; Livon, Doriane; Rabayrol, Laetitia; Popovici, Cornel; Charaffe-Jauffret, Emmanuelle; Sobol, Hagay; Viens, Patrice

    2016-10-01

    Ovarian neoplasms secondary to germline BRCA mutations had been described to have a more favourable survival. There is only few data concerning the prognosis of non mutated patients presenting clinical features evocative of BRCA alterations. We retrospectively collected data from patients treated in our institution for an invasive ovarian carcinoma between 1995 and 2011. Patients considered at high risk of BRCA mutation were tested for BRCA1/2 germline mutations. We described clinical, pathological and therapeutic features and compared prognosis of BRCA mutation carriers and non-mutated patients. Out of 617 ovarian cancer patients, we identified 104 patients who were considered at high risk of mutation. The 33 mutated patients were more likely to present a personal (33 vs. 10 %, p = 0.003) or a family (42 vs. 24 %, p = 0.06) history of breast/ovarian cancers. BRCA1/2 mutation carriers and wild type patients displayed similar prognosis: median progression-free survival (PFS) of 20.9 versus 37.7 months (p = 0.21); median overall survival (OS) of 151.2 versus 122.5 months (p = 0.52). Personal history of breast cancer increased both PFS [HR = 0.45 (95CI 0.25-0.81)] and OS [HR = 0.35 (95CI 0.16-0.75)]. In multivariate analysis, this parameter was an independent prognostic feature, whereas the identification of a BRCA1/2 mutation was not. In our cohort, all patients at high risk of BRCA mutation share a similar prognosis, whatever is their germline mutation status. Prognosis seems to be more influenced by clinical history than by germline mutations identification. If it is confirmed in larger and independent series, this result suggests that the hypothesis of other BRCA pathway alterations (BRCAness phenotype) deserves to be deeply explored.

  1. Identification and analysis of CHEK2 germline mutations in Chinese BRCA1/2-negative breast cancer patients.

    PubMed

    Fan, Zhenhua; Ouyang, Tao; Li, Jinfeng; Wang, Tianfeng; Fan, Zhaoqing; Fan, Tie; Lin, Benyao; Xu, Ye; Xie, Yuntao

    2018-05-01

    Cell-cycle-checkpoint kinase 2 (CHEK2) is an important moderate-penetrance breast cancer predisposition gene; however, recurrent CHEK2 mutations found in Caucasian women are very rare in Chinese population. We investigated the mutation spectrum and clinical relevance of CHEK2 germline mutations in Chinese breast cancer patients. The entire coding regions and splicing sites of CHEK2 were screened in 7657 Chinese BRCA1/2-negative breast cancer patients, using 62-gene panel-based sequencing. Out of 7657 BRCA1/2-negative breast cancer patients, 26 (0.34%) carried CHEK2 pathogenic germline mutations. Most of these mutations (92.3%, 24/26) were nonsense or frameshift mutations; 84.6% (22/26) of them were in forkhead-associated (FHA) or kinase domains. Of the 18 types of CHEK2 mutations we found, 61.1% (11/18) of were novel mutations and two recurrent mutations (Y139X and R137X) were found in this cohort. Patients with CHEK2 mutations were significantly more likely to have family histories of breast and/or ovarian cancer (23.1% vs. 8.6%, p = 0.022) and family histories of any cancer (50.0% vs. 31.6%, p = 0.044); and were significantly more likely to have lymph node-positive (53.8% vs. 27.3%, p = 0.002) and progesterone receptor (PR)-positive (88.5% vs. 64.5%, p = 0.011) breast cancers. Among Chinese breast cancer patients, the CHEK2 germline mutation rate is approximately 0.34% and two specific mutations (Y139X and R137X) are recurrent. Patients with CHEK2 mutations are significantly more likely to have family histories of cancer, and to develop lymph node-positive and/or PR-positive breast cancers.

  2. Germline mutations in SUFU cause Gorlin syndrome-associated childhood medulloblastoma and redefine the risk associated with PTCH1 mutations.

    PubMed

    Smith, Miriam J; Beetz, Christian; Williams, Simon G; Bhaskar, Sanjeev S; O'Sullivan, James; Anderson, Beverley; Daly, Sarah B; Urquhart, Jill E; Bholah, Zaynab; Oudit, Deemesh; Cheesman, Edmund; Kelsey, Anna; McCabe, Martin G; Newman, William G; Evans, D Gareth R

    2014-12-20

    Heterozygous germline PTCH1 mutations are causative of Gorlin syndrome (naevoid basal cell carcinoma), but detection rates > 70% have rarely been reported. We aimed to define the causative mutations in individuals with Gorlin syndrome without PTCH1 mutations. We undertook exome sequencing on lymphocyte DNA from four unrelated individuals from families with Gorlin syndrome with no PTCH1 mutations found by Sanger sequencing, multiplex ligation-dependent probe amplification (MLPA), or RNA analysis. A germline heterozygous nonsense mutation in SUFU was identified in one of four exomes. Sanger sequencing of SUFU in 23 additional PTCH1-negative Gorlin syndrome families identified a SUFU mutation in a second family. Copy-number analysis of SUFU by MLPA revealed a large heterozygous deletion in a third family. All three SUFU-positive families fulfilled diagnostic criteria for Gorlin syndrome, although none had odontogenic jaw keratocysts. Each SUFU-positive family included a single case of medulloblastoma, whereas only two (1.7%) of 115 individuals with Gorlin syndrome and a PTCH1 mutation developed medulloblastoma. We demonstrate convincing evidence that SUFU mutations can cause classical Gorlin syndrome. Our study redefines the risk of medulloblastoma in Gorlin syndrome, dependent on the underlying causative gene. Previous reports have found a 5% risk of medulloblastoma in Gorlin syndrome. We found a < 2% risk in PTCH1 mutation-positive individuals, with a risk up to 20× higher in SUFU mutation-positive individuals. Our data suggest childhood brain magnetic resonance imaging surveillance is justified in SUFU-related, but not PTCH1-related, Gorlin syndrome. © 2014 by American Society of Clinical Oncology.

  3. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.

    PubMed

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

    2014-01-01

    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  4. Mutation Analysis of Inhibitory Guanine Nucleotide Binding Protein Alpha (GNAI) Loci in Young and Familial Pituitary Adenomas

    PubMed Central

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

    2014-01-01

    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15–20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1 , GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas. PMID:25291362

  5. Cell surface fucosylation does not affect development of colon tumors in mice with germline Smad3 mutation

    PubMed Central

    Domino, Steven E.; Karnak, David M.; Hurd, Elizabeth A.

    2006-01-01

    Background/Aims: Neoplasia-related alterations in cell surface α(1,2)fucosylated glycans have been reported in multiple tumors including colon, pancreas, endometrium, cervix, bladder, lung, and choriocarcinoma. Spontaneous colorectal tumors from mice with a germline null mutation of transforming growth factor-β signaling gene Smad3 (Madh3) were tested for α(1,2)fucosylated glycan expression. Methods: Ulex Europaeus Agglutinin-I lectin staining, fucosyltransferase gene northern blot analysis, and a cross of mutant mice with Fut2 and Smad3 germline mutations were performed. Results: Spontaneous colorectal tumors from Smad3 (-/-) homozygous null mice were found to express α(1,2)fucosylated glycans in an abnormal pattern compared to adjacent nonneoplastic colon. Northern blot analysis of α(1,2)fucosyltransferase genes Fut1 and Fut2 revealed that Fut2, but not Fut1, steady-state mRNA levels were significantly increased in tumors relative to adjacent normal colonic mucosa. Mutant mice with a Fut2-inactivating germline mutation were crossed with Smad3 targeted mice. In Smad3 (-/-)/Fut2 (-/-) double knock-out mice, UEA-I lectin staining was eliminated from colon and colon tumors, however, the number and size of tumors present by 24 weeks of age did not vary regardless of the Fut2 genotype. Conclusions: In this model of colorectal cancer, cell surface α(1,2)fucosylation does not affect development of colon tumors. PMID:17264540

  6. Myeloid neoplasms with germline DDX41 mutation.

    PubMed

    Cheah, Jesse J C; Hahn, Christopher N; Hiwase, Devendra K; Scott, Hamish S; Brown, Anna L

    2017-08-01

    Recently, DDX41 mutations have been identified both as germline and acquired somatic mutations in families with multiple cases of late-onset myelodysplastic syndrome (MDS) and/or acute myeloid leukemia. The majority of germline mutations are frameshift mutations suggesting loss of function with DDX41 acting as a tumor suppressor, and there is a common somatic missense mutation found in a majority of germline mutated tumors. Clinically, DDX41 mutations lead to development of high-risk MDS at an age similar to that observed in sporadic cohorts, presenting a unique challenge to hematologists in recognizing the familial context. Functionally, DDX41 has been shown to contribute to multiple pathways and processes including mRNA splicing, innate immunity and rRNA processing. Mutations in DDX41 result in aberrations to each of these in ways that could potentially impact on tumorigenesis-initiation, maintenance or progression. This review discusses the various molecular, clinical and biological aspects of myeloid malignancy predisposition due to DDX41 mutation and highlights how each of these suggest potential therapeutic opportunities through the use of pathway-specific inhibitors.

  7. The developmental basis for germline mosaicism in mouse and Drosophila melanogaster.

    PubMed

    Drost, J B; Lee, W R

    1998-01-01

    Data involving germline mosaics in Drosophila melanogaster and mouse are reconciled with developmental observations. Mutations that become fixed in the early embryo before separation of soma from the germline may, by the sampling process of development, continue as part of germline and/or differentiate into any somatic tissue. The cuticle of adult D. melanogaster, because of segmental development, can be used to estimate the proportion of mutant nuclei in the early embryo, but most somatic tissues and the germlines of both species continue from samples too small to be representative of the early embryo. Because of the small sample of cells/nuclei that remain in the germline after separation of soma in both species, mosaic germlines have percentages of mutant cells that vary widely, with a mean of 50% and an unusual platykurtic, flat-topped distribution. While the sampling process leads to similar statistical results for both species, their patterns of development are very different. In D. melanogaster the first differentiation is the separation of soma from germline with the germline continuing from a sample of only two to four nuclei, whereas the adult cuticle is a representative sample of cleavage nuclei. The presence of mosaicism in D. melanogaster germline is independent of mosaicism in the eye, head, and thorax. This independence was used to determine that mutations can occur at any of the early embryonic cell divisions and still average 50% mutant germ cells when the germline is mosaic; however, the later the mutation occurs, the higher the proportion of completely nonmutant germlines. In contrast to D. melanogaster, the first differentiation in the mouse does not separate soma from germline but produces the inner cell mass that is representative of the cleavage nuclei. Following formation of the primitive streak, the primordial germ cells develop at the base of the allantois and among a clonally related sample of cells, providing the same statistical distribution in the mouse germlines as in D. melanogaster. The proportion of mutations that are fixed during early embryonic development is greatly underestimated. For example, a DNA lesion in a postmeiotic gamete that becomes fixed as a dominant mutation during early embryonic development of the F1 may produce an individual completely mutant in the germ line and relevant somatic tissue or, alternatively, the F1 germline may be completely mutant but with no relevant somatic tissues for detecting the mutation until the F2. In both cases the mutation would be classified as complete in the F1 and F2, respectively, and not recognized as embryonic in origin. Because germ cells differentiate later in mammalian development, there are more opportunities for correlation between germline and soma in the mammal than Drosophila. However, because the germ cells and any somatic tissue, like blood, are derived from small samples, there may be many individuals that test negative in blood but have germlines that are either mosaic or entirely mutant.

  8. Xeroderma Pigmentosum: Low Prevalence of Germline XPA Mutations in a Brazilian XP Population

    PubMed Central

    Santiago, Karina Miranda; França de Nóbrega, Amanda; Rocha, Rafael Malagoli; Rogatto, Silvia Regina; Achatz, Maria Isabel

    2015-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder characterized by DNA repair defects that cause photophobia, sunlight-induced cancers, and neurodegeneration. Prevalence of germline mutations in the nucleotide excision repair gene XPA vary significantly in different populations. No Brazilian patients have been reported to carry a germline mutation in this gene. In this study, the germline mutational status of XPA was determined in Brazilian patients exhibiting major clinical features of XP syndrome. The study was conducted on 27 unrelated patients from select Brazilian families. A biallelic inactivating transition mutation c.619C>T (p.Arg207Ter) was identified in only one patient with a history of neurological impairment and mild skin abnormalities. These findings suggest that XP syndrome is rarely associated with inherited disease-causing XPA mutations in the Brazilian population. Additionally, this report demonstrates the effectiveness of genotype-phenotype correlation as a valuable tool to guide direct genetic screening. PMID:25913378

  9. Xeroderma pigmentosum: low prevalence of germline XPA mutations in a Brazilian XP population.

    PubMed

    Santiago, Karina Miranda; França de Nóbrega, Amanda; Rocha, Rafael Malagoli; Rogatto, Silvia Regina; Achatz, Maria Isabel

    2015-04-22

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder characterized by DNA repair defects that cause photophobia, sunlight-induced cancers, and neurodegeneration. Prevalence of germline mutations in the nucleotide excision repair gene XPA vary significantly in different populations. No Brazilian patients have been reported to carry a germline mutation in this gene. In this study, the germline mutational status of XPA was determined in Brazilian patients exhibiting major clinical features of XP syndrome. The study was conducted on 27 unrelated patients from select Brazilian families. A biallelic inactivating transition mutation c.619C>T (p.Arg207Ter) was identified in only one patient with a history of neurological impairment and mild skin abnormalities. These findings suggest that XP syndrome is rarely associated with inherited disease-causing XPA mutations in the Brazilian population. Additionally, this report demonstrates the effectiveness of genotype-phenotype correlation as a valuable tool to guide direct genetic screening.

  10. Molecular and clinical evidence for an ARMC5 tumor syndrome: concurrent inactivating germline and somatic mutations are associated with both primary macronodular adrenal hyperplasia and meningioma.

    PubMed

    Elbelt, Ulf; Trovato, Alessia; Kloth, Michael; Gentz, Enno; Finke, Reinhard; Spranger, Joachim; Galas, David; Weber, Susanne; Wolf, Cristina; König, Katharina; Arlt, Wiebke; Büttner, Reinhard; May, Patrick; Allolio, Bruno; Schneider, Jochen G

    2015-01-01

    Primary macronodular adrenal hyperplasia (PMAH) is a rare cause of Cushing's syndrome, which may present in the context of different familial multitumor syndromes. Heterozygous inactivating germline mutations of armadillo repeat containing 5 (ARMC5) have very recently been described as cause for sporadic PMAH. Whether this genetic condition also causes familial PMAH in association with other neoplasias is unclear. The aim of the present study was to delineate the molecular cause in a large family with PMAH and other neoplasias. Whole-genome sequencing and comprehensive clinical and biochemical phenotyping was performed in members of a PMAH affected family. Nodules derived from adrenal surgery and pancreatic and meningeal tumor tissue were analyzed for accompanying somatic mutations in the identified target genes. PMAH presenting either as overt or subclinical Cushing's syndrome was accompanied by a heterozygous germline mutation in ARMC5 (p.A110fs*9) located on chromosome 16. Analysis of tumor tissue showed different somatic ARMC5 mutations in adrenal nodules supporting a second hit hypothesis with inactivation of a tumor suppressor gene. A damaging somatic ARMC5 mutation was also found in a concomitant meningioma (p.R502fs) but not in a pancreatic tumor, suggesting biallelic inactivation of ARMC5 as causal also for the intracranial meningioma. Our analysis further confirms inherited inactivating ARMC5 mutations as a cause of familial PMAH and suggests an additional role for the development of concomitant intracranial meningiomas.

  11. No correlation between germline mutation at repeat DNA and meiotic crossover in male mice exposed to X-rays or cisplatin.

    PubMed

    Barber, R; Plumb, M; Smith, A G; Cesar, C E; Boulton, E; Jeffreys, A J; Dubrova, Y E

    2000-12-20

    To test the hypothesis that mouse germline expanded simple tandem repeat (ESTR) mutations are associated with recombination events during spermatogenesis, crossover frequencies were compared with germline mutation rates at ESTR loci in male mice acutely exposed to 1Gy of X-rays or to 10mg/kg of the anticancer drug cisplatin. Ionising radiation resulted in a highly significant 2.7-3.6-fold increase in ESTR mutation rate in males mated 4, 5 and 6 weeks after exposure, but not 3 weeks after exposure. In contrast, irradiation had no effect on meiotic crossover frequencies assayed on six chromosomes using 25 polymorphic microsatellite loci spaced at approximately 20cM intervals and covering 421cM of the mouse genome. Paternal exposure to cisplatin did not affect either ESTR mutation rates or crossover frequencies, despite a report that cisplatin can increase crossover frequency in mice. Correlation analysis did not reveal any associations between the paternal ESTR mutation rate and crossover frequency in unexposed males and in those exposed to X-rays or cisplatin. This study does not, therefore, support the hypothesis that mutation induction at mouse ESTR loci results from a general genome-wide increase in meiotic recombination rate.

  12. Deep Sequencing Reveals Spatially Distributed Distinct Hot Spot Mutations in DICER1-Related Multinodular Goiter.

    PubMed

    de Kock, Leanne; Bah, Ismaël; Revil, Timothée; Bérubé, Pierre; Wu, Mona K; Sabbaghian, Nelly; Priest, John R; Ragoussis, Jiannis; Foulkes, William D

    2016-10-01

    Nontoxic multinodular goiter (MNG) occurs frequently, but its genetic etiology is not well established. Familial MNG and MNG occurring with ovarian Sertoli-Leydig cell tumor are associated with germline DICER1 mutations. We recently identified second somatic DICER1 ribonuclease (RNase) IIIb mutations in two MNGs. The objective of the study was to investigate the occurrence of somatic DICER1 mutations and mutational clonality in MNG. MNGs from 15 patients (10 with and five without germline DICER1 mutations) were selected based on tissue availability. Core biopsies/scrapings (n = 70) were obtained, sampling areas of follicular hyperplasia, hyperplasia within colloid pools, unremarkable thyroid parenchyma, and areas of thyroid parenchyma, not classified. After capture with a Fluidigm access array, the coding sequence of DICER1 was deep sequenced using DNA from each core/scraping. All germline DICER1-mutated cases were found to harbor at least one RNase III mutation. Specifically, we identified 12 individually distinct DICER1 RNase IIIb hot spot mutations in 32 of the follicular hyperplasia or hyperplasia within colloid pools cores/scrapings. These mutations are predicted to affect the metal-ion binding residues at positions p.Glu1705, p.Asp1709, p.Gly1809, p.Asp1810, and p.Glu1813. Somatic RNase IIIb mutations were identified in the 10 DICER1 germline mutated MNGs as follows: two cases contained one somatic mutation, five cases contained two mutations, and three cases contained three distinct somatic hot spot mutations. No RNase IIIb mutations were identified in the MNGs from individuals without germline DICER1 mutations. This study demonstrates that nodules within MNG occurring in DICER1 syndrome are associated with spatially distributed somatic DICER1 RNase IIIb mutations.

  13. RNA-based analysis of two SMARCB1 mutations associated with familial schwannomatosis with meningiomas.

    PubMed

    Melean, German; Velasco, Ana; Hernández-Imaz, Elisabete; Rodríguez-Álvarez, Francisco Javier; Martín, Yolanda; Valero, Ana; Hernández-Chico, Concepción

    2012-08-01

    Germline mutations in the SMARCB1 gene cause familial schwannomatosis, a condition characterized by the presence of multiple schwannomas, although mutations in SMARCB1 have also been associated with rhadboid tumor predisposition syndrome 1 (RTPS1). Both schwannomatosis and RTPS1 are autosomal dominant conditions that predispose individuals to develop distinct types of tumors. We clinically and genetically characterized two families with schwannomatosis associated with SMARCB1 mutations. Eight affected members of these families developed different numbers of schwannomas and/or meningiomas at distinct ages, evidence that meningiomas are variably expressed in this condition. We identified two germline mutations in SMARCB1 associated with the familial disease, c.233-1G>A and the novel c.207_208dupTA mutation, which both proved to affect the main SMARCB1 isoforms at the RNA level distinctly. Interestingly, the c.207_208dupTA mutation had no effect on the coding sequence, pre-mRNA splicing or the level of expression of the SMARCB1 isoform 2. Furthermore, SMARCB1 isoforms harboring a premature termination codon were largely eliminated via the nonsense-mediated mRNA decay pathway. Our results highlight the importance of RNA-based studies to characterize SMARCB1 germline mutations in order to determine their impact on protein expression and gain further insight into the genetic basis of conditions associated with SMARCB1 mutations.

  14. Prevalence of the CHEK2 R95* germline mutation.

    PubMed

    Knappskog, Stian; Leirvaag, Beryl; Gansmo, Liv B; Romundstad, Pål; Hveem, Kristian; Vatten, Lars; Lønning, Per E

    2016-01-01

    While germline CHEK2 mutations have been linked to a moderately elevated cancer risk, to date, a limited number of such mutations have been identified. Recently, we reported a germline nonsense mutation (C283T; R95*), introducing an early stop-codon, in two Norwegian patients diagnosed with locally advanced breast cancer. Both patients were resistant to anthracycline therapy, resembling what has been observed for TP53 mutations. In the present study, we screened a large population based sample, including 3748 non-cancer individuals and 7081 incident cancer cases (breast cancer, n  = 1717; prostate cancer n  = 2501, lung cancer n  = 1331 and colorectal cancer n  = 1532), for the distribution of CHEK2 R95*. We found that 12 individuals (0.11 %) carried the R95* variant: 4 non-cancer individuals (0.11 %), 4 breast cancer cases (0.23 %), and 4 prostate cancer cases (0.16 %). Although the low number of observations precluded formal statistical assessment, our data may indicate an elevated risk for breast (OR: 2.19, 95 % CI: 0.55-8.75) and prostate cancer (OR: 1.5, 95 % CI: 0.36-6.00) associated with CHEK2 R95*. By mining international databanks, we found no individuals carrying the R95* mutation, indicating it to be restricted to the Norwegian population. We provide proof-of-concept that previously unknown CHEK2 germline mutations may be present in certain populations. Notably, germline mutations in tumours are in general missed by contemporary massive parallel sequencing strategies, since tumour mutations are usually filtered against the germline. The fact that the CHEK2 R95* mutation may be associated with resistance to anthracyclines in cancer patients emphasizes its possible clinical importance.

  15. Somatic and germline mosaicism for a mutation of the PHEX gene can lead to genetic transmission of X-linked hypophosphatemic rickets that mimics an autosomal dominant trait.

    PubMed

    Goji, Katsumi; Ozaki, Kayo; Sadewa, Ahmad H; Nishio, Hisahide; Matsuo, Masafumi

    2006-02-01

    Familial hypophosphatemic rickets is usually transmitted as an X-linked dominant disorder (XLH), although autosomal dominant forms have also been observed. Genetic studies of these disorders have identified mutations in PHEX and FGF23 as the causes of X-linked dominant disorder and autosomal dominant forms, respectively. The objective of the study was to describe the molecular genetic findings in a family affected by hypophosphatemic rickets with presumed autosomal dominant inheritance. We studied a family in which the father and the elder of his two daughters, but not the second daughter, were affected by hypophosphatemic rickets. The pedigree interpretation of the family suggested that genetic transmission of the disorder occurred as an autosomal dominant trait. Direct nucleotide sequencing of FGF23 and PHEX revealed that the elder daughter was heterozygous for an R567X mutation in PHEX, rather than FGF23, suggesting that the genetic transmission occurred as an X-linked dominant trait. Unexpectedly, the father was heterozygous for this mutation. Single-nucleotide primer extension and denaturing HPLC analysis of the father using DNA from single hair roots revealed that he was a somatic mosaic for the mutation. Haplotype analysis confirmed that the father transmitted the genotypes for 18 markers on the X chromosome equally to his two daughters. The fact that the father transmitted the mutation to only one of his two daughters indicated that he was a germline mosaic for the mutation. Somatic and germline mosaicism for an X-linked dominant mutation in PHEX may mimic autosomal dominant inheritance.

  16. Mutation spectrum of RB1 mutations in retinoblastoma cases from Singapore with implications for genetic management and counselling.

    PubMed

    Tomar, Swati; Sethi, Raman; Sundar, Gangadhara; Quah, Thuan Chong; Quah, Boon Long; Lai, Poh San

    2017-01-01

    Retinoblastoma (RB) is a rare childhood malignant disorder caused by the biallelic inactivation of RB1 gene. Early diagnosis and identification of carriers of heritable RB1 mutations can improve disease outcome and management. In this study, mutational analysis was conducted on fifty-nine matched tumor and peripheral blood samples from 18 bilateral and 41 unilateral unrelated RB cases by a combinatorial approach of Multiplex Ligation-dependent Probe Amplification (MLPA) assay, deletion screening, direct sequencing, copy number gene dosage analysis and methylation assays. Screening of both blood and tumor samples yielded a mutation detection rate of 94.9% (56/59) while only 42.4% (25/59) of mutations were detected if blood samples alone were analyzed. Biallelic mutations were observed in 43/59 (72.9%) of tumors screened. There were 3 cases (5.1%) in which no mutations could be detected and germline mutations were detected in 19.5% (8/41) of unilateral cases. A total of 61 point mutations were identified, of which 10 were novel. There was a high incidence of previously reported recurrent mutations, occurring at 38.98% (23/59) of all cases. Of interest were three cases of mosaic RB1 mutations detected in the blood from patients with unilateral retinoblastoma. Additionally, two germline mutations previously reported to be associated with low-penetrance phenotypes: missense-c.1981C>T and splice variant-c.607+1G>T, were observed in a bilateral and a unilateral proband, respectively. These findings have implications for genetic counselling and risk prediction for the affected families. This is the first published report on the spectrum of mutations in RB patients from Singapore and shows that further improved mutation screening strategies are required in order to provide a definitive molecular diagnosis for every case of RB. Our findings also underscore the importance of genetic testing in supporting individualized disease management plans for patients and asymptomatic family members carrying low-penetrance, germline mosaicism or heritable unilateral mutational phenotypes.

  17. Molecular characteristics of endometrial cancer coexisting with peritoneal malignant mesothelioma in Li-Fraumeni-like syndrome.

    PubMed

    Chao, Angel; Lai, Chyong-Huey; Lee, Yun-Shien; Ueng, Shir-Hwa; Lin, Chiao-Yun; Wang, Tzu-Hao

    2015-01-15

    Endometrial cancer that occurs concurrently with peritoneal malignant mesothelioma (PMM) is difficult to diagnose preoperatively. A postmenopausal woman had endometrial cancer extending to the cervix, vagina and pelvic lymph nodes, and PMM in bilateral ovaries, cul-de-sac, and multiple peritoneal sites. Adjuvant therapies included chemotherapy and radiotherapy. Targeted, massively parallel DNA sequencing and molecular inversion probe microarray analysis revealed a germline TP53 mutation compatible with Li-Fraumeni-like syndrome, somatic mutations of PIK3CA in the endometrial cancer, and a somatic mutation of GNA11 and JAK3 in the PMM. Large-scale genomic amplifications and some deletions were found in the endometrial cancer. The patient has been stable for 24 months after therapy. One of her four children was also found to carry the germline TP53 mutation. Molecular characterization of the coexistent tumors not only helps us make the definite diagnosis, but also provides information to select targeted therapies if needed in the future. Identification of germline TP53 mutation further urged us to monitor future development of malignancies in this patient and encourage cancer screening in her family.

  18. Accumulation of Spontaneous Mutations in the Ciliate Tetrahymena thermophila

    PubMed Central

    Long, Hong-An; Paixão, Tiago; Azevedo, Ricardo B. R.; Zufall, Rebecca A.

    2013-01-01

    Knowledge of the rate and fitness effects of mutations is essential for understanding the process of evolution. Mutations are inherently difficult to study because they are rare and are frequently eliminated by natural selection. In the ciliate Tetrahymena thermophila, mutations can accumulate in the germline genome without being exposed to selection. We have conducted a mutation accumulation (MA) experiment in this species. Assuming that all mutations are deleterious and have the same effect, we estimate that the deleterious mutation rate per haploid germline genome per generation is U = 0.0047 (95% credible interval: 0.0015, 0.0125), and that germline mutations decrease fitness by s = 11% when expressed in a homozygous state (95% CI: 4.4%, 27%). We also estimate that deleterious mutations are partially recessive on average (h = 0.26; 95% CI: –0.022, 0.62) and that the rate of lethal mutations is <10% of the deleterious mutation rate. Comparisons between the observed evolutionary responses in the germline and somatic genomes and the results from individual-based simulations of MA suggest that the two genomes have similar mutational parameters. These are the first estimates of the deleterious mutation rate and fitness effects from the eukaryotic supergroup Chromalveolata and are within the range of those of other eukaryotes. PMID:23934880

  19. POLD1 Germline Mutations in Patients Initially Diagnosed with Werner Syndrome

    PubMed Central

    Lessel, Davor; Hisama, Fuki M.; Szakszon, Katalin; Saha, Bidisha; Sanjuanelo, Alexander Barrios; Salbert, Bonnie A.; Steele, Pamela D.; Baldwin, Jennifer; Brown, W. Ted; Piussan, Charles; Plauchu, Henri; Szilvássy, Judit; Horkay, Edit; Hoögel, Josef; Martin, George M.; Herr, Alan J.; Oshima, Junko; Kubisch, Christian

    2015-01-01

    Segmental progeroid syndromes are rare, heterogeneous disorders characterized by signs of premature aging affecting more than one tissue or organ. A prototypic example is the Werner syndrome (WS), caused by biallelic germline mutations in the Werner helicase gene (WRN). While heterozygous lamin A/C (LMNA) mutations are found in a few nonclassical cases of WS, another 10%–15% of patients initially diagnosed with WS do not have mutations in WRN or LMNA. Germline POLD1 mutations were recently reported in five patients with another segmental progeroid disorder: mandibular hypoplasia, deafness, progeroid features syndrome. Here, we describe eight additional patients with heterozygous POLD1 mutations, thereby substantially expanding the characterization of this new example of segmental progeroid disorders. First, we identified POLD1 mutations in patients initially diagnosed with WS. Second, we describe POLD1 mutation carriers without clinically relevant hearing impairment or mandibular underdevelopment, both previously thought to represent obligate diagnostic features. These patients also exhibit a lower incidence of metabolic abnormalities and joint contractures. Third, we document postnatal short stature and premature greying/loss of hair in POLD1 mutation carriers. We conclude that POLD1 germline mutations can result in a variably expressed and probably underdiagnosed segmental progeroid syndrome. PMID:26172944

  20. Carcinoma of the lower uterine segment diagnosed with Lynch syndrome based on MSH6 germline mutation: A case report.

    PubMed

    Adachi, Masataka; Banno, Kouji; Masuda, Kenta; Yanokura, Megumi; Iijima, Moito; Takeda, Takashi; Kunitomi, Haruko; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Kameyama, Kaori; Sugano, Kokichi; Aoki, Daisuke

    2017-02-01

    Endometrial cancer in the lower uterine segment (LUS) is associated with Lynch syndrome with MLH1 or MSH2 germline mutation. Here, we report a case of carcinoma of the LUS diagnosed with Lynch syndrome based on MSH6 germline mutation in a 46-year-old woman with abnormal vaginal bleeding. She had had rectal cancer at age 39 with a family history of colon cancer (father, 75 years), pancreatic cancer (paternal grandmother, 74 years), and colon cancer (maternal grandmother, 85 years). Magnetic resonance imaging showed a tumor in the LUS. Endometrial biopsy revealed endometrioid adenocarcinoma G1. As her cancer history met the revised Bethesda criteria, we examined microsatellite instability and the result was negative, but loss of the MSH6 expression was detected by immunohistochemistry. Genetic testing revealed deleterious germline mutation of MSH6, which was compatible with Lynch syndrome. To our knowledge, this is the first case of endometrial carcinoma of the LUS with MSH6 germline mutation. © 2016 Japan Society of Obstetrics and Gynecology.

  1. E-cadherin germline mutation carriers: clinical management and genetic implications.

    PubMed

    Corso, Giovanni; Figueiredo, Joana; Biffi, Roberto; Trentin, Chiara; Bonanni, Bernardo; Feroce, Irene; Serrano, Davide; Cassano, Enrico; Annibale, Bruno; Melo, Soraia; Seruca, Raquel; De Lorenzi, Francesca; Ferrara, Francesco; Piagnerelli, Riccardo; Roviello, Franco; Galimberti, Viviana

    2014-12-01

    Hereditary diffuse gastric cancer is an autosomic dominant syndrome associated with E-cadherin protein (CDH1) gene germline mutations. Clinical criteria for genetic screening were revised in 2010 by the International Gastric Cancer Linkage Consortium at the Cambridge meeting. About 40 % of families fulfilling clinical criteria for this inherited disease present deleterious CDH1 germline mutations. Lobular breast cancer is a neoplastic condition associated with hereditary diffuse gastric cancer syndrome. E-cadherin constitutional mutations have been described in both settings, in gastric and breast cancers. The management of CDH1 asymptomatic mutation carriers requires a multidisciplinary approach; the only life-saving procedure is the prophylactic total gastrectomy after thorough genetic counselling. Several prophylactic gastrectomies have been performed to date; conversely, no prophylactic mastectomies have been described in CDH1 mutant carriers. However, the recent discovery of novel germline alterations in pedigree clustering only for lobular breast cancer opens up a new debate in the management of these individuals. In this critical review, we describe the clinical management of CDH1 germline mutant carriers providing specific recommendations for genetic counselling, clinical criteria, surveillance and/ or prophylactic surgery.

  2. Early-onset lymphoproliferation and autoimmunity caused by germline STAT3 gain-of-function mutations

    PubMed Central

    Vogel, Tiphanie P.; Forbes, Lisa; Ma, Chi A.; Stray-Pedersen, Asbjørg; Niemela, Julie E.; Lyons, Jonathan J.; Engelhardt, Karin R.; Zhang, Yu; Topcagic, Nermina; Roberson, Elisha D. O.; Matthews, Helen; Verbsky, James W.; Dasu, Trivikram; Vargas-Hernandez, Alexander; Varghese, Nidhy; McClain, Kenneth L.; Karam, Lina B.; Nahmod, Karen; Makedonas, George; Mace, Emily M.; Sorte, Hanne S.; Perminow, Gøri; Rao, V. Koneti; O’Connell, Michael P.; Price, Susan; Su, Helen C.; Butrick, Morgan; McElwee, Joshua; Hughes, Jason D.; Willet, Joseph; Swan, David; Xu, Yaobo; Santibanez-Koref, Mauro; Slowik, Voytek; Dinwiddie, Darrell L.; Ciaccio, Christina E.; Saunders, Carol J.; Septer, Seth; Kingsmore, Stephen F.; White, Andrew J.; Cant, Andrew J.; Hambleton, Sophie

    2015-01-01

    Germline loss-of-function mutations in the transcription factor signal transducer and activator of transcription 3 (STAT3) cause immunodeficiency, whereas somatic gain-of-function mutations in STAT3 are associated with large granular lymphocytic leukemic, myelodysplastic syndrome, and aplastic anemia. Recently, germline mutations in STAT3 have also been associated with autoimmune disease. Here, we report on 13 individuals from 10 families with lymphoproliferation and early-onset solid-organ autoimmunity associated with 9 different germline heterozygous mutations in STAT3. Patients exhibited a variety of clinical features, with most having lymphadenopathy, autoimmune cytopenias, multiorgan autoimmunity (lung, gastrointestinal, hepatic, and/or endocrine dysfunction), infections, and short stature. Functional analyses demonstrate that these mutations confer a gain-of-function in STAT3 leading to secondary defects in STAT5 and STAT1 phosphorylation and the regulatory T-cell compartment. Treatment targeting a cytokine pathway that signals through STAT3 led to clinical improvement in 1 patient, suggesting a potential therapeutic option for such patients. These results suggest that there is a broad range of autoimmunity caused by germline STAT3 gain-of-function mutations, and that hematologic autoimmunity is a major component of this newly described disorder. Some patients for this study were enrolled in a trial registered at www.clinicaltrials.gov as #NCT00001350. PMID:25359994

  3. Multifocal nerve lesions and LZTR1 germline mutations in segmental schwannomatosis.

    PubMed

    Farschtschi, Said; Mautner, Victor-Felix; Pham, Mirko; Nguyen, Rosa; Kehrer-Sawatzki, Hildegard; Hutter, Sonja; Friedrich, Reinhard E; Schulz, Alexander; Morrison, Helen; Jones, David T W; Bendszus, Martin; Bäumer, Philipp

    2016-10-01

    Schwannomatosis is a genetic disorder characterized by the occurrence of multiple peripheral schwannomas. Segmental schwannomatosis is diagnosed when schwannomas are restricted to 1 extremity and is thought to be caused by genetic mosaicism. We studied 5 patients with segmental schwannomatosis through microstructural magnetic resonance neurography and mutation analysis of NF2, SMARCB1, and LZTR1. In 4 of 5 patients, subtle fascicular nerve lesions were detected in clinically unaffected extremities. Two patients exhibited LZTR1 germline mutations. This appears contrary to a simple concept of genetic mosaicism and suggests more complex and heterogeneous mechanisms underlying the phenotype of segmental schwannomatosis than previously thought. Ann Neurol 2016;80:625-628. © 2016 American Neurological Association.

  4. Spectrum of SMARCB1/INI1 Mutations in Familial and Sporadic Rhabdoid Tumors

    PubMed Central

    Eaton, Katherine W.; Tooke, Laura S.; Wainwright, Luanne M.; Judkins, Alexander R.; Biegel, Jaclyn A.

    2011-01-01

    Background Germline mutations and deletions of SMARCB1/INI1 in chromosome band 22q11.2 predispose patients to rhabdoid tumor and schwannomatosis. Previous estimates suggested that 15–20% of rhabdoid tumors were caused by an underlying germline abnormality of SMARCB1. However, these studies were limited by case selection and an inability to detect intragenic deletions and duplications. Procedure One hundred matched tumor and blood samples from patients with rhabdoid tumors of the brain, kidney, or soft tissues were analyzed for mutations and deletions of SMARCB1 by FISH, multiplex ligation-dependent probe amplification (MLPA), sequence analysis and high resolution Illumina 610K SNP based oligonucleotide array studies. Results Thirty-five of 100 patients were found to have a germline SMARCB1 abnormality. These abnormalities included point and frameshift mutations, intragenic deletions and duplications, and larger deletions including regions both proximal and distal to SMARCB1. There were 9 cases that demonstrated parent to child transmission of a mutated copy of SMARCB1. In 8 of the 9 cases, one or more family members were also diagnosed with rhabdoid tumor or schwannoma, and 2 of the 8 families presented with multiple affected children in a manner consistent with gonadal mosaicism. Conclusions Approximately one third of newly diagnosed patients with rhabdoid tumor have an underlying genetic predisposition to tumors due to a germline SMARCB1 alteration. Families may demonstrate incomplete penetrance and gonadal mosaicism, which must be considered when counseling families of patients with rhabdoid tumor. PMID:21108436

  5. Germline mutations in lysine specific demethylase 1 (LSD1/KDM1A) confer susceptibility to multiple myeloma.

    PubMed

    Wei, Xiaomu; Calvo-Vidal, M Nieves; Chen, Siwei; Wu, Gang; Revuelta, Maria V; Sun, Jian; Zhang, Jinghui; Walsh, Michael F; Nichols, Kim E; Joseph, Vijai; Snyder, Carrie; Vachon, Celine M; McKay, James D; Wang, Shu-Ping; Jayabalan, David S; Jacobs, Lauren M; Becirovic, Dina; Waller, Rosalie G; Artomov, Mykyta; Viale, Agnes; Patel, Jayeshkumar; Phillip, Jude M; Chen-Kiang, Selina; Curtin, Karen; Salama, Mohamed; Atanackovic, Djordje; Niesvizky, Ruben; Landgren, Ola; Slager, Susan L; Godley, Lucy A; Churpek, Jane; Garber, Judy E; Anderson, Kenneth C; Daly, Mark J; Roeder, Robert G; Dumontet, Charles; Lynch, Henry T; Mullighan, Charles G; Camp, Nicola J; Offit, Kenneth; Klein, Robert J; Yu, Haiyuan; Cerchietti, Leandro; Lipkin, Steven M

    2018-03-20

    Given the frequent and largely incurable occurrence of multiple myeloma (MM), identification of germline genetic mutations that predispose cells to MM may provide insight into disease etiology and the developmental mechanisms of its cell of origin, the plasma cell. Here we identified familial and early-onset MM kindreds with truncating mutations in lysine-specific demethylase 1 (LSD1/KDM1A), an epigenetic transcriptional repressor that primarily demethylates histone H3 on lysine 4 and regulates hematopoietic stem cell self-renewal. Additionally, we found higher rates of germline truncating and predicted deleterious missense KDM1A mutations in MM patients unselected for family history compared to controls. Both monoclonal gammopathy of unknown significance (MGUS) and MM cells have significantly lower KDM1A transcript levels compared with normal plasma cells. Transcriptome analysis of MM cells from KDM1A mutation carriers shows enrichment of pathways and MYC target genes previously associated with myeloma pathogenesis. In mice, antigen challenge followed by pharmacological inhibition of KDM1A promoted plasma cell expansion, enhanced secondary immune response, elicited appearance of serum paraprotein, and mediated upregulation of MYC transcriptional targets. These changes are consistent with the development of MGUS. Collectively, our findings show KDM1A is the first autosomal dominant MM germline predisposition gene, providing new insights into its mechanistic roles as a tumor suppressor during post-germinal center B cell differentiation. Copyright ©2018, American Association for Cancer Research.

  6. Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy.

    PubMed

    Casula, Milena; Muggiano, Antonio; Cossu, Antonio; Budroni, Mario; Caracò, Corrado; Ascierto, Paolo A; Pagani, Elena; Stanganelli, Ignazio; Canzanella, Sergio; Sini, Mariacristina; Palomba, Grazia; Palmieri, Giuseppe

    2009-10-03

    Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. A large series (N = 846) of sporadic and familial cases originating from South Italy was screened for germline mutations in p16(CDKN2A), BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35) as well as melanoma cell lines (N = 18) were analyzed for somatic mutations in NRAS, BRAF, and p16(CDKN2A) genes. For melanoma susceptibility, investigations at germline level indicated that p16(CDKN2A) was exclusively mutated in 16/545 (2.9%) non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4%) patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds) in cultured and in vivo melanomas (either primary or metastatic lesions). Conversely, p16(CDKN2A) gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16(CDKN2A) silencing). Our findings further clarified that: a) mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b) multiple molecular events are accumulating during melanomagenesis.

  7. Germline BAP1 mutations predispose to malignant mesothelioma

    PubMed Central

    Testa, Joseph R.; Cheung, Mitchell; Pei, Jianming; Below, Jennifer E.; Tan, Yinfei; Sementino, Eleonora; Cox, Nancy J.; Dogan, A. Umran; Pass, Harvey I.; Trusa, Sandra; Hesdorffer, Mary; Nasu, Masaki; Powers, Amy; Rivera, Zeyana; Comertpay, Sabahattin; Tanji, Mika; Gaudino, Giovanni; Yang, Haining; Carbone, Michele

    2011-01-01

    Because only a small fraction of asbestos-exposed individuals develop malignant mesothelioma1, and because mesothelioma clustering is observed in some families1, we searched for genetic predisposing factors. We discovered germline mutations in BAP1 (BRCA1-associated protein 1) in two families with a high incidence of mesothelioma. Somatic alterations affecting BAP1 were observed in familial mesotheliomas, indicating biallelic inactivation. Besides mesothelioma, some BAP1 mutation carriers developed uveal melanoma. Germline BAP1 mutations were also found in two of 26 sporadic mesotheliomas: both patients with mutant BAP1 were previously diagnosed with uveal melanoma. Truncating mutations and aberrant BAP1 expression were common in sporadic mesotheliomas without germline mutations. These results reveal a BAP1-related cancer syndrome characterized by mesothelioma and uveal melanoma. We hypothesize that other cancers may also be involved, and that mesothelioma predominates upon asbestos exposure. These findings will help identify individuals at high risk of mesothelioma who could be targeted for early intervention. PMID:21874000

  8. Correlation between mutations and mRNA expression of APC and MUTYH genes: new insight into hereditary colorectal polyposis predisposition.

    PubMed

    Aceto, Gitana Maria; Fantini, Fabiana; De Iure, Sabrina; Di Nicola, Marta; Palka, Giandomenico; Valanzano, Rosa; Di Gregorio, Patrizia; Stigliano, Vittoria; Genuardi, Maurizio; Battista, Pasquale; Cama, Alessandro; Curia, Maria Cristina

    2015-10-28

    Transcript dosage imbalance may influence the transcriptome. To gain insight into the role of altered gene expression in hereditary colorectal polyposis predisposition, in the present study we analyzed absolute and allele-specific expression (ASE) of adenomatous polyposis coli (APC) and mutY Homolog (MUTYH) genes. We analyzed DNA and RNA extracted from peripheral blood mononuclear cells (PBMC) of 49 familial polyposis patients and 42 healthy blood donors selected according similar gender and age. Patients were studied for germline alterations in both genes using dHPLC, MLPA and automated sequencing. APC and MUTYH mRNA expression levels were investigated by quantitative Real-Time PCR (qRT-PCR) analysis using TaqMan assay and by ASE assays using dHPLC-based primer extension. Twenty out of 49 patients showed germline mutations: 14 in APC gene and six in MUTYH gene. Twenty-nine patients did not show mutations in both genes. Results from qRT-PCR indicated that gene expression of both APC and MUTYH was reduced in patients analyzed. In particular, a significant reduction in APC expression was observed in patients without APC germline mutation vs control group (P < 0.05) while APC expression in the mutation carrier patients, although lower compared to control individuals, did not show statistical significance. On the other hand a significant reduced MUTYH expression was detected in patients with MUTYH mutations vs control group (P < 0.05). Altered ASE of APC was detected in four out of eight APC mutation carriers. In particular one case showed a complete loss of one allele. Among APC mutation negative cases, 4 out of 13 showed a moderate ASE. ASE of MUTYH did not show any altered expression in the cases analyzed. Spearman's Rho Test analysis showed a positive and significant correlation between APC and MUTYH genes both in cases and in controls (P = 0.020 and P < 0.001). APC and MUTYH showed a reduced germline expression, not always corresponding to gene mutation. Expression of APC is decreased in mutation negative cases and this appears to be a promising indicator of FAP predisposition, while for MUTYH gene, mutation is associated to reduced mRNA expression. This study could improve the predictive genetic diagnosis of at-risk individuals belonging to families with reduced mRNA expression regardless of presence of mutation.

  9. Histological variations in juvenile polyp phenotype correlate with genetic defect underlying juvenile polyposis

    PubMed Central

    van Hattem, W. Arnout; Langeveld, Danielle; de Leng, Wendy W. J.; Morsink, Folkert H.; van Diest, Paul J.; Iacobuzio-Donahue, Christine A.; Giardiello, Francis M.; Offerhaus, G. Johan A.; Brosens, Lodewijk A. A.

    2011-01-01

    Background Juvenile polyps are distinct hamartomatous malformations of the gastrointestinal tract that may occur in the heritable juvenile polyposis syndrome (JPS) or sporadically. Histologically, juvenile polyps are characterised by a marked increase of the stromal cell compartment but, an epithelial phenotype has also been reported. JPS has an increased risk of colorectal cancer but sporadic juvenile polyps do not. In 50–60% of JPS patients a germline mutation of the TGF-β/BMP pathway genes SMAD4 or BMPR1A is found. This study compares the histological phenotype of juvenile polyps with a SMAD4 or BMPR1A germline mutation and sporadic juvenile polyps. Methods H&E slides of 65 JPS polyps and 25 sporadic juvenile polyps were reviewed for histological features and dysplasia. Systematic random crypt and stroma counts were obtained by count stereology and a crypt-stroma ratio was determined. All polyps were subsequently categorised as type A (crypt-stroma ratio <1.00) or type B (crypt-stroma ratio ≥1.00), the latter referring to the epithelial phenotype. Cell cycle activity was assessed using immunohistochemistry of the proliferation marker Ki67, and mutation analysis was conducted for KRAS and APC to determine the involvement of the adenoma-carcinoma sequence. Results Juvenile polyps with a SMAD4 germline mutation were predominantly type B, whereas, type A was more common among juvenile polyps with a BMPR1A germline mutation, but this distinction could not be ascribed to differences in cell cycle activity. Dysplasia was equally common in JPS polyps with either a SMAD4 or BMPR1A germline mutation, where the involvement of the adenoma-carcinoma sequence does not seem to play a distinct role. Conclusion juvenile polyps in the setting of JPS exhibit distinct phenotypes correlating with the underlying genetic defect. PMID:21412070

  10. Inherited DNA-Repair Gene Mutations in Men with Metastatic Prostate Cancer.

    PubMed

    Pritchard, Colin C; Mateo, Joaquin; Walsh, Michael F; De Sarkar, Navonil; Abida, Wassim; Beltran, Himisha; Garofalo, Andrea; Gulati, Roman; Carreira, Suzanne; Eeles, Rosalind; Elemento, Olivier; Rubin, Mark A; Robinson, Dan; Lonigro, Robert; Hussain, Maha; Chinnaiyan, Arul; Vinson, Jake; Filipenko, Julie; Garraway, Levi; Taplin, Mary-Ellen; AlDubayan, Saud; Han, G Celine; Beightol, Mallory; Morrissey, Colm; Nghiem, Belinda; Cheng, Heather H; Montgomery, Bruce; Walsh, Tom; Casadei, Silvia; Berger, Michael; Zhang, Liying; Zehir, Ahmet; Vijai, Joseph; Scher, Howard I; Sawyers, Charles; Schultz, Nikolaus; Kantoff, Philip W; Solit, David; Robson, Mark; Van Allen, Eliezer M; Offit, Kenneth; de Bono, Johann; Nelson, Peter S

    2016-08-04

    Inherited mutations in DNA-repair genes such as BRCA2 are associated with increased risks of lethal prostate cancer. Although the prevalence of germline mutations in DNA-repair genes among men with localized prostate cancer who are unselected for family predisposition is insufficient to warrant routine testing, the frequency of such mutations in patients with metastatic prostate cancer has not been established. We recruited 692 men with documented metastatic prostate cancer who were unselected for family history of cancer or age at diagnosis. We isolated germline DNA and used multiplex sequencing assays to assess mutations in 20 DNA-repair genes associated with autosomal dominant cancer-predisposition syndromes. A total of 84 germline DNA-repair gene mutations that were presumed to be deleterious were identified in 82 men (11.8%); mutations were found in 16 genes, including BRCA2 (37 men [5.3%]), ATM (11 [1.6%]), CHEK2 (10 [1.9% of 534 men with data]), BRCA1 (6 [0.9%]), RAD51D (3 [0.4%]), and PALB2 (3 [0.4%]). Mutation frequencies did not differ according to whether a family history of prostate cancer was present or according to age at diagnosis. Overall, the frequency of germline mutations in DNA-repair genes among men with metastatic prostate cancer significantly exceeded the prevalence of 4.6% among 499 men with localized prostate cancer (P<0.001), including men with high-risk disease, and the prevalence of 2.7% in the Exome Aggregation Consortium, which includes 53,105 persons without a known cancer diagnosis (P<0.001). In our multicenter study, the incidence of germline mutations in genes mediating DNA-repair processes among men with metastatic prostate cancer was 11.8%, which was significantly higher than the incidence among men with localized prostate cancer. The frequencies of germline mutations in DNA-repair genes among men with metastatic disease did not differ significantly according to age at diagnosis or family history of prostate cancer. (Funded by Stand Up To Cancer and others.).

  11. Second Malignant Neoplasms in Patients With Cowden Syndrome With Underlying Germline PTEN Mutations

    PubMed Central

    Ngeow, Joanne; Stanuch, Kim; Mester, Jessica L.; Barnholtz-Sloan, Jill S.; Eng, Charis

    2014-01-01

    Purpose Patients with Cowden syndrome (CS) with underlying germline PTEN mutations are at increased risk of breast, thyroid, endometrial, and renal cancers. To our knowledge, risk of subsequent cancers in these patients has not been previously explored or quantified. Patients and Methods We conducted a 7-year multicenter prospective study (2005 to 2012) of patients with CS or CS-like disease, all of whom underwent comprehensive PTEN mutational analysis. Second malignant neoplasms (SMNs) were ascertained by medical records and confirmed by pathology reports. Standardized incidence ratios (SIRs) for all SMNs combined and for breast, thyroid, endometrial, and renal cancers were calculated. Results Of the 2,912 adult patients included in our analysis, 2,024 had an invasive cancer history. Germline pathogenic PTEN mutations (PTEN mutation positive) were identified in 114 patients (5.6%). Of these 114 patients, 46 (40%) had an SMN. Median age of SMN diagnosis was 50 years (range, 21 to 71 years). Median interval between primary cancer and SMN was 5 years (range, < 1 to 35 years). Of the 51 PTEN mutation–positive patients who presented with primary breast cancer, 11 (22%) had a subsequent new primary breast cancer and 10-year second breast cancer cumulative risk of 29% (95% CI, 15.3 to 43.7). Risk of SMNs compared with that of the general population was significantly elevated for all cancers (SIR, 7.74; 95% CI, 5.84 to 10.07), specifically for breast (SIR, 8.92; 95% CI, 5.85 to 13.07), thyroid (SIR, 5.83; 95% CI, 3.01 to 10.18), and endometrial SMNs (SIR, 14.08.07; 95% CI, 7.10 to 27.21). Conclusion Patients with CS with germline PTEN mutations are at higher risk for SMNs compared with the general population. Prophylactic mastectomy should be considered on an individual basis given the significant risk of subsequent breast cancer. PMID:24778394

  12. Germline TP53 Mutations in Patients With Early-Onset Colorectal Cancer in the Colon Cancer Family Registry

    PubMed Central

    Yurgelun, Matthew B.; Masciari, Serena; Joshi, Victoria A.; Mercado, Rowena C.; Lindor, Noralane M.; Gallinger, Steven; Hopper, John L.; Jenkins, Mark A.; Buchanan, Daniel D.; Newcomb, Polly A.; Potter, John D.; Haile, Robert W.; Kucherlapati, Raju; Syngal, Sapna

    2015-01-01

    IMPORTANCE Li-Fraumeni syndrome, usually characterized by germline TP53 mutations, is associated with markedly elevated lifetime risks of multiple cancers, and has been linked to an increased risk of early-onset colorectal cancer. OBJECTIVE To examine the frequency of germline TP53 alterations in patients with early-onset colorectal cancer. DESIGN, SETTING, AND PARTICIPANTS This was a multicenter cross-sectional cohort study of individuals recruited to the Colon Cancer Family Registry (CCFR) from 1998 through 2007 (genetic testing data updated as of January 2015). Both population-based and clinic-based patients in the United States, Canada, Australia, and New Zealand were recruited to the CCFR. Demographic information, clinical history, and family history data were obtained at enrollment. Biospecimens were collected from consenting probands and families, including microsatellite instability and DNA mismatch repair immunohistochemistry results. A total of a 510 individuals diagnosed as having colorectal cancer at age 40 years or younger and lacking a known hereditary cancer syndrome were identified from the CCFR as being potentially eligible. Fifty-three participants were excluded owing to subsequent identification of germline mutations in DNA mismatch repair genes (n = 47) or biallelic MUTYH mutations (n = 6). INTERVENTIONS Germline sequencing of the TP53 gene was performed. Identified TP53 alterations were assessed for pathogenicity using literature and international mutation database searches and in silico prediction models. MAIN OUTCOMES AND MEASURES Frequency of nonsynonymous germline TP53 alterations. RESULTS Among 457 eligible participants (314, population-based; 143, clinic-based; median age at diagnosis, 36 years [range, 15–40 years]), 6 (1.3%; 95%CI, 0.5%–2.8%) carried germline missense TP53 alterations, none of whom met clinical criteria for Li-Fraumeni syndrome. Four of the identified TP53 alterations have been previously described in the literature in probands with clinical features of Li-Fraumeni syndrome, and 2 were novel alterations. CONCLUSIONS AND RELEVANCE In a large cohort of patients with early-onset colorectal cancer, germline TP53 mutations were detected at a frequency comparable with the published prevalence of germline APC mutations in colorectal cancer. With the increasing use of multigene next-generation sequencing panels in hereditary cancer risk assessment, clinicians will be faced with the challenge of interpreting the biologic and clinical significance of germline TP53 mutations in families whose phenotypes are atypical for Li-Fraumeni syndrome. PMID:26086041

  13. Somatic and Germline TP53 Alterations in Second Malignant Neoplasms from Pediatric Cancer Survivors.

    PubMed

    Sherborne, Amy L; Lavergne, Vincent; Yu, Katharine; Lee, Leah; Davidson, Philip R; Mazor, Tali; Smirnoff, Ivan V; Horvai, Andrew E; Loh, Mignon; DuBois, Steven G; Goldsby, Robert E; Neglia, Joseph P; Hammond, Sue; Robison, Leslie L; Wustrack, Rosanna; Costello, Joseph F; Nakamura, Alice O; Shannon, Kevin M; Bhatia, Smita; Nakamura, Jean L

    2017-04-01

    Purpose: Second malignant neoplasms (SMNs) are severe late complications that occur in pediatric cancer survivors exposed to radiotherapy and other genotoxic treatments. To characterize the mutational landscape of treatment-induced sarcomas and to identify candidate SMN-predisposing variants, we analyzed germline and SMN samples from pediatric cancer survivors. Experimental Design: We performed whole-exome sequencing (WES) and RNA sequencing on radiation-induced sarcomas arising from two pediatric cancer survivors. To assess the frequency of germline TP53 variants in SMNs, Sanger sequencing was performed to analyze germline TP53 in 37 pediatric cancer survivors from the Childhood Cancer Survivor Study (CCSS) without any history of a familial cancer predisposition syndrome but known to have developed SMNs. Results: WES revealed TP53 mutations involving p53's DNA-binding domain in both index cases, one of which was also present in the germline. The germline and somatic TP53- mutant variants were enriched in the transcriptomes for both sarcomas. Analysis of TP53- coding exons in germline specimens from the CCSS survivor cohort identified a G215C variant encoding an R72P amino acid substitution in 6 patients and a synonymous SNP A639G in 4 others, resulting in 10 of 37 evaluable patients (27%) harboring a germline TP53 variant. Conclusions: Currently, germline TP53 is not routinely assessed in patients with pediatric cancer. These data support the concept that identifying germline TP53 variants at the time a primary cancer is diagnosed may identify patients at high risk for SMN development, who could benefit from modified therapeutic strategies and/or intensive posttreatment monitoring. Clin Cancer Res; 23(7); 1852-61. ©2016 AACR . ©2016 American Association for Cancer Research.

  14. Somatic and germline TP53 alterations in second malignant neoplasms from pediatric cancer survivors

    PubMed Central

    Sherborne, Amy L.; Lavergne, Vincent; Yu, Katharine; Lee, Leah; Davidson, Philip R.; Mazor, Tali; Smirnoff, Ivan; Horvai, Andrew; Loh, Mignon; DuBois, Steven G.; Goldsby, Robert E.; Neglia, Joseph; Hammond, Sue; Robison, Leslie L.; Wustrack, Rosanna; Costello, Joseph; Nakamura, Alice O.; Shannon, Kevin; Bhatia, Smita; Nakamura, Jean L.

    2016-01-01

    Purpose Second malignant neoplasms (SMNs) are severe late complications that occur in pediatric cancer survivors exposed to radiotherapy and other genotoxic treatments. To characterize the mutational landscape of treatment-induced sarcomas and to identify candidate SMN-predisposing variants we analyzed germline and SMN samples from pediatric cancer survivors. Experimental Design We performed whole exome sequencing (WES) and RNA sequencing on radiation-induced sarcomas arising from two pediatric cancer survivors. To assess the frequency of germline TP53 variants in SMNs, Sanger sequencing was performed to analyze germline TP53 in thirty-seven pediatric cancer survivors from the Childhood Cancer Survivor Study (CCSS) without history of a familial cancer predisposition syndrome but known to have developed SMNs. Results WES revealed TP53 mutations involving p53’s DNA binding domain in both index cases, one of which was also present in the germline. The germline and somatic TP53 mutant variants were enriched in the transcriptomes for both sarcomas. Analysis of TP53 coding exons in germline specimens from the CCSS survivor cohort identified a G215C variant encoding an R72P amino acid substitution in six patients and a synonymous single nucleotide polymorphism A639G in four others, resulting in ten out of 37 evaluable patients (27%) harboring a germline TP53 variant. Conclusions Currently, germline TP53 is not routinely assessed in pediatric cancer patients. These data support the concept that identifying germline TP53 variants at the time a primary cancer is diagnosed may identify patients at high risk for SMN development, who could benefit from modified therapeutic strategies and/or intensive post-treatment monitoring. PMID:27683180

  15. BRCA Mutation Frequency and Patterns of Treatment Response in BRCA Mutation–Positive Women With Ovarian Cancer: A Report From the Australian Ovarian Cancer Study Group

    PubMed Central

    Alsop, Kathryn; Fereday, Sian; Meldrum, Cliff; deFazio, Anna; Emmanuel, Catherine; George, Joshy; Dobrovic, Alexander; Birrer, Michael J.; Webb, Penelope M.; Stewart, Colin; Friedlander, Michael; Fox, Stephen; Bowtell, David; Mitchell, Gillian

    2012-01-01

    Purpose The frequency of BRCA1 and BRCA2 germ-line mutations in women with ovarian cancer is unclear; reports vary from 3% to 27%. The impact of germ-line mutation on response requires further investigation to understand its impact on treatment planning and clinical trial design. Patients and Methods Women with nonmucinous ovarian carcinoma (n = 1,001) enrolled onto a population-based, case-control study were screened for point mutations and large deletions in both genes. Survival outcomes and responses to multiple lines of chemotherapy were assessed. Results Germ-line mutations were found in 14.1% of patients overall, including 16.6% of serous cancer patients (high-grade serous, 22.6%); 44% had no reported family history of breast or ovarian cancer. Patients carrying germ-line mutations had improved rates of progression-free and overall survival. In the relapse setting, patients carrying mutations more frequently responded to both platin- and nonplatin-based regimens than mutation-negative patients, even in patients with early relapse after primary treatment. Mutation-negative patients who responded to multiple cycles of platin-based treatment were more likely to carry somatic BRCA1/2 mutations. Conclusion BRCA mutation status has a major influence on survival in ovarian cancer patients and should be an additional stratification factor in clinical trials. Treatment outcomes in BRCA1/2 carriers challenge conventional definitions of platin resistance, and mutation status may be able to contribute to decision making and systemic therapy selection in the relapse setting. Our data, together with the advent of poly(ADP-ribose) polymerase inhibitor trials, supports the recommendation that germ-line BRCA1/2 testing should be offered to all women diagnosed with nonmucinous, ovarian carcinoma, regardless of family history. PMID:22711857

  16. Germline Mutations in ATM and BRCA1/2 Distinguish Risk for Lethal and Indolent Prostate Cancer and are Associated with Early Age at Death

    PubMed Central

    Na, Rong; Zheng, S. Lilly; Han, Misop; Yu, Hongjie; Jiang, Deke; Shah, Sameep; Ewing, Charles M.; Zhang, Liti; Novakovic, Kristian; Petkewicz, Jacqueline; Gulukota, Kamalakar; Helseth, Donald L.; Quinn, Margo; Humphries, Elizabeth; Wiley, Kathleen E.; Isaacs, Sarah D.; Wu, Yishuo; Liu, Xu; Zhang, Ning; Wang, Chi-Hsiung; Khandekar, Janardan; Hulick, Peter J.; Shevrin, Daniel H.; Cooney, Kathleen A.; Shen, Zhoujun; Partin, Alan W.; Carter, H. Ballentine; Carducci, Michael A.; Eisenberger, Mario A.; Denmeade, Sam R.; McGuire, Michael; Walsh, Patrick C.; Helfand, Brian T.; Brendler, Charles B.; Ding, Qiang; Xu, Jianfeng; Isaacs, William B.

    2017-01-01

    Background Germline mutations in BRCA1/2 and ATM have been associated with prostate cancer (PCa) risk. Objective To directly assess whether germline mutations in these three genes distinguish lethal from indolent PCa and whether they confer any effect on age at death. Design, setting, and participants A retrospective case-case study of 313 patients who died of PCa and 486 patients with low-risk localized PCa of European, African, and Chinese descent. Germline DNA of each of the 799 patients was sequenced for these three genes. Outcome measurements and statistical analysis Mutation carrier rates and their effect on lethal PCa were analyzed using the Fisher’s exact test and Cox regression analysis, respectively. Results and limitations The combined BRCA1/2 and ATM mutation carrier rate was significantly higher in lethal PCa patients (6.07%) than localized PCa patients (1.44%), p = 0.0007. The rate also differed significantly among lethal PCa patients as a function of age at death (10.00%, 9.08%, 8.33%, 4.94%, and 2.97% in patients who died ≤60 yr, 61–65 yr, 66–70 yr, 71–75 yr, and over 75 yr, respectively, p = 0.046) and time to death after diagnosis (12.26%, 4.76%, and 0.98% in patients who died ≤5 yr, 6–10 yr, and > 10 yr after a PCa diagnosis, respectively, p = 0.0006). Survival analysis in the entire cohort revealed mutation carriers remained an independent predictor of lethal PCa after adjusting for race and age, prostate-specific antigen, and Gleason score at the time of diagnosis (hazard ratio = 2.13, 95% confidence interval: 1.24–3.66, p = 0.004). A limitation of this study is that other DNA repair genes were not analyzed. Conclusions Mutation status of BRCA1/2 and ATM distinguishes risk for lethal and indolent PCa and is associated with earlier age at death and shorter survival time. Patient summary Prostate cancer patients with inherited mutations in BRCA1/2 and ATM are more likely to die of prostate cancer and do so at an earlier age. PMID:27989354

  17. The role of the JAK2 GGCC haplotype and the TET2 gene in familial myeloproliferative neoplasms

    PubMed Central

    Olcaydu, Damla; Rumi, Elisa; Harutyunyan, Ashot; Passamonti, Francesco; Pietra, Daniela; Pascutto, Cristiana; Berg, Tiina; Jäger, Roland; Hammond, Emma; Cazzola, Mario; Kralovics, Robert

    2011-01-01

    Background Myeloproliferative neoplasms constitute a group of diverse chronic myeloid malignancies that share pathogenic features such as acquired mutations in the JAK2, TET2, CBL and MPL genes. There are recent reports that a JAK2 gene haplotype (GGCC or 46/1) confers susceptibility to JAK2 mutation-positive myeloproliferative neoplasms. The aim of this study was to examine the role of the JAK2 GGCC haplotype and germline mutations of TET2, CBL and MPL in familial myeloproliferative neoplasms. Design and Methods We investigated patients with familial (n=88) or sporadic (n=684) myeloproliferative neoplasms, and a control population (n=203) from the same demographic area in Italy. Association analysis was performed using tagged single nucleotide polymorphisms (rs10974944 and rs12343867) of the JAK2 haplotype. Sequence analysis of TET2, CBL and MPL was conducted in the 88 patients with familial myeloproliferative neoplasms. Results Association analysis revealed no difference in haplotype frequency between familial and sporadic cases of myeloproliferative neoplasms (P=0.6529). No germline mutations in TET2, CBL or MPL that segregate with the disease phenotype were identified. As we observed variability in somatic mutations in the affected members of a pedigree with myeloproliferative neoplasms, we postulated that somatic mutagenesis is increased in familial myeloproliferative neoplasms. Accordingly, we compared the incidence of malignant disorders between sporadic and familial patients. Although the overall incidence of malignant disorders did not differ significantly between cases of familial and sporadic myeloproliferative neoplasms, malignancies were more frequent in patients with familial disease aged between 50 to 70 years (P=0.0198) than in patients in the same age range with sporadic myeloproliferative neoplasms. Conclusions We conclude that the JAK2 GGCC haplotype and germline mutations of TET2, CBL or MPL do not explain familial clustering of myeloproliferative neoplasms. As we observed an increased frequency of malignant disorders in patients with familial myeloproliferative neoplasms, we hypothesize that the germline genetic lesions that underlie familial clustering of myeloproliferative neoplasms predispose to somatic mutagenesis that is not restricted to myeloid hematopoietic cells but cause an increase in overall carcinogenesis. PMID:21173100

  18. Prevalence of deleterious ATM germline mutations in gastric cancer patients.

    PubMed

    Huang, Dong-Sheng; Tao, Hou-Quan; He, Xu-Jun; Long, Ming; Yu, Sheng; Xia, Ying-Jie; Wei, Zhang; Xiong, Zikai; Jones, Sian; He, Yiping; Yan, Hai; Wang, Xiaoyue

    2015-12-01

    Besides CDH1, few hereditary gastric cancer predisposition genes have been previously reported. In this study, we discovered two germline ATM mutations (p.Y1203fs and p.N1223S) in a Chinese family with a history of gastric cancer by screening 83 cancer susceptibility genes. Using a published exome sequencing dataset, we found deleterious germline mutations of ATM in 2.7% of 335 gastric cancer patients of different ethnic origins. The frequency of deleterious ATM mutations in gastric cancer patients is significantly higher than that in general population (p=0.0000435), suggesting an association of ATM mutations with gastric cancer predisposition. We also observed biallelic inactivation of ATM in tumors of two gastric cancer patients. Further evaluation of ATM mutations in hereditary gastric cancer will facilitate genetic testing and risk assessment.

  19. Mitochondrial DNA sequence variation in human evolution and disease.

    PubMed

    Wallace, D C

    1994-09-13

    Germ-line and somatic mtDNA mutations are hypothesized to act together to shape our history and our health. Germ-line mtDNA mutations, both ancient and recent, have been associated with a variety of degenerative diseases. Mildly to moderately deleterious germ-line mutations, like neutral polymorphisms, have become established in the distant past through genetic drift but now may predispose certain individuals to late-onset degenerative diseases. As an example, a homoplasmic, Caucasian, tRNA(Gln) mutation at nucleotide pair (np) 4336 has been observed in 5% of Alzheimer disease and Parkinson disease patients and may contribute to the multifactorial etiology of these diseases. Moderately to severely deleterious germ-line mutations, on the other hand, appear repeatedly but are eliminated by selection. Hence, all extant mutations of this class are recent and associated with more devastating diseases of young adults and children. Representative of these mutations is a heteroplasmic mutation in MTND6 at np 14459 whose clinical presentations range from adult-onset blindness to pediatric dystonia and basal ganglial degeneration. To the inherited mutations are added somatic mtDNA mutations which accumulate in random arrays within stable tissues. These mutations provide a molecular clock that measures our age and may cause a progressive decline in tissue energy output that could precipitate the onset of degenerative diseases in individuals harboring inherited deleterious mutations.

  20. Genetics and phenomics of inherited and sporadic non-autoimmune hyperthyroidism.

    PubMed

    Gozu, Hulya Iliksu; Lublinghoff, Julia; Bircan, Rifat; Paschke, Ralf

    2010-06-30

    TSH receptor (TSHR) germline mutations occur as activating mutations in familial non-autoimmune hyperthyroidism (FNAH) or sporadic non-autoimmune hyperthyroidism (SNAH). Up to date 17 constitutively activating TSHR mutations have been reported in 24 families with FNAH. The diagnosis of FNAH should be considered in cases with a positive family history, early onset of hyperthyroidism, goiter, absence of clinical stigmata of autoimmunity and recurrent hyperthyroidism. Moreover, 14 subjects with sporadic non-autoimmune hyperthyroidism and 10 different TSH receptor germline mutations have been reported. The main characteristic of SNAH is a negative family history. Additional consequences of prolonged neonatal hyperthyroidism (mental retardation, speech disturbances and craniosynostosis) have often been reported in SNAH. No genotype-phenotype relationship has been reported in patients with germline TSHR mutations. There is no association of in vitro activities determined by linear regression analysis (LRA) and several clinical indicators of hyperthyroidism activity for SNAH. However, the comparison of the LRA values of sporadic TSHR mutations with LRA values of familial TSHR mutations does show a significantly higher median LRA value for sporadic as compared to familial autosomal dominant hyperthyroidism. This finding is in line with the clinical impression of a more active clinical course in patients with SNAH. However, additional genetic, constitutional or environmental factors are most likely responsible for the phenotypic variations of the disease and the lack of correlation between in vitro activities of the TSHR mutations and the severity of hyperthyroidism. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  1. Germline mutations in 40 cancer susceptibility genes among Chinese patients with high hereditary risk breast cancer.

    PubMed

    Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun

    2018-05-12

    Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.

  2. Genomic analysis and clinical management of adolescent cutaneous melanoma.

    PubMed

    Rabbie, Roy; Rashid, Mamunur; Arance, Ana M; Sánchez, Marcelo; Tell-Marti, Gemma; Potrony, Miriam; Conill, Carles; van Doorn, Remco; Dentro, Stefan; Gruis, Nelleke A; Corrie, Pippa; Iyer, Vivek; Robles-Espinoza, Carla Daniela; Puig-Butille, Joan A; Puig, Susana; Adams, David J

    2017-05-01

    Melanoma in young children is rare; however, its incidence in adolescents and young adults is rising. We describe the clinical course of a 15-year-old female diagnosed with AJCC stage IB non-ulcerated primary melanoma, who died from metastatic disease 4 years after diagnosis despite three lines of modern systemic therapy. We also present the complete genomic profile of her tumour and compare this to a further series of 13 adolescent melanomas and 275 adult cutaneous melanomas. A somatic BRAF V 600E mutation and a high mutational load equivalent to that found in adult melanoma and composed primarily of C>T mutations were observed. A germline genomic analysis alongside a series of 23 children and adolescents with melanoma revealed no mutations in known germline melanoma-predisposing genes. Adolescent melanomas appear to have genomes that are as complex as those arising in adulthood and their clinical course can, as with adults, be unpredictable. © 2017 The Authors. Pigment Cell & Melanoma Research published by John Wiley & Sons Ltd.

  3. Comprehensive Mutation Analysis of PMS2 in a Large Cohort of Probands Suspected of Lynch Syndrome or Constitutional Mismatch Repair Deficiency Syndrome.

    PubMed

    van der Klift, Heleen M; Mensenkamp, Arjen R; Drost, Mark; Bik, Elsa C; Vos, Yvonne J; Gille, Hans J J P; Redeker, Bert E J W; Tiersma, Yvonne; Zonneveld, José B M; García, Encarna Gómez; Letteboer, Tom G W; Olderode-Berends, Maran J W; van Hest, Liselotte P; van Os, Theo A; Verhoef, Senno; Wagner, Anja; van Asperen, Christi J; Ten Broeke, Sanne W; Hes, Frederik J; de Wind, Niels; Nielsen, Maartje; Devilee, Peter; Ligtenberg, Marjolijn J L; Wijnen, Juul T; Tops, Carli M J

    2016-11-01

    Monoallelic PMS2 germline mutations cause 5%-15% of Lynch syndrome, a midlife cancer predisposition, whereas biallelic PMS2 mutations cause approximately 60% of constitutional mismatch repair deficiency (CMMRD), a rare childhood cancer syndrome. Recently improved DNA- and RNA-based strategies are applied to overcome problematic PMS2 mutation analysis due to the presence of pseudogenes and frequent gene conversion events. Here, we determined PMS2 mutation detection yield and mutation spectrum in a nationwide cohort of 396 probands. Furthermore, we studied concordance between tumor IHC/MSI (immunohistochemistry/microsatellite instability) profile and mutation carrier state. Overall, we found 52 different pathogenic PMS2 variants explaining 121 Lynch syndrome and nine CMMRD patients. In vitro mismatch repair assays suggested pathogenicity for three missense variants. Ninety-one PMS2 mutation carriers (70%) showed isolated loss of PMS2 in their tumors, for 31 (24%) no or inconclusive IHC was available, and eight carriers (6%) showed discordant IHC (presence of PMS2 or loss of both MLH1 and PMS2). Ten cases with isolated PMS2 loss (10%; 10/97) harbored MLH1 mutations. We confirmed that recently improved mutation analysis provides a high yield of PMS2 mutations in patients with isolated loss of PMS2 expression. Application of universal tumor prescreening methods will however miss some PMS2 germline mutation carriers. © 2016 WILEY PERIODICALS, INC.

  4. Germline mutations and somatic inactivation of TRIM28 in Wilms tumour

    PubMed Central

    Halliday, Benjamin J.; Markie, David M.; Grundy, Richard G.; Ludgate, Jackie L.; Black, Michael A.; Weeks, Robert J.; Catchpoole, Daniel R.; Reeve, Anthony E.

    2018-01-01

    Wilms tumour is a childhood tumour that arises as a consequence of somatic and rare germline mutations, the characterisation of which has refined our understanding of nephrogenesis and carcinogenesis. Here we report that germline loss of function mutations in TRIM28 predispose children to Wilms tumour. Loss of function of this transcriptional co-repressor, which has a role in nephrogenesis, has not previously been associated with cancer. Inactivation of TRIM28, either germline or somatic, occurred through inactivating mutations, loss of heterozygosity or epigenetic silencing. TRIM28-mutated tumours had a monomorphic epithelial histology that is uncommon for Wilms tumour. Critically, these tumours were negative for TRIM28 immunohistochemical staining whereas the epithelial component in normal tissue and other Wilms tumours stained positively. These data, together with a characteristic gene expression profile, suggest that inactivation of TRIM28 provides the molecular basis for defining a previously described subtype of Wilms tumour, that has early age of onset and excellent prognosis. PMID:29912901

  5. High incidence of large deletions in the PMS2 gene in Spanish Lynch syndrome families.

    PubMed

    Brea-Fernández, A J; Cameselle-Teijeiro, J M; Alenda, C; Fernández-Rozadilla, C; Cubiella, J; Clofent, J; Reñé, J M; Anido, U; Milá, M; Balaguer, F; Castells, A; Castellvi-Bel, S; Jover, R; Carracedo, A; Ruiz-Ponte, C

    2014-06-01

    Lynch syndrome (LS) is caused by germline mutations in one of the four mismatch repair (MMR) genes. Defects in this pathway lead to microsatellite instability (MSI) in DNA tumors, which constitutes the molecular hallmark of this disease. Selection of patients for genetic testing in LS is usually based on fulfillment of diagnostic clinical criteria (i.e. Amsterdam criteria or the revised Bethesda guidelines). However, following these criteria PMS2 mutations have probably been underestimated as their penetrances appear to be lower than those of the other MMR genes. The use of universal MMR study-based strategies, using MSI testing and immunohistochemical (IHC) staining, is being one proposed alternative. Besides, germline mutation detection in PMS2 is complicated by the presence of highly homologous pseudogenes. Nevertheless, specific amplification of PMS2 by long-range polymerase chain reaction (PCR) and the improvement of the analysis of large deletions/duplications by multiplex ligation-dependent probe amplification (MLPA) overcome this difficulty. By using both approaches, we analyzed 19 PMS2-suspected carriers who have been selected by clinical or universal strategies and found five large deletions and one frameshift mutation in PMS2 in six patients (31%). Owing to the high incidence of large deletions found in our cohort, we recommend MLPA analysis as the first-line method for searching germline mutations in PMS2. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. A novel germline POLE mutation causes an early onset cancer prone syndrome mimicking constitutional mismatch repair deficiency.

    PubMed

    Wimmer, Katharina; Beilken, Andreas; Nustede, Rainer; Ripperger, Tim; Lamottke, Britta; Ure, Benno; Steinmann, Diana; Reineke-Plaass, Tanja; Lehmann, Ulrich; Zschocke, Johannes; Valle, Laura; Fauth, Christine; Kratz, Christian P

    2017-01-01

    In a 14-year-old boy with polyposis and rectosigmoid carcinoma, we identified a novel POLE germline mutation, p.(Val411Leu), previously found as recurrent somatic mutation in 'ultramutated' sporadic cancers. This is the youngest reported cancer patient with polymerase proofreading-associated polyposis indicating that POLE mutation p.(Val411Leu) may confer a more severe phenotype than previously reported POLE and POLD1 germline mutations. The patient had multiple café-au-lait macules and a pilomatricoma mimicking the clinical phenotype of constitutional mismatch repair deficiency. We hypothesize that these skin features may be common to different types of constitutional DNA repair defects associated with polyposis and early-onset cancer.

  7. Identification of Grandchildless Loci Whose Products Are Required for Normal Germ-Line Development in the Nematode Caenorhabditis Elegans

    PubMed Central

    Capowski, E. E.; Martin, P.; Garvin, C.; Strome, S.

    1991-01-01

    To identify genes that encode maternal components required for development of the germ line in the nematode Caenorhabditis elegans, we have screened for mutations that confer a maternal-effect sterile or ``grandchildless'' phenotype: homozygous mutant hermaphrodites produced by heterozygous mothers are themselves fertile, but produce sterile progeny. Our screens have identified six loci, defined by 21 mutations. This paper presents genetic and phenotypic characterization of four of the loci. The majority of mutations, those in mes-2, mes-3 and mes-4, affect postembryonic germ-line development; the progeny of mutant mothers undergo apparently normal embryogenesis but develop into agametic adults with 10-1000-fold reductions in number of germ cells. In contrast, mutations in mes-1 cause defects in cytoplasmic partitioning during embryogenesis, and the resulting larvae lack germ-line progenitor cells. Mutations in all of the mes loci primarily affect the germ line, and none disrupt the structural integrity of germ granules. This is in contrast to grandchildless mutations in Drosophila melanogaster, all of which disrupt germ granules and affect abdominal as well as germ-line development. PMID:1783292

  8. Single genome retrieval of context-dependent variability in mutation rates for human germline.

    PubMed

    Sahakyan, Aleksandr B; Balasubramanian, Shankar

    2017-01-13

    Accurate knowledge of the core components of substitution rates is of vital importance to understand genome evolution and dynamics. By performing a single-genome and direct analysis of 39,894 retrotransposon remnants, we reveal sequence context-dependent germline nucleotide substitution rates for the human genome. The rates are characterised through rate constants in a time-domain, and are made available through a dedicated program (Trek) and a stand-alone database. Due to the nature of the method design and the imposed stringency criteria, we expect our rate constants to be good estimates for the rates of spontaneous mutations. Benefiting from such data, we study the short-range nucleotide (up to 7-mer) organisation and the germline basal substitution propensity (BSP) profile of the human genome; characterise novel, CpG-independent, substitution prone and resistant motifs; confirm a decreased tendency of moieties with low BSP to undergo somatic mutations in a number of cancer types; and, produce a Trek-based estimate of the overall mutation rate in human. The extended set of rate constants we report may enrich our resources and help advance our understanding of genome dynamics and evolution, with possible implications for the role of spontaneous mutations in the emergence of pathological genotypes and neutral evolution of proteomes.

  9. Germline MLH1, MSH2 and MSH6 variants in Brazilian patients with colorectal cancer and clinical features suggestive of Lynch Syndrome.

    PubMed

    Schneider, Nayê Balzan; Pastor, Tatiane; Paula, André Escremim de; Achatz, Maria Isabel; Santos, Ândrea Ribeiro Dos; Vianna, Fernanda Sales Luiz; Rosset, Clévia; Pinheiro, Manuela; Ashton-Prolla, Patricia; Moreira, Miguel Ângelo Martins; Palmero, Edenir Inêz

    2018-05-01

    Lynch syndrome (LS) is the most common hereditary colorectal cancer syndrome, caused by germline mutations in one of the major genes involved in mismatch repair (MMR): MLH1, MSH2, MSH6 and more rarely, PMS2. Recently, germline deletions in EPCAM have been also associated to the syndrome. Most of the pathogenic MMR mutations found in LS families occur in MLH1 or MSH2. Gene variants include missense, nonsense, frameshift mutations, large genomic rearrangements and splice-site variants and most of the studies reporting the molecular characterization of LS families have been conducted outside South America. In this study, we analyzed 60 unrelated probands diagnosed with colorectal cancer and LS criteria. Testing for germline mutations and/or rearrangements in the most commonly affected MMR genes (MLH1, MSH2, EPCAM and MSH6) was done by Sanger sequencing and MLPA. Pathogenic or likely pathogenic variants were identified in MLH1 or MSH2 in 21 probands (35.0%). Of these, approximately one-third were gene rearrangements. In addition, nine variants of uncertain significance (VUS) were identified in 10 (16.6%) of the sixty probands analyzed. Other four novel variants were identified, only in MLH1. Our results suggest that MSH6 pathogenic variants are not common among Brazilian LS probands diagnosed with CRC and that MMR gene rearrangements account for a significant proportion of the germline variants in this population underscoring the need to include rearrangement analysis in the molecular testing of Brazilian individuals with suspected Lynch syndrome. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  10. Germline mutations in the spindle assembly checkpoint genes BUB1 and BUB3 are infrequent in familial colorectal cancer and polyposis.

    PubMed

    Mur, Pilar; De Voer, Richarda M; Olivera-Salguero, Rubén; Rodríguez-Perales, Sandra; Pons, Tirso; Setién, Fernando; Aiza, Gemma; Valdés-Mas, Rafael; Bertini, Angelo; Pineda, Marta; Vreede, Lilian; Navarro, Matilde; Iglesias, Silvia; González, Sara; Brunet, Joan; Valencia, Alfonso; Esteller, Manel; Lázaro, Conxi; Kops, Geert J P L; Urioste, Miguel; Puente, Xose S; Capellá, Gabriel; Valle, Laura

    2018-02-15

    Germline mutations in BUB1 and BUB3 have been reported to increase the risk of developing colorectal cancer (CRC) at young age, in presence of variegated aneuploidy and reminiscent dysmorphic traits of mosaic variegated aneuploidy syndrome. We performed a mutational analysis of BUB1 and BUB3 in 456 uncharacterized mismatch repair-proficient hereditary non-polyposis CRC families and 88 polyposis cases. Four novel or rare germline variants, one splice-site and three missense, were identified in four families. Neither variegated aneuploidy nor dysmorphic traits were observed in carriers. Evident functional effects in the heterozygous form were observed for c.1965-1G>A, but not for c.2296G>A (p.E766K), in spite of the positive co-segregation in the family. BUB1 c.2473C>T (p.P825S) and BUB3 c.77C>T (p.T26I) remained as variants of uncertain significance. As of today, the rarity of functionally relevant mutations identified in familial and/or early onset series does not support the inclusion of BUB1 and BUB3 testing in routine genetic diagnostics of familial CRC.

  11. Multiple endocrine neoplasia type 1 (MEN1): An update of 208 new germline variants reported in the last nine years.

    PubMed

    Concolino, Paola; Costella, Alessandra; Capoluongo, Ettore

    2016-01-01

    This review will focus on the germline MEN1 mutations that have been reported in patients with MEN1 and other hereditary endocrine disorders from 2007 to September 2015. A comprehensive review regarding the analysis of 1336 MEN1 mutations reported in the first decade following the gene's identification was performed by Lemos and Thakker in 2008. No other similar papers are available in literature apart from these data. We also checked for the list of Locus-Specific DataBases (LSDBs) and we found five MEN1 free-online mutational databases. 151 articles from the NCBI PubMed literature database were read and evaluated and a total of 75 MEN1 variants were found. On the contrary, 67, 22 and 44 novel MEN1 variants were obtained from ClinVar, MEN1 at Café Variome and HGMD (The Human Gene Mutation Database) databases respectively. A final careful analysis of MEN1 mutations affecting the coding region was performed. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. ExScalibur: A High-Performance Cloud-Enabled Suite for Whole Exome Germline and Somatic Mutation Identification.

    PubMed

    Bao, Riyue; Hernandez, Kyle; Huang, Lei; Kang, Wenjun; Bartom, Elizabeth; Onel, Kenan; Volchenboum, Samuel; Andrade, Jorge

    2015-01-01

    Whole exome sequencing has facilitated the discovery of causal genetic variants associated with human diseases at deep coverage and low cost. In particular, the detection of somatic mutations from tumor/normal pairs has provided insights into the cancer genome. Although there is an abundance of publicly-available software for the detection of germline and somatic variants, concordance is generally limited among variant callers and alignment algorithms. Successful integration of variants detected by multiple methods requires in-depth knowledge of the software, access to high-performance computing resources, and advanced programming techniques. We present ExScalibur, a set of fully automated, highly scalable and modulated pipelines for whole exome data analysis. The suite integrates multiple alignment and variant calling algorithms for the accurate detection of germline and somatic mutations with close to 99% sensitivity and specificity. ExScalibur implements streamlined execution of analytical modules, real-time monitoring of pipeline progress, robust handling of errors and intuitive documentation that allows for increased reproducibility and sharing of results and workflows. It runs on local computers, high-performance computing clusters and cloud environments. In addition, we provide a data analysis report utility to facilitate visualization of the results that offers interactive exploration of quality control files, read alignment and variant calls, assisting downstream customization of potential disease-causing mutations. ExScalibur is open-source and is also available as a public image on Amazon cloud.

  13. Mutation spectrum of RB1 mutations in retinoblastoma cases from Singapore with implications for genetic management and counselling

    PubMed Central

    Tomar, Swati; Sethi, Raman; Sundar, Gangadhara; Quah, Thuan Chong; Quah, Boon Long; Lai, Poh San

    2017-01-01

    Retinoblastoma (RB) is a rare childhood malignant disorder caused by the biallelic inactivation of RB1 gene. Early diagnosis and identification of carriers of heritable RB1 mutations can improve disease outcome and management. In this study, mutational analysis was conducted on fifty-nine matched tumor and peripheral blood samples from 18 bilateral and 41 unilateral unrelated RB cases by a combinatorial approach of Multiplex Ligation-dependent Probe Amplification (MLPA) assay, deletion screening, direct sequencing, copy number gene dosage analysis and methylation assays. Screening of both blood and tumor samples yielded a mutation detection rate of 94.9% (56/59) while only 42.4% (25/59) of mutations were detected if blood samples alone were analyzed. Biallelic mutations were observed in 43/59 (72.9%) of tumors screened. There were 3 cases (5.1%) in which no mutations could be detected and germline mutations were detected in 19.5% (8/41) of unilateral cases. A total of 61 point mutations were identified, of which 10 were novel. There was a high incidence of previously reported recurrent mutations, occurring at 38.98% (23/59) of all cases. Of interest were three cases of mosaic RB1 mutations detected in the blood from patients with unilateral retinoblastoma. Additionally, two germline mutations previously reported to be associated with low-penetrance phenotypes: missense-c.1981C>T and splice variant-c.607+1G>T, were observed in a bilateral and a unilateral proband, respectively. These findings have implications for genetic counselling and risk prediction for the affected families. This is the first published report on the spectrum of mutations in RB patients from Singapore and shows that further improved mutation screening strategies are required in order to provide a definitive molecular diagnosis for every case of RB. Our findings also underscore the importance of genetic testing in supporting individualized disease management plans for patients and asymptomatic family members carrying low-penetrance, germline mosaicism or heritable unilateral mutational phenotypes. PMID:28575107

  14. BRCA1, TP53, and CHEK2 germline mutations in uterine serous carcinoma.

    PubMed

    Pennington, Kathryn P; Walsh, Tom; Lee, Ming; Pennil, Christopher; Novetsky, Akiva P; Agnew, Kathy J; Thornton, Anne; Garcia, Rochelle; Mutch, David; King, Mary-Claire; Goodfellow, Paul; Swisher, Elizabeth M

    2013-01-15

    Uterine serous carcinoma (USC) is not recognized as part of any defined hereditary cancer syndrome, and its association with hereditary breast and ovarian carcinoma and Lynch syndrome are uncertain. Using targeted capture and massively parallel genomic sequencing, 151 subjects with USC were assessed for germline mutations in 30 tumor suppressor genes, including BRCA1 (breast cancer 1, early onset), BRCA2, the DNA mismatch repair genes (MLH1 [mutL homolog 1], MSH2 [mutS homolog 2], MSH6, PMS2 [postmeiotic segregation increased 2]), TP53 (tumor protein p53), and 10 other genes in the Fanconi anemia-BRCA pathway. Ten cases with < 10% serous histology were also assessed. Seven subjects (4.6%) carried germline loss-of-function mutations: 3 subjects (2.0%) with mutations in BRCA1, 2 subjects (1.3%) with mutations in TP53, and 2 subjects (1.3%) with mutations in CHEK2 (checkpoint kinase 2). One subject with < 10% serous histology had an MSH6 mutation. Subjects with MSH6 and TP53 mutations had neither personal nor family histories suggestive of Lynch or Li-Fraumeni syndromes. Of the 22 women with USC and a personal history of breast carcinoma, the frequency of BRCA1 mutations was 9%, compared to 0.9% in 119 women with no such history. Approximately 5% of women with USC have germline mutations in 3 different tumor suppressor genes: BRCA1, CHEK2, and TP53. Mutations in DNA mismatch repair genes that cause Lynch syndrome are rare in USC. The germline BRCA1 mutation rate in USC subjects of 2% is higher than expected in a nonfounder population, suggesting that USC is associated with hereditary breast and ovarian carcinoma in a small proportion of cases. Women with USC and breast cancer should be offered genetic testing for BRCA1 and BRCA2 mutations. Copyright © 2012 American Cancer Society.

  15. Expression and functional analysis of menin in a multiple endocrine neoplasia type 1 (MEN1) patient with somatic loss of heterozygosity in chromosome 11q13 and unidentified germline mutation of the MEN1 gene.

    PubMed

    Naito, Junko; Kaji, Hiroshi; Sowa, Hideaki; Kitazawa, Riko; Kitazawa, Sohei; Tsukada, Toshihiko; Hendy, Geoffrey N; Sugimoto, Toshitsugu; Chihara, Kazuo

    2006-06-01

    In some patients with multiple endocrine neoplasia type 1 (MEN1) it is not possible to identify a germline mutation in the MEN1 gene. We sought to document the loss of expression and function of the MEN1 gene product, menin, in the tumors of such a patient. The proband is an elderly female patient with primary hyperparathyroidism, pancreatic islet tumor, and breast cancer. Her son has primary hyperparathyroidism. No germline MEN1 mutation was identified in the proband or her son. However, loss of heterozygosity at the MEN1 locus and complete lack of menin expression were demonstrated in the proband's tumor tissue. The proband's cultured parathyroid cells lacked the normal reduction in proliferation and parathyroid hormone secretion in response to transforming growth factor- beta. This assessment provided insight into the molecular pathogenesis of the patient and provides evidence for a critical requirement for menin in the antiproliferative action of transforming growth factor-beta.

  16. Tumour risks and genotype-phenotype correlations associated with germline variants in succinate dehydrogenase subunit genes SDHB, SDHC and SDHD.

    PubMed

    Andrews, Katrina A; Ascher, David B; Pires, Douglas Eduardo Valente; Barnes, Daniel R; Vialard, Lindsey; Casey, Ruth T; Bradshaw, Nicola; Adlard, Julian; Aylwin, Simon; Brennan, Paul; Brewer, Carole; Cole, Trevor; Cook, Jackie A; Davidson, Rosemarie; Donaldson, Alan; Fryer, Alan; Greenhalgh, Lynn; Hodgson, Shirley V; Irving, Richard; Lalloo, Fiona; McConachie, Michelle; McConnell, Vivienne P M; Morrison, Patrick J; Murday, Victoria; Park, Soo-Mi; Simpson, Helen L; Snape, Katie; Stewart, Susan; Tomkins, Susan E; Wallis, Yvonne; Izatt, Louise; Goudie, David; Lindsay, Robert S; Perry, Colin G; Woodward, Emma R; Antoniou, Antonis C; Maher, Eamonn R

    2018-06-01

    Germline pathogenic variants in SDHB/SDHC / SDHD are the most frequent causes of inherited phaeochromocytomas/paragangliomas. Insufficient information regarding penetrance and phenotypic variability hinders optimum management of mutation carriers. We estimate penetrance for symptomatic tumours and elucidate genotype-phenotype correlations in a large cohort of SDHB/SDHC / SDHD mutation carriers. A retrospective survey of 1832 individuals referred for genetic testing due to a personal or family history of phaeochromocytoma/paraganglioma. 876 patients (401 previously reported) had a germline mutation in SDHB/SDHC / SDHD (n=673/43/160). Tumour risks were correlated with in silico structural prediction analyses. Tumour risks analysis provided novel penetrance estimates and genotype-phenotype correlations. In addition to tumour type susceptibility differences for individual genes, we confirmed that the SDHD: p.Pro81Leu mutation has a distinct phenotype and identified increased age-related tumour risks with highly destabilising SDHB missense mutations. By Kaplan-Meier analysis, the penetrance (cumulative risk of clinically apparent tumours) in SDHB and (paternally inherited) SDHD mutation-positive non-probands (n=371/67 with detailed clinical information) by age 60 years was 21.8% (95% CI 15.2% to 27.9%) and 43.2% (95% CI 25.4% to 56.7%), respectively. Risk of malignant disease at age 60 years in non-proband SDHB mutation carriers was 4.2%(95% CI 1.1% to 7.2%). With retrospective cohort analysis to adjust for ascertainment, cumulative tumour risks for SDHB mutation carriers at ages 60 years and 80 years were 23.9% (95% CI 20.9% to 27.4%) and 30.6% (95% CI 26.8% to 34.7%). Overall risks of clinically apparent tumours for SDHB mutation carriers are substantially lower than initially estimated and will improve counselling of affected families. Specific genotype-tumour risk associations provides a basis for novel investigative strategies into succinate dehydrogenase-related mechanisms of tumourigenesis and the development of personalised management for SDHB/SDHC / SDHD mutation carriers. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  17. Tumor testing to identify lynch syndrome in two Australian colorectal cancer cohorts.

    PubMed

    Buchanan, Daniel D; Clendenning, Mark; Rosty, Christophe; Eriksen, Stine V; Walsh, Michael D; Walters, Rhiannon J; Thibodeau, Stephen N; Stewart, Jenna; Preston, Susan; Win, Aung Ko; Flander, Louisa; Ouakrim, Driss Ait; Macrae, Finlay A; Boussioutas, Alex; Winship, Ingrid M; Giles, Graham G; Hopper, John L; Southey, Melissa C; English, Dallas; Jenkins, Mark A

    2017-02-01

    Tumor testing of colorectal cancers (CRC) for mismatch repair (MMR) deficiency is an effective approach to identify carriers of germline MMR gene mutation (Lynch syndrome). The aim of this study was to identify MMR gene mutation carriers in two cohorts of population-based CRC utilizing a combination of tumor and germline testing approaches. Colorectal cancers from 813 patients diagnosed with CRC < 60 years of age from the Australasian Colorectal Cancer Family Registry (ACCFR) and from 826 patients from the Melbourne Collaborative Cohort Study (MCCS) were tested for MMR protein expression using immunohistochemistry, microsatellite instability (MSI), BRAF V600E somatic mutation, and for MLH1 methylation. MMR gene mutation testing (Sanger sequencing and Multiplex Ligation Dependent Probe Amplification) was performed on germline DNA of patients with MMR-deficient tumors and a subset of MMR-proficient CRCs. Of the 813 ACCFR probands, 90 probands demonstrated tumor MMR deficiency (11.1%), and 42 had a MMR gene germline mutation (5.2%). For the MCCS, MMR deficiency was identified in the tumors of 103 probands (12.5%) and seven had a germline mutation (0.8%). All the mutation carriers were diagnosed prior to 70 years of age. Probands with a MMR-deficient CRC without MLH1 methylation and a gene mutation were considered Lynch-like and comprised 41.1% and 25.2% of the MMR-deficient CRCs for the ACCFR and MCCS, respectively. Identification of MMR gene mutation carriers in Australian CRC-affected patients is optimized by immunohistochemistry screening of CRC diagnosed before 70 years of age. A significant proportion of MMR-deficient CRCs will have unknown etiology (Lynch-like) proving problematic for clinical management. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  18. Tumour testing to identify Lynch syndrome in two Australian colorectal cancer cohorts

    PubMed Central

    Eriksen, Stine V.; Walsh, Michael D.; Walters, Rhiannon J.; Thibodeau, Stephen N.; Stewart, Jenna; Preston, Susan; Win, Aung Ko; Flander, Louisa; Ouakrim, Driss Ait; Macrae, Finlay A.; Boussioutas, Alex; Winship, Ingrid M.; Giles, Graham G.; Hopper, John L.; Southey, Melissa C.

    2016-01-01

    Background and Aim Tumour testing of colorectal cancers (CRC) for mismatch repair (MMR) deficiency is an effective approach to identify carriers of germline MMR gene mutation (Lynch syndrome). The aim of this study was to identify MMR gene mutation carriers in two cohorts of population-based CRC utilising a combination of tumour and germline testing approaches. Methods CRCs from 813 patients diagnosed with CRC <60 years of age from the Australasian Colorectal Cancer Family Registry (ACCFR) and from 826 patients from the Melbourne Collaborative Cohort Study (MCCS) were tested for MMR protein expression using immunohistochemistry (IHC), microsatellite instability (MSI), BRAFV600E somatic mutation and for MLH1 methylation. MMR gene mutation testing (Sanger sequencing and MLPA) was performed on germline DNA of patients with MMR-deficient tumours and a subset of MMR-proficient CRCs. Results Of the 813 ACCFR probands, 90 probands demonstrated tumour MMR-deficiency (11.1%) and 42 had a MMR gene germline mutation (5.2%). For the MCCS, MMR-deficiency was identified in the tumours of 103 probands (12.5%) and 7 had a germline mutation (0.8%). All the mutation carriers were diagnosed prior to 70 years of age. Probands with a MMR-deficient CRC without MLH1 methylation and a gene mutation were considered Lynch-like and comprised 41.1% and 22.3% of the MMR-deficient CRCs for the ACCFR and MCCS, respectively. Conclusions Identification of MMR gene mutation carriers in Australian CRC-affected patients is optimised by IHC screening of CRC diagnosed before 70 years. A significant proportion of MMR-deficient CRCs will have unknown aetiology (Lynch-like) proving problematic for clinical management. PMID:27273229

  19. Novel mutations and phenotypic associations identified through APC, MUTYH, NTHL1, POLD1, POLE gene analysis in Indian Familial Adenomatous Polyposis cohort.

    PubMed

    Khan, Nikhat; Lipsa, Anuja; Arunachal, Gautham; Ramadwar, Mukta; Sarin, Rajiv

    2017-05-22

    Colo-Rectal Cancer is a common cancer worldwide with 5-10% cases being hereditary. Familial Adenomatous Polyposis (FAP) syndrome is due to germline mutations in the APC or rarely MUTYH gene. NTHL1, POLD1, POLE have been recently reported in previously unexplained FAP cases. Unlike the Caucasian population, FAP phenotype and its genotypic associations have not been widely studied in several geoethnic groups. We report the first FAP cohort from South Asia and the only non-Caucasian cohort with comprehensive analysis of APC, MUTYH, NTHL1, POLD1, POLE genes. In this cohort of 112 individuals from 53 FAP families, we detected germline APC mutations in 60 individuals (45 families) and biallelic MUTYH mutations in 4 individuals (2 families). No NTHL1, POLD1, POLE mutations were identified. Fifteen novel APC mutations and a new Indian APC mutational hotspot at codon 935 were identified. Eight very rare FAP phenotype or phenotypes rarely associated with mutations outside specific APC regions were observed. APC genotype-phenotype association studies in different geo-ethnic groups can enrich the existing knowledge about phenotypic consequences of distinct APC mutations and guide counseling and risk management in different populations. A stepwise cost-effective mutation screening approach is proposed for genetic testing of south Asian FAP patients.

  20. CDH1 mutations in gastric cancer patients from northern Brazil identified by Next- Generation Sequencing (NGS)

    PubMed Central

    El-Husny, Antonette; Raiol-Moraes, Milene; Amador, Marcos; Ribeiro-dos-Santos, André M.; Montagnini, André; Barbosa, Silvanira; Silva, Artur; Assumpção, Paulo; Ishak, Geraldo; Santos, Sidney; Pinto, Pablo; Cruz, Aline; Ribeiro-dos-Santos, Ândrea

    2016-01-01

    Abstract Gastric cancer is considered to be the fifth highest incident tumor worldwide and the third leading cause of cancer deaths. Developing regions report a higher number of sporadic cases, but there are only a few local studies related to hereditary cases of gastric cancer in Brazil to confirm this fact. CDH1 germline mutations have been described both in familial and sporadic cases, but there is only one recent molecular description of individuals from Brazil. In this study we performed Next Generation Sequencing (NGS) to assess CDH1 germline mutations in individuals who match the clinical criteria for Hereditary Diffuse Gastric Cancer (HDGC), or who exhibit very early diagnosis of gastric cancer. Among five probands we detected CDH1 germline mutations in two cases (40%). The mutation c.1023T > G was found in a HDGC family and the mutation c.1849G > A, which is nearly exclusive to African populations, was found in an early-onset case of gastric adenocarcinoma. The mutations described highlight the existence of gastric cancer cases caused by CDH1 germline mutations in northern Brazil, although such information is frequently ignored due to the existence of a large number of environmental factors locally. Our report represent the first CDH1 mutations in HDGC described from Brazil by an NGS platform. PMID:27192129

  1. Preleukemic and second-hit mutational events in an acute myeloid leukemia patient with a novel germline RUNX1 mutation.

    PubMed

    Ng, Isaac Ks; Lee, Joanne; Ng, Christopher; Kosmo, Bustamin; Chiu, Lily; Seah, Elaine; Mok, Michelle Meng Huang; Tan, Karen; Osato, Motomi; Chng, Wee-Joo; Yan, Benedict; Tan, Lip Kun

    2018-01-01

    Germline mutations in the RUNX1 transcription factor give rise to a rare autosomal dominant genetic condition classified under the entity: Familial Platelet Disorders with predisposition to Acute Myeloid Leukaemia (FPD/AML). While several studies have identified a myriad of germline RUNX1 mutations implicated in this disorder, second-hit mutational events are necessary for patients with hereditary thrombocytopenia to develop full-blown AML. The molecular picture behind this process remains unclear. We describe a patient of Malay descent with an unreported 7-bp germline RUNX1 frameshift deletion, who developed second-hit mutations that could have brought about the leukaemic transformation from a pre-leukaemic state. These mutations were charted through the course of the treatment and stem cell transplant, showing a clear correlation between her clinical presentation and the mutations present. The patient was a 27-year-old Malay woman who presented with AML on the background of hereditary thrombocytopenia affecting her father and 3 brothers. Initial molecular testing revealed the same novel RUNX1 mutation in all 5 individuals. The patient received standard induction, consolidation chemotherapy, and a haploidentical stem cell transplant from her mother with normal RUNX1 profile. Comprehensive genomic analyses were performed at diagnosis, post-chemotherapy and post-transplant. A total of 8 mutations ( RUNX1 , GATA2 , DNMT3A , BCORL1 , BCOR , 2 PHF6 and CDKN2A ) were identified in the pre-induction sample, of which 5 remained ( RUNX1 , DNMT3A , BCORL1 , BCOR and 1 out of 2 PHF6 ) in the post-treatment sample and none were present post-transplant. In brief, the 3 mutations which were lost along with the leukemic cells at complete morphological remission were most likely acquired leukemic driver mutations that were responsible for the AML transformation from a pre-leukemic germline RUNX1 -mutated state. On the contrary, the 5 mutations that persisted post-treatment, including the germline RUNX1 mutation, were likely to be part of the preleukemic clone. Further studies are necessary to assess the prevalence of these preleukemic and secondary mutations in the larger FPD/AML patient cohort and establish their prognostic significance. Given the molecular heterogeneity of FPD/AML and other AML subtypes, a better understanding of mutational classes and their involvement in AML pathogenesis can improve risk stratification of patients for more effective and targeted therapy.

  2. Spectrum of APC and MUTYH germ-line mutations in Russian patients with colorectal malignancies.

    PubMed

    Yanus, G A; Akhapkina, T A; Ivantsov, A O; Preobrazhenskaya, E V; Aleksakhina, S N; Bizin, I V; Sokolenko, A P; Mitiushkina, N V; Kuligina, E Sh; Suspitsin, E N; Venina, A R; Holmatov, M M; Zaitseva, O A; Yatsuk, O S; Pashkov, D V; Belyaev, A M; Togo, A V; Imyanitov, E N; Iyevleva, A G

    2018-05-01

    Distribution of cancer-predisposing mutations demonstrates significant interethnic variations. This study aimed to evaluate patterns of APC and MUTYH germ-line mutations in Russian patients with colorectal malignancies. APC gene defects were identified in 26/38 (68%) subjects with colon polyposis; 8/26 (31%) APC mutations were associated with 2 known mutational hotspots (p.E1309Dfs*4 [n = 5] and p.Q1062fs* [n = 3]), while 6/26 (23%) mutations were novel (p.K73Nfs*6, p.S254Hfs*12, p.S1072Kfs*9, p.E1547Kfs*11, p.L1564X and p.C1263Wfs*22). Biallelic mutations in MUTYH gene were detected in 3/12 (25%) remaining subjects with polyposis and in 6/90 (6.7%) patients with colorectal cancer (CRC) carrying KRAS p.G12C substitution, but not in 231 early-onset CRC cases negative for KRAS p.G12C allele. In addition to known European founder alleles p.Y179C and p.G396D, this study revealed a recurrent character of MUTYH p.R245H germ-line mutation. Besides that, 3 novel pathogenic MUTYH alleles (p.L111P, p.R245S and p.Q293X) were found. Targeted next-generation sequencing of 7 APC/MUTYH mutation-negative DNA samples identified novel potentially pathogenic POLD1 variant (p.L460R) in 1 patient and known low-penetrant cancer-associated allele CHEK2 p.I157T in 3 patients. The analysis of 1120 healthy subjects revealed 15 heterozygous carriers of recurrent MUTYH mutations, thus the expected incidence of MUTYH-associated polyposis in Russia is likely to be 1:23 000. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Germline BRCA mutation in male carriers-ripe for precision oncology?

    PubMed

    Leão, Ricardo Romão Nazário; Price, Aryeh Joshua; James Hamilton, Robert

    2018-04-01

    Prostate cancer (PC) is one of the known heritable cancers with individual variations attributed to genetic factors. BRCA1 and BRCA2 are tumour suppressor genes with crucial roles in repairing DNA and thereby maintaining genomic integrity. Germline BRCA mutations predispose to multiple familial tumour types including PC. We performed a Pubmed database search along with review of reference lists from prominent articles to capture papers exploring the association between BRCA mtuations and prostate cancer risk and prognosis. Articles were retrieved until May 2017 and filtered for relevance, and publication type. We explored familial PC genetics; discussed the discovery and magnitude of the association between BRCA mutations and PC risk and outcome; examined implications of factoring BRCA mutations into PC screening; and discussed the rationale for chemoprevention in this high-risk population. We confirmed that BRCA1/2 mutations confer an up to 4.5-fold and 8.3-fold increased risk of PC, respectively. BRCA2 mutations are associated with an increased risk of high-grade disease, progression to metastatic castration-resistant disease, and 5-year cancer-specific survival rates of 50 to 60%. Despite the growing body of research on DNA repair genes, deeper analysis is needed to understand the aetiological role of germline BRCA mutations in the natural history of PC. There is a need for awareness to screen for this marker of PC risk. There is similarly an opportunity for structured PC screening programs for BRCA mutation carriers. Finally, further research is required to identify potential chemopreventive strategies for this high-risk subgroup.

  4. A novel dysfunctional germline P53 mutation identified in a family with Li-Fraumeni syndrome.

    PubMed

    Ji, Min; Wang, Lin; Shao, Yuguo; Cao, Wei; Xu, Ting; Chen, Shujie; Wang, Zhiwei; He, Qi; Yang, Kuo

    2018-01-01

    Li-Fraumeni Syndrome (LFS), which is a rare dominantly inherited cancer predisposition syndrome, is associated with germline P53 mutations. Mutations of the tumor suppressor protein P53 are associated with more than 50% of human cancers; however, almost 30% of P53 mutations occur rarely and this has raised questions about their significance. It therefore appeared of particular interest that we identified a novel mutation in a patient suffering from breast cancer and fulfilling the diagnostic criteria of LFS. In this study, a patient with remarkable family history developed breast cancer and was diagnosed with LFS. By performing next-generation sequencing on the patient and subsequent verification by Sanger sequencing among other family members, a new germ-line P53 replication error, a trinucleotide repeat mutation in the coding region, was identified in two generations of this Li-Fraumeni family.

  5. Elevated germline mutation rate in teenage fathers.

    PubMed

    Forster, Peter; Hohoff, Carsten; Dunkelmann, Bettina; Schürenkamp, Marianne; Pfeiffer, Heidi; Neuhuber, Franz; Brinkmann, Bernd

    2015-03-22

    Men age and die, while cells in their germline are programmed to be immortal. To elucidate how germ cells maintain viable DNA despite increasing parental age, we analysed DNA from 24 097 parents and their children, from Europe, the Middle East and Africa. We chose repetitive microsatellite DNA that mutates (unlike point mutations) only as a result of cellular replication, providing us with a natural 'cell-cycle counter'. We observe, as expected, that the overall mutation rate for fathers is seven times higher than for mothers. Also as expected, mothers have a low and lifelong constant DNA mutation rate. Surprisingly, however, we discover that (i) teenage fathers already set out from a much higher mutation rate than teenage mothers (potentially equivalent to 77-196 male germline cell divisions by puberty); and (ii) ageing men maintain sperm DNA quality similar to that of teenagers, presumably by using fresh batches of stem cells known as 'A-dark spermatogonia'.

  6. Screening for germline phosphatase and tensin homolog-mutations in suspected Cowden syndrome and Cowden syndrome-like families among uterine cancer patients

    PubMed Central

    TZORTZATOS, GERASIMOS; ARAVIDIS, CHRISTOS; LINDBLOM, ANNIKA; MINTS, MIRIAM; THAM, EMMA

    2015-01-01

    Cowden syndrome (CS) is an autosomal dominant disorder characterized by multiple hamartomas in the breast, thyroid and endometrium, with a prevalence of 1 per 250,000. Females with CS have a 21–28% lifetime risk of developing uterine cancer. Germline mutations in the phosphatase and tensin homolog (PTEN) gene, a tumor suppressor gene, are responsible for 30–80% of CS cases. PTEN is a nine-exon gene, located on chromosome 10q23.3, which encodes the 403 amino acid PTEN protein. It negatively regulates the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin pathway, affecting various cellular processes and signaling pathways. The present study examined whether PTEN mutations are present in CS-like families with uterine cancer (UC). UC patients underwent surgery at Karolinska University Hospital, Stockholm, Sweden (2008–2012). Pedigrees were analyzed and 54 unrelated CS-like families were identified. CS-like families were defined as having at least one occurrence of uterine cancer and one of breast cancer, as well as at least one additional Cowden-associated tumor (uterine, breast, thyroid, colon or kidney cancer) in the same individual or in first-degree relatives. Genomic DNA was amplified using polymerase chain reaction, and DNA sequencing analysis of all nine exons of the PTEN gene was conducted. No germline PTEN mutations or polymorphisms were identified. Germline PTEN mutations are rare in CS-like families with uterine cancer, therefore, genetic screening must be restricted to patients that meet the strict National Comprehensive Cancer Network criteria. Gynecologists must be aware of the CS criteria and identify potential cases of CS in females where uterine cancer is the sentinel cancer. PMID:25789042

  7. High-Resolution Array CGH Profiling Identifies Na/K Transporting ATPase Interacting 2 (NKAIN2) as a Predisposing Candidate Gene in Neuroblastoma

    PubMed Central

    Romania, Paolo; Castellano, Aurora; Surace, Cecilia; Citti, Arianna; De Ioris, Maria Antonietta; Sirleto, Pietro; De Mariano, Marilena; Longo, Luca; Boldrini, Renata; Angioni, Adriano; Locatelli, Franco; Fruci, Doriana

    2013-01-01

    Neuroblastoma (NB), the most common solid cancer in early childhood, usually occurs sporadically but also its familial occurance is known in 1-2% of NB patients. Germline mutations in the ALK and PHOX2B genes have been found in a subset of familial NBs. However, because some individuals harbouring mutations in these genes do not develop this tumor, additional genetic alterations appear to be required for NB pathogenesis. Herein, we studied an Italian family with three NB patients, two siblings and a first cousin, carrying an ALK germline-activating mutation R1192P, that was inherited from their unaffected mothers and with no mutations in the PHOX2B gene. A comparison between somatic and germline DNA copy number changes in the two affected siblings by a high resolution array-based Comparative Genomic Hybridization (CGH) analysis revealed a germline gain at NKAIN2 (Na/K transporting ATPase interacting 2) locus in one of the sibling, that was inherited from the parent who does not carry the ALK mutation. Surprisingly, NKAIN2 was expressed at high levels also in the affected sibling that lacks the genomic gain at this locus, clearly suggesting the existance of other regulatory mechanisms. High levels of NKAIN2 were detected in the MYCN-amplified NB cell lines and in the most aggressive NB lesions as well as in the peripheral blood of a large cohort of NB patients. Consistent with a role of NKAIN2 in NB development, NKAIN2 was down-regulated during all-trans retinoic acid differentiation in two NB cell lines. Taken together, these data indicate a potential role of NKAIN2 gene in NB growth and differentiation. PMID:24205241

  8. High-resolution array CGH profiling identifies Na/K transporting ATPase interacting 2 (NKAIN2) as a predisposing candidate gene in neuroblastoma.

    PubMed

    Romania, Paolo; Castellano, Aurora; Surace, Cecilia; Citti, Arianna; De Ioris, Maria Antonietta; Sirleto, Pietro; De Mariano, Marilena; Longo, Luca; Boldrini, Renata; Angioni, Adriano; Locatelli, Franco; Fruci, Doriana

    2013-01-01

    Neuroblastoma (NB), the most common solid cancer in early childhood, usually occurs sporadically but also its familial occurance is known in 1-2% of NB patients. Germline mutations in the ALK and PHOX2B genes have been found in a subset of familial NBs. However, because some individuals harbouring mutations in these genes do not develop this tumor, additional genetic alterations appear to be required for NB pathogenesis. Herein, we studied an Italian family with three NB patients, two siblings and a first cousin, carrying an ALK germline-activating mutation R1192P, that was inherited from their unaffected mothers and with no mutations in the PHOX2B gene. A comparison between somatic and germline DNA copy number changes in the two affected siblings by a high resolution array-based Comparative Genomic Hybridization (CGH) analysis revealed a germline gain at NKAIN2 (Na/K transporting ATPase interacting 2) locus in one of the sibling, that was inherited from the parent who does not carry the ALK mutation. Surprisingly, NKAIN2 was expressed at high levels also in the affected sibling that lacks the genomic gain at this locus, clearly suggesting the existance of other regulatory mechanisms. High levels of NKAIN2 were detected in the MYCN-amplified NB cell lines and in the most aggressive NB lesions as well as in the peripheral blood of a large cohort of NB patients. Consistent with a role of NKAIN2 in NB development, NKAIN2 was down-regulated during all-trans retinoic acid differentiation in two NB cell lines. Taken together, these data indicate a potential role of NKAIN2 gene in NB growth and differentiation.

  9. Germline loss-of-function mutations in LZTR1 predispose to an inherited disorder of multiple schwannomas

    PubMed Central

    Piotrowski, Arkadiusz; Xie, Jing; Liu, Ying F; Poplawski, Andrzej B; Gomes, Alicia R; Madanecki, Piotr; Fu, Chuanhua; Crowley, Michael R; Crossman, David K; Armstrong, Linlea; Babovic-Vuksanovic, Dusica; Bergner, Amanda; Blakeley, Jaishri O; Blumenthal, Andrea L; Daniels, Molly S; Feit, Howard; Gardner, Kathy; Hurst, Stephanie; Kobelka, Christine; Lee, Chung; Nagy, Rebecca; Rauen, Katherine A; Slopis, John M; Suwannarat, Pim; Westman, Judith A; Zanko, Andrea; Korf, Bruce R; Messiaen, Ludwine M

    2015-01-01

    Constitutional SMARCB1 mutations at 22q11.23 have been found in ~50% of familial and <10% of sporadic schwannomatosis cases1. We sequenced highly conserved regions along 22q from eight individuals with schwannomatosis whose schwannomas involved somatic loss of one copy of 22q, encompassing SMARCB1 and NF2, with a different somatic mutation of the other NF2 allele in every schwannoma but no mutation of the remaining SMARCB1 allele in blood and tumor samples. LZTR1 germline mutations were identified in seven of the eight cases. LZTR1 sequencing in 12 further cases with the same molecular signature identified 9 additional germline mutations. Loss of heterozygosity with retention of an LZTR1 mutation was present in all 25 schwannomas studied. Mutations segregated with disease in all available affected first-degree relatives, although four asymptomatic parents also carried an LZTR1 mutation. Our findings identify LZTR1 as a gene predisposing to an autosomal dominant inherited disorder of multiple schwannomas in ~80% of 22q-related schwannomatosis cases lacking mutation in SMARCB1. PMID:24362817

  10. SMARCB1 involvement in the development of leiomyoma in a patient with schwannomatosis.

    PubMed

    Hulsebos, Theo J M; Kenter, Susan; Siebers-Renelt, Ulrike; Hans, Volkmar; Wesseling, Pieter; Flucke, Uta

    2014-03-01

    Germline SMARCB1 mutations predispose in schwannomatosis patients to the development of multiple benign schwannomas and, in some cases, meningiomas. Here, we report on a 34-year-old female patient who developed multiple schwannomas at various locations and in addition a leiomyoma of the cervix uteri. She carried a c.362+1G>A mutation that inactivates the donor splice site of exon 3. This mutation caused the schwannomatosis phenotype in this patient and was also demonstrated to be present in her affected mother. The leiomyoma displayed the genetic features that are characteristic for germline SMARCB1 mutation-associated tumors. The mutant allele retained in the tumor, whereas the wild-type allele was lost by loss of heterozygosity. Furthermore, the loss of heterozygosity involved net loss of chromosome 22. An NF2 mutation was not found. However, quantitative polymerase chain reaction suggested that both NF2 copies were lost in the tumor. Immunostaining with a SMARCB1 antibody revealed the mosaic expression pattern that is typical for schwannomatosis-associated tumors. To our knowledge, this is the first reported case of leiomyoma associated with a germline SMARCB1 mutation. As such, it widens the spectrum of benign tumors associated with a germline SMARCB1 mutation.

  11. PMS2 involvement in patients suspected of Lynch syndrome.

    PubMed

    Niessen, Renée C; Kleibeuker, Jan H; Westers, Helga; Jager, Paul O J; Rozeveld, Dennie; Bos, Krista K; Boersma-van Ek, Wytske; Hollema, Harry; Sijmons, Rolf H; Hofstra, Robert M W

    2009-04-01

    It is well-established that germline mutations in the mismatch repair genes MLH1, MSH2, and MSH6 cause Lynch syndrome. However, mutations in these three genes do not account for all Lynch syndrome (suspected) families. Recently, it was shown that germline mutations in another mismatch repair gene, PMS2, play a far more important role in Lynch syndrome than initially thought. To explore this further, we determined the prevalence of pathogenic germline PMS2 mutations in a series of Lynch syndrome-suspected patients. Ninety-seven patients who had early-onset microsatellite instable colorectal or endometrial cancer, or multiple Lynch syndrome-associated tumors and/or were from an Amsterdam Criteria II-positive family were selected for this study. These patients carried no pathogenic germline mutation in MLH1, MSH2, or MSH6. When available, tumors were investigated for immunohistochemical staining (IHC) for PMS2. PMS2 was screened in all patients by exon-by-exon sequencing. We identified four patients with a pathogenic PMS2 mutation (4%) among the 97 patients we selected. IHC of PMS2 was informative in one of the mutation carriers, and in this case, the tumor showed loss of PMS2 expression. In conclusion, our study confirms the finding of previous studies that PMS2 is more frequently involved in Lynch syndrome than originally expected.

  12. Frequent germline deleterious mutations in DNA repair genes in familial prostate cancer cases are associated with advanced disease.

    PubMed

    Leongamornlert, D; Saunders, E; Dadaev, T; Tymrakiewicz, M; Goh, C; Jugurnauth-Little, S; Kozarewa, I; Fenwick, K; Assiotis, I; Barrowdale, D; Govindasami, K; Guy, M; Sawyer, E; Wilkinson, R; Antoniou, A C; Eeles, R; Kote-Jarai, Z

    2014-03-18

    Prostate cancer (PrCa) is one of the most common diseases to affect men worldwide and among the leading causes of cancer-related death. The purpose of this study was to use second-generation sequencing technology to assess the frequency of deleterious mutations in 22 tumour suppressor genes in familial PrCa and estimate the relative risk of PrCa if these genes are mutated. Germline DNA samples from 191 men with 3 or more cases of PrCa in their family were sequenced for 22 tumour suppressor genes using Agilent target enrichment and Illumina technology. Analysis for genetic variation was carried out by using a pipeline consisting of BWA, Genome Analysis Toolkit (GATK) and ANNOVAR. Clinical features were correlated with mutation status using standard statistical tests. Modified segregation analysis was used to determine the relative risk of PrCa conferred by the putative loss-of-function (LoF) mutations identified. We discovered 14 putative LoF mutations in 191 samples (7.3%) and these mutations were more frequently associated with nodal involvement, metastasis or T4 tumour stage (P=0.00164). Segregation analysis of probands with European ancestry estimated that LoF mutations in any of the studied genes confer a relative risk of PrCa of 1.94 (95% CI: 1.56-2.42). These findings show that LoF mutations in DNA repair pathway genes predispose to familial PrCa and advanced disease and therefore warrants further investigation. The clinical utility of these findings will become increasingly important as targeted screening and therapies become more widespread.

  13. First description of mutational analysis of MLH1, MSH2 and MSH6 in Algerian families with suspected Lynch syndrome.

    PubMed

    Ziada-Bouchaar, H; Sifi, K; Filali, T; Hammada, T; Satta, D; Abadi, N

    2017-01-01

    Hereditary non-polyposis colorectal cancer (HNPCC) is an autosomal dominant disorder characterized by the early onset of colorectal cancer (CRC) linked to germline defects in Mismatch Repair (MMR) genes. We present here, the first molecular study of the correlation between CRC and mutations occurring in these genes performed in twenty-one unrelated Algerian families. The presence of germline mutations in MMR genes, MLH1, MSH2 and MSH6 genes was tested by sequencing all exons plus adjacent intronic sequences and Multiplex ligand-dependent probe amplification (MLPA) for testing large genomic rearrangements. Pathogenic mutations were identified in 20 % of families with clinical suspicion on HNPCC. Two novel variants described for the first time in Algerian families were identified in MLH1, c.881_884delTCAGinsCATTCCT and a large deletion in MSH6 gene from a young onset of CRC. Moreover, the variants of MSH2 gene: c.942+3A>T, c.1030C>T, the most described ones, were also detected in Algerian families. Furthermore, the families HNPCC caused by MSH6 germline mutation may show an age of onset that is comparable to this of patients with MLH1 and MSH2 mutations. In this study, we confirmed that MSH2, MLH1, and MSH6 contribute to CRC susceptibility. This work represents the implementation of a diagnostic algorithm for the identification of Lynch syndrome patients in Algerian families.

  14. Discrimination of germline V genes at different sequencing lengths and mutational burdens: A new tool for identifying and evaluating the reliability of V gene assignment.

    PubMed

    Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri

    2015-12-01

    Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Pitfalls in genetic analysis of pheochromocytomas/paragangliomas-case report.

    PubMed

    Canu, Letizia; Rapizzi, Elena; Zampetti, Benedetta; Fucci, Rossella; Nesi, Gabriella; Richter, Susan; Qin, Nan; Giachè, Valentino; Bergamini, Carlo; Parenti, Gabriele; Valeri, Andrea; Ercolino, Tonino; Eisenhofer, Graeme; Mannelli, Massimo

    2014-07-01

    About 35% of patients with pheochromocytoma/paraganglioma carry a germline mutation in one of the 10 main susceptibility genes. The recent introduction of next-generation sequencing will allow the analysis of all these genes in one run. When positive, the analysis is generally unequivocal due to the association between a germline mutation and a concordant clinical presentation or positive family history. When genetic analysis reveals a novel mutation with no clinical correlates, particularly in the presence of a missense variant, the question arises whether the mutation is pathogenic or a rare polymorphism. We report the case of a 35-year-old patient operated for a pheochromocytoma who turned out to be a carrier of a novel SDHD (succinate dehydrogenase subunit D) missense mutation. With no positive family history or clinical correlates, we decided to perform additional analyses to test the clinical significance of the mutation. We performed in silico analysis, tissue loss of heterozygosity analysis, immunohistochemistry, Western blot analysis, SDH enzymatic assay, and measurement of the succinate/fumarate concentration ratio in the tumor tissue by tandem mass spectrometry. Although the in silico analysis gave contradictory results according to the different methods, all the other tests demonstrated that the SDH complex was conserved and normally active. We therefore came to the conclusion that the variant was a nonpathogenic polymorphism. Advancements in technology facilitate genetic analysis of patients with pheochromocytoma but also offer new challenges to the clinician who, in some cases, needs clinical correlates and/or functional tests to give significance to the results of the genetic assay.

  16. Spectrum and prevalence of genetic predisposition in medulloblastoma: a retrospective genetic study and prospective validation in a clinical trial cohort.

    PubMed

    Waszak, Sebastian M; Northcott, Paul A; Buchhalter, Ivo; Robinson, Giles W; Sutter, Christian; Groebner, Susanne; Grund, Kerstin B; Brugières, Laurence; Jones, David T W; Pajtler, Kristian W; Morrissy, A Sorana; Kool, Marcel; Sturm, Dominik; Chavez, Lukas; Ernst, Aurelie; Brabetz, Sebastian; Hain, Michael; Zichner, Thomas; Segura-Wang, Maia; Weischenfeldt, Joachim; Rausch, Tobias; Mardin, Balca R; Zhou, Xin; Baciu, Cristina; Lawerenz, Christian; Chan, Jennifer A; Varlet, Pascale; Guerrini-Rousseau, Lea; Fults, Daniel W; Grajkowska, Wiesława; Hauser, Peter; Jabado, Nada; Ra, Young-Shin; Zitterbart, Karel; Shringarpure, Suyash S; De La Vega, Francisco M; Bustamante, Carlos D; Ng, Ho-Keung; Perry, Arie; MacDonald, Tobey J; Hernáiz Driever, Pablo; Bendel, Anne E; Bowers, Daniel C; McCowage, Geoffrey; Chintagumpala, Murali M; Cohn, Richard; Hassall, Timothy; Fleischhack, Gudrun; Eggen, Tone; Wesenberg, Finn; Feychting, Maria; Lannering, Birgitta; Schüz, Joachim; Johansen, Christoffer; Andersen, Tina V; Röösli, Martin; Kuehni, Claudia E; Grotzer, Michael; Kjaerheim, Kristina; Monoranu, Camelia M; Archer, Tenley C; Duke, Elizabeth; Pomeroy, Scott L; Shelagh, Redmond; Frank, Stephan; Sumerauer, David; Scheurlen, Wolfram; Ryzhova, Marina V; Milde, Till; Kratz, Christian P; Samuel, David; Zhang, Jinghui; Solomon, David A; Marra, Marco; Eils, Roland; Bartram, Claus R; von Hoff, Katja; Rutkowski, Stefan; Ramaswamy, Vijay; Gilbertson, Richard J; Korshunov, Andrey; Taylor, Michael D; Lichter, Peter; Malkin, David; Gajjar, Amar; Korbel, Jan O; Pfister, Stefan M

    2018-06-01

    Medulloblastoma is associated with rare hereditary cancer predisposition syndromes; however, consensus medulloblastoma predisposition genes have not been defined and screening guidelines for genetic counselling and testing for paediatric patients are not available. We aimed to assess and define these genes to provide evidence for future screening guidelines. In this international, multicentre study, we analysed patients with medulloblastoma from retrospective cohorts (International Cancer Genome Consortium [ICGC] PedBrain, Medulloblastoma Advanced Genomics International Consortium [MAGIC], and the CEFALO series) and from prospective cohorts from four clinical studies (SJMB03, SJMB12, SJYC07, and I-HIT-MED). Whole-genome sequences and exome sequences from blood and tumour samples were analysed for rare damaging germline mutations in cancer predisposition genes. DNA methylation profiling was done to determine consensus molecular subgroups: WNT (MB WNT ), SHH (MB SHH ), group 3 (MB Group3 ), and group 4 (MB Group4 ). Medulloblastoma predisposition genes were predicted on the basis of rare variant burden tests against controls without a cancer diagnosis from the Exome Aggregation Consortium (ExAC). Previously defined somatic mutational signatures were used to further classify medulloblastoma genomes into two groups, a clock-like group (signatures 1 and 5) and a homologous recombination repair deficiency-like group (signatures 3 and 8), and chromothripsis was investigated using previously established criteria. Progression-free survival and overall survival were modelled for patients with a genetic predisposition to medulloblastoma. We included a total of 1022 patients with medulloblastoma from the retrospective cohorts (n=673) and the four prospective studies (n=349), from whom blood samples (n=1022) and tumour samples (n=800) were analysed for germline mutations in 110 cancer predisposition genes. In our rare variant burden analysis, we compared these against 53 105 sequenced controls from ExAC and identified APC, BRCA2, PALB2, PTCH1, SUFU, and TP53 as consensus medulloblastoma predisposition genes according to our rare variant burden analysis and estimated that germline mutations accounted for 6% of medulloblastoma diagnoses in the retrospective cohort. The prevalence of genetic predispositions differed between molecular subgroups in the retrospective cohort and was highest for patients in the MB SHH subgroup (20% in the retrospective cohort). These estimates were replicated in the prospective clinical cohort (germline mutations accounted for 5% of medulloblastoma diagnoses, with the highest prevalence [14%] in the MB SHH subgroup). Patients with germline APC mutations developed MB WNT and accounted for most (five [71%] of seven) cases of MB WNT that had no somatic CTNNB1 exon 3 mutations. Patients with germline mutations in SUFU and PTCH1 mostly developed infant MB SHH . Germline TP53 mutations presented only in childhood patients in the MB SHH subgroup and explained more than half (eight [57%] of 14) of all chromothripsis events in this subgroup. Germline mutations in PALB2 and BRCA2 were observed across the MB SHH , MB Group3 , and MB Group4 molecular subgroups and were associated with mutational signatures typical of homologous recombination repair deficiency. In patients with a genetic predisposition to medulloblastoma, 5-year progression-free survival was 52% (95% CI 40-69) and 5-year overall survival was 65% (95% CI 52-81); these survival estimates differed significantly across patients with germline mutations in different medulloblastoma predisposition genes. Genetic counselling and testing should be used as a standard-of-care procedure in patients with MB WNT and MB SHH because these patients have the highest prevalence of damaging germline mutations in known cancer predisposition genes. We propose criteria for routine genetic screening for patients with medulloblastoma based on clinical and molecular tumour characteristics. German Cancer Aid; German Federal Ministry of Education and Research; German Childhood Cancer Foundation (Deutsche Kinderkrebsstiftung); European Research Council; National Institutes of Health; Canadian Institutes for Health Research; German Cancer Research Center; St Jude Comprehensive Cancer Center; American Lebanese Syrian Associated Charities; Swiss National Science Foundation; European Molecular Biology Organization; Cancer Research UK; Hertie Foundation; Alexander and Margaret Stewart Trust; V Foundation for Cancer Research; Sontag Foundation; Musicians Against Childhood Cancer; BC Cancer Foundation; Swedish Council for Health, Working Life and Welfare; Swedish Research Council; Swedish Cancer Society; the Swedish Radiation Protection Authority; Danish Strategic Research Council; Swiss Federal Office of Public Health; Swiss Research Foundation on Mobile Communication; Masaryk University; Ministry of Health of the Czech Republic; Research Council of Norway; Genome Canada; Genome BC; Terry Fox Research Institute; Ontario Institute for Cancer Research; Pediatric Oncology Group of Ontario; The Family of Kathleen Lorette and the Clark H Smith Brain Tumour Centre; Montreal Children's Hospital Foundation; The Hospital for Sick Children: Sonia and Arthur Labatt Brain Tumour Research Centre, Chief of Research Fund, Cancer Genetics Program, Garron Family Cancer Centre, MDT's Garron Family Endowment; BC Childhood Cancer Parents Association; Cure Search Foundation; Pediatric Brain Tumor Foundation; Brainchild; and the Government of Ontario. Copyright © 2018 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY-NC-ND 4.0 license. Published by Elsevier Ltd.. All rights reserved.

  17. ExScalibur: A High-Performance Cloud-Enabled Suite for Whole Exome Germline and Somatic Mutation Identification

    PubMed Central

    Huang, Lei; Kang, Wenjun; Bartom, Elizabeth; Onel, Kenan; Volchenboum, Samuel; Andrade, Jorge

    2015-01-01

    Whole exome sequencing has facilitated the discovery of causal genetic variants associated with human diseases at deep coverage and low cost. In particular, the detection of somatic mutations from tumor/normal pairs has provided insights into the cancer genome. Although there is an abundance of publicly-available software for the detection of germline and somatic variants, concordance is generally limited among variant callers and alignment algorithms. Successful integration of variants detected by multiple methods requires in-depth knowledge of the software, access to high-performance computing resources, and advanced programming techniques. We present ExScalibur, a set of fully automated, highly scalable and modulated pipelines for whole exome data analysis. The suite integrates multiple alignment and variant calling algorithms for the accurate detection of germline and somatic mutations with close to 99% sensitivity and specificity. ExScalibur implements streamlined execution of analytical modules, real-time monitoring of pipeline progress, robust handling of errors and intuitive documentation that allows for increased reproducibility and sharing of results and workflows. It runs on local computers, high-performance computing clusters and cloud environments. In addition, we provide a data analysis report utility to facilitate visualization of the results that offers interactive exploration of quality control files, read alignment and variant calls, assisting downstream customization of potential disease-causing mutations. ExScalibur is open-source and is also available as a public image on Amazon cloud. PMID:26271043

  18. Elucidating the impact of neurofibromatosis-1 germline mutations on neurofibromin function and dopamine-based learning.

    PubMed

    Anastasaki, Corina; Woo, Albert S; Messiaen, Ludwine M; Gutmann, David H

    2015-06-15

    Neurofibromatosis type 1 (NF1) is a common autosomal dominant neurologic condition characterized by significant clinical heterogeneity, ranging from malignant cancers to cognitive deficits. Recent studies have begun to reveal rare genotype-phenotype correlations, suggesting that the specific germline NF1 gene mutation may be one factor underlying disease heterogeneity. The purpose of this study was to define the impact of the germline NF1 gene mutation on brain neurofibromin function relevant to learning. Herein, we employ human NF1-patient primary skin fibroblasts, induced pluripotent stem cells and derivative neural progenitor cells (NPCs) to demonstrate that NF1 germline mutations have dramatic effects on neurofibromin expression. Moreover, while all NF1-patient NPCs exhibit increased RAS activation and reduced cyclic AMP generation, there was a neurofibromin dose-dependent reduction in dopamine (DA) levels. Additionally, we leveraged two complementary Nf1 genetically-engineered mouse strains in which hippocampal-based learning and memory is DA-dependent to establish that neuronal DA levels and signaling as well as mouse spatial learning are controlled in an Nf1 gene dose-dependent manner. Collectively, this is the first demonstration that different germline NF1 gene mutations differentially dictate neurofibromin function in the brain. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Germline Mutations in the BRIP1, BARD1, PALB2, and NBN Genes in Women With Ovarian Cancer

    PubMed Central

    Ramus, Susan J.; Song, Honglin; Dicks, Ed; Tyrer, Jonathan P.; Rosenthal, Adam N.; Intermaggio, Maria P.; Fraser, Lindsay; Gentry-Maharaj, Aleksandra; Hayward, Jane; Philpott, Susan; Anderson, Christopher; Edlund, Christopher K.; Conti, David; Harrington, Patricia; Barrowdale, Daniel; Bowtell, David D.; Alsop, Kathryn; Mitchell, Gillian; Cicek, Mine S.; Cunningham, Julie M.; Fridley, Brooke L.; Alsop, Jennifer; Jimenez-Linan, Mercedes; Poblete, Samantha; Lele, Shashi; Sucheston-Campbell, Lara; Moysich, Kirsten B.; Sieh, Weiva; McGuire, Valerie; Lester, Jenny; Bogdanova, Natalia; Dürst, Matthias; Hillemanns, Peter; Odunsi, Kunle; Whittemore, Alice S.; Karlan, Beth Y; Dörk, Thilo; Goode, Ellen L.; Menon, Usha; Jacobs, Ian J.; Antoniou, Antonis C.; Pharoah, Paul D. P.; Gayther, Simon A.

    2015-01-01

    Background: Epithelial ovarian cancer (EOC) is the most lethal gynecological malignancy, responsible for 13 000 deaths per year in the United States. Risk prediction based on identifying germline mutations in ovarian cancer susceptibility genes could have a clinically significant impact on reducing disease mortality. Methods: Next generation sequencing was used to identify germline mutations in the coding regions of four candidate susceptibility genes—BRIP1, BARD1, PALB2 and NBN—in 3236 invasive EOC case patients and 3431 control patients of European origin, and in 2000 unaffected high-risk women from a clinical screening trial of ovarian cancer (UKFOCSS). For each gene, we estimated the prevalence and EOC risks and evaluated associations between germline variant status and clinical and epidemiological risk factor information. All statistical tests were two-sided. Results: We found an increased frequency of deleterious mutations in BRIP1 in case patients (0.9%) and in the UKFOCSS participants (0.6%) compared with control patients (0.09%) (P = 1 x 10–4 and 8 x 10–4, respectively), but no differences for BARD1 (P = .39), NBN1 (P = .61), or PALB2 (P = .08). There was also a difference in the frequency of rare missense variants in BRIP1 between case patients and control patients (P = 5.5 x 10–4). The relative risks associated with BRIP1 mutations were 11.22 for invasive EOC (95% confidence interval [CI] = 3.22 to 34.10, P = 1 x 10–4) and 14.09 for high-grade serous disease (95% CI = 4.04 to 45.02, P = 2 x 10–5). Segregation analysis in families estimated the average relative risks in BRIP1 mutation carriers compared with the general population to be 3.41 (95% CI = 2.12 to 5.54, P = 7×10–7). Conclusions: Deleterious germline mutations in BRIP1 are associated with a moderate increase in EOC risk. These data have clinical implications for risk prediction and prevention approaches for ovarian cancer and emphasize the critical need for risk estimates based on very large sample sizes before genes of moderate penetrance have clinical utility in cancer prevention. PMID:26315354

  20. Endometrial tumour BRAF mutations and MLH1 promoter methylation as predictors of germline mismatch repair gene mutation status: a literature review.

    PubMed

    Metcalf, Alexander M; Spurdle, Amanda B

    2014-03-01

    Colorectal cancer (CRC) that displays high microsatellite instability (MSI-H) can be caused by either germline mutations in mismatch repair (MMR) genes, or non-inherited transcriptional silencing of the MLH1 promoter. A correlation between MLH1 promoter methylation, specifically the 'C' region, and BRAF V600E status has been reported in CRC studies. Germline MMR mutations also greatly increase risk of endometrial cancer (EC), but no systematic review has been undertaken to determine if these tumour markers may be useful predictors of MMR mutation status in EC patients. Endometrial cancer cohorts meeting review inclusion criteria encompassed 2675 tumours from 20 studies for BRAF V600E, and 447 tumours from 11 studies for MLH1 methylation testing. BRAF V600E mutations were reported in 4/2675 (0.1%) endometrial tumours of unknown MMR mutation status, and there were 7/823 (0.9%) total sequence variants in exon 11 and 27/1012 (2.7%) in exon 15. Promoter MLH1 methylation was not observed in tumours from 32 MLH1 mutation carriers, or for 13 MSH2 or MSH6 mutation carriers. MMR mutation-negative individuals with tumour MLH1 and PMS2 IHC loss displayed MLH1 methylation in 48/51 (94%) of tumours. We have also detailed specific examples that show the importance of MLH1 promoter region, assay design, and quantification of methylation. This review shows that BRAF mutations occurs so infrequently in endometrial tumours they can be discounted as a useful marker for predicting MMR-negative mutation status, and further studies of endometrial cohorts with known MMR mutation status are necessary to quantify the utility of tumour MLH1 promoter methylation as a marker of negative germline MMR mutation status in EC patients.

  1. High-Throughput Genome Editing and Phenotyping Facilitated by High Resolution Melting Curve Analysis

    PubMed Central

    Thomas, Holly R.; Percival, Stefanie M.; Yoder, Bradley K.; Parant, John M.

    2014-01-01

    With the goal to generate and characterize the phenotypes of null alleles in all genes within an organism and the recent advances in custom nucleases, genome editing limitations have moved from mutation generation to mutation detection. We previously demonstrated that High Resolution Melting (HRM) analysis is a rapid and efficient means of genotyping known zebrafish mutants. Here we establish optimized conditions for HRM based detection of novel mutant alleles. Using these conditions, we demonstrate that HRM is highly efficient at mutation detection across multiple genome editing platforms (ZFNs, TALENs, and CRISPRs); we observed nuclease generated HRM positive targeting in 1 of 6 (16%) open pool derived ZFNs, 14 of 23 (60%) TALENs, and 58 of 77 (75%) CRISPR nucleases. Successful targeting, based on HRM of G0 embryos correlates well with successful germline transmission (46 of 47 nucleases); yet, surprisingly mutations in the somatic tail DNA weakly correlate with mutations in the germline F1 progeny DNA. This suggests that analysis of G0 tail DNA is a good indicator of the efficiency of the nuclease, but not necessarily a good indicator of germline alleles that will be present in the F1s. However, we demonstrate that small amplicon HRM curve profiles of F1 progeny DNA can be used to differentiate between specific mutant alleles, facilitating rare allele identification and isolation; and that HRM is a powerful technique for screening possible off-target mutations that may be generated by the nucleases. Our data suggest that micro-homology based alternative NHEJ repair is primarily utilized in the generation of CRISPR mutant alleles and allows us to predict likelihood of generating a null allele. Lastly, we demonstrate that HRM can be used to quickly distinguish genotype-phenotype correlations within F1 embryos derived from G0 intercrosses. Together these data indicate that custom nucleases, in conjunction with the ease and speed of HRM, will facilitate future high-throughput mutation generation and analysis needed to establish mutants in all genes of an organism. PMID:25503746

  2. Rates of loss of heterozygosity and mitotic recombination in NF2 schwannomas, sporadic vestibular schwannomas and schwannomatosis schwannomas.

    PubMed

    Hadfield, K D; Smith, M J; Urquhart, J E; Wallace, A J; Bowers, N L; King, A T; Rutherford, S A; Trump, D; Newman, W G; Evans, D G

    2010-11-25

    Biallelic inactivation of the NF2 gene occurs in the majority of schwannomas. This usually involves a combination of a point mutation or multiexon deletion, in conjunction with either a second point mutation or loss of heterozygosity (LOH). We have performed DNA sequence and dosage analysis of the NF2 gene in a panel of 239 schwannoma tumours: 97 neurofibromatosis type 2 (NF2)-related schwannomas, 104 sporadic vestibular schwannomas (VS) and 38 schwannomatosis-related schwannomas. In total, we identified germline NF2 mutations in 86 out of 97 (89%) NF2 patients and a second mutational event in 77 out of 97 (79%). LOH was by far the most common form of second hit. A combination of microsatellite analysis with either conventional comparative genomic hybridization (CGH) or multiplex ligation-dependent probe amplification (MLPA) identified mitotic recombination (MR) as the cause of LOH in 14 out of 72 (19%) total evaluable tumours. Among sporadic VS, at least one NF2 mutation was identified by sequence analysis or MLPA in 65 out of 98 (66%) tumours. LOH occurred in 54 out of 96 (56%) evaluable tumours, but MR only accounted for 5 out of 77 (6%) tested. LOH was present in 28 out of 34 (82%) schwannomatosis-related schwannomas. In all eight patients who had previously tested positive for a germline SMARCB1 mutation, this involved loss of the whole, or part of the long arm, of chromosome 22. In contrast, 5 out of 22 (23%) tumours from patients with no germline SMARCB1 mutation exhibited MR. High-resolution Affymetrix SNP6 genotyping and copy number (CN) analysis (Affymetrix, Santa Clara, CA, USA) were used to determine the chromosomal breakpoint locations in tumours with MR. A range of unique recombination sites, spanning approximately 11.4 Mb, were identified. This study shows that MR is a mechanism of LOH in NF2 and SMARCB1-negative schwannomatosis-related schwannomas, occurring less frequently in sporadic VS. We found no evidence of MR in SMARCB1-positive schwannomatosis, suggesting that susceptibility to MR varies according to the disease context.

  3. Identification of a Variety of Mutations in Cancer Predisposition Genes in Patients With Suspected Lynch Syndrome.

    PubMed

    Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna

    2015-09-01

    Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many of which were unexpected based on patients' histories. Parallel sequencing also detected a high number of potentially uninformative germline findings, including VUS. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

  4. Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

    PubMed

    Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

    2018-01-01

    Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

  5. Establishing high resolution melting analysis: method validation and evaluation for c-RET proto-oncogene mutation screening.

    PubMed

    Benej, Martin; Bendlova, Bela; Vaclavikova, Eliska; Poturnajova, Martina

    2011-10-06

    Reliable and effective primary screening of mutation carriers is the key condition for common diagnostic use. The objective of this study is to validate the method high resolution melting (HRM) analysis for routine primary mutation screening and accomplish its optimization, evaluation and validation. Due to their heterozygous nature, germline point mutations of c-RET proto-oncogene, associated to multiple endocrine neoplasia type 2 (MEN2), are suitable for HRM analysis. Early identification of mutation carriers has a major impact on patients' survival due to early onset of medullary thyroid carcinoma (MTC) and resistance to conventional therapy. The authors performed a series of validation assays according to International Conference on Harmonization of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH) guidelines for validation of analytical procedures, along with appropriate design and optimization experiments. After validated evaluation of HRM, the method was utilized for primary screening of 28 pathogenic c-RET mutations distributed among nine exons of c-RET gene. Validation experiments confirm the repeatability, robustness, accuracy and reproducibility of HRM. All c-RET gene pathogenic variants were detected with no occurrence of false-positive/false-negative results. The data provide basic information about design, establishment and validation of HRM for primary screening of genetic variants in order to distinguish heterozygous point mutation carriers among the wild-type sequence carriers. HRM analysis is a powerful and reliable tool for rapid and cost-effective primary screening, e.g., of c-RET gene germline and/or sporadic mutations and can be used as a first line potential diagnostic tool.

  6. Frequency of Germline Mutations in 25 Cancer Susceptibility Genes in a Sequential Series of Patients With Breast Cancer

    PubMed Central

    Lin, Nancy U.; Kidd, John; Allen, Brian A.; Singh, Nanda; Wenstrup, Richard J.; Hartman, Anne-Renee; Winer, Eric P.; Garber, Judy E.

    2016-01-01

    Purpose Testing for germline mutations in BRCA1/2 is standard for select patients with breast cancer to guide clinical management. Next-generation sequencing (NGS) allows testing for mutations in additional breast cancer predisposition genes. The frequency of germline mutations detected by using NGS has been reported in patients with breast cancer who were referred for BRCA1/2 testing or with triple-negative breast cancer. We assessed the frequency and predictors of mutations in 25 cancer predisposition genes, including BRCA1/2, in a sequential series of patients with breast cancer at an academic institution to examine the utility of genetic testing in this population. Methods Patients with stages I to III breast cancer who were seen at a single cancer center between 2010 and 2012, and who agreed to participate in research DNA banking, were included (N = 488). Personal and family cancer histories were collected and germline DNA was sequenced with NGS to identify mutations. Results Deleterious mutations were identified in 10.7% of women, including 6.1% in BRCA1/2 (5.1% in non-Ashkenazi Jewish patients) and 4.6% in other breast/ovarian cancer predisposition genes including CHEK2 (n = 10), ATM (n = 4), BRIP1 (n = 4), and one each in PALB2, PTEN, NBN, RAD51C, RAD51D, MSH6, and PMS2. Whereas young age (P < .01), Ashkenazi Jewish ancestry (P < .01), triple-negative breast cancer (P = .01), and family history of breast/ovarian cancer (P = .01) predicted for BRCA1/2 mutations, no factors predicted for mutations in other breast cancer predisposition genes. Conclusion Among sequential patients with breast cancer, 10.7% were found to have a germline mutation in a gene that predisposes women to breast or ovarian cancer, using a panel of 25 predisposition genes. Factors that predict for BRCA1/2 mutations do not predict for mutations in other breast/ovarian cancer susceptibility genes when these genes are analyzed as a single group. Additional cohorts will be helpful to define individuals at higher risk of carrying mutations in genes other than BRCA1/2. PMID:26976419

  7. The clinical genetics of phaeochromocytoma and paraganglioma.

    PubMed

    Kavinga Gunawardane, P T; Grossman, Ashley

    2017-10-01

    Phaeochromocytoma and paraganglioma are rare catecholamine-producing tumours, recognised to have one of the richest hereditary backgrounds of all neoplasms, with germline mutations seen in approximately 30% of patients. They can be a part of genetic syndromes such as MEN 2 or Neurofibromatosis type 1, or can be found as apparently sporadic tumours. Germline mutations are almost always found in syndromic patients. Nonetheless, apparently sporadic phaeochromocytoma too show high germline mutation rates. Early detection of a genetic mutation can lead to early diagnosis of further tumours via surveillance, early treatment and better prognosis. Apart from this, the genetic profile has important relevance for tumour location and biochemical profile, and can be a useful predictor of future tumour behaviour. It also enables family screening and surveillance. Moreover, recent studies have demonstrated significant driver somatic mutations in up to 75% of all tumours. Arch Endocrinol Metab. 2017;61(5):490-500.

  8. Predominant RET Germline Mutations in Exons 10, 11, and 16 in Iranian Patients with Hereditary Medullary Thyroid Carcinoma

    PubMed Central

    Hedayati, Mehdi; Zarif Yeganeh, Marjan; Sheikhol Eslami, Sara; Rezghi Barez, Shekoofe; Hoghooghi Rad, Laleh; Azizi, Fereidoun

    2011-01-01

    Medullary thyroid carcinoma occurs in both sporadic (75%) and hereditary (25%) forms. The missense mutations of RET proto-oncogene in MTC development have been well demonstrated. To investigate the spectrum of predominant RET germline mutations in exons 10, 11, and 16 in hereditary MTC in Iranian population, 217 participants were included. Genomic DNAs were extracted from the leukocytes using the standard Salting Out/Proteinase K method. Mutation detection was performed through PCR-RFLP and DNA sequencing. In 217 participants, 43 missense mutations were identified in exons 10 (6%), 11 (13%), and 16 (0.9%). Moreover, a novel germline mutation was detected in exon 11 (S686N). Also four different polymorphisms were found in intron 16 in eight patients. The obtained data showed the frequency profile of RET mutations in Iranian individuals with MTC (19.8%). The most frequent mutation in our population was C634G whereas in most population it was C634R. Altogether, these results underline the importance of the genetic background of family members of any patient with MTC. PMID:21765987

  9. Novel mutation in the TMEM127 gene associated with phaeochromocytoma.

    PubMed

    Elston, M S; Meyer-Rochow, G Y; Prosser, D; Love, D R; Conaglen, J V

    2013-04-01

    Phaeochromocytomas and paragangliomas are rare neuroendocrine tumours that arise from the adrenal glands or paraganglia (paragangliomas) within the abdomen, thorax and neck. Although it was originally suggested that approximately 10% of these tumours were inherited, it is now recognised that up to approximately 30% of these tumours are associated with a germline mutation in one of the phaeochromocytoma/paraganglioma susceptibility genes. Of the 12 currently known genes predisposing to these tumours, the TMEM127 gene is one of the more recently identified and appears to be present in approximately 2% of apparently sporadic phaeochromocytomas. We report a 33-year-old man who presented with an apparently sporadic adrenal phaeochromocytoma and was identified as carrying a novel TMEM127 germline mutation, p.Gln139X. Patients harbouring a germline TMEM127 mutation most commonly present with an apparently sporadic solitary adrenal phaeochromocytoma. Testing patients who present with a phaeochromocytoma or paraganglioma for an underlying germline mutation needs to be considered in all patients due to implications for family members, but a strategy based on clinical and immunohistochemical findings would be prudent to limit costs. © 2013 The Authors; Internal Medicine Journal © 2013 Royal Australasian College of Physicians.

  10. Correlational study on mitochondrial DNA mutations as potential risk factors in breast cancer.

    PubMed

    Li, Linhai; Chen, Lidan; Li, Jun; Zhang, Weiyun; Liao, Yang; Chen, Jianyun; Sun, Zhaohui

    2016-05-24

    The presented study performed an mtDNA genome-wide association analysis to screen the peripheral blood of breast cancer patients for high-risk germline mutations. Unlike previous studies, which have used breast tissue in analyzing somatic mutations, we looked for germline mutations in our study, since they are better predictors of breast cancer in high-risk groups, facilitate early, non-invasive diagnoses of breast cancer and may provide a broader spectrum of therapeutic options. The data comprised 22 samples of healthy group and 83 samples from breast cancer patients. The sequencing data showed 170 mtDNA mutations in the healthy group and 393 mtDNA mutations in the disease group. Of these, 283 mtDNA mutations (88 in the healthy group and 232 in the disease group) had never been reported in the literature. Moreover, correlation analysis indicated there was a significant difference in 32 mtDNA mutations. According to our relative risk analysis of these 32 mtDNA mutations, 27 of the total had odds ratio values (ORs) of less than 1, meaning that these mutations have a potentially protective role to play in breast cancer. The remaining 5 mtDNA mutations, RNR2-2463 indelA, COX1-6296 C>A, COX1-6298 indelT, ATP6-8860 A>G, and ND5-13327 indelA, whose ORs were 8.050, 4.464, 4.464, 5.254 and 4.853, respectively, were regarded as risk factors of increased breast cancer. The five mutations identified here may serve as novel indicators of breast cancer and may have future therapeutic applications. In addition, the use of peripheral blood samples was procedurally simple and could be applied as a non-invasive diagnostic technique.

  11. Germline PMS2 mutation screened by mismatch repair protein immunohistochemistry of colorectal cancer in Japan.

    PubMed

    Sugano, Kokichi; Nakajima, Takeshi; Sekine, Shigeki; Taniguchi, Hirokazu; Saito, Shinya; Takahashi, Masahiro; Ushiama, Mineko; Sakamoto, Hiromi; Yoshida, Teruhiko

    2016-11-01

    Germline PMS2 gene mutations were detected by RT-PCR/direct sequencing of total RNA extracted from puromycin-treated peripheral blood lymphocytes (PBL) and multiplex ligation-dependent probe amplification (MLPA) analyses of Japanese patients with colorectal cancer (CRC) fulfilling either the revised Bethesda Guidelines or being an age at disease onset of younger than 70 years, and screened by mismatch repair protein immunohistochemistry of formalin-fixed paraffin embedded sections. Of the 501 subjects examined, 7 (1.40%) showed the downregulated expression of the PMS2 protein alone and were referred to the genetic counseling clinic. Germline PMS2 mutations were detected in 6 (85.7%), including 3 nonsense and 1 frameshift mutations by RT-PCR/direct sequencing and 2 genomic deletions by MLPA. No mutations were identified in the other MMR genes (i.e. MSH2, MLH1 and MSH6). The prevalence of the downregulated expression of the PMS2 protein alone was 1.40% among the subjects examined and IHC results predicted the presence of PMS2 germline mutations. RT-PCR from puromycin-treated PBL and MLPA may be employed as the first screening step to detect PMS2 mutations without pseudogene interference, followed by the long-range PCR/nested PCR validation using genomic DNA. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  12. Elevated germline mutation rate in teenage fathers

    PubMed Central

    Forster, Peter; Hohoff, Carsten; Dunkelmann, Bettina; Schürenkamp, Marianne; Pfeiffer, Heidi; Neuhuber, Franz; Brinkmann, Bernd

    2015-01-01

    Men age and die, while cells in their germline are programmed to be immortal. To elucidate how germ cells maintain viable DNA despite increasing parental age, we analysed DNA from 24 097 parents and their children, from Europe, the Middle East and Africa. We chose repetitive microsatellite DNA that mutates (unlike point mutations) only as a result of cellular replication, providing us with a natural ‘cell-cycle counter’. We observe, as expected, that the overall mutation rate for fathers is seven times higher than for mothers. Also as expected, mothers have a low and lifelong constant DNA mutation rate. Surprisingly, however, we discover that (i) teenage fathers already set out from a much higher mutation rate than teenage mothers (potentially equivalent to 77–196 male germline cell divisions by puberty); and (ii) ageing men maintain sperm DNA quality similar to that of teenagers, presumably by using fresh batches of stem cells known as ‘A-dark spermatogonia’. PMID:25694621

  13. Variable Autosomal and X Divergence Near and Far from Genes Affects Estimates of Male Mutation Bias in Great Apes

    PubMed Central

    Narang, Pooja; Wilson Sayres, Melissa A.

    2016-01-01

    Male mutation bias, when more mutations are passed on via the male germline than via the female germline, is observed across mammals. One common way to infer the magnitude of male mutation bias, α, is to compare levels of neutral sequence divergence between genomic regions that spend different amounts of time in the male and female germline. For great apes, including human, we show that estimates of divergence are reduced in putatively unconstrained regions near genes relative to unconstrained regions far from genes. Divergence increases with increasing distance from genes on both the X chromosome and autosomes, but increases faster on the X chromosome than autosomes. As a result, ratios of X/A divergence increase with increasing distance from genes and corresponding estimates of male mutation bias are significantly higher in intergenic regions near genes versus far from genes. Future studies in other species will need to carefully consider the effect that genomic location will have on estimates of male mutation bias. PMID:27702816

  14. Inherited mutations in 17 breast cancer susceptibility genes among a large triple-negative breast cancer cohort unselected for family history of breast cancer.

    PubMed

    Couch, Fergus J; Hart, Steven N; Sharma, Priyanka; Toland, Amanda Ewart; Wang, Xianshu; Miron, Penelope; Olson, Janet E; Godwin, Andrew K; Pankratz, V Shane; Olswold, Curtis; Slettedahl, Seth; Hallberg, Emily; Guidugli, Lucia; Davila, Jaime I; Beckmann, Matthias W; Janni, Wolfgang; Rack, Brigitte; Ekici, Arif B; Slamon, Dennis J; Konstantopoulou, Irene; Fostira, Florentia; Vratimos, Athanassios; Fountzilas, George; Pelttari, Liisa M; Tapper, William J; Durcan, Lorraine; Cross, Simon S; Pilarski, Robert; Shapiro, Charles L; Klemp, Jennifer; Yao, Song; Garber, Judy; Cox, Angela; Brauch, Hiltrud; Ambrosone, Christine; Nevanlinna, Heli; Yannoukakos, Drakoulis; Slager, Susan L; Vachon, Celine M; Eccles, Diana M; Fasching, Peter A

    2015-02-01

    Recent advances in DNA sequencing have led to the development of breast cancer susceptibility gene panels for germline genetic testing of patients. We assessed the frequency of mutations in 17 predisposition genes, including BRCA1 and BRCA2, in a large cohort of patients with triple-negative breast cancer (TNBC) unselected for family history of breast or ovarian cancer to determine the utility of germline genetic testing for those with TNBC. Patients with TNBC (N = 1,824) unselected for family history of breast or ovarian cancer were recruited through 12 studies, and germline DNA was sequenced to identify mutations. Deleterious mutations were identified in 14.6% of all patients. Of these, 11.2% had mutations in the BRCA1 (8.5%) and BRCA2 (2.7%) genes. Deleterious mutations in 15 other predisposition genes were detected in 3.7% of patients, with the majority observed in genes involved in homologous recombination, including PALB2 (1.2%) and BARD1, RAD51D, RAD51C, and BRIP1 (0.3% to 0.5%). Patients with TNBC with mutations were diagnosed at an earlier age (P < .001) and had higher-grade tumors (P = .01) than those without mutations. Deleterious mutations in predisposition genes are present at high frequency in patients with TNBC unselected for family history of cancer. Mutation prevalence estimates suggest that patients with TNBC, regardless of age at diagnosis or family history of cancer, should be considered for germline genetic testing of BRCA1 and BRCA2. Although mutations in other predisposition genes are observed among patients with TNBC, better cancer risk estimates are needed before these mutations are used for clinical risk assessment in relatives. © 2014 by American Society of Clinical Oncology.

  15. Inherited Mutations in 17 Breast Cancer Susceptibility Genes Among a Large Triple-Negative Breast Cancer Cohort Unselected for Family History of Breast Cancer

    PubMed Central

    Couch, Fergus J.; Hart, Steven N.; Sharma, Priyanka; Toland, Amanda Ewart; Wang, Xianshu; Miron, Penelope; Olson, Janet E.; Godwin, Andrew K.; Pankratz, V. Shane; Olswold, Curtis; Slettedahl, Seth; Hallberg, Emily; Guidugli, Lucia; Davila, Jaime I.; Beckmann, Matthias W.; Janni, Wolfgang; Rack, Brigitte; Ekici, Arif B.; Slamon, Dennis J.; Konstantopoulou, Irene; Fostira, Florentia; Vratimos, Athanassios; Fountzilas, George; Pelttari, Liisa M.; Tapper, William J.; Durcan, Lorraine; Cross, Simon S.; Pilarski, Robert; Shapiro, Charles L.; Klemp, Jennifer; Yao, Song; Garber, Judy; Cox, Angela; Brauch, Hiltrud; Ambrosone, Christine; Nevanlinna, Heli; Yannoukakos, Drakoulis; Slager, Susan L.; Vachon, Celine M.; Eccles, Diana M.; Fasching, Peter A.

    2015-01-01

    Purpose Recent advances in DNA sequencing have led to the development of breast cancer susceptibility gene panels for germline genetic testing of patients. We assessed the frequency of mutations in 17 predisposition genes, including BRCA1 and BRCA2, in a large cohort of patients with triple-negative breast cancer (TNBC) unselected for family history of breast or ovarian cancer to determine the utility of germline genetic testing for those with TNBC. Patients and Methods Patients with TNBC (N = 1,824) unselected for family history of breast or ovarian cancer were recruited through 12 studies, and germline DNA was sequenced to identify mutations. Results Deleterious mutations were identified in 14.6% of all patients. Of these, 11.2% had mutations in the BRCA1 (8.5%) and BRCA2 (2.7%) genes. Deleterious mutations in 15 other predisposition genes were detected in 3.7% of patients, with the majority observed in genes involved in homologous recombination, including PALB2 (1.2%) and BARD1, RAD51D, RAD51C, and BRIP1 (0.3% to 0.5%). Patients with TNBC with mutations were diagnosed at an earlier age (P < .001) and had higher-grade tumors (P = .01) than those without mutations. Conclusion Deleterious mutations in predisposition genes are present at high frequency in patients with TNBC unselected for family history of cancer. Mutation prevalence estimates suggest that patients with TNBC, regardless of age at diagnosis or family history of cancer, should be considered for germline genetic testing of BRCA1 and BRCA2. Although mutations in other predisposition genes are observed among patients with TNBC, better cancer risk estimates are needed before these mutations are used for clinical risk assessment in relatives. PMID:25452441

  16. Tumor genome analysis includes germline genome: Are we ready for surprises?

    PubMed Central

    Catenacci, Daniel VT; Amico, Andrea L; Nielsen, Sarah M; Geynisman, Daniel M; Rambo, Brittany; Carey, George B; Gulden, Cassandra; Fackenthal, Jim; Marsh, Robert D; Kindler, Hedy L; Olopade, Olufunmilayo I

    2015-01-01

    We sought to describe the spectrum of potential and confirmed germline genomic events incidentally identified during routine medium-throughput somatic tumor DNA sequencing, and to provide a framework for pre- and post-test consent and counseling for patients and families. Targeted tumor-only next-generation sequencing (NGS) had been used to evaluate for possible druggable genomic events obtained from consecutive new patients with metastatic gastroesophageal, hepatobiliary or colorectal cancer seen at the University of Chicago. A panel of medical oncologists, cancer geneticists and genetic counselors retrospectively grouped these patients (N = 111) based on probability of possessing a potentially inherited mutation in a cancer susceptibility gene, both prior to and after incorporating tumor-only NGS results. High-risk patients (determined from NGS results) were contacted and counseled in person by a genetic counselor (N = 21). When possible and indicated, germline genetic testing was offered. Of 8 evaluable high-risk patients, 7 underwent germline testing. Three (37.5%) had confirmed actionable germline mutations (all in the BRCA2 gene). NGS offers promise, but poses significant challenges for oncologists who are ill prepared to handle incidental findings that have clinical implications for at risk family members. In this relatively small cohort of patients undergoing tumor genomic testing for gastrointestinal malignancies, we incidentally identified 3 BRCA2 mutations carriers. This report underscores the need for oncologists to develop a framework for pre- and post-test communication of risks to patients undergoing routine tumor-only sequencing. What's new? High-throughput, ‘next-generation sequencing’ (NGS) allows millions of DNA strands to be sequenced in parallel. NGS is increasingly used to test tumors for mutations that may guide therapy. Sometimes, however, this testing can reveal mutations that are known to be inherited, which means that family members are also at increased risk for cancer. How should this information be presented? This article underscores the need for oncologists to develop a framework for pre- and post-test communication and counseling regarding risk for patients undergoing tumor-only sequencing. PMID:25123297

  17. Mutation risk associated with paternal and maternal age in a cohort of retinoblastoma survivors.

    PubMed

    Mills, Melissa B; Hudgins, Louanne; Balise, Raymond R; Abramson, David H; Kleinerman, Ruth A

    2012-07-01

    Autosomal dominant conditions are known to be associated with advanced paternal age, and it has been suggested that retinoblastoma (Rb) also exhibits a paternal age effect due to the paternal origin of most new germline RB1 mutations. To further our understanding of the association of parental age and risk of de novo germline RB1 mutations, we evaluated the effect of parental age in a cohort of Rb survivors in the United States. A cohort of 262 Rb patients was retrospectively identified at one institution, and telephone interviews were conducted with parents of 160 survivors (65.3%). We classified Rb survivors into three groups: those with unilateral Rb were classified as sporadic if they had no or unknown family history of Rb, those with bilateral Rb were classified as having a de novo germline mutation if they had no or unknown family history of Rb, and those with unilateral or bilateral Rb, who had a family history of Rb, were classified as familial. We built two sets of nested logistic regression models to detect an increased odds of the de novo germline mutation classification related to older parental age compared to sporadic and familial Rb classifications. The modeling strategy evaluated effects of continuous increasing maternal and paternal age and 5-year age increases adjusted for the age of the other parent. Mean maternal ages for survivors classified as having de novo germline mutations and sporadic Rb were similar (28.3 and 28.5, respectively) as were mean paternal ages (31.9 and 31.2, respectively), and all were significantly higher than the weighted general US population means. In contrast, maternal and paternal ages for familial Rb did not differ significantly from the weighted US general population means. Although we noted no significant differences between mean maternal and paternal ages between each of the three Rb classification groups, we found increased odds of a survivor being in the de novo germline mutation group for each 5-year increase in paternal age, but these findings were not statistically significant (de novo vs. sporadic ORs 30-34 = 1.7 [0.7-4], ≥ 35 = 1.3 [0.5-3.3]; de novo vs. familial ORs 30-34 = 2.8 [1.0-8.4], ≥ 35 = 1.6 [0.6-4.6]). Our study suggests a weak paternal age effect for Rb resulting from de novo germline mutations consistent with the paternal origin of most of these mutations.

  18. Problem-Solving Test: Analysis of DNA Damage Recognizing Proteins in Yeast and Human Cells

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2013-01-01

    The experiment described in this test was aimed at identifying DNA repair proteins in human and yeast cells. Terms to be familiar with before you start to solve the test: DNA repair, germline mutation, somatic mutation, inherited disease, cancer, restriction endonuclease, radioactive labeling, [alpha-[superscript 32]P]ATP, [gamma-[superscript…

  19. The future: genetics advances in MEN1 therapeutic approaches and management strategies.

    PubMed

    Agarwal, Sunita K

    2017-10-01

    The identification of the multiple endocrine neoplasia type 1 ( MEN1 ) gene in 1997 has shown that germline heterozygous mutations in the MEN1 gene located on chromosome 11q13 predisposes to the development of tumors in the MEN1 syndrome. Tumor development occurs upon loss of the remaining normal copy of the MEN1 gene in MEN1-target tissues. Therefore, MEN1 is a classic tumor suppressor gene in the context of MEN1. This tumor suppressor role of the protein encoded by the MEN1 gene, menin, holds true in mouse models with germline heterozygous Men1 loss, wherein MEN1-associated tumors develop in adult mice after spontaneous loss of the remaining non-targeted copy of the Men1 gene. The availability of genetic testing for mutations in the MEN1 gene has become an essential part of the diagnosis and management of MEN1. Genetic testing is also helping to exclude mutation-negative cases in MEN1 families from the burden of lifelong clinical screening. In the past 20 years, efforts of various groups world-wide have been directed at mutation analysis, molecular genetic studies, mouse models, gene expression studies, epigenetic regulation analysis, biochemical studies and anti-tumor effects of candidate therapies in mouse models. This review will focus on the findings and advances from these studies to identify MEN1 germline and somatic mutations, the genetics of MEN1-related states, several protein partners of menin, the three-dimensional structure of menin and menin-dependent target genes. The ongoing impact of all these studies on disease prediction, management and outcomes will continue in the years to come. © 2017 Society for Endocrinology.

  20. No recombination of mtDNA after heteroplasmy for 50 generations in the mouse maternal germline

    PubMed Central

    Hagström, Erik; Freyer, Christoph; Battersby, Brendan J.; Stewart, James B.; Larsson, Nils-Göran

    2014-01-01

    Variants of mitochondrial DNA (mtDNA) are commonly used as markers to track human evolution because of the high sequence divergence and exclusive maternal inheritance. It is assumed that the inheritance is clonal, i.e. that mtDNA is transmitted between generations without germline recombination. In contrast to this assumption, a number of studies have reported the presence of recombinant mtDNA molecules in cell lines and animal tissues, including humans. If germline recombination of mtDNA is frequent, it would strongly impact phylogenetic and population studies by altering estimates of coalescent time and branch lengths in phylogenetic trees. Unfortunately, this whole area is controversial and the experimental approaches have been widely criticized as they often depend on polymerase chain reaction (PCR) amplification of mtDNA and/or involve studies of transformed cell lines. In this study, we used an in vivo mouse model that has had germline heteroplasmy for a defined set of mtDNA mutations for more than 50 generations. To assess recombination, we adapted and validated a method based on cloning of single mtDNA molecules in the λ phage, without prior PCR amplification, followed by subsequent mutation analysis. We screened 2922 mtDNA molecules and found no germline recombination after transmission of mtDNA under genetically and evolutionary relevant conditions in mammals. PMID:24163253

  1. A comprehensive functional analysis of PTEN mutations: implications in tumor- and autism-related syndromes.

    PubMed

    Rodríguez-Escudero, Isabel; Oliver, María D; Andrés-Pons, Amparo; Molina, María; Cid, Víctor J; Pulido, Rafael

    2011-11-01

    The PTEN (phosphatase and tensin homolog) phosphatase is unique in mammals in terms of its tumor suppressor activity, exerted by dephosphorylation of the lipid second messenger PIP(3) (phosphatidylinositol 3,4,5-trisphosphate), which activates the phosphoinositide 3-kinase/Akt/mTOR (mammalian target of rapamycin) oncogenic pathway. Loss-of-function mutations in the PTEN gene are frequent in human cancer and in the germline of patients with PTEN hamartoma tumor-related syndromes (PHTSs). In addition, PTEN is mutated in patients with autism spectrum disorders (ASDs), although no functional information on these mutations is available. Here, we report a comprehensive in vivo functional analysis of human PTEN using a heterologous yeast reconstitution system. Ala-scanning mutagenesis at the catalytic loops of PTEN outlined the critical role of residues within the P-catalytic loop for PIP(3) phosphatase activity in vivo. PTEN mutations that mimic the P-catalytic loop of mammalian PTEN-like proteins (TPTE, TPIP, tensins and auxilins) affected PTEN function variably, whereas tumor- or PHTS-associated mutations targeting the PTEN P-loop produced complete loss of function. Conversely, Ala-substitutions, as well as tumor-related mutations at the WPD- and TI-catalytic loops, displayed partial activity in many cases. Interestingly, a tumor-related D92N mutation was partially active, supporting the notion that the PTEN Asp92 residue might not function as the catalytic general acid. The analysis of a panel of ASD-associated hereditary PTEN mutations revealed that most of them did not substantially abrogate PTEN activity in vivo, whereas most of PHTS-associated mutations did. Our findings reveal distinctive functional patterns among PTEN mutations found in tumors and in the germline of PHTS and ASD patients, which could be relevant for therapy.

  2. Germline Mutations and Polymorphisms in the Origins of Cancers in Women

    PubMed Central

    Hirshfield, Kim M.; Rebbeck, Timothy R.; Levine, Arnold J.

    2010-01-01

    Several female malignancies including breast, ovarian, and endometrial cancers can be characterized based on known somatic and germline mutations. Initiation and propagation of tumors reflect underlying genomic alterations such as mutations, polymorphisms, and copy number variations found in genes of multiple cellular pathways. The contributions of any single genetic variation or mutation in a population depend on its frequency and penetrance as well as tissue-specific functionality. Genome wide association studies, fluorescence in situ hybridization, comparative genomic hybridization, and candidate gene studies have enumerated genetic contributors to cancers in women. These include p53, BRCA1, BRCA2, STK11, PTEN, CHEK2, ATM, BRIP1, PALB2, FGFR2, TGFB1, MDM2, MDM4 as well as several other chromosomal loci. Based on the heterogeneity within a specific tumor type, a combination of genomic alterations defines the cancer subtype, biologic behavior, and in some cases, response to therapeutics. Consideration of tumor heterogeneity is therefore important in the critical analysis of gene associations in cancer. PMID:20111735

  3. Deactivating germline mutations in LEMD3 cause osteopoikilosis and Buschke-Ollendorff syndrome, but not sporadic melorheostosis.

    PubMed

    Mumm, Steven; Wenkert, Deborah; Zhang, Xiafang; McAlister, William H; Mier, Richard J; Whyte, Michael P

    2007-02-01

    Autosomal dominant OPK and BOS feature widespread foci of osteosclerotic trabeculae without or with skin lesions, respectively. Occasionally, a larger area of dense bone in OPK or BOS resembles MEL, a sporadic sclerosing disorder primarily involving cortical bone. Others, finding deactivating germline LEMD3 mutations in OPK or BOS, concluded such defects explain all three conditions. We found germline LEMD3 mutations in OPK and BOS but not in sporadic MEL. In 2004, others discovered that heterozygous, loss-of-function, germline mutations in the LEMD3 gene (LEMD3 or MAN1) cause both osteopoikilosis (OPK) and Buschke-Ollendorff syndrome (BOS). OPK is an autosomal dominant, usually benign, skeletal dysplasia featuring multiple, small, especially metaphyseal, oval or round, dense trabecular foci distributed symmetrically throughout the skeleton. BOS combines OPK with connective tissue nevi comprised of collagen and elastin. In some OPK and BOS families, an individual may have relatively large, asymmetric areas of dense cortical bone interpreted as melorheostosis (MEL). MEL, however, classically refers to a sporadic, troublesome skeletal dysostosis featuring large, asymmetric, "flowing hyperostosis" of long bone cortices often with overlying, constricting soft tissue abnormalities. However, a heterozygous germline mutation in LEMD3 was offered to explain MEL. We studied 11 unrelated individuals with sclerosing bone disorders where LEMD3 mutation was a potential etiology: familial OPK (1), familial BOS (2), previously reported familial OPK with MEL (1), sporadic MEL (3), sporadic MEL with mixed-sclerosing-bone dystrophy (1), and patients with other unusual sclerosing bone disorders (3). All coding exons and adjacent mRNA splice sites for LEMD3 were amplified by PCR and sequenced using genomic DNA from leukocytes. We did not study lesional tissue from bone or skin. In the OPK family, a heterozygous nonsense mutation (c.1433T>A, p.L478X) was discovered in exon 1. In the two BOS families, a heterozygous nonsense mutation (exon 1, c.1323C>A, p.Y441X) and a heterozygous frame-shift mutation (exon 1, c.332_333insTC) were identified. In the individual with MEL and familial OPK, a heterozygous nonsense mutation (c.1963C>T, p.R655X) was detected in exon 7. However, no LEMD3 mutation was found for any other patient, including all four with sporadic MEL. We confirm that OPK and BOS individuals, including those with MEL-like lesions, have heterozygous, deactivating, germline LEMD3 mutations. However, MEL remains of unknown etiology.

  4. Autosomal dominant polycystic kidney disease caused by somatic and germline mosaicism.

    PubMed

    Tan, A Y; Blumenfeld, J; Michaeel, A; Donahue, S; Bobb, W; Parker, T; Levine, D; Rennert, H

    2015-04-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a heterogeneous genetic disorder caused by loss of function mutations of PKD1 or PKD2 genes. Although PKD1 is highly polymorphic and the new mutation rate is relatively high, the role of mosaicism is incompletely defined. Herein, we describe the molecular analysis of ADPKD in a 19-year-old female proband and her father. The proband had a PKD1 truncation mutation c.10745dupC (p.Val3584ArgfsX43), which was absent in paternal peripheral blood lymphocytes (PBL). However, very low quantities of this mutation were detected in the father's sperm DNA, but not in DNA from his buccal cells or urine sediment. Next generation sequencing (NGS) analysis determined the level of this mutation in the father's PBL, buccal cells and sperm to be ∼3%, 4.5% and 10%, respectively, consistent with somatic and germline mosaicism. The PKD1 mutation in ∼10% of her father's sperm indicates that it probably occurred early in embryogenesis. In ADPKD cases where a de novo mutation is suspected because of negative PKD gene testing of PBL, additional evaluation with more sensitive methods (e.g. NGS) of the proband PBL and paternal sperm can enhance detection of mosaicism and facilitate genetic counseling. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Tissue-specific time courses of spontaneous mutation frequency and deviations in mutation pattern are observed in middle to late adulthood in Big Blue mice.

    PubMed

    Hill, Kathleen A; Halangoda, Asanga; Heinmoeller, Petra W; Gonzalez, Kelly; Chitaphan, Chaniga; Longmate, Jeffrey; Scaringe, William A; Wang, Ji-Cheng; Sommer, Steve S

    2005-06-01

    To better define the time course of spontaneous mutation frequency in middle to late adulthood of the mouse, measurements were made at 10, 14, 17, 23, 25, and 30 months of age in samples of adipose tissue, liver, cerebellum (90% neurons), and the male germline (95% germ cells). A total of 46 million plaque-forming units (pfus) were screened at the six time points and 1,450 circular blue plaques were harvested and sequenced. These data improve resolution and confirm the previously observed occurrence of at least two tissue-specific profiles of spontaneous mutation frequency (elevation with age in adipose tissue and liver, and constancy with age in neurons and male germ cells), a low mutation frequency in the male germline, and a mutation pattern unchanged with age within a tissue. These findings appear to extend to very old age (30 months). Additional findings include interanimal variation in spontaneous mutation frequency is larger in adipose tissues and liver compared with neurons and male germ cells, and subtle but significant differences in the mutation pattern among tissues, consistent with a minor effect of tissue-specific metabolism. The presumptive unaltered balance of DNA damage and repair with age in the male germline has evolutionary consequences. It is of particular interest given the controversy over whether or not increasing germline mutation frequency with paternal age underlies the reports associating older males with a higher incidence of some types of genetic disease. These most detailed measurements available to date regarding the time course of spontaneous mutation frequency and pattern in individual tissues help to constrain hypotheses regarding the role of mutational mechanisms in DNA repair and aging.

  6. E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

    PubMed

    Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

    2017-01-01

    Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

  7. Mosaic parental germline mutations causing recurrent forms of malformations of cortical development

    PubMed Central

    Zillhardt, Julia Lauer; Poirier, Karine; Broix, Loïc; Lebrun, Nicolas; Elmorjani, Adrienne; Martinovic, Jelena; Saillour, Yoann; Muraca, Giuseppe; Nectoux, Juliette; Bessieres, Bettina; Fallet-Bianco, Catherine; Lyonnet, Stanislas; Dulac, Olivier; Odent, Sylvie; Rejeb, Imen; Jemaa, Lamia Ben; Rivier, Francois; Pinson, Lucile; Geneviève, David; Musizzano, Yuri; Bigi, Nicole; Leboucq, Nicolas; Giuliano, Fabienne; Philip, Nicole; Vilain, Catheline; Van Bogaert, Patrick; Maurey, Hélène; Beldjord, Cherif; Artiguenave, François; Boland, Anne; Olaso, Robert; Masson, Cécile; Nitschké, Patrick; Deleuze, Jean-François; Bahi-Buisson, Nadia; Chelly, Jamel

    2016-01-01

    To unravel missing genetic causes underlying monogenic disorders with recurrence in sibling, we explored the hypothesis of parental germline mosaic mutations in familial forms of malformation of cortical development (MCD). Interestingly, four families with parental germline variants, out of 18, were identified by whole-exome sequencing (WES), including a variant in a new candidate gene, syntaxin 7. In view of this high frequency, revision of diagnostic strategies and reoccurrence risk should be considered not only for the recurrent forms, but also for the sporadic cases of MCD. PMID:26395554

  8. MAX mutations status in Swedish patients with pheochromocytoma and paraganglioma tumours.

    PubMed

    Crona, Joakim; Maharjan, Rajani; Delgado Verdugo, Alberto; Stålberg, Peter; Granberg, Dan; Hellman, Per; Björklund, Peyman

    2014-03-01

    Pheochromocytoma (PCC) and Paraganglioma are rare tumours originating from neuroendocrine cells. Up to 60% of cases have either germline or somatic mutation in one of eleven described susceptibility loci, SDHA, SDHB, SDHC, SDHD, SDHAF2, VHL, EPAS1, RET, NF1, TMEM127 and MYC associated factor-X (MAX). Recently, germline mutations in MAX were found to confer susceptibility to PCC and paraganglioma (PGL). A subsequent multicentre study found about 1% of PCCs and PGLs to have germline or somatic mutations in MAX. However, there has been no study investigating the frequency of MAX mutations in a Scandinavian cohort. We analysed tumour specimens from 63 patients with PCC and PGL treated at Uppsala University hospital, Sweden, for re-sequencing of MAX using automated Sanger sequencing. Our results show that 0% (0/63) of tumours had mutations in MAX. Allele frequencies of known single nucleotide polymorphisms rs4902359, rs45440292, rs1957948 and rs1957949 corresponded to those available in the Single Nucleotide Polymorphism Database. We conclude that MAX mutations remain unusual events and targeted genetic screening should be considered after more common genetic events have been excluded.

  9. Germline Mutations of Inhibins in Early-Onset Ovarian Epithelial Tumors

    PubMed Central

    Tournier, Isabelle; Marlin, Régine; Walton, Kelly; Charbonnier, Françoise; Coutant, Sophie; Théry, Jean-Christophe; Charbonnier, Camille; Spurrell, Cailyn; Vezain, Myriam; Ippolito, Lorena; Bougeard, Gaëlle; Roman, Horace; Tinat, Julie; Sabourin, Jean-Christophe; Stoppa-Lyonnet, Dominique; Caron, Olivier; Bressac-de Paillerets, Brigitte; Vaur, Dominique; King, Mary-Claire; Harrison, Craig; Frebourg, Thierry

    2014-01-01

    To identify novel genetic bases of early-onset epithelial ovarian tumors, we used the trio exome sequencing strategy in a patient without familial history of cancer who presented metastatic serous ovarian adenocarcinomas at 21 years of age. We identified a single de novo mutation (c.1157A>G/p.Asn386Ser) within the INHBA gene encoding the βA-subunit of inhibins/activins, which play a key role in ovarian development. In vitro, this mutation alters the ratio of secreted activins and inhibins. In a second patient with early-onset serous borderline papillary cystadenoma, we identified an unreported germline mutation (c.179G>T/p.Arg60Leu) of the INHA gene encoding the α-subunit, the partner of the βA-subunit. This mutation also alters the secreted activin/inhibin ratio, by disrupting both inhibin A and inhibin B biosynthesis. In a cohort of 62 cases, we detected an additional unreported germline mutation of the INHBA gene (c.839G>A/p.Gly280Glu). Our results strongly suggest that inhibin mutations contribute to the genetic determinism of epithelial ovarian tumors. PMID:24302632

  10. Novel DNA variants and mutation frequencies of hMLH1 and hMSH2 genes in colorectal cancer in the Northeast China population.

    PubMed

    Hu, Fulan; Li, Dandan; Wang, Yibaina; Yao, Xiaoping; Zhang, Wencui; Liang, Jing; Lin, Chunqing; Ren, Jiaojiao; Zhu, Lin; Wu, Zhiwei; Li, Shuying; Li, Ye; Zhao, Xiaojuan; Cui, Binbin; Dong, Xinshu; Tian, Suli; Zhao, Yashuang

    2013-01-01

    Research on hMLH1 and hMSH2 mutations tend to focus on Lynch syndrome (LS) and LS-like colorectal cancer (CRC). No studies to date have assessed the role of hMLH1 and hMSH2 genes in mass sporadic CRC (without preselection by MSI or early age of onset). We aimed to identify novel hMLH1 and hMSH2 DNA variants, to determine the mutation frequencies and sites in both sporadic and LS CRC and their relationships with clinicopathological characteristics of CRC in Northeast of China. 452 sporadic and 21 LS CRC patients were screened for germline and somatic mutations in hMLH1 and hMSH2 genes with PCR-SSCP sequencing. We identified 11 hMLH1 and seven hMSH2 DNA variants in our study cohort. Six of them were novel: four in hMLH1 gene (IVS8-16 A>T, c.644 GAT>GTT, c.1529 CAG>CGG and c.1831 ATT>TTT) and two in hMSH2 gene (-39 C>T, insertion AACAACA at c.1127 and deletion AAG at c.1129). In sporadic CRC, germline and somatic mutation frequencies of hMLH1/hMSH2 gene were 15.59% and 17.54%, respectively (p = 0.52). Germline mutations present in hMLH1 and hMSH2 genes were 5.28% and 10.78%, respectively (p<0.01). Somatic mutations in hMLH1 and hMSH2 genes were 6.73% and 11.70%, respectively (p = 0.02). In LS CRC, both germline and somatic mutation frequencies of hMLH1/hMSH2 gene were 28.57%. The most prevalent germline mutation site in hMSH2 gene was c.1168 CTT>TTT (3.90%), a polymorphism. Somatic mutation frequency of hMLH1/hMSH2 gene was significantly different in proximal, distal colon and rectal cancer (p = 0.03). Our findings elucidate the mutation spectrum and frequency of hMLH1 and hMSH2 genes in sporadic and LS CRC, and their relationships with clinicopathological characteristics of CRC.

  11. Almost 2% of Spanish breast cancer families are associated to germline pathogenic mutations in the ATM gene.

    PubMed

    Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A

    2017-02-01

    There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.

  12. A Recurrent Mutation in PARK2 Is Associated with Familial Lung Cancer

    PubMed Central

    Xiong, Donghai; Wang, Yian; Kupert, Elena; Simpson, Claire; Pinney, Susan M.; Gaba, Colette R.; Mandal, Diptasri; Schwartz, Ann G.; Yang, Ping; de Andrade, Mariza; Pikielny, Claudio; Byun, Jinyoung; Li, Yafang; Stambolian, Dwight; Spitz, Margaret R.; Liu, Yanhong; Amos, Christopher I.; Bailey-Wilson, Joan E.; Anderson, Marshall; You, Ming

    2015-01-01

    PARK2, a gene associated with Parkinson disease, is a tumor suppressor in human malignancies. Here, we show that c.823C>T (p.Arg275Trp), a germline mutation in PARK2, is present in a family with eight cases of lung cancer. The resulting amino acid change, p.Arg275Trp, is located in the highly conserved RING finger 1 domain of PARK2, which encodes an E3 ubiquitin ligase. Upon further analysis, the c.823C>T mutation was detected in three additional families affected by lung cancer. The effect size for PARK2 c.823C>T (odds ratio = 5.24) in white individuals was larger than those reported for variants from lung cancer genome-wide association studies. These data implicate this PARK2 germline mutation as a genetic susceptibility factor for lung cancer. Our results provide a rationale for further investigations of this specific mutation and gene for evaluation of the possibility of developing targeted therapies against lung cancer in individuals with PARK2 variants by compensating for the loss-of-function effect caused by the associated variation. PMID:25640678

  13. The clinical phenotype of Lynch syndrome due to germline PMS2 mutations

    PubMed Central

    Senter, Leigha; Clendenning, Mark; Sotamaa, Kaisa; Hampel, Heather; Green, Jane; Potter, John D.; Lindblom, Annika; Lagerstedt, Kristina; Thibodeau, Stephen N.; Lindor, Noralane M.; Young, Joanne; Winship, Ingrid; Dowty, James G.; White, Darren M.; Hopper, John L.; Baglietto, Laura; Jenkins, Mark A.; de la Chapelle, Albert

    2009-01-01

    Background and Aims Although the clinical phenotype of Lynch syndrome (also known as Hereditary Nonpolyposis Colorectal Cancer) has been well described, little is known about disease in PMS2 mutation carriers. Now that mutation detection methods can discern mutations in PMS2 from mutations in its pseudogenes, more mutation carriers have been identified. Information about the clinical significance of PMS2 mutations is crucial for appropriate counseling. Here, we report the clinical characteristics of a large series of PMS2 mutation carriers. Methods We performed PMS2 mutation analysis using long range PCR and MLPA for 99 probands diagnosed with Lynch syndrome-associated tumors showing isolated loss of PMS2 by immunohistochemistry. Penetrance was calculated using a modified segregation analysis adjusting for ascertainment. Results Germline PMS2 mutations were detected in 62% of probands (n = 55 monoallelic; 6 biallelic). Among families with monoallelic PMS2 mutations, 65.5% met revised Bethesda guidelines. Compared with the general population, in mutation carriers, the incidence of colorectal cancer was 5.2 fold higher and the incidence of endometrial cancer was 7.5 fold higher. In North America, this translates to a cumulative cancer risk to age 70 of 15–20% for colorectal cancer, 15% for endometrial cancer, and 25–32% for any Lynch syndrome-associated cancer. No elevated risk for non-Lynch syndrome-associated cancers was observed. Conclusions PMS2 mutations contribute significantly to Lynch syndrome but the penetrance for monoallelic mutation carriers appears to be lower than that for the other mismatch repair genes. Modified counseling and cancer surveillance guidelines for PMS2 mutation carriers are proposed. PMID:18602922

  14. The clinical phenotype of Lynch syndrome due to germ-line PMS2 mutations.

    PubMed

    Senter, Leigha; Clendenning, Mark; Sotamaa, Kaisa; Hampel, Heather; Green, Jane; Potter, John D; Lindblom, Annika; Lagerstedt, Kristina; Thibodeau, Stephen N; Lindor, Noralane M; Young, Joanne; Winship, Ingrid; Dowty, James G; White, Darren M; Hopper, John L; Baglietto, Laura; Jenkins, Mark A; de la Chapelle, Albert

    2008-08-01

    Although the clinical phenotype of Lynch syndrome (also known as hereditary nonpolyposis colorectal cancer) has been well described, little is known about disease in PMS2 mutation carriers. Now that mutation detection methods can discern mutations in PMS2 from mutations in its pseudogenes, more mutation carriers have been identified. Information about the clinical significance of PMS2 mutations is crucial for appropriate counseling. Here, we report the clinical characteristics of a large series of PMS2 mutation carriers. We performed PMS2 mutation analysis using long-range polymerase chain reaction and multiplex ligation-dependent probe amplification for 99 probands diagnosed with Lynch syndrome-associated tumors showing isolated loss of PMS2 by immunohistochemistry. Penetrance was calculated using a modified segregation analysis adjusting for ascertainment. Germ-line PMS2 mutations were detected in 62% of probands (n = 55 monoallelic; 6 biallelic). Among families with monoallelic PMS2 mutations, 65.5% met revised Bethesda guidelines. Compared with the general population, in mutation carriers, the incidence of colorectal cancer was 5.2-fold higher, and the incidence of endometrial cancer was 7.5-fold higher. In North America, this translates to a cumulative cancer risk to age 70 years of 15%-20% for colorectal cancer, 15% for endometrial cancer, and 25%-32% for any Lynch syndrome-associated cancer. No elevated risk for non-Lynch syndrome-associated cancers was observed. PMS2 mutations contribute significantly to Lynch syndrome, but the penetrance for monoallelic mutation carriers appears to be lower than that for the other mismatch repair genes. Modified counseling and cancer surveillance guidelines for PMS2 mutation carriers are proposed.

  15. Molecular characterization of the breakpoints of a 12-kb deletion in the NF1 gene in a family showing germ-line mosaicism.

    PubMed Central

    Lázaro, C; Gaona, A; Lynch, M; Kruyer, H; Ravella, A; Estivill, X

    1995-01-01

    Neurofibromatosis type 1 (NF1) is caused by deletions, insertions, translocations, and point mutations in the NF1 gene, which spans 350 kb on the long arm of human chromosome 17. Although several point mutations have been described, large molecular abnormalities have rarely been characterized in detail. We describe here the molecular breakpoints of a 12-kb deletion of the NF1 gene, which is responsible for the NF1 phenotype in a kindred with two children affected because of germline mosaicism in the unaffected father, who has the mutation in 10% of his spermatozoa. The mutation spans introns 31-39, removing 12,021 nt and inserting 30 bp, of which 19 bp are a direct repetition of a sequence located in intron 31, just 4 bp before the 5' breakpoint. The 5' and 3' breakpoints contain the sequence TATTTTA, which could be involved in the generation of the deletion. The most plausible explanation for the mechanism involved in the generation of this 12-kb deletion is homologous/nonhomologous recombination. Since sperm of the father does not contain the corresponding insertion of the 12-kb deleted sequence, this deletion could have occurred within the NF1 chromosome through loop formation. RNA from lymphocytes of one of the NF1 patients showed similar levels of the mutated and normal transcripts, suggesting that the NF1-mRNA from mutations causing frame shifts of the reading frame or stop codons in this gene is not degraded during its processing. The mutation was not detected in fresh lymphocytes from the unaffected father by PCR analysis, supporting the case for true germ-line mosaicism. Images Figure 1 Figure 3 PMID:7485153

  16. Detecting Germline PTEN Mutations Among At-Risk Patients With Cancer: An Age- and Sex-Specific Cost-Effectiveness Analysis.

    PubMed

    Ngeow, Joanne; Liu, Chang; Zhou, Ke; Frick, Kevin D; Matchar, David B; Eng, Charis

    2015-08-10

    Cowden syndrome (CS) is an autosomal dominant disorder characterized by benign and malignant tumors. One-quarter of patients who are diagnosed with CS have pathogenic germline PTEN mutations, which increase the risk of the development of breast, thyroid, uterine, renal, and other cancers. PTEN testing and regular, intensive cancer surveillance allow for early detection and treatment of these cancers for mutation-positive patients and their relatives. Individual CS-related features, however, occur commonly in the general population, making it challenging for clinicians to identify CS-like patients to offer PTEN testing. We calculated the cost per mutation detected and analyzed the cost-effectiveness of performing selected PTEN testing among CS-like patients using a semi-quantitative score (the PTEN Cleveland Clinic [CC] score) compared with existing diagnostic criteria. In our model, first-degree relatives of the patients with detected PTEN mutations are offered PTEN testing. All individuals with detected PTEN mutations are offered cancer surveillance. CC score at a threshold of 15 (CC15) costs from $3,720 to $4,573 to detect one PTEN mutation, which is the most inexpensive among the different strategies. At base-case, CC10 is the most cost-effective strategy for female patients who are younger than 40 years, and CC15 is the most cost-effective strategy for female patients who are between 40 and 60 years of age and male patients of all ages. In sensitivity analyses, CC15 is robustly the most cost-effective strategy for probands who are younger than 60 years. Use of the CC score as a clinical risk calculator is a cost-effective prescreening method to identify CS-like patients for PTEN germline testing. © 2015 by American Society of Clinical Oncology.

  17. Age at cancer onset in germline TP53 mutation carriers: association with polymorphisms in predicted G-quadruplex structures

    PubMed Central

    Hainaut, Pierre

    2014-01-01

    Germline TP53 mutations predispose to multiple cancers defining Li-Fraumeni/Li-Fraumeni-like syndrome (LFS/LFL), a disease with large individual disparities in cancer profiles and age of onset. G-quadruplexes (G4s) are secondary structural motifs occurring in guanine tracks, with regulatory effects on DNA and RNA. We analyzed 85 polymorphisms within or near five predicted G4s in TP53 in search of modifiers of penetrance of LFS/LFL in Brazilian cancer families with (n = 35) or without (n = 110) TP53 mutations. Statistical analyses stratified on family structure showed that cancer tended to occur ~15 years later in mutation carriers who also carried the variant alleles of two polymorphisms within predicted G4-forming regions, rs17878362 (TP53 PIN3, 16 bp duplication in intron 3; P = 0.082) and rs17880560 (6 bp duplication in 3′ flanking region; P = 0.067). Haplotype analysis showed that this inverse association was driven by the polymorphic status of the remaining wild-type (WT) haplotype in mutation carriers: in carriers with a WT haplotype containing at least one variant allele of rs17878362 or rs17880560, cancer occurred ~15 years later than in carriers with other WT haplotypes (P = 0.019). No effect on age of cancer onset was observed in subjects without a TP53 mutation. The G4 in intron 3 has been shown to regulate alternative p53 messenger RNA splicing, whereas the biological roles of predicted G4s in the 3′ flanking region remain to be elucidated. In conclusion, this study demonstrates that G4 polymorphisms in haplotypes of the WT TP53 allele have an impact on LFS/LFL penetrance in germline TP53 mutation carriers. PMID:24336192

  18. Disruption of the APC gene by t(5;7) translocation in a Turcot family.

    PubMed

    Sahnane, Nora; Bernasconi, Barbara; Carnevali, Ileana; Furlan, Daniela; Viel, Alessandra; Sessa, Fausto; Tibiletti, Maria Grazia

    2016-03-01

    Turcot syndrome (TS) refers to the combination of colorectal polyps and primary tumours of the central nervous system. TS is a heterogeneous genetic condition due to APC and/or mismatch repair germline mutations. When APC is involved the vast majority of mutations are truncating, but in approximately 20%-30% of patients with familial polyposis no germline mutation can be found. A 30-year-old Caucasian woman with a positive pedigree for TS was referred to our Genetic Counselling Service. She was negative for APC and MUTYH but showed a reciprocal balanced translocation t(5;7)(q22;p15) at chromosome analysis. FISH analysis using specific BAC probes demonstrated that 5q22 breakpoint disrupted the APC gene. Transcript analysis by MLPA and digital PCR revealed that the cytogenetic rearrangement involving the 3' end of the APC gene caused a defective expression of a truncated transcript. This result allowed cytogenetic analysis to be offered to all the other family members and segregation analysis clearly demonstrated that all the carriers were affected, whereas non-carriers did not have the polyposis. A cytogenetic approach permitted the identification of the mutation-causing disease in this family, and the segregation analysis together with the transcript study supported the pathogenetic role of this mutation. Karyotype analysis was used as a predictive test in all members of this family. This family suggests that clinically positive TS and FAP cases, which test negative with standard molecular analysis, could be easily and cost-effectively resolved by a classical and molecular cytogenetic approach. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Germline and somatic JAK2 mutations and susceptibility to chronic myeloproliferative neoplasms

    PubMed Central

    2009-01-01

    Myeloproliferative neoplasms (MPNs) are a group of closely related stem-cell-derived clonal proliferative diseases. Most cases are sporadic but first-degree relatives of MPN patients have a five- to seven-fold increased risk for developing an MPN. The tumors of most patients carry a mutation in the Janus kinase 2 gene (JAK2V617F). Recently, three groups have described a strong association of JAK2 germline polymorphisms with MPN in patients positive for JAK2V617F. The somatic mutation occurs primarily on one particular germline JAK2 haplotype, which may account for as much as 50% of the risk to first-degree relatives. This finding provides new directions for unraveling the pathogenesis of MPN. PMID:19490586

  20. Rhabdoid tumor predisposition syndrome caused by SMARCB1 constitutional deletion: prenatal detection of new case of recurrence in siblings due to gonadal mosaicism.

    PubMed

    Gigante, Laura; Paganini, Irene; Frontali, Marina; Ciabattoni, Serena; Sangiuolo, Federica Carla; Papi, Laura

    2016-01-01

    Rhabdoid tumors are aggressive malignancies that show loss-of-function mutations of SMARCB1 gene, a member of the SWI/SNF chromatin-remodeling complex controlling gene transcription. One-third of patients affected by rhabdoid tumor harbor a germ-line mutation of SMARCB1 defining a rhabdoid tumor predisposition syndrome. The occurrence of a second somatic mutation determines the development of neoplasia in a two-hit model. Most germ-line mutations occur de novo, and few cases of recurrence in a sibship have been described. Here we report on a new Italian family with recurrence of SMARCB1 germ-line deletion in two siblings due to gonadal mosaicism. The deletion was identified in the 9-month-old proband with malignant rhabdoid tumor of the right kidney and disseminated metastases. Testing of both parents confirmed the de novo origin of the mutation, but recurrence was then detected prenatally in a new pregnancy. This is the sixth family with malignant rhabdoid tumor predisposition syndrome with the recurrence of the same germ-line SMARCB1 mutation in the sibship but not in healthy parents, suggesting that gonadal mosaicism is a less rare event than supposed. The clinical outcome in our patient confirms previous data of poorer outcome in patients with rhabdoid tumor predisposition syndrome.

  1. Multiple endocrine neoplasia type 1: analysis of germline MEN1 mutations in the Italian multicenter MEN1 patient database.

    PubMed

    Marini, Francesca; Giusti, Francesca; Fossi, Caterina; Cioppi, Federica; Cianferotti, Luisella; Masi, Laura; Boaretto, Francesca; Zovato, Stefania; Cetani, Filomena; Colao, Annamaria; Davì, Maria Vittoria; Faggiano, Antongiulio; Fanciulli, Giuseppe; Ferolla, Piero; Ferone, Diego; Loli, Paola; Mantero, Franco; Marcocci, Claudio; Opocher, Giuseppe; Beck-Peccoz, Paolo; Persani, Luca; Scillitani, Alfredo; Guizzardi, Fabiana; Spada, Anna; Tomassetti, Paola; Tonelli, Francesco; Brandi, Maria Luisa

    2018-03-01

    Multiple endocrine neoplasia type 1 (MEN1) is caused by germline inactivating mutations of the MEN1 gene. Currently, no direct genotype-phenotype correlation is identified. We aim to analyze MEN1 mutation site and features, and possible correlations between the mutation type and/or the affected menin functional domain and clinical presentation in patients from the Italian multicenter MEN1 database, one of the largest worldwide MEN1 mutation series published to date. The study included the analysis of MEN1 mutation profile in 410 MEN1 patients [370 familial cases from 123 different pedigrees (48 still asymptomatic at the time of this study) and 40 single cases]. We identified 99 different mutations: 41 frameshift [small intra-exon deletions (28) or insertions (13)], 13 nonsense, 26 missense and 11 splicing site mutations, 4 in-frame small deletions, and 4 intragenic large deletions spanning more than one exon. One family had two different inactivating MEN1 mutations on the same allele. Gastro-entero-pancreatic tumors resulted more frequent in patients with a nonsense mutation, and thoracic neuroendocrine tumors in individuals bearing a splicing-site mutation. Our data regarding mutation type frequency and distribution are in accordance with previously published data: MEN1 mutations are scattered through the entire coding region, and truncating mutations are the most common in MEN1 syndrome. A specific direct correlation between MEN1 genotype and clinical phenotype was not found in all our families, and wide intra-familial clinical variability and variable disease penetrance were both confirmed, suggesting a role for modifying, still undetermined, factors, explaining the variable MEN1 tumorigenesis.

  2. Evidence that human immunoglobulin M rheumatoid factors can Be derived from the natural autoantibody pool and undergo an antigen driven immune response in which somatically mutated rheumatoid factors have lower affinities for immunoglobulin G Fc than their germline counterparts.

    PubMed

    Carayannopoulos, M O; Potter, K N; Li, Y; Natvig, J B; Capra, J D

    2000-04-01

    The question of whether immunoglobulin (Ig)M rheumatoid factors (RF) arise as the result of an abnormal expansion of already existing clones producing natural autoantibodies or emerge as new clones that are somatically mutated owing to an antigen driven immune response has never been conclusively answered. In this study, an inhibition ELISA was utilized to measure the affinities of recombinant antibodies using VH segments reverted back to their closest germline counterparts (germline revertants). In all cases, the somatically mutated parental RFs had a decreased affinity for immunoglobulin (Ig)G Fc compared to the germline revertant, indicating that the antibodies in the germline configuration had the higher affinities. This demonstrates that somatic mutation is not a prerequisite to generate disease associated antibodies. The presence of mutations in the parental IgM RFS suggests that these cells had been involved in a germinal centre reaction. As the germinal centre is the conventional site of the acquisition of mutations during an antigen driven response, these data suggest a role for germinal centres in the generation of the antibody diversity in addition to the selection of higher affinity antibodies. Assuming that only antigen selected cells survive deletion, these data support the hypothesis that IgM RFS can be derived from the natural autoantibody repertoire and result from an antigen driven response. Mechanisms controlling the survival of B cells based on the affinity/avidity of the immunoglobulin receptor are shown to be functional in patients with rheumatoid arthritis.

  3. Expanding the spectrum of phenotypes associated with germline PIGA mutations: a child with developmental delay, accelerated linear growth, facial dysmorphisms, elevated alkaline phosphatase, and progressive CNS abnormalities.

    PubMed

    van der Crabben, Saskia N; Harakalova, Magdalena; Brilstra, Eva H; van Berkestijn, Frédérique M C; Hofstede, Floris C; van Vught, Adrianus J; Cuppen, Edwin; Kloosterman, Wigard; Ploos van Amstel, Hans Kristian; van Haaften, Gijs; van Haelst, Mieke M

    2014-01-01

    Phosphatidyl inositol glycan (PIG) enzyme subclasses are involved in distinct steps of glycosyl phosphatidyl inositol anchor protein biosynthesis. Glycolsyl phosphatidyl inositol-anchored proteins have heterogeneous functions; they can function as enzymes, adhesion molecules, complement regulators and co-receptors in signal transduction pathways. Germline mutations in genes encoding different members of the PIG family result in diverse conditions with (severe) developmental delay, (neonatal) seizures, hypotonia, CNS abnormalities, growth abnormalities, and congenital abnormalities as hallmark features. The variability of clinical features resembles the typical diversity of other glycosylation pathway deficiencies such as the congenital disorders of glycosylation. Here, we report the first germline missense mutation in the PIGA gene associated with accelerated linear growth, obesity, central hypotonia, severe refractory epilepsy, cardiac anomalies, mild facial dysmorphic features, mildly elevated alkaline phosphatase levels, and CNS anomalies consisting of progressive cerebral atrophy, insufficient myelinization, and cortical MRI signal abnormalities. X-exome sequencing in the proband identified a c.278C>T (p.Pro93Leu) mutation in the PIGA gene. The mother and maternal grandmother were unaffected carriers and the mother showed 100% skewing of the X-chromosome harboring the mutation. These results together with the clinical similarity of the patient reported here and the previously reported patients with a germline nonsense mutation in PIGA support the determination that this mutation caused the phenotype in this family. © 2013 Wiley Periodicals, Inc.

  4. A novel deletion in the splice donor site of MLH1 exon 6 in a Japanese colon cancer patient with Lynch syndrome.

    PubMed

    Yamaguchi, Junya; Sato, Yuri; Kita, Mizuho; Nomura, Sachio; Yamamoto, Noriko; Kato, Yo; Ishikawa, Yuichi; Arai, Masami

    2015-10-01

    Lynch syndrome is an autosomal dominantly inherited disease that is characterized by a predisposition to cancers, mainly colorectal cancer. Germline mutations of DNA mismatch repair genes such as MLH1, MSH2, MSH6 and PMS2 have been described in patients with Lynch syndrome. Here, we report deletion of 2 bp in the splice donor site of the MLH1 exon 6 (c.545+4_545+5delCA) in a 48-year-old Japanese woman with Lynch syndrome. RT-PCR direct sequencing analysis revealed that this mutation led to an increase in the level of an MLH1 transcript in which exon 6 was skipped, and may cause a frameshift (p.E153FfsX8). Therefore, this mutation appears to be pathogenic and is responsible for Lynch syndrome. Additionally, analysis of the patient's tumor cells indicated microsatellite instability high phenotype and loss of the MLH1 and PMS2 proteins. To our knowledge, this is a germline splice site mutation of MLH1 that has not been reported previously. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Multiplex screening for RB1 germline mutations in 106 patients with hereditary retinoblastoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lohmann, D.R.; Brandt, B.; Passarge, E.

    1994-09-01

    The identification of germline mutations in the retinoblastoma susceptibility gene (RB1) is important for genetic counseling in hereditary retinoblastoma. Due to the complex genomic organization of this gene and the heterogeneity of mutations, efficient screening procedures are important for rapid mutation detection. We have developed methods based on simultaneous analysis of multiple regions of this gene in an ABI automated DNA fragment analyzer to examine 106 patients with hereditary retinoblastoma in which no alteration was identified by Southern blot hybridization. Primers for the amplification of all 27 exons of the RB1 gene as well as the promoter and poly(A) signalmore » sequences were labelled with distinct fluorescent dyes (FAM, HEX, TAMRA) to enable simultaneous electrophoretic analysis of PCR products with similar mobility. PCR fragments distinguishable by size or color were co-amplified by multiplex PCR and analyzed for length by GENESCAN analysis. Using this approach, small deletions ranging from 1 bp to 22 bp were identified in 24 patients (23%). Short sequence repeats or polypyrimidine runs were present in the vicinity of most of these deletions. In 4 patients (4%), insertions from 1 bp to 4 bp were found. The majority of length mutations resulted in a truncated gene product due to frameshift and premature termination. No mutation was identified in exons 25 to 27 possibly indicating that the encoded protein domains have minor functional importance. In order to screen for base substitutions that are not detectable by fragment length analysis, we adapted heteroduplex analysis for the use in the DNA fragment analyzer. During the optimization of this method we detected 10 single base substitutions most of which generated stop codons. Intriguingly, two identical missense mutations were identified in two unrelated families with a low-penetrance phenotype.« less

  6. Double heterozygotes among breast cancer patients analyzed for BRCA1, CHEK2, ATM, NBN/NBS1, and BLM germ-line mutations.

    PubMed

    Sokolenko, Anna P; Bogdanova, Natalia; Kluzniak, Wojciech; Preobrazhenskaya, Elena V; Kuligina, Ekatherina S; Iyevleva, Aglaya G; Aleksakhina, Svetlana N; Mitiushkina, Natalia V; Gorodnova, Tatiana V; Bessonov, Alexandr A; Togo, Alexandr V; Lubiński, Jan; Cybulski, Cezary; Jakubowska, Anna; Dörk, Thilo; Imyanitov, Evgeny N

    2014-06-01

    17 double heterozygous (DH) breast cancer (BC) patients were identified upon the analysis of 5,391 affected women for recurrent Slavic mutations in BRCA1, CHEK2, NBN/NBS1, ATM, and BLM genes. Double heterozygosity was found for BRCA1 and BLM (4 patients), BRCA1 and CHEK2 (4 patients), CHEK2 and NBS1 (3 patients), BRCA1 and ATM (2 patients), CHEK2 and BLM (2 patients), CHEK2 and ATM (1 patient), and NBS1 and BLM (1 patient). DH BC patients were on average not younger than single mutation carriers and did not have an excess of bilateral BC; an additional non-breast tumor was documented in two BRCA1/BLM DH patients (ovarian cancer and lymphoplasmacytic lymphoma). Loss-of-heterozygosity (LOH) analysis of involved genes was performed in 5 tumors, and revealed a single instance of somatic loss of the wild-type allele (LOH at CHEK2 locus in BRCA1/CHEK2 double heterozygote). Distribution of mutations in patients and controls favors the hypothesis on multiplicative interaction between at least some of the analyzed genes. Other studies on double heterozygosity for BC-predisposing germ-line mutations are reviewed.

  7. 8-oxoguanine causes spontaneous de novo germline mutations in mice.

    PubMed

    Ohno, Mizuki; Sakumi, Kunihiko; Fukumura, Ryutaro; Furuichi, Masato; Iwasaki, Yuki; Hokama, Masaaki; Ikemura, Toshimichi; Tsuzuki, Teruhisa; Gondo, Yoichi; Nakabeppu, Yusaku

    2014-04-15

    Spontaneous germline mutations generate genetic diversity in populations of sexually reproductive organisms, and are thus regarded as a driving force of evolution. However, the cause and mechanism remain unclear. 8-oxoguanine (8-oxoG) is a candidate molecule that causes germline mutations, because it makes DNA more prone to mutation and is constantly generated by reactive oxygen species in vivo. We show here that endogenous 8-oxoG caused de novo spontaneous and heritable G to T mutations in mice, which occurred at different stages in the germ cell lineage and were distributed throughout the chromosomes. Using exome analyses covering 40.9 Mb of mouse transcribed regions, we found increased frequencies of G to T mutations at a rate of 2 × 10(-7) mutations/base/generation in offspring of Mth1/Ogg1/Mutyh triple knockout (TOY-KO) mice, which accumulate 8-oxoG in the nuclear DNA of gonadal cells. The roles of MTH1, OGG1, and MUTYH are specific for the prevention of 8-oxoG-induced mutation, and 99% of the mutations observed in TOY-KO mice were G to T transversions caused by 8-oxoG; therefore, we concluded that 8-oxoG is a causative molecule for spontaneous and inheritable mutations of the germ lineage cells.

  8. A Cost-Effectiveness Evaluation of Germline BRCA1 and BRCA2 Testing in UK Women with Ovarian Cancer.

    PubMed

    Eccleston, Anthony; Bentley, Anthony; Dyer, Matthew; Strydom, Ann; Vereecken, Wim; George, Angela; Rahman, Nazneen

    2017-04-01

    To evaluate the long-term cost-effectiveness of germline BRCA1 and BRCA2 (collectively termed "BRCA") testing in women with epithelial ovarian cancer, and testing for the relevant mutation in first- and second-degree relatives of BRCA mutation-positive individuals, compared with no testing. Female BRCA mutation-positive relatives of patients with ovarian cancer could undergo risk-reducing mastectomy and/or bilateral salpingo-oophorectomy. A cost-effectiveness model was developed that included the risks of breast and ovarian cancer; the costs, utilities, and effects of risk-reducing surgery on cancer rates; and the costs, utilities, and mortality rates associated with cancer. BRCA testing of all women with epithelial ovarian cancer each year is cost-effective at a UK willingness-to-pay threshold of £20,000/quality-adjusted life-year (QALY) compared with no testing, with an incremental cost-effectiveness ratio of £4,339/QALY. The result was primarily driven by fewer cases of breast cancer (142) and ovarian cancer (141) and associated reductions in mortality (77 fewer deaths) in relatives over the subsequent 50 years. Sensitivity analyses showed that the results were robust to variations in the input parameters. Probabilistic sensitivity analysis showed that the probability of germline BRCA mutation testing being cost-effective at a threshold of £20,000/QALY was 99.9%. Implementing germline BRCA testing in all patients with ovarian cancer would be cost-effective in the United Kingdom. The consequent reduction in future cases of breast and ovarian cancer in relatives of mutation-positive individuals would ease the burden of cancer treatments in subsequent years and result in significantly better outcomes and reduced mortality rates for these individuals. Copyright © 2017 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

  9. Late manifestation of subclinical hyperthyroidism after goitrogenesis in an index patient with a N670S TSH receptor germline mutation masquerading as TSH receptor antibody negative Graves' disease.

    PubMed

    Schaarschmidt, J; Paschke, S; Özerden, M; Jäschke, H; Huth, S; Eszlinger, M; Meller, J; Paschke, R

    2012-12-01

    In 27 families with familial non-autoimmune hyperthyroidism (FNAH) reported up to date, the onset of hyperthyroidism varies from 18 months to 60 years. Also the manifestation of goitres is variable in these families. A 74-year-old woman first presented at the age of 69 years with tachyarrhythmia and hypertension. After initial treatment of her hypertension and oral anticoagulation for her intermittent atrial fibrillation, a thyroid workup revealed a suppressed TSH and normal fT3 and fT4. TPO, TSH receptor (TSHR), and thyroglobulin antibodies were negative. Thyroid ultrasound revealed a thyroid volume of 102 ml with several nodules with diameters of up to 2.6 cm right and up to 1.8 cm left. Scintigraphy showed a homogeneous Technetium-99 m ((99 m)Tc) uptake of 1.27%. She was subsequently treated with 1 GBq radioiodine ((131)I). At the age of 74, her thyroid function was normal and her thyroid volume decreased to 90 ml. Because of the diffuse (99 m)Tc uptake and the negative TPO, TSHR, and thyroglobulin antibodies, genetic analysis of her TSHR gene was performed, in spite of her negative family history for hyperthyroidism. Sequencing revealed a N670S TSHR germline mutation. Previous in vitro characterisation of this TSHR mutation suggests a weak constitutive activity, yet the experimental data are ambiguous. This case illustrates the necessity to analyse patients with hyperthyroidism accompanied by diffuse (99 m)Tc uptake and negative TPO, TSHR, and thyroglobulin antibodies for TSHR germline mutations. Moreover, it demonstrates that TSHR germline mutations may first lead to longstanding nodular goitrogenesis before the late manifestation of subclinical hyperthyroidism. © Georg Thieme Verlag KG Stuttgart · New York.

  10. Mutation rates for 20 STR loci in a population from São Paulo state, Southeast, Brazil.

    PubMed

    Martinez, Juliana; Braganholi, Danilo Faustino; Ambrósio, Isabela Brunelli; Polverari, Fernanda Silva; Cicarelli, Regina Maria Barretto

    2017-11-01

    Short tandem repeats (STRs) are genetic markers largely employed in forensic analysis and paternity investigation cases. When an inconsistency between the parent and child is considered as a possible mutation, the mutation rate should be incorporated into paternity index calculations to give a robust result and to reduce the chance of misinterpretation. The aim of this study was to estimate the mutation rates of 20 autosomal STRs loci used for paternity tests. In these loci we analysed 29,831 parent-child allelic transfers from 929 duo or trio paternity tests carried out during 2012?2016 from São Paulo State, Brazil. We identified 35 mutations in 16 loci, and they were more frequent in the paternal germline compared to the maternal germline. The loci with the highest rate were vWA and FGA and the ones with the lowest rate were PENTA E, PENTA D, D21S11, D7S820 and D6S1043. We did not identified any mutation in D2S1338, TH01, TPOX and D16S539 loci. All mutations consisted of losses or gains of one repeat unit. Mutation rates found in the São Paulo population have peculiarities, which justifies the use of regional databases in laboratories.

  11. Germline CYBB mutations that selectively affect macrophages in kindreds with X-linked predisposition to tuberculous mycobacterial disease

    PubMed Central

    Bustamante, Jacinta; Arias, Andres A; Vogt, Guillaume; Picard, Capucine; Galicia, Lizbeth Blancas; Prando, Carolina; Grant, Audrey V; Marchal, Christophe C; Hubeau, Marjorie; Chapgier, Ariane; de Beaucoudrey, Ludovic; Puel, Anne; Feinberg, Jacqueline; Valinetz, Ethan; Jannière, Lucile; Besse, Céline; Boland, Anne; Brisseau, Jean-Marie; Blanche, Stéphane; Lortholary, Olivier; Fieschi, Claire; Emile, Jean-François; Boisson-Dupuis, Stéphanie; Al-Muhsen, Saleh; Woda, Bruce; Newburger, Peter E; Condino-Neto, Antonio; Dinauer, Mary C; Abel, Laurent; Casanova, Jean-Laurent

    2011-01-01

    Germline mutations in CYBB, the human gene encoding the gp91phox subunit of the phagocyte NADPH oxidase, impair the respiratory burst of all types of phagocytes and result in X-linked chronic granulomatous disease (CGD). We report here two kindreds in which otherwise healthy male adults developed X-linked recessive Mendelian susceptibility to mycobacterial disease (MSMD) syndromes. These patients had previously unknown mutations in CYBB that resulted in an impaired respiratory burst in monocyte-derived macrophages but not in monocytes or granulocytes. The macrophage-specific functional consequences of the germline mutation resulted from cell-specific impairment in the assembly of the NADPH oxidase. This ‘experiment of nature’ indicates that CYBB is associated with MSMD and demonstrates that the respiratory burst in human macrophages is a crucial mechanism for protective immunity to tuberculous mycobacteria. PMID:21278736

  12. Detection of a new heterozygous germline ETV6 mutation in a case with hyperdiploid acute lymphoblastic leukemia.

    PubMed

    Duployez, Nicolas; Abou Chahla, Wadih; Lejeune, Sophie; Marceau-Renaut, Alice; Letizia, Guillaume; Boyer, Thomas; Geffroy, Sandrine; Peyrouze, Pauline; Grardel, Nathalie; Nelken, Brigitte; Michel, Gérard; Bertrand, Yves; Preudhomme, Claude

    2018-01-01

    ETV6 is a target of recurrent aberrations in sporadic and familial acute lymphoblastic leukemia (ALL). Here, we report on a new pedigree with a germline ETV6 mutation in which the index patient and his father developed high hyperdiploid (HeH) ALL and polycythemia vera at age 13 and 51, respectively. The index patient achieved durable complete remission without transplantation but had persistent moderate thrombocytopenia without bleeding tendency. To determine the prevalence of ETV6 alterations in HeH-ALL, we screened 81 unrelated subjects with HeH-ALL by single nucleotide polymorphism array and high-throughput sequencing for the ETV6 gene. Overall, ETV6 microdeletions and mutations were identified in 9% of cases, all of which were somatic and considered as secondary events. Apart from the index patient, no germline ETV6 aberration was identified. Finally, we reviewed the literature for ETV6 germline aberrations and predispositions to ALL. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

    PubMed

    Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

    2012-10-01

    The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

  14. Germline LEMD3 mutations are rare in sporadic patients with isolated melorheostosis.

    PubMed

    Hellemans, Jan; Debeer, Philippe; Wright, Michael; Janecke, Andreas; Kjaer, Klaus W; Verdonk, Peter C M; Savarirayan, Ravi; Basel, Lina; Moss, Celia; Roth, Johannes; David, Albert; De Paepe, Anne; Coucke, Paul; Mortier, Geert R

    2006-03-01

    To further explore the allelic heterogeneity within the group of LEMD3-related disorders, we have screened a larger series of patients including 5 probands with osteopoikilosis or Buschke-Ollendorff syndrome (BOS), 2 families with the co-occurrence of melorheostosis and BOS, and 12 unrelated patients with isolated melorheostosis. Seven novel LEMD3 mutations were identified, all predicted to result in loss-of-function of the protein. We confirm that loss-of-function mutations in the LEMD3 gene can result in either osteopoikilosis or BOS. However, LEMD3 germline mutations were only found in two melorheostosis patients belonging to a different BOS family and one sporadic patient with melorheostosis. The additional presence of osteopoikilosis lesions in these patients seemed to distinguish them from the group of sporadic melorheostosis patients where no germline LEMD3 mutation was identified. Somatic mosaicism for a LEMD3 mutation in the latter group was also not observed, and therefore we must conclude that the genetic defect in the majority of sporadic and isolated melorheostosis remains unknown. 2006 Wiley-Liss, Inc.

  15. New mutation in the PTEN gene in a Brazilian patient with Cowden's syndrome.

    PubMed

    Lima, Erika U de; Soares, Iberê C; Danilovic, Debora L S; Marui, Suemi

    2012-11-01

    Cowden syndrome is characterized by hamartomatous polyps, trichilemmomas, increased risk of developing neoplasms, and is associated with germline mutations in the PTEN gene. We searched for germline mutations in PTEN in a 49-year-old female patient who presented trichilemmoma with previous history of breast carcinoma, and thyroidectomy for a thyroid nodule. We also searched for somatic mutations in breast and thyroid tumoral tissues. DNA was extracted from peripheral leukocytes, paraffin samples of breast carcinoma, and cytological smears of thyroid nodule fine-needle aspiration biopsy, whose final histopathological diagnosis was adenomatous goiter. PTEN was amplified and sequenced. We identified a novel mutation, due to a T>A inversion at position 159 and A>T inversion at position 160, leading to valine-to-aspartic acid substitution at position 53. The p.Val53Asp was also found in homozygous state in samples obtained from adenocarcinoma breast and thyroid biopsy, denoting loss of heterozygosity. Here, we demonstrated a novel germline mutation in PTEN, as well as somatic loss of the wild-type PTEN allele in breast and thyroid tumors in a patient with Cowden syndrome.

  16. Human Germline Mutation and the Erratic Evolutionary Clock

    PubMed Central

    Przeworski, Molly

    2016-01-01

    Our understanding of the chronology of human evolution relies on the “molecular clock” provided by the steady accumulation of substitutions on an evolutionary lineage. Recent analyses of human pedigrees have called this understanding into question by revealing unexpectedly low germline mutation rates, which imply that substitutions accrue more slowly than previously believed. Translating mutation rates estimated from pedigrees into substitution rates is not as straightforward as it may seem, however. We dissect the steps involved, emphasizing that dating evolutionary events requires not “a mutation rate” but a precise characterization of how mutations accumulate in development in males and females—knowledge that remains elusive. PMID:27760127

  17. Cancer Susceptibility Gene Mutations in Individuals With Colorectal Cancer

    PubMed Central

    Yurgelun, Matthew B.; Kulke, Matthew H.; Fuchs, Charles S.; Allen, Brian A.; Uno, Hajime; Hornick, Jason L.; Ukaegbu, Chinedu I.; Brais, Lauren K.; McNamara, Philip G.; Mayer, Robert J.; Schrag, Deborah; Meyerhardt, Jeffrey A.; Ng, Kimmie; Kidd, John; Singh, Nanda; Hartman, Anne-Renee; Wenstrup, Richard J.

    2017-01-01

    Purpose Hereditary factors play an important role in colorectal cancer (CRC) risk, yet the prevalence of germline cancer susceptibility gene mutations in patients with CRC unselected for high-risk features (eg, early age at diagnosis, personal/family history of cancer or polyps, tumor microsatellite instability [MSI], mismatch repair [MMR] deficiency) is unknown. Patients and Methods We recruited 1,058 participants who received CRC care in a clinic-based setting without preselection for age at diagnosis, personal/family history, or MSI/MMR results. All participants underwent germline testing for mutations in 25 genes associated with inherited cancer risk. Each gene was categorized as high penetrance or moderate penetrance on the basis of published estimates of the lifetime cancer risks conferred by pathogenic germline mutations in that gene. Results One hundred five (9.9%; 95% CI, 8.2% to 11.9%) of 1,058 participants carried one or more pathogenic mutations, including 33 (3.1%) with Lynch syndrome (LS). Twenty-eight (96.6%) of 29 available LS CRCs demonstrated abnormal MSI/MMR results. Seventy-four (7.0%) of 1,058 participants carried non-LS gene mutations, including 23 (2.2%) with mutations in high-penetrance genes (five APC, three biallelic MUTYH, 11 BRCA1/2, two PALB2, one CDKN2A, and one TP53), 15 of whom lacked clinical histories suggestive of their underlying mutation. Thirty-eight (3.6%) participants had moderate-penetrance CRC risk gene mutations (19 monoallelic MUTYH, 17 APC*I1307K, two CHEK2). Neither proband age at CRC diagnosis, family history of CRC, nor personal history of other cancers significantly predicted the presence of pathogenic mutations in non-LS genes. Conclusion Germline cancer susceptibility gene mutations are carried by 9.9% of patients with CRC. MSI/MMR testing reliably identifies LS probands, although 7.0% of patients with CRC carry non-LS mutations, including 1.0% with BRCA1/2 mutations. PMID:28135145

  18. Screening for Novel Germline Rare Mutations Associated with Aggressive Prostate Cancer

    DTIC Science & Technology

    2014-10-01

    Schmidt S., Peshkin L., et al. A method and server for predicting damaging missense mutations. Nat Methods. 7, 248-249 (2010). Akbari MR, Trachtenberg...Inst. 2012 Aug 1;104(16):1260-2. Epub 2012 Jul 9. Castro E. G.C.L., Olmos D., et al. Correlation of germ-line BRCA2 mutations with aggressive...prostate cancer. Clin Cancer Res. 16, 2115-2121 (2010). 20    Hammer GE, Gonzalez F, Champsaur M, Cado D, Shastri N. The aminopeptidase ERAAP shapes the

  19. Recurrence of Marfan syndrome as a result of parental germ-line mosaicism for an FBN1 mutation.

    PubMed Central

    Rantamäki, T; Kaitila, I; Syvänen, A C; Lukka, M; Peltonen, L

    1999-01-01

    Mutations in the FBN1 gene cause Marfan syndrome (MFS), a dominantly inherited connective tissue disease. Almost all the identified FBN1mutations have been family specific, and the rate of new mutations is high. We report here a de novo FBN1mutation that was identified in two sisters with MFS born to clinically unaffected parents. The paternity and maternity were unequivocally confirmed by genotyping. Although one of the parents had to be an obligatory carrier for the mutation, we could not detect the mutation in the leukocyte DNA of either parent. To identify which parent was a mosaic for the mutation we analyzed several tissues from both parents, with a quantitative and sensitive solid-phase minisequencing method. The mutation was not, however, detectable in any of the analyzed tissues. Although the mutation could not be identified in a sperm sample from the father or in samples of multiple tissue from the mother, we concluded that the mother was the likely mosaic parent and that the mutation must have occurred during the early development of her germ-line cells. Mosaicism confined to germ-line cells has rarely been reported, and this report of mosaicism for the FBN1 mutation in MFS represents an important case, in light of the evaluation of the recurrence risk in genetic counseling of families with MFS. PMID:10090884

  20. Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms

    PubMed Central

    Milosevic Feenstra, Jelena D.; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N.; Cazzola, Mario

    2016-01-01

    Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed “triple negative.” We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. PMID:26423830

  1. Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms.

    PubMed

    Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert

    2016-01-21

    Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.

  2. Genomic profiles of lung cancer associated with idiopathic pulmonary fibrosis.

    PubMed

    Hwang, Ji An; Kim, Deokhoon; Chun, Sung-Min; Bae, SooHyun; Song, Joon Seon; Kim, Mi Young; Koo, Hyun Jung; Song, Jin Woo; Kim, Woo Sung; Lee, Jae Cheol; Kim, Hyeong Ryul; Choi, Chang-Min; Jang, Se Jin

    2018-01-01

    Little is known about the pathogenesis or molecular profiles of idiopathic pulmonary fibrosis-associated lung cancer (IPF-LC). This study was performed to investigate the genomic profiles of IPF-LC and to explore the possibility of defining potential therapeutic targets in IPF-LC. We assessed genomic profiles of IPF-LC by using targeted exome sequencing (OncoPanel version 2) in 35 matched tumour/normal pairs surgically resected between 2004 and 2014. Germline and somatic variant calling was performed with GATK HaplotypeCaller and MuTect with GATK SomaticIndelocator, respectively. Copy number analysis was conducted with CNVkit, with focal events determined by Genomic Identification of Significant Targets in Cancer 2.0, and pathway analysis (KEGG) with DAVID. Germline mutations in TERT (rs2736100, n = 33) and CDKN1A (rs2395655, n = 27) associated with idiopathic pulmonary fibrosis risk were detected in most samples. A total of 410 somatic mutations were identified, with an average of 11.7 per tumour, including 69 synonymous, 177 missense, 17 nonsense, 1 nonstop and 11 splice-site mutations, and 135 small coding indels. Spectra of the somatic mutations revealed predominant C > T transitions despite an extensive smoking history in most patients, suggesting a potential association between APOBEC-related mutagenesis and the development of IPF-LC. TP53 (22/35, 62.9%) and BRAF (6/35, 17.1%) were found to be significantly mutated in IPF-LC. Recurrent focal amplifications in three chromosomal loci (3q26.33, 7q31.2, and 12q14.3) and 9p21.3 deletion were identified, and genes associated with the JAK-STAT signalling pathway were significantly amplified in IPF-LC (P = 0.012). This study demonstrates that IPF-LC is genetically characterized by the presence of somatic mutations reflecting a variety of environmental exposures on the background of specific germline mutations, and is associated with potentially targetable alterations such as BRAF mutations. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  3. Familial gastrointestinal stromal tumors, lentigines, and café-au-lait macules associated with germline c-kit mutation treated with imatinib.

    PubMed

    Gupta, Divya; Chandrashekar, Laxmisha; Larizza, Lidia; Colombo, Elisa A; Fontana, Laura; Gervasini, Cristina; Thappa, Devinder M; Rajappa, Medha; Rajendiran, Kalai Selvi; Sreenath, Gubbi Shamanna; Kate, Vikram

    2017-02-01

    Familial lentiginosis syndromes are characterized by a wide array of manifestations resulting from activation of molecular pathways which control growth, proliferation, and differentiation of a broad range of tissues. Familial gastrointestinal stromal tumors (GISTs) are often accompanied by additional features like hyperpigmentation, mastocytosis, and dysphagia. They have been described with mutations in c-kit (most commonly), platelet-derived growth factor receptor A, neurofibromatosis-1, and succinate dehydrogenase genes. We report on molecular characterization and tumor histopathology of two siblings in whom lentigines and café-au-lait macules were present along with multifocal GIST. Immuhistochemical analysis of CD34 and CD117 was performed on GIST biopsy samples from both siblings, while c-kit mutational analysis was done by PCR and direct sequencing on DNA from peripheral blood leukocytes of all family members and from paraffin-embedded gastric biopsy specimens of affected siblings. Histopathology revealed positive expression of CD117 and CD34. Mutational analysis showed the germline c.1676T>C mutation in c-kit exon 11, (p.(Val559Ala)), in the peripheral blood of both siblings and a second exon 11 mutation, c.1669T>A (p.(Trp557Arg)) in the tumor biopsy of one of them. Initiation of imatinib treatment resulted in striking resolution of their hyperpigmentation and a stable gastrointestinal disease in one of them. A c-kit mutational test in familial GISTs is indicated before initiation of imatinib therapy, as it can help predict tumor response to treatment. © 2017 The International Society of Dermatology.

  4. Sun exposure causes somatic second-hit mutations and angiofibroma development in tuberous sclerosis complex

    PubMed Central

    Tyburczy, Magdalena E.; Wang, Ji-an; Li, Shaowei; Thangapazham, Rajesh; Chekaluk, Yvonne; Moss, Joel; Kwiatkowski, David J.; Darling, Thomas N.

    2014-01-01

    Tuberous sclerosis complex (TSC) is characterized by the formation of tumors in multiple organs and is caused by germline mutation in one of two tumor suppressor genes, TSC1 and TSC2. As for other tumor suppressor gene syndromes, the mechanism of somatic second-hit events in TSC tumors is unknown. We grew fibroblast-like cells from 29 TSC skin tumors from 22 TSC subjects and identified germline and second-hit mutations in TSC1/TSC2 using next-generation sequencing. Eighteen of 22 (82%) subjects had a mutation identified, and 8 of the 18 (44%) subjects were mosaic with mutant allele frequencies of 0 to 19% in normal tissue DNA. Multiple tumors were available from four patients, and in each case, second-hit mutations in TSC2 were distinct indicating they arose independently. Most remarkably, 7 (50%) of the 14 somatic point mutations were CC>TT ultraviolet ‘signature’ mutations, never seen as a TSC germline mutation. These occurred exclusively in facial angiofibroma tumors from sun-exposed sites. These results implicate UV-induced DNA damage as a cause of second-hit mutations and development of TSC facial angiofibromas and suggest that measures to limit UV exposure in TSC children and adults should reduce the frequency and severity of these lesions. PMID:24271014

  5. POLE mutations in families predisposed to cutaneous melanoma.

    PubMed

    Aoude, Lauren G; Heitzer, Ellen; Johansson, Peter; Gartside, Michael; Wadt, Karin; Pritchard, Antonia L; Palmer, Jane M; Symmons, Judith; Gerdes, Anne-Marie; Montgomery, Grant W; Martin, Nicholas G; Tomlinson, Ian; Kearsey, Stephen; Hayward, Nicholas K

    2015-12-01

    Germline mutations in the exonuclease domain of POLE have been shown to predispose to colorectal cancers and adenomas. POLE is an enzyme involved in DNA repair and chromosomal DNA replication. In order to assess whether such mutations might also predispose to cutaneous melanoma, we interrogated whole-genome and exome data from probands of 34 melanoma families lacking pathogenic mutations in known high penetrance melanoma susceptibility genes: CDKN2A, CDK4, BAP1, TERT, POT1, ACD and TERF2IP. We found a novel germline mutation, POLE p.(Trp347Cys), in a 7-case cutaneous melanoma family. Functional assays in S. pombe showed that this mutation led to an increased DNA mutation rate comparable to that seen with a Pol ε mutant with no exonuclease activity. We then performed targeted sequencing of POLE in 1243 cutaneous melanoma cases and found that a further ten probands had novel or rare variants in the exonuclease domain of POLE. Although this frequency is not significantly higher than that in unselected Caucasian controls, we observed multiple cancer types in the melanoma families, suggesting that some germline POLE mutations may predispose to a broad spectrum of cancers, including melanoma. In addition, we found the first mutation outside the exonuclease domain, p.(Gln520Arg), in a family with an extensive history of colorectal cancer.

  6. Clinically actionable mutation profiles in patients with cancer identified by whole-genome sequencing

    PubMed Central

    Mizani, Tuba; Hamblin, Angela; Parton, Marina; Orosz, Zsolt; Athanasou, Nick; Hassan, Bass; Flanagan, Adrienne M.; Ahmed, Ahmed; Winter, Stuart; Harris, Adrian; Popitsch, Niko; Church, David; Taylor, Jenny C.

    2018-01-01

    Next-generation sequencing (NGS) efforts have established catalogs of mutations relevant to cancer development. However, the clinical utility of this information remains largely unexplored. Here, we present the results of the first eight patients recruited into a clinical whole-genome sequencing (WGS) program in the United Kingdom. We performed PCR-free WGS of fresh frozen tumors and germline DNA at 75× and 30×, respectively, using the HiSeq2500 HTv4. Subtracted tumor VCFs and paired germlines were subjected to comprehensive analysis of coding and noncoding regions, integration of germline with somatically acquired variants, and global mutation signatures and pathway analyses. Results were classified into tiers and presented to a multidisciplinary tumor board. WGS results helped to clarify an uncertain histopathological diagnosis in one case, led to informed or supported prognosis in two cases, leading to de-escalation of therapy in one, and indicated potential treatments in all eight. Overall 26 different tier 1 potentially clinically actionable findings were identified using WGS compared with six SNVs/indels using routine targeted NGS. These initial results demonstrate the potential of WGS to inform future diagnosis, prognosis, and treatment choice in cancer and justify the systematic evaluation of the clinical utility of WGS in larger cohorts of patients with cancer. PMID:29610388

  7. Germline BRCA mutations are associated with higher risk of nodal involvement, distant metastasis, and poor survival outcomes in prostate cancer.

    PubMed

    Castro, Elena; Goh, Chee; Olmos, David; Saunders, Ed; Leongamornlert, Daniel; Tymrakiewicz, Malgorzata; Mahmud, Nadiya; Dadaev, Tokhir; Govindasami, Koveela; Guy, Michelle; Sawyer, Emma; Wilkinson, Rosemary; Ardern-Jones, Audrey; Ellis, Steve; Frost, Debra; Peock, Susan; Evans, D Gareth; Tischkowitz, Marc; Cole, Trevor; Davidson, Rosemarie; Eccles, Diana; Brewer, Carole; Douglas, Fiona; Porteous, Mary E; Donaldson, Alan; Dorkins, Huw; Izatt, Louise; Cook, Jackie; Hodgson, Shirley; Kennedy, M John; Side, Lucy E; Eason, Jacqueline; Murray, Alex; Antoniou, Antonis C; Easton, Douglas F; Kote-Jarai, Zsofia; Eeles, Rosalind

    2013-05-10

    To analyze the baseline clinicopathologic characteristics of prostate tumors with germline BRCA1 and BRCA2 (BRCA1/2) mutations and the prognostic value of those mutations on prostate cancer (PCa) outcomes. This study analyzed the tumor features and outcomes of 2,019 patients with PCa (18 BRCA1 carriers, 61 BRCA2 carriers, and 1,940 noncarriers). The Kaplan-Meier method and Cox regression analysis were used to evaluate the associations between BRCA1/2 status and other PCa prognostic factors with overall survival (OS), cause-specific OS (CSS), CSS in localized PCa (CSS_M0), metastasis-free survival (MFS), and CSS from metastasis (CSS_M1). PCa with germline BRCA1/2 mutations were more frequently associated with Gleason ≥ 8 (P = .00003), T3/T4 stage (P = .003), nodal involvement (P = .00005), and metastases at diagnosis (P = .005) than PCa in noncarriers. CSS was significantly longer in noncarriers than in carriers (15.7 v 8.6 years, multivariable analyses [MVA] P = .015; hazard ratio [HR] = 1.8). For localized PCa, 5-year CSS and MFS were significantly higher in noncarriers (96% v 82%; MVA P = .01; HR = 2.6%; and 93% v 77%; MVA P = .009; HR = 2.7, respectively). Subgroup analyses confirmed the poor outcomes in BRCA2 patients, whereas the role of BRCA1 was not well defined due to the limited size and follow-up in this subgroup. Our results confirm that BRCA1/2 mutations confer a more aggressive PCa phenotype with a higher probability of nodal involvement and distant metastasis. BRCA mutations are associated with poor survival outcomes and this should be considered for tailoring clinical management of these patients.

  8. Germline BRCA Mutations Are Associated With Higher Risk of Nodal Involvement, Distant Metastasis, and Poor Survival Outcomes in Prostate Cancer

    PubMed Central

    Castro, Elena; Goh, Chee; Olmos, David; Saunders, Ed; Leongamornlert, Daniel; Tymrakiewicz, Malgorzata; Mahmud, Nadiya; Dadaev, Tokhir; Govindasami, Koveela; Guy, Michelle; Sawyer, Emma; Wilkinson, Rosemary; Ardern-Jones, Audrey; Ellis, Steve; Frost, Debra; Peock, Susan; Evans, D. Gareth; Tischkowitz, Marc; Cole, Trevor; Davidson, Rosemarie; Eccles, Diana; Brewer, Carole; Douglas, Fiona; Porteous, Mary E.; Donaldson, Alan; Dorkins, Huw; Izatt, Louise; Cook, Jackie; Hodgson, Shirley; Kennedy, M. John; Side, Lucy E.; Eason, Jacqueline; Murray, Alex; Antoniou, Antonis C.; Easton, Douglas F.; Kote-Jarai, Zsofia; Eeles, Rosalind

    2013-01-01

    Purpose To analyze the baseline clinicopathologic characteristics of prostate tumors with germline BRCA1 and BRCA2 (BRCA1/2) mutations and the prognostic value of those mutations on prostate cancer (PCa) outcomes. Patients and Methods This study analyzed the tumor features and outcomes of 2,019 patients with PCa (18 BRCA1 carriers, 61 BRCA2 carriers, and 1,940 noncarriers). The Kaplan-Meier method and Cox regression analysis were used to evaluate the associations between BRCA1/2 status and other PCa prognostic factors with overall survival (OS), cause-specific OS (CSS), CSS in localized PCa (CSS_M0), metastasis-free survival (MFS), and CSS from metastasis (CSS_M1). Results PCa with germline BRCA1/2 mutations were more frequently associated with Gleason ≥ 8 (P = .00003), T3/T4 stage (P = .003), nodal involvement (P = .00005), and metastases at diagnosis (P = .005) than PCa in noncarriers. CSS was significantly longer in noncarriers than in carriers (15.7 v 8.6 years, multivariable analyses [MVA] P = .015; hazard ratio [HR] = 1.8). For localized PCa, 5-year CSS and MFS were significantly higher in noncarriers (96% v 82%; MVA P = .01; HR = 2.6%; and 93% v 77%; MVA P = .009; HR = 2.7, respectively). Subgroup analyses confirmed the poor outcomes in BRCA2 patients, whereas the role of BRCA1 was not well defined due to the limited size and follow-up in this subgroup. Conclusion Our results confirm that BRCA1/2 mutations confer a more aggressive PCa phenotype with a higher probability of nodal involvement and distant metastasis. BRCA mutations are associated with poor survival outcomes and this should be considered for tailoring clinical management of these patients. PMID:23569316

  9. Epitope-positive truncating MLH1 mutation and loss of PMS2: implications for IHC-directed genetic testing for Lynch syndrome.

    PubMed

    Zighelboim, Israel; Powell, Matthew A; Babb, Sheri A; Whelan, Alison J; Schmidt, Amy P; Clendenning, Mark; Senter, Leigha; Thibodeau, Stephen N; de la Chapelle, Albert; Goodfellow, Paul J

    2009-01-01

    We assessed mismatch repair by immunohistochemistry (IHC) and microsatellite instability (MSI) analysis in an early onset endometrial cancer and a sister's colon cancer. We demonstrated high-level MSI and normal expression for MLH1, MSH2 and MSH6. PMS2 failed to stain in both tumors, strongly implicating a PMS2 defect. This family did not meet clinical criteria for Lynch syndrome. However, early onset endometrial cancers in the proband and her sister, a metachronous colorectal cancer in the sister as well as MSI in endometrial and colonic tumors suggested a heritable mismatch repair defect. PCR-based direct exonic sequencing and multiplex ligation-dependent probe amplification (MLPA) were undertaken to search for PMS2 mutations in the germline DNA from the proband and her sister. No mutation was identified in the PMS2 gene. However, PMS2 exons 3, 4, 13, 14, 15 were not evaluated by MLPA and as such, rearrangements involving those exons cannot be excluded. Clinical testing for MLH1 and MSH2 mutation revealed a germline deletion of MLH1 exons 14 and 15. This MLH1 germline deletion leads to an immunodetectable stable C-terminal truncated MLH1 protein which based on the IHC staining must abrogate PMS2 stabilization. To the best of our knowledge, loss of PMS2 in MLH1 truncating mutation carriers that express MLH1 in their tumors has not been previously reported. This family points to a potential limitation of IHC-directed gene testing for suspected Lynch syndrome and the need to consider comprehensive MLH1 testing for individuals whose tumors lack PMS2 but for whom PMS2 mutations are not identified.

  10. RNA-based mutation analysis identifies an unusual MSH6 splicing defect and circumvents PMS2 pseudogene interference.

    PubMed

    Etzler, J; Peyrl, A; Zatkova, A; Schildhaus, H-U; Ficek, A; Merkelbach-Bruse, S; Kratz, C P; Attarbaschi, A; Hainfellner, J A; Yao, S; Messiaen, L; Slavc, I; Wimmer, K

    2008-02-01

    Heterozygous germline mutations in one of the mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2 cause hereditary nonpolyposis colorectal cancer (HNPCC) or Lynch syndrome, a dominantly inherited cancer susceptibility syndrome. Recent reports provide evidence for a novel recessively inherited cancer syndrome with constitutive MMR deficiency due to biallelic germline mutations in one of the MMR genes. MMR-deficiency (MMR-D) syndrome is characterized by childhood brain tumors, hematological and/or gastrointestinal malignancies, and signs of neurofibromatosis type 1 (NF1). We established an RNA-based mutation detection assay for the four MMR genes, since 1) a number of splicing defects may escape detection by the analysis of genomic DNA, and 2) DNA-based mutation detection in the PMS2 gene is severely hampered by the presence of multiple highly similar pseudogenes, including PMS2CL. Using this assay, which is based on direct cDNA sequencing of RT-PCR products, we investigated two families with children suspected to suffer from MMR-D syndrome. We identified a homozygous complex MSH6 splicing alteration in the index patients of the first family and a novel homozygous PMS2 mutation (c.182delA) in the index patient of the second family. Furthermore, we demonstrate, by the analysis of a PMS2/PMS2CL "hybrid" allele carrier, that RNA-based PMS2 testing effectively avoids the caveats of genomic DNA amplification approaches; i.e., pseudogene coamplification as well as allelic dropout, and will, thus, allow more sensitive mutation analysis in MMR deficiency and in HNPCC patients with PMS2 defects. (c) 2007 Wiley-Liss, Inc.

  11. Mutational Analysis of Mismatch Repair Genes, hMLH1 and hMSH2, in Sporadic Endometrial Carcinomas with Microsatellite Instability

    PubMed Central

    Kobayashi, Kanji; Matsushima, Mieko; Koi, Sumiko; Saito, Hiroko; Sagae, Satoru; Kudo, Ryuichi

    1996-01-01

    Microsatellite instability, monitored by replication error (RER), bas been observed in both sporadic and hereditary types of endometrial carcinoma. In the hereditary tumors, this instability is considered to be caused by a germline defect in the DNA mismatch‐repair system. We previously reported that nearly one‐quarter of sporadic endometrial carcinomas examined revealed an RER‐positive phenotype at multiple microsatellite loci. To investigate the role of genetic alterations of DNA mismatch‐repair genes in sporadic endometrial carcinomas, we screened 18 RER(+) endometrial carcinomas for mutations of hMLH1 and hMSH2. Although we found no germline mutations, we detected two somatic mutations of hMLH1 in a single endometrial cancer; these two mutations had occurred on different alleles, suggesting that two separate mutational events had affected both copies of hMLH1 in this particular tumor. These data implied that mutations of hMLH1 or hMSH2 play limited roles in the development of sporadic endometrial carcinomas, and that the tumors with genetic instability might have alterations of other mismatch‐repair genes, such as hPMS1 and hPMS2, or of unknown genes related to the mismatch‐repair system. PMID:8609062

  12. Development and Validation of the PREMM5 Model for Comprehensive Risk Assessment of Lynch Syndrome.

    PubMed

    Kastrinos, Fay; Uno, Hajime; Ukaegbu, Chinedu; Alvero, Carmelita; McFarland, Ashley; Yurgelun, Matthew B; Kulke, Matthew H; Schrag, Deborah; Meyerhardt, Jeffrey A; Fuchs, Charles S; Mayer, Robert J; Ng, Kimmie; Steyerberg, Ewout W; Syngal, Sapna

    2017-07-01

    Purpose Current Lynch syndrome (LS) prediction models quantify the risk to an individual of carrying a pathogenic germline mutation in three mismatch repair (MMR) genes: MLH1, MSH2, and MSH6. We developed a new prediction model, PREMM 5 , that incorporates the genes PMS2 and EPCAM to provide comprehensive LS risk assessment. Patients and Methods PREMM 5 was developed to predict the likelihood of a mutation in any of the LS genes by using polytomous logistic regression analysis of clinical and germline data from 18,734 individuals who were tested for all five genes. Predictors of mutation status included sex, age at genetic testing, and proband and family cancer histories. Discrimination was evaluated by the area under the receiver operating characteristic curve (AUC), and clinical impact was determined by decision curve analysis; comparisons were made to the existing PREMM 1,2,6 model. External validation of PREMM 5 was performed in a clinic-based cohort of 1,058 patients with colorectal cancer. Results Pathogenic mutations were detected in 1,000 (5%) of 18,734 patients in the development cohort; mutations included MLH1 (n = 306), MSH2 (n = 354), MSH6 (n = 177), PMS2 (n = 141), and EPCAM (n = 22). PREMM 5 distinguished carriers from noncarriers with an AUC of 0.81 (95% CI, 0.79 to 0.82), and performance was similar in the validation cohort (AUC, 0.83; 95% CI, 0.75 to 0.92). Prediction was more difficult for PMS2 mutations (AUC, 0.64; 95% CI, 0.60 to 0.68) than for other genes. Performance characteristics of PREMM 5 exceeded those of PREMM 1,2,6 . Decision curve analysis supported germline LS testing for PREMM 5 scores ≥ 2.5%. Conclusion PREMM 5 provides comprehensive risk estimation of all five LS genes and supports LS genetic testing for individuals with scores ≥ 2.5%. At this threshold, PREMM 5 provides performance that is superior to the existing PREMM 1,2,6 model in the identification of carriers of LS, including those with weaker phenotypes and individuals unaffected by cancer.

  13. Development and Validation of the PREMM5 Model for Comprehensive Risk Assessment of Lynch Syndrome

    PubMed Central

    Uno, Hajime; Ukaegbu, Chinedu; Alvero, Carmelita; McFarland, Ashley; Yurgelun, Matthew B.; Kulke, Matthew H.; Schrag, Deborah; Meyerhardt, Jeffrey A.; Fuchs, Charles S.; Mayer, Robert J.; Ng, Kimmie; Steyerberg, Ewout W.; Syngal, Sapna

    2017-01-01

    Purpose Current Lynch syndrome (LS) prediction models quantify the risk to an individual of carrying a pathogenic germline mutation in three mismatch repair (MMR) genes: MLH1, MSH2, and MSH6. We developed a new prediction model, PREMM5, that incorporates the genes PMS2 and EPCAM to provide comprehensive LS risk assessment. Patients and Methods PREMM5 was developed to predict the likelihood of a mutation in any of the LS genes by using polytomous logistic regression analysis of clinical and germline data from 18,734 individuals who were tested for all five genes. Predictors of mutation status included sex, age at genetic testing, and proband and family cancer histories. Discrimination was evaluated by the area under the receiver operating characteristic curve (AUC), and clinical impact was determined by decision curve analysis; comparisons were made to the existing PREMM1,2,6 model. External validation of PREMM5 was performed in a clinic-based cohort of 1,058 patients with colorectal cancer. Results Pathogenic mutations were detected in 1,000 (5%) of 18,734 patients in the development cohort; mutations included MLH1 (n = 306), MSH2 (n = 354), MSH6 (n = 177), PMS2 (n = 141), and EPCAM (n = 22). PREMM5 distinguished carriers from noncarriers with an AUC of 0.81 (95% CI, 0.79 to 0.82), and performance was similar in the validation cohort (AUC, 0.83; 95% CI, 0.75 to 0.92). Prediction was more difficult for PMS2 mutations (AUC, 0.64; 95% CI, 0.60 to 0.68) than for other genes. Performance characteristics of PREMM5 exceeded those of PREMM1,2,6. Decision curve analysis supported germline LS testing for PREMM5 scores ≥ 2.5%. Conclusion PREMM5 provides comprehensive risk estimation of all five LS genes and supports LS genetic testing for individuals with scores ≥ 2.5%. At this threshold, PREMM5 provides performance that is superior to the existing PREMM1,2,6 model in the identification of carriers of LS, including those with weaker phenotypes and individuals unaffected by cancer. PMID:28489507

  14. A novel germline mutation in the aryl hydrocarbon receptor-interacting protein (AIP) gene in an Italian family with gigantism.

    PubMed

    Urbani, C; Russo, D; Raggi, F; Lombardi, M; Sardella, C; Scattina, I; Lupi, I; Manetti, L; Tomisti, L; Marcocci, C; Martino, E; Bogazzi, F

    2014-10-01

    Acromegaly usually occurs as a sporadic disease, but it may be a part of familial pituitary tumor syndromes in rare cases. Germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene have been associated with a predisposition to familial isolated pituitary adenoma. The aim of the present study was to evaluate the AIP gene in a patient with gigantism and in her relatives. Direct sequencing of AIP gene was performed in fourteen members of the family, spanning among three generations. The index case was an 18-year-old woman with gigantism due to an invasive GH-secreting pituitary adenoma and a concomitant tall-cell variant of papillary thyroid carcinoma. A novel germline mutation in the AIP gene (c.685C>T, p.Q229X) was identified in the proband and in two members of her family, who did not present clinical features of acromegaly or other pituitary disorders. Eleven subjects had no mutation in the AIP gene. Two members of the family with clinical features of acromegaly refused either the genetic or the biochemical evaluation. The Q229X mutation was predicted to generate a truncated AIP protein, lacking the last two tetratricopeptide repeat domains and the final C-terminal α-7 helix. We identified a new AIP germline mutation predicted to produce a truncated AIP protein, lacking its biological properties due to the disruption of the C-terminus binding sites for both the chaperones and the client proteins of AIP.

  15. Detection and Identification of Ciprofloxacin-Resistant Yersinia pestis Denaturing High-Performance Liquid Chromatography

    DTIC Science & Technology

    2003-07-01

    analysis in hereditary breast and ovarian cancers . Hum. Mutat. 14:333– 339. 2. Bauer, A. W., W. M. Kirby, J. C. Sherris, and M. Turck. 1966. Antibiotic...Listeria monocytogenes lineage group classification by MAMA -PCR of the listeriolysin gene. Curr. Microbiol. 43:129–133. 17. Klein, B., G. Weirich...Germline and somatic mutation anal- yses in the DNA mismatch repair gene MLH3: evidence for somatic muta- tion in colorectal cancers . Hum. Mutat. 17:389–396

  16. Genomic characterization of biliary tract cancers identifies driver genes and predisposing mutations.

    PubMed

    Wardell, Christopher P; Fujita, Masashi; Yamada, Toru; Simbolo, Michele; Fassan, Matteo; Karlic, Rosa; Polak, Paz; Kim, Jaegil; Hatanaka, Yutaka; Maejima, Kazuhiro; Lawlor, Rita T; Nakanishi, Yoshitsugu; Mitsuhashi, Tomoko; Fujimoto, Akihiro; Furuta, Mayuko; Ruzzenente, Andrea; Conci, Simone; Oosawa, Ayako; Sasaki-Oku, Aya; Nakano, Kaoru; Tanaka, Hiroko; Yamamoto, Yujiro; Michiaki, Kubo; Kawakami, Yoshiiku; Aikata, Hiroshi; Ueno, Masaki; Hayami, Shinya; Gotoh, Kunihito; Ariizumi, Shun-Ichi; Yamamoto, Masakazu; Yamaue, Hiroki; Chayama, Kazuaki; Miyano, Satoru; Getz, Gad; Scarpa, Aldo; Hirano, Satoshi; Nakamura, Toru; Nakagawa, Hidewaki

    2018-05-01

    Biliary tract cancers (BTCs) are clinically and pathologically heterogeneous and respond poorly to treatment. Genomic profiling can offer a clearer understanding of their carcinogenesis, classification and treatment strategy. We performed large-scale genome sequencing analyses on BTCs to investigate their somatic and germline driver events and characterize their genomic landscape. We analyzed 412 BTC samples from Japanese and Italian populations, 107 by whole-exome sequencing (WES), 39 by whole-genome sequencing (WGS), and a further 266 samples by targeted sequencing. The subtypes were 136 intrahepatic cholangiocarcinomas (ICCs), 101 distal cholangiocarcinomas (DCCs), 109 peri-hilar type cholangiocarcinomas (PHCs), and 66 gallbladder or cystic duct cancers (GBCs/CDCs). We identified somatic alterations and searched for driver genes in BTCs, finding pathogenic germline variants of cancer-predisposing genes. We predicted cell-of-origin for BTCs by combining somatic mutation patterns and epigenetic features. We identified 32 significantly and commonly mutated genes including TP53, KRAS, SMAD4, NF1, ARID1A, PBRM1, and ATR, some of which negatively affected patient prognosis. A novel deletion of MUC17 at 7q22.1 affected patient prognosis. Cell-of-origin predictions using WGS and epigenetic features suggest hepatocyte-origin of hepatitis-related ICCs. Deleterious germline mutations of cancer-predisposing genes such as BRCA1, BRCA2, RAD51D, MLH1, or MSH2 were detected in 11% (16/146) of BTC patients. BTCs have distinct genetic features including somatic events and germline predisposition. These findings could be useful to establish treatment and diagnostic strategies for BTCs based on genetic information. We here analyzed genomic features of 412 BTC samples from Japanese and Italian populations. A total of 32 significantly and commonly mutated genes were identified, some of which negatively affected patient prognosis, including a novel deletion of MUC17 at 7q22.1. Cell-of-origin predictions using WGS and epigenetic features suggest hepatocyte-origin of hepatitis-related ICCs. Deleterious germline mutations of cancer-predisposing genes were detected in 11% of patients with BTC. BTCs have distinct genetic features including somatic events and germline predisposition. Copyright © 2018 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  17. Constitutional von Hippel-Lindau (VHL) gene deletions detected in VHL families by fluorescence in situ hybridization.

    PubMed

    Pack, S D; Zbar, B; Pak, E; Ault, D O; Humphrey, J S; Pham, T; Hurley, K; Weil, R J; Park, W S; Kuzmin, I; Stolle, C; Glenn, G; Liotta, L A; Lerman, M I; Klausner, R D; Linehan, W M; Zhuang, Z

    1999-11-01

    von Hippel-Lindau (VHL) disease is an autosomal dominantly inherited cancer syndrome predisposing to a variety of tumor types that include retinal hemangioblastomas, hemangioblastomas of the central nervous system, renal cell carcinomas, pancreatic cysts and tumors, pheochromocytomas, endolymphatic sac tumors, and epididymal cystadenomas [W. M. Linehan et al., J. Am. Med. Assoc., 273: 564-570, 1995; E. A. Maher and W. G. Kaelin, Jr., Medicine (Baltimore), 76: 381-391, 1997; W. M. Linehan and R. D. Klausner, In: B. Vogelstein and K. Kinzler (eds.), The Genetic Basis of Human Cancer, pp. 455-473, McGraw-Hill, 1998]. The VHL gene was localized to chromosome 3p25-26 and cloned [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. Germline mutations in the VHL gene have been detected in the majority of VHL kindreds. The reported frequency of detection of VHL germline mutations has varied from 39 to 80% (J. M. Whaley et al., Am. J. Hum. Genet., 55: 1092-1102, 1994; Clinical Research Group for Japan, Hum. Mol. Genet., 4: 2233-2237, 1995; F. Chen et al., Hum. Mutat., 5: 66-75, 1995; E. R. Maher et al., J. Med. Genet., 33: 328-332, 1996; B. Zbar, Cancer Surv., 25: 219-232, 1995). Recently a quantitative Southern blotting procedure was found to improve this frequency (C. Stolle et al., Hum. Mutat., 12: 417-423, 1998). In the present study, we report the use of fluorescence in situ hybridization (FISH) as a method to detect and characterize VHL germline deletions. We reexamined a group of VHL patients shown previously by single-strand conformation and sequencing analysis not to harbor point mutations in the VHL locus. We found constitutional deletions in 29 of 30 VHL patients in this group using cosmid and P1 probes that cover the VHL locus. We then tested six phenotypically normal offspring from four of these VHL families: two were found to carry the deletion and the other four were deletion-free. In addition, germline mosaicism of the VHL gene was identified in one family. In sum, FISH was found to be a simple and reliable method to detect VHL germline deletions and practically useful in cases where other methods of screening have failed to detect a VHL gene abnormality.

  18. Investigating the effects of dietary folic acid on sperm count, DNA damage and mutation in Balb/c mice.

    PubMed

    Swayne, Breanne G; Kawata, Alice; Behan, Nathalie A; Williams, Andrew; Wade, Mike G; Macfarlane, Amanda J; Yauk, Carole L

    2012-09-01

    To date, fewer than 50 mutagens have been studied for their ability to cause heritable mutations. The majority of those studied are classical mutagens like radiation and anti-cancer drugs. Very little is known about the dietary variables influencing germline mutation rates. Folate is essential for DNA synthesis and methylation and can impact chromatin structure. We therefore determined the effects of folic acid-deficient (0mg/kg), control (2mg/kg) and supplemented (6mg/kg) diets in early development and during lactation or post-weaning on mutation rates and chromatin quality in sperm of adult male Balb/c mice. The sperm chromatin structure assay and mutation frequencies at expanded simple tandem repeats (ESTRs) were used to evaluate germline DNA integrity. Treatment of a subset of mice fed the control diet with the mutagen ethylnitrosourea (ENU) at 8 weeks of age was included as a positive control. ENU treated mice exhibited decreased cauda sperm counts, increased DNA fragmentation and increased ESTR mutation frequencies relative to non-ENU treated mice fed the control diet. Male mice weaned to the folic acid deficient diet had decreased cauda sperm numbers, increased DNA fragmentation index, and increased ESTR mutation frequency. Folic acid deficiency in early development did not lead to changes in sperm counts or chromatin integrity in adult mice. Folic acid supplementation in early development or post-weaning did not affect germ cell measures. Therefore, adequate folic acid intake in adulthood is important for preventing chromatin damage and mutation in the male germline. Folic acid supplementation at the level achieved in this study does not improve nor is it detrimental to male germline chromatin integrity. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  19. CHEK2 1100DELC germline mutation: a frequency study in hereditary breast and colon cancer Brazilian families.

    PubMed

    Abud, Jamile; Koehler-Santos, Patricia; Ashton-Prolla, Patricia; Prolla, João Carlos

    2012-12-01

    CHEK2 encodes a cell cycle checkpoint kinase that plays an important role in the DNA damage repair pathway, activated mainly by ATM (Ataxia Telangiectasia Mutated) in response to double-stranded DNA breaks. A germline mutation in CHEK2, 1100delC, has been described as a low penetrance allele in a significant number of families with breast and colorectal cancer in certain countries and is also associated with increased risk of contralateral breast cancer in women previously affected by the disease. About 5%-10% of all breast and colorectal cancers are associated with hereditary predisposition and its recognition is of great importance for genetic counseling and cancer risk management. Here, we have assessed the frequency of the CHEK2 1100delC mutation in the germline of 59 unrelated Brazilian individuals with clinical criteria for the hereditary breast and colorectal cancer syndrome. A long-range PCR strategy followed by gene sequencing was used. The 1100delC mutation was encountered in the germline of one (1.7%) individual in this high risk cohort. This indicates that the CHEK2 1100delC is not commonly encountered in Brazilian families with multiple diagnoses of breast and colorectal cancer. These results should be confirmed in a larger series of families and further testing should be undertaken to investigate the molecular mechanisms underlying the hereditary breast and colorectal cancer phenotype.

  20. Commentary on "Inherited DNA-repair gene mutations in men with metastatic prostate cancer". Pritchard CC, Mateo J, Walsh MF, De Sarkar N, Abida W, Beltran H, Garofalo A, Gulati R, Carreira S, Eeles R, Elemento O, Rubin MA, Robinson D, Lonigro R, Hussain M, Chinnaiyan A, Vinson J, Filipenko J, Garraway L, Taplin ME, AlDubayan S, Han GC, Beightol M, Morrissey C, Nghiem B, Cheng HH, Montgomery B, Walsh T, Casadei S, Berger M, Zhang L, Zehir A, Vijai J, Scher HI, Sawyers C, Schultz N, Kantoff PW, Solit D, Robson M, Van Allen EM, Offit K, de Bono J, Nelson PS. N Engl J Med. 2016;375(5):443-53.

    PubMed

    Freedland, Stephen J; Aronson, William J

    2017-08-01

    Inherited mutations in DNA-repair genes such as BRCA2 are associated with increased risks of lethal prostate cancer. Although the prevalence of germline mutations in DNA-repair genes among men with localized prostate cancer who are unselected for family predisposition is insufficient to warrant routine testing, the frequency of such mutations in patients with metastatic prostate cancer has not been established. We recruited 692 men with documented metastatic prostate cancer who were unselected for family history of cancer or age at diagnosis. We isolated germline DNA and used multiplex sequencing assays to assess mutations in 20 DNA-repair genes associated with autosomal dominant cancer-predisposition syndromes. A total of 84 germline DNA-repair gene mutations that were presumed to be deleterious were identified in 82 men (11.8%); mutations were found in 16 genes, including BRCA2 (37 men [5.3%]), ATM (11 [1.6%]), CHEK2 (10 [1.9% of 534 men with data]), BRCA1 (6 [0.9%]), RAD51D (3 [0.4%]), and PALB2 (3 [0.4%]). Mutation frequencies did not differ according to whether a family history of prostate cancer was present or according to age at diagnosis. Overall, the frequency of germline mutations in DNA-repair genes among men with metastatic prostate cancer significantly exceeded the prevalence of 4.6% among 499 men with localized prostate cancer (P<0.001), including men with high-risk disease, and the prevalence of 2.7% in the Exome Aggregation Consortium, which includes 53,105 persons without a known cancer diagnosis (P<0.001). In our multicenter study, the incidence of germline mutations in genes mediating DNA-repair processes among men with metastatic prostate cancer was 11.8%, which was significantly higher than the incidence among men with localized prostate cancer. The frequencies of germline mutations in DNA-repair genes among men with metastatic disease did not differ significantly according to age at diagnosis or family history of prostate cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Commentary on: "Inherited DNA-repair gene mutations in men with metastatic prostate cancer." Pritchard CC, Mateo J, Walsh MF, De Sarkar N, Abida W, Beltran H, Garofalo A, Gulati R, Carreira S, Eeles R, Elemento O, Rubin MA, Robinson D, Lonigro R, Hussain M, Chinnaiyan A, Vinson J, Filipenko J, Garraway L, Taplin ME, AlDubayan S, Han GC, Beightol M, Morrissey C, Nghiem B, Cheng HH, Montgomery B, Walsh T, Casadei S, Berger M, Zhang L, Zehir A, Vijai J, Scher HI, Sawyers C, Schultz N, Kantoff PW, Solit D, Robson M, Van Allen EM, Offit K, de Bono J, Nelson PS. N Engl J Med. 2016 Aug 4;375(5):443-53.

    PubMed

    Lee, Byron H

    2017-09-01

    Inherited mutations in DNA-repair genes such as BRCA2 are associated with increased risks of lethal prostate cancer. Although the prevalence of germline mutations in DNA-repair genes among men with localized prostate cancer who are unselected for family predisposition is insufficient to warrant routine testing, the frequency of such mutations in patients with metastatic prostate cancer has not been established. We recruited 692 men with documented metastatic prostate cancer who were unselected for family history of cancer or age at diagnosis. We isolated germline DNA and used multiplex sequencing assays to assess mutations in 20 DNA-repair genes associated with autosomal dominant cancer-predisposition syndromes. A total of 84 germline DNA-repair gene mutations that were presumed to be deleterious were identified in 82 men (11.8%); mutations were found in 16 genes, including BRCA2 (37 men [5.3%]), ATM (11 [1.6%]), CHEK2 (10 [1.9% of 534 men with data]), BRCA1 (6 [0.9%]), RAD51D (3 [0.4%]), and PALB2 (3 [0.4%]). Mutation frequencies did not differ according to whether a family history of prostate cancer was present or according to age at diagnosis. Overall, the frequency of germline mutations in DNA-repair genes among men with metastatic prostate cancer significantly exceeded the prevalence of 4.6% among 499 men with localized prostate cancer (P<0.001), including men with high-risk disease, and the prevalence of 2.7% in the Exome Aggregation Consortium, which includes 53,105 persons without a known cancer diagnosis (P<0.001). In our multicenter study, the incidence of germline mutations in genes mediating DNA-repair processes among men with metastatic prostate cancer was 11.8%, which was significantly higher than the incidence among men with localized prostate cancer. The frequencies of germline mutations in DNA-repair genes among men with metastatic disease did not differ significantly according to age at diagnosis or family history of prostate cancer. (Funded by Stand Up To Cancer and others.). Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Melorheostosis: Exome sequencing of an associated dermatosis implicates postzygotic mosaicism of mutated KRAS.

    PubMed

    Whyte, Michael P; Griffith, Malachi; Trani, Lee; Mumm, Steven; Gottesman, Gary S; McAlister, William H; Krysiak, Kilannin; Lesurf, Robert; Skidmore, Zachary L; Campbell, Katie M; Rosman, Ilana S; Bayliss, Susan; Bijanki, Vinieth N; Nenninger, Angela; Van Tine, Brian A; Griffith, Obi L; Mardis, Elaine R

    2017-08-01

    Melorheostosis (MEL) is the rare sporadic dysostosis characterized by monostotic or polyostotic osteosclerosis and hyperostosis often distributed in a sclerotomal pattern. The prevailing hypothesis for MEL invokes postzygotic mosaicism. Sometimes scleroderma-like skin changes, considered a representation of the pathogenetic process of MEL, overlie the bony changes, and sometimes MEL becomes malignant. Osteopoikilosis (OPK) is the autosomal dominant skeletal dysplasia that features symmetrically distributed punctate osteosclerosis due to heterozygous loss-of-function mutation within LEMD3. Rarely, radiographic findings of MEL occur in OPK. However, germline mutation of LEMD3 does not explain sporadic MEL. To explore if mosaicism underlies MEL, we studied a boy with polyostotic MEL and characteristic overlying scleroderma-like skin, a few bony lesions consistent with OPK, and a large epidermal nevus known to usually harbor a HRAS, FGFR3, or PIK3CA gene mutation. Exome sequencing was performed to ~100× average read depth for his two dermatoses, two areas of normal skin, and peripheral blood leukocytes. As expected for non-malignant tissues, the patient's mutation burden in his normal skin and leukocytes was low. He, his mother, and his maternal grandfather carried a heterozygous, germline, in-frame, 24-base-pair deletion in LEMD3. Radiographs of the patient and his mother revealed bony foci consistent with OPK, but she showed no MEL. For the patient, somatic variant analysis, using four algorithms to compare all 20 possible pairwise combinations of his five DNA samples, identified only one high-confidence mutation, heterozygous KRAS Q61H (NM_033360.3:c.183A>C, NP_203524.1:p.Gln61His), in both his dermatoses but absent in his normal skin and blood. Thus, sparing our patient biopsy of his MEL bone, we identified a heterozygous somatic KRAS mutation in his scleroderma-like dermatosis considered a surrogate for MEL. This implicates postzygotic mosaicism of mutated KRAS, perhaps facilitated by germline LEMD3 haploinsufficiency, causing his MEL. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Germline stem cell competition, mutation hot spots, genetic disorders and older dads

    PubMed Central

    Arnheim, Norman; Calabrese, Peter

    2016-01-01

    Some de novo human mutations arise at frequencies far exceeding the genome average mutation rate. Examples are the common mutations at one or a few sites in the genes causing achondroplasia, Noonan syndrome, multiple endocrine neoplasia 2B and Apert syndrome. These mutations are recurrent, provide a gain of function, are paternally derived and are more likely transmitted as the father ages. Recent experiments tested whether the high mutation frequencies are due to an elevated mutation rate per cell division, as expected, or an advantage of the mutant spermatogonial stem cells over wild-type stem cells. The evidence, which includes the surprising discovery of testis mutation clusters, rejects the former model but not the latter. We propose how the mutations might alter spermatogonial stem cell function and discuss how germline selection contributes to the paternal age effect, the human mutational load and adaptive evolution. PMID:27070266

  4. A comprehensive characterization of rare mitochondrial DNA variants in neuroblastoma.

    PubMed

    Calabrese, Francesco Maria; Clima, Rosanna; Pignataro, Piero; Lasorsa, Vito Alessandro; Hogarty, Michael D; Castellano, Aurora; Conte, Massimo; Tonini, Gian Paolo; Iolascon, Achille; Gasparre, Giuseppe; Capasso, Mario

    2016-08-02

    Neuroblastoma, a tumor of the developing sympathetic nervous system, is a common childhood neoplasm that is often lethal. Mitochondrial DNA (mtDNA) mutations have been found in most tumors including neuroblastoma. We extracted mtDNA data from a cohort of neuroblastoma samples that had undergone Whole Exome Sequencing (WES) and also used snap-frozen samples in which mtDNA was entirely sequenced by Sanger technology. We next undertook the challenge of determining those mutations that are relevant to, or arisen during tumor development. The bioinformatics pipeline used to extract mitochondrial variants from matched tumor/blood samples was enriched by a set of filters inclusive of heteroplasmic fraction, nucleotide variability, and in silico prediction of pathogenicity. Our in silico multistep workflow applied both on WES and Sanger-sequenced neuroblastoma samples, allowed us to identify a limited burden of somatic and germline mitochondrial mutations with a potential pathogenic impact. The few singleton germline and somatic mitochondrial mutations emerged, according to our in silico analysis, do not appear to impact on the development of neuroblastoma. Our findings are consistent with the hypothesis that most mitochondrial somatic mutations can be considered as 'passengers' and consequently have no discernible effect in this type of cancer.

  5. Craniosynostosis and Noonan syndrome with KRAS mutations: Expanding the phenotype with a case report and review of the literature.

    PubMed

    Addissie, Yonit A; Kotecha, Udhaya; Hart, Rachel A; Martinez, Ariel F; Kruszka, Paul; Muenke, Maximilian

    2015-11-01

    Noonan syndrome (NS) is a multiple congenital anomaly syndrome caused by germline mutations in genes coding for components of the Ras-mitogen-activated protein kinase (RAS-MAPK) pathway. Features include short stature, characteristic facies, congenital heart anomalies, and developmental delay. While there is considerable clinical heterogeneity in NS, craniosynostosis is not a common feature of the condition. Here, we report on a 2 month-old girl with Noonan syndrome associated with a de novo mutation in KRAS (p.P34Q) and premature closure of the sagittal suture. We provide a review of the literature of germline KRAS mutations and find that approximately 10% of published cases have craniosynostosis. Our findings expand on the NS phenotype and suggest that germline mutations in the KRAS gene are causally involved in craniosynostosis, supporting the role of the RAS-MAPK pathway as a mediator of aberrant bone growth in cranial sutures. The inclusion of craniosynostosis as a possible phenotype in KRAS-associated Noonan Syndrome has implications in the differential diagnosis and surgical management of individuals with craniosynostosis. © 2015 Wiley Periodicals, Inc.

  6. Evaluation of chromosome 6p22 as a breast cancer risk modifier locus in a follow-up study of BRCA2 mutation carriers

    PubMed Central

    Stevens, Kristen N.; Wang, Xianshu; Fredericksen, Zachary; Pankratz, Vernon S.; Greene, Mark H.; Andrulis, Irene L.; Thomassen, Mads; Caligo, Maria; Nathanson, Katherine L.; Jakubowska, Anna; Osorio, Ana; Hamann, Ute; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Southey, Melissa; Buys, Saundra S.; Singer, Christian F.; Hansen, Thomas V.O.; Arason, Adalgeir; Offit, Kenneth; Piedmonte, Marion; Montagna, Marco; Imyanitov, Evgeny; Tihomirova, Laima; Sucheston, Lara; Beattie, Mary; Neuhausen, Susan L.; Szabo, Csilla I.; Simard, Jacques; Spurdle, Amanda B.; Healey, Sue; Chen, Xiaoqing; Rebbeck, Timothy R.; Easton, Douglas F.; Chenevix-Trench, Georgia; Antoniou, Antonis C; Couch, Fergus J.

    2012-01-01

    Several common germline variants identified through genome-wide association studies of breast cancer risk in the general population have recently been shown to be associated with breast cancer risk for BRCA1 and/or BRCA2 mutation carriers. When combined, these variants can identify marked differences in the absolute risk of developing breast cancer for mutation carriers, suggesting that additional modifier loci may further enhance individual risk assessment for BRCA1 and BRCA2 mutation carriers. Recently, a common variant on 6p22 (rs9393597) was found to be associated with increased breast cancer risk for BRCA2 mutation carriers [Hazard ratio (HR)=1.55, 95% CI 1.25–1.92, p=6.0×10−5]. This observation was based on data from GWAS studies in which, despite statistical correction for multiple comparisons, the possibility of false discovery remains a concern. Here we report on an analysis of this variant in an additional 6,165 BRCA1 and 3,900 BRCA2 mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). In this replication analysis, rs9393597 was not associated with breast cancer risk for BRCA2 mutation carriers [HR=1.09, 95% CI 0.96–1.24, p=0.18]. No association with ovarian cancer risk for BRCA1 or BRCA2 mutation carriers or with breast cancer risk for BRCA1 mutation carriers was observed. This follow-up study suggests that, contrary to our initial report, this variant is not associated with breast cancer risk among individuals with germline BRCA2 mutations. PMID:23011509

  7. The Ying and Yang of STAT3 in Human Disease.

    PubMed

    Vogel, Tiphanie P; Milner, Joshua D; Cooper, Megan A

    2015-10-01

    The transcription factor signal transducer and activator of transcription 3 (STAT3) is a critical regulator of multiple, diverse cellular processes. Heterozgyous, germline, loss-of-function mutations in STAT3 lead to the primary immune deficiency Hyper-IgE syndrome. Heterozygous, somatic, gain-of-function mutations in STAT3 have been reported in malignancy. Recently, germline, heterozygous mutations in STAT3 that confer a gain-of-function have been discovered and result in early-onset, multi-organ autoimmunity. This review summarizes what is known about the role of STAT3 in human disease.

  8. Variable Autosomal and X Divergence Near and Far from Genes Affects Estimates of Male Mutation Bias in Great Apes.

    PubMed

    Narang, Pooja; Wilson Sayres, Melissa A

    2016-12-31

    Male mutation bias, when more mutations are passed on via the male germline than via the female germline, is observed across mammals. One common way to infer the magnitude of male mutation bias, α, is to compare levels of neutral sequence divergence between genomic regions that spend different amounts of time in the male and female germline. For great apes, including human, we show that estimates of divergence are reduced in putatively unconstrained regions near genes relative to unconstrained regions far from genes. Divergence increases with increasing distance from genes on both the X chromosome and autosomes, but increases faster on the X chromosome than autosomes. As a result, ratios of X/A divergence increase with increasing distance from genes and corresponding estimates of male mutation bias are significantly higher in intergenic regions near genes versus far from genes. Future studies in other species will need to carefully consider the effect that genomic location will have on estimates of male mutation bias. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Molecular characterisation of SMARCB1 and NF2 in familial and sporadic schwannomatosis.

    PubMed

    Hadfield, K D; Newman, W G; Bowers, N L; Wallace, A; Bolger, C; Colley, A; McCann, E; Trump, D; Prescott, T; Evans, D G R

    2008-06-01

    Schwannomatosis is a rare condition characterised by multiple schwannomas and lack of involvement of the vestibular nerve. A recent report identified bi-allelic mutations in the SMARCB1/INI1 gene in a single family with schwannomatosis. We aimed to establish the contribution of the SMARCB1 and the NF2 genes to sporadic and familial schwannomatosis in our cohort. We performed DNA sequence and dosage analysis of SMARCB1 and NF2 in 28 sporadic cases and 15 families with schwannomatosis. We identified germline mutations in SMARCB1 in 5 of 15 (33.3%) families with schwannomatosis and 2 of 28 (7.1%) individuals with sporadic schwannomatosis. In all individuals with a germline mutation in SMARCB1 in whom tumour tissue was available, we detected a second hit with loss of SMARCB1. In addition, in all affected individuals with SMARCB1 mutations and available tumour tissue, we detected bi-allelic somatic inactivation of the NF2 gene. SMARCB1 mutations were associated with a higher number of spinal tumours in patients with a positive family history (p = 0.004). In contrast to the recent report where no NF2 mutations were identified in a schwannomatosis family with SMARCB1 mutations, in our cohort, a four hit model with mutations in both SMARCB1 and NF2 define a subset of patients with schwannomatosis.

  10. TumorNext-Lynch-MMR: a comprehensive next generation sequencing assay for the detection of germline and somatic mutations in genes associated with mismatch repair deficiency and Lynch syndrome.

    PubMed

    Gray, Phillip N; Tsai, Pei; Chen, Daniel; Wu, Sitao; Hoo, Jayne; Mu, Wenbo; Li, Bing; Vuong, Huy; Lu, Hsiao-Mei; Batth, Navanjot; Willett, Sara; Uyeda, Lisa; Shah, Swati; Gau, Chia-Ling; Umali, Monalyn; Espenschied, Carin; Janicek, Mike; Brown, Sandra; Margileth, David; Dobrea, Lavinia; Wagman, Lawrence; Rana, Huma; Hall, Michael J; Ross, Theodora; Terdiman, Jonathan; Cullinane, Carey; Ries, Savita; Totten, Ellen; Elliott, Aaron M

    2018-04-17

    The current algorithm for Lynch syndrome diagnosis is highly complex with multiple steps which can result in an extended time to diagnosis while depleting precious tumor specimens. Here we describe the analytical validation of a custom probe-based NGS tumor panel, TumorNext-Lynch-MMR, which generates a comprehensive genetic profile of both germline and somatic mutations that can accelerate and streamline the time to diagnosis and preserve specimen. TumorNext-Lynch-MMR can detect single nucleotide variants, small insertions and deletions in 39 genes that are frequently mutated in Lynch syndrome and colorectal cancer. Moreover, the panel provides microsatellite instability status and detects loss of heterozygosity in the five Lynch genes; MSH2 , MSH6 , MLH1 , PMS2 and EPCAM . Clinical cases are described that highlight the assays ability to differentiate between somatic and germline mutations, precisely classify variants and resolve discordant cases.

  11. TumorNext-Lynch-MMR: a comprehensive next generation sequencing assay for the detection of germline and somatic mutations in genes associated with mismatch repair deficiency and Lynch syndrome

    PubMed Central

    Gray, Phillip N.; Tsai, Pei; Chen, Daniel; Wu, Sitao; Hoo, Jayne; Mu, Wenbo; Li, Bing; Vuong, Huy; Lu, Hsiao-Mei; Batth, Navanjot; Willett, Sara; Uyeda, Lisa; Shah, Swati; Gau, Chia-Ling; Umali, Monalyn; Espenschied, Carin; Janicek, Mike; Brown, Sandra; Margileth, David; Dobrea, Lavinia; Wagman, Lawrence; Rana, Huma; Hall, Michael J.; Ross, Theodora; Terdiman, Jonathan; Cullinane, Carey; Ries, Savita; Totten, Ellen; Elliott, Aaron M.

    2018-01-01

    The current algorithm for Lynch syndrome diagnosis is highly complex with multiple steps which can result in an extended time to diagnosis while depleting precious tumor specimens. Here we describe the analytical validation of a custom probe-based NGS tumor panel, TumorNext-Lynch-MMR, which generates a comprehensive genetic profile of both germline and somatic mutations that can accelerate and streamline the time to diagnosis and preserve specimen. TumorNext-Lynch-MMR can detect single nucleotide variants, small insertions and deletions in 39 genes that are frequently mutated in Lynch syndrome and colorectal cancer. Moreover, the panel provides microsatellite instability status and detects loss of heterozygosity in the five Lynch genes; MSH2, MSH6, MLH1, PMS2 and EPCAM. Clinical cases are described that highlight the assays ability to differentiate between somatic and germline mutations, precisely classify variants and resolve discordant cases. PMID:29755653

  12. A novel molecular diagnostics platform for somatic and germline precision oncology.

    PubMed

    Cabanillas, Rubén; Diñeiro, Marta; Castillo, David; Pruneda, Patricia C; Penas, Cristina; Cifuentes, Guadalupe A; de Vicente, Álvaro; Durán, Noelia S; Álvarez, Rebeca; Ordóñez, Gonzalo R; Cadiñanos, Juan

    2017-07-01

    Next-generation sequencing (NGS) opens new options in clinical oncology, from therapy selection to genetic counseling. However, realization of this potential not only requires succeeding in the bioinformatics and interpretation of the results, but also in their integration into the clinical practice. We have developed a novel NGS diagnostic platform aimed at detecting (1) somatic genomic alterations associated with the response to approved targeted cancer therapies and (2) germline mutations predisposing to hereditary malignancies. Next-generation sequencing libraries enriched in the exons of 215 cancer genes (97 for therapy selection and 148 for predisposition, with 30 informative for both applications), as well as selected introns from 17 genes involved in drug-related rearrangements, were prepared from 39 tumors (paraffin-embedded tissues/cytologies), 36 germline samples (blood) and 10 cell lines using hybrid capture. Analysis of NGS results was performed with specifically developed bioinformatics pipelines. The platform detects single-nucleotide variants (SNVs) and insertions/deletions (indels) with sensitivity and specificity >99.5% (allelic frequency ≥0.1), as well as copy-number variants (CNVs) and rearrangements. Somatic testing identified tailored approved targeted drugs in 35/39 tumors (89.74%), showing a diagnostic yield comparable to that of leading commercial platforms. A somatic EGFR p.E746_S752delinsA mutation in a mediastinal metastasis from a breast cancer prompted its anatomopathologic reassessment, its definite reclassification as a lung cancer and its treatment with gefitinib (partial response sustained for 15 months). Testing of 36 germline samples identified two pathogenic mutations (in CDKN2A and BRCA2 ). We propose a strategy for interpretation and reporting of results adaptable to the aim of the request, the availability of tumor and/or normal samples and the scope of the informed consent. With an adequate methodology, it is possible to translate to the clinical practice the latest advances in precision oncology, integrating under the same platform the identification of somatic and germline genomic alterations.

  13. Co-occurrence of schwannomatosis and rhabdoid tumor predisposition syndrome 1.

    PubMed

    Kehrer-Sawatzki, Hildegard; Kordes, Uwe; Seiffert, Simone; Summerer, Anna; Hagel, Christian; Schüller, Ulrich; Farschtschi, Said; Schneppenheim, Reinhard; Bendszus, Martin; Godel, Tim; Mautner, Victor-Felix

    2018-05-20

    The clinical phenotype associated with germline SMARCB1 mutations has as yet not been fully documented. It is known that germline SMARCB1 mutations may cause rhabdoid tumor predisposition syndrome (RTPS1) or schwannomatosis. However, the co-occurrence of rhabdoid tumor and schwannomas in the same patient has not so far been reported. We investigated a family with members harboring a germline SMARCB1 deletion by means of whole-body MRI as well as high-resolution microstructural magnetic resonance neurography (MRN). Breakpoint-spanning PCRs were performed to characterize the SMARCB1 deletion and its segregation in the family. The index patient of this family was in complete continuous remission for an atypical teratoid/rhabdoid tumor (AT/RT) treated at the age of 2 years. However, at the age of 21 years, she exhibited paraparesis of her legs and MRI investigations revealed multiple intrathoracic and spinal schwannomas. Breakpoint-spanning PCRs indicated that the germline deletion segregating in the family encompasses 6.4-kb and includes parts of SMARCB1 intron 7, exons 8-9 and 3.3-kb located telomeric to exon 9 including the SMARCB1 3' UTR. The analysis of sequences at the deletion breakpoints showed that the deletion has been caused by replication errors including template-switching. The patient had inherited the deletion from her 56-year-old healthy mother who did not exhibit schwannomas or other tumors as determined by whole-body MRI. However, MRN of the peripheral nerves of the mother's extremities revealed multiple fascicular microlesions which have been previously identified as indicative of schwannomatosis-associated subclinical peripheral nerve pathology. The occurrence of schwannomatosis-associated clinical symptoms independent of the AT/RT as the primary disease should be considered in long-term survivors of AT/RT. Furthermore, our investigations indicate that germline SMARCB1 mutation carriers not presenting RTs or schwannomatosis-associated clinical symptoms may nevertheless exhibit peripheral nerve pathology as revealed by MRN. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  14. High-Resolution Analysis of the Efficiency, Heritability, and Editing Outcomes of CRISPR/Cas9-Induced Modifications of NCED4 in Lettuce (Lactuca sativa).

    PubMed

    Bertier, Lien D; Ron, Mily; Huo, Heqiang; Bradford, Kent J; Britt, Anne B; Michelmore, Richard W

    2018-05-04

    CRISPR/Cas9 is a transformative tool for making targeted genetic alterations. In plants, high mutation efficiencies have been reported in primary transformants. However, many of the mutations analyzed were somatic and therefore not heritable. To provide more insights into the efficiency of creating stable homozygous mutants using CRISPR/Cas9, we targeted LsNCED4 ( 9-cis-EPOXYCAROTENOID DIOXYGENASE4) , a gene conditioning thermoinhibition of seed germination in lettuce. Three constructs, each capable of expressing Cas9 and a single gRNA targeting different sites in LsNCED4 , were stably transformed into lettuce (Lactuca sativa) cvs. Salinas and Cobham Green. Analysis of 47 primary transformants (T 1 ) and 368 T 2 plants by deep amplicon sequencing revealed that 57% of T 1 plants contained events at the target site: 28% of plants had germline mutations in one allele indicative of an early editing event (mono-allelic), 8% of plants had germline mutations in both alleles indicative of two early editing events (bi-allelic), and the remaining 21% of plants had multiple low frequency mutations indicative of late events (chimeric plants). Editing efficiency was similar in both genotypes, while the different gRNAs varied in efficiency. Amplicon sequencing of 20 T 1 and more than 100 T 2 plants for each of the three gRNAs showed that repair outcomes were not random, but reproducible and characteristic for each gRNA. Knockouts of NCED4 resulted in large increases in the maximum temperature for seed germination, with seeds of both cultivars capable of germinating >70% at 37°. Knockouts of NCED4 provide a whole-plant selectable phenotype that has minimal pleiotropic consequences. Targeting NCED4 in a co-editing strategy could therefore be used to enrich for germline-edited events simply by germinating seeds at high temperature. Copyright © 2018 Bertier et al.

  15. High-Resolution Analysis of the Efficiency, Heritability, and Editing Outcomes of CRISPR/Cas9-Induced Modifications of NCED4 in Lettuce (Lactuca sativa)

    PubMed Central

    Bertier, Lien D.; Ron, Mily; Huo, Heqiang; Bradford, Kent J.; Britt, Anne B.; Michelmore, Richard W.

    2018-01-01

    CRISPR/Cas9 is a transformative tool for making targeted genetic alterations. In plants, high mutation efficiencies have been reported in primary transformants. However, many of the mutations analyzed were somatic and therefore not heritable. To provide more insights into the efficiency of creating stable homozygous mutants using CRISPR/Cas9, we targeted LsNCED4 (9-cis-EPOXYCAROTENOID DIOXYGENASE4), a gene conditioning thermoinhibition of seed germination in lettuce. Three constructs, each capable of expressing Cas9 and a single gRNA targeting different sites in LsNCED4, were stably transformed into lettuce (Lactuca sativa) cvs. Salinas and Cobham Green. Analysis of 47 primary transformants (T1) and 368 T2 plants by deep amplicon sequencing revealed that 57% of T1 plants contained events at the target site: 28% of plants had germline mutations in one allele indicative of an early editing event (mono-allelic), 8% of plants had germline mutations in both alleles indicative of two early editing events (bi-allelic), and the remaining 21% of plants had multiple low frequency mutations indicative of late events (chimeric plants). Editing efficiency was similar in both genotypes, while the different gRNAs varied in efficiency. Amplicon sequencing of 20 T1 and more than 100 T2 plants for each of the three gRNAs showed that repair outcomes were not random, but reproducible and characteristic for each gRNA. Knockouts of NCED4 resulted in large increases in the maximum temperature for seed germination, with seeds of both cultivars capable of germinating >70% at 37°. Knockouts of NCED4 provide a whole-plant selectable phenotype that has minimal pleiotropic consequences. Targeting NCED4 in a co-editing strategy could therefore be used to enrich for germline-edited events simply by germinating seeds at high temperature. PMID:29511025

  16. NanoTIO(2) (UV-Titan) does not induce ESTR mutations in the germline of prenatally exposed female mice.

    PubMed

    Boisen, Anne Mette Zenner; Shipley, Thomas; Jackson, Petra; Hougaard, Karin Sørig; Wallin, Håkan; Yauk, Carole L; Vogel, Ulla

    2012-06-01

    Particulate air pollution has been linked to an increased risk of cardiovascular disease and cancer. Animal studies have shown that inhalation of air particulates induces mutations in the male germline. Expanded simple tandem repeat (ESTR) loci in mice are sensitive markers of mutagenic effects on male germ cells resulting from environmental exposures; however, female germ cells have received little attention. Oocytes may be vulnerable during stages of active cell division (e.g., during fetal development). Accordingly, an increase in germline ESTR mutations in female mice prenatally exposed to radiation has previously been reported. Here we investigate the effects of nanoparticles on the female germline. Since pulmonary exposure to nanosized titanium dioxide (nanoTiO(2)) produces a long-lasting inflammatory response in mice, it was chosen for the present study. Pregnant C57BL/6 mice were exposed by whole-body inhalation to the nanoTiO(2) UV-Titan L181 (~42.4 mg UV-Titan/m(3)) or filtered clean air on gestation days (GD) 8-18. Female C57BL/6 F1 offspring were raised to maturity and mated with unexposed CBA males. The F2 descendents were collected and ESTR germline mutation rates in this generation were estimated from full pedigrees (mother, father, offspring) of F1 female mice (192 UV-Titan-exposed F2 offspring and 164 F2 controls). ESTR mutation rates of 0.029 (maternal allele) and 0.047 (paternal allele) in UV-Titan-exposed F2 offspring were not statistically different from those of F2 controls: 0.037 (maternal allele) and 0.061 (paternal allele). We found no evidence for increased ESTR mutation rates in F1 females exposed in utero to UV-Titan nanoparticles from GD8-18 relative to control females.

  17. Hyperthyroidism caused by a germline activating mutation of the thyrotropin receptor gene: difficulties in diagnosis and therapy.

    PubMed

    Bertalan, Rita; Sallai, Agnes; Sólyom, János; Lotz, Gábor; Szabó, István; Kovács, Balázs; Szabó, Eva; Patócs, Attila; Rácz, Károly

    2010-03-01

    Germline activating mutations of the thyrotropin receptor (TSHR) gene have been considered as the only known cause of sporadic nonautoimmune hyperthyroidism in the pediatric population. Here we describe the long-term follow-up and evaluation of a patient with sporadic nonautoimmune primary hyperthyroidism who was found to have a de novo germline activating mutation of the TSHR gene. The patient was an infant who presented at the age of 10 months in an unconscious state with exsiccation, wet skin, fever, and tachycardia. Nonautoimmune primary hyperthyroidism was diagnosed, and brain magnetic resonance imaging and computed tomography showed also Arnold-Chiari malformation type I. Continuous propylthiouracil treatment resulted in a prolonged clinical cure lasting for 10 years. At the age of 11 years and 5 months the patient underwent subtotal thyroidectomy because of symptoms of trachea compression caused by a progressive multinodular goiter. However, 2 months after surgery, hormonal evaluation indicated recurrent hyperthyroidism and the patient was treated with propylthiouracil during the next 4 years. At the age of 15 years the patient again developed symptoms of trachea compression. Radioiodine treatment resulted in a regression of the recurrent goiter and a permanent cure of hyperthyroidism without relapse during the last 3 years of his follow-up. Sequencing of exon 10 of the TSHR gene showed a de novo heterozygous germline I630L mutation, which has been previously described as activating mutation at somatic level in toxic thyroid nodules. The I630L mutation of the TSHR gene occurs not only at somatic level in toxic thyroid nodules, but also its presence in germline is associated with nonautoimmune primary hyperthyroidism. Our case report demonstrates that in this disorder a continuous growth of the thyroid occurs without any evidence of elevated TSH due to antithyroid drug overdosing. This may justify previous recommendations for early treatment of affected patients with removal of as much thyroid tissue as possible.

  18. Identification of a G‐Protein Subunit‐α11 Gain‐of‐Function Mutation, Val340Met, in a Family With Autosomal Dominant Hypocalcemia Type 2 (ADH2)

    PubMed Central

    Piret, Sian E; Gorvin, Caroline M; Pagnamenta, Alistair T; Howles, Sarah A; Cranston, Treena; Rust, Nigel; Nesbit, M Andrew; Glaser, Ben; Taylor, Jenny C; Buchs, Andreas E; Hannan, Fadil M

    2016-01-01

    ABSTRACT Autosomal dominant hypocalcemia (ADH) is characterized by hypocalcemia, inappropriately low serum parathyroid hormone concentrations and hypercalciuria. ADH is genetically heterogeneous with ADH type 1 (ADH1), the predominant form, being caused by germline gain‐of‐function mutations of the G‐protein coupled calcium‐sensing receptor (CaSR), and ADH2 caused by germline gain‐of‐function mutations of G‐protein subunit α‐11 (Gα11). To date Gα11 mutations causing ADH2 have been reported in only five probands. We investigated a multigenerational nonconsanguineous family, from Iran, with ADH and keratoconus which are not known to be associated, for causative mutations by whole‐exome sequencing in two individuals with hypoparathyroidism, of whom one also had keratoconus, followed by cosegregation analysis of variants. This identified a novel heterozygous germline Val340Met Gα11 mutation in both individuals, and this was also present in the other two relatives with hypocalcemia that were tested. Three‐dimensional modeling revealed the Val340Met mutation to likely alter the conformation of the C‐terminal α5 helix, which may affect G‐protein coupled receptor binding and G‐protein activation. In vitro functional expression of wild‐type (Val340) and mutant (Met340) Gα11 proteins in HEK293 cells stably expressing the CaSR, demonstrated that the intracellular calcium responses following stimulation with extracellular calcium, of the mutant Met340 Gα11 led to a leftward shift of the concentration‐response curve with a significantly (p < 0.0001) reduced mean half‐maximal concentration (EC50) value of 2.44 mM (95% CI, 2.31 to 2.77 mM) when compared to the wild‐type EC50 of 3.14 mM (95% CI, 3.03 to 3.26 mM), consistent with a gain‐of‐function mutation. A novel His403Gln variant in transforming growth factor, beta‐induced (TGFBI), that may be causing keratoconus was also identified, indicating likely digenic inheritance of keratoconus and ADH2 in this family. In conclusion, our identification of a novel germline gain‐of‐function Gα11 mutation, Val340Met, causing ADH2 demonstrates the importance of the Gα11 C‐terminal region for G‐protein function and CaSR signal transduction. © 2016 The Authors. Journal of Bone and Mineral Research Published by Wiley Periodicals, Inc. on behalf of American Society for Bone and Mineral Research (ASBMR). PMID:26818911

  19. Evaluation of germline BRCA1 and BRCA2 mutations in a multi-ethnic Asian cohort of ovarian cancer patients.

    PubMed

    Hasmad, Hanis Nazihah; Lai, Kah Nyin; Wen, Wei Xiong; Park, Daniel Jonathan; Nguyen-Dumont, Tú; Kang, Peter Choon Eng; Thirthagiri, Eswary; Ma'som, Mahirah; Lim, Boon Kiong; Southey, Melissa; Woo, Yin Ling; Teo, Soo-Hwang

    2016-05-01

    Despite the discovery of breast and ovarian cancer predisposition genes BRCA1 and BRCA2 more than two decades ago, almost all the available data relate to women of European ancestry, with only a handful of studies in Asian populations. In this study, we determined the frequency of germline alterations in BRCA1 and BRCA2 in ovarian cancer patients from a multi-ethnic cross-sectional cohort of Asian ovarian cancer patients from Malaysia. From October 2008 to February 2015, we established a hospital-based cohort of ovarian cancer patients and the germline status of all 218 women with invasive epithelial ovarian cancer was tested using targeted amplification and sequencing of the intron-exon junctions and exonic sequences of BRCA1, BRCA2, PALB2 and TP53. BRCA1 and BRCA2 mutations were found in 8% (17 cases) and 3% (7 cases) of the ovarian cancer patients, respectively. Mutation carriers were diagnosed at a similar age to non-carriers, but were more likely to be Indian, have serous ovarian cancer, and have more relatives with breast or ovarian cancer. Nonetheless, 42% (10/24) of mutation carriers did not have any family history of breast or ovarian cancer and offering genetic counselling and genetic testing only to women with family history would mean that 35% (6/17) of BRCA1 mutation carriers and 57% (4/7) of BRCA2 mutation carriers would not be offered genetic testing. Our data suggest that, similar to Caucasians, a significant proportion of Asian ovarian cancer was attributed to germline mutations in BRCA1 and to a lesser extent in BRCA2. Copyright © 2015. Published by Elsevier Inc.

  20. Pain correlates with germline mutation in schwannomatosis.

    PubMed

    Jordan, Justin T; Smith, Miriam J; Walker, James A; Erdin, Serkan; Talkowski, Michael E; Merker, Vanessa L; Ramesh, Vijaya; Cai, Wenli; Harris, Gordon J; Bredella, Miriam A; Seijo, Marlon; Suuberg, Alessandra; Gusella, James F; Plotkin, Scott R

    2018-02-01

    Schwannomatosis has been linked to germline mutations in the SMARCB1 and LZTR1 genes, and is frequently associated with pain.In a cohort study, we assessed the mutation status of 37 patients with clinically diagnosed schwannomatosis and compared to clinical data, whole body MRI (WBMRI), visual analog pain scale, and Short Form 36 (SF-36) bodily pain subscale.We identified a germline mutation in LZTR1 in 5 patients (13.5%) and SMARCB1 in 15 patients (40.5%), but found no germline mutation in 17 patients (45.9%). Peripheral schwannomas were detected in 3 LZTR1-mutant (60%) and 10 SMARCB1-mutant subjects (66.7%). Among those with peripheral tumors, the median tumor number was 4 in the LZTR1 group (median total body tumor volume 30 cc) and 10 in the SMARCB1 group (median volume 85cc), (P=.2915 for tumor number and P = .2289 for volume). mutation was associated with an increased prevalence of spinal schwannomas (100% vs 41%, P = .0197). The median pain score was 3.9/10 in the LZTR1 group and 0.5/10 in the SMARCB1 group (P = .0414), and SF-36 pain-associated quality of life was significantly worse in the LZTR1 group (P = .0106). Pain scores correlated with total body tumor volume (rho = 0.32471, P = .0499), but not with number of tumors (rho = 0.23065, P = .1696).We found no significant difference in quantitative tumor burden between mutational groups, but spinal schwannomas were more common in LZTR1-mutant patients. Pain was significantly higher in LZTR1-mutant than in SMARCB1-mutant patients, though spinal tumor location did not significantly correlate with pain. This suggests a possible genetic association with schwannomatosis-associated pain.

  1. Pain correlates with germline mutation in schwannomatosis

    PubMed Central

    Jordan, Justin T.; Smith, Miriam J.; Walker, James A.; Erdin, Serkan; Talkowski, Michael E.; Merker, Vanessa L.; Ramesh, Vijaya; Cai, Wenli; Harris, Gordon J.; Bredella, Miriam A.; Seijo, Marlon; Suuberg, Alessandra; Gusella, James F.; Plotkin, Scott R.

    2018-01-01

    Abstract Schwannomatosis has been linked to germline mutations in the SMARCB1 and LZTR1 genes, and is frequently associated with pain. In a cohort study, we assessed the mutation status of 37 patients with clinically diagnosed schwannomatosis and compared to clinical data, whole body MRI (WBMRI), visual analog pain scale, and Short Form 36 (SF-36) bodily pain subscale. We identified a germline mutation in LZTR1 in 5 patients (13.5%) and SMARCB1 in 15 patients (40.5%), but found no germline mutation in 17 patients (45.9%). Peripheral schwannomas were detected in 3 LZTR1-mutant (60%) and 10 SMARCB1-mutant subjects (66.7%). Among those with peripheral tumors, the median tumor number was 4 in the LZTR1 group (median total body tumor volume 30 cc) and 10 in the SMARCB1 group (median volume 85cc), (P=.2915 for tumor number and P = .2289 for volume). mutation was associated with an increased prevalence of spinal schwannomas (100% vs 41%, P = .0197). The median pain score was 3.9/10 in the LZTR1 group and 0.5/10 in the SMARCB1 group (P = .0414), and SF-36 pain-associated quality of life was significantly worse in the LZTR1 group (P = .0106). Pain scores correlated with total body tumor volume (rho = 0.32471, P = .0499), but not with number of tumors (rho = 0.23065, P = .1696). We found no significant difference in quantitative tumor burden between mutational groups, but spinal schwannomas were more common in LZTR1-mutant patients. Pain was significantly higher in LZTR1-mutant than in SMARCB1-mutant patients, though spinal tumor location did not significantly correlate with pain. This suggests a possible genetic association with schwannomatosis-associated pain. PMID:29384852

  2. Germline CDKN2A/P16INK4A mutations contribute to genetic determinism of sarcoma.

    PubMed

    Jouenne, Fanélie; Chauvot de Beauchene, Isaure; Bollaert, Emeline; Avril, Marie-Françoise; Caron, Olivier; Ingster, Olivier; Lecesne, Axel; Benusiglio, Patrick; Terrier, Philippe; Caumette, Vincent; Pissaloux, Daniel; de la Fouchardière, Arnaud; Cabaret, Odile; N'Diaye, Birama; Velghe, Amélie; Bougeard, Gaelle; Mann, Graham J; Koscielny, Serge; Barrett, Jennifer H; Harland, Mark; Newton-Bishop, Julia; Gruis, Nelleke; Van Doorn, Remco; Gauthier-Villars, Marion; Pierron, Gaelle; Stoppa-Lyonnet, Dominique; Coupier, Isabelle; Guimbaud, Rosine; Delnatte, Capucine; Scoazec, Jean-Yves; Eggermont, Alexander M; Feunteun, Jean; Tchertanov, Luba; Demoulin, Jean-Baptiste; Frebourg, Thierry; Bressac-de Paillerets, Brigitte

    2017-09-01

    Sarcomas are rare mesenchymal malignancies whose pathogenesis is poorly understood; both environmental and genetic risk factors could contribute to their aetiology. We performed whole-exome sequencing (WES) in a familial aggregation of three individuals affected with soft-tissue sarcoma (STS) without TP53 mutation (Li-Fraumeni-like, LFL) and found a shared pathogenic mutation in CDKN2A tumour suppressor gene. We searched for individuals with sarcoma among 474 melanoma-prone families with a CDKN2A -/+ genotype and for CDKN2A mutations in 190 TP53 -negative LFL families where the index case was a sarcoma. Including the initial family, eight independent sarcoma cases carried a germline mutation in the CDKN2A /p16 INK4A gene. In five out of seven formalin-fixed paraffin-embedded sarcomas, heterozygosity was lost at germline CDKN2A mutations sites demonstrating complete loss of function. As sarcomas are rare in CDKN2A /p16 INK4A carriers, we searched in constitutional WES of nine carriers for potential modifying rare variants and identified three in platelet-derived growth factor receptor ( PDGFRA ) gene. Molecular modelling showed that two never-described variants could impact the PDGFRA extracellular domain structure. Germline mutations in CDKN2A /P16 INK4A , a gene known to predispose to hereditary melanoma, pancreatic cancer and tobacco-related cancers, account also for a subset of hereditary sarcoma. In addition, we identified PDGFRA as a candidate modifier gene. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  3. Germline PARP4 mutations in patients with primary thyroid and breast cancers.

    PubMed

    Ikeda, Yuji; Kiyotani, Kazuma; Yew, Poh Yin; Kato, Taigo; Tamura, Kenji; Yap, Kai Lee; Nielsen, Sarah M; Mester, Jessica L; Eng, Charis; Nakamura, Yusuke; Grogan, Raymon H

    2016-03-01

    Germline mutations in the PTEN gene, which cause Cowden syndrome, are known to be one of the genetic factors for primary thyroid and breast cancers; however, PTEN mutations are found in only a small subset of research participants with non-syndrome breast and thyroid cancers. In this study, we aimed to identify germline variants that may be related to genetic risk of primary thyroid and breast cancers. Genomic DNAs extracted from peripheral blood of 14 PTEN WT female research participants with primary thyroid and breast cancers were analyzed by whole-exome sequencing. Gene-based case-control association analysis using the information of 406 Europeans obtained from the 1000 Genomes Project database identified 34 genes possibly associated with the phenotype with P < 1.0 × 10(-3). Among them, rare variants in the PARP4 gene were detected at significant high frequency (odds ratio = 5.2; P = 1.0 × 10(-5)). The variants, G496V and T1170I, were found in six of the 14 study participants (43%) while their frequencies were only 0.5% in controls. Functional analysis using HCC1143 cell line showed that knockdown of PARP4 with siRNA significantly enhanced the cell proliferation, compared with the cells transfected with siControl (P = 0.02). Kaplan-Meier analysis using Gene Expression Omnibus (GEO), European Genome-phenome Archive (EGA) and The Cancer Genome Atlas (TCGA) datasets showed poor relapse-free survival (P < 0.001, Hazard ratio 1.27) and overall survival (P = 0.006, Hazard ratio 1.41) in a PARP4 low-expression group, suggesting that PARP4 may function as a tumor suppressor. In conclusion, we identified PARP4 as a possible susceptibility gene of primary thyroid and breast cancer. © 2016 Society for Endocrinology.

  4. Germline PARP4 mutations in patients with primary thyroid and breast cancers

    PubMed Central

    Ikeda, Yuji; Kiyotani, Kazuma; Yew, Poh Yin; Kato, Taigo; Tamura, Kenji; Yap, Kai-Lee; Nielsen, Sarah M.; Mester, Jessica L; Eng, Charis; Nakamura, Yusuke; Grogan, Raymon H.

    2016-01-01

    Germline mutations in the PTEN gene, which cause Cowden syndrome (CS), are known to be one of the genetic factors for primary thyroid and breast cancers, however, PTEN mutations are found in only a small subset of research participants with non-syndrome breast and thyroid cancers. In this study, we aimed to identify germline variants that may be related to genetic risk of primary thyroid and breast cancers. Genomic DNAs extracted from peripheral blood of 14 PTEN-wild-type female research participants with primary thyroid and breast cancers were analyzed by whole-exome sequencing. Gene-based case control association analysis using the information of 406 Europeans obtained from the 1000 Genomes Project database identified 34 genes possibly associated with the phenotype with P<1.0×10−3. Among them, rare variants in the PARP4 gene were detected at significant high frequency (odds ratio = 5.2, P = 1.0×10−5). The variants, G496V and T1170I, were found in 6 of the 14 study participants (43%) while their frequencies were only 0.5% in controls. Functional analysis using HCC1143 cell line showed that knockdown of PARP4 with siRNA significantly enhanced the cell proliferation, compared with the cells transfected with siControl (P = 0.02). Kaplan-Meier analysis using GEO, EGA and TCGA datasets showed poor progression-free survival (P = 0.006, Hazard ratio 0.71) and overall survival (P < 0.0001, Hazard ratio 0.79) in a PARP4 low-expression group, suggesting that PARP4 may function as a tumor suppression. In conclusion, we identified PARP4 as a possible susceptibility gene of primary thyroid and breast cancer. PMID:26699384

  5. Prevalence of thyrotropin receptor germline mutations and clinical courses in 89 hyperthyroid patients with diffuse goiter and negative anti-thyrotropin receptor antibodies.

    PubMed

    Nishihara, Eijun; Fukata, Shuji; Hishinuma, Akira; Amino, Nobuyuki; Miyauchi, Akira

    2014-05-01

    We studied the frequency of thyrotropin (TSH) receptor mutations in hyperthyroid patients with diffuse goiter and negative TSH receptor antibodies (TRAb), and the clinical pictures of the hyperthyroid patients in the presence and absence of mutations. From 2003 through 2012, 89 hyperthyroid patients with diffuse goiter and negative TRAb based on a second- or third-generation assay underwent sequence analysis of the TSH receptor gene from peripheral leukocytes. The outcome of hyperthyroidism in patients with a TSH receptor mutation and their affected family members was compared with that in patients without any mutation after a 1-10-year follow-up. Germline mutations of the TSH receptor occurred in 4 of the 89 patients (4.5%), including 3 definitive constitutively activating mutations (L512Q, E575K, and D617Y). The main difference in the clinical outcome of hyperthyroidism was that no patients with a TSH receptor mutation achieved euthyroidism throughout the follow-up, while 23.5% of patients without any mutation entered remission. The progression from subclinical to overt hyperthyroidism was not significantly different between patients with or without a mutation. Meanwhile, 10.3% of TRAb-negative patients without any TSH receptor mutation developed TRAb-positive Graves' hyperthyroidism during the follow-up. The prevalence of nonautoimmune hyperthyroidism with TSH receptor mutations is lower than that of latent Graves' disease in TRAb-negative patients with hyperthyroidism. However, all affected patients with a TSH receptor mutation showed persistent hyperthyroidism regardless of subclinical or overt hyperthyroidism throughout the follow-up.

  6. Genomic analysis of the origins and evolution of multicentric diffuse lower-grade gliomas.

    PubMed

    Hayes, Josie; Yu, Yao; Jalbert, Llewellyn E; Mazor, Tali; Jones, Lindsey E; Wood, Matthew D; Walsh, Kyle M; Bengtsson, Henrik; Hong, Chibo; Oberndorfer, Stefan; Roetzer, Thomas; Smirnov, Ivan V; Clarke, Jennifer L; Aghi, Manish K; Chang, Susan M; Nelson, Sarah J; Woehrer, Adelheid; Phillips, Joanna J; Solomon, David A; Costello, Joseph F

    2018-04-09

    Rare multicentric lower-grade gliomas (LGGs) represent a unique opportunity to study the heterogeneity among distinct tumor foci in a single patient and to infer their origins and parallel patterns of evolution. In this study, we integrate clinical features, histology, and immunohistochemistry for 4 patients with multicentric LGG, arising both synchronously and metachronously. For 3 patients we analyze the phylogeny of the lesions using exome sequencing, including one case with a total of 8 samples from the 2 lesions. One patient was diagnosed with multicentric isocitrate dehydrogenase 1 (IDH1) mutated diffuse astrocytomas harboring distinct IDH1 mutations, R132H and R132C; the latter mutation has been associated with Li-Fraumeni syndrome, which was subsequently confirmed in the patient's germline DNA and shown in additional cases with The Cancer Genome Atlas data. In another patient, phylogenetic analysis of synchronously arising grade II and grade III diffuse astrocytomas demonstrated a single shared mutation, IDH1 R132H, and revealed convergent evolution via non-overlapping mutations in ATRX and TP53. In 2 cases, there was divergent evolution of IDH1-mutated and 1p/19q-codeleted oligodendroglioma and IDH1-mutated and 1p/19q-intact diffuse astrocytoma, occurring synchronously in one case and metachronously in a second. Each tumor in multicentric LGG cases may arise independently or may diverge very early in their development, presenting as genetically and histologically distinct tumors. Comprehensive sampling of these lesions can therefore significantly alter diagnosis and management. Additionally, somatic IDH1 R132C mutation in either multicentric or solitary LGG identifies unsuspected germline TP53 mutation, validating the limited number of published cases.

  7. The Molecular Chaperone HSP90 Promotes Notch Signaling in the Germline of Caenorhabditis elegans

    PubMed Central

    Lissemore, James L.; Connors, Elyse; Liu, Ying; Qiao, Li; Yang, Bing; Edgley, Mark L.; Flibotte, Stephane; Taylor, Jon; Au, Vinci; Moerman, Donald G.; Maine, Eleanor M.

    2018-01-01

    In a genetic screen to identify genes that promote GLP-1/Notch signaling in Caenorhabditis elegans germline stem cells, we found a single mutation, om40, defining a gene called ego-3. ego-3(om40) causes several defects in the soma and the germline, including paralysis during larval development, sterility, delayed proliferation of germline stem cells, and ectopic germline stem cell proliferation. Whole genome sequencing identified om40 as an allele of hsp-90, previously known as daf-21, which encodes the C. elegans ortholog of the cytosolic form of HSP90. This protein is a molecular chaperone with a central position in the protein homeostasis network, which is responsible for proper folding, structural maintenance, and degradation of proteins. In addition to its essential role in cellular function, HSP90 plays an important role in stem cell maintenance and renewal. Complementation analysis using a deletion allele of hsp-90 confirmed that ego-3 is the same gene. hsp-90(om40) is an I→N conservative missense mutation of a highly conserved residue in the middle domain of HSP-90. RNA interference-mediated knockdown of hsp-90 expression partially phenocopied hsp-90(om40), confirming the loss-of-function nature of hsp-90(om40). Furthermore, reduced HSP-90 activity enhanced the effect of reduced function of both the GLP-1 receptor and the downstream LAG-1 transcription factor. Taken together, our results provide the first experimental evidence of an essential role for HSP90 in Notch signaling in development. PMID:29507057

  8. The Molecular Chaperone HSP90 Promotes Notch Signaling in the Germline of Caenorhabditis elegans.

    PubMed

    Lissemore, James L; Connors, Elyse; Liu, Ying; Qiao, Li; Yang, Bing; Edgley, Mark L; Flibotte, Stephane; Taylor, Jon; Au, Vinci; Moerman, Donald G; Maine, Eleanor M

    2018-05-04

    In a genetic screen to identify genes that promote GLP-1/Notch signaling in Caenorhabditis elegans germline stem cells, we found a single mutation, om40 , defining a gene called ego-3. ego-3(om40) causes several defects in the soma and the germline, including paralysis during larval development, sterility, delayed proliferation of germline stem cells, and ectopic germline stem cell proliferation. Whole genome sequencing identified om40 as an allele of hsp-90 , previously known as daf-21 , which encodes the C. elegans ortholog of the cytosolic form of HSP90. This protein is a molecular chaperone with a central position in the protein homeostasis network, which is responsible for proper folding, structural maintenance, and degradation of proteins. In addition to its essential role in cellular function, HSP90 plays an important role in stem cell maintenance and renewal. Complementation analysis using a deletion allele of hsp-90 confirmed that ego-3 is the same gene. hsp-90(om40) is an I→N conservative missense mutation of a highly conserved residue in the middle domain of HSP-90 RNA interference-mediated knockdown of hsp-90 expression partially phenocopied hsp-90(om40) , confirming the loss-of-function nature of hsp-90(om40) Furthermore, reduced HSP-90 activity enhanced the effect of reduced function of both the GLP-1 receptor and the downstream LAG-1 transcription factor. Taken together, our results provide the first experimental evidence of an essential role for HSP90 in Notch signaling in development. Copyright © 2018 Lissemore et al.

  9. AluY-mediated germline deletion, duplication and somatic stem cell reversion in UBE2T defines a new subtype of Fanconi anemia.

    PubMed

    Virts, Elizabeth L; Jankowska, Anna; Mackay, Craig; Glaas, Marcel F; Wiek, Constanze; Kelich, Stephanie L; Lottmann, Nadine; Kennedy, Felicia M; Marchal, Christophe; Lehnert, Erik; Scharf, Rüdiger E; Dufour, Carlo; Lanciotti, Marina; Farruggia, Piero; Santoro, Alessandra; Savasan, Süreyya; Scheckenbach, Kathrin; Schipper, Jörg; Wagenmann, Martin; Lewis, Todd; Leffak, Michael; Farlow, Janice L; Foroud, Tatiana M; Honisch, Ellen; Niederacher, Dieter; Chakraborty, Sujata C; Vance, Gail H; Pruss, Dmitry; Timms, Kirsten M; Lanchbury, Jerry S; Alpi, Arno F; Hanenberg, Helmut

    2015-09-15

    Fanconi anemia (FA) is a rare inherited disorder clinically characterized by congenital malformations, progressive bone marrow failure and cancer susceptibility. At the cellular level, FA is associated with hypersensitivity to DNA-crosslinking genotoxins. Eight of 17 known FA genes assemble the FA E3 ligase complex, which catalyzes monoubiquitination of FANCD2 and is essential for replicative DNA crosslink repair. Here, we identify the first FA patient with biallelic germline mutations in the ubiquitin E2 conjugase UBE2T. Both mutations were aluY-mediated: a paternal deletion and maternal duplication of exons 2-6. These loss-of-function mutations in UBE2T induced a cellular phenotype similar to biallelic defects in early FA genes with the absence of FANCD2 monoubiquitination. The maternal duplication produced a mutant mRNA that could encode a functional protein but was degraded by nonsense-mediated mRNA decay. In the patient's hematopoietic stem cells, the maternal allele with the duplication of exons 2-6 spontaneously reverted to a wild-type allele by monoallelic recombination at the duplicated aluY repeat, thereby preventing bone marrow failure. Analysis of germline DNA of 814 normal individuals and 850 breast cancer patients for deletion or duplication of UBE2T exons 2-6 identified the deletion in only two controls, suggesting aluY-mediated recombinations within the UBE2T locus are rare and not associated with an increased breast cancer risk. Finally, a loss-of-function germline mutation in UBE2T was detected in a high-risk breast cancer patient with wild-type BRCA1/2. Cumulatively, we identified UBE2T as a bona fide FA gene (FANCT) that also may be a rare cancer susceptibility gene. © The Author 2015. Published by Oxford University Press.

  10. Germline whole exome sequencing and large-scale replication identifies FANCM as a likely high grade serous ovarian cancer susceptibility gene.

    PubMed

    Dicks, Ed; Song, Honglin; Ramus, Susan J; Oudenhove, Elke Van; Tyrer, Jonathan P; Intermaggio, Maria P; Kar, Siddhartha; Harrington, Patricia; Bowtell, David D; Group, Aocs Study; Cicek, Mine S; Cunningham, Julie M; Fridley, Brooke L; Alsop, Jennifer; Jimenez-Linan, Mercedes; Piskorz, Anna; Goranova, Teodora; Kent, Emma; Siddiqui, Nadeem; Paul, James; Crawford, Robin; Poblete, Samantha; Lele, Shashi; Sucheston-Campbell, Lara; Moysich, Kirsten B; Sieh, Weiva; McGuire, Valerie; Lester, Jenny; Odunsi, Kunle; Whittemore, Alice S; Bogdanova, Natalia; Dürst, Matthias; Hillemanns, Peter; Karlan, Beth Y; Gentry-Maharaj, Aleksandra; Menon, Usha; Tischkowitz, Marc; Levine, Douglas; Brenton, James D; Dörk, Thilo; Goode, Ellen L; Gayther, Simon A; Pharoah, D P Paul

    2017-08-01

    We analyzed whole exome sequencing data in germline DNA from 412 high grade serous ovarian cancer (HGSOC) cases from The Cancer Genome Atlas Project and identified 5,517 genes harboring a predicted deleterious germline coding mutation in at least one HGSOC case. Gene-set enrichment analysis showed enrichment for genes involved in DNA repair (p = 1.8×10 -3 ). Twelve DNA repair genes - APEX1, APLF, ATX, EME1, FANCL, FANCM, MAD2L2, PARP2, PARP3, POLN, RAD54L and SMUG1 - were prioritized for targeted sequencing in up to 3,107 HGSOC cases, 1,491 cases of other epithelial ovarian cancer (EOC) subtypes and 3,368 unaffected controls of European origin. We estimated mutation prevalence for each gene and tested for associations with disease risk. Mutations were identified in both cases and controls in all genes except MAD2L2 , where we found no evidence of mutations in controls. In FANCM we observed a higher mutation frequency in HGSOC cases compared to controls (29/3,107 cases, 0.96 percent; 13/3,368 controls, 0.38 percent; P=0.008) with little evidence for association with other subtypes (6/1,491, 0.40 percent; P=0.82). The relative risk of HGSOC associated with deleterious FANCM mutations was estimated to be 2.5 (95% CI 1.3 - 5.0; P=0.006). In summary, whole exome sequencing of EOC cases with large-scale replication in case-control studies has identified FANCM as a likely novel susceptibility gene for HGSOC, with mutations associated with a moderate increase in risk. These data may have clinical implications for risk prediction and prevention approaches for high-grade serous ovarian cancer in the future and a significant impact on reducing disease mortality.

  11. Phase II and Biomarker Study of the Dual MET/VEGFR2 Inhibitor Foretinib in Patients With Papillary Renal Cell Carcinoma

    PubMed Central

    Choueiri, Toni K.; Vaishampayan, Ulka; Rosenberg, Jonathan E.; Logan, Theodore F.; Harzstark, Andrea L.; Bukowski, Ronald M.; Rini, Brian I.; Srinivas, Sandy; Stein, Mark N.; Adams, Laurel M.; Ottesen, Lone H.; Laubscher, Kevin H.; Sherman, Laurie; McDermott, David F.; Haas, Naomi B.; Flaherty, Keith T.; Ross, Robert; Eisenberg, Peter; Meltzer, Paul S.; Merino, Maria J.; Bottaro, Donald P.; Linehan, W. Marston; Srinivasan, Ramaprasad

    2013-01-01

    Purpose Foretinib is an oral multikinase inhibitor targeting MET, VEGF, RON, AXL, and TIE-2 receptors. Activating mutations or amplifications in MET have been described in patients with papillary renal cell carcinoma (PRCC). We aimed to evaluate the efficacy and safety of foretinib in patients with PRCC. Patients and Methods Patients were enrolled onto the study in two cohorts with different dosing schedules of foretinib: cohort A, 240 mg once per day on days 1 through 5 every 14 days (intermittent arm); cohort B, 80 mg daily (daily dosing arm). Patients were stratified on the basis of MET pathway activation (germline or somatic MET mutation, MET [7q31] amplification, or gain of chromosome 7). The primary end point was overall response rate (ORR). Results Overall, 74 patients were enrolled, with 37 in each dosing cohort. ORR by Response Evaluation Criteria in Solid Tumors (RECIST) 1.0 was 13.5%, median progression-free survival was 9.3 months, and median overall survival was not reached. The presence of a germline MET mutation was highly predictive of a response (five of 10 v five of 57 patients with and without germline MET mutations, respectively). The most frequent adverse events of any grade associated with foretinib were fatigue, hypertension, gastrointestinal toxicities, and nonfatal pulmonary emboli. Conclusion Foretinib demonstrated activity in patients with advanced PRCC with a manageable toxicity profile and a high response rate in patients with germline MET mutations. PMID:23213094

  12. Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

    PubMed

    Zhao, Yongzhong; Epstein, Richard J

    2013-01-01

    Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

  13. Roles of germline JAK2 activation mutation JAK2 V625F in the pathology of myeloproliferative neoplasms.

    PubMed

    Wu, Qing-Yun; Ma, Meng-Meng; Fu, Lin; Zhu, Yuan-Yuan; Liu, Yang; Cao, Jiang; Zhou, Ping; Li, Zhen-Yu; Zeng, Ling-Yu; Li, Feng; Wang, Xiao-Yun; Xu, Kai-Lin

    2018-05-18

    Janus tyrosine kinase 2 (JAK2) mediates downstream signaling of cytokine receptors in all hematological lineages, constitutively active somatic JAK2 mutations play key roles in the pathology of myeloproliferative neoplasms (MPNs). Recently, germline JAK2 mutations are also associated with triple-negative MPNs. A novel germline mutation JAK2 V625F is reported to be involved in a subset of MPNs patients. However, the pathogenesis of this mutation caused MPN is still unclear. In this study, the homology models of JAK2 V625F showed that the newly formed interaction between F625 and Y613 disrupted the JAK2 JH1-JH2 domain interactions was responsible for its activation, when F625 and Y613 interaction was disrupted, its activity significantly decreased. While, when this interaction was repaired whether by forming hydrogen bond or salt bond, it would cause JAK2 activation. Biochemical studies also demonstrated that JAK2 V625F mutation led to JAK2-STAT5 pathway activation and promoted the proliferation of BaF3 cells. Thus, our results herein provide clues to understand the mechanism JAK2 V625F mutation caused MPNs and give information for the development of JAK2 mutation specific inhibitors. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. PMS2 monoallelic mutation carriers: the known unknown

    PubMed Central

    Goodenberger, McKinsey L.; Thomas, Brittany C.; Riegert-Johnson, Douglas; Boland, C. Richard; Plon, Sharon E.; Clendenning, Mark; Ko Win, Aung; Senter, Leigha; Lipkin, Steven M.; Stadler, Zsofia K.; Macrae, Finlay A.; Lynch, Henry T.; Weitzel, Jeffrey N.; de la Chapelle, Albert; Syngal, Sapna; Lynch, Patrick; Parry, Susan; Jenkins, Mark A.; Gallinger, Steven; Holter, Spring; Aronson, Melyssa; Newcomb, Polly A.; Burnett, Terrilea; Le Marchand, Loïc; Pichurin, Pavel; Hampel, Heather; Terdiman, Jonathan P.; Lu, Karen H.; Thibodeau, Stephen; Lindor, Noralane M.

    2016-01-01

    Germline mutations in MLH1, MSH2, MSH6 and PMS2 have been shown to cause Lynch syndrome. The penetrance for cancer and tumor spectrum has been repeatedly studied and multiple professional societies have proposed clinical management guidelines for affected individuals. Several studies have demonstrated a reduced penetrance for monoallelic carriers of PMS2 mutations compared to the other mismatch repair (MMR) genes, but clinical management guidelines have largely proposed the same screening recommendations for all MMR gene carriers. The authors considered whether enough evidence existed to propose new screening guidelines specific to PMS2 mutation carriers with regard to age of onset and frequency of colonic screening. Published reports of PMS2 germline mutations were combined with unpublished cases from the authors’ research registries and clinical practices, and a discussion of potential modification of cancer screening guidelines was pursued. A total of 234 monoallelic PMS2 mutation carriers from 170 families were included. Approximately 8% of those with CRC were diagnosed under age 30 and each of these tumors presented on the left-side of the colon. As it is currently unknown what causes the early-onset of CRC in some families with monoallelic PMS2 germline mutations, the authors recommend against reducing cancer surveillance guidelines in families found having monoallelic PMS2 mutations in spite of the documented reduced penetrance. PMID:25856668

  15. PMS2 monoallelic mutation carriers: the known unknown.

    PubMed

    Goodenberger, McKinsey L; Thomas, Brittany C; Riegert-Johnson, Douglas; Boland, C Richard; Plon, Sharon E; Clendenning, Mark; Win, Aung Ko; Senter, Leigha; Lipkin, Steven M; Stadler, Zsofia K; Macrae, Finlay A; Lynch, Henry T; Weitzel, Jeffrey N; de la Chapelle, Albert; Syngal, Sapna; Lynch, Patrick; Parry, Susan; Jenkins, Mark A; Gallinger, Steven; Holter, Spring; Aronson, Melyssa; Newcomb, Polly A; Burnett, Terrilea; Le Marchand, Loïc; Pichurin, Pavel; Hampel, Heather; Terdiman, Jonathan P; Lu, Karen H; Thibodeau, Stephen; Lindor, Noralane M

    2016-01-01

    Germ-line mutations in MLH1, MSH2, MSH6, and PMS2 have been shown to cause Lynch syndrome. The penetrance of the cancer and tumor spectrum has been repeatedly studied, and multiple professional societies have proposed clinical management guidelines for affected individuals. Several studies have demonstrated a reduced penetrance for monoallelic carriers of PMS2 mutations compared with the other mismatch repair (MMR) genes, but clinical management guidelines have largely proposed the same screening recommendations for all MMR gene carriers. The authors considered whether enough evidence existed to propose new screening guidelines specific to PMS2 mutation carriers with regard to age at onset and frequency of colonic screening. Published reports of PMS2 germ-line mutations were combined with unpublished cases from the authors' research registries and clinical practices, and a discussion of potential modification of cancer screening guidelines was pursued. A total of 234 monoallelic PMS2 mutation carriers from 170 families were included. Approximately 8% of those with colorectal cancer (CRC) were diagnosed before age 30, and each of these tumors presented on the left side of the colon. As it is currently unknown what causes the early onset of CRC in some families with monoallelic PMS2 germline mutations, the authors recommend against reducing cancer surveillance guidelines in families found having monoallelic PMS2 mutations in spite of the reduced penetrance.Genet Med 18 1, 13-19.

  16. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers.

    PubMed

    Hu, Hai; Li, Hong; Jiao, Feng; Han, Ting; Zhuo, Meng; Cui, Jiujie; Li, Yixue; Wang, Liwei

    2017-10-03

    Multiple primary cancers (MPC) have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing) that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR) genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  17. Rubinstein-Taybi syndrome predisposing to non-WNT, non-SHH, group 3 medulloblastoma.

    PubMed

    Bourdeaut, Franck; Miquel, Catherine; Richer, Wilfrid; Grill, Jacques; Zerah, Michel; Grison, Camille; Pierron, Gaelle; Amiel, Jeanne; Krucker, Clementine; Radvanyi, Francois; Brugieres, Laurence; Delattre, Olivier

    2014-02-01

    Medulloblastomas (MB) are classified in four subgroups: the well defined WNT and Sonic Hedgehog (SHH) subgroups, and the less defined groups 3 and 4. They occasionally occur in the context of a cancer predisposition syndrome. While germline APC mutations predispose to WNT MB, germline mutations in SUFU, PTCH1, and TP53 predispose to SHH tumors. We report on a child with a Rubinstein-Taybi syndrome (RTS) due to a germline deletion in CREBBP, who developed a MB. Biological profilings demonstrate that this tumor belongs to the group 3. RTS may therefore be the first predisposition syndrome identified for non-WNT/non-SHH MB. © 2013 Wiley Periodicals, Inc.

  18. The somatic POLE P286R mutation defines a unique subclass of colorectal cancer featuring hypermutation, representing a potential genomic biomarker for immunotherapy

    PubMed Central

    Kim, Jihun; Kim, Deokhoon; Chun, Sung-Min; Kim, Jiyun; Kim, Tae Won; Park, Inja; Yu, Chang-Sik; Jang, Se Jin

    2016-01-01

    Early-onset colorectal cancers (EOCRCs) may have biological or genomic features distinct from late-onset CRCs (LOCRCs). Previous studies have mostly focused on the germline predisposition conditions of EOCRCs, but we hypothesized that EOCRCs may have distinct somatic aberrations that accelerate cancer development. To identify the somatic aberrations that accelerate cancer development at an early age, we conducted whole exome sequencing for 28 polyposis-unrelated, microsatellite stable (MSS) EOCRCs with no known germline predisposition conditions. Surprisingly, we found two distinct groups in the context of mutational burden: 6 hypermutated cases with 2325 to 10973 mutations and 22 nonhypermutated cases with 47 to 154 mutations. Further analysis revealed that four of the six hypermutated cases had the same POLE P286R mutation. We validated this finding in 83 MSS EOCRCs and 27 MSS LOCRCs, which revealed that 7.2% of EOCRCs (6/83) had the POLE P286R mutation, which was not found in LOCRCs. Clinicopathologically, EOCRCs with POLE mutations occurred far more frequently in the right colon than in the left colon, affecting men more frequently than women. In summary, we have identified a unique subclass of colon cancer characterized by a hypermutation associated with the POLE mutation. The acquisition of the POLE mutation leading to hypermutation can accelerate cancer development. Clinically, this subset with hypermutation may be susceptible to immune checkpoint blockade. PMID:27612425

  19. Association between CHEK2 H371Y mutation and response to neoadjuvant chemotherapy in women with breast cancer.

    PubMed

    Liu, Yin; Xu, Ye; Ouyang, Tao; Li, Jinfeng; Wang, Tianfeng; Fan, Zhaoqing; Fan, Tie; Lin, Benyao; Xie, Yuntao

    2015-03-28

    Our previous study suggested that the recurrent CHEK2 H371Y mutation is a novel pathogenic mutation that confers an increased risk of breast cancer. The purpose of this study was to investigate whether breast cancer patients with CHEK2 H371Y mutation were more likely to respond to neoadjuvant chemotherapy. We screened a cohort of 2334 Chinese women with operable primary breast cancer who received a neoadjuvant chemotherapy regimen for CHEK2 H371Y germline mutations. Pathologic complete response (pCR) was defined as the absence of tumor cells in the breast after the completion of neoadjuvant chemotherapy. Thirty-nine patients (1.7%) with CHEK2 H371Y germline mutation were identified in this cohort of 2334 patients. CHEK2 H371Y mutation carriers had a significantly higher pCR rate than non-carriers (33.3% versus 19.5%, P = 0.031) in the entire study population, and CHEK2 H371Y mutation-positive status remained an independent favorable predictor of pCR in a multivariate analysis (odds ratio [OR] = 3.01; 95% confidence interval [CI]: 1.34- 6.78, P = 0.008). CHEK2 H371Y carriers had a slightly worse distant recurrence-free survival than non-carriers (adjusted hazard ratio [HR] =1.24, 95% CI: 0.59-2.63). CHEK2 H371Y mutation carriers are more likely to respond to neoadjuvant chemotherapy than are non-carriers.

  20. Activation of the ALT pathway for telomere maintenance can affect other sequences in the human genome.

    PubMed

    Jeyapalan, Jennie N; Varley, Helen; Foxon, Jenny L; Pollock, Raphael E; Jeffreys, Alec J; Henson, Jeremy D; Reddel, Roger R; Royle, Nicola J

    2005-07-01

    Immortal human cells maintain telomere length by the expression of telomerase or through the alternative lengthening of telomeres (ALT). The ALT mechanism involves a recombination-like process that allows the rapid elongation of shortened telomeres. However, it is not known whether activation of the ALT pathway affects other sequences in the genome. To address this we have investigated, in ALT-expressing cell lines and tumours, the stability of tandem repeat sequences known to mutate via homologous recombination in the human germline. We have shown extraordinary somatic instability in the human minisatellite MS32 (D1S8) in ALT-expressing (ALT+) but not in normal or telomerase-expressing cell lines. The MS32 mutation frequency varied across 15 ALT+ cell lines and was on average 55-fold greater than in ALT- cell lines. The MS32 minisatellite was also highly unstable in three of eight ALT+ soft tissue sarcomas, indicating that somatic destabilization occurs in vivo. The MS32 mutation rates estimated for two ALT+ cell lines were similar to that seen in the germline. However, the internal structures of ALT and germline mutant alleles are very different, indicating differences in the underlying mutation mechanisms. Five other hypervariable minisatellites did not show elevated instability in ALT-expressing cell lines, indicating that minisatellite destabilization is not universal. The elevation of MS32 instability upon activation of the ALT pathway and telomere length maintenance suggests there is overlap between the underlying processes that may be tractable through analysis of the D1S8 locus.

  1. GERM-LINE SPECIFIC FACTORS IN CHEMICAL MUTAGENESIS

    EPA Science Inventory

    Chemical mutagenesis test results ave not revealed evidence of germ-line specific mutagens. owever, conventional assays have indicated that there are male-female differences in mutagenic response, as well as quantitative/qualitative differences in induced mutations which depend u...

  2. Maternal dazap2 Regulates Germ Granules by Counteracting Dynein in Zebrafish Primordial Germ Cells.

    PubMed

    Forbes, Meredyth M; Rothhämel, Sophie; Jenny, Andreas; Marlow, Florence L

    2015-07-07

    Primordial germ cells (PGCs) are the stem cells of the germline. Generally, germline induction occurs via zygotic factors or the inheritance of maternal determinants called germ plasm (GP). GP is packaged into ribonucleoprotein complexes within oocytes and later promotes the germline fate in embryos. Once PGCs are specified by either mechanism, GP components localize to perinuclear granular-like structures. Although components of zebrafish PGC germ granules have been studied, the maternal factors regulating their assembly and contribution to germ cell development are unknown. Here, we show that the scaffold protein Dazap2 binds to Bucky ball, an essential regulator of oocyte polarity and GP assembly, and colocalizes with the GP in oocytes and in PGCs. Mutational analysis revealed a requirement for maternal Dazap2 (MDazap2) in germ-granule maintenance. Through molecular epistasis analyses, we show that MDazap2 is epistatic to Tdrd7 and maintains germ granules in the embryonic germline by counteracting Dynein activity. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Deep sequencing detects very-low-grade somatic mosaicism in the unaffected mother of siblings with nemaline myopathy.

    PubMed

    Miyatake, Satoko; Koshimizu, Eriko; Hayashi, Yukiko K; Miya, Kazushi; Shiina, Masaaki; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Miyake, Noriko; Saitsu, Hirotomo; Ogata, Kazuhiro; Nishino, Ichizo; Matsumoto, Naomichi

    2014-07-01

    When an expected mutation in a particular disease-causing gene is not identified in a suspected carrier, it is usually assumed to be due to germline mosaicism. We report here very-low-grade somatic mosaicism in ACTA1 in an unaffected mother of two siblings affected with a neonatal form of nemaline myopathy. The mosaicism was detected by deep resequencing using a next-generation sequencer. We identified a novel heterozygous mutation in ACTA1, c.448A>G (p.Thr150Ala), in the affected siblings. Three-dimensional structural modeling suggested that this mutation may affect polymerization and/or actin's interactions with other proteins. In this family, we expected autosomal dominant inheritance with either parent demonstrating germline or somatic mosaicism. Sanger sequencing identified no mutation. However, further deep resequencing of this mutation on a next-generation sequencer identified very-low-grade somatic mosaicism in the mother: 0.4%, 1.1%, and 8.3% in the saliva, blood leukocytes, and nails, respectively. Our study demonstrates the possibility of very-low-grade somatic mosaicism in suspected carriers, rather than germline mosaicism. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. A novel pathogenic splice acceptor site germline mutation in intron 14 of the APC gene in a Chinese family with familial adenomatous polyposis.

    PubMed

    Wang, Dan; Liang, Shengyun; Zhang, Zhao; Zhao, Guoru; Hu, Yuan; Liang, Shengran; Zhang, Xipeng; Banerjee, Santasree

    2017-03-28

    Familial adenomatous polyposis (FAP) is an autosomal dominant precancerous condition, clinically characterized by the presence of multiple colorectal adenomas or polyps. Patients with FAP has a high risk of developing colorectal cancer (CRC) from these colorectal adenomatous polyps by the mean age of diagnosis at 40 years. Germline mutations of the APC gene cause familial adenomatous polyposis (FAP). Colectomy has recommended for the FAP patients with significant polyposis. Here, we present a clinical molecular study of a four generation Chinese family with FAP. Clinical diagnosis of FAP has been done according to the phenotype, family history and medical records. Patient's blood samples were collected and genomic DNA was extracted. In order to identify the pathogenic mutation underlying the disease phenotype targeted next-generation sequencing and confirmatory sanger sequencing has undertaken. Targeted next generation sequencing identified a novel heterozygous splice-acceptor site mutation [c.1744-1G>A] in intron 14 of APC gene, which is co-segregated with the FAP phenotypes in the proband and amongst all the affected family members. This mutation is not present in unaffected family members and in normal healthy controls of same ethnic origin. According to the LOVD database for Chinese colorectal cancer patients, in Chinese population, 60% of the previously reported APC gene mutations causes FAP, are missense mutations. This novel splice-acceptor site mutation causing FAP in this Chinese family expands the germline mutation spectrum of the APC gene in the Chinese population.

  5. Germ-line PHD1 and PHD2 mutations detected in patients with pheochromocytoma/paraganglioma-polycythemia.

    PubMed

    Yang, Chunzhang; Zhuang, Zhengping; Fliedner, Stephanie M J; Shankavaram, Uma; Sun, Michael G; Bullova, Petra; Zhu, Roland; Elkahloun, Abdel G; Kourlas, Peter J; Merino, Maria; Kebebew, Electron; Pacak, Karel

    2015-01-01

    We have investigated genetic/pathogenetic factors associated with a new clinical entity in patients presenting with pheochromocytoma/paraganglioma (PHEO/PGL) and polycythemia. Two patients without hypoxia-inducible factor 2α (HIF2A) mutations, who presented with similar clinical manifestations, were analyzed for other gene mutations, including prolyl hydroxylase (PHD) mutations. We have found for the first time a germ-line mutation in PHD1 in one patient and a novel germ-line PHD2 mutation in a second patient. Both mutants exhibited reduced protein stability with substantial quantitative protein loss and thus compromised catalytic activities. Due to the unique association of patients' polycythemia with borderline or mildly elevated erythropoietin (EPO) levels, we also performed an in vitro sensitivity assay of erythroid progenitors to EPO and for EPO receptor (EPOR) expression. The results show inappropriate hypersensitivity of erythroid progenitors to EPO in these patients, indicating increased EPOR expression/activity. In addition, the present study indicates that HIF dysregulation due to PHD mutations plays an important role in the pathogenesis of these tumors and associated polycythemia. The PHD1 mutation appears to be a new member contributing to the genetic landscape of this novel clinical entity. Our results support the existence of a specific PHD1- and PHD2-associated PHEO/PGL-polycythemia disorder. • A novel germ-l i n e PHD1 mutation causing heochromocytoma/paraganglioma and polycythemia. • Increased EPOR activity and inappropriate hypersensitivity of erythroid progenitors to EPO.

  6. Germline genetic variants in men with prostate cancer and one or more additional cancers.

    PubMed

    Pilié, Patrick G; Johnson, Anna M; Hanson, Kristen L; Dayno, Megan E; Kapron, Ashley L; Stoffel, Elena M; Cooney, Kathleen A

    2017-10-15

    Prostate cancer has a significant heritable component, and rare deleterious germline variants in certain genes can increase the risk of the disease. The aim of the current study was to describe the prevalence of pathogenic germline variants in cancer-predisposing genes in men with prostate cancer and at least 1 additional primary cancer. Using a multigene panel, the authors sequenced germline DNA from 102 men with prostate cancer and at least 1 additional primary cancer who also met ≥1 of the following criteria: 1) age ≤55 years at the time of diagnosis of the first malignancy; 2) rare tumor type or atypical presentation of a common tumor; and/or 3) ≥3 primary malignancies. Cancer family history and clinicopathologic data were independently reviewed by a clinical genetic counselor to determine whether the patient met established criteria for testing for a hereditary cancer syndrome. Sequencing identified approximately 3500 variants. Nine protein-truncating deleterious mutations were found across 6 genes, including BRCA2, ataxia telangiectasia mutated (ATM), mutL homolog 1 (MLH1), BRCA1 interacting protein C-terminal helicase 1 (BRIP1), partner and localizer of BRCA2 (PALB2), and fibroblast growth factor receptor 3 (FGFR3). Likely pathogenic missense variants were identified in checkpoint kinase 2 (CHEK2) and homeobox protein Hox-B13 (HOXB13). In total, 11 of 102 patients (10.8%) were found to have pathogenic or likely pathogenic mutations in cancer-predisposing genes. The majority of these men (64%) did not meet current clinical criteria for germline testing. Men with prostate cancer and at least 1 additional primary cancer are enriched for harboring a germline deleterious mutation in a cancer-predisposing gene that may impact cancer prognosis and treatment, but the majority do not meet current criteria for clinical genetic testing. Cancer 2017;123:3925-32. © 2017 American Cancer Society. © 2017 American Cancer Society.

  7. Refining the role of PMS2 in Lynch syndrome: germline mutational analysis improved by comprehensive assessment of variants.

    PubMed

    Borràs, Ester; Pineda, Marta; Cadiñanos, Juan; Del Valle, Jesús; Brieger, Angela; Hinrichsen, Inga; Cabanillas, Ruben; Navarro, Matilde; Brunet, Joan; Sanjuan, Xavier; Musulen, Eva; van der Klift, Helen; Lázaro, Conxi; Plotz, Guido; Blanco, Ignacio; Capellá, Gabriel

    2013-08-01

    The majority of mismatch repair (MMR) gene mutations causing Lynch syndrome (LS) occur either in MLH1 or MSH2. However, the relative contribution of PMS2 is less well defined. The aim of this study was to evaluate the role of PMS2 in LS by assessing the pathogenicity of variants of unknown significance (VUS) detected in the mutational analysis of PMS2 in a series of Spanish patients. From a cohort of 202 LS suspected patients, 13 patients showing loss of PMS2 expression in tumours were screened for germline mutations in PMS2, using a long range PCR based strategy and multiplex ligation dependent probe amplification (MLPA). Pathogenicity assessment of PMS2 VUS was performed evaluating clinicopathological data, frequency in control population and in silico and in vitro analyses at the RNA and protein level. Overall 25 different PMS2 DNA variants were detected. Fourteen were classified as polymorphisms. Nine variants were classified as pathogenic: seven alterations based on their molecular nature and two after demonstrating a functional defect (c.538-3C>G affected mRNA processing and c.137G>T impaired MMR activity). The c.1569C>G variant was classified as likely neutral while the c.384G>A remained as a VUS. We have also shown that the polymorphic variant c.59G>A is MMR proficient. Pathogenic PMS2 mutations were detected in 69% of patients harbouring LS associated tumours with loss of PMS2 expression. In all, PMS2 mutations account for 6% of the LS cases identified. The comprehensive functional analysis shown here has been useful in the classification of PMS2 VUS and contributes to refining the role of PMS2 in LS.

  8. Mutation Pattern of Paired Immunoglobulin Heavy and Light Variable Domains in Chronic Lymphocytic Leukemia B Cells

    PubMed Central

    Ghiotto, Fabio; Marcatili, Paolo; Tenca, Claudya; Calevo, Maria Grazia; Yan, Xiao-Jie; Albesiano, Emilia; Bagnara, Davide; Colombo, Monica; Cutrona, Giovanna; Chu, Charles C; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Tramontano, Anna; Fais, Franco; Chiorazzi, Nicholas

    2011-01-01

    B-cell chronic lymphocytic leukemia (CLL) patients display leukemic clones bearing either germline or somatically mutated immunoglobulin heavy variable (IGHV ) genes. Most information on CLL immunoglobulins (Igs), such as the definition of stereotyped B-cell receptors (BCRs), was derived from germline unmutated Igs. In particular, detailed studies on the distribution and nature of mutations in paired heavy- and light-chain domains of CLL clones bearing mutated Igs are lacking. To address the somatic hyper-mutation dynamics of CLL Igs, we analyzed the mutation pattern of paired IGHV–diversity-joining (IGHV-D-J ) and immunoglobulin kappa/lambda variable-joining (IGK/LV-J ) rearrangements of 193 leukemic clones that displayed ≥2% mutations in at least one of the two immunoglobulin variable (IGV ) genes (IGHV and/or IGK/LV ). The relationship between the mutation frequency in IGHV and IGK/LV complementarity determining regions (CDRs) and framework regions (FRs) was evaluated by correlation analysis. Replacement (R) mutation frequency within IGK/LV chain CDRs correlated significantly with mutation frequency of paired IGHV CDRs in λ but not κ isotype CLL clones. CDRs of IGKV-J rearrangements displayed a lower percentage of R mutations than IGHVs. The frequency/pattern of mutations in kappa CLL Igs differed also from that in κ-expressing normal B cells described in the literature. Instead, the mutation frequency within the FRs of IGHV and either IGKV or IGLV was correlated. Notably, the amount of diversity introduced by replaced amino acids was comparable between IGHVs and IGKVs. The data indicate a different mutation pattern between κ and λ isotype CLL clones and suggest an antigenic selection that, in κ samples, operates against CDR variation. PMID:21785810

  9. A homozygous loss-of-function CAMK2A mutation causes growth delay, frequent seizures and severe intellectual disability.

    PubMed

    Chia, Poh Hui; Zhong, Franklin Lei; Niwa, Shinsuke; Bonnard, Carine; Utami, Kagistia Hana; Zeng, Ruizhu; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Xie, William H; Al-Tawalbeh, Samah; El-Khateeb, Mohammad; Shboul, Mohammad; Pouladi, Mahmoud A; Al-Raqad, Mohammed; Reversade, Bruno

    2018-05-22

    Calcium/calmodulin-dependent protein kinase II (CAMK2) plays fundamental roles in synaptic plasticity that underlies learning and memory. Here, we describe a new recessive neurodevelopmental syndrome with global developmental delay, seizures and intellectual disability. Using linkage analysis and exome sequencing, we found that this disease maps to chromosome 5q31.1-q34 and is caused by a biallelic germline mutation in CAMK2A . The missense mutation, p.His477Tyr is located in the CAMK2A association domain that is critical for its function and localization. Biochemically, the p.His477Tyr mutant is defective in self-oligomerization and unable to assemble into the multimeric holoenzyme. In vivo , CAMK2A H477Y failed to rescue neuronal defects in C. elegans lacking unc-43 , the ortholog of human CAMK2A. In vitro , neurons derived from patient iPSCs displayed profound synaptic defects. Together, our data demonstrate that a recessive germline mutation in CAMK2A leads to neurodevelopmental defects in humans and suggest that dysfunctional CAMK2 paralogs may contribute to other neurological disorders. © 2018, Chia et al.

  10. A comprehensive characterization of rare mitochondrial DNA variants in neuroblastoma

    PubMed Central

    Pignataro, Piero; Lasorsa, Vito Alessandro; Hogarty, Michael D.; Castellano, Aurora; Conte, Massimo; Tonini, Gian Paolo; Iolascon, Achille; Gasparre, Giuseppe; Capasso, Mario

    2016-01-01

    Background Neuroblastoma, a tumor of the developing sympathetic nervous system, is a common childhood neoplasm that is often lethal. Mitochondrial DNA (mtDNA) mutations have been found in most tumors including neuroblastoma. We extracted mtDNA data from a cohort of neuroblastoma samples that had undergone Whole Exome Sequencing (WES) and also used snap-frozen samples in which mtDNA was entirely sequenced by Sanger technology. We next undertook the challenge of determining those mutations that are relevant to, or arisen during tumor development. The bioinformatics pipeline used to extract mitochondrial variants from matched tumor/blood samples was enriched by a set of filters inclusive of heteroplasmic fraction, nucleotide variability, and in silico prediction of pathogenicity. Results Our in silico multistep workflow applied both on WES and Sanger-sequenced neuroblastoma samples, allowed us to identify a limited burden of somatic and germline mitochondrial mutations with a potential pathogenic impact. Conclusions The few singleton germline and somatic mitochondrial mutations emerged, according to our in silico analysis, do not appear to impact on the development of neuroblastoma. Our findings are consistent with the hypothesis that most mitochondrial somatic mutations can be considered as ‘passengers’ and consequently have no discernible effect in this type of cancer. PMID:27351283

  11. Impact of 226C>T MSH2 gene mutation on cancer phenotypes in two HNPCC-associated highly-consanguineous families from Kuwait: emphasis on premarital genetic testing.

    PubMed

    Marafie, Makia J; Al-Awadi, Sadiqa; Al-Mosawi, Fatemah; Elshafey, Alaa; Al-Ali, Waleed; Al-Mulla, Fahd

    2009-01-01

    Lynch syndrome or hereditary nonpolyposis colorectal cancer (HNPCC) is one of the commonest cancer susceptibility syndromes. It is characterized by early onset colon cancer and a variety of extracolonic tumours. Germline mutations in the DNA mismatch repair genes (MLH1, MSH2, MSH6, PMS1, and PMS2) are responsible for this disorder. Identifying an affected individual depends on the tumour histopathology, family history that fulfils the Amsterdam and/or Bethesda criteria, tumour immunohistochemistry, microsatellite instability, and finally molecular analysis of an affected member. It is a laborious, time consuming and expensive procedure, which needs the effort of a multi-disciplinary team. However, once the diagnosis is established and germline defect is identified, other high risk pre-symptomatic carriers could be offered intensive surveillance and management as a preventive measure against cancer development. Here, we present two large highly consanguineous HNPCC-families from Kuwait in whom a founder MSH2 mutation was identified. The relationship between this mutation and cancer expressivity in two large consanguineous families harbouring other genetic defects is discussed. Moreover, we shed light on the challenges pertaining to diagnosis, screening, premarital counselling of couples and prenatal diagnosis of offspring with biallelic MSH2 gene mutation.

  12. Prevalence and spectrum of germline rare variants in BRCA1/2 and PALB2 among breast cancer cases in Sarawak, Malaysia.

    PubMed

    Yang, Xiaohong R; Devi, Beena C R; Sung, Hyuna; Guida, Jennifer; Mucaki, Eliseos J; Xiao, Yanzi; Best, Ana; Garland, Lisa; Xie, Yi; Hu, Nan; Rodriguez-Herrera, Maria; Wang, Chaoyu; Jones, Kristine; Luo, Wen; Hicks, Belynda; Tang, Tieng Swee; Moitra, Karobi; Rogan, Peter K; Dean, Michael

    2017-10-01

    To characterize the spectrum of germline mutations in BRCA1, BRCA2, and PALB2 in population-based unselected breast cancer cases in an Asian population. Germline DNA from 467 breast cancer patients in Sarawak General Hospital, Malaysia, where 93% of the breast cancer patients in Sarawak are treated, was sequenced for the entire coding region of BRCA1; BRCA2; PALB2; Exons 6, 7, and 8 of TP53; and Exons 7 and 8 of PTEN. Pathogenic variants included known pathogenic variants in ClinVar, loss of function variants, and variants that disrupt splice site. We found 27 pathogenic variants (11 BRCA1, 10 BRCA2, 4 PALB2, and 2 TP53) in 34 patients, which gave a prevalence of germline mutations of 2.8, 3.23, and 0.86% for BRCA1, BRCA2, and PALB2, respectively. Compared to mutation non-carriers, BRCA1 mutation carriers were more likely to have an earlier age at onset, triple-negative subtype, and lower body mass index, whereas BRCA2 mutation carriers were more likely to have a positive family history. Mutation carrier cases had worse survival compared to non-carriers; however, the association was mostly driven by stage and tumor subtype. We also identified 19 variants of unknown significance, and some of them were predicted to alter splicing or transcription factor binding sites. Our data provide insight into the genetics of breast cancer in this understudied group and suggest the need for modifying genetic testing guidelines for this population with a much younger age at diagnosis and more limited resources compared with Caucasian populations.

  13. BRCA germline mutations in women with uterine serous carcinoma--still a debate.

    PubMed

    Lavie, Ofer; Ben-Arie, Alon; Segev, Yakir; Faro, Jonathan; Barak, Frida; Haya, Nir; Auslender, Ron; Gemer, Ofer

    2010-12-01

    To determine the incidence of BRCA1 and BRCA2 mutations in an enlarged series of uterine serous carcinoma (USC) patients and to determine whether patients with USC are associated with a personal or familial history of breast or ovarian carcinoma. A cohort of all consecutive patients with diagnosed USC was identified for 9 years. Family pedigrees were drawn as far back and laterally as possible. In all patients, genomic DNA was extracted from peripheral blood samples and analyzed for the 3 mutations common in Ashkenazi Jewish patients. All patients went through total abdominal hysterectomy, bilateral salpingo-oophorectomy, and omentectomy. Tubal, ovarian, and peritoneal carcinoma were ruled out clinically and pathologically in all patients. Of 51 consecutive patients with USC in Ashkenazi Jews studied, we identified 13 patients (25.5%) who were previously found to have breast carcinoma, 17 patients (33.3%) who had a first-degree relative with breast or ovarian carcinoma, and 8 patients (15.7%) who were found to be carriers of 1 of the 3 BRCA germline mutations. This series of USC patients, the largest consecutive series to date, suggests a higher incidence of BRCA carriers among Ashkenazi Jews as compared with the general population. This high rate of BRCA germline mutations in USC patients coupled with a high rate of personal and familial cancer histories may suggest that USC is associated with the hereditary breast-ovarian syndrome. This potential association of USC to the BRCA-associated cancer spectrum may have implications for the clinical management and intervention of unaffected BRCA1-2 germline mutation carriers. However, at the current time, there are insufficient data to provide evidence-based guidelines regarding the optimal timing or specific intervention to prevent cancers in these high-risk women.

  14. Co-existence of breast and ovarian cancers in BRCA germ-line mutation carriers

    PubMed Central

    Dilawari, A; Cangiarella, J; Smith, J; Huang, A; Downey, A; Muggia, F

    2008-01-01

    The co-existence of breast and ovarian cancers in the same individual should raise suspicion of a hereditary process. Patients with either BRCA1 or BRCA2 germ-line mutations have an average risk of 39% and 11% respectively of developing ovarian cancer by the age of 70; they have a risk of 35–85% of developing breast cancer in their lifetime. We report here unusual pathologic features in a BRCA2 germ-line mutation carrier recently diagnosed with synchronous breast and ovarian cancers, and summarize the findings in six other women who were diagnosed with ovarian cancer either simultaneously with the diagnosis of breast cancer or at varying times after the diagnosis. While in most instances this may be a coincidental occurrence in highly susceptible individuals, the patient we highlight raises the provocative hypothesis that at times breast cancer metastasizes to the ovaries of mutation carriers and stimulates the development of an ovarian cancer as well as other cancers. In addition, these ovarian cancers may have different mechanisms of metastases predisposing them to travel to unusual sites. PMID:22275985

  15. Extraordinary genome stability in the ciliate Paramecium tetraurelia

    PubMed Central

    Sung, Way; Tucker, Abraham E.; Doak, Thomas G.; Choi, Eunjin; Thomas, W. Kelley; Lynch, Michael

    2012-01-01

    Mutation plays a central role in all evolutionary processes and is also the basis of genetic disorders. Established base-substitution mutation rates in eukaryotes range between ∼5 × 10−10 and 5 × 10−8 per site per generation, but here we report a genome-wide estimate for Paramecium tetraurelia that is more than an order of magnitude lower than any previous eukaryotic estimate. Nevertheless, when the mutation rate per cell division is extrapolated to the length of the sexual cycle for this protist, the measure obtained is comparable to that for multicellular species with similar genome sizes. Because Paramecium has a transcriptionally silent germ-line nucleus, these results are consistent with the hypothesis that natural selection operates on the cumulative germ-line replication fidelity per episode of somatic gene expression, with the germ-line mutation rate per cell division evolving downward to the lower barrier imposed by random genetic drift. We observe ciliate-specific modifications of widely conserved amino acid sites in DNA polymerases as one potential explanation for unusually high levels of replication fidelity. PMID:23129619

  16. The E-cadherin gene (CDH1) variants T340A and L599V in gastric and colorectal cancer patients in Korea

    PubMed Central

    Kim, H; Wheeler, J; Kim, J; Ilyas, M; Beck, N; Kim, B; Park, K; Bodmer, W

    2000-01-01

    INTRODUCTION—Germline mutations in E-cadherin (CDH1) have been reported in families with early onset, diffuse gastric cancer. More recently, mutations in CDH1 have been described in colorectal cancer cell lines.
AIMS—We have investigated if germline mutations in CDH1 occur among different groups of Korean gastric and colorectal cancer patients, with and without a positive family history.
METHODS—We studied 131 patients and 168 normal controls (88 Korean and 80 non-Korean). Patients were divided into five groups: group I, 20 gastric cancer patients with a family history; group II, 26 colorectal cancer patients with a family history of gastric cancer (those from familial adenomatous polyposis (FAP) and hereditary non-polyposis colorectal cancer (HNPCC) kindred were excluded); group III, 16 HNPCC patients without identified germline mutations in hMLH1 and hMSH2; group IV, 35 gastric cancer patients without a family history; and group V, 34 colorectal cancer patients without a family history. Polymerase chain reaction, single strand conformational polymorphism analysis, direct sequencing, and genotyping for identified variants were performed.
RESULTS—Several germline changes in CDH1 were found. In addition to previously described polymorphisms, we found three novel changes, two of which were missense changes (T340A and L599V). T340A was present in one patient in group III and one in group V. L599V was present in one patient in group II, in two in group III, and in one in group IV. T340A was not found in normal controls while L599V was present in two of 88 Korean controls. Patients with these variants may appear to have a tendency to early onset cancer with a positive family history, although differences in frequencies did not reach statistical significance. Genotyping results suggest that these variants might have a common origin, particularly T340A.
CONCLUSION—We have described two new missense germline variants in CDH1 in various groups of Korean gastrointestinal cancer patients. Further work is required to assess if these variants increase the risk of gastrointestinal cancer.


Keywords: E-cadherin; CDH1; gastric cancer; colorectal cancer; family history; missense variant PMID:10896919

  17. Inversion of exons 1-7 of the MSH2 gene is a frequent cause of unexplained Lynch syndrome in one local population.

    PubMed

    Rhees, Jennifer; Arnold, Mildred; Boland, C Richard

    2014-06-01

    Germline mutations in DNA mismatch repair (MMR) genes, such as MSH2, cause Lynch syndrome, an autosomal dominant predisposition to colorectal as well as other cancers. Our research clinic focuses on hereditary colorectal cancer, and over the past 9 years we have identified germline mutations in DNA MMR genes in 101 patients using commercial genetic reference laboratories. We also collected samples from twelve patients with absent MSH2 protein expression and microsatellite instability in tumor tissue, with a family history suggestive of Lynch syndrome, but negative germline test results. The most likely explanation for this set of results is that the germline testing did not detect true germline mutations in these patients. Two of our patients with failed commercial testing were later found to have deletions in the 3' region of EPCAM, the gene just upstream of MSH2, but no explanation could be found for inactivation of MSH2 in the other ten patients. We used allelic dropout in long PCR to look for potential regions of rearrangement in the MSH2 gene. This method detected a potential rearrangement breakpoint in the same region of MSH2 where one breakpoint of a 10 Mb inversion was reported previously. We tested these ten patients for this inversion. Six of 10 patients had the inversion, indicating the importance of including testing for this inversion in patients suspected of having MSH2-type Lynch syndrome in our population. Additionally, this method could be further developed to look for inversions in other genes where current methods of testing fail to find a causative mutation.

  18. Peutz-Jeghers families unlinked to STK11/LKB1 gene mutations are highly predisposed to primitive biliary adenocarcinoma

    PubMed Central

    Olschwang, S.; Boisson, C.; Thomas, G.

    2001-01-01

    INTRODUCTION—Germline mutations of the STK11/LKB1 tumour suppressor gene (19p13.3) are responsible for Peutz-Jeghers syndrome (PJS), a rare genetic disorder, which is dominantly inherited. In addition to the typical hamartomatous gastrointestinal polyps and perioral pigmented lesions, PJS is also associated with the development of tumours in various sites. No specific follow up has yet been evaluated for gene carriers. Furthermore, genetic heterogeneity has been reported, which makes genetic counselling difficult.
METHODS—We report here the analysis of the STK11/LKB1 locus in a series of 34 PJS families, combining the search for mutations and rearrangements in the coding sequence, allele specific expression tests, and linkage studies.
RESULTS—Germline deleterious mutation of the STK11/LKB1 gene were identified in 70% of cases. The hypothesis of a second PJS locus was reinforced and PJS families could be divided into two groups on the basis of the presence or absence of an identified STK11/LKB1 alteration. Analysis of clinical data indicates that the cancer associated risk is markedly different in the two groups. PJS patients with no identified STK11/LKB1 mutation are at major risk for proximal biliary adenocarcinoma, an infrequent tumour in the general population.
CONCLUSION—Up to 30% of PJS patients are caused by mutation in an unidentified gene that confers high susceptibility to cancer development.


Keywords: Peutz-Jeghers disease; genetic heterogeneity; cancer predisposition; risk estimation PMID:11389158

  19. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs

    PubMed Central

    2013-01-01

    Background The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations – changes specific to a tumor and not within an individual’s germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. Results We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. Conclusion We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic. PMID:23642077

  20. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

    PubMed

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

    2013-05-04

    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

  1. New evidence for positive selection helps explain the paternal age effect observed in achondroplasia

    PubMed Central

    Shinde, Deepali N.; Elmer, Dominik P.; Calabrese, Peter; Boulanger, Jérôme; Arnheim, Norman; Tiemann-Boege, Irene

    2013-01-01

    There are certain de novo germline mutations associated with genetic disorders whose mutation rates per generation are orders of magnitude higher than the genome average. Moreover, these mutations occur exclusively in the male germ line and older men have a higher probability of having an affected child than younger ones, known as the paternal age effect (PAE). The classic example of a genetic disorder exhibiting a PAE is achondroplasia, caused predominantly by a single-nucleotide substitution (c.1138G>A) in FGFR3. To elucidate what mechanisms might be driving the high frequency of this mutation in the male germline, we examined the spatial distribution of the c.1138G>A substitution in a testis from an 80-year-old unaffected man. Using a technology based on bead-emulsion amplification, we were able to measure mutation frequencies in 192 individual pieces of the dissected testis with a false-positive rate lower than 2.7 × 10−6. We observed that most mutations are clustered in a few pieces with 95% of all mutations occurring in 27% of the total testis. Using computational simulations, we rejected the model proposing an elevated mutation rate per cell division at this nucleotide site. Instead, we determined that the observed mutation distribution fits a germline selection model, where mutant spermatogonial stem cells have a proliferative advantage over unmutated cells. Combined with data on several other PAE mutations, our results support the idea that the PAE, associated with a number of Mendelian disorders, may be explained primarily by a selective mechanism. PMID:23740942

  2. Four novel germline mutations in the MLH1 and PMS2 mismatch repair genes in patients with hereditary nonpolyposis colorectal cancer.

    PubMed

    Montazer Haghighi, Mahdi; Radpour, Ramin; Aghajani, Katayoun; Zali, Narges; Molaei, Mahsa; Zali, Mohammad Reza

    2009-08-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) is the most common cause of early onset hereditary colorectal cancer. In the majority of HNPCC families, microsatellite instability (MSI) and germline mutation in one of the DNA mismatch repair (MMR) genes are found. The entire coding sequence of MMR genes (MLH1, MLH2, MLH6, and PMS2) was analyzed using direct sequencing. Also, tumor tests were done as MSI and immunohistochemistry testing. We were able to find three novel MLH1 and one novel PMS2 germline mutations in three Iranian HNPCC patients. The first was a transversion mutation c.346A>C (T116P) and happened in the highly conserved HATPase-c region of MLH1 protein. The second was a transversion mutation c.736A>T (I246L), which caused an amino acid change of isoleucine to leucine. The third mutation (c.2145,6 delTG) was frameshift and resulted in an immature stop codon in five codons downstream. All of these three mutations were detected in the MLH1 gene. The other mutation was a transition mutation, c.676G>A (G207E), which has been found in exon six of the PMS2 gene and caused an amino acid change of glycine to glutamic acid. MSI assay revealed high instability in microsatellite for two patients and microsatellite stable for one patient. In all patients, an abnormal expression of the MMR proteins in HNPCC was related to the above novel mutations.

  3. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  4. A novel germline inactivating mutation in the CASR gene in an Italian kindred affected by familial hypocalciuric hypercalcemia.

    PubMed

    Falchetti, Alberto; Gozzini, Alessia; Terranegra, Annalisa; Soldati, Laura; Vezzoli, Giuseppe; Leoncini, Gigliola; Giusti, Francesca; Franceschelli, Francesco; Masi, Laura; Tanini, Annalisa; Cavalli, Loredana; Brandi, Maria Luisa

    2012-05-01

    Familial hypocalciuric hypercalcemia (FHH) syndrome is a rare benign condition, inherited as an autosomal dominant trait, in which inactivating mutations of the calcium-sensing receptor (CASR) gene affects the body's ability to regulate calcium homeostasis. Its outcome is featured by increased levels of serum calcium, moderate hypophosphatemia, and inadequately normal or elevated circulating parathyroid hormone levels. Affected patients are mostly asymptomatic and do not benefit from surgical resection of their mildly enlarged parathyroids. We evaluated for hypercalcemia an Italian family that was identified via a young adult male proband referred to our center for parathyroidectomy. The patients and the family members were evaluated both biochemically and genetically as suspected FHH subjects. An in vitro functional study was performed by site-directed mutagenesis, and CASR activity was monitored by measuring intracellular calcium ([Ca(2)(+)](i)). The patient had a novel germline heterozygous CASR mutation (c.361_364GATT; p.D121del/fsX122). The mutation caused a premature stop codon at codon 122, exiting a truncated protein. The biochemical phenotype of all family members carrying the heterozygous deletion was concordant with classic FHH syndrome. Our findings confirm the role of CASR gene mutational analysis to offer a valuable addition for the recognition of FHH in hypercalcemic patients not yet characterized for a positive familial history of hypercalcemia, the only condition that identifies CASR gene mutations in hypercalcemia.

  5. Subclinical hyperthyroidism due to a thyrotropin receptor (TSHR) gene mutation (S505R).

    PubMed

    Pohlenz, Joachim; Pfarr, Nicole; Krüger, Silvia; Hesse, Volker

    2006-12-01

    To identify the molecular defect by which non-autoimmune subclinical hyperthyroidism was caused in a 6-mo-old infant who presented with weight loss. Congenital non-autoimmune hyperthyroidism is caused by activating germline mutations in the thyrotropin receptor (TSHR) gene. Therefore, the TSHR gene was sequenced directly from the patient's genomic DNA. Molecular analysis revealed a heterozygous point mutation (S505R) in the TSHR gene as the underlying defect. A constitutively activating mutation in the TSHR gene has to be considered not only in patients with severe congenital non-autoimmune hyperthyroidism, but also in children with subclinical non-autoimmune hyperthyroidism.

  6. Universal screening for Lynch syndrome in endometrial cancers: frequency of germline mutations and identification of patients with Lynch-like syndrome.

    PubMed

    Dillon, Jessica L; Gonzalez, Jorge L; DeMars, Leslie; Bloch, Katarzyna J; Tafe, Laura J

    2017-12-01

    Lynch syndrome (LS) is an inherited clinical syndrome characterized by a high risk of colorectal, endometrial (lifetime risk of up to 60%), ovarian, and urinary tract cancers. The diagnosis is confirmed by identification of germline mutations in the DNA mismatch repair genes MLH1, PMS2, MSH2, MSH6, or EPCAM. In 2015, our institution implemented universal screening of endometrial cancer (EC) hysterectomy specimens by mismatch repair immunohistochemistry (IHC) with reflex MLH1 promoter hypermethylation analysis for tumors with loss of MLH1/PMS2 expression. Patients with tumors negative for MLH1 methylation and those with a loss of the heterodimer pair MSH2 and MSH6, or isolated loss of either PMS2 or MSH6 were referred to the Familial Cancer Program for genetic counseling and consideration of germline testing. Between May 2015 to Dec 2016, 233 EC patients were screened by IHC for LS with a median age of 63 years. Sixty tumors (27%) had abnormal IHC staining results. Fifty-one (22%) harbored heterodimeric loss of MLH1 and PMS2, 49 of which showed MLH1 promoter methylation (1 failure, 1 negative). One showed loss of MLH1/PMS2 and MSH6, 2 showed loss of MSH2/MSH6, and 6 had isolated loss of MSH6 only. Ten patients underwent genetic counseling, and germline testing was performed in 8; LS was confirmed in 5 patients (2.1%). In addition, 3 patients with negative germline testing and presumed Lynch-like syndrome were identified and offered additional somatic testing. Universal screening for LS in EC patients has yielded positive results for identification of patients at risk for this inherited syndrome. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Molecular genetics of syndromic and non-syndromic forms of parathyroid carcinoma.

    PubMed

    Cardoso, Luís; Stevenson, Mark; Thakker, Rajesh V

    2017-12-01

    Parathyroid carcinoma (PC) may occur as part of a complex hereditary syndrome or an isolated (i.e., non-syndromic) non-hereditary (i.e., sporadic) endocrinopathy. Studies of hereditary and syndromic forms of PC, which include the hyperparathyroidism-jaw tumor syndrome (HPT-JT), multiple endocrine neoplasia types 1 and 2 (MEN1 and MEN2), and familial isolated primary hyperparathyroidism (FIHP), have revealed some genetic mechanisms underlying PC. Thus, cell division cycle 73 (CDC73) germline mutations cause HPT-JT, and CDC73 mutations occur in 70% of sporadic PC, but in only ∼2% of parathyroid adenomas. Moreover, CDC73 germline mutations occur in 20%-40% of patients with sporadic PC and may reveal unrecognized HPT-JT. This indicates that CDC73 mutations are major driver mutations in the etiology of PCs. However, there is no genotype-phenotype correlation and some CDC73 mutations (e.g., c.679_680insAG) have been reported in patients with sporadic PC, HPT-JT, or FIHP. Other genes involved in sporadic PC include germline MEN1 and rearranged during transfection (RET) mutations and somatic alterations of the retinoblastoma 1 (RB1) and tumor protein P53 (TP53) genes, as well as epigenetic modifications including DNA methylation and histone modifications, and microRNA misregulation. This review summarizes the genetics and epigenetics of the familial syndromic and non-syndromic (sporadic) forms of PC. © 2017 The Authors. Human Mutation published by Wiley Periodicals, Inc.

  8. Pan-arthropod analysis reveals somatic piRNAs as an ancestral defence against transposable elements.

    PubMed

    Lewis, Samuel H; Quarles, Kaycee A; Yang, Yujing; Tanguy, Melanie; Frézal, Lise; Smith, Stephen A; Sharma, Prashant P; Cordaux, Richard; Gilbert, Clément; Giraud, Isabelle; Collins, David H; Zamore, Phillip D; Miska, Eric A; Sarkies, Peter; Jiggins, Francis M

    2018-01-01

    In animals, small RNA molecules termed PIWI-interacting RNAs (piRNAs) silence transposable elements (TEs), protecting the germline from genomic instability and mutation. piRNAs have been detected in the soma in a few animals, but these are believed to be specific adaptations of individual species. Here, we report that somatic piRNAs were probably present in the ancestral arthropod more than 500 million years ago. Analysis of 20 species across the arthropod phylum suggests that somatic piRNAs targeting TEs and messenger RNAs are common among arthropods. The presence of an RNA-dependent RNA polymerase in chelicerates (horseshoe crabs, spiders and scorpions) suggests that arthropods originally used a plant-like RNA interference mechanism to silence TEs. Our results call into question the view that the ancestral role of the piRNA pathway was to protect the germline and demonstrate that small RNA silencing pathways have been repurposed for both somatic and germline functions throughout arthropod evolution.

  9. Lessons learnt from implementation of a Lynch syndrome screening program for patients with gynaecological malignancy.

    PubMed

    Najdawi, Fedaa; Crook, Ashley; Maidens, Jayne; McEvoy, Christopher; Fellowes, Andrew; Pickett, Justine; Ho, Musei; Nevell, David; McIlroy, Kirsten; Sheen, Amy; Sioson, Loretta; Ahadi, Mahsa; Turchini, John; Clarkson, Adele; Hogg, Russell; Valmadre, Sue; Gard, Greg; Dooley, Susan J; Scott, Rodney J; Fox, Stephen B; Field, Michael; Gill, Anthony J

    2017-08-01

    Despite a trend towards universal testing, best practice to screen patients presenting with gynaecological malignancy for Lynch syndrome (LS) is uncertain. We report our institutional experience of a co-ordinated gynaecological LS screening program. All patients with endometrial carcinoma or carcinosarcoma, or gynaecological endometrioid or clear cell carcinomas undergo reflex four panel immunohistochemistry (IHC) for MLH1, PMS2, MSH2 and MSH6 followed by cascade somatic hypermethylation analysis of the MLH1 promoter locus for dual MLH1/PMS2 negative tumours. On the basis of these results, genetic counselling and targeted germline mutation testing is then offered to patients considered at high risk of LS. From 1 August 2013 to 31 December 2015, 124 patients were screened (mean age 64.6 years). Thirty-six (29.0%) demonstrated abnormal MMR IHC: 26 (72.2%) showed dual loss of MLH1/PMS2, five (13.9%) dual loss of MSH2/MSH6, three (8.3%) isolated loss of MSH6, and two (5.6%) isolated loss of PMS2. Twenty-five of 26 (96.1%) patients with dual MLH1/PMS2 loss demonstrated MLH1 promoter methylation. Therefore, 11 (8.9%) patients screened were classified as high risk for LS, of whom nine (81.8%) accepted germline mutation testing. Three (2.4% of total screened) were confirmed to have LS, two with germline PMS2 and one with germline MSH2 mutation. Massive parallel sequencing of tumour tissue demonstrated somatic mutations which were concordant with the IHC results in the remainder. Interestingly, the one MLH1/PMS2 IHC negative but not hypermethylated tumour harboured only somatic MLH1 mutations, indicating that universal cascade methylation testing in MLH1/PMS2 IHC negative tumours is very low yield and could be reconsidered in a resource-poor setting. In conclusion, universal screening for LS in patients presenting with gynaecological malignancy using the algorithm described above identified LS in three of 124 (2.4%) of our population. Only three of nine (33.3%) patients considered at high risk for LS by combined IHC and hypermethylation analysis were proven to have LS. Only one of the LS patients was less than 50 years of age and none of these patients would have been identified had more restrictive Amsterdam or Bethesda criteria been applied. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  10. A novel de novo germ-line V292M mutation in the extracellular region of RET in a patient with phaeochromocytoma and medullary thyroid carcinoma: functional characterization.

    PubMed

    Castellone, Maria D; Verrienti, Antonella; Magendra Rao, Deva; Sponziello, Marialuisa; Fabbro, Dora; Muthu, Magesh; Durante, Cosimo; Maranghi, Marianna; Damante, Giuseppe; Pizzolitto, Stefano; Costante, Giuseppe; Russo, Diego; Santoro, Massimo; Filetti, Sebastiano

    2010-10-01

    In multiple endocrine neoplasia (MEN), rearranged during transfection (RET), gene testing has been extensively exploited to characterize tumour aggressiveness and optimize the diagnostic and clinical management. To report the underlying genetic alterations in an unusual case of MEN type 2 (MEN-2A). Occult medullary thyroid carcinoma (MTC) was diagnosed in a 44-year-old man who had presented with unilateral phaeochromcytoma. DNA extracted from the blood and tumour tissues was analysed for mutations in RET. The transforming potential and mitogenic properties of the identified RET mutation were investigated. The patient carried a novel heterozygous germ-line RET mutation in exon 5 (Val292Met, GTG>ATG) (V292M/RET) with no evidence of additional somatic alterations. The mutation maps to the third cadherin-like domain of RET, which is usually not included in RET screening. Interestingly, MTC with concomitant phaeochromcytoma has never been associated with a RET mutation involving the extracellular cadherin-like domain. V292M/RET was absent in the only two relatives examined. In vitro assays indicate that the mutant has low-grade transforming potential. Complete characterization and classification of all novel RET mutations are essential for extending genetic analysis in clinical practice. Our findings suggest that: (i) in all MEN-2 patients negative for RET hot-spot mutations, testing should be extended to all coding regions of the gene and (ii) the newly identified V292M/RET mutation is characterized by relatively weak in vitro transforming ability. © 2010 Blackwell Publishing Ltd.

  11. [Mutation analysis for a pedigree affected with keratitis-ichthyosis-deafness syndrome].

    PubMed

    Li, Lulu; Li, Yuan; Lin, Wei; Zhao, Xiuli

    2017-10-10

    To identify mutation of GJB2 gene and provide genetic counseling for a family affected with keratitis-ichthyosis-deafness (KID) syndrome. Genomic DNA was extracted from peripheral blood samples with a standard phenol-chloroform method. PCR and Sanger sequencing were used to analyze potential mutation in the proband. Suspected mutation was verified with a PCR-high-resolution melting (PCR-HRM) method. T-clone sequencing was applied to determine the parental origin of the mutation. A heterozygous mutation, c.148G>A (p.Asp50Asn), which is located in the exon 1 of the GJB2 gene, was found in the proband. The results was confirmed by HRM analysis. Cloning sequencing suggested that the mutation was derived from the father's germline. The hot-spot mutation c.148G>A (p.Asp50Asn) in the GJB2 gene probably underlies the KID syndrome in this Chinese family. A PCR-HRM method has been established to rapidly detect common mutations associated with this disease.

  12. Caenorhabditis elegans MES-3 is a target of GLD-1 and functions epigenetically in germline development.

    PubMed Central

    Xu, L; Paulsen, J; Yoo, Y; Goodwin, E B; Strome, S

    2001-01-01

    The maternal-effect sterile (MES) proteins are maternally supplied regulators of germline development in Caenorhabditis elegans. In the hermaphrodite progeny from mes mutant mothers, the germline dies during larval development. On the basis of the similarities of MES-2 and MES-6 to known transcriptional regulators and on the basis of the effects of mes mutations on transgene expression in the germline, the MES proteins are predicted to be transcriptional repressors. One of the MES proteins, MES-3, is a novel protein with no recognizable motifs. In this article we show that MES-3 is localized in the nuclei of embryos and germ cells, consistent with its predicted role in transcriptional regulation. Its distribution in the germline and in early embryos does not depend on the wild-type functions of the other MES proteins. However, its nuclear localization in midstage embryos and its persistence in the primordial germ cells depend on wild-type MES-2 and MES-6. These results are consistent with biochemical data showing that MES-2, MES-3, and MES-6 associate in a complex in embryos. The distribution of MES-3 in the adult germline is regulated by the translational repressor GLD-1: MES-3 is absent from the region of the germline where GLD-1 is known to be present, MES-3 is overexpressed in the germline of gld-1 mutants, and GLD-1 specifically binds the mes-3 3' untranslated region (3' UTR). Analysis of temperature-shifted mes-3(bn21ts) worms and embryos indicates that MES-3 function is required in the mother's germline and during embryogenesis to ensure subsequent normal germline development. We propose that MES-3 acts epigenetically to induce a germline state that is inherited through both meiosis and mitosis and that is essential for survival of the germline. PMID:11729149

  13. Methylation Analysis of DNA Mismatch Repair Genes Using DNA Derived from the Peripheral Blood of Patients with Endometrial Cancer: Epimutation in Endometrial Carcinogenesis.

    PubMed

    Takeda, Takashi; Banno, Kouji; Yanokura, Megumi; Adachi, Masataka; Iijima, Moito; Kunitomi, Haruko; Nakamura, Kanako; Iida, Miho; Nogami, Yuya; Umene, Kiyoko; Masuda, Kenta; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke

    2016-10-14

    Germline mutation of DNA mismatch repair (MMR) genes is a cause of Lynch syndrome. Methylation of MutL homolog 1 ( MLH1 ) and MutS homolog 2 ( MSH2 ) has been detected in peripheral blood cells of patients with colorectal cancer. This methylation is referred to as epimutation. Methylation of these genes has not been studied in an unselected series of endometrial cancer cases. Therefore, we examined methylation of MLH1 , MSH2 , and MSH6 promoter regions of peripheral blood cells in 206 patients with endometrial cancer using a methylation-specific polymerase chain reaction (MSP). Germline mutation of MMR genes, microsatellite instability (MSI), and immunohistochemistry (IHC) were also analyzed in each case with epimutation. MLH1 epimutation was detected in a single patient out of a total of 206 (0.49%)-1 out of 58 (1.72%) with an onset age of less than 50 years. The patient with MLH1 epimutation showed high level MSI (MSI-H), loss of MLH1 expression and had developed endometrial cancer at 46 years old, complicated with colorectal cancer. No case had epimutation of MSH2 or MSH6 . The MLH1 epimutation detected in a patient with endometrial cancer may be a cause of endometrial carcinogenesis. This result indicates that it is important to check epimutation in patients with endometrial cancer without a germline mutation of MMR genes.

  14. Personalized genomic analyses for cancer mutation discovery and interpretation

    PubMed Central

    Jones, Siân; Anagnostou, Valsamo; Lytle, Karli; Parpart-Li, Sonya; Nesselbush, Monica; Riley, David R.; Shukla, Manish; Chesnick, Bryan; Kadan, Maura; Papp, Eniko; Galens, Kevin G.; Murphy, Derek; Zhang, Theresa; Kann, Lisa; Sausen, Mark; Angiuoli, Samuel V.; Diaz, Luis A.; Velculescu, Victor E.

    2015-01-01

    Massively parallel sequencing approaches are beginning to be used clinically to characterize individual patient tumors and to select therapies based on the identified mutations. A major question in these analyses is the extent to which these methods identify clinically actionable alterations and whether the examination of the tumor tissue alone is sufficient or whether matched normal DNA should also be analyzed to accurately identify tumor-specific (somatic) alterations. To address these issues, we comprehensively evaluated 815 tumor-normal paired samples from patients of 15 tumor types. We identified genomic alterations using next-generation sequencing of whole exomes or 111 targeted genes that were validated with sensitivities >95% and >99%, respectively, and specificities >99.99%. These analyses revealed an average of 140 and 4.3 somatic mutations per exome and targeted analysis, respectively. More than 75% of cases had somatic alterations in genes associated with known therapies or current clinical trials. Analyses of matched normal DNA identified germline alterations in cancer-predisposing genes in 3% of patients with apparently sporadic cancers. In contrast, a tumor-only sequencing approach could not definitively identify germline changes in cancer-predisposing genes and led to additional false-positive findings comprising 31% and 65% of alterations identified in targeted and exome analyses, respectively, including in potentially actionable genes. These data suggest that matched tumor-normal sequencing analyses are essential for precise identification and interpretation of somatic and germline alterations and have important implications for the diagnostic and therapeutic management of cancer patients. PMID:25877891

  15. Somatic mutations in early onset luminal breast cancer

    PubMed Central

    de Lyra, Eduardo Carneiro; Hirata Katayama, Maria Lucia; Maistro, Simone; de Vasconcellos Valle, Pedro Wilson Mompean; de Lima Pereira, Gláucia Fernanda; Rodrigues, Lívia Munhoz; de Menezes Pacheco Serio, Pedro Adolpho; de Gouvêa, Ana Carolina Ribeiro Chaves; Geyer, Felipe Correa; Basso, Ricardo Alves; Pasini, Fátima Solange; del Pilar Esteves Diz, Maria; Brentani, Maria Mitzi; Guedes Sampaio Góes, João Carlos; Chammas, Roger; Boutros, Paul C.; Koike Folgueira, Maria Aparecida Azevedo

    2018-01-01

    Breast cancer arising in very young patients may be biologically distinct; however, these tumors have been less well studied. We characterized a group of very young patients (≤ 35 years) for BRCA germline mutation and for somatic mutations in luminal (HER2 negative) breast cancer. Thirteen of 79 unselected very young patients were BRCA1/2 germline mutation carriers. Of the non-BRCA tumors, eight with luminal subtype (HER2 negative) were submitted for whole exome sequencing and integrated with 29 luminal samples from the COSMIC database or previous literature for analysis. We identified C to T single nucleotide variants (SNVs) as the most common base-change. A median of six candidate driver genes was mutated by SNVs in each sample and the most frequently mutated genes were PIK3CA, GATA3, TP53 and MAP2K4. Potential cancer drivers affected in the present non-BRCA tumors include GRHL2, PIK3AP1, CACNA1E, SEMA6D, SMURF2, RSBN1 and MTHFD2. Sixteen out of 37 luminal tumors (43%) harbored SNVs in DNA repair genes, such as ATR, BAP1, ERCC6, FANCD2, FANCL, MLH1, MUTYH, PALB2, POLD1, POLE, RAD9A, RAD51 and TP53, and 54% presented pathogenic mutations (frameshift or nonsense) in at least one gene involved in gene transcription. The differential biology of luminal early-age onset breast cancer needs a deeper genomic investigation. PMID:29854292

  16. Heterozygous Germline Mutations in the CBL Tumor-Suppressor Gene Cause a Noonan Syndrome-like Phenotype

    PubMed Central

    Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

    2010-01-01

    RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386

  17. The contribution of CHEK2 to the TP53-negative Li-Fraumeni phenotype.

    PubMed

    Ruijs, Marielle W G; Broeks, Annegien; Menko, Fred H; Ausems, Margreet G E M; Wagner, Anja; Oldenburg, Rogier; Meijers-Heijboer, Hanne; van't Veer, Laura J; Verhoef, Senno

    2009-02-17

    CHEK2 has previously been excluded as a major cause of Li-Fraumeni syndrome (LFS). One particular CHEK2 germline mutation, c.1100delC, has been shown to be associated with elevated breast cancer risk. The prevalence of CHEK2*1100delC differs between populations and has been found to be relatively high in the Netherlands. The question remains nevertheless whether CHEK2 germline mutations contribute to the Li-Fraumeni phenotype. We have screened 65 Dutch TP53-negative LFS/LFL candidate patients for CHEK2 germline mutations to determine their contribution to the LFS/LFL phenotype. We identified six index patients with a CHEK2 sequence variant, four with the c.1100delC variant and two sequence variants of unknown significance, p.Phe328Ser and c.1096-?_1629+?del. Our data show that CHEK2 is not a major LFS susceptibility gene in the Dutch population. However, CHEK2 might be a factor contributing to individual tumour development in TP53-negative cancer-prone families.

  18. [Induced germ line genomic instability at mini- and micro-satellites in animals].

    PubMed

    Bezlepkin, V G; Gaziev, A I

    2001-01-01

    The recent data on the phenomenon of the induced germline genomic instability at mini- and microsatellites in animals were considered. Natural hypervariability of the minisatellites and microsatellites and their abundance in eukaryotic genome provide it's utility as the useful genetic markers for evaluation of the germline mutation frequency induced by treatment with different type of genotoxic factors at the low doses. High sensitivity of assays and possibility for direct determinations of the mutations, without the necessity to use extrapolation, are ensured. Some discussion is presented on the role of non-targeted mechanisms for the radiation-prone DNA lesions in the induction of germline genomic instability and also on the involving in this process the recombination events upon meiosis or during the early development stages of embryos. It is proposed that quantitative determination of germline genomic instability rate may be used as an acceptable variant for the genetic risk assessment and as indicator of increased probability for cancer and other pathologies at the offspring born to irradiated parents.

  19. Genetic Testing in Pancreatic Ductal Adenocarcinoma: Implications for Prevention and Treatment.

    PubMed

    Peters, Mary Linton B; Tseng, Jennifer F; Miksad, Rebecca A

    2016-07-01

    This article reviews the progress to date and future directions for investigation of germline and somatic genetic testing to inform pancreatic adenocarcinoma (PDAC) treatment, screening, and prevention strategies. We searched PubMed to identify recent articles regarding genetic testing in pancreatic cancer, including both germline and somatic testing, and recent genome-wide association studies. References were specifically hand searched as relevant. Guidelines for testing and screening high-risk individuals were included. We searched clinicaltrials.gov to review the current landscape of active clinical trials. Approximately 10% of PDACs are associated with an identified germline mutation. Although germline mutations may inform treatment options and identify high-risk individuals for screening in other cancers, the data on PDAC are only now emerging. For example, poly adenosine diphosphate ribose polymerase (PARP) inhibitors are under investigation for BRCA-associated PDAC. Somatic mutations have also been identified in PDAC. However, current data are limited regarding treatment for potential PDAC somatic driver mutations. Although erlotinib is used in PDAC, its use is not targeted based on a tumor marker. Many tyrosine kinase inhibitors targeted toward potential driver mutations and critical pathways are in development, including BRAF/MEK, ALK, and CDK4/6. A consensus on screening strategies for individuals at high risk for PDAC is still evolving because of the relatively low prevalence of the disease, the relative invasiveness of endoscopic procedures often used as part of screening, and the lack of a clear survival benefit. Pancreatic cancer has been slower to move toward genomic testing, partially because of a lower prevalence of mutations and partially because of a limited effect of results on treatment choices outside a clinical trial. This is an area of active investigation, and we anticipate that there will be both preventive and therapeutic implications of driver mutations in the coming decade. Copyright © 2016 Elsevier HS Journals, Inc. All rights reserved.

  20. Radiation-induced transgenerational instability.

    PubMed

    Dubrova, Yuri E

    2003-10-13

    To date, the analysis of mutation induction has provided an irrefutable evidence for an elevated germline mutation rate in the parents directly exposed to ionizing radiation and a number of chemical mutagens. However, the results of numerous publications suggest that radiation may also have an indirect effect on genome stability, which is transmitted through the germ line of irradiated parents to their offspring. This review describes the phenomenon of transgenerational instability and focuses on the data showing increased cancer incidence and elevated mutation rates in the germ line and somatic tissues of the offspring of irradiated parents. The possible mechanisms of transgenerational instability are also discussed.

  1. Validation of predictive models for germline mutations in DNA mismatch repair genes in colorectal cancer.

    PubMed

    Monzon, Jose G; Cremin, Carol; Armstrong, Linlea; Nuk, Jennifer; Young, Sean; Horsman, Doug E; Garbutt, Kristy; Bajdik, Chris D; Gill, Sharlene

    2010-02-15

    Lynch syndrome is defined by the presence of germline mutations in mismatch repair (MMR) genes. Several models have been recently devised that predict mutation carrier status (Myriad Genetics, Wijnen, Barnetson, PREMM and MMRpro models). Families at moderate-high risk for harboring a Lynch-associated mutation, referred to the BC Cancer Agency (BCCA) Hereditary Cancer Program (HCP), underwent mutation analysis, immunohistochemistry and/or microsatellite testing. Seventy-two tested cases were included. Twenty-five patients were mutation positive (34.7%) and 47 were mutation negative (65.3%). Nineteen of 43 patients who were both microsatellite stable and normal on immunohistochemistry for MLH1 and MSH2 were also genotyped for mutations in these genes; all 19 were negative for MMR gene mutations. Model-derived probabilities of harboring a MMR gene mutation in the proband were calculated and compared to observed results. The area under the ROC curves were 0.75 (95%CI; 0.63-0.87), 0.86 (0.7-0.96), 0.89 (0.82-0.97), 0.89 (0.81-0.98) and 0.93 (0.86-0.99) for the Myriad, Barnetson, Wijnen, MMRpro and PREMM models, respectively. The Amsterdam II criteria had a sensitivity and specificity of 0.76 and 0.74, respectively, in this cohort. The PREMM model demonstrated the best performance for predicting carrier status based on the positive likelihood ratios at the >10%, >20% and >30% probability thresholds. In this referred cohort, the PREMM model had the most favorable concordance index and predictive performance for carrier status based on the positive LR. These prediction models (PREMM, MMRPro and Wijnen) may soon replace the Amsterdam II and revised Bethesda criteria as a prescreening tool for Lynch mutations.

  2. A Wide Range of 3243A>G/tRNALeu(UUR) (MELAS) Mutation Loads May Segregate in Offspring through the Female Germline Bottleneck

    PubMed Central

    Pallotti, Francesco; Binelli, Giorgio; Fabbri, Raffaella; Valentino, Maria L.; Vicenti, Rossella; Macciocca, Maria; Cevoli, Sabina; Baruzzi, Agostino; DiMauro, Salvatore; Carelli, Valerio

    2014-01-01

    Segregation of mutant mtDNA in human tissues and through the germline is debated, with no consensus about the nature and size of the bottleneck hypothesized to explain rapid generational shifts in mutant loads. We investigated two maternal lineages with an apparently different inheritance pattern of the same pathogenic mtDNA 3243A>G/tRNALeu(UUR) (MELAS) mutation. We collected blood cells, muscle biopsies, urinary epithelium and hair follicles from 20 individuals, as well as oocytes and an ovarian biopsy from one female mutation carrier, all belonging to the two maternal lineages to assess mutant mtDNA load, and calculated the theoretical germline bottleneck size (number of segregating units). We also evaluated “mother-to-offspring” segregations from the literature, for which heteroplasmy assessment was available in at least three siblings besides the proband. Our results showed that mutation load was prevalent in skeletal muscle and urinary epithelium, whereas in blood cells there was an inverse correlation with age, as previously reported. The histoenzymatic staining of the ovarian biopsy failed to show any cytochrome-c-oxidase defective oocyte. Analysis of four oocytes and one offspring from the same unaffected mother of the first family showed intermediate heteroplasmic mutant loads (10% to 75%), whereas very skewed loads of mutant mtDNA (0% or 81%) were detected in five offspring of another unaffected mother from the second family. Bottleneck size was 89 segregating units for the first mother and 84 for the second. This was remarkably close to 88, the number of “segregating units” in the “mother-to-offspring” segregations retrieved from literature. In conclusion, a wide range of mutant loads may be found in offspring tissues and oocytes, resulting from a similar theoretical bottleneck size. PMID:24805791

  3. Lung Cancer: One Disease or Many.

    PubMed

    O'Brien, Timothy D; Jia, Peilin; Aldrich, Melinda C; Zhao, Zhongming

    2018-06-05

    Lung cancer is classified as a single entity comprised of multiple histological subtypes. But how similar are these subtypes on a genetic level? This paper aims to address this question through a concise overview of germline and somatic differences between small cell lung cancer, lung adenocarcinoma, and lung squamous cell carcinoma. We reveal the weak overlap found between these 3 lung cancer subtypes using published data from one of the largest germline genetic studies on lung cancer to date and somatic mutation data from Catalogue of Somatic Mutations in Cancer (COSMIC). These data indicate that these 3 subtypes share very little with each other at the genetic level. At the germline SNP level, only 24 independent SNPs from 2 chromosomes were shared across all 3 subtypes. We also demonstrate that only 30 unique cancer-specific mutations overlap the 3 subtypes from COSMIC, and that this is fewer than overlapping mutations chosen at random. Finally, we show that only 3 somatic mutational signatures are shared between these 3 subtypes. This paper highlights that these 3 lung cancer subtypes may be distinct diseases at the genetic level. In the era of precision medicine, we feel that these genomic differences will be of utmost importance in the choice of lung cancer therapy in the future. © 2018 S. Karger AG, Basel.

  4. Simple detection of germline microsatellite instability for diagnosis of constitutional mismatch repair cancer syndrome.

    PubMed

    Ingham, Danielle; Diggle, Christine P; Berry, Ian; Bristow, Claire A; Hayward, Bruce E; Rahman, Nazneen; Markham, Alexander F; Sheridan, Eamonn G; Bonthron, David T; Carr, Ian M

    2013-06-01

    Heterozygous mutations in DNA mismatch repair (MMR) genes result in predisposition to colorectal cancer (hereditary nonpolyposis colorectal cancer or Lynch syndrome). Patients with biallelic mutations in these genes, however, present earlier, with constitutional mismatch repair deficiency cancer syndrome (CMMRD), which is characterized by a spectrum of rare childhood malignancies and café-au-lait skin patches. The hallmark of MMR deficiency, microsatellite instability (MSI), is readily detectable in tumor DNA in Lynch syndrome, but is also present in constitutional DNA of CMMRD patients. However, detection of constitutional or germline MSI (gMSI) has hitherto relied on technically difficult assays that are not routinely applicable for clinical diagnosis. Consequently, we have developed a simple high-throughput screening methodology to detect gMSI in CMMRD patients based on the presence of stutter peaks flanking a dinucleotide repeat allele when amplified from patient blood DNA samples. Using the three different microsatellite markers, the gMSI ratio was determined in a cohort of normal individuals and 10 CMMRD patients, with biallelic germline mutations in PMS2 (seven patients), MSH2 (one patient), or MSH6 (two patients). Subjects with either PMS2 or MSH2 mutations were easily identified; however, this measure was not altered in patients with CMMRD due to MSH6 mutation. © 2013 Wiley Periodicals, Inc.

  5. MEN4 and CDKN1B mutations: the latest of the MEN syndromes.

    PubMed

    Alrezk, Rami; Hannah-Shmouni, Fady; Stratakis, Constantine A

    2017-10-01

    Multiple endocrine neoplasia (MEN) refers to a group of autosomal dominant disorders with generally high penetrance that lead to the development of a wide spectrum of endocrine and non-endocrine manifestations. The most frequent among these conditions is MEN type 1 (MEN1), which is caused by germline heterozygous loss-of-function mutations in the tumor suppressor gene MEN1 MEN1 is characterized by primary hyperparathyroidism (PHPT) and functional or nonfunctional pancreatic neuroendocrine tumors and pituitary adenomas. Approximately 10% of patients with familial or sporadic MEN1-like phenotype do not have MEN1 mutations or deletions. A novel MEN syndrome was discovered, initially in rats (MENX), and later in humans (MEN4), which is caused by germline mutations in the putative tumor suppressor CDKN1B The most common phenotype of the 19 established cases of MEN4 that have been described to date is PHPT followed by pituitary adenomas. Recently, somatic or germline mutations in CDKN1B were also identified in patients with sporadic PHPT, small intestinal neuroendocrine tumors, lymphoma and breast cancer, demonstrating a novel role for CDKN1B as a tumor susceptibility gene for other neoplasms. In this review, we report on the genetic characterization and clinical features of MEN4. © 2017 Society for Endocrinology.

  6. Risk assessment of maternally inherited SDHD paraganglioma and phaeochromocytoma.

    PubMed

    Burnichon, Nelly; Mazzella, Jean-Michaël; Drui, Delphine; Amar, Laurence; Bertherat, Jérôme; Coupier, Isabelle; Delemer, Brigitte; Guilhem, Isabelle; Herman, Philippe; Kerlan, Véronique; Tabarin, Antoine; Wion, Nelly; Lahlou-Laforet, Khadija; Favier, Judith; Gimenez-Roqueplo, Anne-Paule

    2017-02-01

    Germline mutations in the SDHD tumour suppressor gene (11q23.1) predispose to phaeochromocytomas and paragangliomas (PPGL) mainly on a paternal transmission. However, PPGL have been recently reported in three carriers of a maternally inherited SDHD mutation. To assess the risk of PPGL occurrence on maternal transmission of SDHD mutation. Pedigrees of 80 SDHD-related families have been reviewed. 35 asymptomatic subjects carrying a maternally transmitted SDHD mutation were identified. 20 of them accepted to benefit from a PPGL imaging screening. A unique histologically proven biochemically negative phaeochromocytoma has been diagnosed in a 35-year-old woman. Molecular investigations carried out on tumour tissue revealed that the loss of heterozygosity encompassed the paternally derived q arm and the maternally derived p arm of chromosome 11. This study demonstrates that the risk of developing PPGL for a subject carrying a germline SDHD mutation on the maternal allele remains a rare scenario but does exist. Our data suggest an adjustment of current genetic counselling and clinical care recommendations for at-risk subjects. A targeted familial genetic test should be proposed from the age of 18 years to every subject having a mother carrying a germline SDHD mutation and a first medical workup, including imaging, should be recommended to SDHD-positive mutation carriers. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  7. Aggressive pituitary adenomas occurring in young patients in a large Polynesian kindred with a germline R271W mutation in the AIP gene.

    PubMed

    Jennings, Juliet E; Georgitsi, Marianthi; Holdaway, Ian; Daly, Adrian F; Tichomirowa, Maria; Beckers, Albert; Aaltonen, Lauri A; Karhu, Auli; Cameron, Fergus J

    2009-11-01

    Mutations in the aryl hydrocarbon receptor-interacting protein (AIP) were recently shown to confer a pituitary adenoma predisposition in patients with familial isolated pituitary adenomas (FIPA). We report a large Samoan FIPA kindred from Australia/New Zealand with an R271W mutation that was associated with aggressive pituitary tumors. Case series with germline screening of AIP and haplotype analyses among R271W families. This previously unreported kindred consisted of three affected individuals that either presented with or had first symptoms of a pituitary macroadenoma in late childhood or adolescence. The index case, a 15-year-old male with incipient gigantism and his maternal aunt, had somatotropinomas, and the maternal uncle of the index case had a prolactinoma. All tumors were large (15, 40, and 60 mm maximum diameter) and two required transcranial surgery and radiotherapy. All three affected subjects and ten other unaffected relatives were found to be positive for a germline R271W AIP mutation. Comparison of the single nucleotide polymorphism patterns among this family and two previously reported European FIPA families with the same R271W mutation demonstrated no common ancestry. This kindred exemplifies the aggressive features of pituitary adenomas associated with AIP mutations, while genetic analyses among three R271W FIPA families indicate that R271W represents a mutational hotspot that should be studied further in functional studies.

  8. A case study of an integrative genomic and experimental therapeutic approach for rare tumors: identification of vulnerabilities in a pediatric poorly differentiated carcinoma.

    PubMed

    Dela Cruz, Filemon S; Diolaiti, Daniel; Turk, Andrew T; Rainey, Allison R; Ambesi-Impiombato, Alberto; Andrews, Stuart J; Mansukhani, Mahesh M; Nagy, Peter L; Alvarez, Mariano J; Califano, Andrea; Forouhar, Farhad; Modzelewski, Beata; Mitchell, Chelsey M; Yamashiro, Darrell J; Marks, Lianna J; Glade Bender, Julia L; Kung, Andrew L

    2016-10-31

    Precision medicine approaches are ideally suited for rare tumors where comprehensive characterization may have diagnostic, prognostic, and therapeutic value. We describe the clinical case and molecular characterization of an adolescent with metastatic poorly differentiated carcinoma (PDC). Given the rarity and poor prognosis associated with PDC in children, we utilized genomic analysis and preclinical models to validate oncogenic drivers and identify molecular vulnerabilities. We utilized whole exome sequencing (WES) and transcriptome analysis to identify germline and somatic alterations in the patient's tumor. In silico and in vitro studies were used to determine the functional consequences of genomic alterations. Primary tumor was used to generate a patient-derived xenograft (PDX) model, which was used for in vivo assessment of predicted therapeutic options. WES revealed a novel germline frameshift variant (p.E1554fs) in APC, establishing a diagnosis of Gardner syndrome, along with a somatic nonsense (p.R790*) APC mutation in the tumor. Somatic mutations in TP53, MAX, BRAF, ROS1, and RPTOR were also identified and transcriptome and immunohistochemical analyses suggested hyperactivation of the Wnt/ß-catenin and AKT/mTOR pathways. In silico and biochemical assays demonstrated that the MAX p.R60Q and BRAF p.K483E mutations were activating mutations, whereas the ROS1 and RPTOR mutations were of lower utility for therapeutic targeting. Utilizing a patient-specific PDX model, we demonstrated in vivo activity of mTOR inhibition with temsirolimus and partial response to inhibition of MEK. This clinical case illustrates the depth of investigation necessary to fully characterize the functional significance of the breadth of alterations identified through genomic analysis.

  9. Germline Chd8 haploinsufficiency alters brain development in mouse

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gompers, Andrea L.; Su-Feher, Linda; Ellegood, Jacob

    The chromatin remodeling gene CHD8 represents a central node in neurodevelopmental gene networks implicated in autism. In this paper, we examined the impact of germline heterozygous frameshift Chd8 mutation on neurodevelopment in mice. Chd8 +/ del5 mice displayed normal social interactions with no repetitive behaviors but exhibited cognitive impairment correlated with increased regional brain volume, validating that phenotypes of Chd8 +/ del5 mice overlap pathology reported in humans with CHD8 mutations. We applied network analysis to characterize neurodevelopmental gene expression, revealing widespread transcriptional changes in Chd8 +/ del5 mice across pathways disrupted in neurodevelopmental disorders, including neurogenesis, synaptic processes andmore » neuroimmune signaling. We identified a co-expression module with peak expression in early brain development featuring dysregulation of RNA processing, chromatin remodeling and cell-cycle genes enriched for promoter binding by Chd8, and we validated increased neuronal proliferation and developmental splicing perturbation in Chd8 +/ del5 mice. Finally, this integrative analysis offers an initial picture of the consequences of Chd8 haploinsufficiency for brain development.« less

  10. Germline Chd8 haploinsufficiency alters brain development in mouse

    DOE PAGES

    Gompers, Andrea L.; Su-Feher, Linda; Ellegood, Jacob; ...

    2017-06-26

    The chromatin remodeling gene CHD8 represents a central node in neurodevelopmental gene networks implicated in autism. In this paper, we examined the impact of germline heterozygous frameshift Chd8 mutation on neurodevelopment in mice. Chd8 +/ del5 mice displayed normal social interactions with no repetitive behaviors but exhibited cognitive impairment correlated with increased regional brain volume, validating that phenotypes of Chd8 +/ del5 mice overlap pathology reported in humans with CHD8 mutations. We applied network analysis to characterize neurodevelopmental gene expression, revealing widespread transcriptional changes in Chd8 +/ del5 mice across pathways disrupted in neurodevelopmental disorders, including neurogenesis, synaptic processes andmore » neuroimmune signaling. We identified a co-expression module with peak expression in early brain development featuring dysregulation of RNA processing, chromatin remodeling and cell-cycle genes enriched for promoter binding by Chd8, and we validated increased neuronal proliferation and developmental splicing perturbation in Chd8 +/ del5 mice. Finally, this integrative analysis offers an initial picture of the consequences of Chd8 haploinsufficiency for brain development.« less

  11. The effect of a germline mutation in the APC gene on β-catenin in human embryonic stem cells.

    PubMed

    Yedid, Nofar; Kalma, Yael; Malcov, Mira; Amit, Ami; Kariv, Revital; Caspi, Michal; Rosin-Arbesfeld, Rina; Ben-Yosef, Dalit

    2016-12-23

    Most cases of colorectal cancer (CRC) are initiated by inactivation mutations in the APC gene, which is a negative regulator of the Wnt-β-catenin pathway. Patients with familial adenomatous polyposis (FAP) inherit a germline mutation in one APC allele, and loss of the second allele leads to the development of polyps that will turn malignant if not removed. It is not fully understood which molecular mechanisms are activated by APC loss and when the loss of the second APC allele occurs. Two FAP human embryonic stem cell (hESCs) lines were derived from APC mutated embryos following pre-implantation genetic diagnosis (PGD) for FAP. These FAP-hESCs were cultured in vitro and following extended culture: 1) β-catenin expression was analyzed by Western blot analysis; 2) Wnt-β-catenin/TCF-mediated transcription luciferase assay was performed; 3) cellular localization of β-catenin was evaluated by immunoflorecence confocal microscopy; and 4) DNA sequencing of the APC gene was performed. We have established a novel human in-vitro model for studying malignant transformation, using hESCs that carry a germline mutation in the APC gene following PGD for FAP. Extended culturing of FAP1 hESCs led to activation of the Wnt signaling pathway, as demonstrated by enhanced β-catenin/TCF-mediated activity. Additionally, β-catenin showed a distinct perinuclear distribution in most (91 %) of the FAP1 hESCs high passage colonies. DNA sequencing of the whole gene detected several polymorphisms in FAP1 hESCs, however, no somatic mutations were discovered in the APC gene. On the other hand, no changes in β-catenin were detected in the FAP2 hESCs, demonstrating the natural diversity of the human FAP population. Our results describe the establishment of novel hESC lines from FAP patients with a predisposition for cancer mutation. These cells can be maintained in culture for long periods of time and may serve as a platform for studying the initial molecular and cellular changes that occur during early stages of malignant transformation.

  12. Germline and somatic polymerase ε and δ mutations define a new class of hypermutated colorectal and endometrial cancers

    PubMed Central

    Briggs, Sarah; Tomlinson, Ian

    2013-01-01

    Polymerases ϵ and δ are the main enzymes that replicate eukaryotic DNA. Accurate replication occurs through Watson–Crick base pairing and also through the action of the polymerases' exonuclease (proofreading) domains. We have recently shown that germline exonuclease domain mutations (EDMs) of POLE and POLD1 confer a high risk of multiple colorectal adenomas and carcinoma (CRC). POLD1 mutations also predispose to endometrial cancer (EC). These mutations are associated with high penetrance and dominant inheritance, although the phenotype can be variable. We have named the condition polymerase proofreading-associated polyposis (PPAP). Somatic POLE EDMs have also been found in sporadic CRCs and ECs, although very few somatic POLD1 EDMs have been detected. Both the germline and the somatic DNA polymerase EDMs cause an ‘ultramutated’, apparently microsatellite-stable, type of cancer, sometimes leading to over a million base substitutions per tumour. Here, we present the evidence for POLE and POLD1 as important contributors to the pathogenesis of CRC and EC, and highlight some of the key questions in this emerging field. Copyright © 2013 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd PMID:23447401

  13. Germline APC mutations in hepatoblastoma.

    PubMed

    Yang, Adeline; Sisson, Rebecca; Gupta, Anita; Tiao, Greg; Geller, James I

    2018-04-01

    Conflicting reports on the frequency of germline adenomatous polyposis coli (APC) gene mutations in patients with hepatoblastoma (HB) have called into question the clinical value of APC mutation testing on apparently sporadic HB. An Institutional Review Board approved retrospective review of clinical data collected from patients with HB who received APC testing at our institution was conducted. All HB patients seen at Cincinnati Children's Hospital Medical Center were eligible for testing. Potential genotype/phenotype correlations were assessed. As of July 2015, 29 patients with HB had received constitutional APC testing. Four (14%) were found to have APC pathogenic truncations of the APC protein and in addition two (7%) had APC missense variants of unknown clinical significance. Two patients (7%) had family histories indicative of familial adenomatous polyposis (FAP). Response to chemotherapy tracked differently in APC pathogenic cases, with a slower imaging response despite an equivalent or slightly faster α-fetoprotein (AFP) response. The prevalence of pathogenic APC variants in apparently sporadic HB may be higher than previously detected. Differences in time to imaging response, despite similar AFP response, may impact surgical planning. All patients with HB warrant germline APC mutation testing for underlying FAP. © 2017 Wiley Periodicals, Inc.

  14. Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis

    PubMed Central

    Hulsebos, Theo J. M.; Plomp, Astrid S.; Wolterman, Ruud A.; Robanus-Maandag, Els C.; Baas, Frank; Wesseling, Pieter

    2007-01-01

    Patients with schwannomatosis develop multiple schwannomas but no vestibular schwannomas diagnostic of neurofibromatosis type 2. We report an inactivating germline mutation in exon 1 of the tumor-suppressor gene INI1 in a father and daughter who both had schwannomatosis. Inactivation of the wild-type INI1 allele, by a second mutation in exon 5 or by clear loss, was found in two of four investigated schwannomas from these patients. All four schwannomas displayed complete loss of nuclear INI1 protein expression in part of the cells. Although the exact oncogenetic mechanism in these schwannomas remains to be elucidated, our findings suggest that INI1 is the predisposing gene in familial schwannomatosis. PMID:17357086

  15. Cell Lineage Analysis of the Mammalian Female Germline

    PubMed Central

    Elbaz, Judith; Jinich, Adrian; Chapal-Ilani, Noa; Maruvka, Yosef E.; Nevo, Nava; Marx, Zipora; Horovitz, Inna; Wasserstrom, Adam; Mayo, Avi; Shur, Irena; Benayahu, Dafna; Skorecki, Karl; Segal, Eran; Dekel, Nava; Shapiro, Ehud

    2012-01-01

    Fundamental aspects of embryonic and post-natal development, including maintenance of the mammalian female germline, are largely unknown. Here we employ a retrospective, phylogenetic-based method for reconstructing cell lineage trees utilizing somatic mutations accumulated in microsatellites, to study female germline dynamics in mice. Reconstructed cell lineage trees can be used to estimate lineage relationships between different cell types, as well as cell depth (number of cell divisions since the zygote). We show that, in the reconstructed mouse cell lineage trees, oocytes form clusters that are separate from hematopoietic and mesenchymal stem cells, both in young and old mice, indicating that these populations belong to distinct lineages. Furthermore, while cumulus cells sampled from different ovarian follicles are distinctly clustered on the reconstructed trees, oocytes from the left and right ovaries are not, suggesting a mixing of their progenitor pools. We also observed an increase in oocyte depth with mouse age, which can be explained either by depth-guided selection of oocytes for ovulation or by post-natal renewal. Overall, our study sheds light on substantial novel aspects of female germline preservation and development. PMID:22383887

  16. Prevalence of Lynch syndrome in a Middle Eastern population with colorectal cancer.

    PubMed

    Siraj, Abdul K; Prabhakaran, Sarita; Bavi, Prashant; Bu, Rong; Beg, Shaham; Hazmi, Mohsen Al; Al-Rasheed, Maha; Al-Assiri, Mohammed; Sairafi, Rami; Al-Dayel, Fouad; Al-Sanea, Nasser; Uddin, Shahab; Al-Kuraya, Khawla S

    2015-06-01

    Lynch syndrome (LS; hereditary nonpolyposis colorectal cancer) is a common cause of hereditary colorectal cancer (CRC). CRC is the most common cancer diagnosed among males in Saudi Arabia but to the authors' knowledge there is a lack of data regarding the prevalence of LS in patients with CRC. There currently are no clear guidelines for the selection criteria for these patients to screen for LS. A comprehensive molecular characterization was performed in a cohort of 807 CRC cases by immunohistochemical and microsatellite analysis using polymerase chain reaction. BRAF mutation screening, high CpG island methylator phenotype, and analysis for germline mutations were performed in 425 CRC samples. These were all high microsatellite instability (MSI-H) samples (91 cases), all low MSI samples (143 cases), and selected cases from the microsatellite stable group (191 cases) that met revised Bethesda guidelines. Polymerase chain reaction identified 91 MSI-H cases (11.3%) and sequencing revealed mismatch repair germline mutations in 8 CRC cases only. Of the total of 807 CRC cases, these 8 cases (0.99%) were MSI-H, met the revised Bethesda guidelines, and did not harbor BRAF mutations. The results of the current study confirmed cases of LS in approximately 1.0% of CRC samples and reflects the efficacy of screening among MSI-H cases that lack BRAF mutations. This comprehensive study from Saudi Arabia will help in implementing a universal screening/reflex testing strategy in a clinical setting in Saudi Arabia and in conducting a national screening program that benefits both patients and their relatives. © 2015 American Cancer Society.

  17. Risk of colorectal cancer for carriers of a germline mutation in POLE or POLD1

    PubMed Central

    Buchanan, Daniel D.; Stewart, Jenna R.; Clendenning, Mark; Rosty, Christophe; Mahmood, Khalid; Pope, Bernard J.; Jenkins, Mark A.; Hopper, John L.; Southey, Melissa C.; Macrae, Finlay A.; Winship, Ingrid M.; Win, Aung Ko

    2017-01-01

    Background Germline mutations in the exonuclease domains of the POLE and POLD1 genes are associated with an as yet unquantified increased risk of colorectal cancer (CRC). Methods We identified families with POLE or POLD1 variants by searching PubMed for relevant studies prior to October 2016 and by genotyping 669 population-based CRC cases diagnosed <60 years of age from the Australasian Colorectal Cancer Family Registry. We estimated the age-specific cumulative risks (penetrance) using a modified segregation analysis. Results We observed 67 CRCs (mean age at diagnosis=50.2 (standard deviation [SD]=13.8) years) among 364 first- and second- degree relatives from 41 POLE families and 6 CRCs (mean age at diagnosis=39.7 (SD=6.83) years) among 69 relatives from 9 POLD1 families. We estimated risks of CRC to age 70 years (95% confidence interval [CI]) for males and females, respectively, to be: 40%(26%–57%) and 32%(20%–47%) for POLE mutation carriers; and 63%(15%–99%) and 52%(11%–99%) for POLD1 mutation carriers. Conclusion CRC risks for POLE mutation carriers are sufficiently high warranting consideration of annual colonoscopy screening and management guidelines comparable to Lynch syndrome. Refinement of estimates of CRC risk for POLD1 carriers is needed, however, clinical management recommendations could follow those suggested for POLE carriers. PMID:29120461

  18. Incidental germline variants in 1000 advanced cancers on a prospective somatic genomic profiling protocol.

    PubMed

    Meric-Bernstam, F; Brusco, L; Daniels, M; Wathoo, C; Bailey, A M; Strong, L; Shaw, K; Lu, K; Qi, Y; Zhao, H; Lara-Guerra, H; Litton, J; Arun, B; Eterovic, A K; Aytac, U; Routbort, M; Subbiah, V; Janku, F; Davies, M A; Kopetz, S; Mendelsohn, J; Mills, G B; Chen, K

    2016-05-01

    Next-generation sequencing in cancer research may reveal germline variants of clinical significance. We report patient preferences for return of results and the prevalence of incidental pathogenic germline variants (PGVs). Targeted exome sequencing of 202 genes was carried out in 1000 advanced cancers using tumor and normal DNA in a research laboratory. Pathogenic variants in 18 genes, recommended for return by The American College of Medical Genetics and Genomics, as well as PALB2, were considered actionable. Patient preferences of return of incidental germline results were collected. Return of results was initiated with genetic counseling and repeat CLIA testing. Of the 1000 patients who underwent sequencing, 43 had likely PGVs: APC (1), BRCA1 (11), BRCA2 (10), TP53 (10), MSH2 (1), MSH6 (4), PALB2 (2), PTEN (2), TSC2 (1), and RB1 (1). Twenty (47%) of 43 variants were previously known based on clinical genetic testing. Of the 1167 patients who consented for a germline testing protocol, 1157 (99%) desired to be informed of incidental results. Twenty-three previously unrecognized mutations identified in the research environment were confirmed with an orthogonal CLIA platform. All patients approached decided to proceed with formal genetic counseling; in all cases where formal genetic testing was carried out, the germline variant of concern validated with clinical genetic testing. In this series, 2.3% patients had previously unrecognized pathogenic germline mutations in 19 cancer-related genes. Thus, genomic sequencing must be accompanied by a plan for return of germline results, in partnership with genetic counseling. © The Author 2016. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. Probability of Positive Genetic Testing Results in Patients with Family History of Primary Hyperparathyroidism.

    PubMed

    El Lakis, Mustapha; Nockel, Pavel; Gaitanidis, Apostolos; Guan, Bin; Agarwal, Sunita; Welch, James; Simonds, William F; Weinstein, Lee; Marx, Stephen; Nilubol, Naris; Patel, Dhaval; Merkel, Roxanne; Tirosh, Amit; Kebebew, Electron

    2018-05-01

    Approximately 10% of patients with primary hyperparathyroidism (PHPT) have hereditary disease. Hereditary PHPT may be syndromic (MEN1, 2, and 4 and hyperparathyroidism-jaw tumor syndrome) or non-syndromic (familial isolated PHPT). There are limited data on the probability of testing positive for genetic mutation based on clinical presentation. The aim of this study was to determine potential associations between clinical and biochemical features and mutation in susceptibility genes for PHPT in patients with a family history of PHPT. A retrospective analysis of 657 patients who had an initial parathyroidectomy for PHPT at a tertiary referral center. Logistic regression analyses were performed in 205 patients with a family history of PHPT to identify factors associated with a positive genetic test. Of 657 patients, 205 (31.2%) had a family history of PHPT. Of those 205 patients, 123 (60%) had a germline mutation detected (91 MEN1, 14 CDC73, and 18 GCM2). In univariate analysis, younger age (45 years and younger), male sex, multigland disease, and parathyroid carcinoma were associated with positive germline mutation; biochemical cure after an initial parathyroidectomy was less frequent in patients with familial PHPT (96.2% vs 89.2%; p = 0.005). In multivariable analysis, age 45 years and younger, male sex, and multigland disease were independent factors associated with positive genetic testing. In addition to a family history of PHPT, male sex, age 45 years and younger, and presence of multigland disease, should prompt physicians to offer the opportunity for genetic counseling and testing, as it could influence the management of patients with PHPT. Published by Elsevier Inc.

  20. Role of microsatellite instability-low as a diagnostic biomarker of Lynch syndrome in colorectal cancer

    PubMed Central

    Vilar, Eduardo; Mork, Maureen E.; Cuddy, Amanda; Borras, Ester; Bannon, Sarah A.; Taggart, Melissa W.; Ying, Jun; Broaddus, Russell R.; Luthra, Rajyalakshmi; Rodriguez-Bigas, Miguel A.; Lynch, Patrick M.; You, Y. Nancy

    2014-01-01

    Lynch syndrome is the most common Mendelian disorder predisposing to hereditary colorectal cancer. Carriers of MSH6 mutations constitute less than 10% of total cases and present with a weaker clinical phenotype, including low levels of microsatellite instability (MSI-L) in colorectal tumors. The frequency of MSH6 mutation carriers among patients presenting with MSI-L colorectal cancer has yet to be determined, as has the appropriate genetic work-up in this context. We have reviewed here the clinicopathological characteristics, immunohistochemistry and genetic testing results for 71 patients at a single institution diagnosed with MSI-L colorectal cancers. Of 71 patients with MSI-L tumors, 21 underwent genetic testing for MSH6 mutations, three of them presented with loss of staining of MSH6 and only one carried a pathogenic germline MSH6 mutation in exon 4 (c.2677_2678delCT; p.Leu893Alafs*6). This latter patient had a significant family history and had a rectal primary that showed instability only in mononucleotide markers. In this cohort of MSI-L patients, we detected no notable clinicopathological and molecular characteristics that would help to distinguish a group most likely to harbor germline MSH6 mutations. Therefore, we conclude that the prevalence of MSH6 mutations among subjects with MSI-L tumors is very low. MSI analysis combined with immunohistochemistry of mismatch repair proteins adequately detects potential MSH6 carriers among MSI-L colorectal cancers. PMID:25432668

  1. Impact of Clinical Genetics Attendance at a Gynecologic Oncology Tumor Board on Referrals for Genetic Counseling and BRCA Mutation Testing.

    PubMed

    Cohen, Paul A; Nichols, Cassandra B; Schofield, Lyn; Van Der Werf, Steven; Pachter, Nicholas

    2016-06-01

    The objectives of this work were to determine the proportion of eligible patients with ovarian cancer discussed at a gynecologic oncology tumor board who were referred for counseling and BRCA mutation testing; to compare referral rates before genetics attendance at the tumor board to referral rates after genetics attendance; and to ascertain the proportions of women with germline BRCA mutations. Eligible cases were identified from the minutes of the weekly Western Australian gynecologic oncology tumor board from July 1, 2013 to June 30, 2015.Patients with ovarian cancer who met eligibility criteria for genetics referral were identified and checked against the records of the genetic services database to ascertain whether a referral was received. Outcomes including attendance for counseling and results of mutation testing were analyzed. Two hundred sixty-one patients were eligible for referral during the 24-month study period. One hundred six patients (40.6%) were referred for counseling and germline mutation testing. Of the eligible patients, 26.7% were referred in the 12 months before genetics attendance at the tumor board compared to 51.7% of the eligible patients in the 12 months after genetics attendance (P ≤ 0.0001). Ninety-seven patients were offered BRCA mutation testing, and 73 underwent testing with 65 results reported to date. Twenty-two patients (33.8 %) tested positive for a germline BRCA mutation. Patients with ovarian cancer had a high rate of BRCA mutations. Attendance of a genetics service at a tumor board was associated with an improved rate of referral of patients for genetic counseling and BRCA mutation testing.

  2. Mosaicism in HIF2A-related polycythemia-paraganglioma syndrome.

    PubMed

    Buffet, Alexandre; Smati, Sarra; Mansuy, Ludovic; Ménara, Mélanie; Lebras, Maëlle; Heymann, Marie-Françoise; Simian, Christophe; Favier, Judith; Murat, Arnaud; Cariou, Bertrand; Gimenez-Roqueplo, Anne-Paule

    2014-02-01

    HIF2A germline mutations were known to cause congenital polycythemia. Recently, HIF2A somatic mutations were found in several patients with polycythemia and paraganglioma, pheochromocytoma, or somatostatinoma, suggesting the occurrence of a de novo postzygotic HIF2A mutation that has not been demonstrated clearly. Patient 1 is a woman suffering from polycythemia diagnosed at the age of 16 years. She was operated on for a pheochromocytoma at 45 years and for two abdominal paragangliomas at 59 years. She was also diagnosed with somatostatinoma. Patient 2 is a young boy who suffered from polycythemia since infancy. He underwent surgery for a nonfunctional adrenal paraganglioma at the age of 9 years. We sequenced by Sanger and next-generation sequencing the HIF2A gene in DNA extracted from tumors, leukocytes, and buccal cells. In patient 1, we identified a somatic HIF2A mutation (c.1586T>C; p.Leu529Pro) in DNA extracted from both paragangliomas. The mutation was detected as a somatic mosaic in DNA extracted from somatostatinoma and was absent from germline DNA. In patient 2, we found an HIF2A heterozygous mutation (c.1625T>C; p.Leu542Pro) in the paraganglioma, but the mutation was also present as a mosaic in leukocyte DNA and in DNA extracted from buccal cells (3.3 and 8.96% of sequencing reads, respectively). Both mutations disrupt the hydroxylation domain of the HIF2α protein. Our study shows that HIF2A-related tumors are caused by postzygotic mutations occurring in early developmental stages. Potential germline mosaicism should be considered during the familial genetic counseling when an individual has been diagnosed with HIF2A-related polycythemia-paraganglioma syndrome.

  3. Germline PMS2 and somatic POLE exonuclease mutations cause hypermutability of the leading DNA strand in biallelic mismatch repair deficiency syndrome brain tumours.

    PubMed

    Andrianova, Maria A; Chetan, Ghati Kasturirangan; Sibin, Madathan Kandi; Mckee, Thomas; Merkler, Doron; Narasinga, Rao Kvl; Ribaux, Pascale; Blouin, Jean-Louis; Makrythanasis, Periklis; Seplyarskiy, Vladimir B; Antonarakis, Stylianos E; Nikolaev, Sergey I

    2017-11-01

    Biallelic mismatch repair deficiency (bMMRD) in tumours is frequently associated with somatic mutations in the exonuclease domains of DNA polymerases POLE or POLD1, and results in a characteristic mutational profile. In this article, we describe the genetic basis of ultramutated high-grade brain tumours in the context of bMMRD. We performed exome sequencing of two second-cousin patients from a large consanguineous family of Indian origin with early onset of high-grade glioblastoma and astrocytoma. We identified a germline homozygous nonsense variant, p.R802*, in the PMS2 gene. Additionally, by genome sequencing of these tumours, we found extremely high somatic mutation rates (237/Mb and 123/Mb), as well as somatic mutations in the proofreading domain of POLE polymerase (p.P436H and p.L424V), which replicates the leading DNA strand. Most interestingly, we found, in both cancers, that the vast majority of mutations were consistent with the signature of POLE exo - , i.e. an abundance of C>A and C>T mutations, particularly in special contexts, on the leading strand. We showed that the fraction of mutations under positive selection among mutations in tumour suppressor genes is more than two-fold lower in ultramutated tumours than in other glioblastomas. Genetic analyses enabled the diagnosis of the two consanguineous childhood brain tumours as being due to a combination of PMS2 germline and POLE somatic variants, and confirmed them as bMMRD/POLE exo - disorders. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  4. BRAF/KRAS gene sequencing of sebaceous neoplasms after mismatch repair protein analysis.

    PubMed

    Cornejo, Kristine M; Hutchinson, Lloyd; Deng, April; Tomaszewicz, Keith; Welch, Matthew; Lyle, Stephen; Dresser, Karen; Cosar, Ediz F

    2014-06-01

    Sebaceous neoplasms are cutaneous markers for the autosomal-dominant Muir-Torre syndrome (MTS). This phenotypic variant of Lynch syndrome (LS) is caused by germline mutations in DNA mismatch repair (MMR) genes. Microsatellite instability or loss of protein expression suggests a mutation or promoter hypermethylation in 1 of the MMR genes. BRAF gene sequencing may help to distinguish between patients with sporadic and LS-associated colorectal carcinomas with loss of MLH1 expression. LS-associated carcinomas are virtually negative for BRAF mutations, but a subset harbors KRAS mutations. The aim of our study was to test sebaceous neoplasms for V600E BRAF or KRAS mutations to determine if these mutations are associated with somatic or germline MMR defects, analogous to colorectal carcinomas. Over a 4-year period, 32 cases comprising 21 sebaceous adenomas, 3 sebaceomas, and 8 sebaceous carcinomas with sufficient material for testing were collected. MMR immunohistochemistry showed that 7 neoplasms had combined loss of MLH1-PMS2, 16 neoplasms had combined loss of MSH2-MSH6, 2 neoplasms had solitary loss of MSH6, and 7 sebaceous neoplasms had intact protein expression. BRAF/KRAS testing revealed all sebaceous neoplasms contained a wild-type BRAF gene. Two (15%) of 13 patients with MTS were found to harbor a KRAS mutation and loss of MLH1 expression. We conclude that a V600E BRAF mutation may not be helpful in distinguishing sporadic from MTS-associated sebaceous neoplasms. Further studies are needed to determine if KRAS mutations are restricted to patients with MTS or are also present in sporadic sebaceous neoplasms. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Whole Exome Sequencing of Pediatric Gastric Adenocarcinoma Reveals an Atypical Presentation of Li-Fraumeni Syndrome

    PubMed Central

    Chang, Vivian Y.; Federman, Noah; Martinez-Agosto, Julian; Tatishchev, Sergei F.; Nelson, Stanley F.

    2014-01-01

    Background Gastric adenocarcinoma is a rare diagnosis in childhood. A 14-year old male patient presented with metastatic gastric adenocarcinoma, and a strong family history of colon cancer. Clinical sequencing of CDH1 and APC were negative. Whole exome sequencing was therefore applied to capture the majority of protein-coding regions for the identification of single-nucleotide variants, small insertion/deletions, and copy number abnormalities in the patient’s germline as well as primary tumor. Materials and Methods DNA was extracted from the patient’s blood, primary tumor, and the unaffected mother’s blood. DNA libraries were constructed and sequenced on Illumina HiSeq2000. Data were post-processed using Picard and Samtools, then analyzed with the Genome Analysis Toolkit. Variants were annotated using an in-house Ensembl-based program. Copy number was assessed using ExomeCNV. Results Each sample was sequenced to a mean depth of coverage of greater than 120×. A rare non-synonymous coding SNV in TP53 was identified in the germline. There were 10 somatic cancer protein-damaging variants that were not observed in the unaffected mother genome. ExomeCNV comparing tumor to the patient’s germline, identified abnormal copy number, spanning 6,946 genes. Conclusion We present an unusual case of Li-Fraumeni detected by whole exome sequencing. There were also likely driver somatic mutations in the gastric adenocarcinoma. These results highlight the need for more thorough and broad scale germline and cancer analyses to accurately inform patients of inherited risk to cancer and to identify somatic mutations. PMID:23015295

  6. New observations on maternal age effect on germline de novo mutations.

    PubMed

    Wong, Wendy S W; Solomon, Benjamin D; Bodian, Dale L; Kothiyal, Prachi; Eley, Greg; Huddleston, Kathi C; Baker, Robin; Thach, Dzung C; Iyer, Ramaswamy K; Vockley, Joseph G; Niederhuber, John E

    2016-01-19

    Germline mutations are the source of evolution and contribute substantially to many health-related processes. Here we use whole-genome deep sequencing data from 693 parents-offspring trios to examine the de novo point mutations (DNMs) in the offspring. Our estimate for the mutation rate per base pair per generation is 1.05 × 10(-8), well within the range of previous studies. We show that maternal age has a small but significant correlation with the total number of DNMs in the offspring after controlling for paternal age (0.51 additional mutations per year, 95% CI: 0.29, 0.73), which was not detectable in the smaller and younger parental cohorts of earlier studies. Furthermore, while the total number of DNMs increases at a constant rate for paternal age, the contribution from the mother increases at an accelerated rate with age.These observations have implications related to the incidence of de novo mutations relating to maternal age.

  7. Molecular Diagnostics in Colorectal Carcinoma: Advances and Applications for 2018.

    PubMed

    Bhalla, Amarpreet; Zulfiqar, Muhammad; Bluth, Martin H

    2018-06-01

    The molecular pathogenesis and classification of colorectal carcinoma are based on the traditional adenomaecarcinoma sequence, serrated polyp pathway, and microsatellite instability (MSI). The genetic basis for hereditary nonpolyposis colorectal cancer is the detection of mutations in the MLH1, MSH2, MSH6, PMS2, and EPCAM genes. Genetic testing for Lynch syndrome includes MSI testing, methylator phenotype testing, BRAF mutation testing, and molecular testing for germline mutations in MMR genes. Molecular makers with predictive and prognostic implications include quantitative multigene reverse transcriptase polymerase chain reaction assay and KRAS and BRAF mutation analysis. Mismatch repair-deficient tumors have higher rates of programmed death-ligand 1 expression. Cell-free DNA analysis in fluids are proving beneficial for diagnosis and prognosis in these disease states towards effective patient management. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Role of microsatellite instability-low as a diagnostic biomarker of Lynch syndrome in colorectal cancer.

    PubMed

    Vilar, Eduardo; Mork, Maureen E; Cuddy, Amanda; Borras, Ester; Bannon, Sarah A; Taggart, Melissa W; Ying, Jun; Broaddus, Russell R; Luthra, Rajyalakshmi; Rodriguez-Bigas, Miguel A; Lynch, Patrick M; You, Yi-Qian Nancy

    2014-01-01

    Lynch syndrome is the most common Mendelian disorder predisposing persons to hereditary colorectal cancer. Carriers of MSH6 mutations constitute less than 10% of the total of cases with Lynch syndrome and present with a weaker clinical phenotype, including low levels of microsatellite instability (MSI-L) in colorectal tumors. The frequency of MSH6 mutation carriers among patients presenting with MSI-L colorectal cancer has yet to be determined, as has the appropriate genetic workup in this context. We have reviewed here the clinicopathologic characteristics, immunohistochemistry, and genetic testing results for 71 patients at a single institution diagnosed with MSI-L colorectal cancers. Of 71 patients with MSI-L tumors, 21 underwent genetic testing for MSH6 mutations, three of whom presented with loss of staining of MSH6 and only one of whom carried a pathogenic germline MSH6 mutation in exon 4 (c.2677_2678delCT; p.Leu893Alafs*6). This latter patient had a significant family history of cancer and had a rectal primary tumor that showed instability only in mononucleotide markers. In this cohort of MSI-L patients, we detected no notable clinicopathologic or molecular characteristic that would help to distinguish a group most likely to harbor germline MSH6 mutations. Therefore, we conclude that the prevalence of MSH6 mutations among patients with MSI-L tumors is very low. Microsatellite instability analysis combined with immunohistochemistry of mismatch repair proteins adequately detects potential MSH6 mutation carriers among MSI-L colorectal cancers. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Biochemical screening and PTEN mutation analysis in individuals with autism spectrum disorders and macrocephaly

    PubMed Central

    Hobert, Judith A; Embacher, Rebecca; Mester, Jessica L; Frazier, Thomas W; Eng, Charis

    2014-01-01

    Unlike some other childhood neurodevelopmental disorders, no diagnostic biochemical marker has been identified in all individuals with an autism spectrum disorder (ASD). This deficit likely results from genetic heterogeneity among the population. Therefore, we evaluated a subset of individuals with ASDs, specifically, individuals with or without macrocephaly in the presence or absence of PTEN mutations. We sought to determine if amino or organic acid markers could be used to identify individuals with ASDs with or without macrocephaly in the presence or absence of PTEN mutations, and to establish the degree of macrocephaly in individuals with ASDs and PTEN mutation. Urine, blood and occipital–frontal circumference (OFC) measurements were collected from 69 individuals meeting DSM-IV-TR criteria. Urine and plasma samples were subjected to amino and organic acid analyses. PTEN was Sanger-sequenced from germline genomic DNA. Germline PTEN mutations were identified in 27% (6/22) of the macrocephalic ASD population. All six PTEN mutation-positive individuals were macrocephalic with average OFC+4.35 standard deviations (SDs) above the mean. No common biochemical abnormalities were identified in macrocephalic ASD individuals with or without PTEN mutations. In contrast, among the collective ASD population, elevation of urine aspartic acid (87% 54/62), plasma taurine (69% 46/67) and reduction of plasma cystine (72% 46/64) were observed. PTEN sequencing should be carried out for all individuals with ASDs and macrocephaly with OFC ≥2SDs above the mean. A proportion of individuals with ASDs may have an underlying disorder in sulfur amino acid metabolism. PMID:23695273

  10. Congenital Neonatal Hyperthyroidism Caused by Germline Mutations in the TSH Receptor Gene: Case Report and Review of the Literature

    PubMed Central

    Chester, Jeremy; Rotenstein, Deborah; Ringkananont, Usanee; Steuer, Guy; Carlin, Beatrice; Stewart, Lindsay; Grasberger, Helmut; Refetoff, Samuel

    2018-01-01

    Neonatal hyperthyroidism, a rare and serious disorder occurs in two forms. An autoimmune form associated with maternal Graves’ disease, resulting from transplacental passage of maternal thyroid-stimulating antibodies, and a nonautoimmune form, resulting from mutations in the stimulatory G protein or the thyrotropin receptor (TSHR) causing constitutive activation of intracellular signaling cascades. To date, 29 separate cases of thyrotoxicosis caused by germline mutations of the TSHR have been documented. These cases have expressed themselves in a range of clinical consequences. This report describes a new case of a newborn with nonautoimmune hyperthyroidism secondary to a constitutively active TSHR mutation (S281N) whose clinical course was complicated by severe respiratory compromise. Typical clinical findings in this disorder are discussed by a review of all previously published cases. PMID:18655531

  11. Li-Fraumeni syndrome: cancer risk assessment and clinical management.

    PubMed

    McBride, Kate A; Ballinger, Mandy L; Killick, Emma; Kirk, Judy; Tattersall, Martin H N; Eeles, Rosalind A; Thomas, David M; Mitchell, Gillian

    2014-05-01

    Carriers of germline mutations in the TP53 gene, encoding the cell-cycle regulator and tumour suppressor p53, have a markedly increased risk of cancer-related morbidity and mortality during both childhood and adulthood, and thus require appropriate and effective cancer risk management. However, the predisposition of such patients to multiorgan tumorigenesis presents a specific challenge for cancer risk management programmes. Herein, we review the clinical implications of germline mutations in TP53 and the evidence for cancer screening and prevention strategies in individuals carrying such mutations, as well as examining the potential psychosocial implications of lifelong management for a ubiquitous cancer risk. In addition, we propose an evidence-based framework for the clinical management of TP53 mutation carriers and provide a platform for addressing the management of other cancer predisposition syndromes that can affect multiple organs.

  12. Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures.

    PubMed

    Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

    2014-01-01

    High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5-13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known. We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations.

  13. Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures

    PubMed Central

    Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

    2014-01-01

    High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5–13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known.     We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations. PMID:24879340

  14. Synteny analysis in Rosids with a walnut physical map reveals slow genome evolution in long-lived woody perennials

    USDA-ARS?s Scientific Manuscript database

    Mutations often accompany DNA replication. Since there may be fewer cell cycles per year in the germlines of long-lived than short-lived angiosperms, the genomes of long-lived angiosperms may be diverging more slowly than those of short-lived angiosperms. Here we test this hypothesis. We first const...

  15. Germline mutations in PALB2 in African-American breast cancer cases.

    PubMed

    Ding, Yuan Chun; Steele, Linda; Chu, Li-Hao; Kelley, Karen; Davis, Helen; John, Esther M; Tomlinson, Gail E; Neuhausen, Susan L

    2011-02-01

    Breast cancer incidence is lower in African Americans than in Caucasian Americans. However, African-American women have higher breast cancer mortality rates and tend to be diagnosed with earlier-onset disease. Identifying factors correlated to the racial/ethnic variation in the epidemiology of breast cancer may provide better understanding of the more aggressive disease at diagnosis. Truncating germline mutations in PALB2 have been identified in approximately 1% of early-onset and/or familial breast cancer cases. To date, PALB2 mutation testing has not been performed in African-American breast cancer cases. We screened for germline mutations in PALB2 in 139 African-American breast cases by denaturing high-performance liquid chromatography and direct sequencing. Twelve variants were identified in these cases and none caused truncation of the protein. Three missense variants, including two rare variants (P8L and T300I) and one common variant (P210L), were predicted to be pathogenic, and were located in a coiled-coil domain of PALB2 required for RAD51- and BRCA1-binding. We investigated and found no significant association between the P210L variant and breast cancer risk in a small case-control study of African-American women. This study adds to the literature that PALB2 mutations, although rare, appear to play a role in breast cancer in all populations investigated to date.

  16. The TP53 gene promoter is not methylated in families suggestive of Li-Fraumeni syndrome with no germline TP53 mutations.

    PubMed

    Finkova, Alena; Vazna, Alzbeta; Hrachovina, Ondrej; Bendova, Sarka; Prochazkova, Kamila; Sedlacek, Zdenek

    2009-08-01

    Germline TP53 mutations are found in only 70% of families with the Li-Fraumeni syndrome (LFS), and with an even lower frequency in families suggestive of LFS but not meeting clinical criteria of the syndrome. Despite intense efforts, to date, no other genes have been associated with the disorder in a significant number of TP53 mutation-negative families. A search for defects in TP53 other than heterozygous missense mutations showed that neither intron variants nor sequence variants in the TP53 promoter are frequent in LFS, and multiexon deletions have been found to be responsible for LFS only in several cases. Another cancer predisposition syndrome, hereditary non-polyposis colon cancer, has been associated with epigenetic silencing of one allele of the MLH1 or MSH2 genes. This prompted us to test the methylation of the TP53 gene promoter in a set of 14 families suggestive of LFS using bisulphite sequencing of three DNA fragments from the 5' region of the gene. We found no detectable methylation at any of the CG dinucleotides tested. Thus, epigenetic silencing of the TP53 promoter is not a frequent cause of the disorder in families suggestive of LFS but with no germline mutations in the coding part of the gene.

  17. Genetic features of myelodysplastic syndrome and aplastic anemia in pediatric and young adult patients

    PubMed Central

    Keel, Siobán B.; Scott, Angela; Sanchez-Bonilla, Marilyn; Ho, Phoenix A.; Gulsuner, Suleyman; Pritchard, Colin C.; Abkowitz, Janis L.; King, Mary-Claire; Walsh, Tom; Shimamura, Akiko

    2016-01-01

    The clinical and histopathological distinctions between inherited versus acquired bone marrow failure and myelodysplastic syndromes are challenging. The identification of inherited bone marrow failure/myelodysplastic syndromes is critical to inform appropriate clinical management. To investigate whether a subset of pediatric and young adults undergoing transplant for aplastic anemia or myelodysplastic syndrome have germline mutations in bone marrow failure/myelodysplastic syndrome genes, we performed a targeted genetic screen of samples obtained between 1990–2012 from children and young adults with aplastic anemia or myelodysplastic syndrome transplanted at the Fred Hutchinson Cancer Research Center. Mutations in inherited bone marrow failure/myelodysplastic syndrome genes were found in 5.1% (5/98) of aplastic anemia patients and 13.6% (15/110) of myelodysplastic syndrome patients. While the majority of mutations were constitutional, a RUNX1 mutation present in the peripheral blood at a 51% variant allele fraction was confirmed to be somatically acquired in one myelodysplastic syndrome patient. This highlights the importance of distinguishing germline versus somatic mutations by sequencing DNA from a second tissue or from parents. Pathological mutations were present in DKC1, MPL, and TP53 among the aplastic anemia cohort, and in FANCA, GATA2, MPL, RTEL1, RUNX1, SBDS, TERT, TINF2, and TP53 among the myelodysplastic syndrome cohort. Family history or physical examination failed to reliably predict the presence of germline mutations. This study shows that while any single specific bone marrow failure/myelodysplastic syndrome genetic disorder is rare, screening for these disorders in aggregate identifies a significant subset of patients with inherited bone marrow failure/myelodysplastic syndrome. PMID:27418648

  18. Male Mutation Bias Is the Main Force Shaping Chromosomal Substitution Rates in Monotreme Mammals

    PubMed Central

    Link, Vivian; Aguilar-Gómez, Diana; Ramírez-Suástegui, Ciro; Hurst, Laurence D.

    2017-01-01

    Abstract In many species, spermatogenesis involves more cell divisions than oogenesis, and the male germline, therefore, accumulates more DNA replication errors, a phenomenon known as male mutation bias. The extent of male mutation bias (α) is estimated by comparing substitution rates of the X, Y, and autosomal chromosomes, as these chromosomes spend different proportions of their time in the germlines of the two sexes. Male mutation bias has been characterized in placental and marsupial mammals as well as birds, but analyses in monotremes failed to detect any such bias. Monotremes are an ancient lineage of egg-laying mammals with distinct biological properties, which include unique germline features. Here, we sought to assess the presence and potential characteristics of male mutation bias in platypus and the short-beaked echidna based on substitution rate analyses of X, Y, and autosomes. We established the presence of moderate male mutation bias in monotremes, corresponding to an α value of 2.12–3.69. Given that it has been unclear what proportion of the variation in substitution rates on the different chromosomal classes is really due to differential number of replications, we analyzed the influence of other confounding forces (selection, replication-timing, etc.) and found that male mutation bias is the main force explaining the between-chromosome classes differences in substitution rates. Finally, we estimated the proportion of variation at the gene level in substitution rates that is owing to replication effects and found that this phenomenon can explain >68% of these variations in monotremes, and in control species, rodents, and primates. PMID:28922870

  19. Genetic testing and counseling of a recipient after bone marrow transplant from a sibling harboring a germline BRCA1 pathogenic mutation.

    PubMed

    Škerl, Petra; Krajc, Mateja; Blatnik, Ana; Novaković, Srdjan

    2017-07-01

    Allogenic bone marrow transplant recipients represent a unique challenge, when they are referred for genetic testing and counseling. When performing genetic testing, it is extremely important to ensure that the detected DNA mutations originate from the patients own DNA, and therefore the most appropriate and reliable biological sample for DNA isolation must be obtained. The aim of the present study was to present the germline testing and counseling approach utilized in a rare case of a chimeric woman who received an allogenic bone marrow transplant from a sibling with a germline BRCA1 pathogenic mutation. According to our results, hairs with follicles are a reliable and ready source of DNA in a patient whose blood is of allogenic bone marrow transplant donor origin. Compared with a fibroblast culture, which is more difficult to obtain, the hair follicles are much more accessible and hair sampling is less invasive for the patient. Genetic testing based on the other sources of DNA, such as buccal swabs, is questionable due to the known risk of donor DNA contamination.

  20. Clinical Characterization of the Pheochromocytoma and Paraganglioma Susceptibility Genes SDHA, TMEM127, MAX, and SDHAF2 for Gene-Informed Prevention

    PubMed Central

    Schiavi, Francesca; Ni, Ying; Welander, Jenny; Patocs, Attila; Ngeow, Joanne; Wellner, Ulrich; Malinoc, Angelica; Taschin, Elisa; Barbon, Giovanni; Lanza, Virginia; Söderkvist, Peter; Stenman, Adam; Larsson, Catharina; Svahn, Fredrika; Chen, Jin-Lian; Marquard, Jessica; Fraenkel, Merav; Walter, Martin A.; Peczkowska, Mariola; Prejbisz, Aleksander; Jarzab, Barbara; Hasse-Lazar, Kornelia; Petersenn, Stephan; Moeller, Lars C.; Meyer, Almuth; Reisch, Nicole; Trupka, Arnold; Brase, Christoph; Galiano, Matthias; Preuss, Simon F.; Kwok, Pingling; Lendvai, Nikoletta; Berisha, Gani; Makay, Özer; Boedeker, Carsten C.; Weryha, Georges; Racz, Karoly; Januszewicz, Andrzej; Walz, Martin K.; Gimm, Oliver; Opocher, Giuseppe; Eng, Charis; Neumann, Hartmut P. H.

    2017-01-01

    Importance Effective cancer prevention is based on accurate molecular diagnosis and results of genetic family screening, genotype-informed risk assessment, and tailored strategies for early diagnosis. The expanding etiology for hereditary pheochromocytomas and paragangliomas has recently included SDHA, TMEM127, MAX, and SDHAF2 as susceptibility genes. Clinical management guidelines for patients with germline mutations in these 4 newly included genes are lacking. Objective To study the clinical spectra and age-related penetrance of individuals with mutations in the SDHA, TMEM127, MAX, and SDHAF2 genes. Design, Setting, and Patients This study analyzed the prospective, longitudinally followed up European-American-Asian Pheochromocytoma-Paraganglioma Registry for prevalence of SDHA, TMEM127, MAX, and SDHAF2 germline mutation carriers from 1993 to 2016. Genetic predictive testing and clinical investigation by imaging from neck to pelvis was offered to mutation-positive registrants and their relatives to clinically characterize the pheochromocytoma/paraganglioma diseases associated with mutations of the 4 new genes. Main Outcomes and Measures Prevalence and spectra of germline mutations in the SDHA, TMEM127, MAX, and SDHAF2 genes were assessed. The clinical features of SDHA, TMEM127, MAX, and SDHAF2 disease were characterized. Results Of 972 unrelated registrants without mutations in the classic pheochromocytoma- and paraganglioma-associated genes (632 female [65.0%] and 340 male [35.0%]; age range, 8-80; mean [SD] age, 41.0 [13.3] years), 58 (6.0%) carried germline mutations of interest, including 29 SDHA, 20 TMEM127, 8 MAX, and 1 SDHAF2. Fifty-three of 58 patients (91%) had familial, multiple, extra-adrenal, and/or malignant tumors and/or were younger than 40 years. Newly uncovered are 7 of 63 (11%) malignant pheochromocytomas and paragangliomas in SDHA and TMEM127 disease. SDHA disease occurred as early as 8 years of age. Extra-adrenal tumors occurred in 28 mutation carriers (48%) and in 23 of 29 SDHA mutation carriers (79%), particularly with head and neck paraganglioma. MAX disease occurred almost exclusively in the adrenal glands with frequently bilateral tumors. Penetrance in the largest subset, SDHA carriers, was 39% at 40 years of age and is statistically different in index patients (45%) vs mutation-carrying relatives (13%; P < .001). Conclusions and Relevance The SDHA, TMEM127, MAX, and SDHAF2 genes may contribute to hereditary pheochromocytoma and paraganglioma. Genetic testing is recommended in patients at clinically high risk if the classic genes are mutation negative. Gene-specific prevention and/or early detection requires regular, systematic whole-body investigation. PMID:28384794

  1. Clinical Characterization of the Pheochromocytoma and Paraganglioma Susceptibility Genes SDHA, TMEM127, MAX, and SDHAF2 for Gene-Informed Prevention.

    PubMed

    Bausch, Birke; Schiavi, Francesca; Ni, Ying; Welander, Jenny; Patocs, Attila; Ngeow, Joanne; Wellner, Ulrich; Malinoc, Angelica; Taschin, Elisa; Barbon, Giovanni; Lanza, Virginia; Söderkvist, Peter; Stenman, Adam; Larsson, Catharina; Svahn, Fredrika; Chen, Jin-Lian; Marquard, Jessica; Fraenkel, Merav; Walter, Martin A; Peczkowska, Mariola; Prejbisz, Aleksander; Jarzab, Barbara; Hasse-Lazar, Kornelia; Petersenn, Stephan; Moeller, Lars C; Meyer, Almuth; Reisch, Nicole; Trupka, Arnold; Brase, Christoph; Galiano, Matthias; Preuss, Simon F; Kwok, Pingling; Lendvai, Nikoletta; Berisha, Gani; Makay, Özer; Boedeker, Carsten C; Weryha, Georges; Racz, Karoly; Januszewicz, Andrzej; Walz, Martin K; Gimm, Oliver; Opocher, Giuseppe; Eng, Charis; Neumann, Hartmut P H

    2017-09-01

    Effective cancer prevention is based on accurate molecular diagnosis and results of genetic family screening, genotype-informed risk assessment, and tailored strategies for early diagnosis. The expanding etiology for hereditary pheochromocytomas and paragangliomas has recently included SDHA, TMEM127, MAX, and SDHAF2 as susceptibility genes. Clinical management guidelines for patients with germline mutations in these 4 newly included genes are lacking. To study the clinical spectra and age-related penetrance of individuals with mutations in the SDHA, TMEM127, MAX, and SDHAF2 genes. This study analyzed the prospective, longitudinally followed up European-American-Asian Pheochromocytoma-Paraganglioma Registry for prevalence of SDHA, TMEM127, MAX, and SDHAF2 germline mutation carriers from 1993 to 2016. Genetic predictive testing and clinical investigation by imaging from neck to pelvis was offered to mutation-positive registrants and their relatives to clinically characterize the pheochromocytoma/paraganglioma diseases associated with mutations of the 4 new genes. Prevalence and spectra of germline mutations in the SDHA, TMEM127, MAX, and SDHAF2 genes were assessed. The clinical features of SDHA, TMEM127, MAX, and SDHAF2 disease were characterized. Of 972 unrelated registrants without mutations in the classic pheochromocytoma- and paraganglioma-associated genes (632 female [65.0%] and 340 male [35.0%]; age range, 8-80; mean [SD] age, 41.0 [13.3] years), 58 (6.0%) carried germline mutations of interest, including 29 SDHA, 20 TMEM127, 8 MAX, and 1 SDHAF2. Fifty-three of 58 patients (91%) had familial, multiple, extra-adrenal, and/or malignant tumors and/or were younger than 40 years. Newly uncovered are 7 of 63 (11%) malignant pheochromocytomas and paragangliomas in SDHA and TMEM127 disease. SDHA disease occurred as early as 8 years of age. Extra-adrenal tumors occurred in 28 mutation carriers (48%) and in 23 of 29 SDHA mutation carriers (79%), particularly with head and neck paraganglioma. MAX disease occurred almost exclusively in the adrenal glands with frequently bilateral tumors. Penetrance in the largest subset, SDHA carriers, was 39% at 40 years of age and is statistically different in index patients (45%) vs mutation-carrying relatives (13%; P < .001). The SDHA, TMEM127, MAX, and SDHAF2 genes may contribute to hereditary pheochromocytoma and paraganglioma. Genetic testing is recommended in patients at clinically high risk if the classic genes are mutation negative. Gene-specific prevention and/or early detection requires regular, systematic whole-body investigation.

  2. Targeted Prostate Cancer Screening in BRCA1 and BRCA2 Mutation Carriers: Results from the Initial Screening Round of the IMPACT Study

    PubMed Central

    Bancroft, Elizabeth K.; Page, Elizabeth C.; Castro, Elena; Lilja, Hans; Vickers, Andrew; Sjoberg, Daniel; Assel, Melissa; Foster, Christopher S.; Mitchell, Gillian; Drew, Kate; Mæhle, Lovise; Axcrona, Karol; Evans, D. Gareth; Bulman, Barbara; Eccles, Diana; McBride, Donna; van Asperen, Christi; Vasen, Hans; Kiemeney, Lambertus A.; Ringelberg, Janneke; Cybulski, Cezary; Wokolorczyk, Dominika; Selkirk, Christina; Hulick, Peter J.; Bojesen, Anders; Skytte, Anne-Bine; Lam, Jimmy; Taylor, Louise; Oldenburg, Rogier; Cremers, Ruben; Verhaegh, Gerald; van Zelst-Stams, Wendy A.; Oosterwijk, Jan C.; Blanco, Ignacio; Salinas, Monica; Cook, Jackie; Rosario, Derek J.; Buys, Saundra; Conner, Tom; Ausems, Margreet G.; Ong, Kai-ren; Hoffman, Jonathan; Domchek, Susan; Powers, Jacquelyn; Teixeira, Manuel R.; Maia, Sofia; Foulkes, William D.; Taherian, Nassim; Ruijs, Marielle; den Enden, Apollonia T. Helderman-van; Izatt, Louise; Davidson, Rosemarie; Adank, Muriel A.; Walker, Lisa; Schmutzler, Rita; Tucker, Kathy; Kirk, Judy; Hodgson, Shirley; Harris, Marion; Douglas, Fiona; Lindeman, Geoffrey J.; Zgajnar, Janez; Tischkowitz, Marc; Clowes, Virginia E.; Susman, Rachel; Ramón y Cajal, Teresa; Patcher, Nicholas; Gadea, Neus; Spigelman, Allan; van Os, Theo; Liljegren, Annelie; Side, Lucy; Brewer, Carole; Brady, Angela F.; Donaldson, Alan; Stefansdottir, Vigdis; Friedman, Eitan; Chen-Shtoyerman, Rakefet; Amor, David J.; Copakova, Lucia; Barwell, Julian; Giri, Veda N.; Murthy, Vedang; Nicolai, Nicola; Teo, Soo-Hwang; Greenhalgh, Lynn; Strom, Sara; Henderson, Alex; McGrath, John; Gallagher, David; Aaronson, Neil; Ardern-Jones, Audrey; Bangma, Chris; Dearnaley, David; Costello, Philandra; Eyfjord, Jorunn; Rothwell, Jeanette; Falconer, Alison; Gronberg, Henrik; Hamdy, Freddie C.; Johannsson, Oskar; Khoo, Vincent; Kote-Jarai, Zsofia; Lubinski, Jan; Axcrona, Ulrika; Melia, Jane; McKinley, Joanne; Mitra, Anita V.; Moynihan, Clare; Rennert, Gad; Suri, Mohnish; Wilson, Penny; Killick, Emma; Moss, Sue; Eeles, Rosalind A.

    2014-01-01

    Background Men with germline breast cancer 1, early onset (BRCA1) or breast cancer 2, early onset (BRCA2) gene mutations have a higher risk of developing prostate cancer (PCa) than noncarriers. IMPACT (Identification of Men with a genetic predisposition to ProstAte Cancer: Targeted screening in BRCA1/2 mutation carriers and controls) is an international consortium of 62 centres in 20 countries evaluating the use of targeted PCa screening in men with BRCA1/2 mutations. Objective To report the first year's screening results for all men at enrolment in the study. Design, setting and participants We recruited men aged 40–69 yr with germline BRCA1/2 mutations and a control group of men who have tested negative for a pathogenic BRCA1 or BRCA2 mutation known to be present in their families. All men underwent prostate-specific antigen (PSA) testing at enrolment, and those men with PSA >3 ng/ml were offered prostate biopsy. Outcome measurements and statistical analysis PSA levels, PCa incidence, and tumour characteristics were evaluated. The Fisher exact test was used to compare the number of PCa cases among groups and the differences among disease types. Results and limitations We recruited 2481 men (791 BRCA1 carriers, 531 BRCA1 controls; 731 BRCA2 carriers, 428 BRCA2 controls). A total of 199 men (8%) presented with PSA >3.0 ng/ml, 162 biopsies were performed, and 59 PCas were diagnosed (18 BRCA1 carriers, 10 BRCA1 controls; 24 BRCA2 carriers, 7 BRCA2 controls); 66% of the tumours were classified as intermediate- or high-risk disease. The positive predictive value (PPV) for biopsy using a PSA threshold of 3.0 ng/ml in BRCA2 mutation carriers was 48%—double the PPV reported in population screening studies. A significant difference in detecting intermediate- or high-risk disease was observed in BRCA2 carriers. Ninety-five percent of the men were white, thus the results cannot be generalised to all ethnic groups. Conclusions The IMPACT screening network will be useful for targeted PCa screening studies in men with germline genetic risk variants as they are discovered. These preliminary results support the use of targeted PSA screening based on BRCA genotype and show that this screening yields a high proportion of aggressive disease. Patient summary In this report, we demonstrate that germline genetic markers can be used to identify men at higher risk of prostate cancer. Targeting screening at these men resulted in the identification of tumours that were more likely to require treatment. PMID:24484606

  3. Germline epimutation in humans.

    PubMed

    Cropley, Jennifer E; Martin, David I K; Suter, Catherine M

    2008-12-01

    Epigenetic modifications provide all multicellular organisms with a system of gene regulation that allows clonally heritable yet reversible alterations in gene transcription. Errors in this complex system can give rise to abnormal gene silencing, termed 'epimutation'; importantly, this can occur in the absence of any underlying genetic defect. Epimutations are commonly somatic events, and are particularly prevalent in tumors, but we and others have shown that epimutation can also arise in the germline, giving rise to soma-wide transcriptional silencing of a gene. A germline epimutation can mimic the effect of an inactivating mutation, and in doing so, can phenocopy a genetic disease. In this article, we will review the recent findings with germline epimutation at the tumor suppressor gene MLH1, discuss the possible etiology of this phenomenon, and the implications of germline epimutation in humans.

  4. Biallelic PMS2 Mutation and Heterozygous DICER1 Mutation Presenting as Constitutional Mismatch Repair Deficiency With Corpus Callosum Agenesis: Case Report and Review of Literature.

    PubMed

    Cheyuo, Cletus; Radwan, Walid; Ahn, Janice; Gyure, Kymberly; Qaiser, Rabia; Tomboc, Patrick

    2017-10-01

    Constitutional mismatch repair deficiency syndrome is a cancer predisposition syndrome caused by autosomal recessive biallelic (homozygous) germline mutations in the mismatch repair genes (MLH1, MSH2, MSH6, and PMS2). The clinical spectrum includes neoplastic and non-neoplastic manifestations. We present the case of a 7-year-old boy who presented with T-lymphoblastic lymphoma and glioblastoma, together with non-neoplastic manifestations including corpus callosum agenesis, arachnoid cyst, developmental venous anomaly, and hydrocephalus. Gene mutation analysis revealed pathogenic biallelic mutations of PMS2 and heterozygous DICER1 variant predicted to be pathogenic. This report is the first to allude to a possible interaction of the mismatch repair system with DICER1 to cause corpus callosum agenesis.

  5. Lynch syndrome caused by germline PMS2 mutations: delineating the cancer risk.

    PubMed

    ten Broeke, Sanne W; Brohet, Richard M; Tops, Carli M; van der Klift, Heleen M; Velthuizen, Mary E; Bernstein, Inge; Capellá Munar, Gabriel; Gomez Garcia, Encarna; Hoogerbrugge, Nicoline; Letteboer, Tom G W; Menko, Fred H; Lindblom, Annika; Mensenkamp, Arjen R; Moller, Pal; van Os, Theo A; Rahner, Nils; Redeker, Bert J W; Sijmons, Rolf H; Spruijt, Liesbeth; Suerink, Manon; Vos, Yvonne J; Wagner, Anja; Hes, Frederik J; Vasen, Hans F; Nielsen, Maartje; Wijnen, Juul T

    2015-02-01

    The clinical consequences of PMS2 germline mutations are poorly understood compared with other Lynch-associated mismatch repair gene (MMR) mutations. The aim of this European cohort study was to define the cancer risk faced by PMS2 mutation carriers. Data were collected from 98 PMS2 families ascertained from family cancer clinics that included a total of 2,548 family members and 377 proven mutation carriers. To adjust for potential ascertainment bias, a modified segregation analysis model was used to calculate colorectal cancer (CRC) and endometrial cancer (EC) risks. Standardized incidence ratios (SIRs) were calculated to estimate risks for other Lynch syndrome-associated cancers. The cumulative risk (CR) of CRC for male mutation carriers by age 70 years was 19%. The CR among female carriers was 11% for CRC and 12% for EC. The mean age of CRC development was 52 years, and there was a significant difference in mean age of CRC between the probands (mean, 47 years; range, 26 to 68 years) and other family members with a PMS2 mutation (mean, 58 years; range, 31 to 86 years; P < .001). Significant SIRs were observed for cancers of the small bowel, ovaries, breast, and renal pelvis. CRC and EC risks were found to be markedly lower than those previously reported for the other MMR. However, these risks embody the isolated risk of carrying a PMS2 mutation, and it should be noted that we observed a substantial variation in cancer phenotype within and between families, suggesting the influence of genetic modifiers and lifestyle factors on cancer risks. © 2014 by American Society of Clinical Oncology.

  6. Pathological and Genetic Characterization of Bilateral Adrenomedullary Hyperplasia in a Patient with Germline MAX Mutation.

    PubMed

    Romanet, Pauline; Guerin, Carole; Pedini, Pascal; Essamet, Wassim; Castinetti, Frédéric; Sebag, Fréderic; Roche, Philippe; Cascon, Alberto; Tischler, Arthur S; Pacak, Karel; Barlier, Anne; Taïeb, David

    2017-12-01

    In recent years, familial pheochromocytoma (PHEO) with germline mutations in the MAX (MYC associated factor X) gene has been reported in a few cases. Here, we investigated a 25-year-old patient with multiple PHEOs associated with a non-sense germline MAX mutation. Preoperative 18 F-FDOPA PET/CT revealed bilateral adrenal involvement with multiple tumors. In addition, both adrenal glands were found to have diffuse or nodular adrenal medullary hyperplasia (AMH), a histopathological feature previously described as a precursor of MEN2- and SDHB-related PHEOs but not MAX. After bilateral adrenalectomy, different paraffin-embedded and frozen samples were analyzed for allelic imbalances of the MAX gene using allelic quantification by pyrosequencing. The expression of the protein MAX was studied by immunohistochemistry. All PHEOs but also nodular AMH exhibited a loss of the normal allele. By contrast, the diffuse AMH did not show loss-of-heterozygosity. Nevertheless, immunohistochemistry demonstrated loss of protein MAX expression in all samples including diffuse hyperplasia, suggesting a causative role of MAX mutation for both PHEOs and AMH. The present case shows that both nodular and diffuse AMH belongs to the spectrum of MAX-related disease. These data support the possible continuum between nodular AMH and PHEO, expanding the qualification of micro-PHEO to nodular AMH.

  7. Syndrome complex of bone marrow failure and pulmonary fibrosis predicts germline defects in telomerase

    PubMed Central

    Parry, Erin M.; Alder, Jonathan K.; Qi, Xiaodong; Chen, Julian J.-L.

    2011-01-01

    Mutations in the essential telomerase components hTERT and hTR cause dyskeratosis congenita, a bone marrow failure syndrome characterized by mucocutaneous features. Some (∼ 3%) sporadic aplastic anemia (AA) and idiopathic pulmonary fibrosis cases also carry mutations in hTERT and hTR. Even though it can affect clinical outcome, because the mutation frequency is rare, genetic testing is not standard. We examined whether the cooccurrence of bone marrow failure and pulmonary fibrosis in the same individual or family enriches for the presence of a telomerase mutation. Ten consecutive individuals with a total of 36 family members who fulfilled these criteria carried a germline mutant telomerase gene (100%). The mean age of onset for individuals with AA was significantly younger than that for those with pulmonary fibrosis (14 vs 51; P < .0001). Families displayed autosomal dominant inheritance and there was an evolving pattern of genetic anticipation, with the older generation primarily affected by pulmonary fibrosis and successive generations by bone marrow failure. The cooccurrence of AA and pulmonary fibrosis in a single patient or family is highly predictive for the presence of a germline telomerase defect. This diagnosis affects the choice of bone marrow transplantation preparative regimen and can prevent morbidity. PMID:21436073

  8. [Genotyping of BRCA1, BRCA2 and CHEK2 germline mutations in Russian breast cancer patients using diagnostic biochips].

    PubMed

    Nasedkina, T V; Gromyko, O E; Emel'ianova, M A; Ignatova, E O; Kazubskaia, T P; Portnoĭ, S M; Zasedatelev, A S; Liubchenko, L N

    2014-01-01

    Germline mutations of BRCA1/2 genes cause the predisposition of their carriers to breast or/and ovary cancers (BC or/and OC) during the lifetime. Identification of these mutations is a basis of molecular diagnosis for BC susceptibility. Rapid genotyping technique using microarrays for identification of BRCA1 185delAG, 300T>G, 4153delA, 5382insC mutations and 4158 A>G sequence variant; BRCA2 695insT and 6174delT mutations; 1100delC mutation in CHEK2 gene was applied for 412 randomly collected breast cancer samples from the central region of European area of Russia. In 25 (6.0%) patients (6.0%) BC was associated with other tumours: OC, cervical cancer, colorectal cancer etc. BRCA1/2 and CHEK2 mutations were found in 33 (8.0%) BC patients. The most frequent mutation was BRCA1 5382insC, occurred in 16 (3.9%) BC patients, and CHEK2 1100delC, revealed in 7 (1.7%) BC patients. An application of diagnostic BC-microarray for genetic testing of BRCA1/2 and CHEK2 founder mutations has been discussed.

  9. Low Base-Substitution Mutation Rate in the Germline Genome of the Ciliate Tetrahymena thermophila

    DTIC Science & Technology

    2016-09-15

    generations of mutation accumulation (MA). We applied an existing mutation-calling pipeline and developed a new probabilistic mutation detection approach...noise introduced by mismapped reads. We used both our new method and an existing mutation-calling pipeline (Sung, Tucker, et al. 2012) to analyse the...and larger MA experiments will be required to confidently estimate the mutational spectrum of a species with such a low mutation rate. Materials and

  10. The phenotype of mes-2, mes-3, mes-4 and mes-6, maternal-effect genes required for survival of the germline in Caenorhabditis elegans, is sensitive to chromosome dosage.

    PubMed Central

    Garvin, C; Holdeman, R; Strome, S

    1998-01-01

    Mutations in mes-2, mes-3, mes-4, and mes-6 result in maternal-effect sterility: hermaphrodite offspring of mes/mes mothers are sterile because of underproliferation and death of the germ cells, as well as an absence of gametes. Mutant germ cells do not undergo programmed cell death, but instead undergo a necrotic-type death, and their general poor health apparently prevents surviving germ cells from forming gametes. Male offspring of mes mothers display a significantly less severe germline phenotype than their hermaphrodite siblings, and males are often fertile. This differential response of hermaphrodite and male offspring to the absence of mes+ product is a result of their different X chromosome compositions; regardless of their sexual phenotype, XX worms display a more severe germline phenotype than XO worms, and XXX worms display the most severe phenotype. The sensitivity of the mutant phenotype to chromosome dosage, along with the similarity of two MES proteins to chromatin-associated regulators of gene expression in Drosophila, suggest that the essential role of the mes genes is in control of gene expression in the germline. An additional, nonessential role of the mes genes in the soma is suggested by the surprising finding that mutations in the mes genes, like mutations in dosage compensation genes, feminize animals whose male sexual identity is somewhat ambiguous. We hypothesize that the mes genes encode maternally supplied regulators of chromatin structure and gene expression in the germline and perhaps in somatic cells of the early embryo, and that at least some of their targets are on the X chromosomes. PMID:9475730

  11. Genetic testing in women with breast cancer: implications for treatment.

    PubMed

    Paterson, Robin; Phillips, Kelly-Anne

    2017-11-01

    Mutations in either the BRCA1 or BRCA2 genes are responsible for approximately 42,000 cases of breast cancer annually. Identifying these germline mutations in a woman with breast cancer is important because it can influence her immediate and long-term management and has important implications for other family members. Areas covered: This review highlights how treatment-focussed genetic testing for BRCA1 and BRCA2 mutations can potentially influence cancer treatment and secondary prevention decisions in women with breast cancer. Expert commentary: Testing women with breast cancer for BRCA1 and BRCA2 germline mutations has the potential to decrease cancer burden and improve cancer outcomes. It can help optimise surgical and systemic therapy approaches. Clinicians should actively consider whether genetic testing is appropriate for each woman with breast cancer, and if so should instigate it early in the treatment trajectory when it can most influence cancer care.

  12. Familial Colorectal Cancer: Understanding the Alphabet Soup.

    PubMed

    Giglia, Matthew D; Chu, Daniel I

    2016-09-01

    While most colorectal cancers (CRCs) originate from nonhereditary spontaneous mutations, one-third of cases are familial or hereditary. Hereditary CRCs, which account for < 5% of all CRCs, have identifiable germline mutations and phenotypes, such as Lynch syndrome and familial adenomatous polyposis (FAP). Familial CRCs, which account for up to 30% of CRCs, have no identifiable germline mutation or specific pattern of inheritance, but higher-than-expected incidence within a family. Since the discovery that certain genotypes can lead to development of CRC, thousands of mutations have now been implicated in CRC. These new findings have enhanced our ability to identify at-risk patients, initiate better surveillance, and take preventative measures. Given the large number of genes now associated with hereditary and familial CRCs, clinicians should be familiar with the alphabet soup of genes to provide the highest quality of care for patients and families.

  13. Familial recurrences of FOXG1-related disorder: Evidence for mosaicism.

    PubMed

    McMahon, Kelly Q; Papandreou, Apostolos; Ma, Mandy; Barry, Brenda J; Mirzaa, Ghayda M; Dobyns, William B; Scott, Richard H; Trump, Natalie; Kurian, Manju A; Paciorkowski, Alex R

    2015-12-01

    FOXG1-related disorders are caused by heterozygous mutations in FOXG1 and result in a spectrum of neurodevelopmental phenotypes including postnatal microcephaly, intellectual disability with absent speech, epilepsy, chorea, and corpus callosum abnormalities. The recurrence risk for de novo mutations in FOXG1-related disorders is assumed to be low. Here, we describe three unrelated sets of full siblings with mutations in FOXG1 (c.515_577del63, c.460dupG, and c.572T > G), representing familial recurrence of the disorder. In one family, we have documented maternal somatic mosaicism for the FOXG1 mutation, and all of the families presumably represent parental gonadal (or germline) mosaicism. To our knowledge, mosaicism has not been previously reported in FOXG1-related disorders. Therefore, this report provides evidence that germline mosaicism for FOXG1 mutations is a likely explanation for familial recurrence and should be considered during recurrence risk counseling for families of children with FOXG1-related disorders. © 2015 Wiley Periodicals, Inc.

  14. SMARCB1/INI1 germline mutations contribute to 10% of sporadic schwannomatosis.

    PubMed

    Rousseau, Guillaume; Noguchi, Tetsuro; Bourdon, Violaine; Sobol, Hagay; Olschwang, Sylviane

    2011-01-24

    Schwannomatosis is a disease characterized by multiple non-vestibular schwannomas. Although biallelic NF2 mutations are found in schwannomas, no germ line event is detected in schwannomatosis patients. In contrast, germline mutations of the SMARCB1 (INI1) tumor suppressor gene were described in familial and sporadic schwannomatosis patients. To delineate the SMARCB1 gene contribution, the nine coding exons were sequenced in a series of 56 patients affected with a variable number of non-vestibular schwannomas. Nine variants scattered along the sequence of SMARCB1 were identified. Five of them were classified as deleterious. All five patients carrying a SMARCB1 mutation had more multiple schwannomas, corresponding to 10.2% of patients with schwannomatosis. They were also diagnosed before 35 years of age. These results suggest that patients with schwannomas have a significant probability of carrying a SMARCB1 mutation. Combined with data available from other studies, they confirm the clinical indications for genetic screening of the SMARCB1 gene.

  15. SMARCB1/INI1 germline mutations contribute to 10% of sporadic schwannomatosis

    PubMed Central

    2011-01-01

    Background Schwannomatosis is a disease characterized by multiple non-vestibular schwannomas. Although biallelic NF2 mutations are found in schwannomas, no germ line event is detected in schwannomatosis patients. In contrast, germline mutations of the SMARCB1 (INI1) tumor suppressor gene were described in familial and sporadic schwannomatosis patients. Methods To delineate the SMARCB1 gene contribution, the nine coding exons were sequenced in a series of 56 patients affected with a variable number of non-vestibular schwannomas. Results Nine variants scattered along the sequence of SMARCB1 were identified. Five of them were classified as deleterious. All five patients carrying a SMARCB1 mutation had more multiple schwannomas, corresponding to 10.2% of patients with schwannomatosis. They were also diagnosed before 35 years of age. Conclusions These results suggest that patients with schwannomas have a significant probability of carrying a SMARCB1 mutation. Combined with data available from other studies, they confirm the clinical indications for genetic screening of the SMARCB1 gene. PMID:21255467

  16. Role of framework mutations and antibody flexibility in the evolution of broadly neutralizing antibodies

    PubMed Central

    2018-01-01

    Eliciting antibodies that are cross reactive with surface proteins of diverse strains of highly mutable pathogens (e.g., HIV, influenza) could be key for developing effective universal vaccines. Mutations in the framework regions of such broadly neutralizing antibodies (bnAbs) have been reported to play a role in determining their properties. We used molecular dynamics simulations and models of affinity maturation to study specific bnAbs against HIV. Our results suggest that there are different classes of evolutionary lineages for the bnAbs. If germline B cells that initiate affinity maturation have high affinity for the conserved residues of the targeted epitope, framework mutations increase antibody rigidity as affinity maturation progresses to evolve bnAbs. If the germline B cells exhibit weak/moderate affinity for conserved residues, an initial increase in flexibility via framework mutations may be required for the evolution of bnAbs. Subsequent mutations that increase rigidity result in highly potent bnAbs. Implications of our results for immunogen design are discussed. PMID:29442996

  17. Statistical Methods for Identifying Sequence Motifs Affecting Point Mutations

    PubMed Central

    Zhu, Yicheng; Neeman, Teresa; Yap, Von Bing; Huttley, Gavin A.

    2017-01-01

    Mutation processes differ between types of point mutation, genomic locations, cells, and biological species. For some point mutations, specific neighboring bases are known to be mechanistically influential. Beyond these cases, numerous questions remain unresolved, including: what are the sequence motifs that affect point mutations? How large are the motifs? Are they strand symmetric? And, do they vary between samples? We present new log-linear models that allow explicit examination of these questions, along with sequence logo style visualization to enable identifying specific motifs. We demonstrate the performance of these methods by analyzing mutation processes in human germline and malignant melanoma. We recapitulate the known CpG effect, and identify novel motifs, including a highly significant motif associated with A→G mutations. We show that major effects of neighbors on germline mutation lie within ±2 of the mutating base. Models are also presented for contrasting the entire mutation spectra (the distribution of the different point mutations). We show the spectra vary significantly between autosomes and X-chromosome, with a difference in T→C transition dominating. Analyses of malignant melanoma confirmed reported characteristic features of this cancer, including statistically significant strand asymmetry, and markedly different neighboring influences. The methods we present are made freely available as a Python library https://bitbucket.org/pycogent3/mutationmotif. PMID:27974498

  18. An Analysis of the Sensitivity of Proteogenomic Mapping of Somatic Mutations and Novel Splicing Events in Cancer.

    PubMed

    Ruggles, Kelly V; Tang, Zuojian; Wang, Xuya; Grover, Himanshu; Askenazi, Manor; Teubl, Jennifer; Cao, Song; McLellan, Michael D; Clauser, Karl R; Tabb, David L; Mertins, Philipp; Slebos, Robbert; Erdmann-Gilmore, Petra; Li, Shunqiang; Gunawardena, Harsha P; Xie, Ling; Liu, Tao; Zhou, Jian-Ying; Sun, Shisheng; Hoadley, Katherine A; Perou, Charles M; Chen, Xian; Davies, Sherri R; Maher, Christopher A; Kinsinger, Christopher R; Rodland, Karen D; Zhang, Hui; Zhang, Zhen; Ding, Li; Townsend, R Reid; Rodriguez, Henry; Chan, Daniel; Smith, Richard D; Liebler, Daniel C; Carr, Steven A; Payne, Samuel; Ellis, Matthew J; Fenyő, David

    2016-03-01

    Improvements in mass spectrometry (MS)-based peptide sequencing provide a new opportunity to determine whether polymorphisms, mutations, and splice variants identified in cancer cells are translated. Herein, we apply a proteogenomic data integration tool (QUILTS) to illustrate protein variant discovery using whole genome, whole transcriptome, and global proteome datasets generated from a pair of luminal and basal-like breast-cancer-patient-derived xenografts (PDX). The sensitivity of proteogenomic analysis for singe nucleotide variant (SNV) expression and novel splice junction (NSJ) detection was probed using multiple MS/MS sample process replicates defined here as an independent tandem MS experiment using identical sample material. Despite analysis of over 30 sample process replicates, only about 10% of SNVs (somatic and germline) detected by both DNA and RNA sequencing were observed as peptides. An even smaller proportion of peptides corresponding to NSJ observed by RNA sequencing were detected (<0.1%). Peptides mapping to DNA-detected SNVs without a detectable mRNA transcript were also observed, suggesting that transcriptome coverage was incomplete (∼80%). In contrast to germline variants, somatic variants were less likely to be detected at the peptide level in the basal-like tumor than in the luminal tumor, raising the possibility of differential translation or protein degradation effects. In conclusion, this large-scale proteogenomic integration allowed us to determine the degree to which mutations are translated and identify gaps in sequence coverage, thereby benchmarking current technology and progress toward whole cancer proteome and transcriptome analysis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Spectrum and prevalence of FP/TMEM127 gene mutations in pheochromocytomas and paragangliomas.

    PubMed

    Yao, Li; Schiavi, Francesca; Cascon, Alberto; Qin, Yuejuan; Inglada-Pérez, Lucia; King, Elizabeth E; Toledo, Rodrigo A; Ercolino, Tonino; Rapizzi, Elena; Ricketts, Christopher J; Mori, Luigi; Giacchè, Mara; Mendola, Antonella; Taschin, Elisa; Boaretto, Francesca; Loli, Paola; Iacobone, Maurizio; Rossi, Gian-Paolo; Biondi, Bernadette; Lima-Junior, José Viana; Kater, Claudio E; Bex, Marie; Vikkula, Miikka; Grossman, Ashley B; Gruber, Stephen B; Barontini, Marta; Persu, Alexandre; Castellano, Maurizio; Toledo, Sergio P A; Maher, Eamonn R; Mannelli, Massimo; Opocher, Giuseppe; Robledo, Mercedes; Dahia, Patricia L M

    2010-12-15

    Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P = 2.7 × 10(-4)) and/or with familial disease (5 of 20 samples; P = .005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P = .54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Germline mutations of FP/TMEM127 were associated with pheochromocytoma but not paraganglioma and occurred in an age group frequently excluded from genetic screening algorithms. Disease-associated mutations disrupt intracellular distribution of the FP/TMEM127 protein.

  20. Screening for germline BRCA1, BRCA2, TP53 and CHEK2 mutations in families at-risk for hereditary breast cancer identified in a population-based study from Southern Brazil.

    PubMed

    Palmero, Edenir Inêz; Alemar, Bárbara; Schüler-Faccini, Lavínia; Hainaut, Pierre; Moreira-Filho, Carlos Alberto; Ewald, Ingrid Petroni; Santos, Patricia Koehler Dos; Ribeiro, Patricia Lisbôa Izetti; Oliveira, Cristina Brinkmann de Netto; Calvez-Kelm, Florence Le; Tavtigian, Sean; Cossio, Silvia Liliana; Giugliani, Roberto; Caleffi, Maira; Ashton-Prolla, Patricia

    2016-05-24

    In Brazil, breast cancer is a public health care problem due to its high incidence and mortality rates. In this study, we investigated the prevalence of hereditary breast cancer syndromes (HBCS) in a population-based cohort in Brazils southernmost capital, Porto Alegre. All participants answered a questionnaire about family history (FH) of breast, ovarian and colorectal cancer and those with a positive FH were invited for genetic cancer risk assessment (GCRA). If pedigree analysis was suggestive of HBCS, genetic testing of the BRCA1, BRCA2, TP53, and CHEK2 genes was offered. Of 902 women submitted to GCRA, 214 had pedigrees suggestive of HBCS. Fifty of them underwent genetic testing: 18 and 40 for BRCA1/BRCA2 and TP53 mutation screening, respectively, and 7 for CHEK2 1100delC testing. A deleterious BRCA2 mutation was identified in one of the HBOC probands and the CHEK2 1100delC mutation occurred in one of the HBCC families. No deleterious germline alterations were identified in BRCA1 or TP53. Although strict inclusion criteria and a comprehensive testing approach were used, the suspected genetic risk in these families remains unexplained. Further studies in a larger cohort are necessary to better understand the genetic component of hereditary breast cancer in Southern Brazil.

  1. Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression

    PubMed Central

    Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D.; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

    2016-01-01

    The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma. Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines. We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK. Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%. Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression. Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants. In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression. PMID:27009842

  2. Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression.

    PubMed

    Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

    2016-04-19

    The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma.Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines.We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK.Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%.Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression.Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants.In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression.

  3. Germ-line mutations in the neurofibromatosis 2 gene: Correlations with disease severity and retinal abnormalities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parry, D.M.; Kaiser-Kupfer, M.; Eldridge, R.

    Neurofibromatosis 2 (NF2) features bilateral vestibular schwannomas, other benign neural tumors, and cataracts. Patients in some families develop many tumors at an early age and have rapid clinical progression, whereas in other families, patients may not have symptoms until much later and vestibular schwannomas may be the only tumors. The NF2 gene has been cloned from chromosome 22q; most identified germ-line mutations result in a truncated protein and severe NF2. To look for additional mutations and clinical correlations, we used SSCP analysis to screen DNA from 32 unrelated patients. We identified 20 different mutations in 21 patients (66%): 10 nonsensemore » mutations, 2 frameshifts, 7 splice-site mutations, and 1 large in-frame deletion. Clinical information on 47 patients from the 21 families included ages at onset and at diagnosis, numbers of meningiomas, spinal and skin tumors, and presence of cataracts and retinal abnormalities. We compared clinical findings in patients with nonsense or frameshift mutations to those with splice-site mutations. When each patient was considered as an independent random event, the two groups differed (P {le} .05) for nearly every variable. Patients with nonsense or frameshift mutations were younger at onset and at diagnosis and had a higher frequency and mean number of tumors, supporting the correlation between nonsense and frameshift mutations and severe NF2. When each family was considered as an independent random event, statistically significant differences between the two groups were observed only for mean ages at onset and at diagnosis. A larger data set is needed to resolve these discrepancies. We observed retinal hamartomas and/or epiretinal membranes in nine patients from five families with four different nonsense mutations. This finding, which may represent a new genotype-phenotype correlation, merits further study. 58 refs., 2 tabs.« less

  4. Germline mutations of BRCA1 gene exon 11 are not associated with platinum response neither with survival advantage in patients with primary ovarian cancer: understanding the clinical importance of one of the biggest human exons. A study of the Tumor Bank Ovarian Cancer (TOC) Consortium.

    PubMed

    Dimitrova, Desislava; Ruscito, Ilary; Olek, Sven; Richter, Rolf; Hellwag, Alexander; Türbachova, Ivana; Woopen, Hannah; Baron, Udo; Braicu, Elena Ioana; Sehouli, Jalid

    2016-09-01

    Germline mutations in BRCA1 gene have been reported in up to 20 % of epithelial ovarian cancer (EOC) patients. Distinct clinical characteristics have been attributed to this special EOC population. We hypothesized that mutations in different BRCA1 gene exons may differently affect the clinical course of the disease. The aim of this study was to analyze, in a large cohort of primary EOCs, the clinical impact of mutations in BRCA1 gene exon 11, the largest exon of the gene sequence encoding the 60 % of BRCA1 protein. Two hundred sixty-three primary EOC patients, treated between 2000 and 2008 at Charité University Hospital of Berlin, were included. Patients' blood samples were obtained from the Tumor Ovarian Cancer (TOC) Network ( www.toc-network.de ). Direct sequencing of BRCA1 gene exon 11 was performed for each patient to detect mutations. Based on their BRCA1 exon 11 mutational status, patients were compared regarding clinico-pathological variables and survival. Mutations in BRCA1 exon 11 were found in 18 out of 263 patients (6.8 %). Further 10/263 (3.8 %) cases showed variants of uncertain significance (VUS). All exon 11 BRCA1-positive tumors (100 %) were Type 2 ovarian carcinomas (p = 0.05). Age at diagnosis was significantly younger in Type 2 exon 11 mutated patients (p = 0.01). On multivariate analysis, BRCA1 exon 11 mutational status was not found to be an independent predictive factor for optimal cytoreduction, platinum response, or survival. Mutations in BRCA1 gene exon 11 seem to predispose women to exclusively develop a Type 2 ovarian cancer at younger age. Exon 11 BRCA1-mutated EOC patients showed distinct clinico-pathological features but similar clinical outcome with respect to sporadic EOC patients.

  5. Low Prevalence of CHEK2 Gene Mutations in Multiethnic Cohorts of Breast Cancer Patients in Malaysia

    PubMed Central

    Mohamad, Suriati; Isa, Nurismah Md; Muhammad, Rohaizak; Emran, Nor Aina; Kitan, Nor Mayah; Kang, Peter; Kang, In Nee; Taib, Nur Aishah Mohd; Teo, Soo Hwang; Akmal, Sharifah Noor

    2015-01-01

    CHEK2 is a protein kinase that is involved in cell-cycle checkpoint control after DNA damage. Germline mutations in CHEK2 gene have been associated with increase in breast cancer risk. The aim of this study is to identify the CHEK2 gene germline mutations among high-risk breast cancer patients and its contribution to the multiethnic population in Malaysia. We screened the entire coding region of CHEK2 gene on 59 high-risk breast cancer patients who tested negative for BRCA1/2 germline mutations from UKM Medical Centre (UKMMC), Hospital Kuala Lumpur (HKL) and Hospital Putrajaya (HPJ). Sequence variants identified were screened further in case-control cohorts consisting of 878 unselected invasive breast cancer patients (180 Malays, 526 Chinese and 172 Indian) and 270 healthy individuals (90 Malays, 90 Chinese and 90 Indian). By screening the entire coding region of the CHEK2 gene, two missense mutations, c.480A>G (p.I160M) and c.538C>T (p.R180C) were identified in two unrelated patients (3.4%). Further screening of these missense mutations on the case-control cohorts unveiled the variant p.I160M in 2/172 (1.1%) Indian cases and 1/90 (1.1%) Indian control, variant p.R180C in 2/526 (0.38%) Chinese cases and 0/90 Chinese control, and in 2/180 (1.1%) of Malay cases and 1/90 (1.1%) of Malay control. The results of this study suggest that CHEK2 mutations are rare among high-risk breast cancer patients and may play a minor contributing role in breast carcinogenesis among Malaysian population. PMID:25629968

  6. Clinical and genetic spectrum of Birt–Hogg–Dubé syndrome patients in whom pneumothorax and/or multiple lung cysts are the presenting feature

    PubMed Central

    Kunogi, Makiko; Kurihara, Masatoshi; Ikegami, Takako Shigihara; Kobayashi, Toshiyuki; Shindo, Noriko; Kumasaka, Toshio; Gunji, Yoko; Kikkawa, Mika; Iwakami, Shin-ichiro; Hino, Okio; Takahashi, Kazuhisa

    2010-01-01

    Background Birt–Hogg–Dubé syndrome (BHDS) is an inherited autosomal genodermatosis characterised by fibrofolliculomas of the skin, renal tumours and multiple lung cysts. Genetic studies have disclosed that the clinical picture as well as responsible germline FLCN mutations are diverse. Objectives BHDS may be caused by a germline deletion which cannot be detected by a conventional genetic approach. Real-time quantitative polymerase chain reaction (qPCR) may be able to identify such a mutation and thus provide us with a more accurate clinical picture of BHDS. Methods This study analysed 36 patients with multiple lung cysts of undetermined causes. Denaturing high performance liquid chromatography (DHPLC) was applied for mutation screening. If no abnormality was detected by DHPLC, the amount of each FLCN exon in genome was quantified by qPCR. Results An FLCN germline mutation was found in 23 (63.9%) of the 36 patients by DHPLC and direct sequencing (13 unique small nucleotide alterations which included 11 novel mutations). A large genomic deletion was identified in two of the remaining 13 patients by qPCR (one patient with exon 14 deletion and one patient with a deletion encompassing exons 9 to 14). Mutations including genomic deletions were most frequently identified in the 3′-end of the FLCN gene including exons 12 and 13 (13/25=52.0%). The BHDS patients whose multiple cysts prompted the diagnosis in this study showed a very low incidence of skin and renal involvement. Conclusions BHDS is due to large deletions as well as small nucleotide alterations. Racial differences may occur between Japanese and patients of European decent in terms of FLCN mutations and clinical manifestations. PMID:20413710

  7. Male Mutation Bias Is the Main Force Shaping Chromosomal Substitution Rates in Monotreme Mammals.

    PubMed

    Link, Vivian; Aguilar-Gómez, Diana; Ramírez-Suástegui, Ciro; Hurst, Laurence D; Cortez, Diego

    2017-09-01

    In many species, spermatogenesis involves more cell divisions than oogenesis, and the male germline, therefore, accumulates more DNA replication errors, a phenomenon known as male mutation bias. The extent of male mutation bias (α) is estimated by comparing substitution rates of the X, Y, and autosomal chromosomes, as these chromosomes spend different proportions of their time in the germlines of the two sexes. Male mutation bias has been characterized in placental and marsupial mammals as well as birds, but analyses in monotremes failed to detect any such bias. Monotremes are an ancient lineage of egg-laying mammals with distinct biological properties, which include unique germline features. Here, we sought to assess the presence and potential characteristics of male mutation bias in platypus and the short-beaked echidna based on substitution rate analyses of X, Y, and autosomes. We established the presence of moderate male mutation bias in monotremes, corresponding to an α value of 2.12-3.69. Given that it has been unclear what proportion of the variation in substitution rates on the different chromosomal classes is really due to differential number of replications, we analyzed the influence of other confounding forces (selection, replication-timing, etc.) and found that male mutation bias is the main force explaining the between-chromosome classes differences in substitution rates. Finally, we estimated the proportion of variation at the gene level in substitution rates that is owing to replication effects and found that this phenomenon can explain >68% of these variations in monotremes, and in control species, rodents, and primates. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Low prevalence of CHEK2 gene mutations in multiethnic cohorts of breast cancer patients in Malaysia.

    PubMed

    Mohamad, Suriati; Isa, Nurismah Md; Muhammad, Rohaizak; Emran, Nor Aina; Kitan, Nor Mayah; Kang, Peter; Kang, In Nee; Taib, Nur Aishah Mohd; Teo, Soo Hwang; Akmal, Sharifah Noor

    2015-01-01

    CHEK2 is a protein kinase that is involved in cell-cycle checkpoint control after DNA damage. Germline mutations in CHEK2 gene have been associated with increase in breast cancer risk. The aim of this study is to identify the CHEK2 gene germline mutations among high-risk breast cancer patients and its contribution to the multiethnic population in Malaysia. We screened the entire coding region of CHEK2 gene on 59 high-risk breast cancer patients who tested negative for BRCA1/2 germline mutations from UKM Medical Centre (UKMMC), Hospital Kuala Lumpur (HKL) and Hospital Putrajaya (HPJ). Sequence variants identified were screened further in case-control cohorts consisting of 878 unselected invasive breast cancer patients (180 Malays, 526 Chinese and 172 Indian) and 270 healthy individuals (90 Malays, 90 Chinese and 90 Indian). By screening the entire coding region of the CHEK2 gene, two missense mutations, c.480A>G (p.I160M) and c.538C>T (p.R180C) were identified in two unrelated patients (3.4%). Further screening of these missense mutations on the case-control cohorts unveiled the variant p.I160M in 2/172 (1.1%) Indian cases and 1/90 (1.1%) Indian control, variant p.R180C in 2/526 (0.38%) Chinese cases and 0/90 Chinese control, and in 2/180 (1.1%) of Malay cases and 1/90 (1.1%) of Malay control. The results of this study suggest that CHEK2 mutations are rare among high-risk breast cancer patients and may play a minor contributing role in breast carcinogenesis among Malaysian population.

  9. Unregulated smooth-muscle myosin in human intestinal neoplasia.

    PubMed

    Alhopuro, Pia; Phichith, Denis; Tuupanen, Sari; Sammalkorpi, Heli; Nybondas, Miranda; Saharinen, Juha; Robinson, James P; Yang, Zhaohui; Chen, Li-Qiong; Orntoft, Torben; Mecklin, Jukka-Pekka; Järvinen, Heikki; Eng, Charis; Moeslein, Gabriela; Shibata, Darryl; Houlston, Richard S; Lucassen, Anneke; Tomlinson, Ian P M; Launonen, Virpi; Ristimäki, Ari; Arango, Diego; Karhu, Auli; Sweeney, H Lee; Aaltonen, Lauri A

    2008-04-08

    A recent study described a recessive ATPase activating germ-line mutation in smooth-muscle myosin (smmhc/myh11) underlying the zebrafish meltdown (mlt) phenotype. The mlt zebrafish develops intestinal abnormalities reminiscent of human Peutz-Jeghers syndrome (PJS) and juvenile polyposis (JP). To examine the role of MYH11 in human intestinal neoplasia, we searched for MYH11 mutations in patients with colorectal cancer (CRC), PJS and JP. We found somatic protein-elongating frameshift mutations in 55% of CRCs displaying microsatellite instability and in the germ-line of one individual with PJS. Additionally, two somatic missense mutations were found in one microsatellite stable CRC. These two missense mutations, R501L and K1044N, and the frameshift mutations were functionally evaluated. All mutations resulted in unregulated molecules displaying constitutive motor activity, similar to the mutant myosin underlying mlt. Thus, MYH11 mutations appear to contribute also to human intestinal neoplasia. Unregulated MYH11 may affect the cellular energy balance or disturb cell lineage decisions in tumor progenitor cells. These data challenge our view on MYH11 as a passive differentiation marker functioning in muscle contraction and add to our understanding of intestinal neoplasia.

  10. Lynch syndrome-associated endometrial carcinoma with MLH1 germline mutation and MLH1 promoter hypermethylation: a case report and literature review.

    PubMed

    Yokoyama, Takanori; Takehara, Kazuhiro; Sugimoto, Nao; Kaneko, Keika; Fujimoto, Etsuko; Okazawa-Sakai, Mika; Okame, Shinichi; Shiroyama, Yuko; Yokoyama, Takashi; Teramoto, Norihiro; Ohsumi, Shozo; Saito, Shinya; Imai, Kazuho; Sugano, Kokichi

    2018-05-21

    Lynch syndrome is an autosomal dominant inherited disease caused by germline mutations in mismatch repair genes. Analysis for microsatellite instability (MSI) and immunohistochemistry (IHC) of protein expressions of disease-associated genes is used to screen for Lynch syndrome in endometrial cancer patients. When losses of both MLH1 and PMS2 proteins are observed by IHC, MLH1 promoter methylation analysis is conducted to distinguish Lynch syndrome-associated endometrial cancer from sporadic cancer. Here we report a woman who developed endometrial cancer at the age of 49 years. She had a family history of colorectal cancer (first-degree relative aged 52 years) and stomach cancer (second-degree relative with the age of onset unknown). No other family history was present, and she failed to meet the Amsterdam II criteria for the diagnosis of Lynch syndrome. Losses of MLH1 and PMS2, but not MSH2 and MSH6, proteins were observed by IHC in endometrial cancer tissues. Because MLH1 promoter hypermethylation was detected in endometrial cancer tissue samples, the epigenetic silencing of MLH1 was suspected as the cause of the protein loss. However, because of the early onset of endometrial cancer and the positive family history, a diagnosis of Lynch syndrome was also suspected. Therefore, we provided her with genetic counseling. After obtaining her consent, MLH1 promoter methylation testing and genetic testing of peripheral blood were performed. MLH1 promoter methylation was not observed in peripheral blood. However, genetic testing revealed a large deletion of exon 5 in MLH1; thus, we diagnosed the presence of Lynch syndrome. Both MLH1 germline mutation and MLH1 promoter hypermethylation may be observed in endometrial cancer. Therefore, even if MLH1 promoter hypermethylation is detected, a diagnosis of Lynch syndrome cannot be excluded.

  11. Immune dysregulation in human subjects with heterozygous germline mutations in CTLA4

    PubMed Central

    Deenick, Elissa K.; Niemela, Julie E.; Avery, Danielle T.; Schickel, Jean-Nicolas; Tran, Dat Q.; Stoddard, Jennifer; Zhang, Yu; Frucht, David M.; Dumitriu, Bogdan; Scheinberg, Phillip; Folio, Les R.; Frein, Cathleen A.; Price, Susan; Koh, Christopher; Heller, Theo; Seroogy, Christine M.; Huttenlocher, Anna; Rao, V. Koneti; Su, Helen C.; Kleiner, David; Notarangelo, Luigi D.; Rampertaap, Yajesh; Olivier, Kenneth N.; McElwee, Joshua; Hughes, Jason; Pittaluga, Stefania; Oliveira, Joao B.; Meffre, Eric; Fleisher, Thomas A.; Holland, Steven M.; Lenardo, Michael J.; Tangye, Stuart G.; Uzel, Gulbu

    2015-01-01

    Cytotoxic T lymphocyte antigen–4 (CTLA-4) is an inhibitory receptor found on immune cells. The consequences of mutations in CTLA4 in humans are unknown. We identified germline heterozygous mutations in CTLA4 in subjects with severe immune dysregulation from four unrelated families. Whereas Ctla4 heterozygous mice have no obvious phenotype, human CTLA4 haploinsufficiency caused dysregulation of FoxP3+ regulatory T (Treg) cells, hyperactivation of effector T cells, and lymphocytic infiltration of target organs. Patients also exhibited progressive loss of circulating B cells, associated with an increase of predominantly autoreactive CD21lo B cells and accumulation of B cells in nonlymphoid organs. Inherited human CTLA4 haploinsufficiency demonstrates a critical quantitative role for CTLA-4 in governing T and B lymphocyte homeostasis. PMID:25213377

  12. Autosomal dominant hypoparathyroidism caused by germline mutation in GNA11: phenotypic and molecular characterization.

    PubMed

    Li, Dong; Opas, Evan E; Tuluc, Florin; Metzger, Daniel L; Hou, Cuiping; Hakonarson, Hakon; Levine, Michael A

    2014-09-01

    Most cases of autosomal dominant hypoparathyroidism (ADH) are caused by gain-of-function mutations in CASR or dominant inhibitor mutations in GCM2 or PTH. Our objectives were to identify the genetic basis for ADH in a multigenerational family and define the underlying disease mechanism. Here we evaluated a multigenerational family with ADH in which affected subjects had normal sequences in these genes and were shorter than unaffected family members. We collected clinical and biochemical data from 6 of 11 affected subjects and performed whole-exome sequence analysis on DNA from two affected sisters and their affected father. Functional studies were performed after expression of wild-type and mutant Gα11 proteins in human embryonic kidney-293-CaR cells that stably express calcium-sensing receptors. Whole-exome-sequencing followed by Sanger sequencing revealed a heterozygous mutation, c.179G>T; p.R60L, in GNA11, which encodes the α-subunit of G11, the principal heterotrimeric G protein that couples calcium-sensing receptors to signal activation in parathyroid cells. Functional studies of Gα11 R60L showed increased accumulation of intracellular concentration of free calcium in response to extracellular concentration of free calcium with a significantly decreased EC50 compared with wild-type Gα11. By contrast, R60L was significantly less effective than the oncogenic Q209L form of Gα11 as an activator of the MAPK pathway. Compared to subjects with CASR mutations, patients with GNA11 mutations lacked hypercalciuria and had normal serum magnesium levels. Our findings indicate that the germline gain-of-function mutation of GNA11 is a cause of ADH and implicate a novel role for GNA11 in skeletal growth.

  13. Autosomal Dominant Hypoparathyroidism Caused by Germline Mutation in GNA11: Phenotypic and Molecular Characterization

    PubMed Central

    Li, Dong; Opas, Evan E.; Tuluc, Florin; Metzger, Daniel L.; Hou, Cuiping; Hakonarson, Hakon

    2014-01-01

    Context: Most cases of autosomal dominant hypoparathyroidism (ADH) are caused by gain-of-function mutations in CASR or dominant inhibitor mutations in GCM2 or PTH. Objective: Our objectives were to identify the genetic basis for ADH in a multigenerational family and define the underlying disease mechanism. Subjects: Here we evaluated a multigenerational family with ADH in which affected subjects had normal sequences in these genes and were shorter than unaffected family members. Methods: We collected clinical and biochemical data from 6 of 11 affected subjects and performed whole-exome sequence analysis on DNA from two affected sisters and their affected father. Functional studies were performed after expression of wild-type and mutant Gα11 proteins in human embryonic kidney-293-CaR cells that stably express calcium-sensing receptors. Results: Whole-exome-sequencing followed by Sanger sequencing revealed a heterozygous mutation, c.179G>T; p.R60L, in GNA11, which encodes the α-subunit of G11, the principal heterotrimeric G protein that couples calcium-sensing receptors to signal activation in parathyroid cells. Functional studies of Gα11 R60L showed increased accumulation of intracellular concentration of free calcium in response to extracellular concentration of free calcium with a significantly decreased EC50 compared with wild-type Gα11. By contrast, R60L was significantly less effective than the oncogenic Q209L form of Gα11 as an activator of the MAPK pathway. Compared to subjects with CASR mutations, patients with GNA11 mutations lacked hypercalciuria and had normal serum magnesium levels. Conclusions: Our findings indicate that the germline gain-of-function mutation of GNA11 is a cause of ADH and implicate a novel role for GNA11 in skeletal growth. PMID:24823460

  14. Diagnostic Genetics at a Distance: Von Hippel-Lindau Disease and a Novel Mutation

    PubMed Central

    Prosser, Debra O.; Love, Jennifer M.; Gardner, R. J. McKinlay; Love, Donald R.

    2013-01-01

    Genetic testing at a distance is commonplace where members of a family with a segregating germline mutation are geographically separated. For the most part, this challenge is addressed through the intervention of health professionals in taking and/or processing blood samples for subsequent couriering of DNA to a referral laboratory. In some circumstances, however, the collecting of pivotal clinical material may involve direct patient involvement. We describe such a situation where noninvasive saliva samples were provided by members of a family manifesting Von Hippel-Lindau (VHL) disease. The analysis identified a novel mutation in the VHL gene that was used to exclude other family members as being at risk of VHL disease. PMID:24062953

  15. Café-au-lait macules and pediatric malignancy caused by biallelic mutations in the DNA mismatch repair (MMR) gene PMS2.

    PubMed

    Jackson, Carl-Christian; Holter, Spring; Pollett, Aaron; Clendenning, Mark; Chou, Shirley; Senter, Leigha; Ramphal, Raveena; Gallinger, Steven; Boycott, Kym

    2008-06-01

    A 14-year-old male presented with a T4 sigmoid adenocarcinoma, <10 colonic adenomas and multiple café-au-lait macules. Family history was not suggestive of a dominant hereditary form of colorectal cancer. Evaluation of the tumor revealed abnormal immunohistochemical staining of the PMS2 protein and high frequency microsatellite instability. Germline analysis identified biallelic PMS2 missense mutations. A new cancer syndrome caused by biallelic mutations in the mismatch repair genes, including PMS2, is now emerging and is characterized by café-au-lait macules, colonic polyps and a distinctive tumor spectrum. (c) 2007 Wiley-Liss, Inc.

  16. Characterization of a germline mosaicism in families with Lowe syndrome, and identification of seven novel mutations in the OCRL1 gene.

    PubMed Central

    Satre, V; Monnier, N; Berthoin, F; Ayuso, C; Joannard, A; Jouk, P S; Lopez-Pajares, I; Megabarne, A; Philippe, H J; Plauchu, H; Torres, M L; Lunardi, J

    1999-01-01

    The oculocerebrorenal syndrome of Lowe (OCRL) is an X-linked disorder characterized by major abnormalities of eyes, nervous system, and kidneys. Mutations in the OCRL1 gene have been associated with the disease. OCRL1 encodes a phosphatidylinositol 4, 5-biphosphate (PtdIns[4,5]P2) 5-phosphatase. We have examined the OCRL1 gene in eight unrelated patients with OCRL and have found seven new mutations and one recurrent in-frame deletion. Among the new mutations, two nonsense mutations (R317X and E558X) and three other frameshift mutations caused premature termination of the protein. A missense mutation, R483G, was located in the highly conserved PtdIns(4,5)P2 5-phosphatase domain. Finally, one frameshift mutation, 2799delC, modifies the C-terminal part of OCRL1, with an extension of six amino acids. Altogether, 70% of missense mutations are located in exon 15, and 52% of all mutations cluster in exons 11-15. We also identified two new microsatellite markers for the OCRL1 locus, and we detected a germline mosaicism in one family. This observation has direct implications for genetic counseling of Lowe syndrome families. PMID:10364518

  17. Colorectal Carcinomas With Isolated Loss of PMS2 Staining by Immunohistochemistry.

    PubMed

    Alpert, Lindsay; Pai, Reetesh K; Srivastava, Amitabh; McKinnon, Wendy; Wilcox, Rebecca; Yantiss, Rhonda K; Arcega, Ramir; Wang, Hanlin L; Robert, Marie E; Liu, Xiuli; Pai, Rish K; Zhao, Lei; Westerhoff, Maria; Hampel, Heather; Kupfer, Sonia; Setia, Namrata; Xiao, Shu-Yuan; Hart, John; Frankel, Wendy L

    2018-04-01

    - Isolated loss of PMS2 staining is an uncommon immunophenotype in colorectal carcinomas, accounting for approximately 4% of tumors with microsatellite instability. Limited information regarding these tumors is available in the literature. - To compare the clinicopathologic features of colorectal carcinomas with isolated PMS2 loss by immunohistochemistry to those with other forms of mismatch repair deficiency. - Ninety-three colorectal carcinomas with isolated PMS2 loss by immunohistochemistry and 193 with other forms of mismatch repair deficiency were identified. Forty (43%) of the isolated PMS2 loss cases and 35 control cases (18%) had a known germline mutation or a clinical diagnosis of Lynch syndrome. - Overall, isolated PMS2-loss tumors occurred in significantly younger patients ( P < .001) and in fewer female patients ( P = .006). These tumors were significantly less likely to be right-sided ( P = .001), high-grade ( P = .01), or display histologic features of microsatellite instability ( P < .001). The isolated PMS2-loss group also exhibited increased odds of disease-specific death (odds ratio [OR], 3.09; 95% CI, 1.41-6.85; P = .007). When the analysis was restricted to germline mutation/Lynch syndrome cases and controls, no significant differences were detected for age, sex, tumor location, tumor grade, histologic features, or distant metastases, although a trend toward increased odds of disease-specific death in the isolated PMS2-loss group was evident (OR, 3.87; 95% CI, 0.89-27.04; P = .10). - Unusual clinicopathologic features observed in colorectal carcinomas with isolated PMS2 loss are likely related to the high proportion of cases caused by germline mutations. Isolated PMS2-loss tumors may demonstrate more aggressive behavior than other tumors with microsatellite instability, but larger studies are needed to investigate that possibility further.

  18. Association of Germline CHEK2 Gene Variants with Risk and Prognosis of Non-Hodgkin Lymphoma

    PubMed Central

    Havranek, Ondrej; Kleiblova, Petra; Hojny, Jan; Lhota, Filip; Soucek, Pavel; Trneny, Marek; Kleibl, Zdenek

    2015-01-01

    The checkpoint kinase 2 gene (CHEK2) codes for the CHK2 protein, an important mediator of the DNA damage response pathway. The CHEK2 gene has been recognized as a multi-cancer susceptibility gene; however, its role in non-Hodgkin lymphoma (NHL) remains unclear. We performed mutation analysis of the entire CHEK2 coding sequence in 340 NHL patients using denaturing high-performance liquid chromatography (DHPLC) and multiplex ligation-dependent probe amplification (MLPA). Identified hereditary variants were genotyped in 445 non-cancer controls. The influence of CHEK2 variants on disease risk was statistically evaluated. Identified CHEK2 germline variants included four truncating mutations (found in five patients and no control; P = 0.02) and nine missense variants (found in 21 patients and 12 controls; P = 0.02). Carriers of non-synonymous variants had an increased risk of NHL development [odds ratio (OR) 2.86; 95% confidence interval (CI) 1.42–5.79] and an unfavorable prognosis [hazard ratio (HR) of progression-free survival (PFS) 2.1; 95% CI 1.12–4.05]. In contrast, the most frequent intronic variant c.319+43dupA (identified in 22% of patients and 31% of controls) was associated with a decreased NHL risk (OR = 0.62; 95% CI 0.45–0.86), but its positive prognostic effect was limited to NHL patients with diffuse large B-cell lymphoma (DLBCL) treated by conventional chemotherapy without rituximab (HR-PFS 0.4; 94% CI 0.17–0.74). Our results show that germ-line CHEK2 mutations affecting protein coding sequence confer a moderately-increased risk of NHL, they are associated with an unfavorable NHL prognosis, and they may represent a valuable predictive biomarker for patients with DLBCL. PMID:26506619

  19. Association of Germline CHEK2 Gene Variants with Risk and Prognosis of Non-Hodgkin Lymphoma.

    PubMed

    Havranek, Ondrej; Kleiblova, Petra; Hojny, Jan; Lhota, Filip; Soucek, Pavel; Trneny, Marek; Kleibl, Zdenek

    2015-01-01

    The checkpoint kinase 2 gene (CHEK2) codes for the CHK2 protein, an important mediator of the DNA damage response pathway. The CHEK2 gene has been recognized as a multi-cancer susceptibility gene; however, its role in non-Hodgkin lymphoma (NHL) remains unclear. We performed mutation analysis of the entire CHEK2 coding sequence in 340 NHL patients using denaturing high-performance liquid chromatography (DHPLC) and multiplex ligation-dependent probe amplification (MLPA). Identified hereditary variants were genotyped in 445 non-cancer controls. The influence of CHEK2 variants on disease risk was statistically evaluated. Identified CHEK2 germline variants included four truncating mutations (found in five patients and no control; P = 0.02) and nine missense variants (found in 21 patients and 12 controls; P = 0.02). Carriers of non-synonymous variants had an increased risk of NHL development [odds ratio (OR) 2.86; 95% confidence interval (CI) 1.42-5.79] and an unfavorable prognosis [hazard ratio (HR) of progression-free survival (PFS) 2.1; 95% CI 1.12-4.05]. In contrast, the most frequent intronic variant c.319+43dupA (identified in 22% of patients and 31% of controls) was associated with a decreased NHL risk (OR = 0.62; 95% CI 0.45-0.86), but its positive prognostic effect was limited to NHL patients with diffuse large B-cell lymphoma (DLBCL) treated by conventional chemotherapy without rituximab (HR-PFS 0.4; 94% CI 0.17-0.74). Our results show that germ-line CHEK2 mutations affecting protein coding sequence confer a moderately-increased risk of NHL, they are associated with an unfavorable NHL prognosis, and they may represent a valuable predictive biomarker for patients with DLBCL.

  20. Convergent mechanisms favor fast amyloid formation in two lambda 6a Ig light chain mutants.

    PubMed

    Valdés-García, Gilberto; Millán-Pacheco, César; Pastor, Nina

    2017-08-01

    Extracellular deposition as amyloids of immunoglobulin light chains causes light chain amyloidosis. Among the light chain families, lambda 6a is one of the most frequent in light chain amyloidosis patients. Its germline protein, 6aJL2, and point mutants, R24G and P7S, are good models to study fibrillogenesis, because their stability and fibril formation characteristics have been described. Both mutations make the germline protein unstable and speed up its ability to aggregate. To date, there is no molecular mechanism that explains how these differences in amyloidogenesis can arise from a single mutation. To look into the structural and dynamical differences in the native state of these proteins, we carried out molecular dynamics simulations at room temperature. Despite the structural similarity of the germline protein and the mutants, we found differences in their dynamical signatures that explain the mutants' increased tendency to form amyloids. The contact network alterations caused by the mutations, though different, converge in affecting two anti-aggregation motifs present in light chain variable domains, suggesting a different starting point for aggregation in lambda chains compared to kappa chains. © 2017 Wiley Periodicals, Inc.

  1. HIV-1 broadly neutralizing antibody precursor B cells revealed by germline-targeting immunogen

    DOE PAGES

    Jardine, Joseph G.; Kulp, Daniel W.; Havenar-Daughton, Colin; ...

    2016-03-25

    Induction of broadly neutralizing antibodies (bnAbs) is a major HIV vaccine goal. Germline-targeting immunogens aim to initiate bnAb induction by activating bnAb germline precursor B cells. Critical unmet challenges are to determine whether bnAb precursor naïve B cells bind germline-targeting immunogens and occur at sufficient frequency in humans for reliable vaccine responses. We employed deep mutational scanning and multi-target optimization to develop a germline-targeting immunogen (eOD-GT8) for diverse VRC01-class bnAbs. We then used the immunogen to isolate VRC01-class precursor naïve B cells from HIV-uninfected donors. Frequencies of true VRC01-class precursors, their structures, and their eOD-GT8 affinities support this immunogen asmore » a candidate human vaccine prime. Lastly, these methods could be applied to germline targeting for other classes of HIV bnAbs and for Abs to other pathogens.« less

  2. HIV-1 broadly neutralizing antibody precursor B cells revealed by germline-targeting immunogen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jardine, Joseph G.; Kulp, Daniel W.; Havenar-Daughton, Colin

    Induction of broadly neutralizing antibodies (bnAbs) is a major HIV vaccine goal. Germline-targeting immunogens aim to initiate bnAb induction by activating bnAb germline precursor B cells. Critical unmet challenges are to determine whether bnAb precursor naïve B cells bind germline-targeting immunogens and occur at sufficient frequency in humans for reliable vaccine responses. We employed deep mutational scanning and multi-target optimization to develop a germline-targeting immunogen (eOD-GT8) for diverse VRC01-class bnAbs. We then used the immunogen to isolate VRC01-class precursor naïve B cells from HIV-uninfected donors. Frequencies of true VRC01-class precursors, their structures, and their eOD-GT8 affinities support this immunogen asmore » a candidate human vaccine prime. Lastly, these methods could be applied to germline targeting for other classes of HIV bnAbs and for Abs to other pathogens.« less

  3. HIV-1 broadly neutralizing antibody precursor B cells revealed by germline-targeting immunogen.

    PubMed

    Jardine, Joseph G; Kulp, Daniel W; Havenar-Daughton, Colin; Sarkar, Anita; Briney, Bryan; Sok, Devin; Sesterhenn, Fabian; Ereño-Orbea, June; Kalyuzhniy, Oleksandr; Deresa, Isaiah; Hu, Xiaozhen; Spencer, Skye; Jones, Meaghan; Georgeson, Erik; Adachi, Yumiko; Kubitz, Michael; deCamp, Allan C; Julien, Jean-Philippe; Wilson, Ian A; Burton, Dennis R; Crotty, Shane; Schief, William R

    2016-03-25

    Induction of broadly neutralizing antibodies (bnAbs) is a major HIV vaccine goal. Germline-targeting immunogens aim to initiate bnAb induction by activating bnAb germline precursor B cells. Critical unmet challenges are to determine whether bnAb precursor naïve B cells bind germline-targeting immunogens and occur at sufficient frequency in humans for reliable vaccine responses. Using deep mutational scanning and multitarget optimization, we developed a germline-targeting immunogen (eOD-GT8) for diverse VRC01-class bnAbs. We then used the immunogen to isolate VRC01-class precursor naïve B cells from HIV-uninfected donors. Frequencies of true VRC01-class precursors, their structures, and their eOD-GT8 affinities support this immunogen as a candidate human vaccine prime. These methods could be applied to germline targeting for other classes of HIV bnAbs and for Abs to other pathogens. Copyright © 2016, American Association for the Advancement of Science.

  4. High penetrance of pheochromocytoma associated with the novel C634Y/Y791F double germline mutation in the RET protooncogene.

    PubMed

    Toledo, Rodrigo A; Wagner, Simona M; Coutinho, Flavia L; Lourenço, Delmar M; Azevedo, Juliana A; Longuini, Viviane C; Reis, Mariana T A; Siqueira, Sheila A C; Lucon, Antonio M; Tavares, Marcos R; Fragoso, Maria C B V; Pereira, Adelaide A; Dahia, Patricia L M; Mulligan, Lois M; Toledo, Sergio P A

    2010-03-01

    Previous studies have shown that double RET mutations may be associated with unusual multiple endocrine neoplasia type 2 (MEN 2) phenotypes. Our objective was to report the clinical features of patients harboring a previously unreported double mutation of the RET gene and to characterize this mutation in vitro. Sixteen patients from four unrelated families and harboring the C634Y/Y791F double RET germline mutation were included in the study. Large pheochromocytomas measuring 6.0-14 cm and weighing up to 640 g were identified in the four index cases. Three of the four tumors were bilateral. High penetrance of pheochromocytoma was also seen in the C634Y/Y791F-mutation-positive relatives (seven of nine, 77.7%). Of these, two cases had bilateral tumors, one presented with multifocal tumors, two cases had large tumors (>5 cm), and one case, which was diagnosed with a large (5.5 x 4.5 x 4.0 cm) pheochromocytoma, reported early onset of symptoms of the disease (14 yr old). The overall penetrance of pheochromocytoma was 84.6% (11 of 13). Development of medullary thyroid carcinoma in our patients seemed similar to that observed in patients with codon 634 mutations. Haplotype analysis demonstrated that the mutation did not arise from a common ancestor. In vitro studies showed the double C634Y/Y791F RET receptor was significantly more phosphorylated than either activated wild-type receptor or single C634Y and Y791F RET mutants. Our data suggest that the natural history of the novel C634Y/Y791F double mutation carries a codon 634-like pattern of medullary thyroid carcinoma development, is associated with increased susceptibility to unusually large bilateral pheochromocytomas, and is likely more biologically active than each individual mutation.

  5. MEN1 mutations and potentially MEN1-targeting miRNAs are responsible for menin deficiency in sporadic and MEN1 syndrome-associated primary hyperparathyroidism.

    PubMed

    Grolmusz, Vince Kornél; Borka, Katalin; Kövesdi, Annamária; Németh, Kinga; Balogh, Katalin; Dékány, Csaba; Kiss, András; Szentpéteri, Anna; Sármán, Beatrix; Somogyi, Anikó; Csajbók, Éva; Valkusz, Zsuzsanna; Tóth, Miklós; Igaz, Péter; Rácz, Károly; Patócs, Attila

    2017-09-01

    Inherited, germline mutations of menin-coding MEN1 gene cause multiple endocrine neoplasia type 1 (MEN1), while somatic MEN1 mutations are the sole main driver mutations in sporadic primary hyperparathyroidism (PHPT), suggesting that menin deficiency has a central role in the pathogenesis of PHPT. MiRNAs are small, noncoding RNAs posttranscriptionally regulating gene expression. Our aim was to investigate both the role of MEN1 mutations and potentially MEN1-targeting miRNAs as the underlying cause of menin deficiency in MEN1-associated and sporadic PHPT tissues. Fifty six PHPT tissues, including 16 MEN1-associated tissues, were evaluated. Diagnosis of MEN1 syndrome was based on identification of germline MEN1 mutations. In silico target prediction was used to identify miRNAs potentially targeting MEN1. Menin expression was determined by immunohistochemistry while expression of miRNAs was analyzed by quantitative real-time PCR. Sporadic PHPT tissues were subjected to somatic MEN1 mutation analysis as well. Lack of nuclear menin was identified in all MEN1-associated and in 28% of sporadic PHPT tissues. Somatic MEN1 mutations were found in 25% of sporadic PHPTs. The sensitivity and specificity of menin immunohistochemistry to detect a MEN1 mutation were 86 and 87%, respectively. Expression levels of hsa-miR-24 and hsa-miR-28 were higher in sporadic compared to MEN1-associated PHPT tissues; however, no difference in miRNA levels occurred between menin-positive and menin-negative PHPT tissues. Menin deficiency is the consequence of a MEN1 mutation in most menin-negative PHPT tissues. Elevated expression of hsa-miR-24 and hsa-miR-28 mark the first epigenetic changes observed between sporadic and MEN1-associated PHPT.

  6. A germline mutation of CDKN2A and a novel RPLP1-C19MC fusion detected in a rare melanotic neuroectodermal tumor of infancy: a case report.

    PubMed

    Barnes, David J; Hookway, Edward; Athanasou, Nick; Kashima, Takeshi; Oppermann, Udo; Hughes, Simon; Swan, Daniel; Lueerssen, Dietrich; Anson, John; Hassan, A Bassim

    2016-08-12

    Melanotic neuroectodermal tumor of infancy (MNTI) is exceptionally rare and occurs predominantly in the head and neck (92.8 % cases). The patient reported here is only the eighth case of MNTI presenting in an extremity, and the first reported in the fibula. A 2-month-old female presented with a mass arising in the fibula. Exhaustive genomic, transcriptomic, epigenetic and pathological characterization was performed on the excised primary tumor and a derived cell line. Whole-exome analysis of genomic DNA from both the tumor and blood indicated no somatic, non-synonymous coding mutations within the tumor, but a heterozygous, unique germline, loss of function mutation in CDKN2A (p16(INK4A), D74A). SNP-array CGH on DNA samples revealed the tumor to be euploid, with no detectable gene copy number variants. Multiple chromosomal translocations were identified by RNA-Seq, and fusion genes included RPLP1-C19MC, potentially deregulating the C19MC cluster, an imprinted locus containing microRNA genes reactivated by gene fusion in embryonal tumors with multilayered rosettes. Since the presumed cell of origin of MNTI is from the neural crest, we also compared gene expression with a dataset from human neural crest cells and identified 185 genes with significantly different expression. Consistent with the melanotic phenotype of the tumor, elevated expression of tyrosinase was observed. Other highly expressed genes encoded muscle proteins and modulators of the extracellular matrix. A derived MNTI cell line was sensitive to inhibitors of lysine demethylase, but not to compounds targeting other epigenetic regulators. In the absence of somatic copy number variations or mutations, the fully transformed phenotype of the MNTI may have arisen in infancy because of the combined effects of a germline CDKN2A mutation, tumor promoting somatic fusion genes and epigenetic deregulation. Very little is known about the etiology of MNTI and this report advances knowledge of these rare tumors by providing the first comprehensive genomic, transcriptomic and epigenetic characterization of a case.

  7. Cancer predisposition syndromes: lessons for truly precision medicine.

    PubMed

    Glaire, Mark A; Brown, Matthew; Church, David N; Tomlinson, Ian

    2017-01-01

    Cancer predisposition syndromes are typically uncommon, monogenic, high-penetrance disorders. Despite their rarity, they have proven to be highly clinically relevant in directing cancer prevention strategies. As such, they share notable similarities with an expanding class of low-frequency somatic mutations that are associated with a striking prognostic or predictive effect in the tumours in which they occur. In this review, we highlight these commonalities, with particular reference to mutations in the proofreading domain of replicative DNA polymerases. These molecular phenotypes may occur as either germline or somatic events, and in the latter case, have been shown to confer a favourable prognosis and potential increased benefit from immune checkpoint inhibition. We note that incorporation of these variants into clinical management algorithms will help refine patient management, and that this will be further improved by the inclusion of other germline variants, such as those that determine the likelihood of benefit or toxicity from anti-neoplastic therapy. Finally, we propose that such integrated patient and tumour profiling will be essential if we are to deliver truly precision medicine for cancer patients, but in a similar way to rare germline mutations, we must ensure that we identify and utilize rare somatic mutations with strong predictive and prognostic effects. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  8. Preventing the transmission of pathogenic mitochondrial DNA mutations: Can we achieve long-term benefits from germ-line gene transfer?

    PubMed

    Samuels, David C; Wonnapinij, Passorn; Chinnery, Patrick F

    2013-03-01

    Mitochondrial medicine is one of the few areas of genetic disease where germ-line transfer is being actively pursued as a treatment option. All of the germ-line transfer methods currently under development involve some carry-over of the maternal mitochondrial DNA (mtDNA) heteroplasmy, potentially delivering the pathogenic mutation to the offspring. Rapid changes in mtDNA heteroplasmy have been observed within a single generation, and so any 'leakage' of mutant mtDNA could lead to mtDNA disease in future generations, compromising the reproductive health of the first generation, and leading to repeated interventions in subsequent generations. To determine whether this is a real concern, we developed a model of mtDNA heteroplasmy inheritance by studying 87 mother-child pairs, and predicted the likely outcome of different levels of 'mutant mtDNA leakage' on subsequent maternal generations. This showed that, for a clinical threshold of 60%, reducing the proportion of mutant mtDNA to <5% dramatically reduces the chance of disease recurrence in subsequent generations, but transmitting >5% mutant mtDNA was associated with a significant chance of disease recurrence. Mutations with a lower clinical threshold were associated with a higher risk of recurrence. Our findings provide reassurance that, at least from an mtDNA perspective, methods currently under development have the potential to effectively eradicate pathogenic mtDNA mutations from subsequent generations.

  9. Clinical and Functional Analyses of p73R1 Mutations in Prostate Cancer

    DTIC Science & Technology

    2005-02-01

    mutations in several genes (BRCA 1, BRCA2, and CHEK2) whose products are involved in this pathway have been associated with increased risk for this...screened this gene for mutations in prostate cancer. Two germline truncating mutations were identified. Genotyping of 403 men with sporadic prostate...based on mutation screening of candidate genes involved in the DNA damage- signaling pathway. Genomic instability is a common feature of all human

  10. Li-Fraumeni syndrome presenting as mucosal melanoma: Case report and treatment considerations.

    PubMed

    Klein, Jonah D; Kupferman, Michael E

    2017-02-01

    Li-Fraumeni syndrome (LFS) is a familial cancer predisposition associated with a germline mutation in TP53. Patients with LFS are at risk of developing malignancies and require comprehensive screening. We describe an index case of LFS presenting with mucosal melanoma. A 21-year-old woman presented with a left maxillary mucosal lesion and a left neck mass. Biopsies revealed metastatic mucosal melanoma, which is a pathology previously unreported in LFS families. Genetic testing revealed LFS, with a germline TP53 mutation, and pedigree analysis identified 9 first-degree and second-degree relatives with hematologic malignancies. The patient underwent a maxillectomy and left neck dissection, followed by adjuvant radiotherapy. At 30-month follow-up, there was no evidence of local, regional, or distant failure, nor did she develop a second primary tumor. This represents the first reported case of LFS associated with mucosal melanoma. Treatment considerations, specifically the risks of adjuvant therapy in LFS, are discussed. © 2016 Wiley Periodicals, Inc. Head Neck 39: E20-E22, 2017. © 2016 Wiley Periodicals, Inc.

  11. Enhanced sensitivity for detection of low-level germline mosaic RB1 mutations in sporadic retinoblastoma cases using deep semiconductor sequencing.

    PubMed

    Chen, Zhao; Moran, Kimberly; Richards-Yutz, Jennifer; Toorens, Erik; Gerhart, Daniel; Ganguly, Tapan; Shields, Carol L; Ganguly, Arupa

    2014-03-01

    Sporadic retinoblastoma (RB) is caused by de novo mutations in the RB1 gene. Often, these mutations are present as mosaic mutations that cannot be detected by Sanger sequencing. Next-generation deep sequencing allows unambiguous detection of the mosaic mutations in lymphocyte DNA. Deep sequencing of the RB1 gene on lymphocyte DNA from 20 bilateral and 70 unilateral RB cases was performed, where Sanger sequencing excluded the presence of mutations. The individual exons of the RB1 gene from each sample were amplified, pooled, ligated to barcoded adapters, and sequenced using semiconductor sequencing on an Ion Torrent Personal Genome Machine. Six low-level mosaic mutations were identified in bilateral RB and four in unilateral RB cases. The incidence of low-level mosaic mutation was estimated to be 30% and 6%, respectively, in sporadic bilateral and unilateral RB cases, previously classified as mutation negative. The frequency of point mutations detectable in lymphocyte DNA increased from 96% to 97% for bilateral RB and from 13% to 18% for unilateral RB. The use of deep sequencing technology increased the sensitivity of the detection of low-level germline mosaic mutations in the RB1 gene. This finding has significant implications for improved clinical diagnosis, genetic counseling, surveillance, and management of RB. © 2013 WILEY PERIODICALS, INC.

  12. Cancer risks and survival in patients with multiple primary melanomas: Association with family history of melanoma and germline CDKN2A mutation status.

    PubMed

    Helgadottir, Hildur; Tuominen, Rainer; Olsson, Håkan; Hansson, Johan; Höiom, Veronica

    2017-11-01

    Worse outcomes have been noted in patients with multiple primary melanomas (MPMs) than in patients with single primary melanomas. We investigated how family history of melanoma and germline CDKN2A mutation status of MPM patients affects risks of developing subsequent melanomas and other cancers and survival outcomes. Comprehensive data on cancer diagnoses and deaths of MPM patients, their first-degree relatives, and matched controls were obtained through Swedish national health care and population registries. Familial MPM cases with germline CDKN2A mutations were youngest at the diagnosis of their second melanoma (median age 42 years) and had among the MPM cohorts the highest relative risks (RR) compared to controls of developing >2 melanomas (RR 238.4, 95% CI 74.8-759.9). CDKN2A mutated MPM cases and their first-degree relatives were the only cohorts with increased risks of nonskin cancers compared to controls (RR 3.6, 95% CI 1.9-147.1 and RR 3.2, 95% CI 1.9-5.6, respectively). In addition, CDKN2A mutated MPM cases had worse survival compared with both cases with familial (HR 3.0, 95% CI 1.3-8.1) and sporadic wild-type MPM (HR 2.63, 95% CI 1.3-5.4). Our study examined outcomes in subgroups of MPM patients, which affected the sample size of the study groups. This study demonstrates that CDKN2A mutation status and family history of melanoma significantly affects outcomes of MPM patients. Copyright © 2017 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  13. Pathologic findings in breast, fallopian tube, and ovary specimens in non-BRCA hereditary breast and/or ovarian cancer syndromes: a study of 18 patients with deleterious germline mutations in RAD51C, BARD1, BRIP1, PALB2, MUTYH, or CHEK2.

    PubMed

    Schoolmeester, J Kenneth; Moyer, Ann M; Goodenberger, McKinsey L; Keeney, Gary L; Carter, Jodi M; Bakkum-Gamez, Jamie N

    2017-12-01

    Germline BRCA mutations account for a significant proportion of genetic/familial risk of breast and ovarian cancer (GBOC) susceptibility, but a broader spectrum of GBOC susceptibility genes has emerged in recent years. Genotype-to-phenotype correlations are known for some established forms of GBOC; however, whether such correlations exist for less common GBOC variants is unclear. We reviewed our institution's experience with non-BRCA GBOC, looking specifically for trends in pathologic and clinical features. Eighteen women with deleterious germline mutations in RAD51C (5 patients), BARD1 (1 patient), BRIP1 (2 patients), PALB2 (3 patients), MUTYH (2 patients), or CHEK2 (5 patients) were identified between January 2011 and December 2016. Thirteen (72%) of 18 patients developed carcinoma of the breast, fallopian tube, or ovary, with 1 patient developing 2 separate primary neoplasms. Twelve (86%) of 14 tumors occurred in the breast. One (7%) arose in the fallopian tube and another (7%) arose in the ovary. Evidence of genotype-phenotype correlation was not identified. However, some data suggest that the type of alteration in select genes may influence tumor behavior and patient outcome. In our PALB2 mutation cohort, 2 patients with frameshift mutations led to early onset and rapid progression to stage IV breast cancer in contrast to stage IA breast cancer in 1 patient with a nonsense mutation. Despite no apparent genotype-phenotype trends, our data indicate that some loss-of-function variants in PALB2 may lead to differences in tumor behavior and patient outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Hybrid Capture-Based Tumor Sequencing and Copy Number Analysis to Confirm Origin of Metachronous Metastases in BRCA1-Mutant Cholangiocarcinoma Harboring a Novel YWHAZ-BRAF Fusion.

    PubMed

    Lim, Huat C; Montesion, Meagan; Botton, Thomas; Collisson, Eric A; Umetsu, Sarah E; Behr, Spencer C; Gordan, John D; Stephens, Phil J; Kelley, Robin K

    2018-04-05

    Biliary tract cancers such as cholangiocarcinoma represent a heterogeneous group of cancers that can be difficult to diagnose. Recent comprehensive genomic analyses in large cholangiocarcinoma cohorts have defined important molecular subgroups within cholangiocarcinoma that may relate to anatomic location and etiology [1-4] and may predict responsiveness to targeted therapies in development [5-7]. These emerging data highlight the potential for tumor genomics to inform diagnosis and treatment options in this challenging tumor type. We report the case of a patient with a germline BRCA1 mutation who presented with a cholangiocarcinoma driven by the novel YWHAZ-BRAF fusion. Hybrid capture-based DNA sequencing and copy number analysis performed as part of clinical care demonstrated that two later-occurring tumors were clonally derived from the primary cholangiocarcinoma rather than distinct new primaries, revealing an unusual pattern of late metachronous metastasis. We discuss the clinical significance of these genetic alterations and their relevance to therapeutic strategies. Hybrid capture-based next-generation DNA sequencing assays can provide diagnostic clarity in patients with unusual patterns of metastasis and recurrence in which the pathologic diagnosis is ambiguous.To our knowledge, this is the first reported case of a YWHAZ-BRAF fusion in pancreaticobiliary cancer, and a very rare case of cholangiocarcinoma in the setting of a germline BRCA1 mutation.The patient's BRCA1 mutation and YWHAZ-BRAF fusion constitute potential targets for future therapy. © AlphaMed Press 2018.

  15. De novo constitutional MLH1 epimutations confer early-onset colorectal cancer in two new sporadic Lynch syndrome cases, with derivation of the epimutation on the paternal allele in one.

    PubMed

    Goel, Ajay; Nguyen, Thuy-Phuong; Leung, Hon-Chiu E; Nagasaka, Takeshi; Rhees, Jennifer; Hotchkiss, Erin; Arnold, Mildred; Banerji, Pia; Koi, Minoru; Kwok, Chau-To; Packham, Deborah; Lipton, Lara; Boland, C Richard; Ward, Robyn L; Hitchins, Megan P

    2011-02-15

    Lynch syndrome is an autosomal dominant cancer predisposition syndrome classically caused by germline mutations of the mismatch repair genes, MLH1, MSH2, MSH6 and PMS2. Constitutional epimutations of the MLH1 gene, characterized by soma-wide methylation of a single allele of the promoter and allelic transcriptional silencing, have been identified in a subset of Lynch syndrome cases lacking a sequence mutation in MLH1. We report two individuals with no family history of colorectal cancer who developed that disease at age 18 and 20 years. In both cases, cancer had arisen because of the de novo occurrence of a constitutional MLH1 epimutation and somatic loss-of-heterozygosity of the functional allele in the tumors. We show for the first time that the epimutation in one case arose on the paternally inherited allele. Analysis of 13 tumors from seven individuals with constitutional MLH1 epimutations showed eight tumors had lost the second MLH1 allele, two tumors had a novel pathogenic missense mutation and three had retained heterozygosity. Only 1 of 12 tumors demonstrated the BRAF V600E mutation and 3 of 11 tumors harbored a mutation in KRAS. The finding that epimutations can originate on the paternal allele provides important new insights into the mechanism of origin of epimutations. It is clear that the second hit in MLH1 epimutation-associated tumors typically has a genetic not epigenetic basis. Individuals with mismatch repair-deficient cancers without the BRAF V600E mutation are candidates for germline screening for sequence or methylation changes in MLH1. Copyright © 2010 UICC.

  16. De novo constitutional MLH1 epimutations confer early-onset colorectal cancer in two new sporadic Lynch syndrome cases, with derivation of the epimutation on the paternal allele in one

    PubMed Central

    Goel, Ajay; Nguyen, Thuy-Phuong; Leung, Hon-Chiu E.; Nagasaka, Takeshi; Rhees, Jennifer; Hotchkiss, Erin; Arnold, Mildred; Banerji, Pia; Koi, Minoru; Kwok, Chau-To; Packham, Deborah; Lipton, Lara; Boland, C. Richard; Ward, Robyn L.; Hitchins, Megan P.

    2013-01-01

    Lynch syndrome is an autosomal dominant cancer predisposition syndrome classically caused by germline mutations of the mismatch repair genes, MLH1, MSH2, MSH6 and PMS2. Constitutional epimutations of the MLH1 gene, characterized by soma-wide methylation of a single allele of the promoter and allelic transcriptional silencing, have been identified in a subset of Lynch syndrome cases lacking a sequence mutation in MLH1. We report two individuals with no family history of colorectal cancer who developed that disease at age 18 and 20 years. In both cases, cancer had arisen because of the de novo occurrence of a constitutional MLH1 epimutation and somatic loss-of-heterozygosity of the functional allele in the tumors. We show for the first time that the epimutation in one case arose on the paternally inherited allele. Analysis of 13 tumors from seven individuals with constitutional MLH1 epimutations showed eight tumors had lost the second MLH1 allele, two tumors had a novel pathogenic missense mutation and three had retained heterozygosity. Only 1 of 12 tumors demonstrated the BRAF V600E mutation and 3 of 11 tumors harbored a mutation in KRAS. The finding that epimutations can originate on the paternal allele provides important new insights into the mechanism of origin of epimutations. It is clear that the second hit in MLH1 epimutation-associated tumors typically has a genetic not epigenetic basis. Individuals with mismatch repair–deficient cancers without the BRAF V600E mutation are candidates for germline screening for sequence or methylation changes in MLH1. PMID:20473912

  17. Carboplatin in BRCA1/2-mutated and triple-negative breast cancer BRCAness subgroups: the TNT Trial.

    PubMed

    Tutt, Andrew; Tovey, Holly; Cheang, Maggie Chon U; Kernaghan, Sarah; Kilburn, Lucy; Gazinska, Patrycja; Owen, Julie; Abraham, Jacinta; Barrett, Sophie; Barrett-Lee, Peter; Brown, Robert; Chan, Stephen; Dowsett, Mitchell; Flanagan, James M; Fox, Lisa; Grigoriadis, Anita; Gutin, Alexander; Harper-Wynne, Catherine; Hatton, Matthew Q; Hoadley, Katherine A; Parikh, Jyoti; Parker, Peter; Perou, Charles M; Roylance, Rebecca; Shah, Vandna; Shaw, Adam; Smith, Ian E; Timms, Kirsten M; Wardley, Andrew M; Wilson, Gregory; Gillett, Cheryl; Lanchbury, Jerry S; Ashworth, Alan; Rahman, Nazneen; Harries, Mark; Ellis, Paul; Pinder, Sarah E; Bliss, Judith M

    2018-05-01

    Germline mutations in BRCA1/2 predispose individuals to breast cancer (termed germline-mutated BRCA1/2 breast cancer, gBRCA-BC) by impairing homologous recombination (HR) and causing genomic instability. HR also repairs DNA lesions caused by platinum agents and PARP inhibitors. Triple-negative breast cancers (TNBCs) harbor subpopulations with BRCA1/2 mutations, hypothesized to be especially platinum-sensitive. Cancers in putative 'BRCAness' subgroups-tumors with BRCA1 methylation; low levels of BRCA1 mRNA (BRCA1 mRNA-low); or mutational signatures for HR deficiency and those with basal phenotypes-may also be sensitive to platinum. We assessed the efficacy of carboplatin and another mechanistically distinct therapy, docetaxel, in a phase 3 trial in subjects with unselected advanced TNBC. A prespecified protocol enabled biomarker-treatment interaction analyses in gBRCA-BC and BRCAness subgroups. The primary endpoint was objective response rate (ORR). In the unselected population (376 subjects; 188 carboplatin, 188 docetaxel), carboplatin was not more active than docetaxel (ORR, 31.4% versus 34.0%, respectively; P = 0.66). In contrast, in subjects with gBRCA-BC, carboplatin had double the ORR of docetaxel (68% versus 33%, respectively; biomarker, treatment interaction P = 0.01). Such benefit was not observed for subjects with BRCA1 methylation, BRCA1 mRNA-low tumors or a high score in a Myriad HRD assay. Significant interaction between treatment and the basal-like subtype was driven by high docetaxel response in the nonbasal subgroup. We conclude that patients with advanced TNBC benefit from characterization of BRCA1/2 mutations, but not BRCA1 methylation or Myriad HRD analyses, to inform choices on platinum-based chemotherapy. Additionally, gene expression analysis of basal-like cancers may also influence treatment selection.

  18. Risk Profile of the RET A883F Germline Mutation: An International Collaborative Study.

    PubMed

    Mathiesen, Jes Sloth; Habra, Mouhammed Amir; Bassett, John Howard Duncan; Choudhury, Sirazum Mubin; Balasubramanian, Sabapathy Prakash; Howlett, Trevor A; Robinson, Bruce G; Gimenez-Roqueplo, Anne-Paule; Castinetti, Frederic; Vestergaard, Peter; Frank-Raue, Karin

    2017-06-01

    The A883F germline mutation of the rearranged during transfection (RET) proto-oncogene causes multiple endocrine neoplasia 2B. In the revised American Thyroid Association (ATA) guidelines for the management of medullary thyroid carcinoma (MTC), the A883F mutation has been reclassified from the highest to the high-risk level, although no well-defined risk profile for this mutation exists. To create a risk profile for the A883F mutation for appropriate classification among the ATA risk levels. Retrospective analysis. International collaboration. Included were 13 A883F carriers. The intervention was thyroidectomy. Earliest age of MTC, regional lymph node metastases, distant metastases, age-related penetrance of MTC and pheochromocytoma (PHEO), overall and disease-specific survival, and biochemical cure rate. One and three carriers were diagnosed at age 7 to 9 years (median, 7.5 years) with a normal thyroid and C-cell hyperplasia, respectively. Nine carriers were diagnosed with MTC at age 10 to 39 years (median, 19 years). The earliest age of MTC, regional lymph node metastasis, and distant metastasis was 10, 20, and 20 years, respectively. Fifty percent penetrance of MTC and PHEO was achieved by age 19 and 34 years, respectively. Five- and 10-year survival rates (both overall and disease specific) were 88% and 88%, respectively. Biochemical cure for MTC at latest follow-up was achieved in 63% (five of eight carriers) with pertinent data. MTC of A883F carriers seems to have a more indolent natural course compared with that of M918T carriers. Our results support the classification of the A883F mutation in the ATA high-risk level. Copyright © 2017 Endocrine Society

  19. Pituitary Adenoma With Paraganglioma/Pheochromocytoma (3PAs) and Succinate Dehydrogenase Defects in Humans and Mice

    PubMed Central

    Xekouki, Paraskevi; Szarek, Eva; Bullova, Petra; Giubellino, Alessio; Quezado, Martha; Mastroyannis, Spyridon A.; Mastorakos, Panagiotis; Wassif, Christopher A.; Raygada, Margarita; Rentia, Nadia; Dye, Louis; Cougnoux, Antony; Koziol, Deloris; Sierra, Maria de La Luz; Lyssikatos, Charalampos; Belyavskaya, Elena; Malchoff, Carl; Moline, Jessica; Eng, Charis; Maher, Louis James; Pacak, Karel; Lodish, Maya

    2015-01-01

    Context: Germline mutations in genes coding succinate dehydrogenase (SDH) subunits A, B, C, and D have been identified in familial paragangliomas (PGLs)/pheochromocytomas (PHEOs) and other tumors. We described a GH-secreting pituitary adenoma (PA) caused by SDHD mutation in a patient with familial PGLs. Additional patients with PAs and SDHx defects have since been reported. Design: We studied 168 patients with unselected sporadic PA and with the association of PAs, PGLs, and/or pheochromocytomas, a condition we named the 3P association (3PAs) for SDHx germline mutations. We also studied the pituitary gland and hormonal profile of Sdhb+/− mice and their wild-type littermates at different ages. Results: No SDHx mutations were detected among sporadic PA, whereas three of four familial cases were positive for a mutation (75%). Most of the SDHx-deficient PAs were either prolactinomas or somatotropinomas. Pituitaries of Sdhb+/− mice older than 12 months had an increased number mainly of prolactin-secreting cells and several ultrastructural abnormalities such as intranuclear inclusions, altered chromatin nuclear pattern, and abnormal mitochondria. Igf-1 levels of mutant mice tended to be higher across age groups, whereas Prl and Gh levels varied according to age and sex. Conclusion: The present study confirms the existence of a new association that we termed 3PAs. It is due mostly to germline SDHx defects, although sporadic cases of 3PAs without SDHx defects also exist. Using Sdhb+/− mice, we provide evidence that pituitary hyperplasia in SDHx-deficient cells may be the initial abnormality in the cascade of events leading to PA formation. PMID:25695889

  20. Two Siblings With a CDKL5 Mutation: Genotype and Phenotype Evaluation.

    PubMed

    Hagebeuk, Eveline E O; Marcelis, Carlo L; Alders, Mariëlle; Kaspers, Ageeth; de Weerd, Al W

    2015-10-01

    This is the second report of a family with a recurrence of a CDKL5 mutation (c. 283-3_290del) in 2 sisters. Both parents tested negative for the mutation in all tissues, but germline mosaicism is likely. Clinically CDKL5 patients resemble those with Rett syndrome, caused by a MECP2 mutation, who experience a regression, after an initial normal development. Even though both siblings showed a typical CDKL5 phenotype, their presentation is different. From birth, the oldest daughter had a severe developmental delay, feeding problems, and hypotonia and experienced daily refractory seizures. The youngest daughter appeared to be normal until age 3 months. At that age seizures started, deterioration and regression became evident, and an epileptic encephalopathy developed. This report of familial recurrence, with suspected germline mosaicism in a healthy parent, has important consequences for genetic counseling. Although it is not possible to predict an exact recurrence risk, it is likely to be increased. © The Author(s) 2015.

  1. Role of framework mutations and antibody flexibility in the evolution of broadly neutralizing antibodies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ovchinnikov, Victor; Louveau, Joy E.; Barton, John P.

    Eliciting antibodies that are cross reactive with surface proteins of diverse strains of highly mutable pathogens (e.g., HIV, influenza) could be key for developing effective universal vaccines. Mutations in the framework regions of such broadly neutralizing antibodies (bnAbs) have been reported to play a role in determining their properties. We used molecular dynamics simulations and models of affinity maturation to study specific bnAbs against HIV. Our results suggest that there are different classes of evolutionary lineages for the bnAbs. If germline B cells that initiate affinity maturation have high affinity for the conserved residues of the targeted epitope, framework mutationsmore » increase antibody rigidity as affinity maturation progresses to evolve bnAbs. If the germline B cells exhibit weak/moderate affinity for conserved residues, an initial increase in flexibility via framework mutations may be required for the evolution of bnAbs. Subsequent mutations that increase rigidity result in highly potent bnAbs. Implications of our results for immunogen design are discussed.« less

  2. Rare splicing defects of FAS underly severe recessive autoimmune lymphoproliferative syndrome.

    PubMed

    Agrebi, N; Ben-Mustapha, I; Matoussi, N; Dhouib, N; Ben-Ali, M; Mekki, N; Ben-Ahmed, M; Larguèche, B; Ben Becher, S; Béjaoui, M; Barbouche, M R

    2017-10-01

    Autoimmune lymphoproliferative syndrome (ALPS) is a prototypic disorder of impaired apoptosis characterized by autoimmune features and lymphoproliferation. Heterozygous germline or somatic FAS mutations associated with preserved protein expression have been described. Very rare cases of homozygous germline FAS mutations causing severe autosomal recessive form of ALPS with a complete defect of Fas expression have been reported. We report two unrelated patients from highly inbred North African population showing a severe ALPS phenotype and an undetectable Fas surface expression. Two novel homozygous mutations have been identified underlying rare splicing defects mechanisms. The first mutation breaks a branch point sequence and the second alters a regulatory exonic splicing site. These splicing defects induce the skipping of exon 6 encoding the transmembrane domain of CD95. Our findings highlight the requirement of tight regulation of FAS exon 6 splicing for balanced alternative splicing and illustrate the importance of such studies in highly consanguineous populations. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Role of framework mutations and antibody flexibility in the evolution of broadly neutralizing antibodies

    DOE PAGES

    Ovchinnikov, Victor; Louveau, Joy E.; Barton, John P.; ...

    2018-02-14

    Eliciting antibodies that are cross reactive with surface proteins of diverse strains of highly mutable pathogens (e.g., HIV, influenza) could be key for developing effective universal vaccines. Mutations in the framework regions of such broadly neutralizing antibodies (bnAbs) have been reported to play a role in determining their properties. We used molecular dynamics simulations and models of affinity maturation to study specific bnAbs against HIV. Our results suggest that there are different classes of evolutionary lineages for the bnAbs. If germline B cells that initiate affinity maturation have high affinity for the conserved residues of the targeted epitope, framework mutationsmore » increase antibody rigidity as affinity maturation progresses to evolve bnAbs. If the germline B cells exhibit weak/moderate affinity for conserved residues, an initial increase in flexibility via framework mutations may be required for the evolution of bnAbs. Subsequent mutations that increase rigidity result in highly potent bnAbs. Implications of our results for immunogen design are discussed.« less

  4. Linking uterine serous carcinoma to BRCA1/2-associated cancer syndrome: A meta-analysis and case report.

    PubMed

    de Jonge, M M; Mooyaart, A L; Vreeswijk, M P G; de Kroon, C D; van Wezel, T; van Asperen, C J; Smit, V T H B M; Dekkers, O M; Bosse, T

    2017-02-01

    Uterine serous carcinoma (USC) shows greater morphological, clinical and molecular similarities to high-grade ovarian tubal serous carcinoma than to other types of endometrial cancer. As high-grade ovarian tubal serous carcinoma is known to be associated with BRCA1/2 pathogenic germline mutations (PMs), we aimed to explore whether USC is also a constituent of hereditary breast and ovarian cancer syndrome. Pubmed, EMBASE and Web of Science were searched in July 2016 for articles assessing the association between USC and germline BRCA1/2-PMs. Pooled analysis and comparisons were performed using a random effects logistic model, stratifying for ethnicity (Ashkenazi versus non-Ashkenazi). In addition, tumour tissue from an USC case with a hereditary BRCA1-PM was analysed for loss of heterozygosity at the BRCA1 locus and was functionally analysed for homologous recombination proficiency. The search yielded 1893 citations, 10 studies were included describing 345 USC patients. For Ashkenazi Jews, the pooled odds ratio of having a germline BRCA1/2-PM was increased in USC patients compared with the general Ashkenazi population: odds ratio 5.4 (95%confidence interval: 2.2-13.1). In the patient with USC, we identified the known germline BRCA1-PM in the tumour DNA. Furthermore, we showed both loss of heterozygosity of the wild-type allele and a deficiency of homologous recombination. This study suggests that USC may be an overlooked component of BRCA1/2-associated hereditary breast and ovarian cancer syndrome. Screening for germline BRCA1/2-PMs should be considered in patients diagnosed with USC, especially in cases with a positive first-degree family history for breast and/or ovarian cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. A Recurrent Germline Mutation in the 5'UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation.

    PubMed

    Hornig, Nadine C; de Beaufort, Carine; Denzer, Friederike; Cools, Martine; Wabitsch, Martin; Ukat, Martin; Kulle, Alexandra E; Schweikert, Hans-Udo; Werner, Ralf; Hiort, Olaf; Audi, Laura; Siebert, Reiner; Ammerpohl, Ole; Holterhus, Paul-Martin

    2016-01-01

    A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS) generating an upstream open reading frame (uORF) in the 5' untranslated region (5'-UTR) of the androgen receptor (AR) gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5'UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5'UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general.

  6. A Recurrent Germline Mutation in the 5’UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation

    PubMed Central

    Hornig, Nadine C.; de Beaufort, Carine; Denzer, Friederike; Cools, Martine; Wabitsch, Martin; Ukat, Martin; Kulle, Alexandra E.; Schweikert, Hans-Udo; Werner, Ralf; Hiort, Olaf; Audi, Laura; Siebert, Reiner; Ammerpohl, Ole; Holterhus, Paul-Martin

    2016-01-01

    A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS) generating an upstream open reading frame (uORF) in the 5’ untranslated region (5’-UTR) of the androgen receptor (AR) gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5′UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5′UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general. PMID:27110943

  7. De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes

    PubMed Central

    Rivière, Jean-Baptiste; Mirzaa, Ghayda M.; O’Roak, Brian J.; Beddaoui, Margaret; Alcantara, Diana; Conway, Robert L.; St-Onge, Judith; Schwartzentruber, Jeremy A.; Gripp, Karen W.; Nikkel, Sarah M.; Worthylake, Thea; Sullivan, Christopher T.; Ward, Thomas R.; Butler, Hailly E.; Kramer, Nancy A.; Albrecht, Beate; Armour, Christine M.; Armstrong, Linlea; Caluseriu, Oana; Cytrynbaum, Cheryl; Drolet, Beth A.; Innes, A. Micheil; Lauzon, Julie L.; Lin, Angela E.; Mancini, Grazia M. S.; Meschino, Wendy S.; Reggin, James D.; Saggar, Anand K.; Lerman-Sagie, Tally; Uyanik, Gökhan; Weksberg, Rosanna; Zirn, Birgit; Beaulieu, Chandree L.; Majewski, Jacek; Bulman, Dennis E.; O’Driscoll, Mark; Shendure, Jay; Graham, John M.; Boycott, Kym M.; Dobyns, William B.

    2012-01-01

    Megalencephaly-capillary malformation (MCAP) and megalencephaly-polymicrogyria-polydactyly-hydrocephalus (MPPH) syndromes are sporadic overgrowth disorders associated with markedly enlarged brain size and other recognizable features1-5. We performed exome sequencing in three families with MCAP or MPPH and confirmed our initial observations in exomes from 7 MCAP and 174 control individuals, as well as in 40 additional megalencephaly subjects using a combination of Sanger sequencing, restriction-enzyme assays, and targeted deep sequencing. We identified de novo germline or postzygotic mutations in three core components of the phosphatidylinositol-3-kinase (PI3K)/AKT pathway. These include two mutations of AKT3, one recurrent mutation of PIK3R2 in 11 unrelated MPPH families, and 15 mostly postzygotic mutations of PIK3CA in 23 MCAP and one MPPH patients. Our data highlight the central role of PI3K/AKT signaling in vascular, limb and brain development, and emphasize the power of massively parallel sequencing in a challenging context of phenotypic and genetic heterogeneity combined with postzygotic mosaicism. PMID:22729224

  8. Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

    PubMed

    Donehower, Lawrence A

    2014-06-01

    Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.

  9. Mouse mutants from chemically mutagenized embryonic stem cells

    PubMed Central

    Munroe, Robert J.; Bergstrom, Rebecca A.; Zheng, Qing Yin; Libby, Brian; Smith, Richard; John, Simon W.M.; Schimenti, Kerry J.; Browning, Victoria L.; Schimenti, John C.

    2010-01-01

    The drive to characterize functions of human genes on a global scale has stimulated interest in large-scale generation of mouse mutants. Conventional germ-cell mutagenesis with N-ethyl-N-nitrosourea (ENU) is compromised by an inability to monitor mutation efficiency, strain1 and interlocus2 variation in mutation induction, and extensive husbandry requirements. To overcome these obstacles and develop new methods for generating mouse mutants, we devised protocols to generate germline chi-maeric mice from embryonic stem (ES) cells heavily mutagenized with ethylmethanesulphonate (EMS). Germline chimaeras were derived from cultures that underwent a mutation rate of up to 1 in 1,200 at the Hprt locus (encoding hypoxanthine guanine phosphoribosyl transferase). The spectrum of mutations induced by EMS and the frameshift mutagen ICR191 was consistent with that observed in other mammalian cells. Chimaeras derived from ES cells treated with EMS transmitted mutations affecting several processes, including limb development, hair growth, hearing and gametogenesis. This technology affords several advantages over traditional mutagenesis, including the ability to conduct shortened breeding schemes and to screen for mutant phenotypes directly in ES cells or their differentiated derivatives. PMID:10700192

  10. De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes.

    PubMed

    Rivière, Jean-Baptiste; Mirzaa, Ghayda M; O'Roak, Brian J; Beddaoui, Margaret; Alcantara, Diana; Conway, Robert L; St-Onge, Judith; Schwartzentruber, Jeremy A; Gripp, Karen W; Nikkel, Sarah M; Worthylake, Thea; Sullivan, Christopher T; Ward, Thomas R; Butler, Hailly E; Kramer, Nancy A; Albrecht, Beate; Armour, Christine M; Armstrong, Linlea; Caluseriu, Oana; Cytrynbaum, Cheryl; Drolet, Beth A; Innes, A Micheil; Lauzon, Julie L; Lin, Angela E; Mancini, Grazia M S; Meschino, Wendy S; Reggin, James D; Saggar, Anand K; Lerman-Sagie, Tally; Uyanik, Gökhan; Weksberg, Rosanna; Zirn, Birgit; Beaulieu, Chandree L; Majewski, Jacek; Bulman, Dennis E; O'Driscoll, Mark; Shendure, Jay; Graham, John M; Boycott, Kym M; Dobyns, William B

    2012-06-24

    Megalencephaly-capillary malformation (MCAP) and megalencephaly-polymicrogyria-polydactyly-hydrocephalus (MPPH) syndromes are sporadic overgrowth disorders associated with markedly enlarged brain size and other recognizable features. We performed exome sequencing in 3 families with MCAP or MPPH, and our initial observations were confirmed in exomes from 7 individuals with MCAP and 174 control individuals, as well as in 40 additional subjects with megalencephaly, using a combination of Sanger sequencing, restriction enzyme assays and targeted deep sequencing. We identified de novo germline or postzygotic mutations in three core components of the phosphatidylinositol 3-kinase (PI3K)-AKT pathway. These include 2 mutations in AKT3, 1 recurrent mutation in PIK3R2 in 11 unrelated families with MPPH and 15 mostly postzygotic mutations in PIK3CA in 23 individuals with MCAP and 1 with MPPH. Our data highlight the central role of PI3K-AKT signaling in vascular, limb and brain development and emphasize the power of massively parallel sequencing in a challenging context of phenotypic and genetic heterogeneity combined with postzygotic mosaicism.

  11. Worldwide Practice Patterns in Lynch Syndrome Diagnosis and Management, Based on Data From the International Mismatch Repair Consortium.

    PubMed

    Pan, Jennifer Y; Haile, Robert W; Templeton, Allyson; Macrae, Finlay; Qin, FeiFei; Sundaram, Vandana; Ladabaum, Uri

    2018-04-24

    Families with a history of Lynch syndrome often do not adhere to guidelines for genetic testing and screening. We investigated practice patterns related to Lynch syndrome worldwide, to ascertain potential targets for research and public policy efforts. We collected data from the International Mismatch Repair Consortium (IMRC), which comprises major research and clinical groups engaged in the care of families with Lynch syndrome worldwide. IMRC institutions were invited to complete a questionnaire to characterize diagnoses of Lynch syndrome and management practice patterns. Fifty-five providers, representing 63 of 128 member institutions (49%) in 21 countries, completed the questionnaire. For case finding, 55% of respondents reported participating in routine widespread population tumor testing among persons with newly diagnosed Lynch syndrome-associated cancers, whereas 27% reported relying on clinical criteria with selective tumor and/or germline analyses. Most respondents (64%) reported using multigene panels for germline analysis, and only 28% reported testing tumors for biallelic mutations for cases in which suspected pathogenic mutations were not confirmed by germline analysis. Respondents reported relying on passive dissemination of information to at-risk family members, and there was variation in follow through of genetic testing recommendations. Reported risk management practices varied-nearly all programs (98%) recommended colonoscopy every 1 to 2 years, but only 35% recommended chemoprevention with aspirin. There is widespread heterogeneity in management practices for Lynch syndrome worldwide among IMRC member institutions. This may reflect the rapid pace of emerging technology, regional differences in resources, and the lack of definitive data for many clinical questions. Future efforts should focus on the large numbers of high-risk patients without access to state-of-the-art Lynch syndrome management. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

  12. Epithelioid Malignant Peripheral Nerve Sheath Tumor Arising in a Schwannoma, in a Patient with “Neuroblastoma-like” Schwannomatosis and a Novel Germline SMARCB1 mutation

    PubMed Central

    Carter, Jodi M.; O'Hara, Carolyn; Dundas, George; Gilchrist, Dawna; Collins, Mark S.; Eaton, Katherine; Judkins, Alexander R.; Biegel, Jaclyn A.; Folpe, Andrew L.

    2011-01-01

    Epithelioid malignant peripheral nerve sheath tumors arising in pre-existing schwannomas are extremely rare. We report an unusual example occurring in a patient with multiple schwannomas (schwannomatosis), all but one of which showed “neuroblastoma-like” histology. By immunohistochemistry, both the epithelioid malignant peripheral nerve sheath tumor and the schwannomas showed a complete loss of the Smarcb1 protein. Subsequent genetic evaluation revealed the presence of a novel germline mutation in the SMARCB1/INI1 gene in the patient and three of her children, two of whom were diagnosed with atypical teratoid/rhabdoid tumors of the brain. PMID:22082606

  13. Screening for germline BRCA1, BRCA2, TP53 and CHEK2 mutations in families at-risk for hereditary breast cancer identified in a population-based study from Southern Brazil

    PubMed Central

    Palmero, Edenir Inêz; Alemar, Bárbara; Schüler-Faccini, Lavínia; Hainaut, Pierre; Moreira-Filho, Carlos Alberto; Ewald, Ingrid Petroni; dos Santos, Patricia Koehler; Ribeiro, Patricia Lisbôa Izetti; de Oliveira, Cristina Brinkmann; Kelm, Florence Le Calvez; Tavtigian, Sean; Cossio, Silvia Liliana; Giugliani, Roberto; Caleffi, Maira; Ashton-Prolla, Patricia

    2016-01-01

    Abstract In Brazil, breast cancer is a public health care problem due to its high incidence and mortality rates. In this study, we investigated the prevalence of hereditary breast cancer syndromes (HBCS) in a population-based cohort in Brazils southernmost capital, Porto Alegre. All participants answered a questionnaire about family history (FH) of breast, ovarian and colorectal cancer and those with a positive FH were invited for genetic cancer risk assessment (GCRA). If pedigree analysis was suggestive of HBCS, genetic testing of the BRCA1, BRCA2, TP53, and CHEK2 genes was offered. Of 902 women submitted to GCRA, 214 had pedigrees suggestive of HBCS. Fifty of them underwent genetic testing: 18 and 40 for BRCA1/BRCA2 and TP53 mutation screening, respectively, and 7 for CHEK2 1100delC testing. A deleterious BRCA2 mutation was identified in one of the HBOC probands and the CHEK2 1100delC mutation occurred in one of the HBCC families. No deleterious germline alterations were identified in BRCA1 or TP53. Although strict inclusion criteria and a comprehensive testing approach were used, the suspected genetic risk in these families remains unexplained. Further studies in a larger cohort are necessary to better understand the genetic component of hereditary breast cancer in Southern Brazil. PMID:27223485

  14. The Fanconi anemia DNA damage repair pathway in the spotlight for germline predisposition to colorectal cancer.

    PubMed

    Esteban-Jurado, Clara; Franch-Expósito, Sebastià; Muñoz, Jenifer; Ocaña, Teresa; Carballal, Sabela; López-Cerón, Maria; Cuatrecasas, Miriam; Vila-Casadesús, Maria; Lozano, Juan José; Serra, Enric; Beltran, Sergi; Brea-Fernández, Alejandro; Ruiz-Ponte, Clara; Castells, Antoni; Bujanda, Luis; Garre, Pilar; Caldés, Trinidad; Cubiella, Joaquín; Balaguer, Francesc; Castellví-Bel, Sergi

    2016-10-01

    Colorectal cancer (CRC) is one of the most common neoplasms in the world. Fanconi anemia (FA) is a very rare genetic disease causing bone marrow failure, congenital growth abnormalities and cancer predisposition. The comprehensive FA DNA damage repair pathway requires the collaboration of 53 proteins and it is necessary to restore genome integrity by efficiently repairing damaged DNA. A link between FA genes in breast and ovarian cancer germline predisposition has been previously suggested. We selected 74 CRC patients from 40 unrelated Spanish families with strong CRC aggregation compatible with an autosomal dominant pattern of inheritance and without mutations in known hereditary CRC genes and performed germline DNA whole-exome sequencing with the aim of finding new candidate germline predisposition variants. After sequencing and data analysis, variant prioritization selected only those very rare alterations, producing a putative loss of function and located in genes with a role compatible with cancer. We detected an enrichment for variants in FA DNA damage repair pathway genes in our familial CRC cohort as 6 families carried heterozygous, rare, potentially pathogenic variants located in BRCA2/FANCD1, BRIP1/FANCJ, FANCC, FANCE and REV3L/POLZ. In conclusion, the FA DNA damage repair pathway may play an important role in the inherited predisposition to CRC.

  15. Identification of mutations in the PI3K-AKT-mTOR signalling pathway in patients with macrocephaly and developmental delay and/or autism.

    PubMed

    Yeung, Kit San; Tso, Winnie Wan Yee; Ip, Janice Jing Kun; Mak, Christopher Chun Yu; Leung, Gordon Ka Chun; Tsang, Mandy Ho Yin; Ying, Dingge; Pei, Steven Lim Cho; Lee, So Lun; Yang, Wanling; Chung, Brian Hon-Yin

    2017-01-01

    Macrocephaly, which is defined as a head circumference greater than or equal to + 2 standard deviations, is a feature commonly observed in children with developmental delay and/or autism spectrum disorder. Although PTEN is a well-known gene identified in patients with this syndromic presentation, other genes in the PI3K-AKT-mTOR signalling pathway have also recently been suggested to have important roles. The aim of this study is to characterise the mutation spectrum of this group of patients. We performed whole-exome sequencing of 21 patients with macrocephaly and developmental delay/autism spectrum disorder. Sources of genomic DNA included blood, buccal mucosa and saliva. Germline mutations were validated by Sanger sequencing, whereas somatic mutations were validated by droplet digital PCR. We identified ten pathogenic/likely pathogenic mutations in PTEN ( n  = 4), PIK3CA ( n  = 3), MTOR ( n  = 1) and PPP2R5D ( n  = 2) in ten patients. An additional PTEN mutation, which was classified as variant of unknown significance, was identified in a patient with a pathogenic PTEN mutation, making him harbour bi-allelic germline PTEN mutations. Two patients harboured somatic PIK3CA mutations, and the level of somatic mosaicism in blood DNA was low. Patients who tested positive for mutations in the PI3K-AKT-mTOR pathway had a lower developmental quotient than the rest of the cohort (DQ = 62.8 vs. 76.1, p = 0.021). Their dysmorphic features were non-specific, except for macrocephaly. Among the ten patients with identified mutations, brain magnetic resonance imaging was performed in nine, all of whom showed megalencephaly. We identified mutations in the PI3K-AKT-mTOR signalling pathway in nearly half of our patients with macrocephaly and developmental delay/autism spectrum disorder. These patients have subtle dysmorphic features and mild developmental issues. Clinically, patients with germline mutations are difficult to distinguish from patients with somatic mutations, and therefore, sequencing of buccal or saliva DNA is important to identify somatic mosaicism. Given the high diagnostic yield and the management implications, we suggest implementing comprehensive genetic testing in the PI3K-AKT-mTOR pathway in the clinical evaluation of patients with macrocephaly and developmental delay and/or autism spectrum disorder.

  16. Structural insights into humanization of anti-tissue factor antibody 10H10.

    PubMed

    Teplyakov, Alexey; Obmolova, Galina; Malia, Thomas J; Raghunathan, Gopalan; Martinez, Christian; Fransson, Johan; Edwards, Wilson; Connor, Judith; Husovsky, Matthew; Beck, Heena; Chi, Ellen; Fenton, Sandra; Zhou, Hong; Almagro, Juan Carlos; Gilliland, Gary L

    Murine antibody 10H10 raised against human tissue factor is unique in that it blocks the signaling pathway, and thus inhibits angiogenesis and tumor growth without interfering with coagulation. As a potential therapeutic, the antibody was humanized in a two-step procedure. Antigen-binding loops were grafted onto selected human frameworks and the resulting chimeric antibody was subjected to affinity maturation by using phage display libraries. The results of humanization were analyzed from the structural perspective through comparison of the structure of a humanized variant with the parental mouse antibody. This analysis revealed several hot spots in the framework region that appear to affect antigen binding, and therefore should be considered in human germline selection. In addition, some positions in the Vernier zone, e.g., residue 71 in the heavy chain, that are traditionally thought to be crucial appear to tolerate amino acid substitutions without any effect on binding. Several humanized variants were produced using both short and long forms of complementarity-determining region (CDR) H2 following the difference in the Kabat and Martin definitions. Comparison of such pairs indicated consistently higher thermostability of the variants with short CDR H2. Analysis of the binding data in relation to the structures singled out the ImMunoGeneTics information system® germline IGHV1-2*01 as dubious owing to two potentially destabilizing mutations as compared to the other alleles of the same germline and to other human germlines.

  17. Combined hereditary and somatic mutations of replication error repair genes result in rapid onset of ultra-hypermutated cancers.

    PubMed

    Shlien, Adam; Campbell, Brittany B; de Borja, Richard; Alexandrov, Ludmil B; Merico, Daniele; Wedge, David; Van Loo, Peter; Tarpey, Patrick S; Coupland, Paul; Behjati, Sam; Pollett, Aaron; Lipman, Tatiana; Heidari, Abolfazl; Deshmukh, Shriya; Avitzur, Na'ama; Meier, Bettina; Gerstung, Moritz; Hong, Ye; Merino, Diana M; Ramakrishna, Manasa; Remke, Marc; Arnold, Roland; Panigrahi, Gagan B; Thakkar, Neha P; Hodel, Karl P; Henninger, Erin E; Göksenin, A Yasemin; Bakry, Doua; Charames, George S; Druker, Harriet; Lerner-Ellis, Jordan; Mistry, Matthew; Dvir, Rina; Grant, Ronald; Elhasid, Ronit; Farah, Roula; Taylor, Glenn P; Nathan, Paul C; Alexander, Sarah; Ben-Shachar, Shay; Ling, Simon C; Gallinger, Steven; Constantini, Shlomi; Dirks, Peter; Huang, Annie; Scherer, Stephen W; Grundy, Richard G; Durno, Carol; Aronson, Melyssa; Gartner, Anton; Meyn, M Stephen; Taylor, Michael D; Pursell, Zachary F; Pearson, Christopher E; Malkin, David; Futreal, P Andrew; Stratton, Michael R; Bouffet, Eric; Hawkins, Cynthia; Campbell, Peter J; Tabori, Uri

    2015-03-01

    DNA replication-associated mutations are repaired by two components: polymerase proofreading and mismatch repair. The mutation consequences of disruption to both repair components in humans are not well studied. We sequenced cancer genomes from children with inherited biallelic mismatch repair deficiency (bMMRD). High-grade bMMRD brain tumors exhibited massive numbers of substitution mutations (>250/Mb), which was greater than all childhood and most cancers (>7,000 analyzed). All ultra-hypermutated bMMRD cancers acquired early somatic driver mutations in DNA polymerase ɛ or δ. The ensuing mutation signatures and numbers are unique and diagnostic of childhood germ-line bMMRD (P < 10(-13)). Sequential tumor biopsy analysis revealed that bMMRD/polymerase-mutant cancers rapidly amass an excess of simultaneous mutations (∼600 mutations/cell division), reaching but not exceeding ∼20,000 exonic mutations in <6 months. This implies a threshold compatible with cancer-cell survival. We suggest a new mechanism of cancer progression in which mutations develop in a rapid burst after ablation of replication repair.

  18. Biology and applications of human minisatellite loci.

    PubMed

    Armour, J A; Jeffreys, A J

    1992-12-01

    Highly repetitive minisatellites' include the most variable human loci described to date. They have proved invaluable in a wide variety of genetic analyses, and despite some controversies surrounding their practical implementation, have been extensively adopted in civil and forensic casework. Molecular analysis of internal allelic structure has provided detailed insights into the repeat-unit turnover mechanisms operating in germline mutations, which are ultimately responsible for the extreme variability seen at these loci.

  19. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

    PubMed

    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko

    2014-04-01

    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  20. A germline FANCA alteration that is associated with increased sensitivity to DNA damaging agents

    PubMed Central

    Wilkes, David C.; Sailer, Verena; Xue, Hui; Cheng, Hongwei; Collins, Colin C.; Gleave, Martin; Wang, Yuzhuo; Demichelis, Francesca; Beltran, Himisha; Rubin, Mark A.; Rickman, David S.

    2017-01-01

    Defects in genes involved in DNA damage repair (DDR) pathway are emerging as novel biomarkers and targets for new prostate cancer drug therapies. A previous report revealed an association between an exceptional response to cisplatin treatment and a somatic loss of heterozygosity (LOH) of FANCA in a patient with metastatic prostate cancer who also harbored a germline FANCA variant (S1088F). Although germline FANCA mutations are the most frequent alterations in patients with Fanconi anemia, germline alterations are less common in prostate cancer. We hypothesized that the germline S1088F FANCA variant in combination with FANCA LOH was deleterious for FANCA function and contributed to the patient's exceptional response to cisplatin. We show that although it properly localizes to the nucleus, the S1088F FANCA mutant protein disrupts the FANC protein complex resulting in increased sensitivity to DNA damaging agents. Because molecular stratification is emerging as a strategy for treating men with metastatic, castrate-resistant prostate cancer harboring specific DDR gene defects, our findings suggest that more biomarker studies are needed to better define clinically relevant germline and somatic alterations. PMID:28864460

  1. When to Consider Risk-Reducing Mastectomy in BRCA1/BRCA2 Mutation Carriers with Advanced Stage Ovarian Cancer: a Case Study Illustrating the Genetic Counseling Challenges.

    PubMed

    Speight, Beverley; Tischkowitz, Marc

    2017-12-01

    Germline mutations in BRCA1/BRCA2 significantly increase the risk of breast and ovarian cancer in women. This case report describes a BRCA1 germline mutation identified in a woman with stage IV epithelial ovarian cancer and the provision of genetic counseling about BRCA1-associated breast cancer risk in the three years following diagnosis. The report centers on the patient's enquiry about risk-reducing breast surgery. We focus on the challenges for health professionals and patients in understanding and balancing the risks and benefits of major prophylactic surgery in the context of a potentially life-limiting cancer diagnosis. Breast cancer risk management in BRCA1/BRCA2 carriers with advanced ovarian cancer is an under-explored area of genetic counseling research. This article includes a case report, a review of the relevant literature and considers some implications for practice.

  2. Preventing the transmission of pathogenic mitochondrial DNA mutations: can we achieve long-term benefits from germ-line gene transfer?

    PubMed Central

    Samuels, David C.; Wonnapinij, Passorn; Chinnery, Patrick F.

    2013-01-01

    Mitochondrial medicine is one of the few areas of genetic disease where germ-line transfer is being actively pursued as a treatment option. All of the germ-line transfer methods currently under development involve some carry-over of the maternal mitochondrial DNA (mtDNA) heteroplasmy, potentially delivering the pathogenic mutation to the offspring. Rapid changes in mtDNA heteroplasmy have been observed within a single generation, and so any ‘leakage’ of mutant mtDNA could lead to mtDNA disease in future generations, compromising the reproductive health of the first generation, and leading to repeated interventions in subsequent generations. To determine whether this is a real concern, we developed a model of mtDNA heteroplasmy inheritance by studying 87 mother–child pairs, and predicted the likely outcome of different levels of ‘mutant mtDNA leakage’ on subsequent maternal generations. This showed that, for a clinical threshold of 60%, reducing the proportion of mutant mtDNA to <5% dramatically reduces the chance of disease recurrence in subsequent generations, but transmitting >5% mutant mtDNA was associated with a significant chance of disease recurrence. Mutations with a lower clinical threshold were associated with a higher risk of recurrence. Our findings provide reassurance that, at least from an mtDNA perspective, methods currently under development have the potential to effectively eradicate pathogenic mtDNA mutations from subsequent generations. PMID:23297368

  3. CHK2, A Candidate Prostate Cancer Susceptibility Gene

    DTIC Science & Technology

    2003-01-01

    To identify prostate cancer susceptibility genes, we applied a mutation screening of candidate gene approach. We screened for mutations in CHEK2 , the...families, 400 sporadic cases, and 423 unaffected men as control. A total of 28 (4.8%) germline CHEK2 mutations were found among 578 patients and...additional 11 in 9 families. Sixteen of 18 unique CHEK2 mutations identified in this study were not detected among 423 unaffected men, suggesting a

  4. Novel germline mutation (Leu512Met) in the thyrotropin receptor gene (TSHR) leading to sporadic non-autoimmune hyperthyroidism.

    PubMed

    Roberts, Stephanie A; Moon, Jennifer E; Dauber, Andrew; Smith, Jessica R

    2017-03-01

    Primary nonautoimmune hyperthyroidism is a rare cause of neonatal hyperthyroidism. This results from an activating mutation in the thyrotropin-receptor (TSHR). It can be inherited in an autosomal dominant manner or occur sporadically as a de novo mutation. Affected individuals display a wide phenotype from severe neonatal to mild subclinical hyperthyroidism. We describe a 6-month-old boy with a de novo mutation in the TSHR gene who presented with accelerated growth, enlarging head circumference, tremor and thyrotoxicosis. Genomic DNA from the patient's and parents' peripheral blood leukocytes was extracted. Exons 9 and 10 of the TSHR gene were amplified by PCR and sequenced. Sequencing exon 10 of the TSHR gene revealed a novel heterozygous missense mutation substituting cytosine to adenine at nucleotide position 1534 in the patient's peripheral blood leukocytes. This leads to a substitution of leucine to methionine at amino acid position 512. The mutation was absent in the parents. In silico modeling by PolyPhen-2 and SIFT predicted the mutation to be deleterious. The p.Leu512Met mutation (c.1534C>A) of the TSHR gene has not been previously described in germline or somatic mutations. This case presentation highlights the possibility of mild thyrotoxicosis in affected individuals and contributes to the understanding of sporadic non-autoimmune primary hyperthyroidism.

  5. Novel germline mutation (Leu512Met) in the thyrotropin receptor gene (TSHR) leading to sporadic non-autoimmune hyperthyroidism

    PubMed Central

    Roberts, Stephanie A.; Moon, Jennifer E.; Dauber, Andrew; Smith, Jessica R.

    2018-01-01

    Background Primary nonautoimmune hyperthyroidism is a rare cause of neonatal hyperthyroidism. This results from an activating mutation in the thyrotropin-receptor (TSHR). It can be inherited in an autosomal dominant manner or occur sporadically as a de novo mutation. Affected individuals display a wide phenotype from severe neonatal to mild subclinical hyperthyroidism. We describe a 6-month-old boy with a de novo mutation in the TSHR gene who presented with accelerated growth, enlarging head circumference, tremor and thyrotoxicosis. Methods Genomic DNA from the patient’s and parents’ peripheral blood leukocytes was extracted. Exons 9 and 10 of the TSHR gene were amplified by PCR and sequenced. Results Sequencing exon 10 of the TSHR gene revealed a novel heterozygous missense mutation substituting cytosine to adenine at nucleotide position 1534 in the patient’s peripheral blood leukocytes. This leads to a substitution of leucine to methionine at amino acid position 512. The mutation was absent in the parents. In silico modeling by PolyPhen-2 and SIFT predicted the mutation to be deleterious. Conclusions The p.Leu512Met mutation (c.l534C>A) of the TSHR gene has not been previously described in germline or somatic mutations. This case presentation highlights the possibility of mild thyrotoxicosis in affected individuals and contributes to the understanding of sporadic non-autoimmune primary hyperthyroidism. PMID:28195550

  6. Prevalence and Spectrum of Germline Cancer Susceptibility Gene Mutations Among Patients With Early-Onset Colorectal Cancer

    PubMed Central

    Pearlman, Rachel; Frankel, Wendy L.; Swanson, Benjamin; Zhao, Weiqiang; Yilmaz, Ahmet; Miller, Kristin; Bacher, Jason; Bigley, Christopher; Nelsen, Lori; Goodfellow, Paul J.; Goldberg, Richard M.; Paskett, Electra; Shields, Peter G.; Freudenheim, Jo L.; Stanich, Peter P; Lattimer, Ilene; Arnold, Mark; Liyanarachchi, Sandya; Kalady, Matthew; Heald, Brandie; Greenwood, Carla; Paquette, Ian; Prues, Marla; Draper, David J.; Lindeman, Carolyn; Kuebler, J. Philip; Reynolds, Kelly; Brell, Joanna M.; Shaper, Amy A.; Mahesh, Sameer; Buie, Nicole; Weeman, Kisa; Shine, Kristin; Haut, Mitchell; Edwards, Joan; Bastola, Shyamal; Wickham, Karen; Khanduja, Karamjit S.; Zacks, Rosemary; Pritchard, Colin C.; Shirts, Brian H.; Jacobson, Angela; Allen, Brian; de la Chapelle, Albert; Hampel, Heather

    2017-01-01

    IMPORTANCE Hereditary cancer syndromes infer high cancer risks and require intensive cancer surveillance, yet the prevalence and spectrum of these conditions among unselected patients with early-onset colorectal cancer (CRC) is largely undetermined. OBJECTIVE To determine the frequency and spectrum of cancer susceptibility gene mutations among patients with early-onset CRC. DESIGN, SETTING, AND PARTICIPANTS Overall, 450 patients diagnosed with colorectal cancer younger than 50 years were prospectively accrued from 51 hospitals into the Ohio Colorectal Cancer Prevention Initiative from January 1, 2013, to June 20, 2016. Mismatch repair (MMR) deficiency was determined by microsatellite instability and/or immunohistochemistry. Germline DNA was tested for mutations in 25 cancer susceptibility genes using next-generation sequencing. MAIN OUTCOMES AND MEASURES Mutation prevalence and spectrum in patients with early-onset CRC was determined. Clinical characteristics were assessed by mutation status. RESULTS In total 450 patients younger than 50 years were included in the study, and 75 gene mutations were found in 72 patients (16%). Forty-eight patients (10.7%) had MMR-deficient tumors, and 40 patients (83.3%) had at least 1 gene mutation: 37 had Lynch syndrome (13, MLH1 [including one with constitutional MLH1 methylation]; 16, MSH2; 1, MSH2/monoallelic MUTYH; 2, MSH6; 5, PMS2); 1 patient had the APC c.3920T>A, p.I1307K mutation and a PMS2 variant; 9 patients (18.8%) had double somatic MMR mutations (including 2 with germline biallelic MUTYH mutations); and 1 patient had somatic MLH1 methylation. Four hundred two patients (89.3%) had MMR-proficient tumors, and 32 patients (8%) had at least 1 gene mutation: 9 had mutations in high-penetrance CRC genes (5, APC; 1, APC/PMS2; 2, biallelic MUTYH; 1, SMAD4); 13 patients had mutations in high- or moderate-penetrance genes not traditionally associated with CRC (3, ATM; 1, ATM/CHEK2; 2, BRCA1; 4, BRCA2; 1, CDKN2A; 2, PALB2); 10 patients had mutations in low-penetrance CRC genes (3, APC c.3920T>A, p.I1307K; 7, monoallelic MUTYH). Importantly, 24 of 72 patients (33.3%) who were mutation positive did not meet established genetic testing criteria for the gene(s) in which they had a mutation. CONCLUSIONS AND RELEVANCE Of 450 patients with early-onset CRC, 72 (16%) had gene mutations. Given the high frequency and wide spectrum of mutations, genetic counseling and testing with a multigene panel could be considered for all patients with early-onset CRC. PMID:27978560

  7. Resolving a genetic paradox throughout preimplantation genetic diagnosis for autosomal dominant severe congenital neutropenia.

    PubMed

    Malcov, Mira; Reches, Adi; Ben-Yosef, Dalit; Cohen, Tania; Amit, Ami; Dgany, Orly; Tamary, Hannah; Yaron, Yuval

    2010-03-01

    Severe congenital neutropenia is an inherited disease characterized by low peripheral blood neutrophils, amenable to bone marrow transplantation. Genetic analysis in the family here described detected a ELA2 splice-site mutation in the affected child and also in his asymptomatic father. The parents requested preimplantation genetic diagnosis (PGD), coupled with HLA matching, to obtain a suitable bone marrow donor for the affected child. A PGD protocol was developed, based on multiplex nested PCR for direct analysis of the ELA2 mutation, flanking polymorphic markers and HLA typing. The amplification efficiency of the mutation was > 90% in single leukocytes from the affected child but only 67% in the father. Analysis of single haploid sperm cells from the father demonstrated three different sperm-cell populations: (1) sperm cells harboring the ELA2 mutation on the 'affected' haplotype, (2) sperm cells without the ELA2 mutation on the 'normal' haplotype, and (3) sperm cells without the ELA2 mutation on the 'affected' haplotype. These data demonstrate that the ELA2 mutation in the father occurred de novo during his embryonic development, resulting in somatic as well as germ-line mosaicism. This conclusion was also taken into consideration when PGD was performed. Copyright (c) 2010 John Wiley & Sons, Ltd.

  8. p.Arg82Leu von Hippel-Lindau (VHL) Gene Mutation among Three Members of a Family with Familial Bilateral Pheochromocytoma in India: Molecular Analysis and In Silico Characterization

    PubMed Central

    John, Anulekha Mary; C, George Priya Doss; Ebenazer, Andrew; Seshadri, Mandalam Subramaniam; Nair, Aravindan; Rajaratnam, Simon; Pai, Rekha

    2013-01-01

    Various missense mutations in the VHL gene have been reported among patients with familial bilateral pheochromocytoma. However, the p.Arg82Leu mutation in the VHL gene described here among patients with familial bilateral pheochromocytoma, has never been reported previously in a germline configuration. Interestingly, long-term follow-up of these patients indicated that the mutation might have had little impact on the normal function of the VHL gene, since all of them have remained asymptomatic. We further attempted to correlate this information with the results obtained by in silico analysis of this mutation using SIFT, PhD-SNP SVM profile, MutPred, PolyPhen2, and SNPs&GO prediction tools. To gain, new mechanistic insight into the structural effect, we mapped the mutation on to 3D structure (PDB ID 1LM8). Further, we analyzed the structural level changes in time scale level with respect to native and mutant protein complexes by using 12 ns molecular dynamics simulation method. Though these methods predict the mutation to have a pathogenic potential, it remains to be seen if these patients will eventually develop symptomatic disease. PMID:23626751

  9. A germline JAK2 SNP is associated with predisposition to the development of JAK2V617F-positive myeloproliferative neoplasms

    PubMed Central

    Kilpivaara, Outi; Mukherjee, Semanti; Schram, Alison M; Wadleigh, Martha; Mullally, Ann; Ebert, Benjamin L; Bass, Adam; Marubayashi, Sachie; Heguy, Adriana; Garcia-Manero, Guillermo; Kantarjian, Hagop; Offit, Kenneth; Stone, Richard M; Gilliland, D Gary; Klein, Robert J; Levine, Ross L

    2013-01-01

    Polycythemia vera, essential thrombocythemia and primary myelofibrosis are myeloproliferative neoplasms (MPN) characterized by multilineage clonal hematopoiesis1–5. Given that the identical somatic activating mutation in the JAK2 tyrosine kinase gene (JAK2V617F) is observed in most individuals with polycythemia vera, essential thrombocythemia and primary myelofibrosis6–10, there likely are additional genetic events that contribute to the pathogenesis of these phenotypically distinct disorders. Moreover, family members of individuals with MPN are at higher risk for the development of MPN, consistent with the existence of MPN predisposition loci11. We hypothesized that germline variation contributes to MPN predisposition and phenotypic pleiotropy. Genome-wide analysis identified an allele in the JAK2 locus (rs10974944) that predisposes to the development of JAK2V617F-positive MPN, as well as three previously unknown MPN modifier loci. We found that JAK2V617F is preferentially acquired in cis with the predisposition allele. These data suggest that germline variation is an important contributor to MPN phenotype and predisposition. PMID:19287384

  10. Novel germline PALB2 truncating mutations in African-American breast cancer patients

    PubMed Central

    Zheng, Yonglan; Zhang, Jing; Niu, Qun; Huo, Dezheng; Olopade, Olufunmilayo I.

    2011-01-01

    Background It has been demonstrated that PALB2 acts as a bridging molecule between the BRCA1 and BRCA2 proteins and is responsible for facilitating BRCA2-mediated DNA repair. Truncating mutations in the PALB2 gene have been reported to be enriched in Fanconi anemia and breast cancer patients in various populations. Methods We evaluated the contribution of PALB2 germline mutations in 279 African-American breast cancer patients including 29 patients with a strong family history, 29 patients with a moderate family history, 75 patients with a weak family history, and 146 non-familial or sporadic breast cancer cases. Results After direct sequencing of all the coding exons, exon/intron boundaries, 5′UTR and 3′UTR of PALB2, three (1.08%; 3 in 279) novel monoallelic truncating mutations were identified: c.758dupT (exon4), c.1479delC (exon4) and c.3048delT (exon 10); together with 50 sequence variants, 27 of which are novel. None of the truncating mutations were found in 262 controls from the same population. Conclusions PALB2 mutations are present in both familial and non-familial breast cancer among African-Americans. Rare PALB2 mutations account for a small but substantial proportion of breast cancer patients. PMID:21932393

  11. Fibroblast growth factor receptors, developmental corruption and malignant disease.

    PubMed

    Kelleher, Fergal C; O'Sullivan, Hazel; Smyth, Elizabeth; McDermott, Ray; Viterbo, Antonella

    2013-10-01

    Fibroblast growth factors (FGF) are a family of ligands that bind to four different types of cell surface receptor entitled, FGFR1, FGFR2, FGFR3 and FGFR4. These receptors differ in their ligand binding affinity and tissue distribution. The prototypical receptor structure is that of an extracellular region comprising three immunoglobulin (Ig)-like domains, a hydrophobic transmembrane segment and a split intracellular tyrosine kinase domain. Alternative gene splicing affecting the extracellular third Ig loop also creates different receptor isoforms entitled FGFRIIIb and FGFRIIIc. Somatic fibroblast growth factor receptor (FGFR) mutations are implicated in different types of cancer and germline FGFR mutations occur in developmental syndromes particularly those in which craniosynostosis is a feature. The mutations found in both conditions are often identical. Many somatic FGFR mutations in cancer are gain-of-function mutations of established preclinical oncogenic potential. Gene amplification can also occur with 19-22% of squamous cell lung cancers for example having amplification of FGFR1. Ontologic comparators can be informative such as aberrant spermatogenesis being implicated in both spermatocytic seminomas and Apert syndrome. The former arises from somatic FGFR3 mutations and Apert syndrome arises from germline FGFR2 mutations. Finally, therapeutics directed at inhibiting the FGF/FGFR interaction are a promising subject for clinical trials.

  12. The role of metabolic enzymes in mesenchymal tumors and tumor syndromes: genetics, pathology, and molecular mechanisms.

    PubMed

    Schaefer, Inga-Marie; Hornick, Jason L; Bovée, Judith V M G

    2018-04-01

    The discovery of mutations in genes encoding the metabolic enzymes isocitrate dehydrogenase (IDH), succinate dehydrogenase (SDH), and fumarate hydratase (FH) has expanded our understanding not only of altered metabolic pathways but also epigenetic dysregulation in cancer. IDH1/2 mutations occur in enchondromas and chondrosarcomas in patients with the non-hereditary enchondromatosis syndromes Ollier disease and Maffucci syndrome and in sporadic tumors. IDH1/2 mutations result in excess production of the oncometabolite (D)-2-hydroxyglutarate. In contrast, SDH and FH act as tumor suppressors and genomic inactivation results in succinate and fumarate accumulation, respectively. SDH deficiency may result from germline SDHA, SDHB, SDHC, or SDHD mutations and is found in autosomal-dominant familial paraganglioma/pheochromocytoma and Carney-Stratakis syndrome, describing the combination of paraganglioma and gastrointestinal stromal tumor (GIST). In contrast, patients with the non-hereditary Carney triad, including paraganglioma, GIST, and pulmonary chondroma, usually lack germline SDH mutations and instead show epigenetic SDH complex inactivation through SDHC promoter methylation. Inactivating FH germline mutations are found in patients with hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome comprising benign cutaneous/uterine leiomyomas and renal cell carcinoma. Mutant IDH, SDH, and FH share common inhibition of α-ketoglutarate-dependent oxygenases such as the TET family of 5-methylcytosine hydroxylases preventing DNA demethylation, and Jumonji domain histone demethylases increasing histone methylation, which together inhibit cell differentiation. Ongoing studies aim to better characterize these complex alterations in cancer, the different clinical phenotypes, and variable penetrance of inherited and sporadic cancer predisposition syndromes. A better understanding of the roles of metabolic enzymes in cancer may foster the development of therapies that specifically target functional alterations in tumor cells in the future. Here, the physiologic functions of these metabolic enzymes, the mutational spectrum, and associated functional alterations will be discussed, with a focus on mesenchymal tumor predisposition syndromes.

  13. Paediatric intestinal cancer and polyposis due to bi-allelic PMS2 mutations: case series, review and follow-up guidelines.

    PubMed

    Herkert, Johanna C; Niessen, Renée C; Olderode-Berends, Maria J W; Veenstra-Knol, Hermine E; Vos, Yvonne J; van der Klift, Heleen M; Scheenstra, Rene; Tops, Carli M J; Karrenbeld, Arend; Peters, Frans T M; Hofstra, Robert M W; Kleibeuker, Jan H; Sijmons, Rolf H

    2011-05-01

    Bi-allelic germline mutations of one of the DNA mismatch repair genes, so far predominantly found in PMS2, cause constitutional MMR-deficiency syndrome. This rare disorder is characterised by paediatric intestinal cancer and other malignancies. We report the clinical, immunohistochemical and genetic characterisation of four families with bi-allelic germline PMS2 mutations. We present an overview of the published gastrointestinal manifestations of CMMR-D syndrome and propose recommendations for gastro-intestinal screening. The first proband developed a cerebral angiosarcoma at age 2 and two colorectal adenomas at age 7. Genetic testing identified a complete PMS2 gene deletion and a frameshift c.736_741delinsTGTGTGTGAAG (p.Pro246CysfsX3) mutation. In the second family, both the proband and her brother had multiple intestinal adenomas, initially wrongly diagnosed as familial adenomatous polyposis. A splice site c.2174+1G>A, and a missense c.137G>T (p.Ser46Ile) mutation in PMS2 were identified. The third patient was diagnosed with multiple colorectal adenomas at age 11; he developed a high-grade dysplastic colorectal adenocarcinoma at age 21. Two intragenic PMS2 deletions were found. The fourth proband developed a cerebral anaplastic ganglioma at age 9 and a high-grade colerectal dysplastic adenoma at age 10 and carries a homozygous c.2174+1G>A mutation. Tumours of all patients showed microsatellite instability and/or loss of PMS2 expression. Our findings show the association between bi-allelic germline PMS2 mutations and severe childhood-onset gastrointestinal manifestations, and support the notion that patients with early-onset gastrointestinal adenomas and cancer should be investigated for CMMR-D syndrome. We recommend yearly follow-up with colonoscopy from age 6 and simultaneous video-capsule small bowel enteroscopy from age 8. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Male Germline Control of Transposable Elements1

    PubMed Central

    Bao, Jianqiang; Yan, Wei

    2012-01-01

    ABSTRACT Repetitive sequences, especially transposon-derived interspersed repetitive elements, account for a large fraction of the genome in most eukaryotes. Despite the repetitive nature, these transposable elements display quantitative and qualitative differences even among species of the same lineage. Although transposable elements contribute greatly as a driving force to the biological diversity during evolution, they can induce embryonic lethality and genetic disorders as a result of insertional mutagenesis and genomic rearrangement. Temporary relaxation of the epigenetic control of retrotransposons during early germline development opens a risky window that can allow retrotransposons to escape from host constraints and to propagate abundantly in the host genome. Because germline mutations caused by retrotransposon activation are heritable and thus can be deleterious to the offspring, an adaptive strategy has evolved in host cells, especially in the germline. In this review, we will attempt to summarize general defense mechanisms deployed by the eukaryotic genome, with an emphasis on pathways utilized by the male germline to confer retrotransposon silencing. PMID:22357546

  15. Cinacalcet Rectifies Hypercalcemia in a Patient With Familial Hypocalciuric Hypercalcemia Type 2 (FHH2) Caused by a Germline Loss‐of‐Function Gα11 Mutation

    PubMed Central

    Gorvin, Caroline M; Hannan, Fadil M; Cranston, Treena; Valta, Helena; Makitie, Outi; Schalin‐Jantti, Camilla

    2017-01-01

    ABSTRACT G‐protein subunit α‐11 (Gα11) couples the calcium‐sensing receptor (CaSR) to phospholipase C (PLC)‐mediated intracellular calcium (Ca2+ i) and mitogen‐activated protein kinase (MAPK) signaling, which in the parathyroid glands and kidneys regulates parathyroid hormone release and urinary calcium excretion, respectively. Heterozygous germline loss‐of‐function Gα11 mutations cause familial hypocalciuric hypercalcemia type 2 (FHH2), for which effective therapies are currently not available. Here, we report a novel heterozygous Gα11 germline mutation, Phe220Ser, which was associated with hypercalcemia in a family with FHH2. Homology modeling showed the wild‐type (WT) Phe220 nonpolar residue to form part of a cluster of hydrophobic residues within a highly conserved cleft region of Gα11, which binds to and activates PLC; and predicted that substitution of Phe220 with the mutant Ser220 polar hydrophilic residue would disrupt PLC‐mediated signaling. In vitro studies involving transient transfection of WT and mutant Gα11 proteins into HEK293 cells, which express the CaSR, showed the mutant Ser220 Gα11 protein to impair CaSR‐mediated Ca2+ i and extracellular signal‐regulated kinase 1/2 (ERK) MAPK signaling, consistent with diminished activation of PLC. Furthermore, engineered mutagenesis studies demonstrated that loss of hydrophobicity within the Gα11 cleft region also impaired signaling by PLC. The loss‐of‐function associated with the Ser220 Gα11 mutant was rectified by treatment of cells with cinacalcet, which is a CaSR‐positive allosteric modulator. Furthermore, in vivo administration of cinacalcet to the proband harboring the Phe220Ser Gα11 mutation, normalized serum ionized calcium concentrations. Thus, our studies, which report a novel Gα11 germline mutation (Phe220Ser) in a family with FHH2, reveal the importance of the Gα11 hydrophobic cleft region for CaSR‐mediated activation of PLC, and show that allosteric CaSR modulation can rectify the loss‐of‐function Phe220Ser mutation and ameliorate the hypercalcemia associated with FHH2. © 2017 The Authors. Journal of Bone and Mineral Research Published by Wiley Periodicals Inc. PMID:28833550

  16. VHL c.505 T>C mutation confers a high age related penetrance but no increased overall mortality

    PubMed Central

    Bender, B.; Eng, C.; Olschewski, M.; Berger, D.; Laubenberger, J.; Altehofer, C.; Kirste, G.; Orszagh, M.; van Velthoven, V.; Miosczka, H.; Schmidt, D.; Neumann, H.

    2001-01-01

    BACKGROUND—Germline mutations of the VHL gene cause von Hippel-Lindau syndrome (VHL). In southern Germany, a specific mutation in this gene, c.505 T>C, is one of the most frequent alterations owing to a founder effect.
METHODS—This study was conducted to evaluate morbidity, specific clinical risk profile, and mortality among a series of VHL c.505 T/C mutation carriers. A total of 125 eligible subjects carrying VHL c.505 T/C underwent ophthalmoscopy and gadolinium enhanced magnetic resonance imaging of the brain, the spinal cord, and the abdomen. Age related penetrance, morbidity, and mortality were assessed.
RESULTS—Frequently observed lesions were phaeochromocytoma (47%), retinal angiomas (36%), haemangioblastoma of the spine (36%), and haemangioblastoma of the brain (16%). Four patients developed renal cell carcinoma. VHL was symptomatic in 47% of subjects; 30% were asymptomatic despite the presence of at least one VHL related tumour and 23% of the carriers had no detectable VHL lesion. Of the 19 patients who had died (15%), 10 died of symptomatic VHL lesions. Overall penetrance by cumulative incidence functions is estimated at 48% by 35 years and 88% by 70 years. In contrast to the only existing published report based on patients with presumably unselected VHL germline mutations, the mortality rate for c.505 T/C mutation carriers is comparable to that of the general population of Germany.
CONCLUSIONS—Our results are an important example that a specific genotype, at least in the case of VHL c.505 T/C, can favourably impact on mortality despite a high age related penetrance. Our study also indirectly provides objective data which might be useful to the life and health insurance industry; it would appear that c.505 T>C mutation positive subjects have similar disease specific mortality to that of the general population owing to a combination of phenotype and timely detection of mutation carrier status followed by aggressive clinical screening and, if necessary, treatment.


Keywords: VHL gene; c.505 T/C germline mutation; VHL morbidity; VHL mortality PMID:11483638

  17. Hereditary diffuse gastric cancer: updated clinical guidelines with an emphasis on germline CDH1 mutation carriers.

    PubMed

    van der Post, Rachel S; Vogelaar, Ingrid P; Carneiro, Fátima; Guilford, Parry; Huntsman, David; Hoogerbrugge, Nicoline; Caldas, Carlos; Schreiber, Karen E Chelcun; Hardwick, Richard H; Ausems, Margreet G E M; Bardram, Linda; Benusiglio, Patrick R; Bisseling, Tanya M; Blair, Vanessa; Bleiker, Eveline; Boussioutas, Alex; Cats, Annemieke; Coit, Daniel; DeGregorio, Lynn; Figueiredo, Joana; Ford, James M; Heijkoop, Esther; Hermens, Rosella; Humar, Bostjan; Kaurah, Pardeep; Keller, Gisella; Lai, Jennifer; Ligtenberg, Marjolijn J L; O'Donovan, Maria; Oliveira, Carla; Pinheiro, Hugo; Ragunath, Krish; Rasenberg, Esther; Richardson, Susan; Roviello, Franco; Schackert, Hans; Seruca, Raquel; Taylor, Amy; Ter Huurne, Anouk; Tischkowitz, Marc; Joe, Sheena Tjon A; van Dijck, Benjamin; van Grieken, Nicole C T; van Hillegersberg, Richard; van Sandick, Johanna W; Vehof, Rianne; van Krieken, J Han; Fitzgerald, Rebecca C

    2015-06-01

    Germline CDH1 mutations confer a high lifetime risk of developing diffuse gastric (DGC) and lobular breast cancer (LBC). A multidisciplinary workshop was organised to discuss genetic testing, surgery, surveillance strategies, pathology reporting and the patient's perspective on multiple aspects, including diet post gastrectomy. The updated guidelines include revised CDH1 testing criteria (taking into account first-degree and second-degree relatives): (1) families with two or more patients with gastric cancer at any age, one confirmed DGC; (2) individuals with DGC before the age of 40 and (3) families with diagnoses of both DGC and LBC (one diagnosis before the age of 50). Additionally, CDH1 testing could be considered in patients with bilateral or familial LBC before the age of 50, patients with DGC and cleft lip/palate, and those with precursor lesions for signet ring cell carcinoma. Given the high mortality associated with invasive disease, prophylactic total gastrectomy at a centre of expertise is advised for individuals with pathogenic CDH1 mutations. Breast cancer surveillance with annual breast MRI starting at age 30 for women with a CDH1 mutation is recommended. Standardised endoscopic surveillance in experienced centres is recommended for those opting not to have gastrectomy at the current time, those with CDH1 variants of uncertain significance and those that fulfil hereditary DGC criteria without germline CDH1 mutations. Expert histopathological confirmation of (early) signet ring cell carcinoma is recommended. The impact of gastrectomy and mastectomy should not be underestimated; these can have severe consequences on a psychological, physiological and metabolic level. Nutritional problems should be carefully monitored. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  18. Association of low-risk MSH3 and MSH2 variant alleles with Lynch syndrome: probability of synergistic effects.

    PubMed

    Duraturo, Francesca; Liccardo, Raffaella; Cavallo, Angela; De Rosa, Marina; Grosso, Michela; Izzo, Paola

    2011-10-01

    Mutations in the MLH1 and MSH2 genes account for a majority of cases of families with Lynch Syndrome. Germ-line mutations in MSH6, PMS2 and MLH3 are responsible for disease in a minority of cases, usually associated with milder and variable phenotypes. No germ-line mutations in MSH3 have so far been associated with Lynch Syndrome, although it is known that impaired MSH3 activity leads to a partial defect in mismatch repair (MMR), with low levels of microsatellite instability at the loci with dinucleotide repeats in colorectal cancer (CRC), thus suggesting a role for MSH3 in carcinogenesis. To determine a possible role of MSH3 as predisposing to CRC in Lynch syndrome, we screened MSH3 for germ-line mutations in 79 unrelated Lynch patients who were negative for pathogenetic mutations in MLH1, MSH2 and MSH6. We found 13 mutant alleles, including silent, missense and intronic variants. These variants were identified through denaturing high performance liquid chromatography and subsequent DNA sequencing. In one Lynch family, the index case with early-onset colon cancer was a carrier of a polymorphism in the MSH2 gene and two variants in the MSH3 gene. These variants were associated with the disease in the family, thus suggesting the involvement of MSH3 in colon tumour progression. We hypothesise a model in which variants of the MSH3 gene behave as low-risk alleles that contribute to the risk of colon cancer in Lynch families, mostly with other low-risk alleles of MMR genes. Copyright © 2010 UICC.

  19. Hereditary diffuse gastric cancer: updated clinical guidelines with an emphasis on germline CDH1 mutation carriers

    PubMed Central

    van der Post, Rachel S; Vogelaar, Ingrid P; Carneiro, Fátima; Guilford, Parry; Huntsman, David; Hoogerbrugge, Nicoline; Caldas, Carlos; Schreiber, Karen E Chelcun; Hardwick, Richard H; Ausems, Margreet G E M; Bardram, Linda; Benusiglio, Patrick R; Bisseling, Tanya M; Blair, Vanessa; Bleiker, Eveline; Boussioutas, Alex; Cats, Annemieke; Coit, Daniel; DeGregorio, Lynn; Figueiredo, Joana; Ford, James M; Heijkoop, Esther; Hermens, Rosella; Humar, Bostjan; Kaurah, Pardeep; Keller, Gisella; Lai, Jennifer; Ligtenberg, Marjolijn J L; O'Donovan, Maria; Oliveira, Carla; Ragunath, Krish; Rasenberg, Esther; Richardson, Susan; Roviello, Franco; Schackert, Hans; Seruca, Raquel; Taylor, Amy; ter Huurne, Anouk; Tischkowitz, Marc; Joe, Sheena Tjon A; van Dijck, Benjamin; van Grieken, Nicole C T; van Hillegersberg, Richard; van Sandick, Johanna W; Vehof, Rianne; van Krieken, J Han; Fitzgerald, Rebecca C

    2015-01-01

    Germline CDH1 mutations confer a high lifetime risk of developing diffuse gastric (DGC) and lobular breast cancer (LBC). A multidisciplinary workshop was organised to discuss genetic testing, surgery, surveillance strategies, pathology reporting and the patient's perspective on multiple aspects, including diet post gastrectomy. The updated guidelines include revised CDH1 testing criteria (taking into account first-degree and second-degree relatives): (1) families with two or more patients with gastric cancer at any age, one confirmed DGC; (2) individuals with DGC before the age of 40 and (3) families with diagnoses of both DGC and LBC (one diagnosis before the age of 50). Additionally, CDH1 testing could be considered in patients with bilateral or familial LBC before the age of 50, patients with DGC and cleft lip/palate, and those with precursor lesions for signet ring cell carcinoma. Given the high mortality associated with invasive disease, prophylactic total gastrectomy at a centre of expertise is advised for individuals with pathogenic CDH1 mutations. Breast cancer surveillance with annual breast MRI starting at age 30 for women with a CDH1 mutation is recommended. Standardised endoscopic surveillance in experienced centres is recommended for those opting not to have gastrectomy at the current time, those with CDH1 variants of uncertain significance and those that fulfil hereditary DGC criteria without germline CDH1 mutations. Expert histopathological confirmation of (early) signet ring cell carcinoma is recommended. The impact of gastrectomy and mastectomy should not be underestimated; these can have severe consequences on a psychological, physiological and metabolic level. Nutritional problems should be carefully monitored. PMID:25979631

  20. PTCH1 Germline Mutations and the Basaloid Follicular Hamartoma Values in the Tumor Spectrum of Basal Cell Carcinoma Syndrome (NBCCS).

    PubMed

    Ponti, Giovanni; Manfredini, Marco; Pastorino, Lorenza; Maccaferri, Monia; Tomasi, Aldo; Pellacani, Giovanni

    2018-01-01

    Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominantly inherited disorder characterized by multiple basal cell carcinomas (BCC), odontogenic tumors and various skeletal anomalies. Basaloid follicular hamartomas (BFHs) constitute rare neoplasms that can be detected in sporadic and familial settings as in the Basaloid Follicular Hamartoma Syndrome (BFHS). Although BFHS shares clinical, histopathological and genetic overlapping with the NBCCS, they are still considered two distinctive entities. The aim of our single-institution study was the analysis of a cohort of PTCH1-mutated patients in order to define clinical and biomolecular relationship between NBCCS and BFHs. In our study we evaluated PTCH1 gene-carrier probands affected by NBCCS to detect the incidence of BFHs and their correlation with this rare syndrome. Among probands we recognized 4 patients with BFHs. We found 15 germline PTCH1 mutations, uniformly distributed across the PTCH1 gene. Six of them had familial history of NBCCS, two of them were novel and have not been described previously. NBCCS and BFHS may be the same genetic entity and not two distinctive syndromes. The inclusion of BFH in the NBCCS cutaneous tumor spectrum might be useful for the recognition of misdiagnosed NBCCS cases that could benefit from tailored surveillance strategies. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  1. Gonadal Mosaicism Induced by Chemical Treatment of Sperm in Drosophila melanogaster

    PubMed Central

    Lindsley, Dan L.; Hardy, Robert W.; Ripoll, Pedro; Lindsley, Dart

    2016-01-01

    Accurate interpretation of forward genetic screens of chromosomes exposed in mature spermatozoa to a mutagenic chemical requires understanding—incomplete to date—of how exposed chromosomes and their replicas proceed through early development stages from the fertilized ovum to establishment of the germline of the treated male’s offspring. We describe a model for early embryonic development and establishment of the germline of Drosophila melanogaster and a model-validating experiment. Our model proposes that, barring repair, DNA strands modified by treatment with alkylating agents are stable and mutagenic. Each replication of an alkylated strand can result in misreplication and a mutant-bearing daughter nucleus. Daughter nuclei thenceforth replicate faithfully and their descendants comprise the embryonic syncytium. Of the 256 nuclei present after the eighth division, several migrate into the polar plasm at the posterior end of the embryo to found the germline. Based upon distribution of descendants of the alkylated strands, the misreplication rate, and the number of nuclei selected as germline progenitors, the frequency of gonadal mosaicism is predictable. Experimentally, we tracked chromosomes 2 and 3 from EMS-treated sperm through a number of generations, to characterize autosomal recessive lethal mutations and infer gonadal genetic content of the sons of treated males. Over 50% of 106 sons bore germlines that were singly, doubly, or triply mosaic for chromosome 2 or chromosome 3. These findings were consistent with our model, assuming a rate of misreplication between 0.65 and 0.80 at each replication of an alkylated strand. Crossing treated males to mismatch-repair-deficient females had no apparent effect on mutation rate. PMID:26163187

  2. A novel truncating AIP mutation, p.W279*, in a familial isolated pituitary adenoma (FIPA) kindred.

    PubMed

    Cansu, Güven Barış; Taşkıran, Bengür; Trivellin, Giampaolo; Faucz, Fabio R; Stratakis, Constantine A

    2016-07-01

    Familial isolated pituitary adenomas (FIPA) constitute 2-3% of pituitary tumours. AIP is the most commonly mutated gene in FIPA. We herein report a novel germline mutation of the AIP gene in a family with FIPA. We present two patients, a father and his 12-year-old daughter, diagnosed clinically and using laboratory measures with acromegaly-gigantism. Both underwent transsphenoidal hypophyseal surgery for macroadenomas. We initially detected a novel heterozygous germline AIP mutation, c.836G>A (p.W279*), in the father's DNA. We then found the same mutation in his affected daughter. Pituitary adenomas associated with AIP mutations mostly present as FIPA (68%) at an early age (78% occur at <30 years old). They are often growth hormone (GH) - or prolactin - secreting macroadenomas (88%) that have already extended beyond the sella at the time of diagnosis. Acromegalic cases are resistant to somatostatin analogues and multimodal management is frequently essential to control the disease. Our patients had normalized GH/IGF-1 values soon after surgery, although enough time may not have elapsed to reach final cure. While penetrance of the disease can be as low as 10% in FIPA, especially children and young patients with somatotropinoma and prolactinoma should be surveyed for inactivating mutations or deletions in AIP. Determining the causative mutations may be of assistance in early diagnosis, treatment success, and genetic counseling.

  3. Cowden syndrome-associated germline SDHD variants alter PTEN nuclear translocation through SRC-induced PTEN oxidation

    PubMed Central

    Yu, Wanfeng; He, Xin; Ni, Ying; Ngeow, Joanne; Eng, Charis

    2015-01-01

    Germline mutations in the PTEN tumor-suppressor gene and germline variations in succinate dehydrogenase subunit D gene (SDHD-G12S, SDHD-H50R) are associated with a subset of Cowden syndrome and Cowden syndrome-like individuals (CS/CSL) and confer high risk of breast, thyroid and other cancers. However, very little is known about the underlying crosstalk between SDHD and PTEN in CS-associated thyroid cancer. Here, we show SDHD-G12S and SDHD-H50R lead to impaired PTEN function through alteration of its subcellular localization accompanied by resistance to apoptosis and induction of migration in both papillary and follicular thyroid carcinoma cell lines. Other studies have shown elevated proto-oncogene tyrosine kinase (SRC) activity in invasive thyroid cancer cells; so, we explore bosutinib, a specific inhibitor for SRC, to explore SRC as a mediator of SDH-PTEN crosstalk in this context. We show that SRC inhibition could rescue SDHD dysfunction-induced cellular phenotype and tumorigenesis only when wild-type PTEN is expressed, in thyroid cancer lines. Patient lymphoblast cells carrying either SDHD-G12S or SDHD-H50R also show increased nuclear PTEN and more oxidized PTEN after hydrogen peroxide treatment. Like in thyroid cells, bosutinib decreases oxidative PTEN in patient lymphoblast cells carrying SDHD variants, but not in patients carrying both SDHD variants and PTEN truncating mutations. In summary, our data suggest a novel mechanism whereby SDHD germline variants SDHD-G12S or SDHD-H50R induce thyroid tumorigenesis mediated by PTEN accumulation in the nucleus and may shed light on potential treatment with SRC inhibitors like bosutinib in PTEN-wild-type SDHD-variant/mutation positive CS/CSL patients and sporadic thyroid neoplasias. PMID:25149476

  4. BRCAsearch: written pre-test information and BRCA1/2 germline mutation testing in unselected patients with newly diagnosed breast cancer.

    PubMed

    Nilsson, Martin P; Törngren, Therese; Henriksson, Karin; Kristoffersson, Ulf; Kvist, Anders; Silfverberg, Barbro; Borg, Åke; Loman, Niklas

    2018-02-01

    To evaluate a simplified method of pre-test information and germline BRCA1/2 mutation testing. In a prospective, single-arm study, comprehensive BRCA1/2 testing was offered to unselected patients with newly diagnosed breast cancer at three hospitals in south Sweden (BRCAsearch, ClinicalTrials.gov Identifier: NCT02557776). Pre-test information was provided by a standardized invitation letter, but the patients could contact a genetic counselor for telephone genetic counseling if they felt a need for that. Noncarriers were informed about the test result through a letter. Mutation carriers were contacted and offered an appointment for in-person post-test genetic counseling. During the period Feb 2, 2015-Aug 26, 2016, eight hundred and eighteen patients were invited to participate in the study. Through Jan 31, 2017, five hundred and forty-two (66.2%) of them consented to analysis of BRCA1 and BRCA2. Eleven pathogenic mutations were found (BRCA1, n = 2; BRCA2, n = 9), corresponding to a mutation prevalence of 2.0%. Six out of 11 fulfilled the Swedish BRCA testing criteria, and 9 out of 11 fulfilled the NCCN testing criteria. None of the BRCA-associated tumors were of the luminal A-like subtype. Very few patients contacted us for telephone genetic counseling or practical questions, suggesting that a majority felt that the written pre-test information was sufficient for them to make a decision on testing. Streamlining the process of pre-test information, genetic testing, and delivery of test results was feasible and was associated with an uptake of genetic testing in 2/3 of the breast cancer patients.

  5. Germline Mutations in PALB2, BRCA1, and RAD51C, Which Regulate DNA Recombination Repair, in Patients with Gastric Cancer

    PubMed Central

    Sahasrabudhe, Ruta; Lott, Paul; Bohorquez, Mabel; Toal, Ted; Estrada, Ana P.; Suarez, John J.; Brea-Fernández, Alejandro; Cameselle-Teijeiro, José; Pinto, Carla; Ramos, Irma; Mantilla, Alejandra; Prieto, Rodrigo; Corvalan, Alejandro; Norero, Enrique; Alvarez, Carolina; Tapia, Teresa; Carvallo, Pilar; Gonzalez, Luz M.; Cock-Rada, Alicia; Solano, Angela; Neffa, Florencia; Valle, Adriana Della; Yau, Chris; Soares, Gabriela; Borowsky, Alexander; Hu, Nan; He, Li-Ji; Han, Xiao-You; Taylor, Philip R.; Goldstein, Alisa M.; Torres, Javier; Echeverry, Magdalena; Ruiz-Ponte, Clara; Teixeira, Manuel R.; Carvajal Carmona, Luis G.

    2016-01-01

    Up to 10% of cases of gastric cancer are familial, but so far, only mutations in CDH1 have been associated with gastric cancer risk. To identify genetic variants that affect risk for gastric cancer, we collected blood samples from 28 patients with hereditary diffuse gastric cancer (HDGC) not associated with mutations in CDH1 and performed whole-exome sequence analysis. We then analyzed sequences of candidate genes in 333 independent HDGC and non-HDGC cases. We identified 11 cases with mutations in PALB2, BRCA1, or RAD51C genes, which regulate homologous DNA recombination. We found these mutations in 2 of 31 patients with HDGC (6.5%) and 9 of 331 patients with sporadic gastric cancer (2.8%). Most of these mutations had been previously associated with other types of tumors and partially co-segregated with gastric cancer in our study. Tumors that developed in patients with these mutations had a mutation signature associated with somatic homologous recombination deficiency. Our findings indicate that defects in homologous recombination increase risk for gastric cancer. PMID:28024868

  6. Targeted prostate cancer screening in BRCA1 and BRCA2 mutation carriers: results from the initial screening round of the IMPACT study.

    PubMed

    Bancroft, Elizabeth K; Page, Elizabeth C; Castro, Elena; Lilja, Hans; Vickers, Andrew; Sjoberg, Daniel; Assel, Melissa; Foster, Christopher S; Mitchell, Gillian; Drew, Kate; Mæhle, Lovise; Axcrona, Karol; Evans, D Gareth; Bulman, Barbara; Eccles, Diana; McBride, Donna; van Asperen, Christi; Vasen, Hans; Kiemeney, Lambertus A; Ringelberg, Janneke; Cybulski, Cezary; Wokolorczyk, Dominika; Selkirk, Christina; Hulick, Peter J; Bojesen, Anders; Skytte, Anne-Bine; Lam, Jimmy; Taylor, Louise; Oldenburg, Rogier; Cremers, Ruben; Verhaegh, Gerald; van Zelst-Stams, Wendy A; Oosterwijk, Jan C; Blanco, Ignacio; Salinas, Monica; Cook, Jackie; Rosario, Derek J; Buys, Saundra; Conner, Tom; Ausems, Margreet G; Ong, Kai-ren; Hoffman, Jonathan; Domchek, Susan; Powers, Jacquelyn; Teixeira, Manuel R; Maia, Sofia; Foulkes, William D; Taherian, Nassim; Ruijs, Marielle; Helderman-van den Enden, Apollonia T; Izatt, Louise; Davidson, Rosemarie; Adank, Muriel A; Walker, Lisa; Schmutzler, Rita; Tucker, Kathy; Kirk, Judy; Hodgson, Shirley; Harris, Marion; Douglas, Fiona; Lindeman, Geoffrey J; Zgajnar, Janez; Tischkowitz, Marc; Clowes, Virginia E; Susman, Rachel; Ramón y Cajal, Teresa; Patcher, Nicholas; Gadea, Neus; Spigelman, Allan; van Os, Theo; Liljegren, Annelie; Side, Lucy; Brewer, Carole; Brady, Angela F; Donaldson, Alan; Stefansdottir, Vigdis; Friedman, Eitan; Chen-Shtoyerman, Rakefet; Amor, David J; Copakova, Lucia; Barwell, Julian; Giri, Veda N; Murthy, Vedang; Nicolai, Nicola; Teo, Soo-Hwang; Greenhalgh, Lynn; Strom, Sara; Henderson, Alex; McGrath, John; Gallagher, David; Aaronson, Neil; Ardern-Jones, Audrey; Bangma, Chris; Dearnaley, David; Costello, Philandra; Eyfjord, Jorunn; Rothwell, Jeanette; Falconer, Alison; Gronberg, Henrik; Hamdy, Freddie C; Johannsson, Oskar; Khoo, Vincent; Kote-Jarai, Zsofia; Lubinski, Jan; Axcrona, Ulrika; Melia, Jane; McKinley, Joanne; Mitra, Anita V; Moynihan, Clare; Rennert, Gad; Suri, Mohnish; Wilson, Penny; Killick, Emma; Moss, Sue; Eeles, Rosalind A

    2014-09-01

    Men with germline breast cancer 1, early onset (BRCA1) or breast cancer 2, early onset (BRCA2) gene mutations have a higher risk of developing prostate cancer (PCa) than noncarriers. IMPACT (Identification of Men with a genetic predisposition to ProstAte Cancer: Targeted screening in BRCA1/2 mutation carriers and controls) is an international consortium of 62 centres in 20 countries evaluating the use of targeted PCa screening in men with BRCA1/2 mutations. To report the first year's screening results for all men at enrollment in the study. We recruited men aged 40-69 yr with germline BRCA1/2 mutations and a control group of men who have tested negative for a pathogenic BRCA1 or BRCA2 mutation known to be present in their families. All men underwent prostate-specific antigen (PSA) testing at enrollment, and those men with PSA >3 ng/ml were offered prostate biopsy. PSA levels, PCa incidence, and tumour characteristics were evaluated. The Fisher exact test was used to compare the number of PCa cases among groups and the differences among disease types. We recruited 2481 men (791 BRCA1 carriers, 531 BRCA1 controls; 731 BRCA2 carriers, 428 BRCA2 controls). A total of 199 men (8%) presented with PSA >3.0 ng/ml, 162 biopsies were performed, and 59 PCas were diagnosed (18 BRCA1 carriers, 10 BRCA1 controls; 24 BRCA2 carriers, 7 BRCA2 controls); 66% of the tumours were classified as intermediate- or high-risk disease. The positive predictive value (PPV) for biopsy using a PSA threshold of 3.0 ng/ml in BRCA2 mutation carriers was 48%-double the PPV reported in population screening studies. A significant difference in detecting intermediate- or high-risk disease was observed in BRCA2 carriers. Ninety-five percent of the men were white, thus the results cannot be generalised to all ethnic groups. The IMPACT screening network will be useful for targeted PCa screening studies in men with germline genetic risk variants as they are discovered. These preliminary results support the use of targeted PSA screening based on BRCA genotype and show that this screening yields a high proportion of aggressive disease. In this report, we demonstrate that germline genetic markers can be used to identify men at higher risk of prostate cancer. Targeting screening at these men resulted in the identification of tumours that were more likely to require treatment. Copyright © 2014 European Association of Urology. All rights reserved.

  7. Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton.

    PubMed

    Gopal, Sandeep; Pocock, Roger

    2018-04-19

    The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

  8. Ovarian metastasis from uveal melanoma with MLH1/PMS2 protein loss in a patient with germline MLH1 mutated Lynch syndrome: consequence or coincidence?

    PubMed

    Lobo, João; Pinto, Carla; Freitas, Micaela; Pinheiro, Manuela; Vizcaino, Rámon; Oliva, Esther; Teixeira, Manuel R; Jerónimo, Carmen; Bartosch, Carla

    2017-03-01

    Currently, uveal melanoma is not considered within the Lynch syndrome tumor spectrum. However, there are studies suggesting a contribution of microsatellite instability in sporadic uveal melanoma tumorigenesis. We report a 45-year-old woman who was referred for genetic counseling due to a family history of Lynch syndrome caused by a MLH1 mutation. She originally underwent enucleation of the right eye secondary to a uveal spindle cell melanoma diagnosed at age 25. The tumor recurred 22 years later presenting as an ovarian metastasis and concurrently a microscopic endometrial endometrioid carcinoma, grade 1/3 was diagnosed. Subsequent studies highlighted that the uveal melanoma showed high microsatellite instability and loss of MLH1 and PMS2 protein expression, with no MLH1 promoter methylation or BRAF mutation. Additionally, a GNAQ mutation was found. We conclude that our patient's uveal melanoma is most likely related to MLH1 germline mutation and thus Lynch syndrome related. To the best of our knowledge, this is the first report of uveal melanoma showing MLH1/PMS2 protein loss in the context of Lynch syndrome.

  9. Germline contamination and leakage in whole genome somatic single nucleotide variant detection.

    PubMed

    Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C

    2018-01-31

    The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.

  10. Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

    PubMed Central

    McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

    2015-01-01

    Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

  11. BRCA1 and BRCA2 founder mutations account for 78% of germline carriers among hereditary breast cancer families in Chile

    PubMed Central

    Alvarez, Carolina; Tapia, Teresa; Perez-Moreno, Elisa; Gajardo-Meneses, Patricia; Ruiz, Catalina; Rios, Mabel; Missarelli, Claudio; Silva, Mariela; Cruz, Adolfo; Matamala, Luis; Carvajal-Carmona, Luis; Camus, Mauricio; Carvallo, Pilar

    2017-01-01

    Identifying founder mutations in BRCA1 and BRCA2 in specific populations constitute a valuable opportunity for genetic screening. Several studies from different populations have reported recurrent and/or founder mutations representing a relevant proportion of BRCA mutation carriers. In Latin America, only few founder mutations have been described. We screened 453 Chilean patients with hereditary breast cancer for mutations in BRCA1 and BRCA2. For recurrent mutations, we genotyped 11 microsatellite markers in BRCA1 and BRCA2 in order to determine a founder effect through haplotype analysis. We found a total of 25 mutations (6 novel) in 71 index patients among which, nine are present exclusively in Chilean patients. Our analysis revealed the presence of nine founder mutations, 4 in BRCA1 and 5 in BRCA2, shared by 2 to 10 unrelated families and spread in different regions of Chile. Our panel contains the highest amount of founder mutations until today and represents the highest percentage (78%) of BRCA1 and BRCA2 mutation carriers. We suggest that the dramatic reduction of Amerindian population due to smallpox and wars with Spanish conquerors, a scarce population increase during 300 years, and the geographic position of Chile constituted a favorable scenario to establish founder genetic markers in our population. PMID:29088781

  12. Germline NLRP1 Mutations Cause Skin Inflammatory and Cancer Susceptibility Syndromes via Inflammasome Activation.

    PubMed

    Zhong, Franklin L; Mamaï, Ons; Sborgi, Lorenzo; Boussofara, Lobna; Hopkins, Richard; Robinson, Kim; Szeverényi, Ildikó; Takeichi, Takuya; Balaji, Reshmaa; Lau, Aristotle; Tye, Hazel; Roy, Keya; Bonnard, Carine; Ahl, Patricia J; Jones, Leigh Ann; Baker, Paul J; Lacina, Lukas; Otsuka, Atsushi; Fournie, Pierre R; Malecaze, François; Lane, E Birgitte; Akiyama, Masashi; Kabashima, Kenji; Connolly, John E; Masters, Seth L; Soler, Vincent J; Omar, Salma Samir; McGrath, John A; Nedelcu, Roxana; Gribaa, Moez; Denguezli, Mohamed; Saad, Ali; Hiller, Sebastian; Reversade, Bruno

    2016-09-22

    Inflammasome complexes function as key innate immune effectors that trigger inflammation in response to pathogen- and danger-associated signals. Here, we report that germline mutations in the inflammasome sensor NLRP1 cause two overlapping skin disorders: multiple self-healing palmoplantar carcinoma (MSPC) and familial keratosis lichenoides chronica (FKLC). We find that NLRP1 is the most prominent inflammasome sensor in human skin, and all pathogenic NLRP1 mutations are gain-of-function alleles that predispose to inflammasome activation. Mechanistically, NLRP1 mutations lead to increased self-oligomerization by disrupting the PYD and LRR domains, which are essential in maintaining NLRP1 as an inactive monomer. Primary keratinocytes from patients experience spontaneous inflammasome activation and paracrine IL-1 signaling, which is sufficient to cause skin inflammation and epidermal hyperplasia. Our findings establish a group of non-fever inflammasome disorders, uncover an unexpected auto-inhibitory function for the pyrin domain, and provide the first genetic evidence linking NLRP1 to skin inflammatory syndromes and skin cancer predisposition. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Three endocrine neoplasms: an unusual combination of pheochromocytoma, pituitary adenoma, and papillary thyroid carcinoma.

    PubMed

    Sisson, James C; Giordano, Thomas J; Avram, Anca M

    2012-04-01

    Three endocrine neoplasms-bilateral pheochromocytomas, somatotrophic pituitary adenoma inducing acromegaly, and papillary carcinoma of the thyroid-occurred concurrently in a patient. A genetic mutation was hypothesized. Possible previously described genetic mutations were explored. Clinical assessments, laboratory data, images of tumors, histopathology, and immunohistochemistry of excised tissues documented the three neoplasms. Clinical assessment of the patient, family history, and a review of the literature sought a familial basis for the disorders. The methods confirmed the presence of three endocrine neoplasms. Each neoplasm was surgically excised and histologically verified. Surgical and (131)I treatments reduced the papillary carcinoma, but eventually this tumor progressed to a lethal degree. History, including that of nine siblings, uncovered no familial neoplasms. No similar case was found in the literature, but possible associations with germline mutations were considered. The concurrent development of pheochromocytomas, pituitary somatotrophic adenoma, and papillary thyroid carcinoma appears to be unique. Nevertheless, such tumors, particularly bilateral pheochromocytomas, strongly suggest a de novo germline mutation in a gene not previously associated with multiple endocrine neoplasia syndromes.

  14. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    PubMed

    Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to stress that evolved among prokaryotes was co-opted to maintain diversity in the germline and immune system, while the original phenotype is restored in cancer. Reversion to a stress-induced mutational response is a hallmark of cancer that allows for effectively searching "protected" genome space where genes causally implicated in cancer are located and underlies the high adaptive potential and concomitant therapeutic resistance that is characteristic of cancer.

  15. Ancient genes establish stress-induced mutation as a hallmark of cancer

    PubMed Central

    Orr, Adam J.; Miočević, Milica; Lineweaver, Charles H.; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to stress that evolved among prokaryotes was co-opted to maintain diversity in the germline and immune system, while the original phenotype is restored in cancer. Reversion to a stress-induced mutational response is a hallmark of cancer that allows for effectively searching “protected” genome space where genes causally implicated in cancer are located and underlies the high adaptive potential and concomitant therapeutic resistance that is characteristic of cancer. PMID:28441401

  16. Evolutionary pattern of mutation in the factor IX genes of great apes: How does it compare to the pattern of recent germline mutation in patients with hemophilia B?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grouse, L.H.; Ketterling, R.P.; Sommer, S.S.

    Most mutations causing hemophilia B have arisen within the past 150 years. By correcting for multiple biases, the underlying rates of spontaneous germline mutation have been estimated in the factor IX gene. From these rates, an underlying pattern of mutation has emerged. To determine if this pattern compares to a underlying pattern found in the great apes, sequence changes were determined in intronic regions of the factor IX gene. The following species were studied: Gorilla gorilla, Pan troglodytes (chimpanzee), Pongo pygmacus (orangutan) and Homo sapiens. Intronic sequences at least 200 bp from a splice junction were randomly chosen, amplified bymore » cross-species PCR, and sequenced. These regions are expected to be subject to little if any selective pressure. Early diverged species of Old World monkeys were also studied to help determine the direction of mutational changes. A total of 62 sequence changes were observed. Initial data suggest that the average pattern since evolution of the great apes has a paucity of transitions at CpG dinucleotides and an excess of microinsertions to microdeletions when compared to the pattern observed in humans during the past 150 years (p<.05). A larger study is in progress to confirm these results.« less

  17. Frequency of pathogenic germline mutations in cancer susceptibility genes in breast cancer patients.

    PubMed

    Kaur, Raman Preet; Shafi, Gowhar; Benipal, Raja Paramjeet Singh; Munshi, Anjana

    2018-04-26

    In this study, we evaluated the incidence of pathogenic germline mutations in 30 breast cancer susceptibility genes in breast cancer patients. Our aim was to understand the involvement of the inherited mutations in these genes in a breast cancer cohort. Two hundred ninety-six female breast cancer patients including 4.5% of familial breast cancer cases were included in the study. 200 ng of genomic DNA was used to evaluate the pathogenic mutations, detected using Global Screening Array (GSA) microchip (Illumina Inc.) according to the manufacturer's instructions. The pathogenic frameshift and nonsense mutations were observed in BRCA2 (10.9%), MLH1 (58.6%), MTHFR (50%), MSH2 (14.2%), and CYTB (52%) genes. Familial breast cancer patients (4.5%) had variations in BRCA2, MLH1, MSH2, and CYTB genes. 28% of patients with metastasis, recurrence, and death harbored mono/biallelic alterations in MSH2, MLH1, and BRCA2 genes. The results of this study can guide to develop a panel to test the breast cancer patients for pathogenic mutations, from Malwa region of Punjab. The screening of MSH2, MLH1, and BRCA2 should be carried in individuals with or without family history of breast cancer as these genes have been reported to increase the cancer risk by tenfold.

  18. SMARCB1 mutations in schwannomatosis and genotype correlations with rhabdoid tumors.

    PubMed

    Smith, Miriam J; Wallace, Andrew J; Bowers, Naomi L; Eaton, Helen; Evans, D Gareth R

    2014-09-01

    Mutations in the SMARCB1 gene are involved in several human tumor-predisposing syndromes. They were established as an underlying cause of the tumor suppressor syndrome schwannomatosis in 2008. There is a much higher rate of mutation detection in familial disease than in sporadic disease. We have performed extensive genetic testing on a cohort of familial and sporadic patients who fulfilled clinical diagnostic criteria for schwannomatosis. In our updated cohort, we identified novel mutations within the SMARCB1 gene as well as several recurrent mutations. Of the schwannomatosis screens reported to date, including those in our updated cohort, SMARCB1 mutations have been found in 45% of familial probands and 9% of sporadic patients. The exon 1 mutation, c.41C>A p.Pro14His (10% in our series), and the 3' untranslated region mutation, c.*82C>T (27%), are the most common changes reported in patients with schwannomatosis to date, indicating the presence of mutation hot spots at both 5' and 3' portions of the gene. Comparison with germline SMARCB1 mutations in patients with rhabdoid tumors showed that the schwannomatosis mutations were significantly more likely to occur at either end of the gene and be nontruncating mutations (P < 0.0001). SMARCB1 mutations are found in a significant proportion of schwannomatosis patients, and an even higher proportion of rhabdoid patients. Whereas SMARCB1 alone seems to account for rhabdoid disease, there is likely to be substantial heterogeneity in schwannomatosis even for familial disease. There is a clear genotype-phenotype correlation, with germline rhabdoid mutations being significantly more likely to be centrally placed, involve multiple exon deletions, and be truncating mutations. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. rahu is a mutant allele of Dnmt3c, encoding a DNA methyltransferase homolog required for meiosis and transposon repression in the mouse male germline

    PubMed Central

    Lange, Julian; Lailler, Nathalie

    2017-01-01

    Transcriptional silencing by heritable cytosine-5 methylation is an ancient strategy to repress transposable elements. It was previously thought that mammals possess four DNA methyltransferase paralogs—Dnmt1, Dnmt3a, Dnmt3b and Dnmt3l—that establish and maintain cytosine-5 methylation. Here we identify a fifth paralog, Dnmt3c, that is essential for retrotransposon methylation and repression in the mouse male germline. From a phenotype-based forward genetics screen, we isolated a mutant mouse called ‘rahu’, which displays severe defects in double-strand-break repair and homologous chromosome synapsis during male meiosis, resulting in sterility. rahu is an allele of a transcription unit (Gm14490, renamed Dnmt3c) that was previously mis-annotated as a Dnmt3-family pseudogene. Dnmt3c encodes a cytosine methyltransferase homolog, and Dnmt3crahu mutants harbor a non-synonymous mutation of a conserved residue within one of its cytosine methyltransferase motifs, similar to a mutation in human DNMT3B observed in patients with immunodeficiency, centromeric instability and facial anomalies syndrome. The rahu mutation lies at a potential dimerization interface and near the potential DNA binding interface, suggesting that it compromises protein-protein and/or protein-DNA interactions required for normal DNMT3C function. Dnmt3crahu mutant males fail to establish normal methylation within LINE and LTR retrotransposon sequences in the germline and accumulate higher levels of transposon-derived transcripts and proteins, particularly from distinct L1 and ERVK retrotransposon families. Phylogenetic analysis indicates that Dnmt3c arose during rodent evolution by tandem duplication of Dnmt3b, after the divergence of the Dipodoidea and Muroidea superfamilies. These findings provide insight into the evolutionary dynamics and functional specialization of the transposon suppression machinery critical for mammalian sexual reproduction and epigenetic regulation. PMID:28854222

  20. Whole-genome sequencing analysis of phenotypic heterogeneity and anticipation in Li-Fraumeni cancer predisposition syndrome.

    PubMed

    Ariffin, Hany; Hainaut, Pierre; Puzio-Kuter, Anna; Choong, Soo Sin; Chan, Adelyne Sue Li; Tolkunov, Denis; Rajagopal, Gunaretnam; Kang, Wenfeng; Lim, Leon Li Wen; Krishnan, Shekhar; Chen, Kok-Siong; Achatz, Maria Isabel; Karsa, Mawar; Shamsani, Jannah; Levine, Arnold J; Chan, Chang S

    2014-10-28

    The Li-Fraumeni syndrome (LFS) and its variant form (LFL) is a familial predisposition to multiple forms of childhood, adolescent, and adult cancers associated with germ-line mutation in the TP53 tumor suppressor gene. Individual disparities in tumor patterns are compounded by acceleration of cancer onset with successive generations. It has been suggested that this apparent anticipation pattern may result from germ-line genomic instability in TP53 mutation carriers, causing increased DNA copy-number variations (CNVs) with successive generations. To address the genetic basis of phenotypic disparities of LFS/LFL, we performed whole-genome sequencing (WGS) of 13 subjects from two generations of an LFS kindred. Neither de novo CNV nor significant difference in total CNV was detected in relation with successive generations or with age at cancer onset. These observations were consistent with an experimental mouse model system showing that trp53 deficiency in the germ line of father or mother did not increase CNV occurrence in the offspring. On the other hand, individual records on 1,771 TP53 mutation carriers from 294 pedigrees were compiled to assess genetic anticipation patterns (International Agency for Research on Cancer TP53 database). No strictly defined anticipation pattern was observed. Rather, in multigeneration families, cancer onset was delayed in older compared with recent generations. These observations support an alternative model for apparent anticipation in which rare variants from noncarrier parents may attenuate constitutive resistance to tumorigenesis in the offspring of TP53 mutation carriers with late cancer onset.

  1. Germline mutations in DNA repair genes predispose asbestos-exposed patients to malignant pleural mesothelioma.

    PubMed

    Betti, Marta; Casalone, Elisabetta; Ferrante, Daniela; Aspesi, Anna; Morleo, Giulia; Biasi, Alessandra; Sculco, Marika; Mancuso, Giuseppe; Guarrera, Simonetta; Righi, Luisella; Grosso, Federica; Libener, Roberta; Pavesi, Mansueto; Mariani, Narciso; Casadio, Caterina; Boldorini, Renzo; Mirabelli, Dario; Pasini, Barbara; Magnani, Corrado; Matullo, Giuseppe; Dianzani, Irma

    2017-10-01

    Malignant pleural mesothelioma (MPM) is a rare, aggressive cancer caused by asbestos exposure. An inherited predisposition has been suggested to explain multiple cases in the same family and the observation that not all individuals highly exposed to asbestos develop the tumor. Germline mutations in BAP1 are responsible for a rare cancer predisposition syndrome that includes predisposition to mesothelioma. We hypothesized that other genes involved in hereditary cancer syndromes could be responsible for the inherited mesothelioma predisposition. We investigated the prevalence of germline variants in 94 cancer-predisposing genes in 93 MPM patients with a quantified asbestos exposure. Ten pathogenic truncating variants (PTVs) were identified in PALB2, BRCA1, FANCI, ATM, SLX4, BRCA2, FANCC, FANCF, PMS1 and XPC. All these genes are involved in DNA repair pathways, mostly in homologous recombination repair. Patients carrying PTVs represented 9.7% of the panel and showed lower asbestos exposure than did all the other patients (p = 0.0015). This suggests that they did not efficiently repair the DNA damage induced by asbestos and leading to carcinogenesis. This study shows that germline variants in several genes may increase MPM susceptibility in the presence of asbestos exposure and may be important for specific treatment. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Recurrent and founder mutations in the PMS2 gene

    PubMed Central

    Tomsic, Jerneja; Senter, Leigha; Liyanarachchi, Sandya; Clendenning, Mark; Vaughn, Cecily P.; Jenkins, Mark A.; Hopper, John L.; Young, Joanne; Samowitz, Wade; de la Chapelle, Albert

    2012-01-01

    Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However some mutations are observed repeatedly, across individuals not known to be related, due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations, one (c.903G>T) a probable founder, and one (c.1A>G) where founder mutation status could not be evaluated. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. PMID:22577899

  3. Recurrent and founder mutations in the PMS2 gene.

    PubMed

    Tomsic, J; Senter, L; Liyanarachchi, S; Clendenning, M; Vaughn, C P; Jenkins, M A; Hopper, J L; Young, J; Samowitz, W; de la Chapelle, A

    2013-03-01

    Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However, some mutations are observed repeatedly across individuals not known to be related due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here, we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations and one (c.903G>T) a probable founder. One (c.1A>G) could not be evaluated for founder mutation status. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. © 2012 John Wiley & Sons A/S.

  4. A germline FANCA alteration that is associated with increased sensitivity to DNA damaging agents.

    PubMed

    Wilkes, David C; Sailer, Verena; Xue, Hui; Cheng, Hongwei; Collins, Colin C; Gleave, Martin; Wang, Yuzhuo; Demichelis, Francesca; Beltran, Himisha; Rubin, Mark A; Rickman, David S

    2017-09-01

    Defects in genes involved in DNA damage repair (DDR) pathway are emerging as novel biomarkers and targets for new prostate cancer drug therapies. A previous report revealed an association between an exceptional response to cisplatin treatment and a somatic loss of heterozygosity (LOH) of FANCA in a patient with metastatic prostate cancer who also harbored a germline FANCA variant (S1088F). Although germline FANCA mutations are the most frequent alterations in patients with Fanconi anemia, germline alterations are less common in prostate cancer. We hypothesized that the germline S1088F FANCA variant in combination with FANCA LOH was deleterious for FANCA function and contributed to the patient's exceptional response to cisplatin. We show that although it properly localizes to the nucleus, the S1088F FANCA mutant protein disrupts the FANC protein complex resulting in increased sensitivity to DNA damaging agents. Because molecular stratification is emerging as a strategy for treating men with metastatic, castrate-resistant prostate cancer harboring specific DDR gene defects, our findings suggest that more biomarker studies are needed to better define clinically relevant germline and somatic alterations. © 2017 Wilkes et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Assessing the Spectrum of Germline Variation in Fanconi Anemia Genes among Patients with Head and Neck Carcinoma before Age 50

    PubMed Central

    Chandrasekharappa, Settara C.; Chinn, Steven B.; Donovan, Frank X.; Chowdhury, Naweed I.; Kamat, Aparna; Adeyemo, Adebowale A.; Thomas, James W.; Vemulapalli, Meghana; Hussey, Caroline S.; Reid, Holly H.; Mullikin, James C.; Wei, Qingyi; Sturgis, Erich M.

    2018-01-01

    Patients with Fanconi anemia (FA) have increased risk for head and neck squamous cell carcinoma (HNSCC). We sought to determine the prevalence of undiagnosed FA and FA carriers in patients with HNSCC and an age cutoff for FA genetic screening. Screening germline DNA from 417 HNSCC patients under age 50 revealed 194 FA gene variants in 185 patients (44%). The variant spectrum was comprised of 183 nonsynonymous point mutations, nine indels, one large deletion, and one synonymous variant predicted to effect splicing. 108 patients (26%) had at least one rare variant predicted to be damaging, and 57 (14%) had at least one rare variant predicted to be damaging and previously reported. Fifteen patients carried two rare variants, or an X-linked variant, in an FA gene. Overall, we did not identify an age cutoff for FA screening among young HNSCC patients, as there were no significant differences in mutation rates when patients were stratified by age, tumor site, ethnicity, smoking status, or human papillomavirus status. However, we observed an increased burden, or mutation load, of FA gene variants in FANCD2, FANCE, and FANCL in our HNSCC patient cohort relative to the 1000 Genomes population. FANCE and FANCL, components of the core complex, are known to be responsible for the recruitment and ubiquitination, respectively, of FANCD2, a critical step in the FA DNA repair pathway. FA germline functional variants offer a novel area of study in HNSCC tumorigenesis, and the increased mutation burden of critical genes indicates the importance of the FA pathway in HNSCC. PMID:28678401

  6. PDGFRA-mutant syndrome.

    PubMed

    Ricci, Riccardo; Martini, Maurizio; Cenci, Tonia; Carbone, Arnaldo; Lanza, Paola; Biondi, Alberto; Rindi, Guido; Cassano, Alessandra; Larghi, Alberto; Persiani, Roberto; Larocca, Luigi M

    2015-07-01

    Germline PDGFRA mutations cause multiple heterogeneous gastrointestinal mesenchymal tumors. In its familial form this disease, which was formerly termed intestinal neurofibromatosis/neurofibromatosis 3b (INF/NF3b), has been included among familial gastrointestinal stromal tumors (GISTs) because of its genotype, described when GIST was the only known PDGFRA-mutant gastrointestinal tumor. Shortly afterwards, however, inflammatory fibroid polyps also revealed PDGFRA mutations. Subsequently, gastrointestinal CD34+ 'fibrous tumors' of uncertain classification were described in a germline PDGFRA-mutant context. Our aim was to characterize the syndrome produced by germline PDGFRA mutations and establish diagnostic criteria and management strategies for this hitherto puzzling disease. We studied a kindred displaying multiple gastrointestinal mesenchymal tumors, comparing it with published families/individuals with possible analogous conditions. We identified a novel inherited PDGFRA mutation (P653L), constituting the third reported example of familial PDGFRA mutation. In adult mutants we detected inflammatory fibroid polyps, gastric GISTs and gastrointestinal fibrous tumors of uncertain nosology. We demonstrate that the syndrome formerly defined as INF/NF3b (exemplified by the family reported herein) is simplistically considered a form of familial GIST, because inflammatory fibroid polyps often prevail. Fibrous tumors appear variants of inflammatory fibroid polyps. 'INF/NF3b' and 'familial GIST' are misleading terms which we propose changing to 'PDGFRA-mutant syndrome'. In this condition, unlike KIT-dependent familial GIST syndromes, if present, GISTs are stomach-restricted and diffuse Cajal cell hyperplasia is not observed. This restriction of GISTs to the stomach in PDGFRA-mutant syndrome: (i) focuses oncological concern on gastric masses, as inflammatory fibroid polyps are benign; (ii) supports a selective role of gastric environment for PDGFRA mutations to elicit GISTs, justifying the known predilection for stomach of sporadic PDGFRA-mutant GISTs. An awareness that inflammatory fibroid polyps, relatively common among gastrointestinal mesenchymal tumors, may be the prevailing tumor in PDGFRA-mutant syndrome could eventually reveal an unsuspected prevalence of this condition.

  7. Rare Germline Copy Number Variations and Disease Susceptibility in Familial Melanoma.

    PubMed

    Shi, Jianxin; Zhou, Weiyin; Zhu, Bin; Hyland, Paula L; Bennett, Hunter; Xiao, Yanzi; Zhang, Xijun; Burke, Laura S; Song, Lei; Hsu, Chih Hao; Yan, Chunhua; Chen, Qingrong; Meerzaman, Daoud; Dagnall, Casey L; Burdette, Laurie; Hicks, Belynda; Freedman, Neal D; Chanock, Stephen J; Yeager, Meredith; Tucker, Margaret A; Goldstein, Alisa M; Yang, Xiaohong R

    2016-12-01

    Mounting evidence suggests that copy number variations (CNVs) can contribute to cancer susceptibility. The main goal of this study was to evaluate the role of germline CNVs in melanoma predisposition in high-risk melanoma families. We used genome-wide tiling comparative genomic hybridization and single nucleotide polymorphism arrays to characterize CNVs in 335 individuals (240 melanoma cases) from American melanoma-prone families (22 with germline CDKN2A or CDK4 mutations). We found that the global burden of overall CNVs (or deletions or duplications separately) was not significantly associated with case-control or CDKN2A/CDK4 mutation status after accounting for the familial dependence. However, we identified several rare CNVs that either involved known melanoma genes (e.g., PARP1, CDKN2A) or cosegregated with melanoma (duplication on 10q23.23, 3p12.2 and deletions on 8q424.3, 2q22.1) in families without mutations in known melanoma high-risk genes. Some of these CNVs were correlated with expression changes in disrupted genes based on RNASeq data from a subset of melanoma cases included in the CNV study. These results suggest that rare cosegregating CNVs may influence melanoma susceptibility in some melanoma-prone families and genes found in our study warrant further evaluation in future genetic analyses of melanoma. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Rare germline copy number variations and disease susceptibility in familial melanoma

    PubMed Central

    Shi, Jianxin; Zhou, Weiyin; Zhu, Bin; Hyland, Paula L; Bennett, Hunter; Xiao, Yanzi; Zhang, Xijun; Burke, Laura S; Song, Lei; Hsu, Chih Hao; Yan, Chunhua; Chen, Qingrong; Meerzaman, Daoud; Dagnall, Casey L; Burdette, Laurie; Hicks, Belynda; Freedman, Neal D; Chanock, Stephen J; Yeager, Meredith; Tucker, Margaret A; Goldstein, Alisa M; Yang, Xiaohong R

    2016-01-01

    Mounting evidence suggests that copy number variations (CNVs) can contribute to cancer susceptibility. The main goal of this study was to evaluate the role of germline CNVs in melanoma predisposition in high-risk melanoma families. We used genome-wide tiling comparative genomic hybridization and SNP arrays to characterize CNVs in 335 individuals (240 melanoma cases) from American melanoma-prone families (22 with germline CDKN2A or CDK4 mutations). We found that the global burden of overall CNVs (or deletions or duplications separately) was not significantly associated with case-control or CDKN2A/CDK4 mutation status after accounting for the familial dependence. However, we identified several rare CNVs that either involved known melanoma genes (e.g. PARP1, CDKN2A) or co-segregated with melanoma (duplication on 10q23.23, 3p12.2 and deletions on 8q424.3, 2q22.1) in families without mutations in known melanoma high-risk genes. Some of these CNVs were correlated with expression changes in disrupted genes based on RNASeq data from a subset of melanoma cases included in the CNV study. These results suggest that rare co-segregating CNVs may influence melanoma susceptibility in some melanoma-prone families and genes found in our study warrant further evaluation in future genetic analyses of melanoma. PMID:27476724

  9. BRCA1 and BRCA2 mutations in ovarian cancer patients from China: ethnic-related mutations in BRCA1 associated with an increased risk of ovarian cancer.

    PubMed

    Shi, Tingyan; Wang, Pan; Xie, Caixia; Yin, Sheng; Shi, Di; Wei, Congchong; Tang, Wenbin; Jiang, Rong; Cheng, Xi; Wei, Qingyi; Wang, Qing; Zang, Rongyu

    2017-05-01

    BRCA1/2 are cancer predisposition genes involved in hereditary breast and ovarian cancer (HBOC). Mutation carriers display an increased sensitivity to inhibitors of poly(ADP-ribose) polymerase (PARP). Despite a number of small-size hospital-based studies being previously reported, there is not yet, to our knowledge, precise data of BRCA1/2 mutations among Chinese ovarian cancer patients. We performed a multicenter cohort study including 916 unselected consecutive epithelial ovarian cancer (EOC) patients from eastern China to screen for BRCA1/2 mutations using the next-generation sequencing approach. A total of 153 EOC patients were found to carry pathogenic germline mutations in BRCA1/2, accounting for an overall mutation incidence of 16.7% with the predominance in BRCA1 (13.1%) compared with BRCA2 (3.9%). We identified 53 novel pathogenic mutations, among which the c.283_286delCTTG and the c.4573C > T of BRCA1 were both found in two unrelated patients. More importantly, the most common mutation found in this study, c.5470_5477del8 was most likely to be Chinese population-related without an apparent founder origin. This hot-spot mutation was presumably associated with an increased risk of ovarian cancer. Taken together, germline BRCA1/2 mutations were common in Chinese EOC patients with distinct mutational spectrum compared to Western populations. Our study contributes to the current understanding of BRCA1/2 mutation prevalence worldwide. We recommend BRCA1/2 genetic testing to all Chinese women diagnosed with EOC to identify HBOC families, to provide genetic counseling and clinical management for at-risk relatives. Mutation carriers may also benefit from PARP-targeted therapies. © 2017 UICC.

  10. Prevalence of PALB2 mutations in breast cancer patients in multi-ethnic Asian population in Malaysia and Singapore.

    PubMed

    Phuah, Sze Yee; Lee, Sheau Yee; Kang, Peter; Kang, In Nee; Yoon, Sook-Yee; Thong, Meow Keong; Hartman, Mikael; Sng, Jen-Hwei; Yip, Cheng Har; Taib, Nur Aishah Mohd; Teo, Soo-Hwang

    2013-01-01

    The partner and localizer of breast cancer 2 (PALB2) is responsible for facilitating BRCA2-mediated DNA repair by serving as a bridging molecule, acting as the physical and functional link between the breast cancer 1 (BRCA1) and breast cancer 2 (BRCA2) proteins. Truncating mutations in the PALB2 gene are rare but are thought to be associated with increased risks of developing breast cancer in various populations. We evaluated the contribution of PALB2 germline mutations in 122 Asian women with breast cancer, all of whom had significant family history of breast and other cancers. Further screening for nine PALB2 mutations was conducted in 874 Malaysian and 532 Singaporean breast cancer patients, and in 1342 unaffected Malaysian and 541 unaffected Singaporean women. By analyzing the entire coding region of PALB2, we found two novel truncating mutations and ten missense mutations in families tested negative for BRCA1/2-mutations. One additional novel truncating PALB2 mutation was identified in one patient through genotyping analysis. Our results indicate a low prevalence of deleterious PALB2 mutations and a specific mutation profile within the Malaysian and Singaporean populations.

  11. Prevalence of PALB2 Mutations in Breast Cancer Patients in Multi-Ethnic Asian Population in Malaysia and Singapore

    PubMed Central

    Phuah, Sze Yee; Lee, Sheau Yee; Kang, Peter; Kang, In Nee; Yoon, Sook-Yee; Thong, Meow Keong; Hartman, Mikael; Sng, Jen-Hwei; Yip, Cheng Har; Taib, Nur Aishah Mohd; Teo, Soo-Hwang

    2013-01-01

    Background The partner and localizer of breast cancer 2 (PALB2) is responsible for facilitating BRCA2-mediated DNA repair by serving as a bridging molecule, acting as the physical and functional link between the breast cancer 1 (BRCA1) and breast cancer 2 (BRCA2) proteins. Truncating mutations in the PALB2 gene are rare but are thought to be associated with increased risks of developing breast cancer in various populations. Methods We evaluated the contribution of PALB2 germline mutations in 122 Asian women with breast cancer, all of whom had significant family history of breast and other cancers. Further screening for nine PALB2 mutations was conducted in 874 Malaysian and 532 Singaporean breast cancer patients, and in 1342 unaffected Malaysian and 541 unaffected Singaporean women. Results By analyzing the entire coding region of PALB2, we found two novel truncating mutations and ten missense mutations in families tested negative for BRCA1/2-mutations. One additional novel truncating PALB2 mutation was identified in one patient through genotyping analysis. Our results indicate a low prevalence of deleterious PALB2 mutations and a specific mutation profile within the Malaysian and Singaporean populations. PMID:23977390

  12. Visualizing the origins of selfish de novo mutations in individual seminiferous tubules of human testes

    PubMed Central

    Maher, Geoffrey J.; McGowan, Simon J.; Giannoulatou, Eleni; Verrill, Clare; Goriely, Anne; Wilkie, Andrew O. M.

    2016-01-01

    De novo point mutations arise predominantly in the male germline and increase in frequency with age, but it has not previously been possible to locate specific, identifiable mutations directly within the seminiferous tubules of human testes. Using microdissection of tubules exhibiting altered expression of the spermatogonial markers MAGEA4, FGFR3, and phospho-AKT, whole genome amplification, and DNA sequencing, we establish an in situ strategy for discovery and analysis of pathogenic de novo mutations. In 14 testes from men aged 39–90 y, we identified 11 distinct gain-of-function mutations in five genes (fibroblast growth factor receptors FGFR2 and FGFR3, tyrosine phosphatase PTPN11, and RAS oncogene homologs HRAS and KRAS) from 16 of 22 tubules analyzed; all mutations have known associations with severe diseases, ranging from congenital or perinatal lethal disorders to somatically acquired cancers. These results support proposed selfish selection of spermatogonial mutations affecting growth factor receptor-RAS signaling, highlight its prevalence in older men, and enable direct visualization of the microscopic anatomy of elongated mutant clones. PMID:26858415

  13. Visualizing the origins of selfish de novo mutations in individual seminiferous tubules of human testes.

    PubMed

    Maher, Geoffrey J; McGowan, Simon J; Giannoulatou, Eleni; Verrill, Clare; Goriely, Anne; Wilkie, Andrew O M

    2016-03-01

    De novo point mutations arise predominantly in the male germline and increase in frequency with age, but it has not previously been possible to locate specific, identifiable mutations directly within the seminiferous tubules of human testes. Using microdissection of tubules exhibiting altered expression of the spermatogonial markers MAGEA4, FGFR3, and phospho-AKT, whole genome amplification, and DNA sequencing, we establish an in situ strategy for discovery and analysis of pathogenic de novo mutations. In 14 testes from men aged 39-90 y, we identified 11 distinct gain-of-function mutations in five genes (fibroblast growth factor receptors FGFR2 and FGFR3, tyrosine phosphatase PTPN11, and RAS oncogene homologs HRAS and KRAS) from 16 of 22 tubules analyzed; all mutations have known associations with severe diseases, ranging from congenital or perinatal lethal disorders to somatically acquired cancers. These results support proposed selfish selection of spermatogonial mutations affecting growth factor receptor-RAS signaling, highlight its prevalence in older men, and enable direct visualization of the microscopic anatomy of elongated mutant clones.

  14. Screening for germline mutations in the neurofibromatosis type 2 (NF2) gene in NF2 patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andermann, A.A.; Ruttledge, M.H.; Rangaratnam, A.

    Neurofibromatosis type 2 (NF2) is an autosomal dominant disease with over 95% penetrance which predisposes gene carriers to develop multiple tumors of the central nervous system. The NF2 gene is a putative tumor suppressor gene which was previously mapped to the long arm of chromosome 22, and has recently been identified, using positional cloning techniques. The gene encodes a protein, schwannomin (SCH), which is highly homologous to the band 4.1 protein family. In an attempt to identify and characterize mutations which lead to the manifestation of the disease, we have used single strand conformation analysis (SSCA) to screen for germlinemore » mutations in all 17 exons of the NF2 gene in 59 unrelated NF2 patients, representing both familial and new mutations. A total of 27 migration abnormalities was found in 26 patients. Using direct sequencing analysis, the majority of these variants were found to result in nonsense, splice-site or frameshift mutations. Mutations identified in familial NF2 patients segregate in the family, and may prove to be useful tools for a simple and direct SSCA-based technique of presymptomatic or prenatal diagnosis in relatives of patients with NF2. This may be of particular importance in children of patients who have new mutations in the NF2 gene, where linkage analysis may not be feasible.« less

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ruggles, Kelly V.; Tang, Zuojian; Wang, Xuya

    Improvements in mass spectrometry (MS)-based peptide sequencing provide a new opportunity to determine whether polymorphisms, mutations and splice variants identified in cancer cells are translated. Herein we therefore describe a proteogenomic data integration tool (QUILTS) and illustrate its application to whole genome, transcriptome and global MS peptide sequence datasets generated from a pair of luminal and basal-like breast cancer patient derived xenografts (PDX). The sensitivity of proteogenomic analysis for singe nucleotide variant (SNV) expression and novel splice junction (NSJ) detection was probed using multiple MS/MS process replicates. Despite over thirty sample replicates, only about 10% of all SNV (somatic andmore » germline) were detected by both DNA and RNA sequencing were observed as peptides. An even smaller proportion of peptides corresponding to NSJ observed by RNA sequencing were detected (<0.1%). Peptides mapping to DNA-detected SNV without a detectable mRNA transcript were also observed demonstrating the transcriptome coverage was also incomplete (~80%). In contrast to germ-line variants, somatic variants were less likely to be detected at the peptide level in the basal-like tumor than the luminal tumor raising the possibility of differential translation or protein degradation effects. In conclusion, the QUILTS program integrates DNA, RNA and peptide sequencing to assess the degree to which somatic mutations are translated and therefore biologically active. By identifying gaps in sequence coverage QUILTS benchmarks current technology and assesses progress towards whole cancer proteome and transcriptome analysis.« less

  16. Multiple pilomatrixomas in a survivor of WNT-activated medulloblastoma leading to the discovery of a germline APC mutation and the diagnosis of familial adenomatous polyposis.

    PubMed

    Bendelsmith, Charles R; Skrypek, Mary M; Patel, Sachin R; Pond, Dinel A; Linabery, Amy M; Bendel, Anne E

    2018-01-01

    Because children diagnosed with WNT-activated medulloblastoma have a 10-year overall survival rate of 95%, active long-term follow-up is critically important in reducing mortality from other causes. Here, we describe an 11-year-old adopted female who developed multiple pilomatrixomas 3 years after diagnosis of WNT-activated medulloblastoma, an unusual finding that prompted deeper clinical investigation. A heterozygous germline APC gene mutation was discovered, consistent with familial adenomatous polyposis. Screening endoscopy revealed numerous precancerous polyps that were excised. This case highlights the importance of long-term follow-up of pediatric cancer survivors, including attention to unexpected symptoms, which might unveil an underlying cancer predisposition syndrome. © 2017 Wiley Periodicals, Inc.

  17. The occurrence and the type of germline mutations in the RET gene in patients with medullary thyroid carcinoma and their unaffected kindred's from Central Poland.

    PubMed

    Paszko, Z; Sromek, M; Czetwertynska, M; Skasko, E; Czapczak, D; Wisniewska, A; Prokurat, A; Chrupek, M; Jagielska, A; Kozlowicz-Gudzinska, I

    2007-12-01

    We aimed to investigate the occurrence and types of pathogenic mutations in the RET gene in patients with MTC of the Central Poland population and in their relatives. DNA was extracted from the peripheral blood lymphocytes of a total of 330 persons, including 235 MTC patients and 95 of their unaffected kindred's. Exons 10, 11, 13, 14, 15 and 16 of the RET gene were amplified by PCR and sequenced. Sixty-seven people were found to carry pathogenic, germline mutations in the RET gene. In exon 10, C609F, C609R and C609Y (3 families), C618G, C618F (2 families), and C620G (4 families) mutations were identified. In exon 11, C634R (8 families) and C649L mutations (1 patient) were found. Five families carried Y791F mutation in exon 13. One patient with PTC revealed the presence of a Y791F mutation. In 3 families, exon 14 of the RET gene harbored the following mutations: V804L (1 patient), E819K (1 patient) and R844Q (1 patient). In 1 family, the S891A mutation was identified in exon 15, 3 families were found to carry mutations in exon16, R912P in 1 family and M918T in 2 families. In summary, of the 235 patients affected by MTC, 46 (19.6%) carried pathogenic RET gene mutations, 1 patient with RET mutation had kidney carcinoma, and 1 had PTC. The results show the occurrence of a variety of mutations prevalent in patients with MTC in the population of Central Poland. These results may contribute to a better diagnosis of medullary thyroid carcinoma.

  18. Frequent PIK3CA Mutations in Colorectal and Endometrial Cancer with Double Somatic Mismatch Repair Mutations

    PubMed Central

    Cohen, Stacey A.; Turner, Emily H.; Beightol, Mallory B.; Jacobson, Angela; Gooley, Ted A.; Salipante, Stephen J.; Haraldsdottir, Sigurdis; Smith, Christina; Scroggins, Sheena; Tait, Jonathan F.; Grady, William M.; Lin, Edward H.; Cohn, David E.; Goodfellow, Paul J.; Arnold, Mark W.; de la Chapelle, Albert; Pearlman, Rachel; Hampel, Heather; Pritchard, Colin C.

    2016-01-01

    Background & Aims Double somatic mutations in mismatch repair (MMR) genes have recently been described in colorectal and endometrial cancers with microsatellite instability (MSI) not attributable to MLH1 hypermethylation or germline mutation. We sought to define the molecular phenotype of this newly recognized tumor subtype. Methods From two prospective Lynch syndrome screening studies, we identified patients with colorectal and endometrial tumors harboring ≥2 somatic MMR mutations, but normal germline MMR testing (“double somatic”). We determined the frequencies of tumor PIK3CA, BRAF, KRAS, NRAS, and PTEN mutations by targeted next-generation sequencing and used logistic-regression models to compare them to: Lynch syndrome, MLH1 hypermethylated, and microsatellite stable (MSS) tumors. We validated our findings using independent datasets from The Cancer Genome Atlas (TCGA). Results Among colorectal cancer cases, we found that 14/21 (67%) of double somatic cases had PIK3CA mutations vs. 4/18 (22%) Lynch syndrome, 2/10 (20%) MLH1 hypermethylated, and 12/78 (15%) MSS tumors; p<0.0001. PIK3CA mutations were detected in 100% of 13 double somatic endometrial cancers (p=0.04). BRAF mutations were absent in double somatic and Lynch syndrome colorectal tumors. We found highly similar results in a validation cohort from TCGA (113 colorectal, 178 endometrial cancer), with 100% of double somatic cases harboring a PIK3CA mutation (p<0.0001). Conclusions PIK3CA mutations are present in double somatic mutated colorectal and endometrial cancers at substantially higher frequencies than other MSI subgroups. PIK3CA mutation status may better define an emerging molecular entity in colorectal and endometrial cancers, with the potential to inform screening and therapeutic decision making. PMID:27302833

  19. Increased incidence and disparity of diagnosis of retinoblastoma patients in Guatemala

    PubMed Central

    Bendfeldt, Giovana; Lou, Hong; Giron, Veronica; Garrido, Claudia; Valverde, Patricia; Barnoya, Margarita; Castellanos, Mauricio

    2014-01-01

    Analysis of 327 consecutive cases at a pediatric referral hospital of Guatemala reveals that retinoblastoma accounts for 9.4% of all cancers and the estimated incidence is 7.0 cases/million children, higher than the United States or Europe. The number of familial cases is low, and there is a striking disparity in indigenous children due to late diagnosis, advanced disease, rapid progression and elevated mortality. Nine germline mutations in 18 patients were found; two known and five new mutations. Hypermethylation of RB1 was identified in 13% of the tumors. An early diagnosis program could identify cases at an earlier age and improve outcome of retinoblastoma in this diverse population. PMID:24814393

  20. Maturation of Shark Single-Domain (IgNAR) Antibodies: Evidence for Induced-Fit Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stanfield, R.L.; Dooley, H.; Verdino, P.

    2007-07-13

    Sharks express an unusual heavy-chain isotype called IgNAR, whose variable regions bind antigen as independent soluble domains. To further probe affinity maturation of the IgNAR response, we structurally characterized the germline and somatically matured versions of a type II variable (V) region, both in the presence and absence of its antigen, hen egg-white lysozyme. Despite a disulfide bond linking complementarity determining regions (CDRs) 1 and 3, both germline and somatically matured V regions displayed significant structural changes in these CDRs upon complex formation with antigen. Somatic mutations in the IgNAR V region serve to increase the number of contacts withmore » antigen, as reflected by a tenfold increase in affinity, and one of these mutations appears to stabilize the CDR3 region. In addition, a residue in the HV4 loop plays an important role in antibody-antigen interaction, consistent with the high rate of somatic mutations in this non-CDR loop.« less

Top